Directory of Open Access Journals (Sweden)
Stephanie E Hesselson
2009-09-01
Full Text Available Membrane transporters play crucial roles in the cellular uptake and efflux of an array of small molecules including nutrients, environmental toxins, and many clinically used drugs. We hypothesized that common genetic variation in the proximal promoter regions of transporter genes contribute to observed variation in drug response. A total of 579 polymorphisms were identified in the proximal promoters (-250 to +50 bp and flanking 5' sequence of 107 transporters in the ATP Binding Cassette (ABC and Solute Carrier (SLC superfamilies in 272 DNA samples from ethnically diverse populations. Many transporter promoters contained multiple common polymorphisms. Using a sliding window analysis, we observed that, on average, nucleotide diversity (pi was lowest at approximately 300 bp upstream of the transcription start site, suggesting that this region may harbor important functional elements. The proximal promoters of transporters that were highly expressed in the liver had greater nucleotide diversity than those that were highly expressed in the kidney consistent with greater negative selective pressure on the promoters of kidney transporters. Twenty-one promoters were evaluated for activity using reporter assays. Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. Collectively, these results suggest that the proximal promoter region of membrane transporters is rich in variation and that variants in these regions may play a role in interindividual variation in drug disposition and response.
Promoting proximal formative assessment with relational discourse
Scherr, Rachel E.; Close, Hunter G.; McKagan, Sarah B.
2012-02-01
The practice of proximal formative assessment - the continual, responsive attention to students' developing understanding as it is expressed in real time - depends on students' sharing their ideas with instructors and on teachers' attending to them. Rogerian psychology presents an account of the conditions under which proximal formative assessment may be promoted or inhibited: (1) Normal classroom conditions, characterized by evaluation and attention to learning targets, may present threats to students' sense of their own competence and value, causing them to conceal their ideas and reducing the potential for proximal formative assessment. (2) In contrast, discourse patterns characterized by positive anticipation and attention to learner ideas increase the potential for proximal formative assessment and promote self-directed learning. We present an analysis methodology based on these principles and demonstrate its utility for understanding episodes of university physics instruction.
Tumor-promoting phorbol esters effect alkalinization of canine renal proximal tubular cells
International Nuclear Information System (INIS)
Mellas, J.; Hammerman, M.R.
1986-01-01
We have demonstrated the presence of specific receptors for tumor-promoting phorbol esters in the plasma membrane of the canine renal proximal tubular cell. These compounds affect proximal tubular metabolism in vitro. For example, we have shown that they inhibit gluconeogenesis in canine renal proximal tubular segments. Tumor-promoting phorbol esters have been shown to effect alkalinization of non-renal cells, by enhancing Na + -H + exchange across the plasma membrane. To determine whether the actions of tumor-promoting phorbol esters in proximal tubular segments might be mediated by a similar process, we incubated suspensions of segments from dog kidney with these compounds and measured changes in intracellular pH using [ 14 C]-5,5-dimethoxazoladine-2-4-dione (DMO) and flow dialysis. Incubation of segments with phorbol 12,13 dibutyrate, but not inactive phorbol ester, 4 γ phorbol, effected alkalinization of cells within the segments in a concentration-dependent manner. Alkalinization was dependent upon the presence of extracellular [Na + ] > intracellular [Na + ], was prevented by amiloride and was demonstrable in the presence of SITS. Our findings suggest that tumor-promoting esters stimulate the Na + -H + exchanger known to be present in the brush border membrane of the renal proximal tubular cell. It is possible that the stimulation reflects a mechanism by which phorbol esters affect metabolic processes in these cells
AKT increases VEGF expression in tumor cells by transactivating the proximal VEGF promoter
International Nuclear Information System (INIS)
Pore, N.; Bernhard, E.J.; Shu, H.-K.; Li, B.; O'Rourke, D.M.; Maity, A.; Haas-Kogan, D.
2003-01-01
Vascular endothelial growth factor (VEGF) is overexpressed in many cancers including glioblastomas and may contribute to their growth. Epidermal growth factor receptor (EGFR) amplification and loss of PTEN, commonly found in glioblastomas leading to increase phosphatidylinositol-3-kinase (PI3K) activity and VEGF expression. In the current study we show that AKT, which is downstream of PI3K, regulates VEGF expression. U87MG human glioblastoma cells lack wildtype PTEN and express high levels of phosphorylated AKT. Over expression of AKT either by stable expression in immortalized human astrocytes or by transduction with adenovirus containing activated myristoylated AKT in SF188 glioblastoma cells increases VEGF expression. Moreover the elevation of angiogenesis by constitutively expressed AKT is further confirmed by in vivo matrigel plug assay in nude mice. The upregulation of VEGF by AKT is mediated through a region in the proximal promoter located between -88 and -70 (+1 is transcription start site). In transient transfection activity of a luciferase reporter containing the -88/+54 region of the VEGF promoter is increased by cotransfection with myristoylated AKT and downregulated by a dominant negative AKT expression vector. Mutation of the putative Sp1 binding sites located in the -88/-70 region we show that AKT acts through Sp1 to transactivate the VEGF promoter. Cotransfection of the VEGF promoter reporter with both Sp1 and myristoylated AKT expression vectors increases promoter activity to a greater extent than either Sp1 or Akt by itself. In vivo phosphate labeling of proteins reveals that AKT leads to increased Sp1 phosphorylation. Gel shift assays using a radio labeled probe corresponding to nucleotides -88 through -66 in the promoter show increased binding with nuclear extracts from cells transduced with adenovirus expressing myristoylated AKT. In conclusion, our results suggest that loss of PTEN leads to increased VEGF expression by increasing AKT
International Nuclear Information System (INIS)
Spink, Barbara C.; Bloom, Michael S.; Wu, Susan; Sell, Stewart; Schneider, Erasmus; Ding, Xinxin; Spink, David C.
2015-01-01
The aryl hydrocarbon receptor (AhR) regulates expression of numerous genes, including those of the CYP1 gene family. With the goal of determining factors that control AHR gene expression, our studies are focused on the role of the short tandem repeat polymorphism, (GGGGC) n , located in the proximal promoter of the human AHR gene. When luciferase constructs containing varying GGGGC repeats were transfected into cancer cell lines derived from the lung, colon, and breast, the number of GGGGC repeats affected AHR promoter activity. The number of GGGGC repeats was determined in DNA from 327 humans and from 38 samples representing 5 species of non-human primates. In chimpanzees and 3 species of macaques, only (GGGGC) 2 alleles were observed; however, in western gorilla, (GGGGC) n alleles with n = 2, 4, 5, 6, 7, and 8 were identified. In all human populations examined, the frequency of (GGGGC) n was n = 4 > 5 ≫ 2, 6. When frequencies of the (GGGGC) n alleles in DNA from patients with lung, colon, or breast cancer were evaluated, the occurrence of (GGGGC) 2 was found to be 8-fold more frequent among lung cancer patients in comparison with its incidence in the general population, as represented by New York State neonates. Analysis of matched tumor and non-tumor DNA samples from the same individuals provided no evidence of microsatellite instability. These studies indicate that the (GGGGC) n short tandem repeats are inherited, and that the (GGGGC) 2 allele in the AHR proximal promoter region should be further investigated with regard to its potential association with lung cancer susceptibility. - Highlights: • The AHR proximal promoter contains a polymorphism, (GGGGC) n , where n = 4 > 5 ≫ 2, 6 • Matched tumor and non-tumor DNA did not show (GGGGC) n microsatellite instability • AHR promoter activity of a construct with (GGGGC) 2 was lower than that of (GGGGC) 4 • The frequency of (GGGGC) 2 in lung cancer patients was 8-fold higher than in neonates • The
Energy Technology Data Exchange (ETDEWEB)
Spink, Barbara C. [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Bloom, Michael S. [Department of Environmental Health Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Wu, Susan [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Sell, Stewart; Schneider, Erasmus [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Department of Biomedical Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Ding, Xinxin [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Department of Environmental Health Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Department of Biomedical Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Spink, David C., E-mail: spink@wadsworth.org [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Department of Environmental Health Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States)
2015-01-01
The aryl hydrocarbon receptor (AhR) regulates expression of numerous genes, including those of the CYP1 gene family. With the goal of determining factors that control AHR gene expression, our studies are focused on the role of the short tandem repeat polymorphism, (GGGGC){sub n}, located in the proximal promoter of the human AHR gene. When luciferase constructs containing varying GGGGC repeats were transfected into cancer cell lines derived from the lung, colon, and breast, the number of GGGGC repeats affected AHR promoter activity. The number of GGGGC repeats was determined in DNA from 327 humans and from 38 samples representing 5 species of non-human primates. In chimpanzees and 3 species of macaques, only (GGGGC){sub 2} alleles were observed; however, in western gorilla, (GGGGC){sub n} alleles with n = 2, 4, 5, 6, 7, and 8 were identified. In all human populations examined, the frequency of (GGGGC){sub n} was n = 4 > 5 ≫ 2, 6. When frequencies of the (GGGGC){sub n} alleles in DNA from patients with lung, colon, or breast cancer were evaluated, the occurrence of (GGGGC){sub 2} was found to be 8-fold more frequent among lung cancer patients in comparison with its incidence in the general population, as represented by New York State neonates. Analysis of matched tumor and non-tumor DNA samples from the same individuals provided no evidence of microsatellite instability. These studies indicate that the (GGGGC){sub n} short tandem repeats are inherited, and that the (GGGGC){sub 2} allele in the AHR proximal promoter region should be further investigated with regard to its potential association with lung cancer susceptibility. - Highlights: • The AHR proximal promoter contains a polymorphism, (GGGGC){sub n}, where n = 4 > 5 ≫ 2, 6 • Matched tumor and non-tumor DNA did not show (GGGGC){sub n} microsatellite instability • AHR promoter activity of a construct with (GGGGC){sub 2} was lower than that of (GGGGC){sub 4} • The frequency of (GGGGC){sub 2} in lung
On evaluating the robustness of spatial-proximity-based regionalization methods
Lebecherel, Laure; Andréassian, Vazken; Perrin, Charles
2016-08-01
In absence of streamflow data to calibrate a hydrological model, its parameters are to be inferred by a regionalization method. In this technical note, we discuss a specific class of regionalization methods, those based on spatial proximity, which transfers hydrological information (typically calibrated parameter sets) from neighbor gauged stations to the target ungauged station. The efficiency of any spatial-proximity-based regionalization method will depend on the density of the available streamgauging network, and the purpose of this note is to discuss how to assess the robustness of the regionalization method (i.e., its resilience to an increasingly sparse hydrometric network). We compare two options: (i) the random hydrometrical reduction (HRand) method, which consists in sub-sampling the existing gauging network around the target ungauged station, and (ii) the hydrometrical desert method (HDes), which consists in ignoring the closest gauged stations. Our tests suggest that the HDes method should be preferred, because it provides a more realistic view on regionalization performance.
Transactivation of the proximal promoter of human oxytocin gene by TR4 orphan receptor
International Nuclear Information System (INIS)
Wang, C.-P.; Lee, Y.-F.; Chang, C.; Lee, H.-J.
2006-01-01
The human testicular receptor 4 (TR4) shares structural homology with members of the nuclear receptor superfamily. Some other members of this superfamily were able to regulate the transcriptional activity of the human oxytocin (OXT) promoter by binding to the first DR0 regulatory site. However, little investigation was conducted systematically in the study of the second dDR4 site of OXT proximal promoter, and the relationship between the first and the second sites of OXT promoter. Here, we demonstrated for the first time that TR4 could increase the proximal promoter activity of the human OXT gene via DR0, dDR4, and OXT (both DR0 and dDR4) elements, respectively. TR4 might induce OXT gene expression through the OXT element in a dose-dependent manner. However, there is no synergistic effect between DR0 and dDR4 elements during TR4 transactivation. Taken together, these results suggested that TR4 should be one of important regulators of OXT gene expression
Directory of Open Access Journals (Sweden)
Isaacs Richard J
2007-05-01
Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site
On evaluating the robustness of spatial-proximity-based regionalization methods.
Lebecherel , L.; Andréassian , V.; Perrin , C.
2016-01-01
International audience; In absence of streamflow data to calibrate a hydrological model, its parameters are to be inferred by a regionalization method. In this technical note, we discuss a specific class of regionalization methods, those based on spatial proximity, which transfers hydrological information (typically calibrated parameter sets) from neighbor gauged stations to the target ungauged station. The efficiency of any spatialproximity-based regionalization method will depend on the den...
On evaluating the robustness of spatial-proximity-based regionalization methods.
Lebecherel, L.; Andréassian, V.; Perrin, C.
2016-01-01
In absence of streamflow data to calibrate a hydrological model, its parameters are to be inferred by a regionalization method. In this technical note, we discuss a specific class of regionalization methods, those based on spatial proximity, which transfers hydrological information (typically calibrated parameter sets) from neighbor gauged stations to the target ungauged station. The efficiency of any spatialproximity-based regionalization method will depend on the density of the available st...
Promoter proximal polyadenylation sites reduce transcription activity
DEFF Research Database (Denmark)
Andersen, Pia Kjølhede; Lykke-Andersen, Søren; Jensen, Torben Heick
2012-01-01
Gene expression relies on the functional communication between mRNA processing and transcription. We previously described the negative impact of a point-mutated splice donor (SD) site on transcription. Here we demonstrate that this mutation activates an upstream cryptic polyadenylation (CpA) site......, which in turn causes reduced transcription. Functional depletion of U1 snRNP in the context of the wild-type SD triggers the same CpA event accompanied by decreased RNA levels. Thus, in accordance with recent findings, U1 snRNP can shield premature pA sites. The negative impact of unshielded pA sites...... on transcription requires promoter proximity, as demonstrated using artificial constructs and supported by a genome-wide data set. Importantly, transcription down-regulation can be recapitulated in a gene context devoid of splice sites by placing a functional bona fide pA site/transcription terminator within ∼500...
Directory of Open Access Journals (Sweden)
Lu Zheng
2009-09-01
Full Text Available Lu Zheng1, Guanghua Luo1, Xiaoying Zhang1, Jun Zhang1, Jiang Zhu1, Jiang Wei1, Qinfeng Mu1, Lujun Chen1, Peter Nilsson-Ehle2, Ning Xu21Comprehensive Laboratory, The Third Affiliated Hospital, Suzhou University, Changzhou China; 2Division of Clinical Chemistry and Pharmacology, Department of Laboratory Medicine, Lund University, Lund, SwedenObjective: It has been reported that single-nucleotide polymorphism (SNP in the proximal promoter region of apolipoprotein M (apoM gene may confer the risk in the development of type 2 diabetes (T2D and coronary artery disease (CAD in the Han Chinese. However, in a recent study demonstrated that plasma apoM level did not correlated to the coronary heart disease. In the present studies, we investigated the SNP T-778C of apoM gene in CAD patients and controls in the Han Chinese population. Moreover we examined whether serum apoM levels could be influenced by this promoter mutation.Material and methods: One hundred twenty-six CAD patients and 118 non-CAD patients were subjected in the present study. All patients were confirmed by the angiography. The genotyping of polymorphisms T-778C in apoM promoter was determined by real-time polymerase chain reaction. Serum apoM levels were semi-quantitatively determined by the dot-blotting analysis. Results: Distribution of apoM T-778C genotype in non-CAD patients was as following: 84.7% were T/T, 15.3% were T/C and 0.0% was C/C. T allele frequencies were 92.4% and C allele, 7.6%. In the CAD patients, 99 patients (78.6% had the T/T genotype, 25 patients (19.8% with T/C genotype and 2 patients (1.6% with C/C genotype. The allele frequency was 88.5% for the T allele and 11.5% for the C allele. There was no statistical significant difference of serum apoM levels found in these three genotypes.Conclusions: There was no significant difference in allele or genotype frequencies between CAD patients and non-CAD patients. Binary logistic regression analysis with adjustments for age
Identify fracture-critical regions inside the proximal femur using statistical parametric mapping
Li, Wenjun; Kornak, John; Harris, Tamara; Keyak, Joyce; Li, Caixia; Lu, Ying; Cheng, Xiaoguang; Lang, Thomas
2009-01-01
We identified regions inside the proximal femur that are most strongly associated with hip fracture. Bone densitometry based on such fracture-critical regions showed improved power in discriminating fracture patients from controls. Introduction Hip fractures typically occur in lateral falls, with focal mechanical failure of the sub-volumes of tissue in which the applied stress exceeds the strength. In this study, we describe a new methodology to identify proximal femoral tissue elements with highest association with hip fracture. We hypothesize that bone mineral density (BMD) measured in such sub-volumes discriminates hip fracture risk better than BMD in standard anatomic regions such as the femoral neck and trochanter. Materials and Methods We employed inter-subject registration to transform hip QCT images of 37 patients with hip fractures and 38 age-matched controls into a voxel-based statistical atlas. Within voxels, we performed t-tests between the two groups to identify the regions which differed most. We then randomly divided the 75 scans into a training set and a test set. From the training set, we derived a fracture-driven region of interest (ROI) based on association with fracture. In the test set, we measured BMD in this ROI to determine fracture discrimination efficacy using ROC analysis. Additionally, we compared the BMD distribution differences between the 29 patients with neck fractures and the 8 patients with trochanteric fractures. Results By evaluating fracture discrimination power based on ROC analysis, the fracture-driven ROI had an AUC (area under curve) of 0.92, while anatomic ROIs (including the entire proximal femur, the femoral neck, trochanter and their cortical and trabecular compartments) had AUC values between 0.78 and 0.87. We also observed that the neck fracture patients had lower BMD (p=0.014) in a small region near the femoral neck and the femoral head, and patients with trochanteric fractures had lower BMD in trochanteric regions
DEFF Research Database (Denmark)
Makkonen, Teemu; Williams, Allan
2015-01-01
A novel approach, namely cross-border regional innovation system, has been recently introduced to the literature on economic geography as a framework for studying innovation and scientific collaboration in a cross-border context. However, despite the importance of the topic for cross-border regions......, there are no existing empirical accounts comprehensively validating the concept. Here an attempt to shed some light into this “black box” is made by addressing this research gap via empirical material from Northern European cross-border regions. Specifically this is done by applying data on publications, sectoral...... and cultural statistics together with measures for accessibility and institutional and organisational similarity. These measures are linked to the varying types of proximity discussed in the literature on innovation and scientific collaboration; the impacts of proximity on the volume of cross-border scientific...
Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A
2010-01-01
Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.
International Nuclear Information System (INIS)
Weaver, J.C.B.; Stover, S.M.; O'Brien, T.R.
1992-01-01
The sites of bony attachment of the tendons, ligaments, and fibrous portion of the joint capsules of the equine metacarpophalangeal (fetlock) joint region were determined by gross dissection. These sites were transposed to standard radiographic views of the fetlock joint to yield illustrations that can be used as an aid in the diagnosis of soft tissue pathology from radiographs. Evidence of direct attachment of the common digital extensor tendon to the proximal phalanx was not found. Branches of the superficial digital flexor tendon were found to insert only on the middle phalanx. The recently described sites of insertion of the branches of the superficial digital flexor tendon to the proximal phalanx were found to be sites for attachment of the deep axial palmar ligaments of the proximal interphalangeal joint
Okuda, Itaru; Thomson, Vivian E
2007-07-01
The proximity principle - disposing of waste close to its origin - has been a central value in municipal solid waste (MSW) management in Japan for the last 30 years and its widespread adoption has helped resolve numerous "Not in My Backyard" issues related to MSW management. However, MSW management costs have soared, in large part because of aggressive recycling efforts and because most MSW is incinerated in a country that has scarce landfill capacity. In addition, smaller, less sophisticated incinerators have been closed because of high dioxin emissions. Rising costs combined with the closure of smaller incinerators have shifted MSW management policy toward regionalization, which is the sharing of waste management facilities across municipalities. Despite the increased use of regionalized MSW facilities, the proximity principle remains the central value in Japanese MSW management. Municipal solid waste management has become increasingly regionalized in the United States, too, but different driving forces are at work in these two countries. The transition to regionalized MSW management in Japan results from strong governmental control at all levels, with the central government providing funds and policy direction and prefectures and municipalities being the primary implementing authorities. By contrast, market forces are a much stronger force with US MSW management, where local governments - with state government oversight - have primary responsibility for MSW management. We describe recent changes in Japan's MSW programs. We examine the connections between MSW facility regionalization, on the one hand, and, on the other hand, the proximity principle, coordination among local governments, central government control, and financing mechanisms.
Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A
2007-08-01
Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.
International Nuclear Information System (INIS)
Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.
2003-01-01
The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation
Socio-cultural proximity, daily life and shopping tourism in the Dutch–German border region
Szytniewski, Bianca B.; Spierings, Bas; van der Velde, Martin
2017-01-01
This paper analyses feelings of socio-cultural proximity and distance with a specific focus on the tourist experience in cross-border shopping and everyday life practices in border regions. We examined shopping practices of Dutch border crossers who visit the German town Kleve in the Dutch–German
Chiang, I-Ni; Pu, Yeong-Shiau; Huang, Chao-Yuan; Young, Tai-Horng
2017-01-01
Far infrared radiation, a subdivision of the electromagnetic spectrum, is beneficial for long-term tissue healing, anti-inflammatory effects, growth promotion, sleep modulation, acceleration of microcirculation, and pain relief. We investigated if far infrared radiation is beneficial for renal proximal tubule cell cultivation and renal tissue engineering. We observed the effects of far infrared radiation on renal proximal tubules cells, including its effects on cell proliferation, gene and protein expression, and viability. We also examined the protective effects of far infrared radiation against cisplatin, a nephrotoxic agent, using the human proximal tubule cell line HK-2. We found that daily exposure to far infrared radiation for 30 min significantly increased rabbit renal proximal tubule cell proliferation in vitro, as assessed by MTT assay. Far infrared radiation was not only beneficial to renal proximal tubule cell proliferation, it also increased the expression of ATPase Na+/K+ subunit alpha 1 and glucose transporter 1, as determined by western blotting. Using quantitative polymerase chain reaction, we found that far infrared radiation enhanced CDK5R1, GNAS, NPPB, and TEK expression. In the proximal tubule cell line HK-2, far infrared radiation protected against cisplatin-mediated nephrotoxicity by reducing apoptosis. Renal proximal tubule cell cultivation with far infrared radiation exposure resulted in better cell proliferation, significantly higher ATPase Na+/K+ subunit alpha 1 and glucose transporter 1 expression, and significantly enhanced expression of CDK5R1, GNAS, NPPB, and TEK. These results suggest that far infrared radiation improves cell proliferation and differentiation. In HK-2 cells, far infrared radiation mediated protective effects against cisplatin-induced nephrotoxicity by reducing apoptosis, as indicated by flow cytometry and caspase-3 assay.
Directory of Open Access Journals (Sweden)
Eduardo Gonçalves
2011-04-01
Full Text Available O objetivo deste trabalho é verificar a influência da proximidade geográfica e da proximidade tecnológica sobre a inovação regional no Brasil, medida por depósitos de patentes no período 1999-2001 para mesorregiões geográficas. Para tanto, utilizaram-se técnicas de Análise Exploratória de Dados Espaciais (AEDE e de econometria espacial. Os dados de patentes foram organizados em quatro clusters tecnológicos segundo critérios de proximidade cognitiva, como biofarmacêutico, desenvolvimento de novos materiais, bens mecânicos e de consumo e tecnologias eletroeletrônicas, revelando um padrão de concentração da atividade tecnológica em poucas mesorregiões brasileiras. Além disso, foi calculada a medida de proximidade tecnológica de Jaffe para ponderar a vizinhança geográfica pelo grau de similaridade tecnológica das mesorregiões. Os resultados confirmam a hipótese de transbordamentos de conhecimento mediados tecnológica e geograficamente.The aim of this paper is to determine the influence of technological proximity and geographical proximity on Brazilian regional innovation, measured by patent applications over the period 1999-2001 for Brazilian geographical mesoregions. First, the paper undertakes an Exploratory Spatial Data Analysis (ESDA and then uses spatial econometric techniques. According with procedures based on cognitive proximity the patent data are organized into four technological clusters such as chemical and bio-pharmaceutical, new materials, mechanical and process technologies and electrical and electronic technologies. The four aforementioned clusters exhibit a concentrated regional pattern of technological activity over few Brazilian mesoregions. Moreover, the paper uses a Jaffe's measure of technological distance in order to construct a matrix in which the technological similarity is weighted by the geographical proximity. The results corroborate the hypothesis of geographically and technologically
[Health-Promoting Schools Regional Initiative of the Americas].
Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia
2005-01-01
In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen
Some observations on lameness associated with pain in the proximal metacarpal region
International Nuclear Information System (INIS)
Dyson, S.
1988-01-01
The carpus and metacarpus of 40 horses which were free from lameness and 40 horses with lameness associated with the metacarpophalangeal joint or more distal limb were examined radiographically (Group A). The opacity of the proximal third of the third metacarpal bone was regular, with a uniform trabecular pattern. Osseous cyst-like lesions (OCLLs) were identified in the radial carpal bone (1), the ulnar carpal bone (2), the second carpal bone (15) and the fourth carpal bone (1). Thirty-one of 638 horses (4.8 percent) with forelimb lameness had pain localised to the proximal metacarpal region using local anaesthesia (Group B). All these horses were examined radiographically and an ultrasonographic examination was performed in seven. No definitive diagnosis was reached in 16 horses, seven of which had an OCLL in one of the carpal bones or the second metacarpal bone. One horse had, in addition to a poorly defined lucent area in the second carpal bone, radiographic evidence of degenerative joint disease of the carpometacarpal joint and an hypoechoic lesion in the accessory ligament of the deep digital flexor tendon. One horse had an hypoechoic lesion in the proximal part of the suspensory ligament. Abnormalities of the trabecular structure of the third metacarpal bone were identified in 13 horses. In 11 of these there was a vertically orientated lucent line, usually surrounded by sclerotic bone. These lucent lines may represent fatigue fractures seen end on. In one horse an horizontal lucent line was seen. One of these 13 horses also had a lesion in the proximal part of the suspensory ligament. Ten of the 13 (77 per cent) horses with presumed fractures of the third metacarpal bone recovered completely, whereas only eight of the 16 (50 per cent) horses in which no definitive diagnosis was reached returned to their former function
RGmatch: matching genomic regions to proximal genes in omics data integration
Directory of Open Access Journals (Sweden)
Pedro Furió-Tarí
2016-11-01
Full Text Available Abstract Background The integrative analysis of multiple genomics data often requires that genome coordinates-based signals have to be associated with proximal genes. The relative location of a genomic region with respect to the gene (gene area is important for functional data interpretation; hence algorithms that match regions to genes should be able to deliver insight into this information. Results In this work we review the tools that are publicly available for making region-to-gene associations. We also present a novel method, RGmatch, a flexible and easy-to-use Python tool that computes associations either at the gene, transcript, or exon level, applying a set of rules to annotate each region-gene association with the region location within the gene. RGmatch can be applied to any organism as long as genome annotation is available. Furthermore, we qualitatively and quantitatively compare RGmatch to other tools. Conclusions RGmatch simplifies the association of a genomic region with its closest gene. At the same time, it is a powerful tool because the rules used to annotate these associations are very easy to modify according to the researcher’s specific interests. Some important differences between RGmatch and other similar tools already in existence are RGmatch’s flexibility, its wide range of user options, compatibility with any annotatable organism, and its comprehensive and user-friendly output.
Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences
König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.
2013-01-01
G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141
Directory of Open Access Journals (Sweden)
Rogério Franco de Araujo Goes
2015-08-01
Full Text Available ABSTRACTOBJECTIVE: To analyze and describe the distance from the popliteal artery to three specific areas of the proximal region of the tibia, with the knee extended, by means of magnetic resonance. METHODS: Images of 100 knees of patients who underwent magnetic resonance examinations were analyzed. The location of the popliteal artery was measured in three different areas of the posterior proximal region of the tibia. The first measurement was made at the level of the knee joint (tibial plateau. The second was 9 mm distally to the tibial plateau. The third was at the level of the anterior tuberosity of the tibia (ATT. RESULTS: The distances between the popliteal artery and the tibial plateau and ATT region were significantly greater in males than in females. The distances between the popliteal artery and the regions 9 mm distally to the tibial plateau and the ATT were significantly greater in the age group over 36 years than in the group ≤36 years. CONCLUSION: Knowledge of the anatomical position of the popliteal artery, as demonstrated through magnetic resonance studies, is of great relevance in planning surgical procedures that involve the knee joint. In this manner, devastating iatrogenic injuries can be avoided, particularly in regions that are proximal to the tibial plateau and in young patients.
Directory of Open Access Journals (Sweden)
Lu Ying
2004-04-01
Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the
Identification of cis-acting regulatory elements in the human oxytocin gene promoter.
Richard, S; Zingg, H H
1991-12-01
promoter resides in a small region extending only 50 bases upstream of the cap site and that this activity is the result of a cooperative interaction of at least three distinct proximal promoter elements.
Genome-wide analysis of regions similar to promoters of histone genes
Chowdhary, Rajesh
2010-05-28
Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that
Liu, Fu-Jun; Song, Xiulong; Yang, Dongfang; Deng, Ruitang; Yan, Bingfang
2008-01-01
CYP3A4 (cytochrome P450 3A4) is involved in the metabolism of more than 50% of drugs and other xenobiotics. The expression of CYP3A4 is induced by many structurally dissimilar compounds. The PXR (pregnane X receptor) is recognized as a key regulator for the induction, and the PXR-directed transactivation of the CYP3A4 gene is achieved through a co-ordinated mechanism of the distal module with the proximal promoter. Recently, a far module was found to support constitutive expression of CYP3A4. The far module, like the distal module, is structurally clustered by a PXR response element (F-ER6) and elements recognized by HNF-4alpha (hepatocyte nuclear receptor-4alpha). We hypothesized that the far module supports PXR transactivation of the CYP3A4 gene. Consistent with the hypothesis, fusion of the far module to the proximal promoter of CYP3A4 markedly increased rifampicin-induced reporter activity. The increase was synergistically enhanced when both the far and distal modules were fused to the proximal promoter. The increase, however, was significantly reduced when the F-ER6 was disrupted. Chromatin immunoprecipitation detected the presence of PXR in the far module. Interestingly, HNF-4alpha increased the activity of the distal-proximal fused promoter, but decreased the activity of the far-proximal fused promoter. Given the fact that induction of CYP3A4 represents an important detoxification mechanism, the functional redundancy and synergistic interaction in supporting PXR transactivation suggest that the far and distal modules ensure the induction of CYP3A4 during chemical insults. The difference in responding to HNF-4alpha suggests that the magnitude of the induction is under control through various transcriptional networks.
Gualtieri, Gustavo; Conner, Joann A; Morishige, Daryl T; Moore, L David; Mullet, John E; Ozias-Akins, Peggy
2006-03-01
Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory.
Energy Technology Data Exchange (ETDEWEB)
Duan, Liangwei; Du, Jiansen [State Key Laboratory of Medicinal Chemical Biology, College of Life Sciences, Nankai University, Tianjin 300071 (China); Wang, Xuefeng; Zhou, Jianhua; Wang, Xiaojun [State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin 150001 (China); Liu, Xinqi, E-mail: liu2008@nankai.edu.cn [State Key Laboratory of Medicinal Chemical Biology, College of Life Sciences, Nankai University, Tianjin 300071 (China)
2016-04-15
Equine infectious anaemia virus (EIAV) and human immunodeficiency virus (HIV) are members of the lentiviral genus. Similar to HIV gp41, EIAV gp45 is a fusogenic protein that mediates fusion between the viral particle and the host cell membrane. The crystal structure of gp45 reported reveals a different conformation in the here that includes the fusion peptide proximal region (FPPR) and neighboring asparagine-rich layer compared with previous HIV-1 gp41 structures. A complicated hydrogen-bond network containing a cluster of solvent molecules appears to be critical for the stability of the gp45 helical bundle. Interestingly, viral replication was relatively unaffected by site-directed mutagenesis of EIAV, in striking contrast to that of HIV-1. Based on these observations, we speculate that EIAV is more adaptable to emergent mutations, which might be important for the evolution of EIAV as a quasi-species, and could potentially contribute to the success of the EIAV vaccine. - Highlights: • The crystal structure of EIAV gp45 was determined. • The fusion peptide proximal region adopts a novel conformation different to HIV-1. • The asparagine-rich layer includes an extensive hydrogen-bond network. • These regions of EIAV are highly tolerant to mutations. • The results provide insight into the mechanism of gp41/gp45-mediated membrane fusion.
DEFF Research Database (Denmark)
Palm, Henrik; Teixidor, Jordi
2015-01-01
searched the homepages of the national heath authorities and national orthopedic societies in West Europe and found 11 national or regional (in case of no national) guidelines including any type of proximal femoral fracture surgery. RESULTS: Pathway consensus is outspread (internal fixation for un...
International Nuclear Information System (INIS)
Roche, Julien; Louis, John M.; Aniana, Annie; Ghirlando, Rodolfo; Bax, Ad
2015-01-01
The envelope glycoprotein gp41 mediates the process of membrane fusion that enables entry of the HIV-1 virus into the host cell. Strong lipid affinity of the ectodomain suggests that its heptad repeat regions play an active role in destabilizing membranes by directly binding to the lipid bilayers and thereby lowering the free-energy barrier for membrane fusion. In such a model, immediately following the shedding of gp120, the N-heptad and C-heptad helices dissociate and melt into the host cell and viral membranes, respectively, pulling the destabilized membranes into juxtaposition, ready for fusion. Post-fusion, reaching the final 6-helix bundle (6HB) conformation then involves competition between intermolecular interactions needed for formation of the symmetric 6HB trimer and the membrane affinity of gp41’s ectodomain, including its membrane-proximal regions. Our solution NMR study of the structural and dynamic properties of three constructs containing the ectodomain of gp41 with and without its membrane-proximal regions suggests that these segments do not form inter-helical interactions until the very late steps of the fusion process. Interactions between the polar termini of the heptad regions, which are not associating with the lipid surface, therefore may constitute the main driving force initiating formation of the final post-fusion states. The absence of significant intermolecular ectodomain interactions in the presence of dodecyl phosphocholine highlights the importance of trimerization of gp41’s transmembrane helix to prevent complete dissociation of the trimer during the course of fusion
Energy Technology Data Exchange (ETDEWEB)
Roche, Julien; Louis, John M.; Aniana, Annie [National Institute of Diabetes and Digestive and Kidney Diseases, Laboratory of Chemical Physics (United States); Ghirlando, Rodolfo [National Institutes of Health, Laboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases (United States); Bax, Ad, E-mail: bax@nih.gov [National Institute of Diabetes and Digestive and Kidney Diseases, Laboratory of Chemical Physics (United States)
2015-04-15
The envelope glycoprotein gp41 mediates the process of membrane fusion that enables entry of the HIV-1 virus into the host cell. Strong lipid affinity of the ectodomain suggests that its heptad repeat regions play an active role in destabilizing membranes by directly binding to the lipid bilayers and thereby lowering the free-energy barrier for membrane fusion. In such a model, immediately following the shedding of gp120, the N-heptad and C-heptad helices dissociate and melt into the host cell and viral membranes, respectively, pulling the destabilized membranes into juxtaposition, ready for fusion. Post-fusion, reaching the final 6-helix bundle (6HB) conformation then involves competition between intermolecular interactions needed for formation of the symmetric 6HB trimer and the membrane affinity of gp41’s ectodomain, including its membrane-proximal regions. Our solution NMR study of the structural and dynamic properties of three constructs containing the ectodomain of gp41 with and without its membrane-proximal regions suggests that these segments do not form inter-helical interactions until the very late steps of the fusion process. Interactions between the polar termini of the heptad regions, which are not associating with the lipid surface, therefore may constitute the main driving force initiating formation of the final post-fusion states. The absence of significant intermolecular ectodomain interactions in the presence of dodecyl phosphocholine highlights the importance of trimerization of gp41’s transmembrane helix to prevent complete dissociation of the trimer during the course of fusion.
Directory of Open Access Journals (Sweden)
João Carlos Ferreira Correia
2012-04-01
Full Text Available The main objective of this paper is to analyze the means of proximity (regional, local as privileged actors in the development of an interaction with the public to act as construction of general welfare. The sustainable development of the community is discussed from the communitarian, participatory and deliberative views, originated from the European and American tradition, as well as from the theoretical framework of the Latin American community communication, which developed its own approach. The promotion of a dialogue between public and media is discussed, understood as social actors committed to the promotion of development, though not coincident in their concession on it. The proximity articulates with concepts such as those of 'community', 'civil society', 'development' and 'citizenship', which help to structure the analysis of struggles and processes of discussion on models of development. However, it is recognized that the regional media have specific settings that show a tension between the roots of the community and its organizational nature. Thus, throughout the text, is resorted to a study case prepared in Portugal along with several regional means to illustrate this tension.
International Regional Patterns of R&D Networks Involving Low Tech SMEs
Directory of Open Access Journals (Sweden)
Aurora A.C. Teixeira
2013-03-01
Full Text Available A large number of studies have emphasized the spatial proximity of economic activity and its relation to the spatiality of knowledge creation in various types of connections. Far less attention has been paid to the understanding of the determinants of ‘cultural’ and geographical proximity in international R&D cooperation projects involving SMEs and the role of the quality of the Regional Innovation System (RIS. Using a database of completed European Cooperative Research projects, we conclude that: 1 technologically more complex projects are more likely to involve ‘culturally’ and geographically distant partners; 2 RIS related variables determine ‘cultural’ proximity but not geographical proximity; 3 at first sight surprisingly, international cooperation projects involving the 1st promoters of innovation-led regions (high patent propensity and high human capital levels are culturally more distant.
Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.
2006-01-01
Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921
Gualtieri, Gustavo; Conner, Joann A.; Morishige, Daryl T.; Moore, L. David; Mullet, John E.; Ozias-Akins, Peggy
2006-01-01
Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory. PMID:16415213
Identification and annotation of promoter regions in microbial
Indian Academy of Sciences (India)
2007-06-15
Jun 15, 2007 ... Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the ...
Comparative analyses of bidirectional promoters in vertebrates
Directory of Open Access Journals (Sweden)
Taylor James
2008-05-01
Full Text Available Abstract Background Orthologous genes with deep phylogenetic histories are likely to retain similar regulatory features. In this report we utilize orthology assignments for pairs of genes co-regulated by bidirectional promoters to map the ancestral history of the promoter regions. Results Our mapping of bidirectional promoters from humans to fish shows that many such promoters emerged after the divergence of chickens and fish. Furthermore, annotations of promoters in deep phylogenies enable detection of missing data or assembly problems present in higher vertebrates. The functional importance of bidirectional promoters is indicated by selective pressure to maintain the arrangement of genes regulated by the promoter over long evolutionary time spans. Characteristics unique to bidirectional promoters are further elucidated using a technique for unsupervised classification, known as ESPERR. Conclusion Results of these analyses will aid in our understanding of the evolution of bidirectional promoters, including whether the regulation of two genes evolved as a consequence of their proximity or if function dictated their co-regulation.
Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.
Tencomnao, T; Yu, R K; Kapitonov, D
2001-02-16
UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.
Schausi, Diane; Tiffoche, Christophe; Thieulant, Marie-Lise
2003-07-01
We have characterized the intronic promoter of the rat estrogen receptor (ER) alpha gene, responsible for the lactotrope-specific truncated ER product (TERP)-1 isoform expression. Transcriptional regulation was investigated by transient transfections using 5'-deletion constructs. TERP promoter constructs were highly active in MMQ cells, a pure lactotrope cell line, whereas a low basal activity was detected in alphaT3-1 gonadotrope cells or in COS-7 monkey kidney cells. Serial deletion analysis revealed that 1) a minimal -693-bp region encompassing the TATA box is sufficient to allow lactotrope-specific expression; 2) the promoter contains strong positive cis-acting elements both in the distal and proximal regions, and 3) the region spanning the -1698/-1194 region includes repressor elements. Transient transfection studies, EMSAs, and gel shifts demonstrated that estrogen activates the TERP promoter via an estrogen-responsive element (ERE1) located within the proximal region. Mutation of ERE1 site completely abolishes the estradiol-dependent transcription, indicating that ERE1 site is sufficient to confer estrogen responsiveness to TERP promoter. In addition, ERalpha action was synergized by transfection of the pituitary-specific factor Pit-1. EMSAs showed that a single Pit-1 DNA binding element in the vicinity of the TATA box is sufficient to confer response by the TERP promoter. In conclusion, we demonstrated, for the first time, that TERP promoter regulation involves ERE and Pit-1 cis-elements and corresponding trans-acting factors, which could play a role in the physiological changes that occur in TERP-1 transcription in lactotrope cells.
Directory of Open Access Journals (Sweden)
Christine R Langlois
2016-11-01
Full Text Available Prions are a group of proteins that can adopt a spectrum of metastable conformations in vivo. These alternative states change protein function and are self-replicating and transmissible, creating protein-based elements of inheritance and infectivity. Prion conformational flexibility is encoded in the amino acid composition and sequence of the protein, which dictate its ability not only to form an ordered aggregate known as amyloid but also to maintain and transmit this structure in vivo. But, while we can effectively predict amyloid propensity in vitro, the mechanism by which sequence elements promote prion propagation in vivo remains unclear. In yeast, propagation of the [PSI+] prion, the amyloid form of the Sup35 protein, has been linked to an oligopeptide repeat region of the protein. Here, we demonstrate that this region is composed of separable functional elements, the repeats themselves and a repeat proximal region, which are both required for efficient prion propagation. Changes in the numbers of these elements do not alter the physical properties of Sup35 amyloid, but their presence promotes amyloid fragmentation, and therefore maintenance, by molecular chaperones. Rather than acting redundantly, our observations suggest that these sequence elements make complementary contributions to prion propagation, with the repeat proximal region promoting chaperone binding to and the repeats promoting chaperone processing of Sup35 amyloid.
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.
Directory of Open Access Journals (Sweden)
Carlos Guerrero-Bosagna
2010-09-01
Full Text Available Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a was found to be due to a copy number variation (CNV and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.
Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K
2010-09-30
Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
Rogge, George A; Shen, Li-Ling; Kuhar, Michael J
2010-07-16
Both over expression of cyclic AMP response element binding protein (CREB) in the nucleus accumbens (NAc), and intra-accumbal injection of cocaine- and amphetamine-regulated transcript (CART) peptides, have been shown to decrease cocaine reward. Also, over expression of CREB in the rat NAc increased CART mRNA and peptide levels, but it is not known if this was due to a direct action of P-CREB on the CART gene promoter. The goal of this study was to test if CREB and P-CREB bound directly to the CRE site in the CART promoter, using chromatin immunoprecipitation (ChIP) assays. ChIP assay with anti-CREB antibodies showed an enrichment of the CART promoter fragment containing the CRE region over IgG precipitated material, a non-specific control. Forskolin, which was known to increase CART mRNA levels in GH3 cells, was utilized to show that the drug increased levels of P-CREB protein and P-CREB binding to the CART promoter CRE-containing region. A region of the c-Fos promoter containing a CRE cis-regulatory element was previously shown to bind P-CREB, and it was used here as a positive control. These data suggest that the effects of CREB over expression on blunting cocaine reward could be, at least in part, attributed to the increased expression of the CART gene by direct interaction of P-CREB with the CART promoter CRE site, rather than by some indirect action. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Unveiling DNA structural properties of promoter regions of ...
Indian Academy of Sciences (India)
Aditya Kumar
Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...
Social Media Marketing as a tool for promoting the regional investment portals
Directory of Open Access Journals (Sweden)
Alisa Yu. Fadeyeva
2016-01-01
Full Text Available Objective to investigate the potential of Social Media Marketing as a tool for promoting regional investment portals in the information environment to identify the most effective ways of its implementation and to determine the level of mastering of this tool by the Russian regions. Methods general scientific methods observation comparison analysis induction deduction analogy classification. Results the analysis showed that today Social Media Marketing is an essential tool for interaction with the investment community and one of the most effective ways to promote the regional portal which allows to increase the knowledge of and loyalty to the brand to increase the targeted website traffic to increase the awareness of investors about the specific features of the portal and the regional development agenciesrsquo functioning to promptly receive information about the investment environment and to establish contacts with investors. At the same time the study of SMMactivity in the Russian regions revealed a very low level of quality of communication with investors through social networks. Scientific novelty for the first time the article investigates the significance and makes the comparative analysis of the Social Media Marketing channels with regard to investment promotion agencies as well as the results of the regional structures functioning for effective communication through social networks. Practical significance the main results of the research can be used by the regional investment agencies in order to promote their websites increase the quality of communication with investors and promote the investment attractiveness of the region as a whole. nbsp
Dogaru, Dora; van Oort, Frank; Thissen, M.
2014-01-01
The discussion on proximity has evolved in various theoretical, conceptual and empirical directions since the seminal contributions by Torre and Rallet (2005) and Boschma (2005). One of the main arguments for conceptualizing proximities other than physical proximities is embedded in the ever-growing
Identification and annotation of promoter regions in microbial ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
2007-06-15
Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.
Brain region's relative proximity as marker for Alzheimer's disease based on structural MRI
DEFF Research Database (Denmark)
Erleben, Lene Lillemark; Sørensen, Lauge Emil; Pai, Akshay Sadananda Uppinakudru
2014-01-01
BACKGROUND:Alzheimer's disease (AD) is a progressive, incurable neurodegenerative disease and the most common type of dementia. It cannot be prevented, cured or drastically slowed, even though AD research has increased in the past 5-10 years. Instead of focusing on the brain volume or on the single...... brain structures like hippocampus, this paper investigates the relationship and proximity between regions in the brain and uses this information as a novel way of classifying normal control (NC), mild cognitive impaired (MCI), and AD subjects.METHODS:A longitudinal cohort of 528 subjects (170 NC, 240...... to whole brain and hippocampus volume.RESULTS:We found that both our markers was able to significantly classify the subjects. The surface connectivity marker showed the best results with an area under the curve (AUC) at 0.877 (p...
Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C.
Hitrik, Anna; Popliker, Malka; Gancz, Dana; Mukamel, Zohar; Lifshitz, Aviezer; Schwartzman, Omer; Tanay, Amos; Gilboa, Lilach
2016-11-01
The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation.
Thornton, Michael A; Zhang, Chunyan; Kowalska, Maria A; Poncz, Mortimer
2002-11-15
The alphaIIb/beta3-integrin receptor is present at high levels only in megakaryocytes and platelets. Its presence on platelets is critical for hemostasis. The tissue-specific nature of this receptor's expression is secondary to the restricted expression of alphaIIb, and studies of the alphaIIb proximal promoter have served as a model of a megakaryocyte-specific promoter. We have examined the alphaIIb gene locus for distal regulatory elements. Sequence comparison between the human (h) and murine (m) alphaIIb loci revealed high levels of conservation at intergenic regions both 5' and 3' to the alphaIIb gene. Additionally, deoxyribonuclease (DNase) I sensitivity mapping defined tissue-specific hypersensitive (HS) sites that coincide, in part, with these conserved regions. Transgenic mice containing various lengths of the h(alpha)IIb gene locus, which included or excluded the various conserved/HS regions, demonstrated that the proximal promoter was sufficient for tissue specificity, but that a region 2.5 to 7.1 kb upstream of the h(alpha)IIb gene was necessary for consistent expression. Another region 2.2 to 7.4 kb downstream of the gene enhanced expression 1000-fold and led to levels of h(alpha)IIb mRNA that were about 30% of the native m(alpha)IIb mRNA level. These constructs also resulted in detectable h(alpha)IIb/m(beta)3 on the platelet surface. This work not only confirms the importance of the proximal promoter of the alphaIIb gene for tissue specificity, but also characterizes the distal organization of the alphaIIb gene locus and provides an initial localization of 2 important regulatory regions needed for the expression of the alphaIIb gene at high levels during megakaryopoiesis.
Business networking for SMEs as a means to promote regional competitiveness: A Theoretical Framework
Vitor Braga
2004-01-01
The competitiveness of regions, as a means of promoting the competitiveness of a country as a whole, has been one of the main topics on the agenda of policy makers over the last decades. Several attempts at promoting competitiveness have been made with different degrees of success. In most cases, public investment in the regions was perceived as the solution to promote regional competitiveness and top-down policies were implemented. However, competitiveness also has an important dimension tha...
Webb, Lawrence X
2002-01-01
Fractures of the proximal femur include fractures of the head, neck, intertrochanteric, and subtrochanteric regions. Head fractures commonly accompany dislocations. Neck fractures and intertrochanteric fractures occur with greatest frequency in elderly patients with a low bone mineral density and are produced by low-energy mechanisms. Subtrochanteric fractures occur in a predominantly strong cortical osseous region which is exposed to large compressive stresses. Implants used to address these fractures must be able to accommodate significant loads while the fractures consolidate. Complications secondary to these injuries produce significant morbidity and include infection, nonunion, malunion, decubitus ulcers, fat emboli, deep venous thrombosis, pulmonary embolus, pneumonia, myocardial infarction, stroke, and death.
Directory of Open Access Journals (Sweden)
Walker Angela M
2009-04-01
Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed
Symmetry-based reciprocity: evolutionary constraints on a proximate mechanism.
Campennì, Marco; Schino, Gabriele
2016-01-01
Background. While the evolution of reciprocal cooperation has attracted an enormous attention, the proximate mechanisms underlying the ability of animals to cooperate reciprocally are comparatively neglected. Symmetry-based reciprocity is a hypothetical proximate mechanism that has been suggested to be widespread among cognitively unsophisticated animals. Methods. We developed two agent-based models of symmetry-based reciprocity (one relying on an arbitrary tag and the other on interindividual proximity) and tested their ability both to reproduce significant emergent features of cooperation in group living animals and to promote the evolution of cooperation. Results. Populations formed by agents adopting symmetry-based reciprocity showed differentiated "social relationships" and a positive correlation between cooperation given and received: two common aspects of animal cooperation. However, when reproduction and selection across multiple generations were added to the models, agents adopting symmetry-based reciprocity were outcompeted by selfish agents that never cooperated. Discussion. In order to evolve, hypothetical proximate mechanisms must be able to stand competition from alternative strategies. While the results of our simulations require confirmation using analytical methods, we provisionally suggest symmetry-based reciprocity is to be abandoned as a possible proximate mechanism underlying the ability of animals to reciprocate cooperative interactions.
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
Energy Technology Data Exchange (ETDEWEB)
Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)
2006-03-31
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.
Perspectives on Promoting Regional Renewable Energy Research and Development
International Nuclear Information System (INIS)
Dresselhaus, M.
2008-01-01
Recent discussions at the Washington International Renewable Energy Conference (WIREC), hosted in March 2008 by the United States Government, with nearly 9000 participants including 103 ministers from 126 countries, concluded that a major acceleration in the adoption of renewable energy technologies was needed by mid-century. Because of different climatic conditions and societal preferences, regional cooperation is expected to play a major role in the efficient adoption of appropriate renewable energy technologies, and countries with special expertise in specific technologies seem eager to collaborate internationally to promote global goals in renewable energy. A review will be given of what we learned from this conference about renewable energy research and development strategies with a special focus given to using this basic knowledge base to promote the development of renewable energy technologies appropriate to specific regions of the world.(author)
The sooner, the better: exercise outcome proximity and intrinsic motivation.
Evans, M Blair; Cooke, Lisa M; Murray, Robyn A; Wilson, Anne E
2014-11-01
Despite evidence that outcomes are highly valued when they are expected sooner rather than further into the future (Ainslie, 1975), limited research effort has been devoted to understanding the role of exercise outcome proximity. The purpose of this study was to examine how temporal proximity to positive outcomes influences exercisers' intrinsic motivation. We expected that focusing people on temporally proximal exercise outcomes would increase intrinsic motivation, especially among low-frequency exercisers. This online experimental study was completed by 135 community exercisers (Mage = 31.11, SD = 10.29; 62% female) who reported an average of 4.86 exercise bouts per week (SD = 2.12). Participants were randomly assigned to a condition that primed temporally proximal positive exercise outcomes (i.e. experienced during or directly following an exercise bout) or temporally distal outcomes (i.e. experienced after days, months, or years of regular exercise). Participants then reported perceptions of behavioral regulation in exercise. As expected, the proximal exercise outcome condition elicited increased intrinsic regulation among those participants who exercised less frequently (i.e. 1 SD below the mean). This study reveals the importance of considering proximity as an important dimension of exercise outcomes-particularly when promoting intrinsic motivation among relatively infrequent exercisers. © 2014 The International Association of Applied Psychology.
Regional differences in gene expression and promoter usage in aged human brains
Pardo, Luba M.
2013-02-19
To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.
Growing Significance of EU Institutions in Promotion of Inter-regional policies
Directory of Open Access Journals (Sweden)
Ella V. Ermakova
2014-01-01
Full Text Available The article explores the variety of tools and vehicles applied within the EU to expand the prerogative of the regions of the EU member states. The author uses as an example the inter-regional policies in Belgium in respect of the Flemish Region and the Walloon Region. The author analyzes the mechanisms of promotion of external regional relations in Belgium as a means of addressing different problems both on national and all-European level, supporting the arguments and conclusions by examples of relevant EU initiatives. The article details the activities of the EU Regional Committee (RC, the EU advisory body with the powers of political initiative, upholding the principle ofsubsidarity in the implementation of the EU member states' regional policies. The involvement of the Flemish Region and the Walloon Region in the activities of EU RC is described and summarized. As a case study, the article deals with Belgium's rotating six months presidency in the EUin 2010 when the country, which was going through a severe political crisis with no federal government in place, was represented by the two regions. The special focus of the article is on the strategic EU program "Europe2020" and its implementation by the regions of Belgium. There is an account of the initiatives undertaken by the Flemish Region and the Walloon Region within the framework of this program outlining the interaction of the two regions. The author provides a comprehensive analysis of the involvement of the Flemish Region and the Walloon Region with various EU institutions describing how each party achieves the promotion of its regional interests. Within this context, it is a noteworthy development that the Flemish Region is participating in the international program "Pact 2020" on energy all by its own. The article features quotations by Flemish and Walloon political figures which serve as an illustration of the prevailing attitudes in the Belgian society to the process of
Vali Pasha, Kotwal; Ratnavathi, Chamarthy Venkata; Ajani, Jayanna; Raju, Dugyala; Manoj Kumar, Sriramoju; Beedu, Sashidhar Rao
2018-01-01
Millets are a diverse group of small seeded grasses, widely grown around the world as cereal foods. This communication details the proximate, mineral profile and antioxidant activity of six different small millets (Finger, Foxtail, Proso, Little, Barnyard and Kodo millets) and their 21 cultivars that are traditionally cultivated and consumed in the region of Ralayaseema, south India. The proximate analysis revealed that these millets are rich in protein, fat, ash (mineral), total dietary fibre and total phenols with appreciable antioxidant activity. However, starch and amylose content was comparatively lower as compared to major millet sorghum. ICP-MS analysis of small millets demonstrated that they are rich in minerals such as Ca, P, K, Mg, Fe, Cu, Zn, Mn, Cr, Mo and Se. Finger and kodo millets were found to be nutritionally superior over other small millets. The results suggest that small millets have a potential to provide food security and can combat micronutrient malnutrition. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Electromagnetic properties of proximity systems
Kresin, Vladimir Z.
1985-07-01
Magnetic screening in the proximity system Sα-Mβ, where Mβ is a normal metal N, semiconductor (semimetal), or a superconductor, is studied. Main attention is paid to the low-temperature region where nonlocality plays an important role. The thermodynamic Green's-function method is employed in order to describe the behavior of the proximity system in an external field. The temperature and thickness dependences of the penetration depth λ are obtained. The dependence λ(T) differs in a striking way from the dependence in usual superconductors. The strong-coupling effect is taken into account. A special case of screening in a superconducting film backed by a size-quantizing semimetal film is considered. The results obtained are in good agreement with experimental data.
Electromagnetic properties of proximity systems
International Nuclear Information System (INIS)
Kresin, V.Z.
1985-01-01
Magnetic screening in the proximity system S/sub α/-M/sub β/, where M/sub β/ is a normal metal N, semiconductor (semimetal), or a superconductor, is studied. Main attention is paid to the low-temperature region where nonlocality plays an important role. The thermodynamic Green's-function method is employed in order to describe the behavior of the proximity system in an external field. The temperature and thickness dependences of the penetration depth lambda are obtained. The dependence lambda(T) differs in a striking way from the dependence in usual superconductors. The strong-coupling effect is taken into account. A special case of screening in a superconducting film backed by a size-quantizing semimetal film is considered. The results obtained are in good agreement with experimental data
Directory of Open Access Journals (Sweden)
David L. Crowe
1999-10-01
Full Text Available Tumor cell invasion of basement membranes is one of the hallmarks of malignant transformation. Tumor cells secrete proteolytic enzymes known as matrix metalloproteinases (MMPs which degrade extracellular matrix molecules. Increased expression of MMP-9 has been associated with acquisition of invasive phenotype in many tumors. However, multiple mechanisms for regulation of MMP-9 gene expression by tumor cell lines have been proposed. A number of transcription factor binding sites have been characterized in the upstream regulatory region of the MMP-9 gene, including those for AP-1. To determine how a specific AP-1 family member, c-fos, regulates MMP-9 promoter activity through these sites, we used an expression vector containing the c-fos coding region fused to the estrogen receptor (ER ligand binding domain. This construct is activated upon binding estradiol. Stable expression of this construct in ER negative squamous cell carcinoma (SCC lines produced an estradiol dependent decrease in the number of cells that migrated through a reconstituted basement membrane. This decreased invasiveness was accompanied by estradiol dependent downregulation of MMP-9 activity as determined by gelatin zymography. Estradiol also produced transcriptional downregulation of an MMP-9 promoter construct in cells transiently transfected with the c-fosER expression vector. This downregulation was mediated by the AP-1 site at —79 by in the MMP-9 promoter. We concluded that the proximal AP-1 site mediated the transcriptional downregulation of the MMP-9 promoter by a conditionally activated c-fos fusion protein.
Directory of Open Access Journals (Sweden)
Sutapa Datta
Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.
Datta, Sutapa; Mukhopadhyay, Subhasis
2013-01-01
An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045
Characterization of the promoter region of the human c-erbB-2 protooncogene
International Nuclear Information System (INIS)
Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.
1987-01-01
Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors
E4orf1 Enhances Glucose Uptake Independent of Proximal Insulin Signaling.
Na, Ha-Na; Hegde, Vijay; Dubuisson, Olga; Dhurandhar, Nikhil V
2016-01-01
Impaired proximal insulin signaling is often present in diabetes. Hence, approaches to enhance glucose disposal independent of proximal insulin signaling are desirable. Evidence indicates that Adenovirus-derived E4orf1 protein may offer such an approach. This study determined if E4orf1 improves insulin sensitivity and downregulates proximal insulin signaling in vivo and enhances cellular glucose uptake independent of proximal insulin signaling in vitro. High fat fed mice were injected with a retrovirus plasmid expressing E4orf1, or a null vector. E4orf1 significantly improved insulin sensitivity in response to a glucose load. Yet, their proximal insulin signaling in fat depots was impaired, as indicated by reduced tyrosine phosphorylation of insulin receptor (IR), and significantly increased abundance of ectonucleotide pyrophosphatase/phosphodiesterase-1 (ENPP1). In 3T3-L1 pre-adipocytes E4orf1 expression impaired proximal insulin signaling. Whereas, treatment with rosiglitazone reduced ENPP1 abundance. Unaffected by IR-KD (insulin receptor knockdown) with siRNA, E4orf1 significantly up-regulated distal insulin signaling pathway and enhanced cellular glucose uptake. In vivo, E4orf1 impairs proximal insulin signaling in fat depots yet improves glycemic control. This is probably explained by the ability of E4orf1 to promote cellular glucose uptake independent of proximal insulin signaling. E4orf1 may provide a therapeutic template to enhance glucose disposal in the presence of impaired proximal insulin signaling.
E4orf1 Enhances Glucose Uptake Independent of Proximal Insulin Signaling.
Directory of Open Access Journals (Sweden)
Ha-Na Na
Full Text Available Impaired proximal insulin signaling is often present in diabetes. Hence, approaches to enhance glucose disposal independent of proximal insulin signaling are desirable. Evidence indicates that Adenovirus-derived E4orf1 protein may offer such an approach. This study determined if E4orf1 improves insulin sensitivity and downregulates proximal insulin signaling in vivo and enhances cellular glucose uptake independent of proximal insulin signaling in vitro. High fat fed mice were injected with a retrovirus plasmid expressing E4orf1, or a null vector. E4orf1 significantly improved insulin sensitivity in response to a glucose load. Yet, their proximal insulin signaling in fat depots was impaired, as indicated by reduced tyrosine phosphorylation of insulin receptor (IR, and significantly increased abundance of ectonucleotide pyrophosphatase/phosphodiesterase-1 (ENPP1. In 3T3-L1 pre-adipocytes E4orf1 expression impaired proximal insulin signaling. Whereas, treatment with rosiglitazone reduced ENPP1 abundance. Unaffected by IR-KD (insulin receptor knockdown with siRNA, E4orf1 significantly up-regulated distal insulin signaling pathway and enhanced cellular glucose uptake. In vivo, E4orf1 impairs proximal insulin signaling in fat depots yet improves glycemic control. This is probably explained by the ability of E4orf1 to promote cellular glucose uptake independent of proximal insulin signaling. E4orf1 may provide a therapeutic template to enhance glucose disposal in the presence of impaired proximal insulin signaling.
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
Energy Technology Data Exchange (ETDEWEB)
Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio
2006-03-01
The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential
Mechanosensitive promoter region in the human HB-GAM gene
DEFF Research Database (Denmark)
Liedert, Astrid; Kassem, Moustapha; Claes, Lutz
2009-01-01
Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...
Ultrasonographic assessment of the proximal digital annular ligament in the equine forelimb
International Nuclear Information System (INIS)
Dik, K.J.; Boroffka, S.; Stolk, P.
1994-01-01
Ultrasonography was used with 6 normal cadaver forelimbs of Dutch Warmblood horses to delineate the ultrasonographic anatomy of the palmar pastern region, with emphasis on the proximal digital annular ligament. Using a 5.5 MHz sector scanner, the thin proximal digital annular ligament was not visible on offset sonograms. Only if the digital sheath in the normal limb was distended was the distal border of this ligament outlined. In all normal limbs the palmarodistal thickness of the combined skin-proximal digital annular ligament layer in the mid-pastern region was 2 mm. The flexor tendons and distal sesamoidean ligaments were easily identified as hyperechoic structures. Distension of the digital sheath in the normal limbs clearly outlined the anechoic digital sheath pouches. In 4 lame horses ultrasonography aided the diagnosis of functional proximal digital annular ligament constriction. In all 4 diseased forelimbs ultrasonography demonstrated thickening of the skin-proximal digital annular ligament layer and distension of the digital sheath. In one of these limbs the distended digital sheath was also thickened. The flexor tendons and distal sesamoidean ligaments were normal. There was no radiographic evidence of additional bone or joint lesions
Ultrasonographic assessment of the proximal digital annular ligament in the equine forelimb.
Dik, K J; Boroffka, S; Stolk, P
1994-01-01
Ultrasonography was used with 6 normal cadaver forelimbs of Dutch Warmblood horses to delineate the ultrasonographic anatomy of the palmar pastern region, with emphasis on the proximal digital annular ligament. Using a 5.5 MHz sector scanner, the thin proximal digital annular ligament was not visible on offset sonograms. Only if the digital sheath in the normal limb was distended was the distal border of this ligament outlined. In all normal limbs the palmarodistal thickness of the combined skin-proximal digital annular ligament layer in the mid-pastern region was 2 mm. The flexor tendons and distal sesamoidean ligaments were easily identified as hyperechoic structures. Distension of the digital sheath in the normal limbs clearly outlined the anechoic digital sheath pouches. In 4 lame horses ultrasonography aided the diagnosis of functional proximal digital annular ligament constriction. In all 4 diseased forelimbs ultrasonography demonstrated thickening of the skin-proximal digital annular ligament layer and distension of the digital sheath. In one of these limbs the distended digital sheath was also thickened. The flexor tendons and distal sesamoidean ligaments were normal. There was no radiographic evidence of additional bone or joint lesions.
von Thiele Schwarz, Ulrica; Augustsson, Hanna; Hasson, Henna; Stenfors-Hayes, Terese
2015-02-01
To test the effects of integrating health protection and health promotion with a continuous improvement system (Kaizen) on proximal employee outcomes (health promotion, integration, and Kaizen) and distal outcomes (workability, productivity, self-rated health and self-rated sickness absence). Twelve units in a county hospital in Sweden were randomized to control or intervention groups using a quasiexperimental study design. All staff (approximately 500) provided self-ratings in questionnaires at baseline, and a 12- and 24-month follow-up (response rate, 79% to 87.5%). There was a significant increase in the proximal outcomes over time in the intervention group compared with the control group, and a trend toward improvement in the distal outcomes workability and productivity. Integration seems to promote staff engagement in health protection and promotion, as well as to improve their understanding of the link between work and health.
Directory of Open Access Journals (Sweden)
Dina A Moustafa
Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.
Directory of Open Access Journals (Sweden)
Sun JX
2014-05-01
Full Text Available Jingxu Sun,1,* Yongxi Song,1,* Zhenning Wang,1 Guoli Wang,2 Peng Gao,1 Xiaowan Chen,1 Zhaohua Gao,1 Huimian Xu1 1Department of Surgical Oncology and General Surgery, First Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Biochemistry and Molecular Biology, China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: MicroRNAs are associated with tumor genesis and progression in various carcinomas. MicroRNA-148a (miR-148a was reported to have low expression in gastrointestinal cancers, and might be regulated by promoter region DNA methylation. Methods: Bisulfite-modified sequencing was used to determine the promoter region DNA methylation status of human gastrointestinal cancer cell lines. Expression levels of miR-148a in cell lines treated with 5-aza-2′-deoxycytidine were determined by quantitative real-time polymerase chain reaction. Total DNA was extracted from the tissues of 64 patients with gastric cancer and 51 patients with colorectal cancer. Methylation status was determined by methylation-specific polymerase chain reaction. All statistical analyses were performed with SPSS 17.0 software. Results: The promoter regions of genes in human gastrointestinal cancer cell lines were all hypermethylated, except for HT-29, and the expression of miR-148a tended to be higher than in controls after treatment with 5-aza-2′-deoxycytidine. The methylation-specific polymerase chain reaction results showed that 56.25% of gastric cancer tissues and 19.61% of colorectal cancer tissues were hypermethylated. A strong correlation was found between the expression of miR-148a and the methylation status of promoter regions (P<0.001, chi-square test and Pearson’s correlation. Furthermore, promoter region CpG site hypermethylation of miR-148a was correlated with increased tumor size (P=0.01 in gastric cancer after analyzing the correlation between
Directory of Open Access Journals (Sweden)
Ansaya Thonpho
Full Text Available Pyruvate carboxylase (PC is an enzyme that plays a crucial role in many biosynthetic pathways in various tissues including glucose-stimulated insulin secretion. In the present study, we identify promoter usage of the human PC gene in pancreatic beta cells. The data show that in the human, two alternative promoters, proximal and distal, are responsible for the production of multiple mRNA isoforms as in the rat and mouse. RT-PCR analysis performed with cDNA prepared from human liver and islets showed that the distal promoter, but not the proximal promoter, of the human PC gene is active in pancreatic beta cells. A 1108 bp fragment of the human PC distal promoter was cloned and analyzed. It contains no TATA box but possesses two CCAAT boxes, and other putative transcription factor binding sites, similar to those of the distal promoter of rat PC gene. To localize the positive regulatory region in the human PC distal promoter, 5'-truncated and the 25-bp and 15-bp internal deletion mutants of the human PC distal promoter were generated and used in transient transfections in INS-1 832/13 insulinoma and HEK293T (kidney cell lines. The results indicated that positions -340 to -315 of the human PC distal promoter serve as (an activator element(s for cell-specific transcription factor, while the CCAAT box at -71/-67, a binding site for nuclear factor Y (NF-Y, as well as a GC box at -54/-39 of the human PC distal promoter act as activator sequences for basal transcription.
Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze
Directory of Open Access Journals (Sweden)
Bekier-Jaworska Ewa
2015-03-01
Full Text Available Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and methods. Studies were conducted on a group of students studying tourism and recreation at State Higher School of Vocational Education (PWSZ in Zamość using a questionnaire. Results. The questionnaire provided an assessment of the levels of knowledge of regional cuisine among Polish and Ukrainian students, identified the most characteristic dishes and selected brand products, and helped to arrive at a suitable method of promotion. Conclusions. Nationality, family customs and selection of local restaurants highly influence knowledge of regional cuisine. Interviewees decided that the most outstanding products from Roztocze were Zwierzyniec beer, and Biłgoraj pie. Regional products should be used as a tourist attraction in Roztocze.
Identification of functional DNA variants in the constitutive promoter region of MDM2
Directory of Open Access Journals (Sweden)
Lalonde Marie-Eve
2012-09-01
Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.
Diercks, Ron L.; Bain, Gregory; Itoi, Eiji; Di Giacomo, Giovanni; Sugaya, Hiroyuki
2015-01-01
This chapter describes the bony structures of the proximal humerus. The proximal humerus is often regarded as consisting of four parts, which assists in understanding function and, more specially, describes the essential parts in reconstruction after fracture or in joint replacement. These are the
International Nuclear Information System (INIS)
Thach, R.E.; Lawson, T.G.; Lee, K.A.; Abramson, R.D.; Merrick, W.C.
1987-01-01
Ray, et al. demonstrated that the susceptibility of mRNAs to cleavage by ribonucleases is greatly increased by eIF-4A and eIF-4F in an ATP-dependent reaction, and that this reaction is enhanced by the presence of eIF-4B. They now report direct evidence for the dissociation of helical regions at the 5' ends of mRNAs by these factors. Helices were generated at the 5' ends of reovirus and rabbit globin mRNAs by hybridizing to them 32 P-labeled cDNA pentadecamers. The dissociation of the cDNAs from the mRNAs was monitored by Sephadex gel filtration. Addition of eIF-4F to hybrids caused the dissociation of small amounts of cDNAs, and this dissociation required ATP. Addition of eIF-4B stimulated this activity. Neither eIF-4B nor eIF-4A alone caused significant ATP-dependent dissociation, but they did so in combination. Interestingly, cDNAs that were hybridized to 5' distal regions were dissociated with efficiencies and rates similar to those of 5' proximal cDNAs. The presence of unlabelled cDNAs hybridized 5' proximally did not affect distal cDNA dissociation. These results confirm the earlier suggestion that eIF-4A, eIF-4B and eIF-4F play important roles in the disruption of mRNA secondary structure during initiation
Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado
2016-02-09
Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning
High-throughput determination of RNA structure by proximity ligation.
Ramani, Vijay; Qiu, Ruolan; Shendure, Jay
2015-09-01
We present an unbiased method to globally resolve RNA structures through pairwise contact measurements between interacting regions. RNA proximity ligation (RPL) uses proximity ligation of native RNA followed by deep sequencing to yield chimeric reads with ligation junctions in the vicinity of structurally proximate bases. We apply RPL in both baker's yeast (Saccharomyces cerevisiae) and human cells and generate contact probability maps for ribosomal and other abundant RNAs, including yeast snoRNAs, the RNA subunit of the signal recognition particle and the yeast U2 spliceosomal RNA homolog. RPL measurements correlate with established secondary structures for these RNA molecules, including stem-loop structures and long-range pseudoknots. We anticipate that RPL will complement the current repertoire of computational and experimental approaches in enabling the high-throughput determination of secondary and tertiary RNA structures.
Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei
2009-01-01
A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.
Genome-wide function of H2B ubiquitylation in promoter and genic regions.
Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin
2011-11-01
Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).
Novel Biosensor of Membrane Protein Proximity Based on Fluorogen Activated Proteins.
Vasilev, Kalin V; Gallo, Eugenio; Shank, Nathaniel; Jarvik, Jonathan W
2016-01-01
We describe a novel biosensor system for reporting proximity between cell surface proteins in live cultured cells. The biosensor takes advantage of recently developed fluorogen-activating proteins (FAPs) that display fluorescence only when bound to otherwise-nonfluorescent fluorogen molecules. To demonstrate feasibility for the approach, two recombinant rapamycin-binding proteins were expressed as single-pass plasma membrane proteins in HeLa cells; one of the proteins (scAvd- FRB) carried an extracellular avidin tag; the other (HL1-TO1-FKBP) carried an extracellular FAP. Cells were incubated with a membrane-impermeable bivalent ligand (biotin-PEG2000-DIR) consisting of biotin joined to a dimethyl-indole red (DIR) fluorogen by a polyethylene glycol linker, thus tethering the fluorogen to the scAvd-FRB fusion protein. Addition of rapamycin, which promotes FKBP-FRB dimerization and thereby brings the FAP in close proximity to the tethered fluorogen, led to a significant increase in DIR fluorescence. We call the new proximity assay TEFLA, for tethered fluorogen assay.
Guo, Lei; Rhen, Turk
2017-10-01
Sex is determined by temperature during embryogenesis in snapping turtles, Chelydra serpentina. Previous studies in this species show that dihydrotestosterone (DHT) induces ovarian development at temperatures that normally produce males or mixed sex ratios. The feminizing effect of DHT is associated with increased expression of FoxL2, suggesting that androgens regulate transcription of FoxL2. To test this hypothesis, we cloned the proximal promoter (1.6kb) and coding sequence for snapping turtle FoxL2 (tFoxL2) in frame with mCherry to produce a fluorescent reporter. The tFoxL2-mCherry fusion plasmid or mCherry control plasmid were stably transfected into mouse KK1 granulosa cells. These cells were then treated with 0, 1, 10, or 100nM DHT to assess androgen effects on tFoxL2-mCherry expression. In contrast to the main hypothesis, DHT did not alter expression of the tFoxL2-mCherry reporter. However, normal serum increased expression of tFoxL2-mCherry when compared to charcoal-stripped serum, indicating that the cloned region of tFoxL2 contains cis regulatory elements. We also used the tFoxL2-mCherry plasmid as an expression vector to test the hypothesis that DHT and tFoxL2 interact to regulate expression of endogenous genes in granulosa cells. While tFoxL2-mCherry and DHT had independent effects on mouse FoxL2, FshR, GnRHR, and StAR expression, tFoxL2-mCherry potentiated low concentration DHT effects on mouse aromatase expression. Further studies will be required to determine whether synergistic regulation of aromatase by DHT and FoxL2 also occurs in turtle gonads during the sex-determining period, which would explain the feminizing effect of DHT in this species. Copyright © 2017 Elsevier Inc. All rights reserved.
The promotion of regional integration of electricity markets: Lessons for developing countries
International Nuclear Information System (INIS)
Oseni, Musiliu O.; Pollitt, Michael G.
2016-01-01
This paper focuses on how to promote regional cooperation in electricity. We begin by discussing the theory of international trade cooperation in electricity, with a view to discussing what preconditions might be important in facilitating wide area trading across national borders. We then develop lessons based on the comparison of four case studies. These include three regional developing country power pools – the Southern African Power pool (SAPP), West African Power pool (WAPP) and the Central American Power Market (MER). We contrast these with Northern Europe's Nord Pool. These cases highlight both the potential and difficulty of having cross-jurisdictional power pools. In the light of the theory and evidence we present, we draw key lessons in the areas of: preconditions for trading; necessary institutional arrangements; practicalities of timetabling; reasons to be hopeful about future prospects. - Highlights: • This paper focuses on how to promote regional electricity cooperation. • We develop lessons based on comparison of four international case studies. • The cases highlight both the potential and difficulty of power pools. • We identify preconditions, institutional arrangements and timetabling. • We conclude that the future prospects for regional power pools are good.
DGCR6 at the proximal part of the DiGeorge critical region is involved in conotruncal heart defects
Gao, Wenming; Higaki, Takashi; Eguchi-Ishimae, Minenori; Iwabuki, Hidehiko; Wu, Zhouying; Yamamoto, Eiichi; Takata, Hidemi; Ohta, Masaaki; Imoto, Issei; Ishii, Eiichi; Eguchi, Mariko
2015-01-01
Cardiac anomaly is one of the hallmarks of DiGeorge syndrome (DGS), observed in approximately 80% of patients. It often shows a characteristic morphology, termed as conotruncal heart defects. In many cases showing only the conotruncal heart defect, deletion of 22q11.2 region cannot be detected by fluorescence in situ hybridization (FISH), which is used to detect deletion in DGS. We investigated the presence of genomic aberrations in six patients with congenital conotruncal heart defects, who show no deletion at 22q11.2 in an initial screening by FISH. In these patients, no abnormalities were identified in the coding region of the TBX1 gene, one of the key genes responsible for the phenotype of DGS. However, when copy number alteration was analyzed by high-resolution array analysis, a small deletion or duplication in the proximal end of DiGeorge critical region was detected in two patients. The affected region contains the DGCR6 and PRODH genes. DGCR6 has been reported to affect the expression of the TBX1 gene. Our results suggest that altered dosage of gene(s) other than TBX1, possibly DGCR6, may also be responsible for the development of conotruncal heart defects observed in patients with DGS and, in particular, in those with stand-alone conotruncal heart defects. PMID:27081520
Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.
Ogino; Itakura; Kato; Aoki; Sato
1999-07-01
: Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but
International Nuclear Information System (INIS)
Cui Wei; Yin Lingling; Dong Lingyue
2012-01-01
Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)
DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.
Directory of Open Access Journals (Sweden)
Mads Dyrvig
Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.
Congenital anomalies and proximity to landfill sites.
LENUS (Irish Health Repository)
Boyle, E
2004-01-01
The occurrence of congenital anomalies in proximity to municipal landfill sites in the Eastern Region (counties Dublin, Kildare, Wicklow) was examined by small area (district electoral division), distance and clustering tendancies in relation to 83 landfills, five of which were major sites. The study included 2136 cases of congenital anomaly, 37,487 births and 1423 controls between 1986 and 1990. For the more populous areas of the region 50% of the population lived within 2-3 km of a landfill and within 4-5 km for more rural areas. In the area-level analysis, the standardised prevalence ratios, empirical and full Bayesian modelling, and Kulldorff\\'s spatial scan statistic found no association between the residential area of cases and location of landfills. In the case control analysis, the mean distance of cases and controls from the nearest landfill was similar. The odds ratios of cases compared to controls for increasing distances from all landfills and major landfills showed no significant difference from the baseline value of 1. The kernel and K methods showed no tendency of cases to cluster in relationship to landfills. In conclusion, congenital anomalies were not found to occur more commonly in proximity to municipal landfills.
A study of the frequency of methylation of gene promoter regions in ...
Indian Academy of Sciences (India)
2013-04-02
Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.
A-type nuclear lamins act as transcriptional repressors when targeted to promoters
International Nuclear Information System (INIS)
Lee, Damian C.; Welton, K. Linnea; Smith, Erica D.; Kennedy, Brian K.
2009-01-01
Regions of heterochromatin are often found at the periphery of the mammalian nucleus, juxtaposed to the nuclear lamina. Genes in these regions are likely maintained in a transcriptionally silent state, although other locations at the nuclear periphery associated with nuclear pores are sites of active transcription. As primary components of the nuclear lamina, A- and B-type nuclear lamins are intermediate filament proteins that interact with DNA, histones and known transcriptional repressors, leading to speculation that they may promote establishment of repressive domains. However, no direct evidence of a role for nuclear lamins in transcriptional repression has been reported. Here we find that human lamin A, when expressed in yeast and cultured human cells as a fusion protein to the Gal4 DNA-binding domain (DBD), can mediate robust transcriptional repression of promoters with Gal4 binding sites. Full repression by lamin A requires both the coiled-coil rod domain and the C-terminal tail domain. In human cells, other intermediate filament proteins such as lamin B and vimentin are unable to confer robust repression as Gal4-DBD fusions, indicating that this property is specific to A-type nuclear lamins. These findings indicate that A-type lamins can promote transcriptional repression when in proximity of a promoter
Zhang, Weimin; Lu, Huijie; Jiang, Haiyan; Li, Mu; Zhang, Shen; Liu, Qiongyou; Zhang, Lihong
2012-02-01
Aromatase (CYP19A1) catalyzes the conversion of androgens to estrogens. In teleosts, duplicated copies of cyp19a1 genes, namely cyp19a1a and cyp19a1b, were identified, however, the transcriptional regulation of these two genes remains poorly understood. In the present study, the 5'-flanking regions of the orange-spotted grouper cyp19a1a (gcyp19a1a) and cyp19a1b (gcyp19a1b) genes were isolated and characterized. The proximal promoter regions of both genes were relatively conserved when compared to those of the other teleosts. Notably, a conserved FOXO transcriptional factor binding site was firstly reported in the proximal promoter of gcyp19a1a, and deletion of the region (-112 to -60) containing this site significantly decreased the promoter activities. The deletion of the region (-246 to -112) containing the two conserved FTZ-F1 sites also dramatically decreased the transcriptional activities of gcyp19a1a promoter, and both two FTZ-F1 sites were shown to be stimulatory cis-acting elements. A FTZ-F1 homologue isolated from ricefield eel (eFTZ-F1) up-regulated gcyp19a1a promoter activities possibly via the FTZ-F1 sites, however, a previously identified orange-spotted grouper FTZ-F1 homologue (gFTZ-F1) did not activate the transcription of gcyp19a1a promoter unexpectedly. As to gcyp19a1b promoter, all the deletion constructs did not show good promoter activities in either TM4 or U251-MG cells. Estradiol (100nM) up-regulated gcyp19a1b promoter activities by about 13- and 36-fold in TM4 and U251-MG cells, respectively, via the conserved ERE motif, but did not stimulate gcyp19a1a promoter activities. These results are helpful to further elucidate the regulatory mechanisms of cyp19a1a and cyp19a1b expression in the orange-spotted grouper as well as other teleosts. Copyright © 2011 Elsevier Inc. All rights reserved.
Wang, Yajun; Dong, Qing; Ding, Zhaolan; Gai, Kexin; Han, Xiaoyun; Kaleri, Farah Naz; He, Qun; Wang, Ying
2016-10-01
Catalase-3 (CAT-3) constitutes the main catalase activity in growing hyphae of Neurospora crassa, and its activity increases during exponential growth or is induced under different stress conditions. Although extensive progress has been made to identify catalase regulators, the regulation mechanism of CAT-3 at the chromatin level still remains unclear. Here, we aim at investigating the molecular regulation mechanisms of cat-3 at the chromatin level. We found that CAT-3 protein levels increased in mutants defective in proper global heterochromatin formation. Bioinformatics analysis identified a 5-kb AT-rich sequence adjacent to the cat-3 promoter as a heterochromatin region because of its enrichment of H3K9me3 and HP1. Expression of CAT-3 was induced by H 2 O 2 treatment in wild-type and such change occurred along with the accumulation of histone H3 acetylation at 5-kb heterochromatin boundaries and cat-3 locus, but without alteration of its H3K9me3 repressive modification. Moreover, disruption of 5-kb heterochromatin region results in elevated cat-3 expression, and higher levels of cat-3 expression were promoted by the combination with global heterochromatin defective mutants. Interestingly, the molecular weight and activity bands of CAT-3 protein are different in heterochromatin defective mutants compared with those in wild-type, suggesting that its N-terminal processing and modification may be altered. Our study indicates that the local chromatin structure creates a heterochromatin repressive environment to repress nearby gene expression. Copyright © 2016 Elsevier Inc. All rights reserved.
Functional analysis of human and chimpanzee promoters.
Heissig, Florian; Krause, Johannes; Bryk, Jaroslaw; Khaitovich, Philipp; Enard, Wolfgang; Pääbo, Svante
2005-01-01
It has long been argued that changes in gene expression may provide an additional and crucial perspective on the evolutionary differences between humans and chimpanzees. To investigate how often expression differences seen in tissues are caused by sequence differences in the proximal promoters, we tested the expression activity in cultured cells of human and chimpanzee promoters from genes that differ in mRNA expression between human and chimpanzee tissues. Twelve promoters for which the corresponding gene had been shown to be differentially expressed between humans and chimpanzees in liver or brain were tested. Seven showed a significant difference in activity between the human promoter and the orthologous chimpanzee promoter in at least one of the two cell lines used. However, only three of them showed a difference in the same direction as in the tissues. Differences in proximal promoter activity are likely to be common between humans and chimpanzees, but are not linked in a simple fashion to gene-expression levels in tissues. This suggests that several genetic differences between humans and chimpanzees might be responsible for a single expression difference and thus that relevant expression differences between humans and chimpanzees will be difficult to predict from cell culture experiments or DNA sequences.
Directory of Open Access Journals (Sweden)
Minghua Xu
2014-01-01
Full Text Available We consider the problem of seeking a symmetric positive semidefinite matrix in a closed convex set to approximate a given matrix. This problem may arise in several areas of numerical linear algebra or come from finance industry or statistics and thus has many applications. For solving this class of matrix optimization problems, many methods have been proposed in the literature. The proximal alternating direction method is one of those methods which can be easily applied to solve these matrix optimization problems. Generally, the proximal parameters of the proximal alternating direction method are greater than zero. In this paper, we conclude that the restriction on the proximal parameters can be relaxed for solving this kind of matrix optimization problems. Numerical experiments also show that the proximal alternating direction method with the relaxed proximal parameters is convergent and generally has a better performance than the classical proximal alternating direction method.
Role of regional policies in promoting networking and innovation activity of firms
Kirsi Mukkala; Jari Ritsilä
2004-01-01
The success of firms and regions is increasingly defined by their innovation and learning capabilities. It has been emphasized in several studies that a local operational environment may have a positive impact on innovation activity of firms. From policy point of view, the relationship between firms and their local environment is an important research topic. The purpose of this paper is to explore whether there is a demand for regional policy makers in promoting innovative and networking acti...
Directory of Open Access Journals (Sweden)
Kun-Jhih Lin
2014-01-01
Full Text Available Adequately shaped femoral plate is critical for the fixation of fracture in the pertrochanteric regions. Lateral aspect of greater trochanter is an important region where the proximal femoral plate anchored. However, little is known regarding the morphology of greater trochanter. The objective of this study was to measure main dimensions of greater trochanter and other regions in the proximal end of the femur to provide an anatomical basis for the design of the proximal femoral plate. Anthropometric data on the proximal femur were performed utilizing three-dimensional computational modeling. Computed tomography images of healthy femurs in 53 women and 47 men were contributed to three-dimensional femur modeling. All data were compared between male and female femora. The results showed that mean values for male group were found to be greater in most of measured femoral dimensions. Oppositely, females demonstrated higher neck-shaft angle on anteroposterior view and femoral anteversion angle. The anthropometric data can be used for the anatomical shape design of femoral plates for osteosynthesis of fractures in the trochanteric regions. A distinct plate design may be necessary to accommodate differences between the genders.
Luminal uptake and intracellular transport of insulin in renal proximal tubules
International Nuclear Information System (INIS)
Hellfritzsch, M.; Christensen, E.I.; Sonne, O.
1986-01-01
It is generally accepted that proteins taken up from the renal tubular fluid are transported into lysosomes in proximal tubule cells. Recently, however, it has been postulated that insulin in isolated perfused rat kidneys did not accumulate in lysosomes but to a certain degree in the Golgi region. The present study was undertaken to investigate the intracellular handling of biologically unaltered insulin in rat renal proximal tubule cells. Rats were prepared for in vivo micropuncture and either a colloidal gold insulin complex or insulin monoiodinated in the A-14 position ( 125 I-insulin) was microinfused into proximal tubules. After 5, 10, 25 or 60 min the tubules were fixed by microinfusion of glutaraldehyde and processed for electron microscopy or electron microscope autoradiography. A qualitative analysis of tubules infused with colloidal gold insulin or 125 I-insulin showed that insulin was taken up by endocytosis and transported to lysosomes, and a quantitative autoradiographic analysis of the 125 I-insulin microinfused tubules showed that the grain density after five min was significantly increased for endocytic vacuoles and for lysosomes. After 60 min the grain density was still significant over lysosomes. The accumulation of grains was non-significant over all other areas analyzed at any time. This study shows that insulin is taken up from the luminal side of the proximal tubule by endocytosis and transported to the lysosomes. There was no significant transport to the Golgi region
DEFF Research Database (Denmark)
Jensen, Anne
Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...
Tamarkin-Ben-Harush, Ana; Vasseur, Jean-Jacques; Debart, Françoise; Ulitsky, Igor; Dikstein, Rivka
2017-02-08
Transcription start-site (TSS) selection and alternative promoter (AP) usage contribute to gene expression complexity but little is known about their impact on translation. Here we performed TSS mapping of the translatome following energy stress. Assessing the contribution of cap-proximal TSS nucleotides, we found dramatic effect on translation only upon stress. As eIF4E levels were reduced, we determined its binding to capped-RNAs with different initiating nucleotides and found the lowest affinity to 5'cytidine in correlation with the translational stress-response. In addition, the number of differentially translated APs was elevated following stress. These include novel glucose starvation-induced downstream transcripts for the translation regulators eIF4A and Pabp, which are also translationally-induced despite general translational inhibition. The resultant eIF4A protein is N-terminally truncated and acts as eIF4A inhibitor. The induced Pabp isoform has shorter 5'UTR removing an auto-inhibitory element. Our findings uncovered several levels of coordination of transcription and translation responses to energy stress.
Directory of Open Access Journals (Sweden)
Tan TJL
2015-11-01
Full Text Available Stress fractures of the proximal tibia metaphysis are rare in the elderly. We present a case of a 65-year old male who developed sequential proximal tibia stress fractures associated with prolonged usage of methotrexate and prednisolone within a span of 18 months. Magnetic Resonance Imaging revealed an incomplete stress fracture involving the medial proximal tibial region. The patient was treated with stemmed total knee arthroplasty (TKA bilaterally. Stress fractures should be considered in patients with atypical knee pain who have a history of methotrexate and prednisolone usage. TKA is an effective treatment in stress fractures of the proximal tibia.
Additional protocols and regional cooperation on peaceful uses of nuclear energy in northeast Asia
Energy Technology Data Exchange (ETDEWEB)
Choe, Kwan Kyoo [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)
2004-07-01
The main object of this article is to clarify the relations between the implementation of the Protocols Additional to Safeguards Agreement (hereinafter referred to as the Additional Protocols) and the feasibility of the regional cooperation on peaceful uses of nuclear energy in Northeast Asia (NEA). The regionalism has a strong tendency to be based in advance on regional cooperation. The regionalism has three main structural elements in its definition: geographical proximity, cultural resemblance, and cooperative attitudes among all the countries concerned. The Additional Protocols allow the IAEA to access to more detailed information and nuclear activities of a State party. The aspect that the Additional Protocols could increase the nuclear transparency will result in ultimately promoting the confidence among the regional nations concerned.
Proximity credentials: A survey
International Nuclear Information System (INIS)
Wright, L.J.
1987-04-01
Credentials as a means of identifying individuals have traditionally been a photo badge and more recently, the coded credential. Another type of badge, the proximity credential, is making inroads in the personnel identification field. This badge can be read from a distance instead of being veiewed by a guard or inserted into a reading device. This report reviews proximity credentials, identifies the companies marketing or developing proximity credentials, and describes their respective credentials. 3 tabs
Enhancement of RNA synthesis by promoter duplication in tombusviruses
International Nuclear Information System (INIS)
Panavas, T.; Panaviene, Z.; Pogany, J.; Nagy, P.D.
2003-01-01
Replication of tombusviruses, small plus-strand RNA viruses of plants, is regulated by cis-acting elements present in the viral RNA. The role of cis-acting elements can be studied in vitro by using a partially purified RNA-dependent RNA polymerase (RdRp) preparation obtained from tombusvirus-infected plants , Virology 276, 279- 288). Here, we demonstrate that the minus-strand RNA of tombusviruses contains, in addition to the 3'-terminal minimal plus-strand initiation promoter, a second cis-acting element, termed the promoter proximal enhancer (PPE). The PPE element enhanced RNA synthesis by almost threefold from the adjacent minimal promoter in the in vitro assay. The sequence of the PPE element is 70% similar to the minimal promoter, suggesting that sequence duplication of the minimal promoter may have been the mechanism leading to the generation of the PPE. Consistent with this proposal, replacement of the PPE element with the minimal promoter, which resulted in a perfectly duplicated promoter region, preserved its enhancer-like function. In contrast, mutagenesis of the PPE element or its replacement with an artificial G/C-rich sequence abolished its stimulative effect on initiation of RNA synthesis in vitro. In vivo experiments are also consistent with the role of the PPE element in enhancement of tombusvirus replication. Sequence comparison of several tombusviruses and related carmoviruses further supports the finding that duplication of minimal promoter sequences may have been an important mechanism during the evolution of cis-acting elements in tombusviruses and related RNA viruses
Directory of Open Access Journals (Sweden)
Meritxell Granell
2017-06-01
Full Text Available Long tail fibers of bacteriophage T4 are formed by proteins gp34, gp35, gp36, and gp37, with gp34 located at the phage-proximal end and gp37 at the phage-distal, receptor-binding end. We have solved the structure of the carboxy-terminal region of gp34, consisting of amino acids 894–1289, by single-wavelength anomalous diffraction and extended the structure to amino acids 744–1289 using data collected from crystals containing longer gp34-fragments. The structure reveals three repeats of a mixed α-β fibrous domain in residues 744 to 877. A triple-helical neck connects to an extended triple β-helix domain (amino acids 900–1127 punctuated by two β-prism domains. Next, a β-prism domain decorated with short helices and extended β-helices is present (residues 1146–1238, while the C-terminal end is capped with another short β-helical region and three β-hairpins. The structure provides insight into the stability of the fibrous gp34 protein.
Nucleopolis for promoting the nuclear excellence of the Normandy region
International Nuclear Information System (INIS)
2016-01-01
Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)
Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration
Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu
2015-01-01
Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832
the impact of proximity to urban center on crop production choice
African Journals Online (AJOL)
Rahel
of the Amhara Regional State in 2006, it has been found that proximity to ... at Department for Agricultural Economics and Rural Development, University of .... major factors for this is believed to be a poorly developed transport network and.
Directory of Open Access Journals (Sweden)
Susanne Helm
Full Text Available During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE. Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
Governmental promotion of the Information Society in the Spanish Region of Valencia
Directory of Open Access Journals (Sweden)
Emilio Feliu-García, Ph.D.
2011-01-01
Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.
Directory of Open Access Journals (Sweden)
Yvonne Leung
Full Text Available Slow cycling is a common feature shared among several stem cells (SCs identified in adult tissues including hair follicle and cornea. Recently, existence of unipotent SCs in basal and lumenal layers of sweat gland (SG has been described and label retaining cells (LRCs have also been localized in SGs; however, whether these LRCs possess SCs characteristic has not been investigated further. Here, we used a H2BGFP LRCs system for in vivo detection of infrequently dividing cells. This system allowed us to specifically localize and isolate SCs with label-retention and myoepithelial characteristics restricted to the SG proximal acinar region. Using an alternative genetic approach, we demonstrated that SG LRCs expressed keratin 15 (K15 in the acinar region and lineage tracing determined that K15 labeled cells contributed long term to the SG structure but not to epidermal homeostasis. Surprisingly, wound healing experiments did not activate proximal acinar SG cells to participate in epidermal healing. Instead, predominantly non-LRCs in the SG duct actively divided, whereas the majority of SG LRCs remained quiescent. However, when we further challenged the system under more favorable isolated wound healing conditions, we were able to trigger normally quiescent acinar LRCs to trans-differentiate into the epidermis and adopt its long term fate. In addition, dissociated SG cells were able to regenerate SGs and, surprisingly, hair follicles demonstrating their in vivo plasticity. By determining the gene expression profile of isolated SG LRCs and non-LRCs in vivo, we identified several Bone Morphogenetic Protein (BMP pathway genes to be up-regulated and confirmed a functional requirement for BMP receptor 1A (BMPR1A-mediated signaling in SG formation. Our data highlight the existence of SG stem cells (SGSCs and their primary importance in SG homeostasis. It also emphasizes SGSCs as an alternative source of cells in wound healing and their plasticity for
A proximal point algorithm with generalized proximal distances to BEPs
Bento, G. C.; Neto, J. X. Cruz; Lopes, J. O.; Soares Jr, P. A.; Soubeyran, A.
2014-01-01
We consider a bilevel problem involving two monotone equilibrium bifunctions and we show that this problem can be solved by a proximal point method with generalized proximal distances. We propose a framework for the convergence analysis of the sequences generated by the algorithm. This class of problems is very interesting because it covers mathematical programs and optimization problems under equilibrium constraints. As an application, we consider the problem of the stability and change dyna...
Proximal-type epithelioid sarcoma - Case report Sarcoma epitelióide tipo proximal - Relato de caso
Directory of Open Access Journals (Sweden)
Luciana Mendes dos Santos
2013-06-01
Full Text Available Epithelioid sarcoma, first described by Enzinger in 1970, is a rare soft-tissue sarcoma typically presenting as a subcutaneous or deep dermal mass in distal portions of the extremities of adolescents and young adults. In 1997, Guillou et al. described a different type of epithelioid sarcoma, called proximal-type epithelioid sarcoma, which is found mostly in the pelvic and perineal regions and genital tracts of young to middle-aged adults. It is characterized by a proliferation of epithelioid-like cells with rhabdoid features and the absence of a granuloma-like pattern. In this paper we present a case of proximal-type epithelioid sarcoma with an aggressive clinical course, including distant metastasis and death nine months after diagnosis.O sarcoma epitelióide, primeiramente descrito por Enzinger, em 1970, é uma neoplasia de partes moles que ocorre principalmente nas extremidades distais de adolescentes e adultos jovens. Em 1997, Guillou e cols. descreveram um tipo diferente de sarcoma epitelióide, que afetava frequentemente a região pélvica, períneo e áreas genitais de pacientes de média idade, com exame histológico caracterizado pela proliferação de células com aspecto epitelióide. Neste trabalho, descreve-se caso de paciente que apresentava há três meses duas lesões na região glútea, cujo exame histológico confirmou diagnóstico de sarcoma epitelioide do tipo proximal, já com presença de metástases pulmonares e cerebrais e que foi a óbito nove meses após o diagnóstico.
Case report A Rare Cause of Sub-Acute Proximal Intestinal ...
African Journals Online (AJOL)
KIGZ
A Rare Cause of Sub-Acute Proximal Intestinal Obstruction Due to Annular Pancreas. Weledji EP, Ngowe M, Mokake M. Department of Surgery, Regional Hospital Buea, Cameroon. Correspondence to: E P Weledji, P.O Box 126, Limbe, Cameroon. Email:elroypat@yahoo.co.uk. Summary. Background: Annular pancreas is a ...
Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z
2016-10-01
The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.
Adult and Child Development in the Zone of Proximal Development: Socratic Dialogue in a Playworld
Ferholt, Beth; Lecusay, Robert
2010-01-01
This article analyses adult and child development in the zone of proximal development in an educational practice based in Vygotsky's theories of play: the playworld educational practice. The playworld educational practice is a central component of a Scandinavian play pedagogy that promotes shared responsibility amongst adults and children for…
Hereditary motor and sensory neuropathy with proximal predominance (HMSN-P).
Campellone, Joseph V
2013-06-01
Hereditary motor and sensory neuropathy with proximal predominance (HMSN-P) is a rare disorder inherited in an autosomal dominant fashion. Patients present with slowly progressive proximal-predominant weakness, painful muscle cramps, fasciculations, large-fiber sensory loss, and areflexia. Electrodiagnostic (EDX) studies typically reveal abnormalities consistent with a sensorimotor neuronopathy. A patient with HMSN-P underwent EDX studies, revealing ongoing and chronic neurogenic denervation, motor unit instability, and neuromyotonic discharges, further defining the spectrum of EDX findings in HMSN-P. The clinical, pathological, and genetic features are also reviewed. The appearance of HMSN-P in the United States and elsewhere calls for clinicians in nonendemic regions to be familiar with this rare disorder, which has typically been geographically confined.
[Augmentation technique on the proximal humerus].
Scola, A; Gebhard, F; Röderer, G
2015-09-01
The treatment of osteoporotic fractures is still a challenge. The advantages of augmentation with respect to primary in vitro stability and the clinical use for the proximal humerus are presented in this article. In this study six paired human humeri were randomized into an augmented and a non-augmented group. Osteosynthesis was performed with a PHILOS plate (Synthes®). In the augmented group the two screws finding purchase in the weakest cancellous bone were augmented. The specimens were tested in a 3-part fracture model in a varus bending test. The augmented PHILOS plates withstood significantly more load cycles until failure. The correlation to bone mineral density (BMD) showed that augmentation could partially compensate for low BMD. The augmentation of the screws in locked plating in a proximal humerus fracture model is effective in improving the primary stability in a cyclic varus bending test. The targeted augmentation of two particular screws in a region of low bone quality within the humeral head was almost as effective as four screws with twice the amount of bone cement. Screw augmentation combined with a knowledge of the local bone quality could be more effective in enhancing the primary stability of a proximal humerus locking plate because the effect of augmentation can be exploited more effectively limiting it to the degree required. The technique of augmentation is simple and can be applied in open and minimally invasive procedures. When the correct procedure is used, complications (cement leakage into the joint) can be avoided.
Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G
2014-12-01
Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Deng, X; Shao, G; Zhang, H-T; Li, C; Zhang, D; Cheng, L; Elzey, B D; Pili, R; Ratliff, T L; Huang, J; Hu, C-D
2017-03-02
Protein arginine methyltransferase 5 (PRMT5) is an emerging epigenetic enzyme that mainly represses transcription of target genes via symmetric dimethylation of arginine residues on histones H4R3, H3R8 and H2AR3. Accumulating evidence suggests that PRMT5 may function as an oncogene to drive cancer cell growth by epigenetic inactivation of several tumor suppressors. Here, we provide evidence that PRMT5 promotes prostate cancer cell growth by epigenetically activating transcription of the androgen receptor (AR) in prostate cancer cells. Knockdown of PRMT5 or inhibition of PRMT5 by a specific inhibitor reduces the expression of AR and suppresses the growth of multiple AR-positive, but not AR-negative, prostate cancer cells. Significantly, knockdown of PRMT5 in AR-positive LNCaP cells completely suppresses the growth of xenograft tumors in mice. Molecular analysis reveals that PRMT5 binds to the proximal promoter region of the AR gene and contributes mainly to the enriched symmetric dimethylation of H4R3 in the same region. Mechanistically, PRMT5 is recruited to the AR promoter by its interaction with Sp1, the major transcription factor responsible for AR transcription, and forms a complex with Brg1, an ATP-dependent chromatin remodeler, on the proximal promoter region of the AR gene. Furthermore, PRMT5 expression in prostate cancer tissues is significantly higher than that in benign prostatic hyperplasia tissues, and PRMT5 expression correlates positively with AR expression at both the protein and mRNA levels. Taken together, our results identify PRMT5 as a novel epigenetic activator of AR in prostate cancer. Given that inhibiting AR transcriptional activity or androgen synthesis remains the major mechanism of action for most existing anti-androgen agents, our findings also raise an interesting possibility that targeting PRMT5 may represent a novel approach for prostate cancer treatment by eliminating AR expression.
Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce
2014-08-01
Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.
Proximal onychomycosis due to Malassezia furfur: a case report
Directory of Open Access Journals (Sweden)
Zareei M
2013-03-01
Full Text Available Background: The etiologic role of Malassezia furfur in onychomycosis, because of its controversial keratinolytic ability, has not been proven. The most reported cases are distal subungual onychomycosis (DSO. In our knowledge no cases of proximal onychomycosis (PO has been reported. For the first time we report proximal onychomycosis. This case report describes the isolation of Malassezia furfur from fingernails. Case presentation: An Iranian 56- year- old women had been referred to mycology lab with hyperkeratosis in proximal regions of right hand nails and clinical diagnosis of onychomycosis without paronychia in May 2012. She used several medicines for her cardiac disease, mental illness, severe stress and blood glucose fluctuation diseases. Scraping and sampling from nail lesions were done, budding yeast cells with broadband connections were observed in 15% KOH wet mounts. Also, other differentiation tests, consist of staining with methylen blue, cultures and biochemical tests were done. In order to rejecting the probable etiologic role of any dermatophytic or non-dermatophytic fungi in this case, samples were collected from other parts of the body by scotch tape and scraping with scalpel blade too, but the results of direct microscopy and culture were negative. Finally, Malassezia furfur was identified as the causative agent of onychomycosis.Conclusion: Despite failure to prove Malassezia furfur keratinolytic ability, it can be the etiologic agent of proximal onychomycosis that shows the aggressive properties of this species. Its clinical importance is the easier transmission to hospitalized patients and other people.
Directory of Open Access Journals (Sweden)
Man-Tat eLau
2012-03-01
Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin
New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.
Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja
2017-02-01
Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.
Cytosine deletion at AP2-box region of HSP70 promoter and its ...
Indian Academy of Sciences (India)
Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...
Directory of Open Access Journals (Sweden)
Nelli Babayan
2011-12-01
Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.
Transcriptional regulation of HIV-1 host factor COMMD1 by the Sp family.
Kudo, Eriko; Taura, Manabu; Suico, Mary Ann; Goto, Hiroki; Kai, Hirofumi; Okada, Seiji
2018-04-01
Copper metabolism Murr1 domain containing 1 (COMMD1) has multiple functions in the regulation of protein stability at the plasma membrane and in the cytoplasm. However, the regulation of COMMD1 transcriptional has remained to be elucidated. In the present study, the 5'‑flanking region (‑1,192/+83 bp) of the human COMMD1 gene was cloned. It was observed that the COMMD1 promoter region contains GC‑rich region that has 7 putative Sp1‑binding sites via in silico analysis. The proximal promoter region at ‑289/+83 bp was required for COMMD1 basal promoter activity by deletion constructs of COMMD1 promoter. Moreover, Sp1 inhibitor, mithramycin A, suppressed basal COMMD1 promoter activity. The Sp1‑binding site (‑11/‑1 bp) in the proximal promoter region was a critical site for COMMD1 gene regulation by Sp1 and Sp3. Sp1 upregulated COMMD1 promoter activity, whereas Sp3 suppressed it. Endogenous Sp1 and Sp3 bound to the proximal promoter region of COMMD1. Taken together, Sp1 constitutively regulates the basal expression of the COMMD1 gene in human epithelial cell lines.
PROXIMITY MANAGEMENT IN CRISIS CONDITIONS
Directory of Open Access Journals (Sweden)
Ion Dorin BUMBENECI
2010-01-01
Full Text Available The purpose of this study is to evaluate the level of assimilation for the terms "Proximity Management" and "Proximity Manager", both in the specialized literature and in practice. The study has two parts: the theoretical research of the two terms, and an evaluation of the use of Proximity management in 32 companies in Gorj, Romania. The object of the evaluation resides in 27 companies with less than 50 employees and 5 companies with more than 50 employees.
Dorman, Robert M; Vali, Kaveh; Harmon, Carroll M; Zaritzky, Mario; Bass, Kathryn D
2016-05-01
We describe the treatment of a patient with long-gap esophageal atresia with an upper pouch fistula, mircogastria and minimal distal esophageal remnant. After 4.5 months of feeding via gastrostomy, a proximal fistula was identified by bronchoscopy and a thoracoscopic modified Foker procedure was performed reducing the gap from approximately 7-5 cm over 2 weeks of traction. A second stage to ligate the fistula and suture approximate the proximal and distal esophagus resulted in a gap of 1.5 cm. IRB and FDA approval was then obtained for endoscopic placement of 10-French catheter mounted magnets in the proximal and distal pouches promoting a magnetic compression anastomosis (magnamosis). Magnetic coupling occurred at 4 days and after magnet removal at 13 days an esophagram demonstrated a 10 French channel without leak. Serial endoscopic balloon dilation has allowed drainage of swallowed secretions as the baby learns bottling behavior at home.
Regional strain variations in the human patellar tendon.
Pearson, Stephen J; Ritchings, Tim; Mohamed, Azlan S A
2014-07-01
Characteristics of localized tendon strain in vivo are largely unknown. The present study examines local tendon strain between the deep, middle, and surface structures at the proximal and distal aspects of the patellar tendon during ramped isometric contractions. Male subjects (age 28.0 ± 6.3 yr) were examined for patellar tendon excursion (anterior, midsection, and posterior) during ramped isometric voluntary contractions using real-time B-mode ultrasonography and dynamometry. Regional tendon excursion measurements were compared using an automated pixel tracking method. Strain was determined from the tendon delta length normalized to initial/resting segment length. Strain increased from 10% to 100% of force for all regions. Significantly greater mean strain was seen for the anterior proximal region compared to the posterior and mid layer of the tendon (7.5% ± 1.1% vs 3.7% ± 0.5% vs 5.5% ± 1.0%; P < 0.05). Similarly, the distal posterior region showed greater mean strain compared to the mid and anterior regions (7.9% ± 0.6% vs 5.0% ± 0.6% vs 5.4% ± 0.6%; P < 0.05). Relative changes in strain differences from 50% to 100% of force for the proximal region were greatest for the anterior to midline regions (4.6% ± 0.6% and 5.6% ± 0.6%, respectively) and those for the distal region were also greatest for the anterior to midline regions (4.4% ± 0.2% and 5.3% ± 0.2%, respectively). The largest mean strain for the proximal region was at the anterior layer (7.5% ± 1.1%) and that for the distal tendon region was at the posterior layer (7.9% ± 0.9%). This study shows significant regional differences in strain during ramped isometric contractions for the patellar tendon. Lower proximal strains in the posterior tendon compared to the anterior region may be associated with the suggestion of "stress shielding" as an etiological factor in insertional tendinopathy.
DEFF Research Database (Denmark)
Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P
1994-01-01
To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...
Proximal hamstring morphology and morphometry in men: an anatomic and MRI investigation.
Storey, R N; Meikle, G R; Stringer, M D; Woodley, S J
2016-12-01
The proximal musculo-tendinous junction (MTJ) is a common site of hamstring strain injury but the anatomy of this region is not well defined. A morphometric analysis of the proximal MTJs of biceps femoris long head (BFlh), semitendinosus (ST), and semimembranosus (SM) was undertaken from dissection of 10 thighs from five male cadavers and magnetic resonance imaging of 20 thighs of 10 active young men. The length, volume, and cross-sectional area of the proximal tendon, MTJ and muscle belly, and muscle-tendon interface area were calculated. In both groups, MTJs were reconstructed three-dimensionally. The proximal tendons and MTJs were expansive, particularly within SM and BFlh. Morphology varied between muscles although length measurements within individual muscles were similar in cadavers and young men. Semimembranosus had the longest proximal tendon (cadavers: mean 33.6 ± 2.0 cm; young men: mean 31.7 ± 1.6 cm) and MTJ (>20 cm in both groups) and the greatest muscle-tendon interface area, followed by BFlh and ST. Mean muscle belly volumes were more than three times greater in young men than elderly male cadavers (P hamstring anatomy, an important factor in the pathogenesis of hamstring strain injury. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Botella Luisa M
2010-06-01
Full Text Available Abstract Background Activin receptor-like kinase 1 (ALK1 is a Transforming Growth Factor-β (TGF-β receptor type I, mainly expressed in endothelial cells that plays a pivotal role in vascular remodelling and angiogenesis. Mutations in the ALK1 gene (ACVRL1 give rise to Hereditary Haemorrhagic Telangiectasia, a dominant autosomal vascular dysplasia caused by a haploinsufficiency mechanism. In spite of its patho-physiological relevance, little is known about the transcriptional regulation of ACVRL1. Here, we have studied the different origins of ACVRL1 transcription, we have analyzed in silico its 5'-proximal promoter sequence and we have characterized the role of Sp1 in the transcriptional regulation of ACVRL1. Results We have performed a 5'Rapid Amplification of cDNA Ends (5'RACE of ACVRL1 transcripts, finding two new transcriptional origins, upstream of the one previously described, that give rise to a new exon undiscovered to date. The 5'-proximal promoter region of ACVRL1 (-1,035/+210 was analyzed in silico, finding that it lacks TATA/CAAT boxes, but contains a remarkably high number of GC-rich Sp1 consensus sites. In cells lacking Sp1, ACVRL1 promoter reporters did not present any significant transcriptional activity, whereas increasing concentrations of Sp1 triggered a dose-dependent stimulation of its transcription. Moreover, silencing Sp1 in HEK293T cells resulted in a marked decrease of ACVRL1 transcriptional activity. Chromatin immunoprecipitation assays demonstrated multiple Sp1 binding sites along the proximal promoter region of ACVRL1 in endothelial cells. Furthermore, demethylation of CpG islands, led to an increase in ACVRL1 transcription, whereas in vitro hypermethylation resulted in the abolishment of Sp1-dependent transcriptional activation of ACVRL1. Conclusions Our results describe two new transcriptional start sites in ACVRL1 gene, and indicate that Sp1 is a key regulator of ACVRL1 transcription, providing new insights into
Lasan Trcić, Ruzica; Hitrec, Vlasta; Letica, Ljiljana; Cuk, Mario; Begović, Davor
2003-08-01
Conventional cytogenetics detected an interstitial deletion of proximal region of p-arm of chromosome 2 in a 6-month-old boy with a phenotype slightly resembling Down's syndrome. The deletion was inherited from the father, whose karyotype revealed a small ring-shaped marker chromosome, in addition to interstitial deletion. Fluorescence in situ hybridization identified the marker, which consisted of the proximal region of the p-arm of chromosome 2, including a part of its centromere. This case shows that molecular cytogenetic analysis can reveal the mechanism of the formation of the marker chromosome.
Effect of TNFα on activities of different promoters of human apolipoprotein A-I gene
International Nuclear Information System (INIS)
Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.
2010-01-01
Research highlights: → TNFα stimulates the distal alternative promoter of human apoA-I gene. → TNFα acts by weakening of promoter competition within apoA-I gene (promoter switching). → MEK1/2 and nuclear receptors PPARα and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1β and TNFα. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNFα-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNFα on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNFα leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNFα. The MEK1/2-ERK1/2 cascade and nuclear receptors PPARα and LXRs are important for TNFα-mediated apoA-I promoter switching.
Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R
1997-09-05
To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient
Uncemented allograft-prosthetic composite reconstruction of the proximal femur
Directory of Open Access Journals (Sweden)
Li Min
2014-01-01
Full Text Available Background: Allograft-prosthetic composite can be divided into three groups names cemented, uncemented, and partially cemented. Previous studies have mainly reported outcomes in cemented and partially cemented allograft-prosthetic composites, but have rarely focused on the uncemented allograft-prosthetic composites. The objectives of our study were to describe a surgical technique for using proximal femoral uncemented allograft-prosthetic composite and to present the radiographic and clinical results. Materials and Methods: Twelve patients who underwent uncemented allograft-prosthetic composite reconstruction of the proximal femur after bone tumor resection were retrospectively evaluated at an average followup of 24.0 months. Clinical records and radiographs were evaluated. Results: In our series, union occurred in all the patients (100%; range 5-9 months. Until the most recent followup, there were no cases with infection, nonunion of the greater trochanter, junctional bone resorption, dislocation, allergic reaction, wear of acetabulum socket, recurrence, and metastasis. But there were three periprosthetic fractures which were fixed using cerclage wire during surgery. Five cases had bone resorption in and around the greater trochanter. The average Musculoskeletal Tumor Society (MSTS score and Harris hip score (HHS were 26.2 points (range 24-29 points and 80.6 points (range 66.2-92.7 points, respectively. Conclusions: These results showed that uncemented allograft-prosthetic composite could promote bone union through compression at the host-allograft junction and is a good choice for proximal femoral resection. Although this technology has its own merits, long term outcomes are yet not validated.
Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG
2016-01-01
Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751
Directory of Open Access Journals (Sweden)
Ana Tobar
Full Text Available BACKGROUND: Obesity is associated with glomerular hyperfiltration, increased proximal tubular sodium reabsorption, glomerular enlargement and renal hypertrophy. A single experimental study reported an increased glomerular urinary space in obese dogs. Whether proximal tubular volume is increased in obese subjects and whether their glomerular and tubular urinary spaces are enlarged is unknown. OBJECTIVE: To determine whether proximal tubules and glomerular and tubular urinary space are enlarged in obese subjects with proteinuria and glomerular hyperfiltration. METHODS: Kidney biopsies from 11 non-diabetic obese with proteinuria and 14 non-diabetic lean patients with a creatinine clearance above 50 ml/min and with mild or no interstitial fibrosis were retrospectively analyzed using morphometric methods. The cross-sectional area of the proximal tubular epithelium and lumen, the volume of the glomerular tuft and of Bowman's space and the nuclei number per tubular profile were estimated. RESULTS: Creatinine clearance was higher in the obese than in the lean group (P=0.03. Proteinuria was similarly increased in both groups. Compared to the lean group, the obese group displayed a 104% higher glomerular tuft volume (P=0.001, a 94% higher Bowman's space volume (P=0.003, a 33% higher cross-sectional area of the proximal tubular epithelium (P=0.02 and a 54% higher cross-sectional area of the proximal tubular lumen (P=0.01. The nuclei number per proximal tubular profile was similar in both groups, suggesting that the increase in tubular volume is due to hypertrophy and not to hyperplasia. CONCLUSIONS: Obesity-related glomerular hyperfiltration is associated with proximal tubular epithelial hypertrophy and increased glomerular and tubular urinary space volume in subjects with proteinuria. The expanded glomerular and urinary space is probably a direct consequence of glomerular hyperfiltration. These effects may be involved in the pathogenesis of obesity
Sex Specific Association of Physical Activity on Proximal Femur BMD in 9 to 10 Year-Old Children
Cardadeiro, Graça; Baptista, Fátima; Ornelas, Rui; Janz, Kathleen F.; Sardinha, Luís B.
2012-01-01
The results of physical activity (PA) intervention studies suggest that adaptation to mechanical loading at the femoral neck (FN) is weaker in girls than in boys. Less is known about gender differences associated with non-targeted PA levels at the FN or other clinically relevant regions of the proximal femur. Understanding sex-specific relationships between proximal femur sensitivity and mechanical loading during non-targeted PA is critical to planning appropriate public health interventions. We examined sex-specific associations between non-target PA and bone mineral density (BMD) of three sub-regions of the proximal femur in pre- and early-pubertal boys and girls. BMD at the FN, trochanter (TR) and intertrochanter (IT) regions, and lean mass of the whole body were assessed using dual-energy x-ray absorptiometry in 161 girls (age: 9.7±0.3 yrs) and 164 boys (age: 9.7±0.3 yrs). PA was measured using accelerometry. Multiple linear regression analyses (adjusted for body height, total lean mass and pubertal status) revealed that vigorous PA explained 3–5% of the variability in BMD at all three sub-regions in boys. In girls, vigorous PA explained 4% of the variability in IT BMD and 6% in TR BMD. PA did not contribute to the variance in FN BMD in girls. An additional 10 minutes per day of vigorous PA would be expected to result in a ∼1% higher FN, TR, and IT BMD in boys (pgirls. In conclusion, vigorous PA can be expected to contribute positively to bone health outcomes for boys and girls. However, the association of vigorous PA to sub-regions of the proximal femur varies by sex, such that girlś associations are heterogeneous and the lowest at the FN, but stronger at the TR and the IT, when compared to boys. PMID:23209801
Carrara, Paola; Antoninetti, Massimo; Bacai, Hina; Basoni, Anna; Bosc, Christelle; Clave, Magali; Cornacchia, Carmela; L'Astorina, Alba; Monbet, Philippe; Mueller, Bastian; Nicolau, Sonia; Pergola, Nicola; Rampini, Anna; Tramutoli, Valerio; Schumacher, Volker; Wells, Alan; Zepeda Juarez, Jesus; Zolotikova, Svetlana
2013-04-01
which have significant impact on the economy, environment and the quality of life of the citizens To this aim since 2011 the system of Regional Contact Offices (RCOs) was promoted by the EU FP7 DORIS_Net (Downsteam Observatory organized by Regions Active in Space - Network, http://www.doris-net.eu/) project as the regional link to the services provided by the European GMES programme. Since then a first nucleus of 12 pilot European Regions were working together establishing 6 first RCOs around Europe. This paper will present RCOs network goals, achievements and perspectives as well as its planned actions devoted to improve quality of Space Technology products from one side, to promote awareness and use of them by potential end-users (and particularly LRAs), from the other side.
Fractures of the proximal humerus
DEFF Research Database (Denmark)
Brorson, Stig
2013-01-01
Fractures of the proximal humerus have been diagnosed and managed since the earliest known surgical texts. For more than four millennia the preferred treatment was forceful traction, closed reduction, and immobilization with linen soaked in combinations of oil, honey, alum, wine, or cerate......, classification of proximal humeral fractures remains a challenge for the conduct, reporting, and interpretation of clinical trials. The evidence for the benefits of surgery in complex fractures of the proximal humerus is weak. In three systematic reviews I studied the outcome after locking plate osteosynthesis...
Energy Technology Data Exchange (ETDEWEB)
Banerjee, Saikat; Shi, Heliang; Habte, Habtom H.; Qin, Yali; Cho, Michael W., E-mail: mcho@iastate.edu
2016-03-15
The C-terminal alpha-helix of gp41 membrane-proximal external region (MPER; {sup 671}NWFDITNWLWYIK{sup 683}) encompassing 4E10/10E8 epitopes is an attractive target for HIV-1 vaccine development. We previously reported that gp41-HR1-54Q, a trimeric protein comprised of the MPER in the context of a stable six-helix bundle (6HB), induced strong immune responses against the helix, but antibodies were directed primarily against the non-neutralizing face of the helix. To better target 4E10/10E8 epitopes, we generated four putative fusion intermediates by introducing double point mutations or deletions in the heptad repeat region 1 (HR1) that destabilize 6HB in varying degrees. One variant, HR1-∆10-54K, elicited antibodies in rabbits that targeted W672, I675 and L679, which are critical for 4E10/10E8 recognition. Overall, the results demonstrated that altering structural parameters of 6HB can influence immunogenic properties of the MPER and antibody targeting. Further exploration of this strategy could allow development of immunogens that could lead to induction of 4E10/10E8-like antibodies. - Highlights: • Four gp41 MPER-based immunogens that resemble fusion intermediates were generated. • C-terminal region of MPER that contains 4E10/10E8 epitopes was highly immunogenic. • Altering 6HB structure can influence immunogenic properties of the MPER. • Induced antibodies targeted multiple residues critical for 4E10/10E8 binding. • Development of immunogens based on fusion intermediates is a promising strategy.
Noise measurements on proximity effect bridges
International Nuclear Information System (INIS)
Decker, S.K.; Mercereau, J.E.
1975-01-01
Audio frequency noise density measurements were performed on weakly superconducting proximity effect bridges on using a cooled transformer and room temperature low noise preamplifier. The noise temperature of the measuring system is approximately 4 0 K for a 0.9 Ω resistor. Noise density was measured as a function of bias current and temperature for the bridges. Excess noise above that expected from Johnson noise for a resistor equal to the dynamic resistance of the bridges was observed in the region near the critical current of the device. At high currents compared to the critical current, the noise density closely approaches that given by Johnson noise
Proximal iliotibial band syndrome: case report
Directory of Open Access Journals (Sweden)
Guilherme Guadagnini Falotico
2013-08-01
Full Text Available OBJECTIVE: The overuse injuries in the hip joint occur commonly in sports practitioners and currently due to technical advances in diagnostic imaging, especially magnetic resonance imaging (MRI, are often misdiagnosed. Recently, a group of people were reported, all female, with pain and swelling in the pelvic region.T2-weighted MRI showed increased signal in the enthesis of the iliotibial band (ITB along the lower border of the iliac tubercle. We report a case of a 34 year old woman, non-professional runner, with pain at the iliac crest with no history of trauma and whose MRI was compatible with the proximal iliotibial band syndrome.
Directory of Open Access Journals (Sweden)
Mostafa M Abbas
Full Text Available As the number of sequenced bacterial genomes increases, the need for rapid and reliable tools for the annotation of functional elements (e.g., transcriptional regulatory elements becomes more desirable. Promoters are the key regulatory elements, which recruit the transcriptional machinery through binding to a variety of regulatory proteins (known as sigma factors. The identification of the promoter regions is very challenging because these regions do not adhere to specific sequence patterns or motifs and are difficult to determine experimentally. Machine learning represents a promising and cost-effective approach for computational identification of prokaryotic promoter regions. However, the quality of the predictors depends on several factors including: i training data; ii data representation; iii classification algorithms; iv evaluation procedures. In this work, we create several variants of E. coli promoter data sets and utilize them to experimentally examine the effect of these factors on the predictive performance of E. coli σ70 promoter models. Our results suggest that under some combinations of the first three criteria, a prediction model might perform very well on cross-validation experiments while its performance on independent test data is drastically very poor. This emphasizes the importance of evaluating promoter region predictors using independent test data, which corrects for the over-optimistic performance that might be estimated using the cross-validation procedure. Our analysis of the tested models shows that good prediction models often perform well despite how the non-promoter data was obtained. On the other hand, poor prediction models seems to be more sensitive to the choice of non-promoter sequences. Interestingly, the best performing sequence-based classifiers outperform the best performing structure-based classifiers on both cross-validation and independent test performance evaluation experiments. Finally, we propose a
Directory of Open Access Journals (Sweden)
Christopher A Lavender
2016-08-01
Full Text Available Antisense transcription is a prevalent feature at mammalian promoters. Previous studies have primarily focused on antisense transcription initiating upstream of genes. Here, we characterize promoter-proximal antisense transcription downstream of gene transcription starts sites in human breast cancer cells, investigating the genomic context of downstream antisense transcription. We find extensive correlations between antisense transcription and features associated with the chromatin environment at gene promoters. Antisense transcription downstream of promoters is widespread, with antisense transcription initiation observed within 2 kb of 28% of gene transcription start sites. Antisense transcription initiates between nucleosomes regularly positioned downstream of these promoters. The nucleosomes between gene and downstream antisense transcription start sites carry histone modifications associated with active promoters, such as H3K4me3 and H3K27ac. This region is bound by chromatin remodeling and histone modifying complexes including SWI/SNF subunits and HDACs, suggesting that antisense transcription or resulting RNA transcripts contribute to the creation and maintenance of a promoter-associated chromatin environment. Downstream antisense transcription overlays additional regulatory features, such as transcription factor binding, DNA accessibility, and the downstream edge of promoter-associated CpG islands. These features suggest an important role for antisense transcription in the regulation of gene expression and the maintenance of a promoter-associated chromatin environment.
International Nuclear Information System (INIS)
Zhang Zhiming; Zhu Xuesong; Bao Zhaohua; Yang Huilin
2012-01-01
Objective: to explore the initial outcome and efficacy of S 3 proximal humerus locking plate in the treatment of proximal humerus fractures. Methods: Twenty-two patients with proximal humerus fracture were treated with the S 3 proximal humerus locking plate. Most of the fractures were complex, two-part (n=4), three-part (n=11) and four-part (n=7) fractures according to the Neer classification of the proximal humerus fractures. Results: All patients were followed up for 3∼15 months. There were no complications related to the implant including loosening or breakage of the plate. Good and excellent results were documented in 17 patients fair results in 4 patients according the Neer scores of shoulder. Conclusion: New design concepts of S 3 proximal humerus plate provide the subchondral support and the internal fixation support. With the addition of the proper exercise of the shoulder joint, the outcomes would be satisfied. (authors)
Directory of Open Access Journals (Sweden)
Susanne Schmeier
2009-01-01
Full Text Available The development of international rivers is often perceived as leading to conflicts or even water wars. However, as the development of the Mekong River shows, cooperation has not only prevailed in the last decades, but River Basin Organizations (RBOs, established to mitigate river-related conflicts and/or develop the river basin, have also contributed to the emergence of more general cooperation structures, mainly by creating spill-over effects in other issue-areas, bringing cooperation to policy fields beyond the river itself. This article assesses the contribution of the Mekong River Commission (MRC and the Greater Mekong Sub-Region (GMS to the sustainable development of the Mekong Region as well as to the promotion of regional cooperation in mainland South-East Asia in general. --- Die Entwicklung grenzüberschreitender Flüsse wird oft mit Konflikten oder gar Kriegen um Wasser assoziiert. Wie jedoch die Entwicklung im Mekong-Becken zeigt, waren die vergangenen Jahrzehnte nicht nur von Kooperation gezeichnet, sondern Flussbeckenorganisationen konnten außerdem dazu beitragen, weitreichendere Kooperationsstrukturen zu entwickeln, die sich auf andere Politikfelder ausdehnen. Dieser Artikel beschäftigt sich mit dem Beitrag der Mekong River Commission (MRC und der Greater Mekong Sub-Region (GMS zur nachhaltigen Entwicklung in der Mekong Region sowie zur Förderung allgemeiner regionaler Kooperation im Festländischen Südostasien.
International Nuclear Information System (INIS)
Rawłuszko, Agnieszka Anna; Horbacka, Karolina; Krokowicz, Piotr; Jagodziński, Paweł Piotr
2011-01-01
The importance of 17β-estradiol (E2) in the prevention of large bowel tumorigenesis has been shown in many epidemiological studies. Extragonadal E2 may form by the aromatase pathway from androstenedione or the sulfatase pathway from estrone (E1) sulfate followed by E1 reduction to E2 by 17-β-hydroxysteroid dehydrogenase (HSD17B1), so HSD17B1 gene expression may play an important role in the production of E2 in peripheral tissue, including the colon. HSD17B1 expression was analyzed in colorectal cancer cell lines (HT29, SW707) and primary colonic adenocarcinoma tissues collected from fifty two patients who underwent radical colon surgical resection. Histopathologically unchanged colonic mucosa located at least 10-20 cm away from the cancerous lesions was obtained from the same patients. Expression level of HSD17B1 using quantitative PCR and western blot were evaluated. DNA methylation level in the 5' flanking region of HSD17B1 CpG rich region was assessed using bisulfite DNA sequencing and HRM analysis. The influence of DNA methylation on HSD17B1 expression was further evaluated by ChIP analysis in HT29 and SW707 cell lines. The conversion of estrone (E1) in to E2 was determined by electrochemiluminescence method. We found a significant decrease in HSD17B1 transcript (p = 0.0016) and protein (p = 0.0028) levels in colorectal cancer (CRC) from the proximal but not distal colon and rectum. This reduced HSD17B1 expression was associated with significantly increased DNA methylation (p = 0.003) in the CpG rich region located in the 5' flanking sequence of the HSD17B1 gene in CRC in the proximal but not distal colon and rectum. We also showed that 5-dAzaC induced demethylation of the 5' flanking region of HSD17B1, leading to increased occupation of the promoter by Polymerase II, and increased transcript and protein levels in HT29 and SW707 CRC cells, which contributed to the increase in E2 formation. Our results showed that reduced HSD17B1 expression can
Preliminary study on leadership proximity
Directory of Open Access Journals (Sweden)
Ghinea Valentina Mihaela
2017-07-01
Full Text Available In general, it is agreed that effective leadership requires a certain degree of proximity, either physical or mental, which enables leaders to maintain control over their followers and communicate their vision. Although we agree with the leadership proximity principles which states that leaders are able to efficiently serve only those people with whom they interact frequently, in this article we focus instead on the disadvantages of being too close and the way in which close proximity can actually hurt the effectiveness of leadership. The main effects that we discuss regard the way in which proximity and familiarity allow followers to see the weaknesses and faults of the leader much more easily and thus diminish the leader’s heroic aura, and the emotional bias that results from a leader being too familiar with his followers which will impede the process of rational decision making. As a result, we argue that there exists a functional proximity which allows the leader the necessary space in which to perform effective identity work and to hide the backstage aspects of leadership, while also allowing him an emotional buffer zone which will enable him to maintain the ability to see clearly and make rational decisions.
ProxImaL: efficient image optimization using proximal algorithms
Heide, Felix; Diamond, Steven; Nieß ner, Matthias; Ragan-Kelley, Jonathan; Heidrich, Wolfgang; Wetzstein, Gordon
2016-01-01
domain-specific language and compiler for image optimization problems that makes it easy to experiment with different problem formulations and algorithm choices. The language uses proximal operators as the fundamental building blocks of a variety
Burnside, Rachel D; Pasion, Romela; Mikhail, Fady M; Carroll, Andrew J; Robin, Nathaniel H; Youngs, Erin L; Gadi, Inder K; Keitges, Elizabeth; Jaswaney, Vikram L; Papenhausen, Peter R; Potluri, Venkateswara R; Risheg, Hiba; Rush, Brooke; Smith, Janice L; Schwartz, Stuart; Tepperberg, James H; Butler, Merlin G
2011-10-01
The proximal long arm of chromosome 15 has segmental duplications located at breakpoints BP1-BP5 that mediate the generation of NAHR-related microdeletions and microduplications. The classical Prader-Willi/Angelman syndrome deletion is flanked by either of the proximal BP1 or BP2 breakpoints and the distal BP3 breakpoint. The larger Type I deletions are flanked by BP1 and BP3 in both Prader-Willi and Angelman syndrome subjects. Those with this deletion are reported to have a more severe phenotype than individuals with either Type II deletions (BP2-BP3) or uniparental disomy 15. The BP1-BP2 region spans approximately 500 kb and contains four evolutionarily conserved genes that are not imprinted. Reports of mutations or disturbed expression of these genes appear to impact behavioral and neurological function in affected individuals. Recently, reports of deletions and duplications flanked by BP1 and BP2 suggest an association with speech and motor delays, behavioral problems, seizures, and autism. We present a large cohort of subjects with copy number alteration of BP1 to BP2 with common phenotypic features. These include autism, developmental delay, motor and language delays, and behavioral problems, which were present in both cytogenetic groups. Parental studies demonstrated phenotypically normal carriers in several instances, and mildly affected carriers in others, complicating phenotypic association and/or causality. Possible explanations for these results include reduced penetrance, altered gene dosage on a particular genetic background, or a susceptibility region as reported for other areas of the genome implicated in autism and behavior disturbances.
PROXIMAL DISABILITY AND SPINAL DEFORMITY INDEX IN PATIENTS WITH PROXIMAL FEMUR FRACTURES
Directory of Open Access Journals (Sweden)
Sylvio Mistro Neto
2015-12-01
Full Text Available Objective : To evaluate the quality of life related to the spine in patients with proximal femoral fractures. Methods : Study conducted in a tertiary public hospital in patients with proximal femoral fractures caused by low-energy trauma, through the Oswestry Disability Index questionnaire to asses complaints related to the spine at the time of life prior to the femoral fracture. The thoracic and lumbar spine of patients were also evaluated applying the radiographic index described by Gennant (Spinal Deformity Index, which assesses the number and severity of fractures. Results : Seventeen subjects completed the study. All had some degree of vertebral fracture. Patients were classified in the categories of severe and very severe disability in the questionnaire about quality of life. It was found that the higher SDI, the better the quality of life. Conclusion : There is a strong association of disability related to the spine in patients with proximal femoral fracture, and this complaint must be systematically evaluated in patients with appendicular fracture.
Activation of the skeletal alpha-actin promoter during muscle regeneration.
Marsh, D R; Carson, J A; Stewart, L N; Booth, F W
1998-11-01
Little is known concerning promoter regulation of genes in regenerating skeletal muscles. In young rats, recovery of muscle mass and protein content is complete within 21 days. During the initial 5-10 days of regeneration, mRNA abundance for IGF-I, myogenin and MyoD have been shown to be dramatically increased. The skeletal alpha-actin promoter contains E box and serum response element (SRE) regulatory regions which are directly or indirectly activated by myogenin (or MyoD) and IGF-I proteins, respectively. We hypothesized that the skeletal alpha-actin promoter activity would increase during muscle regeneration, and that this induction would occur before muscle protein content returned to normal. Total protein content and the percentage content of skeletal alpha-actin protein was diminished at 4 and 8 days and re-accumulation had largely occurred by 16 days post-bupivacaine injection. Skeletal alpha-actin mRNA per whole muscle was decreased at day 8, and thereafter returned to control values. During regeneration at day 8, luciferase activity (a reporter of promoter activity) directed by -424 skeletal alpha-actin and -99 skeletal alpha-actin promoter constructs was increased by 700% and 250% respectively; however, at day 16, skeletal alpha-actin promoter activities were similar to control values. Thus, initial activation of the skeletal alpha-actin promoter is associated with regeneration of skeletal muscle, despite not being sustained during the later stages of regrowth. The proximal SRE of the skeletal alpha-actin promoter was not sufficient to confer a regeneration-induced promoter activation, despite increased serum response factor protein binding to this regulatory element in electrophoretic mobility shift assays. Skeletal alpha-actin promoter induction during regeneration is due to a combination of regulatory elements, at least including the SRE and E box.
Röderer, Götz; Scola, Alexander; Schmölz, Werner; Gebhard, Florian; Windolf, Markus; Hofmann-Fliri, Ladina
2013-10-01
Proximal humerus fracture fixation can be difficult because of osteoporosis making it difficult to achieve stable implant anchorage in the weak bone stock even when using locking plates. This may cause implant failure requiring revision surgery. Cement augmentation has, in principle, been shown to improve stability. The aim of this study was to investigate whether augmentation of particular screws of a locking plate aimed at a region of low bone quality is effective in improving stability in a proximal humerus fracture model. Twelve paired human humerus specimens were included. Quantitative computed tomography was performed to determine bone mineral density (BMD). Local bone quality in the direction of the six proximal screws of a standard locking plate (PHILOS, Synthes) was assessed using mechanical means (DensiProbe™). A three-part fracture model with a metaphyseal defect was simulated and fixed with the plate. Within each pair of humeri the two screws aimed at the region of the lowest bone quality according to the DensiProbe™ were augmented in a randomised manner. For augmentation, 0.5 ml of bone cement was injected in a screw with multiple outlets at its tip under fluoroscopic control. A cyclic varus-bending test with increasing upper load magnitude was performed until failure of the screw-bone fixation. The augmented group withstood significantly more load cycles. The correlation of BMD with load cycles until failure and BMD with paired difference in load cycles to failure showed that augmentation could compensate for a low BMD. The results demonstrate that augmentation of screws in locked plating in a proximal humerus fracture model is effective in improving primary stability in a cyclic varus-bending test. The augmentation of two particular screws aimed at a region of low bone quality within the humeral head was almost as effective as four screws with twice the amount of bone cement. Screw augmentation combined with a knowledge of the local bone quality
Zago, Anna; Connolly, Sarah A; Spear, Patricia G; Longnecker, Richard
2013-01-01
Among the herpesvirus glycoprotein B (gB) fusion proteins, the hydrophobic content of fusion loops and membrane proximal regions (MPRs) are inversely correlated with each other. We examined the functional importance of the hydrophobicity of these regions by replacing them in herpes simplex virus type 1 gB with corresponding regions from Epstein-Barr virus gB. We show that fusion activity is dependent on the structural context in which the specific loops and MPR sequences exist, rather than a simple hydrophobic relationship. Copyright © 2012 Elsevier B.V. All rights reserved.
Factors affecting minority population proximity to hazardous facilities
Energy Technology Data Exchange (ETDEWEB)
Nieves, L.A. [Argonne National Lab., IL (United States); Nieves, A.L. [Wheaton Coll., IL (United States)]|[Argonne National Lab., IL (United States)
1995-04-01
Disproportionate exposure of minority groups to environmental hazards has been attributed to ``environmental racism`` by some authors, without systematic investigation of the factors underlying this exposure pattern. This study examines regional differences in the proximity of African-Americans, Hispanics, Asians, and non-Hispanic Whites to a broad range of facility types and explores the effects of urban and income factors. A statistically significant inverse relationship is found between the percentage of non-Hispanic Whites and virtually all facility categories in all regions. Except for Hispanics in the South, all such associations for minority groups show a direct relationship, though some are nonsignificant. The geographic concentration of facilities is more closely tied to urbanization than to economic factors. Controlling for both urban and economic factors, minority population concentration is still a significant explanatory variable for some facility types in some regions. This finding is most consistent for African-Americans.
National Research Council Canada - National Science Library
Carpenter, Steven
1997-01-01
This study provides retrospective market research information about the population who enrolled in TRICARE Prime in TRICARE Region 11 and the advertising mediums used to promote enrollment in the TRICARE Prime program...
Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung
2015-01-01
Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934
ProxImaL: efficient image optimization using proximal algorithms
Heide, Felix
2016-07-11
Computational photography systems are becoming increasingly diverse, while computational resources-for example on mobile platforms-are rapidly increasing. As diverse as these camera systems may be, slightly different variants of the underlying image processing tasks, such as demosaicking, deconvolution, denoising, inpainting, image fusion, and alignment, are shared between all of these systems. Formal optimization methods have recently been demonstrated to achieve state-of-the-art quality for many of these applications. Unfortunately, different combinations of natural image priors and optimization algorithms may be optimal for different problems, and implementing and testing each combination is currently a time-consuming and error-prone process. ProxImaL is a domain-specific language and compiler for image optimization problems that makes it easy to experiment with different problem formulations and algorithm choices. The language uses proximal operators as the fundamental building blocks of a variety of linear and nonlinear image formation models and cost functions, advanced image priors, and noise models. The compiler intelligently chooses the best way to translate a problem formulation and choice of optimization algorithm into an efficient solver implementation. In applications to the image processing pipeline, deconvolution in the presence of Poisson-distributed shot noise, and burst denoising, we show that a few lines of ProxImaL code can generate highly efficient solvers that achieve state-of-the-art results. We also show applications to the nonlinear and nonconvex problem of phase retrieval.
Moon, Michael C; Greenberg, Roy K; Morales, Jose P; Martin, Zenia; Lu, Qingsheng; Dowdall, Joseph F; Hernandez, Adrian V
2011-04-01
Proximal aortic dissections are life-threatening conditions that require immediate surgical intervention to avert an untreated mortality rate that approaches 50% at 48 hours. Advances in computed tomography (CT) imaging techniques have permitted increased characterization of aortic dissection that are necessary to assess the design and applicability of new treatment paradigms. All patients presenting during a 2-year period with acute proximal aortic dissections who underwent CT scanning were reviewed in an effort to establish a detailed assessment of their aortic anatomy. Imaging studies were assessed in an effort to document the location of the primary proximal fenestration, the proximal and distal extent of the dissection, and numerous morphologic measurements pertaining to the aortic valve, root, and ascending aorta to determine the potential for an endovascular exclusion of the ascending aorta. During the study period, 162 patients presented with proximal aortic dissections. Digital high-resolution preoperative CT imaging was performed on 76 patients, and 59 scans (77%) were of adequate quality to allow assessment of anatomic suitability for treatment with an endograft. In all cases, the dissection plane was detectable, yet the primary intimal fenestration was identified in only 41% of the studies. Scans showed 24 patients (32%) appeared to be anatomically amenable to such a repair (absence of valvular involvement, appropriate length and diameter of proximal sealing regions, lack of need to occlude coronary vasculature). Of the 42 scans that were determined not to be favorable for endovascular repair, the most common exclusion finding was the absence of a proximal landing zone (n = 15; 36%). Appropriately protocoled CT imaging provides detailed anatomic information about the aortic root and ascending aorta, allowing the assessment of which dissections have proximal fenestrations that may be amenable to an endovascular repair. Copyright © 2011 Society for
Directory of Open Access Journals (Sweden)
Rachel M. Woodfint
2017-01-01
Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.
International Nuclear Information System (INIS)
Apostolaki, Angeliki; Kalosakas, George
2011-01-01
We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties
[MRI characteristic of proximal femur bone marrow edema syndrome].
Wu, Xi-Yuan
2014-07-01
To study the MRI features of proximal femur bone marrow edema syndrome for further improve the understanding of the disease. MRI imaging of 10 patients with proximal femur bone marrow edema syndrome was retrospectively reviewed,including 6 males and 4 females with an average age of 41.5 years old ranging from 36 to 57. The courses of diseases ranged from 1 week to 3 months. Among them, 9 cases had clinical manifestations of sudden hip pain, 7 cases had limited ability of walking and hip movement;all patients had no obvious injury history, non of the female patients was pregnant. All patients were followed up from 3 to 12 months, the following-up were topped after MRI when the symptoms disappeared for 3 months. The MRI demonstrated diffuse bone marrow edema involving the femoral head, neck and the inter-trochanteric region, 13 hips of 10 patients with bone marrow edema included 6 cases in grade 1, 5 cases in grade 2,2 cases in grade 3; 9 hips with hip hydrarthrosis included 6 hips in grade I ,1 hip in grade II, 2 hips in grade III. After treatment for 3 to 12 months the hip symptoms of the patients disappeared and MRI images were normal. MRI is useful in defining the location and extent of proximal femur bone marrow edema syndrome.
Mactaggart, Fiona; McDermott, Liane; Tynan, Anna; Gericke, Christian A
2017-08-03
There is some concern that coal seam gas mining may affect health and wellbeing through changes in social determinants such as living and working conditions, local economy and the environment. The onward impact of these conditions on health and wellbeing is often not monitored to the same degree as direct environmental health impacts in the mining context, but merits attention. This study reports on the findings from a recurrent theme that emerged from analysis of the qualitative component of a comprehensive Health Needs Assessment (HNA) conducted in regional Queensland: that health and wellbeing of communities was reportedly affected by nearby coal seam gas (CSG) development beyond direct environmental impacts. Qualitative analysis was initially completed using the Framework Method to explore key themes from 11 focus group discussions, 19 in-depth interviews, and 45 key informant interviews with health and wellbeing service providers and community members. A key theme emerged from the analysis that forms the basis of this paper. This study is part of a larger comprehensive HNA involving qualitative and quantitative data collection to explore the health and wellbeing needs of three communities living in proximity to CSG development in regional Queensland, Australia. Communities faced social, economic and environmental impacts from the rapid growth of CSG development, which were perceived to have direct and indirect effects on individual lifestyle factors such as alcohol and drug abuse, family relationships, social capital and mental health; and community-level factors including social connectedness, civic engagement and trust. Outer regional communities discussed the effects of mining activity on the fabric of their town and community, whereas the inner regional community that had a longer history of industrial activity discussed the impacts on families and individual health and wellbeing. The findings from this study may inform future health service planning in
de Loubens, Clément; Lentle, Roger G.; Love, Richard J.; Hulls, Corrin; Janssen, Patrick W. M.
2013-01-01
We conducted numerical experiments to study the influence of non-propagating longitudinal and circular contractions, i.e. pendular activity and segmentation, respectively, on flow and mixing in the proximal duodenum. A lattice-Boltzmann numerical method was developed to simulate the fluid mechanical consequences for each of 22 randomly selected sequences of high-definition video of real longitudinal and radial contractile activity in the isolated proximal duodenum of the rat and guinea pig. During pendular activity in the rat duodenum, the flow was characterized by regions of high shear rate. Mixing was so governed by shearing deformation of the fluid that increased the interface between adjacent domains and accelerated their inter-diffusion (for diffusion coefficients approx. less than 10−8 m² s−1). When pendular activity was associated with a slow gastric outflow characteristic of post-prandial period, the dispersion was also improved, especially near the walls. Mixing was not promoted by isolated segmentative contractions in the guinea pig duodenum and not notably influenced by pylorus outflow. We concluded that pendular activity generates mixing of viscous fluids ‘in situ’ and accelerates the diffusive mass transfer, whereas segmentation may be more important in mixing particulate suspensions with high solid volume ratios. PMID:23536539
de Loubens, Clément; Lentle, Roger G; Love, Richard J; Hulls, Corrin; Janssen, Patrick W M
2013-06-06
We conducted numerical experiments to study the influence of non-propagating longitudinal and circular contractions, i.e. pendular activity and segmentation, respectively, on flow and mixing in the proximal duodenum. A lattice-Boltzmann numerical method was developed to simulate the fluid mechanical consequences for each of 22 randomly selected sequences of high-definition video of real longitudinal and radial contractile activity in the isolated proximal duodenum of the rat and guinea pig. During pendular activity in the rat duodenum, the flow was characterized by regions of high shear rate. Mixing was so governed by shearing deformation of the fluid that increased the interface between adjacent domains and accelerated their inter-diffusion (for diffusion coefficients approx. less than 10(-8) m² s(-1)). When pendular activity was associated with a slow gastric outflow characteristic of post-prandial period, the dispersion was also improved, especially near the walls. Mixing was not promoted by isolated segmentative contractions in the guinea pig duodenum and not notably influenced by pylorus outflow. We concluded that pendular activity generates mixing of viscous fluids 'in situ' and accelerates the diffusive mass transfer, whereas segmentation may be more important in mixing particulate suspensions with high solid volume ratios.
Federal Laboratory Consortium — The Proximal Probes Facility consists of laboratories for microscopy, spectroscopy, and probing of nanostructured materials and their functional properties. At the...
On-Demand Targeting: Investigating Biology with Proximity-Directed Chemistry.
Long, Marcus J C; Poganik, Jesse R; Aye, Yimon
2016-03-23
Proximity enhancement is a central chemical tenet underpinning an exciting suite of small-molecule toolsets that have allowed us to unravel many biological complexities. The leitmotif of this opus is "tethering"-a strategy in which a multifunctional small molecule serves as a template to bring proteins/biomolecules together. Scaffolding approaches have been powerfully applied to control diverse biological outcomes such as protein-protein association, protein stability, activity, and improve imaging capabilities. A new twist on this strategy has recently appeared, in which the small-molecule probe is engineered to unleash controlled amounts of reactive chemical signals within the microenvironment of a target protein. Modification of a specific target elicits a precisely timed and spatially controlled gain-of-function (or dominant loss-of-function) signaling response. Presented herein is a unique personal outlook conceptualizing the powerful proximity-enhanced chemical biology toolsets into two paradigms: "multifunctional scaffolding" versus "on-demand targeting". By addressing the latest advances and challenges in the established yet constantly evolving multifunctional scaffolding strategies as well as in the emerging on-demand precision targeting (and related) systems, this Perspective is aimed at choosing when it is best to employ each of the two strategies, with an emphasis toward further promoting novel applications and discoveries stemming from these innovative chemical biology platforms.
[Pathologic proximal femoral fractures in children in an unicameral bone cyst].
Havránek, P; Pesl, T; Bartonícek, J
2005-01-01
Proximal femoral fractures in children are rare, pathologic fractures being extremely rare. Despite many meanings these fractures are still "unsolved" there are some definite rules for treatment of true accidental injuries. Pathologic fractures are outstanding with their extremely rare incidence. The aim of the study is to overview a large clinical material, find out the incidence of this pathologic fracture, the extent and shape of the unicameral bone cyst (UBC), specific therapeutic approach, technical problems of eventual osteosynthesis, number of reoperations and sequels. Altogether 49 children with 50 accidental and pathologic fractures of proximal part of the femur treated in the Regional Pediatric Trauma Centre of the Department of Pediatric and Trauma Surgery, 3rd Faculty of Medicine, Charles University, Prague. Retrospective and prospective study of children (0 to 15 years of age) treated with proximal femoral accidental and pathologic fractures during the 20 year period (from August 1984 to November 2004). Classification of fractures according to Delbet and Colonna. Diagnosis of bone cyst with plain X-rays, eventually CT scans. During the 20 years period (August 1984 to November 2004) 49 children with 50 proximal femoral fractures were treated in the Department. Four patients sustained a pathologic fracture through an unicameral bone cyst. Two of these latter children were treated by an open reduction and osteosynthesis with the use of the proximal femoral AO-ASIF angled-plate and two children nonoperatively using skeletal traction because of impossibility of insertion of the osteosynthetic material without a damage of the growth plate. Subsequent operations of the UBC were necessary in these two children. All four patients recovered well without sequels. Pathologic fractures in UBC are usually treated nonoperatively and the cyst itself is treated after fracture healing. Proximal femoral impairment is the exception from this rule because of weigh bearing
Neighborhoods and manageable proximity
Directory of Open Access Journals (Sweden)
Stavros Stavrides
2011-08-01
Full Text Available The theatricality of urban encounters is above all a theatricality of distances which allow for the encounter. The absolute “strangeness” of the crowd (Simmel 1997: 74 expressed, in its purest form, in the absolute proximity of a crowded subway train, does not generally allow for any movements of approach, but only for nervous hostile reactions and submissive hypnotic gestures. Neither forced intersections in the course of pedestrians or vehicles, nor the instantaneous crossing of distances by the technology of live broadcasting and remote control give birth to places of encounter. In the forced proximity of the metropolitan crowd which haunted the city of the 19th and 20th century, as well as in the forced proximity of the tele-presence which haunts the dystopic prospect of the future “omnipolis” (Virilio 1997: 74, the necessary distance, which is the stage of an encounter between different instances of otherness, is dissipated.
Digital contrast subtraction radiography for proximal caries diagnosis
International Nuclear Information System (INIS)
Kang, Byung Cheol; Yoon, Suk Ja
2002-01-01
To determine whether subtraction images utilizing contrast media can improve the diagnostic performance of proximal caries diagnosis compared to conventional periapical radiographic images. Thirty-six teeth with 57 proximal surfaces were radiographied using a size no.2 RVG-ui sensor (Trophy Radiology, Marne-la-Vallee, France). The teeth immersed in water-soluble contrast media and subtraction images were taken. Each tooth was then sectioned for histologic examination. The digital radiographic images and subtraction images were examined and interpreted by three dentists for proximal caries. The results of the proximal caries diagnosis were then verified with the results of the histologic examination. The proximal caries sensitivity using digital subtraction radiography was significantly higher than simply examining a single digital radiograph. The sensitivity of the proximal dentinal carious lesion when analyzed with the subtraction radiograph and the radiograph together was higher than with the subtraction radiograph or the radiograph alone. The use of subtraction radiography with contrast media may be useful for detecting proximal dentinal carious lesions.
Sex specific association of physical activity on proximal femur BMD in 9 to 10 year-old children.
Directory of Open Access Journals (Sweden)
Graça Cardadeiro
Full Text Available The results of physical activity (PA intervention studies suggest that adaptation to mechanical loading at the femoral neck (FN is weaker in girls than in boys. Less is known about gender differences associated with non-targeted PA levels at the FN or other clinically relevant regions of the proximal femur. Understanding sex-specific relationships between proximal femur sensitivity and mechanical loading during non-targeted PA is critical to planning appropriate public health interventions. We examined sex-specific associations between non-target PA and bone mineral density (BMD of three sub-regions of the proximal femur in pre- and early-pubertal boys and girls. BMD at the FN, trochanter (TR and intertrochanter (IT regions, and lean mass of the whole body were assessed using dual-energy x-ray absorptiometry in 161 girls (age: 9.7±0.3 yrs and 164 boys (age: 9.7±0.3 yrs. PA was measured using accelerometry. Multiple linear regression analyses (adjusted for body height, total lean mass and pubertal status revealed that vigorous PA explained 3-5% of the variability in BMD at all three sub-regions in boys. In girls, vigorous PA explained 4% of the variability in IT BMD and 6% in TR BMD. PA did not contribute to the variance in FN BMD in girls. An additional 10 minutes per day of vigorous PA would be expected to result in a ∼1% higher FN, TR, and IT BMD in boys (p<0.05 and a ∼2% higher IT and TR BMD in girls. In conclusion, vigorous PA can be expected to contribute positively to bone health outcomes for boys and girls. However, the association of vigorous PA to sub-regions of the proximal femur varies by sex, such that girlś associations are heterogeneous and the lowest at the FN, but stronger at the TR and the IT, when compared to boys.
Calculus Rules for V-Proximal Subdifferentials in Smooth Banach Spaces
Directory of Open Access Journals (Sweden)
Messaoud Bounkhel
2016-01-01
Full Text Available In 2010, Bounkhel et al. introduced new proximal concepts (analytic proximal subdifferential, geometric proximal subdifferential, and proximal normal cone in reflexive smooth Banach spaces. They proved, in p-uniformly convex and q-uniformly smooth Banach spaces, the density theorem for the new concepts of proximal subdifferential and various important properties for both proximal subdifferential concepts and the proximal normal cone concept. In this paper, we establish calculus rules (fuzzy sum rule and chain rule for both proximal subdifferentials and we prove the Bishop-Phelps theorem for the proximal normal cone. The limiting concept for both proximal subdifferentials and for the proximal normal cone is defined and studied. We prove that both limiting constructions coincide with the Mordukhovich constructions under some assumptions on the space. Applications to nonconvex minimisation problems and nonconvex variational inequalities are established.
Transverse and Longitudinal proximity effect
Jalan, Pryianka; Chand, Hum; Srianand, Raghunathan
2018-04-01
With close pairs (˜1.5arcmin) of quasars (QSOs), absorption in the spectra of a background quasar in the vicinity of a foreground quasar can be used to study the environment of the latter quasar at kpc-Mpc scales. For this we used a sample of 205 quasar pairs from the Sloan Digital Sky-Survey Data Release 12 (SDSS DR12) in the redshift range of 2.5 to 3.5 by studying their H I Ly-α absorption. We study the environment of QSOs both in the longitudinal as well as in the transverse direction by carrying out a statistical comparison of the Ly-α absorption lines in the quasar vicinity to that of the absorption lines caused by the inter-galactic medium (IGM). This comparison was done with IGM, matched in absorption redshift and signal-to-noise ratio (SNR) to that of the proximity region. In contrast to the measurements along the line-of-sight, the regions transverse to the quasars exhibit enhanced H I Ly-α absorption. This discrepancy can either be interpreted as due to an anisotropic emission from the quasars or as a consequence of their finite lifetime.
Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer
Directory of Open Access Journals (Sweden)
Jae Sook Sung
2012-09-01
Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.
Gary Jacobs; Wenping Ma; Burtron H. Davis
2014-01-01
This focused review article underscores how metal reduction promoters can impact deactivation phenomena associated with cobalt Fischer-Tropsch synthesis catalysts. Promoters can exacerbate sintering if the additional cobalt metal clusters, formed as a result of the promoting effect, are in close proximity at the nanoscale to other cobalt particles on the surface. Recent efforts have shown that when promoters are used to facilitate the reduction of small crystallites with the aim of increasing...
Directory of Open Access Journals (Sweden)
Agarwal RaviP
2009-01-01
Full Text Available We glance at recent advances to the general theory of maximal (set-valued monotone mappings and their role demonstrated to examine the convex programming and closely related field of nonlinear variational inequalities. We focus mostly on applications of the super-relaxed ( -proximal point algorithm to the context of solving a class of nonlinear variational inclusion problems, based on the notion of maximal ( -monotonicity. Investigations highlighted in this communication are greatly influenced by the celebrated work of Rockafellar (1976, while others have played a significant part as well in generalizing the proximal point algorithm considered by Rockafellar (1976 to the case of the relaxed proximal point algorithm by Eckstein and Bertsekas (1992. Even for the linear convergence analysis for the overrelaxed (or super-relaxed ( -proximal point algorithm, the fundamental model for Rockafellar's case does the job. Furthermore, we attempt to explore possibilities of generalizing the Yosida regularization/approximation in light of maximal ( -monotonicity, and then applying to first-order evolution equations/inclusions.
Treatment of proximal humerus fractures with locking plates: a systematic review.
Thanasas, Christos; Kontakis, George; Angoules, Antonios; Limb, David; Giannoudis, Peter
2009-01-01
Locking plates with special configuration for the anatomic region of the proximal humerus have been introduced recently to address the difficulties of stabilizing proximal humeral fractures. The purpose of this study was to carry out a systematic review of the literature on the efficacy and early to medium term functional results of locking plates for stabilization of proximal humeral fractures. Using the PubMed database, a systematic review of the English and German literature was carried out in order to assess the efficacy and complications related to the use of these plates and the patients' functional outcome, using the key words "locking plates proximal humeral fractures," "angular stability plates proximal humeral fractures," "PHILOS plate," and "LPHP plate." Our criteria for eligibility were clinical studies with more than ten cases followed-up, adult patients, and adequate data provided at least in terms of implant related complications. Articles written in English and German language were included. Exclusion criteria were: studies dealing exclusively with 2-part fractures (since this category has a more favorable outcome); experimental studies; case reports; and, literature other than English or German. Each one of the articles was evaluated for quality of the study using the Structured Effectiveness Quality Evaluation Scale (SEQES). Twelve studies including 791 patients met the inclusion criteria. Patients in these studies continued to improve up to one year, achieving a mean Constant score of 74.3. The incidence of the reported complications was: avascular necrosis 7.9%, screw cut-out 11.6% and re-operation rate 13.7%. The high incidence of cut-out may be secondary to the rigidity of the implant in combination with medial inadequate support, in cases compromised by severe underlying osteoporotic bone. Definition of indications for the use of locking plates and attention on technical aspects of applying them would help optimization of the results
Directory of Open Access Journals (Sweden)
Laurent Verkoczy
Full Text Available The membrane proximal external region (MPER of HIV-1 gp41 has several features that make it an attractive antibody-based vaccine target, but eliciting an effective gp41 MPER-specific protective antibody response remains elusive. One fundamental issue is whether the failure to make gp41 MPER-specific broadly neutralizing antibodies like 2F5 and 4E10 is due to structural constraints with the gp41 MPER, or alternatively, if gp41 MPER epitope-specific B cells are lost to immunological tolerance. An equally important question is how B cells interact with, and respond to, the gp41 MPER epitope, including whether they engage this epitope in a non-canonical manner i.e., by non-paratopic recognition via B cell receptors (BCR. To begin understanding how B cells engage the gp41 MPER, we characterized B cell-gp41 MPER interactions in BALB/c and C57BL/6 mice. Surprisingly, we found that a significant (approximately 7% fraction of splenic B cells from BALB/c, but not C57BL/6 mice, bound the gp41 MPER via their BCRs. This strain-specific binding was concentrated in IgM(hi subsets, including marginal zone and peritoneal B1 B cells, and correlated with enriched fractions (approximately 15% of gp41 MPER-specific IgM secreted by in vitro-activated splenic B cells. Analysis of Igh(a (BALB/c and Igh(b (C57BL/6 congenic mice demonstrated that gp41 MPER binding was controlled by determinants of the Igh(a locus. Mapping of MPER gp41 interactions with IgM(a identified MPER residues distinct from those to which mAb 2F5 binds and demonstrated the requirement of Fc C(H regions. Importantly, gp41 MPER ligation produced detectable BCR-proximal signaling events, suggesting that interactions between gp41 MPER and IgM(a determinants may elicit partial B cell activation. These data suggest that low avidity, non-paratopic interactions between the gp41 MPER and membrane Ig on naïve B cells may interfere with or divert bnAb responses.
Euler, Simon A; Petri, Maximilian; Venderley, Melanie B; Dornan, Grant J; Schmoelz, Werner; Turnbull, Travis Lee; Plecko, Michael; Kralinger, Franz S; Millett, Peter J
2017-09-01
Varus failure is one of the most common failure modes following surgical treatment of proximal humeral fractures. Straight antegrade nails (SAN) theoretically provide increased stability by anchoring to the densest zone of the proximal humerus (subchondral zone) with the end of the nail. The aim of this study was to biomechanically investigate the characteristics of this "proximal anchoring point" (PAP). We hypothesized that the PAP would improve stability compared to the same construct without the PAP. Straight antegrade humeral nailing was performed in 20 matched pairs of human cadaveric humeri for a simulated unstable two-part fracture. Biomechanical testing, with stepwise increasing cyclic axial loading (50-N increments each 100 cycles) at an angle of 20° abduction revealed significantly higher median loads to failure for SAN constructs with the PAP (median, 450 N; range, 200-1.000 N) compared to those without the PAP (median, 325 N; range, 100-500 N; p = 0.009). SAN constructs with press-fit proximal extensions (endcaps) showed similar median loads to failure (median, 400 N; range, 200-650 N), when compared to the undersized, commercially available SAN endcaps (median, 450 N; range, 200-600 N; p = 0.240). The PAP provided significantly increased stability in SAN constructs compared to the same setup without this additional proximal anchoring point. Varus-displacing forces to the humeral head were superiorly reduced in this setting. This study provides biomechanical evidence for the "proximal anchoring point's" rationale. Straight antegrade humeral nailing may be beneficial for patients undergoing surgical treatment for unstable proximal humeral fractures to decrease secondary varus displacement and thus potentially reduce revision rates.
Directory of Open Access Journals (Sweden)
James Dollman
2016-01-01
Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.
Silva, Pedro Henrique Imenez; Girardi, Adriana Castello Costa; Neri, Elida Adalgisa; Rebouças, Nancy Amaral
2012-04-01
The Na(+/)H(+) exchanger isoform 3 (NHE3) is essential for HCO(3)(-) reabsorption in renal proximal tubules. The expression and function of NHE3 must adapt to acid-base conditions. The goal of this study was to elucidate the mechanisms responsible for higher proton secretion in proximal tubules during acidosis and to evaluate whether there are differences between metabolic and respiratory acidosis with regard to NHE3 modulation and, if so, to identify the relevant parameters that may trigger these distinct adaptive responses. We achieved metabolic acidosis by lowering HCO(3)(-) concentration in the cell culture medium and respiratory acidosis by increasing CO(2) tension in the incubator chamber. We found that cell-surface NHE3 expression was increased in response to both forms of acidosis. Mild (pH 7.21 ± 0.02) and severe (6.95 ± 0.07) metabolic acidosis increased mRNA levels, at least in part due to up-regulation of transcription, whilst mild (7.11 ± 0.03) and severe (6.86 ± 0.01) respiratory acidosis did not up-regulate NHE3 expression. Analyses of the Nhe3 promoter region suggested that the regulatory elements sensitive to metabolic acidosis are located between -466 and -153 bp, where two consensus binding sites for SP1, a transcription factor up-regulated in metabolic acidosis, were localised. We conclude that metabolic acidosis induces Nhe3 promoter activation, which results in higher mRNA and total protein level. At the plasma membrane surface, NHE3 expression was increased in metabolic and respiratory acidosis alike, suggesting that low pH is responsible for NHE3 displacement to the cell surface.
Cellular localization of uranium in the renal proximal tubules during acute renal uranium toxicity.
Homma-Takeda, Shino; Kitahara, Keisuke; Suzuki, Kyoko; Blyth, Benjamin J; Suya, Noriyoshi; Konishi, Teruaki; Terada, Yasuko; Shimada, Yoshiya
2015-12-01
Renal toxicity is a hallmark of uranium exposure, with uranium accumulating specifically in the S3 segment of the proximal tubules causing tubular damage. As the distribution, concentration and dynamics of accumulated uranium at the cellular level is not well understood, here, we report on high-resolution quantitative in situ measurements by high-energy synchrotron radiation X-ray fluorescence analysis in renal sections from a rat model of uranium-induced acute renal toxicity. One day after subcutaneous administration of uranium acetate to male Wistar rats at a dose of 0.5 mg uranium kg(-1) body weight, uranium concentration in the S3 segment of the proximal tubules was 64.9 ± 18.2 µg g(-1) , sevenfold higher than the mean renal uranium concentration (9.7 ± 2.4 µg g(-1) ). Uranium distributed into the epithelium of the S3 segment of the proximal tubules and highly concentrated uranium (50-fold above mean renal concentration) in micro-regions was found near the nuclei. These uranium levels were maintained up to 8 days post-administration, despite more rapid reductions in mean renal concentration. Two weeks after uranium administration, damaged areas were filled with regenerating tubules and morphological signs of tissue recovery, but areas of high uranium concentration (100-fold above mean renal concentration) were still found in the epithelium of regenerating tubules. These data indicate that site-specific accumulation of uranium in micro-regions of the S3 segment of the proximal tubules and retention of uranium in concentrated areas during recovery are characteristics of uranium behavior in the kidney. Copyright © 2015 John Wiley & Sons, Ltd.
Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A
2009-11-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var
Genetic recombination is targeted towards gene promoter regions in dogs.
Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R
2013-01-01
The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.
International Nuclear Information System (INIS)
Toenjes, R.R.W.; Weith, A.; Rinchik, E.M.; Winking, H.; Carnwath, J.W.; Kaliner, B.; Paul, D.
1991-01-01
A group of radiation-induced perinatal-lethal deletions that include the albino (c) locus on mouse chromosome 7 causes failure of expression of various hepatocyte-specific genes when homozygous. The transcription of such genes could be controlled in trans by a regulatory gene(s) located within the proximal region of the C14CoS deletion. To identify this potential regulatory gene, a microclone library was established from microdissected D and E bands of chromosome 7. Three nonoverlapping microclones (E305, E336B, and E453B) hybridizing with wildtype but not with C14CoS/C14CoS DNA were isolated. E336B represents a single-copy DNA fragment, whereas E305 and E453B hybridized with 3 and 10 EcoRI DNA restriction fragments, respectively. All fragments map exclusively within the deletion. The microclones hybridized to DNA of viable C6H/C14CoS deletion heterozygotes but not to DNA of homozygotes for the lethal mutation c10R75M, which belongs to the same complementation group as c14CoS. DNA of viable homozygous mutant C62DSD, which carries a deletion breakpoint proximal to that of c6H, hybridized only with E453B. This microclone identified 6 EcoRI restriction fragments in C62DSD/C62DSD DNA. The results demonstrate that of the isolated microclones, E453B identifies a locus (D7RT453B) that maps closest to the hsdr-1 (hepatocyte-specific developmental regulation) locus, which maps between the proximal breakpoints of deletions c10R75M and c62DSD
Ishiura, Hiroyuki; Tsuji, Shoji
2013-01-01
Hereditary motor and sensory neuropathy with proximal dominant involvement (HMSN-P) is an autosomal dominant neurodegenerative disease characterized by proximal predominant weakness and muscle atrophy accompanied by distal sensory disturbance. Linkage analysis using 4 families identified a region on chromosome 3 showing a LOD score exceeding 4. Further refinement of candidate region was performed by haplotype analysis using high-density SNP data, resulting in a minimum candidate region spanning 3.3 Mb. Exome analysis of an HMSN-P patient revealed a mutation (c.854C>T, p.Pro285Leu) in TRK-fused gene (TFG). The identical mutation was found in the four families, which cosegregated with the disease. The mutation was neither found in Japanese control subjects nor public databases. Detailed haplotype analysis suggested two independent origins of the mutation. These findings indicate that the mutation in TFG causes HMSN-P.
Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung
2015-07-27
Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Restoration of regenerative ability of x-rayed newt limbs after grafting of proximal or distal skin
International Nuclear Information System (INIS)
Clarke, B.J.
1978-01-01
Studies were conducted in order to determine the role of skin in restoring regenerative ability of x-rayed newt limbs. Non-x-rayed skin from the hindlimb was grafted in four ways to x-rayed (2680R) forelimbs, stripped of their own skin: proximal hindlimb skin to the proximal forelimb, proximal hindlimb skin to the distal forelimb, distal hindlimb skin to the distal forelimb, and distal hindlimb skin to the proximal forelimb. The forelimbs were immediately amputated at the distal extent of the skin graft. Thirty-two of thirty-five (92%) x-rayed forelimbs that had received hindlimb skin regenerated. Of those that regenerated, 28.1% were hindlimbs as shown by the presence of five digits; 34.4% had four digits or less; 31.2% had an outgrowth, but no morphogenesis of digits and 6.3% had two hands. The level of the regenerate from x-rayed limbs was determined by the stump, not the hindlimb skin graft. Only proximal hindlimb skin grafts were able to promote the formation of single 5 digit regenerates. X-rayed forelimb skin was grafted onto x-rayed (2680R) hindlimbs after the hindlimb muscle and skin was removed. X-rayed hindlimbs that had received grafts of forelimb skin produced 5-digit regenerates in 6 of 11 cases (55%). Only 2 (18%) had four digits. The remaining animals (27%) exhibited bud-like regenerates. It is concluded that skin is capable of restoring regenerative ability of x-rayed limbs and that these limbs are able to participate in the production of the regenerate
Giant proximity effect in ferromagnetic bilayers
Ramos, Silvia; Charlton, Tim; Quintanilla, Jorge; Suter, Andreas; Moodera, Jagadeesh; Prokscha, Thomas; Salman, Zaher; Forgan, Ted
2013-03-01
The proximity effect is a phenomenon where an ordered state leaks from a material into an adjacent one over some finite distance, ξ. For superconductors, this distance is ~ the coherence length. Nevertheless much longer-range, ``giant'' proximity effects have been observed in cuprate junctions. This surprising effect can be understood as a consequence of critical opalescence. Since this occurs near all second order phase transitions, giant proximity effects should be very general and, in particular, they should be present in magnetic systems. The ferromagnetic proximity effect has the advantage that its order parameter (magnetization) can be observed directly. We investigate the above phenomenon in Co/EuS bilayer films, where both materials undergo ferromagnetic transitions but at rather different temperatures (bulk TC of 1400K for Co and 16.6K for EuS). A dramatic increase in the range of the proximity effect is expected near the TC of EuS. We present the results of our measurements of the magnetization profiles as a function of temperature, carried out using the complementary techniques of low energy muon rotation and polarized neutron reflectivity. Work supported by EPSRC, STFC and ONR grant N00014-09-1-0177 and NSF grant DMR 0504158.
International Nuclear Information System (INIS)
Rauscher, Garth H.; Kresovich, Jacob K.; Poulin, Matthew; Yan, Liying; Macias, Virgilia; Mahmoud, Abeer M.; Al-Alem, Umaima; Kajdacsy-Balla, Andre; Wiley, Elizabeth L.; Tonetti, Debra; Ehrlich, Melanie
2015-01-01
Breast cancer formation is associated with frequent changes in DNA methylation but the extent of very early alterations in DNA methylation and the biological significance of cancer-associated epigenetic changes need further elucidation. Pyrosequencing was done on bisulfite-treated DNA from formalin-fixed, paraffin-embedded sections containing invasive tumor and paired samples of histologically normal tissue adjacent to the cancers as well as control reduction mammoplasty samples from unaffected women. The DNA regions studied were promoters (BRCA1, CD44, ESR1, GSTM2, GSTP1, MAGEA1, MSI1, NFE2L3, RASSF1A, RUNX3, SIX3 and TFF1), far-upstream regions (EN1, PAX3, PITX2, and SGK1), introns (APC, EGFR, LHX2, RFX1 and SOX9) and the LINE-1 and satellite 2 DNA repeats. These choices were based upon previous literature or publicly available DNA methylome profiles. The percent methylation was averaged across neighboring CpG sites. Most of the assayed gene regions displayed hypermethylation in cancer vs. adjacent tissue but the TFF1 and MAGEA1 regions were significantly hypomethylated (p ≤0.001). Importantly, six of the 16 regions examined in a large collection of patients (105 – 129) and in 15-18 reduction mammoplasty samples were already aberrantly methylated in adjacent, histologically normal tissue vs. non-cancerous mammoplasty samples (p ≤0.01). In addition, examination of transcriptome and DNA methylation databases indicated that methylation at three non-promoter regions (far-upstream EN1 and PITX2 and intronic LHX2) was associated with higher gene expression, unlike the inverse associations between cancer DNA hypermethylation and cancer-altered gene expression usually reported. These three non-promoter regions also exhibited normal tissue-specific hypermethylation positively associated with differentiation-related gene expression (in muscle progenitor cells vs. many other types of normal cells). The importance of considering the exact DNA region analyzed and the
Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul
2010-05-14
The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society.
Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul
2010-01-01
The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society. PMID:20640020
International Nuclear Information System (INIS)
Heller, E.J.
1996-01-01
It is well known that at long wavelengths λ an s-wave scatterer can have a scattering cross section σ on the order of λ 2 , much larger than its physical size, as measured by the range of its potential. Very interesting phenomena can arise when two or more identical scatterers are placed close together, well within one wavelength. We show that, for a pair of identical scatterers, an extremely narrow p-wave open-quote open-quote proximity close-quote close-quote resonance develops from a broader s-wave resonance of the individual scatterers. A new s-wave resonance of the pair also appears. The relation of these proximity resonances (so called because they appear when the scatterers are close together) to the Thomas and Efimov effects is discussed. copyright 1996 The American Physical Society
Method to Measure Tone of Axial and Proximal Muscle
Gurfinkel, Victor S.; Cacciatore, Timothy W.; Cordo, Paul J.; Horak, Fay B.
2011-01-01
The control of tonic muscular activity remains poorly understood. While abnormal tone is commonly assessed clinically by measuring the passive resistance of relaxed limbs1, no systems are available to study tonic muscle control in a natural, active state of antigravity support. We have developed a device (Twister) to study tonic regulation of axial and proximal muscles during active postural maintenance (i.e. postural tone). Twister rotates axial body regions relative to each other about the vertical axis during stance, so as to twist the neck, trunk or hip regions. This twisting imposes length changes on axial muscles without changing the body's relationship to gravity. Because Twister does not provide postural support, tone must be regulated to counteract gravitational torques. We quantify this tonic regulation by the restive torque to twisting, which reflects the state of all muscles undergoing length changes, as well as by electromyography of relevant muscles. Because tone is characterized by long-lasting low-level muscle activity, tonic control is studied with slow movements that produce "tonic" changes in muscle length, without evoking fast "phasic" responses. Twister can be reconfigured to study various aspects of muscle tone, such as co-contraction, tonic modulation to postural changes, tonic interactions across body segments, as well as perceptual thresholds to slow axial rotation. Twister can also be used to provide a quantitative measurement of the effects of disease on axial and proximal postural tone and assess the efficacy of intervention. PMID:22214974
hypoxia-inducible factors activate CD133 promoter through ETS family transcription factors.
Directory of Open Access Journals (Sweden)
Shunsuke Ohnishi
Full Text Available CD133 is a cellular surface protein that has been reported to be a cancer stem cell marker, and thus it is considered to be a potential target for cancer treatment. However, the mechanism regulating CD133 expression is not yet understood. In this study, we analyzed the activity of five putative promoters (P1-P5 of CD133 in human embryonic kidney (HEK 293 cells and colon cancer cell line WiDr, and found that the activity of promoters, particularly of P5, is elevated by overexpression of hypoxia-inducible factors (HIF-1α and HIF-2α. Deletion and mutation analysis identified one of the two E-twenty six (ETS binding sites (EBSs in the P5 region as being essential for its promoter activity induced by HIF-1α and HIF-2α. In addition, a chromatin imunoprecipitation assay demonstrated that HIF-1α and HIF-2α bind to the proximal P5 promoter at the EBSs. The immunoprecipitation assay showed that HIF-1α physically interacts with Elk1; however, HIF-2α did not bind to Elk1 or ETS1. Furthermore, knockdown of both HIF-1α and HIF-2α resulted in a reduction of CD133 expression in WiDr. Taken together, our results revealed that HIF-1α and HIF-2α activate CD133 promoter through ETS proteins.
Predicting stimulation-dependent enhancer-promoter interactions from ChIP-Seq time course data
Directory of Open Access Journals (Sweden)
Tomasz Dzida
2017-09-01
Full Text Available We have developed a machine learning approach to predict stimulation-dependent enhancer-promoter interactions using evidence from changes in genomic protein occupancy over time. The occupancy of estrogen receptor alpha (ERα, RNA polymerase (Pol II and histone marks H2AZ and H3K4me3 were measured over time using ChIP-Seq experiments in MCF7 cells stimulated with estrogen. A Bayesian classifier was developed which uses the correlation of temporal binding patterns at enhancers and promoters and genomic proximity as features to predict interactions. This method was trained using experimentally determined interactions from the same system and was shown to achieve much higher precision than predictions based on the genomic proximity of nearest ERα binding. We use the method to identify a genome-wide confident set of ERα target genes and their regulatory enhancers genome-wide. Validation with publicly available GRO-Seq data demonstrates that our predicted targets are much more likely to show early nascent transcription than predictions based on genomic ERα binding proximity alone.
Biazzo, Alessio; Cardile, Carlo; Brunelli, Luca; Ragni, Paolo; Clementi, Daniele
2017-04-28
The management of displaced 2- and 3-part fractures of the proximal humerus is controversial, both in younger and in elderly patients. The purpose of this paper is to evaluate the functional results of the Contours Proximal Humerus Plate (OrthofixR, Bussolengo,Verona, Italy), for the treatment of displaced 2- and 3-part fractures of the proximal humerus. We retrospectively reviewed 55 patients with proximal humerus fractures, who underwent osteosynthesis with Contours Proximal Humerus Plate from December 2011 to March 2015. We had 21 patients with 2-part fractures and with an average age of 67.1 years and 34 patients with 3-part fractures, with average age of 63.6 years. The average union time was 3 months. The mean Constant score was 67 for 2-part fracture group and 64.9 for 3-part fracture group. The difference was not statistically significant (p = 0.18). The overall complication rate was 14.5 %. Six patients underwent additional surgery (10.9%). The most frequent major complication was secondary loss of reduction following varus collapse of the fracture (2 cases). In these patients, there was loss of medial hinge integrity due to impaction and osteoporosis. The placement of the main locking screw in the calcar area to provide inferomedial support is the rational of the Contours Proximal Humerus Plate. Osteosynthesis with Contours Proximal Humerus Plate is a safe system for treating displaced 2- and 3-part fractures of the proximal humerus, with good functional results and complication rates comparable to those reported in the literature.
Directory of Open Access Journals (Sweden)
Fiona Mactaggart
2017-08-01
Full Text Available Abstract Background There is some concern that coal seam gas mining may affect health and wellbeing through changes in social determinants such as living and working conditions, local economy and the environment. The onward impact of these conditions on health and wellbeing is often not monitored to the same degree as direct environmental health impacts in the mining context, but merits attention. This study reports on the findings from a recurrent theme that emerged from analysis of the qualitative component of a comprehensive Health Needs Assessment (HNA conducted in regional Queensland: that health and wellbeing of communities was reportedly affected by nearby coal seam gas (CSG development beyond direct environmental impacts. Methods Qualitative analysis was initially completed using the Framework Method to explore key themes from 11 focus group discussions, 19 in-depth interviews, and 45 key informant interviews with health and wellbeing service providers and community members. A key theme emerged from the analysis that forms the basis of this paper. This study is part of a larger comprehensive HNA involving qualitative and quantitative data collection to explore the health and wellbeing needs of three communities living in proximity to CSG development in regional Queensland, Australia. Results Communities faced social, economic and environmental impacts from the rapid growth of CSG development, which were perceived to have direct and indirect effects on individual lifestyle factors such as alcohol and drug abuse, family relationships, social capital and mental health; and community-level factors including social connectedness, civic engagement and trust. Conclusions Outer regional communities discussed the effects of mining activity on the fabric of their town and community, whereas the inner regional community that had a longer history of industrial activity discussed the impacts on families and individual health and wellbeing. The
Revised draft: North Central Regional environmental characterization report. Volume 1
International Nuclear Information System (INIS)
1984-11-01
This report presents available environmental information pertinent to siting a repository for high-level nuclear waste in crystalline rock in Minnesota, Wisconsin, and the Upper Peninsula of Michigan. For each of the states within the North Central Region, information is provided on those environmental disqualifying factors and regional screening variables to be used in region-to-area screening. These environmental factors and variables include existing and proposed federal protected lands, proximity to federal protected lands, existing state protected lands, proximity to state protected lands, population density and distribution, proximity to highly populated areas, national and state forest lands, state wildlife lands, designated critical habitats for threatened and endangered species, surface water bodies, and wetlands. In addition, supplementary descriptive information providing a general characterization of the region is presented, as is information on environmental parameters that may be of use at later phases of screening. Also included is a discussion of the relationship between the DOE Siting Guidelines and those environmental disqualifying factors and regional screening variables to be used in the region-to-area screening process
Geography and similarity of regional cuisines in China.
Zhu, Yu-Xiao; Huang, Junming; Zhang, Zi-Ke; Zhang, Qian-Ming; Zhou, Tao; Ahn, Yong-Yeol
2013-01-01
Food occupies a central position in every culture and it is therefore of great interest to understand the evolution of food culture. The advent of the World Wide Web and online recipe repositories have begun to provide unprecedented opportunities for data-driven, quantitative study of food culture. Here we harness an online database documenting recipes from various Chinese regional cuisines and investigate the similarity of regional cuisines in terms of geography and climate. We find that geographical proximity, rather than climate proximity, is a crucial factor that determines the similarity of regional cuisines. We develop a model of regional cuisine evolution that provides helpful clues for understanding the evolution of cuisines and cultures.
Geography and Similarity of Regional Cuisines in China
Zhu, Yu-Xiao; Huang, Junming; Zhang, Zi-Ke; Zhang, Qian-Ming; Zhou, Tao; Ahn, Yong-Yeol
2013-01-01
Food occupies a central position in every culture and it is therefore of great interest to understand the evolution of food culture. The advent of the World Wide Web and online recipe repositories have begun to provide unprecedented opportunities for data-driven, quantitative study of food culture. Here we harness an online database documenting recipes from various Chinese regional cuisines and investigate the similarity of regional cuisines in terms of geography and climate. We find that geographical proximity, rather than climate proximity, is a crucial factor that determines the similarity of regional cuisines. We develop a model of regional cuisine evolution that provides helpful clues for understanding the evolution of cuisines and cultures. PMID:24260166
Proximal Hamstring Tendinosis and Partial Ruptures.
Startzman, Ashley N; Fowler, Oliver; Carreira, Dominic
2017-07-01
Proximal hamstring tendinosis and partial hamstring origin ruptures are painful conditions of the proximal thigh and hip that may occur in the acute, chronic, or acute on chronic setting. Few publications exist related to their diagnosis and management. This systematic review discusses the incidence, treatment, and prognosis of proximal hamstring tendinosis and partial hamstring ruptures. Conservative treatment measures include nonsteroidal anti-inflammatory drugs, physical therapy, rest, and ice. If these measures fail, platelet-rich plasma or shockwave therapy may be considered. When refractory to conservative management, these injuries may be treated with surgical debridement and hamstring reattachment. [Orthopedics. 2017; 40(4):e574-e582.]. Copyright 2017, SLACK Incorporated.
DEFF Research Database (Denmark)
Gyan, B A; Goka, B; Cvetkovic, J T
2004-01-01
Immunoglobulin E has been associated with severe malaria suggesting a regulatory role for interleukin (IL)-4 and/or IgE in the pathogenesis of severe malaria. We have investigated possible associations between polymorphisms in the IL-4 repeat region (intron 3) and promoter regions (IL-4 +33CT and...
Revised draft: Northeastern Regional environmental characterization report. Volume 1
International Nuclear Information System (INIS)
1984-11-01
This report presents available environmental information pertinent to siting a repository for high-level nuclear waste in crystalline rock in Maine, New Hampshire, Vermont, northeastern and southeastern New York, Massachusetts, Rhode Island, Connecticut, northern New Jersey, and eastern Pennsylvania. For each of the states within the Northeastern Region, information is provided on those environmental disqualifying factors and regional screening variables to be used in region-to-area screening. These environmental factors and variables include existing and proposed federal protected lands, proximity to federal protected lands, existing state protected lands, proximity to state protected lands, population density and distribution, proximity to highly populated areas, national and state forest lands, state wildlife lands, designated critical habitats for threatened and endangered species, surface water bodies, and wetlands. In addition, supplementary descriptive information providing a general characterization of the region is presented, as is information on environmental parameters that may be of use at later phases of screening. Also included is a discussion of the relationship between the US Department of Energy (DOE) Siting Guidelines and those environmental disqualifying factors and regional screening variables to be used in the region-to-area screening process
Revised draft: Southeastern Regional environmental characterization report. Volume 1
International Nuclear Information System (INIS)
1984-11-01
This report presents available environmental information pertinent to siting a repository for high-level nuclear waste in crystalline rock in central Maryland; noncoastal Virginia, North Carolina, and South Carolina; and northern Georgia. For each of the states within the Southeastern Region, information is provided on those environmental disqualifying factors and regional screening variables to be used in region-to-area screening. These environmental factors and variables include existing and proposed federal protected lands, proximity to federal protected lands, existing state protected lands, proximity to state protected lands, population density and distribution, proximity to highly populated areas, national and state forest lands, state wild-life lands, designated critical habitats for threatened and endangered species, surface water bodies, and wetlands. In addition, supplementary descriptive information providing a general characterization of the region is presented, as is information on environmental parameters that may be of use at later phases of screening. Also included is a discussion of the relationship between the US Department of Energy (DOE) Siting Guidelines and those environmental disqualifying factors and regional screening variables to be used in the region-to-area screening process
Southeastern Regional Environmental Characterization Report. Volume 1. Final report
International Nuclear Information System (INIS)
1985-08-01
This report presents available environmental information pertinent to siting a repository for high-level nuclear waste in crystalline rock in central Maryland; noncoastal Virginia, North Carolina, and South Carolina; and northern Georgia. For each of the States within the Southeastern Region, information is provided on those environmental disqualifying factors and regional screening variables to be used in region-to-area screening. These environmental factors and variables include existing and proposd Federal-protected lands, components of National Forest Lands, proximity to Federal-protected lands, existing State-protected lands, proximity to State-protected lands, population density and distribution, proximity to highly populated areas, or to 1-mile-square areas with 1000 or more persons, national and State forest lands, designated critical habitats for threatened and endangered species, surface water bodies, and wetlands. In addition, supplementary descriptive information providing a general characterization of the region is presented, as is information on environmental parameters that will be of use at later phases of screening. Also included is a discussion of the relationship between the US Department of Energy Siting Guidelines (10 CFR 960) and those environmental disqualifying factors and regional screening variables to be used in the region-to-area screening process
Proximal Participation: A Pathway into Work
Chan, Selena
2013-01-01
In a longitudinal case study of apprentices, the term proximal participation was coined to describe the entry process of young people, with unclear career destinations, into the trade of baking. This article unravels the significance of proximal participation in the decision-making processes of young people who enter a trade through initial…
Adding a PECS II block for proximal arm arteriovenous access - a randomised study.
Quek, K H; Low, E Y; Tan, Y R; Ong, A S C; Tang, T Y; Kam, J W; Kiew, A S C
2018-05-01
Brachial plexus block is often utilised for proximal arm arteriovenous access creation. However, the medial upper arm and axilla are often inadequately anaesthetised, requiring repeated, intraoperative local anaesthetic supplementation, or conversion into general anaesthesia. We hypothesised that the addition of a PECS II block would improve anaesthesia and analgesia for proximal arm arteriovenous access surgery. In this prospective, double-blinded, randomised proof-of-concept study, 36 consenting adults with end-stage renal disease aged between 21 and 90 years received either a combined supraclavicular and PECS II block (Group PECS, n = 18), or combined supraclavicular and sham block (Group SCB, n = 18) for proximal arm arteriovenous access surgery. Primary outcome was whether patients required intraoperative local anaesthetic supplementation by the surgeon. In Group PECS, 33.3% (6/18) needed local anaesthetic supplementation vs. 100% (18/18) in Group SCB. Group SCB had three times (RR 3.0, 95% CI 1.6-5.8; P PECS required lower volume of supplemental local anaesthetic compared to Group SCB (0.0 ml, IQR 0.0-6.3 ml vs. 15.0 ml, IQR 7.4-17.8 ml; P PECS II block to a supraclavicular block improves regional anaesthesia for patients with end-stage renal disease undergoing proximal arm arteriovenous access surgery. © 2018 The Acta Anaesthesiologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Emily A. Byrd
2017-11-01
Full Text Available Alphaviruses are members of a group of small enveloped RNA viruses that includes important human pathogens such as Chikungunya virus and the equine encephalitis viruses. The virus membrane is covered by a lattice composed of 80 spikes, each a trimer of heterodimers of the E2 and E1 transmembrane proteins. During virus endocytic entry, the E1 glycoprotein mediates the low-pH-dependent fusion of the virus membrane with the endosome membrane, thus initiating virus infection. While much is known about E1 structural rearrangements during membrane fusion, it is unclear how the E1/E2 dimer dissociates, a step required for the fusion reaction. A recent Alphavirus cryo-electron microscopy reconstruction revealed a previously unidentified D subdomain in the E2 ectodomain, close to the virus membrane. A loop within this region, here referred to as the D-loop, contains two highly conserved histidines, H348 and H352, which were hypothesized to play a role in dimer dissociation. We generated Semliki Forest virus mutants containing the single and double alanine substitutions H348A, H352A, and H348/352A. The three D-loop mutations caused a reduction in virus growth ranging from 1.6 to 2 log but did not significantly affect structural protein biosynthesis or transport, dimer stability, virus fusion, or specific infectivity. Instead, growth reduction was due to inhibition of a late stage of virus assembly at the plasma membrane. The virus particles that are produced show reduced thermostability compared to the wild type. We propose the E2 D-loop as a key region in establishing the E1-E2 contacts that drive glycoprotein lattice formation and promote Alphavirus budding from the plasma membrane.
Estradiol represses Insulin-like 3 expression and promoter activity in MA-10 Leydig cells
International Nuclear Information System (INIS)
Lague, Eric; Tremblay, Jacques J.
2009-01-01
There are increasing evidence in the literature reporting the detrimental effects of endocrine disruptors on the development and function of the male reproductive system. One example is cryptorchidism, or undescended testis, caused by exposure to excessive estrogens. Estrogens, acting through the estrogen receptor α (ERα), have been shown to repress expression of the gene encoding insulin-like 3 (INSL3), a small peptide produced by testicular Leydig cells that is essential for normal testis descent. The molecular mechanism of estrogen/ER action on Insl3 expression, however, remains poorly understood. Here we report estradiol (E 2 ) represses Insl3 mRNA levels in MA-10 cells, a Leydig cell line model. We also found that E 2 represses the activity of the human and mouse Insl3 promoter in these cells. The E 2 -responsive region of the human INSL3 promoter was located to the proximal INSL3 promoter. This region does not contain a consensus estrogen response element indicating an indirect mechanism of action. In agreement with this, we found that E 2 -responsiveness was lost when two previously characterized binding sites for the nuclear receptors NUR77 and SF1 were mutated. Finally we show that the E 2 repressive effect could be overcome by cotreatment with testosterone, a positive regulator of Insl3 transcription. Collectively our data provide important new insights into the molecular mechanism of estrogen action in Insl3 transcription in Leydig cells
Ultimate and proximate explanations of strong reciprocity.
Vromen, Jack
2017-08-23
Strong reciprocity (SR) has recently been subject to heated debate. In this debate, the "West camp" (West et al. in Evol Hum Behav 32(4):231-262, 2011), which is critical of the case for SR, and the "Laland camp" (Laland et al. in Science, 334(6062):1512-1516, 2011, Biol Philos 28(5):719-745, 2013), which is sympathetic to the case of SR, seem to take diametrically opposed positions. The West camp criticizes advocates of SR for conflating proximate and ultimate causation. SR is said to be a proximate mechanism that is put forward by its advocates as an ultimate explanation of human cooperation. The West camp thus accuses advocates of SR for not heeding Mayr's original distinction between ultimate and proximate causation. The Laland camp praises advocates of SR for revising Mayr's distinction. Advocates of SR are said to replace Mayr's uni-directional view on the relation between ultimate and proximate causes by the bi-directional one of reciprocal causation. The paper argues that both the West camp and the Laland camp misrepresent what advocates of SR are up to. The West camp is right that SR is a proximate cause of human cooperation. But rather than putting forward SR as an ultimate explanation, as the West camp argues, advocates of SR believe that SR itself is in need of ultimate explanation. Advocates of SR tend to take gene-culture co-evolutionary theory as the correct meta-theoretical framework for advancing ultimate explanations of SR. Appearances notwithstanding, gene-culture coevolutionary theory does not imply Laland et al.'s notion of reciprocal causation. "Reciprocal causation" suggests that proximate and ultimate causes interact simultaneously, while advocates of SR assume that they interact sequentially. I end by arguing that the best way to understand the debate is by disambiguating Mayr's ultimate-proximate distinction. I propose to reserve "ultimate" and "proximate" for different sorts of explanations, and to use other terms for distinguishing
Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.
2009-01-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of
Prosthetic replacement for proximal humeral fractures.
Kontakis, George; Tosounidis, Theodoros; Galanakis, Ioannis; Megas, Panagiotis
2008-12-01
The ideal management of complex proximal humeral fractures continues to be debatable. Evolution of proximal humeral fracture management, during the past decade, led to the implementation of many innovations in surgical treatment. Even though the pendulum of treatment seems to swing towards new trends such as locked plating, hemiarthroplasty remains a valid and reliable option that serves the patient's needs well. Hemiarthroplasty is indicated for complex proximal humeral fractures in elderly patients with poor bone stock and when internal fixation is difficult or unreliable. Hemiarthroplasty provides a better result when it is performed early post-injury. Stem height, retroversion and tuberosity positioning are technical aspects of utmost importance. Additionally reverse total shoulder arthroplasty is an alternative new modality that can be used as a primary solution in selected patients with proximal humeral fracture treatment. Failed hemiarthroplasty and fracture sequelae can be successfully managed with reverse total shoulder arthroplasty. Individual decision-making and tailored treatment that takes into consideration the personality of the fracture and the patient's characteristics should be used.
Cellular specificity of HIV-1 replication can be controlled by LTR sequences
International Nuclear Information System (INIS)
Reed-Inderbitzin, Edward; Maury, Wendy
2003-01-01
Two well-established determinants of retroviral tropism are envelope sequences that regulate entry and LTR sequences that can regulate viral expression in a cell-specific manner. Studies with human immunodeficiency virus-1 (HIV-1) have demonstrated that tropism of this virus maps primarily to variable envelope sequences. Studies have demonstrated that T cell and macrophage-specific transcription factor binding motifs exist in the upstream region of the LTR U3; however, the ability of the core enhancer/promoter proximal elements (two NF-κB and three Sp1 sites) to function well in macrophages and T cells have led many to conclude that HIV LTR sequences are not primary determinants of HIV tropism. To determine if cellular specificity could be imparted to HIV by the core enhancer elements, the enhancer/promoter proximal region of the HIV LTR was substituted with motifs that control gene expression in a myeloid-specific manner. The enhancer region from equine infectious anemia virus (EIAV) when substituted for the HIV enhancer/promoter proximal region was found to drive expression in a macrophage-specific manner and was responsive to HIV Tat. The addition of a 5' methylation-dependent binding site (MDBP) and a promoter proximal Sp1 motif increased expression without altering cellular specificity. Spacing between the promoter proximal region and the TATA box was also found to influence LTR activity. Infectivity studies using chimeric LTRs within the context of a dual-tropic infectious molecular clone established that these LTRs directed HIV replication and production of infectious virions in macrophages but not primary T cells or T cell lines. This investigation demonstrates that cellular specificity can be imparted onto HIV-1 replication at the level of viral transcription and not entry
Industrial Computed Tomography using Proximal Algorithm
Zang, Guangming
2016-04-14
In this thesis, we present ProxiSART, a flexible proximal framework for robust 3D cone beam tomographic reconstruction based on the Simultaneous Algebraic Reconstruction Technique (SART). We derive the proximal operator for the SART algorithm and use it for minimizing the data term in a proximal algorithm. We show the flexibility of the framework by plugging in different powerful regularizers, and show its robustness in achieving better reconstruction results in the presence of noise and using fewer projections. We compare our framework to state-of-the-art methods and existing popular software tomography reconstruction packages, on both synthetic and real datasets, and show superior reconstruction quality, especially from noisy data and a small number of projections.
Osteomyelitis of the proximal sesamoid bone in a horse - a case report
International Nuclear Information System (INIS)
Kofler, J.
1994-01-01
Suppurative osteomyelitis of the lateral proximal sesamoid bone and chronic septic tenosynovitis of the digital flexor tendon sheath of the right hind limb was diagnosed in a 8 year old warmblood mare. Three months earlier the horse had received a puncture wound in the plantar fetlock region, penetrating the plantar annular ligament, tendon sheath and intersesamoidian ligament up to the plantaro-axial surface of the lateral sesamoid bone. The clinical, radiographic and ultrasonographic findings are described. The horse showed grade 2 / 4 right hindlimb lameness, marked thickening of the entire digital flexor tendon sheath area as well as the puncture wound in the middle of the annular ligament region. Radiographs revealed a 10 x 12 mm centro-axial, circular translucent lesion and marked bony proliferation on the abaxial and plantar margins of the lateral proximal sesamoid. Adhesions and marked anechoic areas between the plantar septum of the tendon sheath and the superficial flexor tendon, a thickening of the plantar annular ligament and structural alterations of the deep flexor tendon were demonstrated by sonography. Due to these severe findings a very poor prognosis was given and therefore surgery was not recommended. The horse was euthanized 4 months later as a result of further deterioration. Additional clinical, radiographic and sonographic findings as well as post mortem findings are mentioned. Gross pathology showed a fibrino-purulent tenosynovitis of the digital flexor tendon sheath and tendinitis of both flexor tendons, as well as a fistulous lesion of the intersesamoidian ligament over the lateral proximal sesamoid bone. The patho-histologic examination revealed focal suppurative osteomyelitis of the lateral sesamoid bone with necrotic bone tissue in the osteolytic area and accumulated neutrophils and macrophages [de
Directory of Open Access Journals (Sweden)
Anttila Esa
2011-05-01
Full Text Available Abstract Background Hip resurfacing arthroplasty (HRA is considered a bone-preserving procedure and may eliminate proximal femoral stress shielding and osteolysis. However, in addition to implant-related stress-shielding factors, various patient-related factors may also have an effect on bone mineral density (BMD of the proximal femur in patients with HRA. Thus, we studied the effects of stem-neck angle, demographic variables, and physical functioning on the BMD of the proximal femur in a one-year follow-up. Methods Thirty three patients (9 females and 24 males with a mean (SD age of 55 (9 years were included in the study. BMD was measured two days and 3, 6, and 12 months postoperatively and 10 regions of interest (ROI were used. Stem-neck angle was analyzed from anteroposterior radiographs. Results Three months postoperatively, BMD decreased in six out of 10 regions of interest (ROI on the side operated on and in one ROI on the control side (p Conclusions After an early drop, the BMD of the upper femur was restored and even exceeded the preoperative level at one year follow-up. From a clinical standpoint, the changes in BMD in these HRA patients could not be explained by stem-neck angle or patient related factors.
Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J
2005-03-01
Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.
Proximity sensor system development. CRADA final report
Energy Technology Data Exchange (ETDEWEB)
Haley, D.C. [Oak Ridge National Lab., TN (United States); Pigoski, T.M. [Merrit Systems, Inc. (United States)
1998-01-01
Lockheed Martin Energy Research Corporation (LMERC) and Merritt Systems, Inc. (MSI) entered into a Cooperative Research and Development Agreement (CRADA) for the development and demonstration of a compact, modular proximity sensing system suitable for application to a wide class of manipulator systems operated in support of environmental restoration and waste management activities. In teleoperated modes, proximity sensing provides the manipulator operator continuous information regarding the proximity of the manipulator to objects in the workspace. In teleoperated and robotic modes, proximity sensing provides added safety through the implementation of active whole arm collision avoidance capabilities. Oak Ridge National Laboratory (ORNL), managed by LMERC for the United States Department of Energy (DOE), has developed an application specific integrated circuit (ASIC) design for the electronics required to support a modular whole arm proximity sensing system based on the use of capacitive sensors developed at Sandia National Laboratories. The use of ASIC technology greatly reduces the size of the electronics required to support the selected sensor types allowing deployment of many small sensor nodes over a large area of the manipulator surface to provide maximum sensor coverage. The ASIC design also provides a communication interface to support sensor commands from and sensor data transmission to a distributed processing system which allows modular implementation and operation of the sensor system. MSI is a commercial small business specializing in proximity sensing systems based upon infrared and acoustic sensors.
Proximity sensor system development. CRADA final report
International Nuclear Information System (INIS)
Haley, D.C.; Pigoski, T.M.
1998-01-01
Lockheed Martin Energy Research Corporation (LMERC) and Merritt Systems, Inc. (MSI) entered into a Cooperative Research and Development Agreement (CRADA) for the development and demonstration of a compact, modular proximity sensing system suitable for application to a wide class of manipulator systems operated in support of environmental restoration and waste management activities. In teleoperated modes, proximity sensing provides the manipulator operator continuous information regarding the proximity of the manipulator to objects in the workspace. In teleoperated and robotic modes, proximity sensing provides added safety through the implementation of active whole arm collision avoidance capabilities. Oak Ridge National Laboratory (ORNL), managed by LMERC for the United States Department of Energy (DOE), has developed an application specific integrated circuit (ASIC) design for the electronics required to support a modular whole arm proximity sensing system based on the use of capacitive sensors developed at Sandia National Laboratories. The use of ASIC technology greatly reduces the size of the electronics required to support the selected sensor types allowing deployment of many small sensor nodes over a large area of the manipulator surface to provide maximum sensor coverage. The ASIC design also provides a communication interface to support sensor commands from and sensor data transmission to a distributed processing system which allows modular implementation and operation of the sensor system. MSI is a commercial small business specializing in proximity sensing systems based upon infrared and acoustic sensors
Directory of Open Access Journals (Sweden)
Fabio Afranio de Aguiar Junior
2013-09-01
Full Text Available OBJECTIVE: This study aimed to evaluate the importance of a distal proximal contact on the load transfer to the posterior region of the mandible by non-splinted adjacent implant-supported crowns using photoelastic stress analysis. MATERIAL AND METHODS: A rectangular model (68x30x15 mm was made of polymethylmethacrylate resin to simulate half of the mandibular arch. One model was completed with resin replicas representing the first premolar and second molar and with two 3.75 mm dia.x11 mm internal hexagon threaded implants replacing the second premolar and first molar. The other model was manufactured in the same way but without the second molar. Both models were duplicated using photoelastic resin. The roots of the teeth replicas were covered with a layer of polyether impression material to simulate the periodontal ligament. Two different vertical loads were applied to the crowns as follows: 1 - single static point load alternately applied to the crowns replacing the second premolar and first molar (50 N; 2 - simultaneous static point loads applied to both of the crowns replacing the second premolar and first molar (100 N. The resulting isochromatic fringe pattern in the photoelastic model was monitored and photographed. RESULTS: All loading conditions studied showed that the presence of the second molar has changed the load transmission and the pattern of stresses. CONCLUSION: Results showed that the presence of a second molar proximal contact can help minimize the stresses around the implants.
Locking plate fixation for proximal humerus fractures.
LENUS (Irish Health Repository)
Burke, Neil G
2012-02-01
Locking plates are increasingly used to surgically treat proximal humerus fractures. Knowledge of the bone quality of the proximal humerus is important. Studies have shown the medial and dorsal aspects of the proximal humeral head to have the highest bone strength, and this should be exploited by fixation techniques, particularly in elderly patients with osteoporosis. The goals of surgery for proximal humeral fractures should involve minimal soft tissue dissection and achieve anatomic reduction of the head complex with sufficient stability to allow for early shoulder mobilization. This article reviews various treatment options, in particular locking plate fixation. Locking plate fixation is associated with a high complication rate, such as avascular necrosis (7.9%), screw cutout (11.6%), and revision surgery (13.7%). These complications are frequently due to the varus deformation of the humeral head. Strategic screw placement in the humeral head would minimize the possibility of loss of fracture reduction and potential hardware complications. Locking plate fixation is a good surgical option for the management of proximal humerus fractures. Complications can be avoided by using better bone stock and by careful screw placement in the humeral head.
Proximal collagenous gastroenteritides:
DEFF Research Database (Denmark)
Nielsen, Ole Haagen; Riis, Lene Buhl; Danese, Silvio
2014-01-01
AIM: While collagenous colitis represents the most common form of the collagenous gastroenteritides, the collagenous entities affecting the proximal part of the gastrointestinal tract are much less recognized and possibly overlooked. The aim was to summarize the latest information through a syste...
Directory of Open Access Journals (Sweden)
Aebi Stefan
2008-10-01
Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.
Boundary Dpp promotes growth of medial and lateral regions of the Drosophila wing.
Barrio, Lara; Milán, Marco
2017-07-04
The gradient of Decapentaplegic (Dpp) in the Drosophila wing has served as a paradigm to characterize the role of morphogens in regulating patterning. However, the role of this gradient in regulating tissue size is a topic of intense debate as proliferative growth is homogenous. Here, we combined the Gal4/UAS system and a temperature-sensitive Gal80 molecule to induce RNAi-mediated depletion of dpp and characterise the spatial and temporal requirement of Dpp in promoting growth. We show that Dpp emanating from the AP compartment boundary is required throughout development to promote growth by regulating cell proliferation and tissue size. Dpp regulates growth and proliferation rates equally in central and lateral regions of the developing wing appendage and reduced levels of Dpp affects similarly the width and length of the resulting wing. We also present evidence supporting the proposal that graded activity of Dpp is not an absolute requirement for wing growth.
Effect of a feed/fast protocol on pH in the proximal equine stomach.
Husted, L; Sanchez, L C; Baptiste, K E; Olsen, S N
2009-09-01
Risk factors for the development of gastric squamous ulcers include various management procedures, such as intermittent feed deprivation that can occur during weight management regimens or stall and dry lot confinement. To investigate the effect of intermittent feed deprivation relative to continuous feed intake on proximal intragastric pH, specifically in the region of the squamous mucosa of the lesser curvature. In 6 horses, pH electrodes were placed just inside of the oesophageal sphincter in the stomach for each of two 72 h protocols (A and B) in a randomised, cross-over design. Protocol A consisted of 12 h fed, 12 h fasted, 24 h fed and 24 h fasted, in sequence. Protocol B consisted of 72 h fed. During the fed periods of each protocol, horses had ad libitum access to coastal Bermuda hay and were fed sweet feed (1 kg, b.i.d.). Horses had ad libitum access to water at all times. Proximal intragastric pH was significantly lower during protocol A, than during protocol B. However, hourly mean pH was significantly different only during the day and evening hours between protocols. During protocol B, mean proximal pH decreased significantly from 03.00 to 09.00 compared to 19.00 to 23.00 h. A moderate positive correlation of hay intake vs. proximal gastric pH could be established. Intermittent feed deprivation decreased proximal gastric pH in horses relative to those horses for which feed was not restricted. However, the effect was only significant when fasting occurred during the day and evening hours, as a nocturnal decrease in pH occurred simultaneously in the fed horses. Episodes of daytime feed deprivation should be avoided if possible, as proximal gastric acid exposure rapidly increases during such events.
Maternal residential proximity to nuclear facilities and low birth weight in offspring in Texas
International Nuclear Information System (INIS)
Gong, Xi; Lin, Yan; Benjamin Zhan, F.
2017-01-01
Health effects of close residential proximity to nuclear facilities have been a concern for both the general public and health professionals. Here, a study is reported examining the association between maternal residential proximity to nuclear facilities and low birth weight (LBW) in offspring using data from 1996 through 2008 in Texas, USA. A case-control study design was used together with a proximity-based model for exposure assessment. First, the LBW case/control births were categorized into multiple proximity groups based on distances between their maternal residences and nuclear facilities. Then, a binary logistic regression model was used to examine the association between maternal residential proximity to nuclear facilities and low birth weight in offspring. The odds ratios were adjusted for birth year, public health region of maternal residence, child's sex, gestational weeks, maternal age, education, and race/ethnicity. In addition, sensitivity analyses were conducted for the model. Compared with the reference group (more than 50 km from a nuclear facility), the exposed groups did not show a statistically significant increase in LBW risk [adjusted odds ratio (aOR) 0.91 (95% confidence interval (CI): 0.81, 1.03) for group 40-50 km; aOR 0.98 (CI 0.84, 1.13) for group 30-40 km; aOR 0.95 (CI 0.79, 1.15) for group 20-30 km; aOR 0.86 (CI 0.70, 1.04) for group 10-20 km; and aOR 0.98 (CI 0.59, 1.61) for group 0-10 km]. These results were also confirmed by results of the sensitivity analyses. The results suggest that maternal residential proximity to nuclear facilities is not a significant factor for LBW in offspring. (orig.)
Maternal residential proximity to nuclear facilities and low birth weight in offspring in Texas
Energy Technology Data Exchange (ETDEWEB)
Gong, Xi; Lin, Yan [University of New Mexico, Department of Geography and Environmental Studies, Albuquerque, NM (United States); Benjamin Zhan, F. [Texas State University, Department of Geography, Texas Center for Geographic Information Science, San Marcos, TX (United States)
2017-03-15
Health effects of close residential proximity to nuclear facilities have been a concern for both the general public and health professionals. Here, a study is reported examining the association between maternal residential proximity to nuclear facilities and low birth weight (LBW) in offspring using data from 1996 through 2008 in Texas, USA. A case-control study design was used together with a proximity-based model for exposure assessment. First, the LBW case/control births were categorized into multiple proximity groups based on distances between their maternal residences and nuclear facilities. Then, a binary logistic regression model was used to examine the association between maternal residential proximity to nuclear facilities and low birth weight in offspring. The odds ratios were adjusted for birth year, public health region of maternal residence, child's sex, gestational weeks, maternal age, education, and race/ethnicity. In addition, sensitivity analyses were conducted for the model. Compared with the reference group (more than 50 km from a nuclear facility), the exposed groups did not show a statistically significant increase in LBW risk [adjusted odds ratio (aOR) 0.91 (95% confidence interval (CI): 0.81, 1.03) for group 40-50 km; aOR 0.98 (CI 0.84, 1.13) for group 30-40 km; aOR 0.95 (CI 0.79, 1.15) for group 20-30 km; aOR 0.86 (CI 0.70, 1.04) for group 10-20 km; and aOR 0.98 (CI 0.59, 1.61) for group 0-10 km]. These results were also confirmed by results of the sensitivity analyses. The results suggest that maternal residential proximity to nuclear facilities is not a significant factor for LBW in offspring. (orig.)
Psychological responses to the proximity of climate change
Brügger, Adrian; Dessai, Suraje; Devine-Wright, Patrick; Morton, Thomas A.; Pidgeon, Nicholas F.
2015-12-01
A frequent suggestion to increase individuals' willingness to take action on climate change and to support relevant policies is to highlight its proximal consequences, that is, those that are close in space and time. But previous studies that have tested this proximizing approach have not revealed the expected positive effects on individual action and support for addressing climate change. We present three lines of psychological reasoning that provide compelling arguments as to why highlighting proximal impacts of climate change might not be as effective a way to increase individual mitigation and adaptation efforts as is often assumed. Our contextualization of the proximizing approach within established psychological research suggests that, depending on the particular theoretical perspective one takes on this issue, and on specific individual characteristics suggested by these perspectives, proximizing can bring about the intended positive effects, can have no (visible) effect or can even backfire. Thus, the effects of proximizing are much more complex than is commonly assumed. Revealing this complexity contributes to a refined theoretical understanding of the role that psychological distance plays in the context of climate change and opens up further avenues for future research and for interventions.
Critical Proximity as a Methodological Move in Techno-Anthropology
DEFF Research Database (Denmark)
Birkbak, Andreas; Petersen, Morten Krogh; Elgaard Jensen, Torben
2015-01-01
proximity.’ Critical proximity offers an alternative to critical distance, especially with respect to avoiding premature references to abstract panoramas such as democratization and capitalist exploitation in the quest to conduct ‘critical’ analysis. Critical proximity implies, instead, granting the beings...
Directory of Open Access Journals (Sweden)
Sung Min Ju
2015-01-01
Full Text Available Apigenin is a member of the flavone subclass of flavonoids present in fruits and vegetables. Apigenin has long been considered to have various biological activities, such as antioxidant, anti-inflammatory, and antitumorigenic properties, in various cell types. Cisplatin was known to exhibit cytotoxic effect to renal cells by inducing apoptosis through activation of p53. The present study investigated the antiapoptotic effects of apigenin on the cisplatin-treated human renal proximal tubular epithelial (HK-2 cells. HK-2 cells were pretreated with apigenin (5, 10, 20 μM for 1 h and then treated with 40 μM cisplatin for various times. Apigenin inhibited the cisplatin-induced apoptosis of HK-2 cells. Interestingly, apigenin itself exerted cytostatic activity because of its ability to induce cell cycle arrest. Apigenin inhibited caspase-3 activity and PARP cleavage in cisplatin-treated cells. Apigenin reduced cisplatin-induced phosphorylation and expression of p53, with no significant influence on production of ROS that is known to induce p53 activation. Furthermore, apigenin promoted cisplatin-induced Akt phosphorylation, suggesting that enhanced Akt activation may be involved in cytoprotection. Taken together, these results suggest that apigenin ameliorates cisplatin-induced apoptosis through reduction of p53 activation and promotion of PI3K/Akt pathway in HK-2 cells.
Directory of Open Access Journals (Sweden)
Simrén Magnus
2009-11-01
Full Text Available Abstract Background Oxytocin and the oxytocin receptor have been demonstrated in the gastrointestinal (GI tract and have been shown to exert physiological effects on gut motility. The role for oxytocin in the pathophysiology of GI complaints is unknown. The aim of this study was to examine genetic variations or polymorphism of oxytocin (OXT and its receptor (OXTR genes in patients with GI complaints without visible organic abnormalities. Methods Genetic variants in the OXT promoter region, and in the OXTR gene in DNA samples from 131 rigorously evaluated patients with Irritable Bowel Syndrome (IBS, 408 homozygous subjects referred for lactase (LCT-13910 C>T, rs4988235 genotyping, and 299 asymptomatic blood donors were compared. One polymorphism related to the OXT gene (rs6133010 A>G and 4 related to the OXTR gene (rs1465386 G>T, rs3806675 G>A, rs968389 A>G, rs1042778 G>T were selected for genotyping using Applied Biosystems 7900 HT allele discrimination assays. Results There were no statistically significant differences in the genotype or allele frequencies in any of the SNPs when IBS patients were compared to healthy controls. Among subjects referred for lactase genotyping, the rs6133010 A>G OXT promoter A/G genotype tended to be more common in the 154 non-persistent (27.3% subjects than in the 254 lactase persistant (18.1% subjects and in the healthy controls (19.4% (p = 0.08. When direct comparing, the A/G genotype was less common in the OXT promoter region in controls (p = 0.09 and in subjects with lactase persistence (p = 0.03 compared to subjects with lactase non-persistence. When healthy controls were viewed according to their own LCT-13910 genotypes, the C/C lactase non-persistent controls had a higher frequency for the OXT promoter A/G genotype than LCT-13910 T/T lactase persistent controls (41.2% vs 13.1%. No significant differences in frequencies of the investigated OXTR SNPs were noted in this study. Conclusion The results suggest
Varga, Peter; Grünwald, Leonard; Windolf, Markus
2018-02-22
Fixation of osteoporotic proximal humerus fractures has remained challenging, but may be improved by careful pre-operative planning. The aim of this study was to investigate how well the failure of locking plate fixation of osteoporotic proximal humerus fractures can be predicted by bone density measures assessed with currently available clinical imaging (realistic case) and a higher resolution and quality modality (theoretical best-case). Various density measures were correlated to experimentally assessed number of cycles to construct failure of plated unstable low-density proximal humerus fractures (N = 18). The influence of density evaluation technique was investigated by comparing local (peri-implant) versus global evaluation regions; HR-pQCT-based versus clinical QCT-based image data; ipsilateral versus contralateral side; and bone mineral content (BMC) versus bone mineral density (BMD). All investigated density measures were significantly correlated with the experimental cycles to failure. The best performing clinically feasible parameter was the QCT-based BMC of the contralateral articular cap region, providing significantly better correlation (R 2 = 0.53) compared to a previously proposed clinical density measure (R 2 = 0.30). BMC had consistently, but not significantly stronger correlations with failure than BMD. The overall best results were obtained with the ipsilateral HR-pQCT-based local BMC (R 2 = 0.74) that may be used for implant optimization. Strong correlations were found between the corresponding density measures of the two CT image sources, as well as between the two sides. Future studies should investigate if BMC of the contralateral articular cap region could provide improved prediction of clinical fixation failure compared to previously proposed measures. © 2018 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res. © 2018 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
Infiltrating/sealing proximal caries lesions
DEFF Research Database (Denmark)
Martignon, S; Ekstrand, K R; Gomez, J
2012-01-01
This randomized split-mouth controlled clinical trial aimed at assessing the therapeutic effects of infiltration vs. sealing for controlling caries progression on proximal surfaces. Out of 90 adult students/patients assessed at university clinics and agreeing to participate, 39, each with 3...... differences in lesion progression between infiltration and placebo (P = 0.0012) and between sealing and placebo (P = 0.0269). The study showed that infiltration and sealing are significantly better than placebo treatment for controlling caries progression on proximal lesions. No significant difference...
Coastal proximity and physical activity: Is the coast an under-appreciated public health resource?
White, Mathew P; Wheeler, Benedict W; Herbert, Stephen; Alcock, Ian; Depledge, Michael H
2014-12-01
Recent findings suggest that individuals living near the coast are healthier than those living inland. Here we investigated whether this may be related to higher levels of physical activity among coastal dwellers in England, arising in part as a result of more visits to outdoor coastal settings. Participants (n=183,755) were drawn from Natural England's Monitor of Engagement with the Natural Environment Survey (2009-2012). Analyses were based on self-reported physical activity for leisure and transport. A small, but significant coastal proximity gradient was seen for the likelihood of achieving recommended guidelines of physical activity a week after adjusting for relevant area and individual level controls. This effect was statistically mediated by the likelihood of having visited the coast in the last seven days. Stratification by region, however, suggested that while the main effect was relatively strong for west coast regions, it was not significant for those in the east. In general, our findings replicate and extend work from Australia and New Zealand. Further work is needed to explain the marked regional differences in the relationship between coastal proximity and physical activity in England to better understand the coast's potential role as a public health resource. Copyright © 2014. Published by Elsevier Inc.
North Central Regional environmental characterization report. Volume 1. Final report
International Nuclear Information System (INIS)
1985-08-01
This report presents available environmental information pertinent to siting a repository for high-level nuclear waste in crystalline rock in Minnesota, Wisconsin, and the Upper Peninsula of Michigan. For each of the states within the North Central Region, information is provided on those environmental disqualifying factors and regional screening variables to be used in region-to-area screening. These environmental factors and variables include existing and proposed Federal-protected lands, proximity to Federal-protected lands, components of national forest lands, existing state-protected lands, proximity to state-protected lands, population density and distribution, proximity to highly populated areas or to 1-mile square areas with 1000 or more persons, national and state forest lands, designated critical habitats for threatened and endangered spcies, surface water bodies, and wetlands. In addition, supplementary descriptive information providing a general characterization of the region is presented, as is information on environmental parameters that will be of use at later phases of screening. Also included is a discussion of the relationship between the US Department of Energy Siting Guidelines (10CFR 960) and those environmental disqualifying factors and regional screening variables to be used in the region-to-area screening process
Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J
2012-08-01
Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.
Hermidas, Navid; Eggenhuisen, Joris; Luthi, Stefan; Silva Jacinto, Ricardo; Toth, Ferenc; Pohl, Florian
2017-04-01
Transformations of a subaqueous density flow from proximal to distal regions are investigated. A classification of these transformations based on the state of the free shear and boundary layers and existence of a plug layer during transition from a debris flow to a turbidity current is presented. A connection between the emplaced deposit by the flow and the relevant flow type is drawn through the results obtained from a series of laboratory flume experiments. These were performed using 9%, 15%, and 21% sediment mixture concentrations composed of sand, silt, clay, and tap water, on varying bed slopes of 6°, 8°, and 9.5°, and with discharge rates of 10[m3/h] and 15[m3/h]. Stress-controlled rheometry experiments were performed on the mixtures to obtain apparent viscosity data. A classification was developed based on the imposed flow conditions, where a cohesive flow may fall within one of five distinct flow types: 1) a cohesive plug flow (PF) with a laminar free shear and boundary layers, 2) a top transitional plug flow (TTPF) containing a turbulent free shear layer, a plug layer, and a laminar boundary layer, 3) a complete transitional plug flow (CTPF) consisting of a turbulent free shear and boundary layers and a plug, 4) a transitional turbidity current (TTC) with a turbulent free shear layer and a laminar boundary layer, and, 5) a completely turbulent turbidity current (TC). During the experiments, flow type PF resulted in en masse deposition of a thick uniform ungraded muddy sand mixture, which was emplaced once the yield stress overcame the gravitational forces within the tail region of the flow. Flow type TTPF resulted in deposition of a thin ungraded basal clean sand layer during the run. This layer was covered by a muddy sand deposit from the tail. Flow type TTC did not deposit any sediment during the run. A uniform muddy sand mixture was emplaced by the tail of the flow. Flow type TC resulted in deposition of poorly sorted massive bottom sand layer. This
Northeastern Regional environmental characterization report. Volume 1. Final report
International Nuclear Information System (INIS)
1985-08-01
This report presents available environmental information pertinent to siting a repository for high-level nuclear waste in crystalline rock in Maine, New Hampshire, Vermont, northeastern and southeastern New York, Massachusetts, Rhode Island, Connecticut, northern New Jersey, and eastern Pennsylvania. For each of the States within the Northeastern Region, information is provided on those environmental disqualifying factors and regional screening variables to be used in region-to-area screening. These environmental factors and variables include existing and proposed Federal-protected lands, components of National Forest Lands, proximity to Federal-protected lands, existing State-protected lands, proximity to State-protected lands, population density and distribution, proximity to highly populated areas, or to 1-mile-square areas with 1000 or more persons, National and State forest lands, designated critical habitats for threatened and endangered species, surface water bodies, and wetlands. In addition, supplementary descriptive information providing a general characterization of the region is presented, as is information on environmental parameters that will be of use at later phases of screening. Also included is a discussion of the relationship between the US Department of Energy Siting Guidelines (10 CFR 960) and those environmental disqualifying factors and regional screening variables to be used in the region-to-area screening process
Proximity correction of high-dosed frame with PROXECCO
Eisenmann, Hans; Waas, Thomas; Hartmann, Hans
1994-05-01
Usefulness of electron beam lithography is strongly related to the efficiency and quality of methods used for proximity correction. This paper addresses the above issue by proposing an extension to the new proximity correction program PROXECCO. The combination of a framing step with PROXECCO produces a pattern with a very high edge accuracy and still allows usage of the fast correction procedure. Making a frame with a higher dose imitates a fine resolution correction where the coarse part is disregarded. So after handling the high resolution effect by means of framing, an additional coarse correction is still needed. Higher doses have a higher contribution to the proximity effect. This additional proximity effect is taken into account with the help of the multi-dose input of PROXECCO. The dose of the frame is variable, depending on the deposited energy coming from backscattering of the proximity. Simulation proves the very high edge accuracy of the applied method.
Dual pathology proximal median nerve compression of the forearm.
LENUS (Irish Health Repository)
Murphy, Siun M
2013-12-01
We report an unusual case of synchronous pathology in the forearm- the coexistence of a large lipoma of the median nerve together with an osteochondroma of the proximal ulna, giving rise to a dual proximal median nerve compression. Proximal median nerve compression neuropathies in the forearm are uncommon compared to the prevalence of distal compression neuropathies (eg Carpal Tunnel Syndrome). Both neural fibrolipomas (Refs. 1,2) and osteochondromas of the proximal ulna (Ref. 3) in isolation are rare but well documented. Unlike that of a distal compression, a proximal compression of the median nerve will often have a definite cause. Neural fibrolipoma, also called fibrolipomatous hamartoma are rare, slow-growing, benign tumours of peripheral nerves, most often occurring in the median nerve of younger patients. To our knowledge, this is the first report of such dual pathology in the same forearm, giving rise to a severe proximal compression of the median nerve. In this case, the nerve was being pushed anteriorly by the osteochondroma, and was being compressed from within by the intraneural lipoma. This unusual case highlights the advantage of preoperative imaging as part of the workup of proximal median nerve compression.
Giant proximity effect and critical opalescence in EuS
Charlton, Timothy; Ramos, Silvia; Quintanilla, Jorge; Suter, Andreas; Moodera, Jagadeesh
2015-03-01
The proximity effect is a type of wetting phenomenon where an ordered state, usually magnetism or superconductivity, ``leaks'' from one material into an adjacent one over some finite distance. For superconductors, the characteristic range is of the order of the coherence length, usually hundreds of nm. Nevertheless much longer, ``giant'' proximity effects have been observed in cuprate perovskite junctions. Such giant proximity effects can be understood by taking into account the divergence of the pairing susceptibility in the non-superconducting material when it is itself close to a superconducting instability: a superconducting version of critical opalescence. Since critical opalescence occurs in all second order phase transitions, giant proximity effects are expected to be general, therefor there must be a giant ferromagnetic proximity effect. Compared to its superconducting counterpart, the giant ferromagnetic proximity effect has the advantage that the order parameter (magnetization) can be observed directly. We have fabricated Co/EuS thin films and measured the magnetization profiles as a function of temperature using the complementary techniques of low energy muon relaxation and polarized neutron reflectivity. Details of the proximity effect near TCEuS will be presented.
Tóth, P; Horváth, C; Ferencz, V; Tóth, B; Váradi, A; Szenci, O; Bodó, G
2013-01-01
Despite the fact that bone mineral density (BMD) is an important fracture risk predictor in human medicine, studies in equine orthopedic research are still lacking. We hypothesized that BMD correlates with bone failure and fatigue fractures of this bone. Thus, the objectives of this study were to measure the structural and mechanical properties of the proximal phalanx with dual energy X-ray absorptiometry (DXA), to correlate the data obtained from DXA and computer tomography (CT) measurements to those obtained by loading pressure examination and to establish representative region of interest (ROI) for in vitro BMD measurements of the equine proximal phalanx for predicting bone failure force. DXA was used to measure the whole bone BMD and additional three ROI sites in 14 equine proximal phalanges. Following evaluation of the bone density, whole bone, cortical width and area in the mid-diaphyseal plane were measured on CT images. Bones were broken using a manually controlled universal bone crusher to measure bone failure force and reevaluated for the site of fractures on follow-up CT images. Compressive load was applied at a constant displacement rate of 2 mm/min until failure, defined as the first clear drop in the load measurement. The lowest BMD was measured at the trabecular region (mean +/- SD: 1.52 +/- 0.12 g/cm2; median: 1.48 g/cm2; range: 1.38-1.83 g/cm2). There was a significant positive linear correlation between trabelcular BMD and the breaking strength (P = 0.023, r = 0.62). The trabecular region of the proximal phalanx appears to be the only significant indicator of failure of strength in vitro. This finding should be reassessed to further reveal the prognostic value of trabecular BMD in an in vivo fracture risk model.
Strong Proximities on Smooth Manifolds and Vorono\\" i Diagrams
Peters, J. F.; Guadagni, C.
2015-01-01
This article introduces strongly near smooth manifolds. The main results are (i) second countability of the strongly hit and far-miss topology on a family $\\mathcal{B}$ of subsets on the Lodato proximity space of regular open sets to which singletons are added, (ii) manifold strong proximity, (iii) strong proximity of charts in manifold atlases implies that the charts have nonempty intersection. The application of these results is given in terms of the nearness of atlases and charts of proxim...
Directory of Open Access Journals (Sweden)
Matsutani Sachiko
2004-08-01
Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants
Matsutani, Sachiko
2004-08-09
In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.
75 FR 5009 - Proximity Detection Systems for Underground Mines
2010-02-01
... Proximity Detection Systems for Underground Mines AGENCY: Mine Safety and Health Administration, Labor... information regarding whether the use of proximity detection systems would reduce the risk of accidents where... . Information on MSHA-approved proximity detection systems is available on the Internet at http://www.msha.gov...
Merritt, J Lawrence; Brody, Linnea L; Pino, Gisele; Rinaldo, Piero
2018-04-20
Current newborn screening (NBS) for urea cycle disorders (UCD) is incomplete as only distal UCDs are included in most NBS programs by measuring elevated amino acid concentrations. NBS for the proximal UCDs involves the detection in NBS spots of low citrulline values, a finding which is often overlooked because it is considered to be inadequate. We retrospectively analyzed NBS blood spots from known UCD patients comparing the utility of the Region 4 Stork (R4S) interpretive tools to conventional cutoff based interpretation. This study shows the utility of R4S tools in detecting all UCDs, and provides evidence to support the nomination to add proximal UCDs to the recommended uniform screening panel. Copyright © 2018 Elsevier Inc. All rights reserved.
Bimalleolar ankle fracture with proximal fibular fracture
Colenbrander, R. J.; Struijs, P. A. A.; Ultee, J. M.
2005-01-01
A 56-year-old female patient suffered a bimalleolar ankle fracture with an additional proximal fibular fracture. This is an unusual fracture type, seldom reported in literature. It was operatively treated by open reduction and internal fixation of the lateral malleolar fracture. The proximal fibular
[Partial replantation following proximal limb injury].
Dubert, T; Malikov, S A; Dinh, A; Kupatadze, D D; Oberlin, C; Alnot, J Y; Nabokov, B B
2000-11-01
Proximal replantation is a technically feasible but life-threatening procedure. Indications must be restricted to patients in good condition with a good functional prognosis. The goal of replantation must be focused not only on reimplanting the amputated limb but also on achieving a good functional outcome. For the lower limb, simple terminalization remains the best choice in many cases. When a proximal amputation is not suitable for replantation, the main aim of the surgical procedure must be to reconstruct a stump long enough to permit fitting a prosthesis preserving the function of the adjacent joint. If the proximal stump beyond the last joint is very short, it may be possible to restore some length by partial replantation of spared tissues from the amputated part. We present here the results we obtained following this policy. This series included 16 cases of partial replantations, 14 involving the lower limb and 2 the upper limb. All were osteocutaneous microsurgical transfers. For the lower limb, all transfers recovered protective sensitivity following tibial nerve repair. The functional calcaeoplantar unit was used in 13 cases. The transfer of this specialized weight bearing tissue provided a stable distal surface making higher support unnecessary. In one case, we raised a 13-cm vascularized tibial segment covered with foot skin for additional length. For the upper limb, the osteocutaneous transfer, based on the radial artery, was not reinnervated, but this lack of sensitivity did not impair prosthesis fitting. One vascular failure was finally amputated. This was the only unsuccessful result. For all other patients, the surgical procedure facilitated prosthesis fitting and preserved the proximal joint function despite an initially very proximal amputation. The advantages of partial replantation are obvious compared with simple terminalization or secondary reconstruction. There is no secondary donor site and, because there is no major muscle mass in the
International Nuclear Information System (INIS)
Shannon, M.F.; Gamble, J.R.; Vadas, M.A.
1988-01-01
The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription
Crespo, Joan; Vicente, Jérôme
2016-01-01
Crespo J. and Vicente J. Proximity and distance in knowledge relationships: from micro to structural considerations based on territorial knowledge dynamics (TKDs), Regional Studies. Among the key parameters identified in territorial knowledge dynamics (TKDs), this paper focuses on the balance and
Proximity functions for general right cylinders
International Nuclear Information System (INIS)
Kellerer, A.M.
1981-01-01
Distributions of distances between pairs of points within geometrical objects, or the closely related proximity functions and geometric reduction factors, have applications to dosimetric and microdosimetric calculations. For convex bodies these functions are linked to the chord-length distributions that result from random intersections by straight lines. A synopsis of the most important relations is given. The proximity functions and related functions are derived for right cylinders with arbitrary cross sections. The solution utilizes the fact that the squares of the distances between two random points are sums of independently distributed squares of distances parallel and perpendicular to the axis of the cylinder. Analogous formulas are derived for the proximity functions or geometric reduction factors for a cylinder relative to a point. This requires only a minor modification of the solution
Energy Technology Data Exchange (ETDEWEB)
Mueller, Dirk, E-mail: d.mueller@uk-koeln.de [Department of Radiology, University of Cologne (Germany); Department of Radiology, Technische Universität München (Germany); Schaeffeler, Christoph, E-mail: schaeffeler@me.com [Department of Radiology, Cantonal Hospital Graubuenden, Chur (Switzerland); Department of Radiology, Cantonal Hospital Graubuenden, Chur (Switzerland); Baum, Thomas, E-mail: thomas-baum@gmx.de [Department of Radiology, Technische Universität München (Germany); Walter, Flavia, E-mail: flavia_walter2000@yahoo.de [Department of Radiology, Technische Universität München (Germany); Rechl, Hans, E-mail: rechl@tum.de [Department of Orthopaedics, Technische Universität München (Germany); Rummeny, Ernst J., E-mail: rummeny@tum.de [Department of Radiology, Technische Universität München (Germany); Woertler, Klaus, E-mail: klaus.woertler@tum.de [Department of Radiology, Technische Universität München (Germany)
2014-10-15
Highlights: • DCE-MRI may add information to the pathophysiology of bone marrow edema (BME) of the proximal femur. • Patients with transient bone marrow edema (TBME) or subchondral insufficiency fractures (SIF) and avascular osteonecrosis (AVN) showed different MR perfusion patterns. • Perfusion characteristics suggest different pathophysiology for AVN compared with TBME or SIF. • Diffusion weighted imaging (DWI) was not able to discriminate necrotic from edematous bone marrow. • DWI is of limited value to evaluate BME of the proximal femur. - Abstract: Purpose: To evaluate magnetic resonance (MR) perfusion and diffusion imaging characteristics in patients with transient bone marrow edema (TBME), avascular necrosis (AVN), or subchondral insufficiency fractures (SIF) of the proximal femur. Materials and methods: 29 patients with painful hip and bone marrow edema pattern of the proximal femur on non-contrast MR imaging were examined using diffusion-weighted and dynamic gadolinium-enhanced sequences. Apparent diffusion coefficients (ADCs) and perfusion parameters were calculated for different regions of the proximal femur. Regional distribution and differences in ADC values and perfusion parameters were evaluated. Results: Seven patients presented with TBME, 15 with AVN and seven with SIF of the proximal femur. Perfusion imaging showed significant differences for maximum enhancement values (E{sub max}), slope (E{sub slope}) and time to peak (TTP) between the three patient groups (p < 0.05). In contrast, no significant differences for ADC values were calculated when comparing TBME, AVN, and SIF patients. Conclusion: Diffusion weighted imaging of bone marrow of the proximal femur did not show significant differences between patients with TBME, AVN or SIF. In contrast, MR perfusion imaging demonstrated significant differences for the different patient groups and may as a complementary imaging technique add information to the understanding of the pathophysiology
International Nuclear Information System (INIS)
Mueller, Dirk; Schaeffeler, Christoph; Baum, Thomas; Walter, Flavia; Rechl, Hans; Rummeny, Ernst J.; Woertler, Klaus
2014-01-01
Highlights: • DCE-MRI may add information to the pathophysiology of bone marrow edema (BME) of the proximal femur. • Patients with transient bone marrow edema (TBME) or subchondral insufficiency fractures (SIF) and avascular osteonecrosis (AVN) showed different MR perfusion patterns. • Perfusion characteristics suggest different pathophysiology for AVN compared with TBME or SIF. • Diffusion weighted imaging (DWI) was not able to discriminate necrotic from edematous bone marrow. • DWI is of limited value to evaluate BME of the proximal femur. - Abstract: Purpose: To evaluate magnetic resonance (MR) perfusion and diffusion imaging characteristics in patients with transient bone marrow edema (TBME), avascular necrosis (AVN), or subchondral insufficiency fractures (SIF) of the proximal femur. Materials and methods: 29 patients with painful hip and bone marrow edema pattern of the proximal femur on non-contrast MR imaging were examined using diffusion-weighted and dynamic gadolinium-enhanced sequences. Apparent diffusion coefficients (ADCs) and perfusion parameters were calculated for different regions of the proximal femur. Regional distribution and differences in ADC values and perfusion parameters were evaluated. Results: Seven patients presented with TBME, 15 with AVN and seven with SIF of the proximal femur. Perfusion imaging showed significant differences for maximum enhancement values (E max ), slope (E slope ) and time to peak (TTP) between the three patient groups (p < 0.05). In contrast, no significant differences for ADC values were calculated when comparing TBME, AVN, and SIF patients. Conclusion: Diffusion weighted imaging of bone marrow of the proximal femur did not show significant differences between patients with TBME, AVN or SIF. In contrast, MR perfusion imaging demonstrated significant differences for the different patient groups and may as a complementary imaging technique add information to the understanding of the pathophysiology of
US-India Technical Collaboration to Promote Regional Stability
International Nuclear Information System (INIS)
Killinger, Mark H.; Griggs, James R.; Apt, Kenneth E.; Doyle, James E.
2001-01-01
Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, DOE has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US agencies and the Indian government and scientific communities to identify appropriate non-sensitive areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national/international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes research done on the Indian scientific organization and infrastructure, potential areas for collaboration, the approach for this engagement, and current status of the initiative.
US-INDIA TECHNICAL COLLABORATION TO PROMOTE REGIONAL STABILITY
International Nuclear Information System (INIS)
Killinger, M.H.; Griggs, J.R.; Apt, Kenneth E.; Doyle, J.E.
2001-01-01
Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, the US Department of Energy (DOE) has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US government agencies to identify appropriate non-sensitive, non-nuclear areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national and international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes the approach for this engagement, the Indian scientific organization and infrastructure, potential areas for collaboration, and current status of the initiative.
Directory of Open Access Journals (Sweden)
Rogério Silvestre Pereira
Full Text Available ABSTRACT: Magmatism associated with the Alto Paranaíba structural high comprises kimberlites, kamafugites, and alkaline complexes, forming an approximately 400 x 150 km NW-SE belt in the southern São Francisco Craton. Dating of some intrusions reveals ages between 120 and 75 Ma. Chemical analyses of garnet recovered in alluvium from traditional diamond digging areas indicate peridotitic garnet windows in Três Ranchos and Coromandel. Six hundred and eighty (680 diamonds acquired or recovered during mineral exploration in the digging areas of Romaria, Estrela do Sul, Três Ranchos and Coromandel show unique characteristics, certain populations indicating young, proximal and primary sources (YPP. Analyses of 201 stones from Santo Antônio do Bonito, Santo Inácio and Douradinho rivers alluvium, Coromandel, present no evidence of transport, characterizing a proximal source. Within these river basins, exposures of the Late Cretaceous Capacete Formation basal conglomerate contain mainly small rounded and/or angular quartzite pebbles and of basic and ultrabasic rocks, as well as kimberlite minerals (garnet, ilmenite, spinel, sometimes diamond. A magnetotelluric profile between the Paraná and Sanfranciscana basins shows that the thick underlying lithosphere in the Coromandel region coincides with the peridotitic garnet window and with a diamond population displaying proximal source characteristics. Diamond-bearing kimberlite intrusions occur in different areas of Alto Paranaíba.
Barnidge, Ellen K; Baker, Elizabeth A; Estlund, Amy; Motton, Freda; Hipp, Pamela R; Brownson, Ross C
2015-06-11
Rural residents are less likely than urban and suburban residents to meet recommendations for nutrition and physical activity. Interventions at the environmental and policy level create environments that support healthy eating and physical activity. Healthier Missouri Communities (Healthier MO) is a community-based research project conducted by the Prevention Research Center in St. Louis with community partners from 12 counties in rural southeast Missouri. We created a regional partnership to leverage resources and enhance environmental and policy interventions to improve nutrition and physical activity in rural southeast Missouri. Partners were engaged in a participatory action planning process that included prioritizing, implementing, and evaluating promising evidence-based interventions to promote nutrition and physical activity. Group interviews were conducted with Healthier MO community partners post intervention to evaluate resource sharing and sustainability efforts of the regional partnership. Community partners identified the benefits and challenges of resource sharing within the regional partnership as well as the opportunities and threats to long-term partnership sustainability. The partners noted that the regional participatory process was difficult, but the benefits outweighed the challenges. Regional rural partnerships may be an effective way to leverage relationships to increase the capacity of rural communities to implement environmental and policy interventions to promote nutrition and physical activity.
Proximity effect at Millikelvin temperatures
International Nuclear Information System (INIS)
Mota, A.C.
1986-01-01
Proximity effects have been studied extensively for the past 25 years. Typically, they are in films several thousand angstroms thick at temperatures not so far below T/sub CNS/, the transition temperature of the NS system. Interesting is, however, the proximity effect at temperatures much lower than T/sub CNS/. In this case, the Cooper-pair amplitudes are not small and very long pair penetration lengths into the normal metal can be expected. Thus, we have observed pair penetration lengths. For these investigations very suitable specimens are commercial wires of one filament of NbTi or Nb embedded in a copper matrix. The reasons are the high transmission coefficient at the interface between the copper and the superconductor and the fact that the copper in these commercial wires is rather clean with electron free paths between 5 to 10 μm long. In this paper, the magnetic properties of thick proximity systems in the range of temperatures between T/sub CNS/ and 5 x 10/sup -4/ T/sub CNS/ in both low and high magnetic fields are discussed
Directory of Open Access Journals (Sweden)
Dobrovic Alexander
2009-09-01
Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.
Dual pathology proximal median nerve compression of the forearm.
Murphy, Siun M; Browne, Katherine; Tuite, David J; O'Shaughnessy, Michael
2013-12-01
We report an unusual case of synchronous pathology in the forearm- the coexistence of a large lipoma of the median nerve together with an osteochondroma of the proximal ulna, giving rise to a dual proximal median nerve compression. Proximal median nerve compression neuropathies in the forearm are uncommon compared to the prevalence of distal compression neuropathies (eg Carpal Tunnel Syndrome). Both neural fibrolipomas (Refs. 1,2) and osteochondromas of the proximal ulna (Ref. 3) in isolation are rare but well documented. Unlike that of a distal compression, a proximal compression of the median nerve will often have a definite cause. Neural fibrolipoma, also called fibrolipomatous hamartoma are rare, slow-growing, benign tumours of peripheral nerves, most often occurring in the median nerve of younger patients. To our knowledge, this is the first report of such dual pathology in the same forearm, giving rise to a severe proximal compression of the median nerve. In this case, the nerve was being pushed anteriorly by the osteochondroma, and was being compressed from within by the intraneural lipoma. This unusual case highlights the advantage of preoperative imaging as part of the workup of proximal median nerve compression. Copyright © 2013 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David
2013-08-01
Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.
Quantifying Surface Coal-Mining Patterns to Promote Regional Sustainability in Ordos, Inner Mongolia
Directory of Open Access Journals (Sweden)
Xiaoji Zeng
2018-04-01
Full Text Available Ordos became the new “coal capital” of China within a few decades since the country’s economic reform in 1978, as large-scale surface coal mining dramatically propelled its per capita GDP from being one of the lowest to one of the highest in China, exceeding Hong Kong in 2009. Surface coal-mining areas (SCMAs have continued to expand in this region during recent decades, resulting in serious environmental and socioeconomic consequences. To understand these impacts and promote regional sustainability, quantifying the spatiotemporal patterns of SCMAs is urgently needed. Thus, the main objectives of this study were to quantify the spatiotemporal patterns of SCMAs in the Ordos region from 1990 to 2015, and to examine some of the major environmental and socioeconomic impacts in the study region. We extracted the SCMAs using remote-sensing data, and then quantified their spatiotemporal patterns using landscape metrics. The loss of natural habitat and several socioeconomic indicators were examined in relation to surface coal mining. Our results show that the area of SCMAs increased from 7.12 km2 to 355.95 km2, an increase of nearly 49 times from 1990 to 2015 in the Ordos region. The number of SCMAs in this region increased from 82 to 651, a nearly seven-fold increase. In particular, Zhungeer banner (an administrative division, Yijinhuoluo banner, Dongsheng District and Dalate banner in the north-eastern part of the Ordos region had higher growth rates of SCMAs. The income gap between urban and rural residents increased along with the growth in SCMAs, undermining social equity in the Ordos region. Moreover, the rapid increase in SCMAs resulted in natural habitat loss (including grasslands, forests, and deserts across this region. Thus, we suggest that regional sustainability in Ordos needs to emphasize effective measures to curb large-scale surface coal mining in order to reduce the urban–rural income gap, and to restore degraded natural
Steiner, Elisabeth; Holzmann, Klaus; Pirker, Christine; Elbling, Leonilla; Micksche, Michael; Berger, Walter
2004-04-23
The major vault protein (MVP) has been implicated in multidrug resistance, cellular transport, and malignant transformation. In this study we aimed to identify crucial MVP promoter elements that regulate MVP expression. By mutation as well as deletion analysis a conserved proximal GC-box element was demonstrated to be essential for basal human MVP promoter transactivation. Binding of Sp-family transcription factors but not AP2 to this element in vitro and in vivo was shown by EMSA and ChIP assays, respectively. Inhibition of GC-box binding by a dominant-negative Sp1-variant and by mithramycin A distinctly attenuated MVP promoter activity. In Sp-null Drosophila cells, the silent human MVP promoter was transactivated by several human Sp-family members. In human cells the MVP promoter was potently stimulated by the histone deacetylase (HDAC) inhibitors butyrate (NaB) and trichostatin A (TSA), resulting in enhanced MVP expression. This stimulation was substantially decreased by mutation of the single GC-box and by application of mithramycin A. Treatment with HDAC inhibitors led to a distinct decrease of Sp1 but increase of Sp3 binding in vivo to the respective promoter sequence as demonstrated by ChIP assays. Summarising, this study identifies variations in Sp-transcription factor binding to a single proximal GC-box element as critical for basal MVP promoter activation and its stimulation by HDAC inhibitors.
International Nuclear Information System (INIS)
Buitrago-Tellez, C.H.; Schulze, C.; Gufler, H.; Langer, M.; Bonnaire, F.; Hoenninger, A.; Kuner, E.
1997-01-01
Purpose: In an experimental study, the correlation between the trabecular bone density of the different regions of the proximal femur and the fracture load in the setting of femoral neck fractures was examined. Methods: The bone mineral density 41 random proximal human femora was estimated by single-energy quanitative CT (SE-QCT). The trabecular bone density was measured at the greatest possible extracortical volume at midcapital, midneck and intertrochanteric level and in the 1 cm 3 volumes of the centres of these regions in a standardised 10 mm thick slice in the middle of the femoral neck axis (in mg/ml Ca-hydroxyl apatite). The proximal femora were then isolated and mounted on a compression/bending device under two-legged stand conditions and loaded up to the point when a femoral neck fracture occurred. Results: Statistical analysis revealed a linear correlation between the trabecular bone density and the fracture load for the greater regions, with the highest value in the maximal area of the head (coefficient factor r=0.76). Conclusion: According to our data, the measurement of the trabecular bone by SE-QCT at the femoral head is a more confident adjunct than the neck or trochanteric area to predict a femoral neck fracture. (orig.) [de
International Nuclear Information System (INIS)
Inoue, K.; Takayanagi, H.
1991-01-01
Local tunneling spectroscopy for a Nb/In/As/Nb superconducting proximity system was demonstrated with a low-temperature scanning tunneling microscope. It is found that the local electron density of states in the InAs region is spatially modulated by the neighboring superconductor Nb
Effect of age on proximal esophageal response to swallowing
Directory of Open Access Journals (Sweden)
Roberto Oliveira Dantas
2010-12-01
Full Text Available CONTEXT: It has been demonstrated that the ageing process affects esophageal motility. OBJECTIVES: To evaluate the effect of the age on the proximal esophageal response to wet swallows. METHOD: We measured the proximal esophageal response to swallows of a 5 mL bolus of water in 69 healthy volunteers, 20 of them aged 18-30 years (group I, 27 aged 31-50 years (group II, and 22 aged 51-74 years (group III. We used the manometric method with continuous perfusion. The proximal esophageal contractions were recorded 5 cm from a pharyngeal recording site located 1 cm above the upper esophageal sphincter. The time between the onset of the pharyngeal and of the proximal esophageal recording (pharyngeal-esophageal time and the amplitude, duration and area under the curve of the proximal esophageal contraction were measured. RESULTS: The pharyngeal-esophageal time was shorter in group I subjects than in group II and III subjects (P<0.05. The duration of proximal esophageal contractions was longer in group I than in groups II and III (P<0.001. There was no differences between groups in the amplitude or area under the curve of contractions. There were no differences between groups II and III for any of the measurements. CONCLUSION: We conclude that the age may affects the response of the proximal esophagus to wet swallows.
DEFF Research Database (Denmark)
Peng, Nan; Xia, Qiu; Chen, Zhengjun
2009-01-01
S gene encoding an arabinose binding protein was characterized using an Sulfolobus islandicus reporter gene system. The minimal active araS promoter (P(araS)) was found to be 59 nucleotides long and harboured four promoter elements: an ara-box, an upstream transcription factor B-responsive element (BRE......), a TATA-box and a proximal promoter element, each of which contained important nucleotides that either greatly decreased or completely abolished promoter activity upon mutagenesis. The basal araS promoter was virtually inactive due to intrinsically weak BRE element, and the upstream activating sequence...... (UAS) ara-box activated the basal promoter by recruiting transcription factor B to its BRE. While this UAS ensured a general expression from an inactive or weak basal promoter in the presence of other tested carbon resources, it exhibited a strong arabinose-responsive transcriptional activation. To our...
Directory of Open Access Journals (Sweden)
Sun Yuping
2016-03-01
Full Text Available Labor resource is the necessary productive factor in regional economic development, and one of important indexes to evaluate regional economic competitiveness. The great economic achievement brought by the 30-year reform and opening up of China is due to the fact that China brought the backward advantage of “demographic dividend” into play, promoted the fast development of industrialization and urbanization, and became the second largest economy in the world. The entity of “demographic dividend” is the non-agricultural migrant population, i.e., migrant workers. The transfer employment of migrant workers has typical regional liquidity, and the imbalance of regional economy causes the flow of many migrant workers. In order to achieve harmonious development and coordinated development, underdeveloped areas must understand the character and regulation, adopt positive industrial policy and supportive policy, guide the reasonable flow of migrant workers, and realize the transfer of local employment and citizenization of migrant workers, which can enhance regional economic competitiveness
Directory of Open Access Journals (Sweden)
Dorcas J Orengo
Full Text Available The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO. We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription.
PROXIMAL: a method for Prediction of Xenobiotic Metabolism.
Yousofshahi, Mona; Manteiga, Sara; Wu, Charmian; Lee, Kyongbum; Hassoun, Soha
2015-12-22
Contamination of the environment with bioactive chemicals has emerged as a potential public health risk. These substances that may cause distress or disease in humans can be found in air, water and food supplies. An open question is whether these chemicals transform into potentially more active or toxic derivatives via xenobiotic metabolizing enzymes expressed in the body. We present a new prediction tool, which we call PROXIMAL (Prediction of Xenobiotic Metabolism) for identifying possible transformation products of xenobiotic chemicals in the liver. Using reaction data from DrugBank and KEGG, PROXIMAL builds look-up tables that catalog the sites and types of structural modifications performed by Phase I and Phase II enzymes. Given a compound of interest, PROXIMAL searches for substructures that match the sites cataloged in the look-up tables, applies the corresponding modifications to generate a panel of possible transformation products, and ranks the products based on the activity and abundance of the enzymes involved. PROXIMAL generates transformations that are specific for the chemical of interest by analyzing the chemical's substructures. We evaluate the accuracy of PROXIMAL's predictions through case studies on two environmental chemicals with suspected endocrine disrupting activity, bisphenol A (BPA) and 4-chlorobiphenyl (PCB3). Comparisons with published reports confirm 5 out of 7 and 17 out of 26 of the predicted derivatives for BPA and PCB3, respectively. We also compare biotransformation predictions generated by PROXIMAL with those generated by METEOR and Metaprint2D-react, two other prediction tools. PROXIMAL can predict transformations of chemicals that contain substructures recognizable by human liver enzymes. It also has the ability to rank the predicted metabolites based on the activity and abundance of enzymes involved in xenobiotic transformation.
The role of COMESA in promoting intra-regional agricultural trade: Case study of Sudan
Directory of Open Access Journals (Sweden)
Azharia Abdelbagi Elbushra
2011-06-01
Full Text Available African countries have created many regional trade agreements with the economic objectives of reducing trade barriers and encouraging economic growth. The COMESA is an example of regional integration singed on 1993 by 19 African countries including Sudan. COMESA represents a chance for member countries to enhance their economic and social relations through increasing intra-trade. The objective of this paper is to assess the role of COMESA in promoting intra-regional agricultural trade between Sudan and COMESA countries. A multi-market model with Armington non-linear specification was applied. The paper results showed that there is a great potential for Sudan to increase its agricultural exports to other COMESA countries. The domestic agricultural markets are expected to be hampered by imports surge and increase in competition, while the producers of agricultural export commodities will be better off. In order to compete and benefit from potential in the COMESA markets, the paper recommended improving efficiency in the Sudanese agricultural sector through increasing productivity, lowering cost of production, enhancing marketing services, attaining economies of scale and attracting foreign investment.
The developmental spectrum of proximal radioulnar synostosis
Energy Technology Data Exchange (ETDEWEB)
Elliott, Alison M. [University of Manitoba, Winnipeg Regional Health Association Program of Genetics and Metabolism, Winnipeg, MB (Canada); University of Manitoba, Department of Paediatrics and Child Health, Winnipeg, MB (Canada); University of Manitoba, Department of Biochemistry and Medical Genetics, Winnipeg, MB (Canada); University of Manitoba, WRHA Program of Genetics and Metabolism, Departments of Paediatrics and Child Health, Biochemistry and Medical Genetics, Winnipeg, MB (Canada); Kibria, Lisa [University of Manitoba, Department of School of Medical Rehabilitation, Winnipeg, MB (Canada); Reed, Martin H. [University of Manitoba, Department of Paediatrics and Child Health, Winnipeg, MB (Canada); University of Manitoba, Department of Biochemistry and Medical Genetics, Winnipeg, MB (Canada); University of Manitoba, Department of Diagnostic Imaging, Winnipeg, MB (Canada)
2010-01-15
Proximal radioulnar synostosis is a rare upper limb malformation. The elbow is first identifiable at 35 days (after conception), at which stage the cartilaginous anlagen of the humerus, radius and ulna are continuous. Subsequently, longitudinal segmentation produces separation of the distal radius and ulna. However, temporarily, the proximal ends are united and continue to share a common perichondrium. We investigated the hypothesis that posterior congenital dislocation of the radial head and proximal radioulnar fusion are different clinical manifestations of the same primary developmental abnormality. Records were searched for ''proximal radioulnar fusion/posterior radial head dislocation'' in patients followed at the local Children's Hospital and Rehabilitation Centre for Children. Relevant radiographic, demographic and clinical data were recorded. Ethics approval was obtained through the University Research Ethics Board. In total, 28 patients met the inclusion criteria. The majority of patients (16) had bilateral involvement; eight with posterior dislocation of the radial head only; five had posterior radial head dislocation with radioulnar fusion and two had radioulnar fusion without dislocation. One patient had bilateral proximal radioulnar fusion and posterior dislocation of the left radial head. Nine patients had only left-sided involvement, and three had only right-sided involvement.The degree of proximal fusion varied, with some patients showing 'complete' proximal fusion and others showing fusion that occurred slightly distal to the radial head: 'partially separated.' Associated disorders in our cohort included Poland syndrome (two patients), Cornelia de Lange syndrome, chromosome anomalies (including tetrasomy X) and Cenani Lenz syndactyly. The suggestion of a developmental relationship between posterior dislocation of the radial head and proximal radioulnar fusion is supported by the fact that both anomalies
Inter-regional comparison of land-use effects on stream metabolism
Melody J. Bernot; Daniel J. Sobota; Robert O. Hall; Patrick J. Mulholland; Walter K. Dodds; Jackson R. Webster; Jennifer L. Tank; Linda R. Ashkenas; Lee W. Cooper; Clifford N. Dahm; Stanley V. Gregory; Nancy B. Grimm; Stephen K. Hamilton; Sherri L. Johnson; William H. McDowell; Judith L. Meyer; Bruce Peterson; Geoffrey C. Poole; H. Maurice Valett; Clay Arango; Jake J. Beaulieu; Amy J. Burgin; Chelsea Crenshaw; Ashley M. Helton; Laura Johnson; Jeff Merriam; B.R. Niederlehner; Jonathan M. O' Brien; Jody D. Potter; Richard W. Sheibley; Suzanne M. Thomas; Kym. Wilson
2010-01-01
Rates of whole-system metabolism (production and respiration) are fundamental indicators of ecosystem structure and function. Although first-order, proximal controls are well understood, assessments of the interactions between proximal controls and distal controls, such as land use and geographic region, are lacking. Thus, the influence of land use on stream metabolism...
Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z
2014-03-01
The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.
Directory of Open Access Journals (Sweden)
Chia-Ming Chang
2017-01-01
Full Text Available Objective: Despite its possible role in knee arthroplasty, the proximal-distal condylar length (PDCL of the femur has never been reported in the literature. We conducted an anatomic study of the proximal aspect of the medial femoral condyle to propose a method for measuring the PDCL. Materials and Methods: Inspection of dried bone specimens was carried out to assure the most proximal condylar margin (MPCM as the eligible starting point to measure the PDCL. Simulation surgery was performed on seven pairs of cadaveric knees to verify the clinical application of measuring the PDCL after locating the MPCM. Interobserver reliability of this procedure was also analyzed. Results: Observation of the bone specimens showed that the MPCM is a concavity formed by the junction of the distal end of the supracondylar ridge and the proximal margin of the medial condyle. This anatomically distinctive structure made the MPCM an unambiguous landmark. The cadaveric simulation surgical dissection demonstrated that the MPCM is easily accessed in a surgical setting, making the measurement of the PDCL plausible. The intraclass correlation coefficient was 0.78, indicating good interobserver reliability for this technique. Conclusion: This study has suggested that the PDCL can be measured based on the MPCM in a surgical setting. PDCL measurement might be useful in joint line position management, selection of femoral component sizes, and other applications related to the proximal-distal dimension of the knee. Further investigation is required.
Evaluation and Management of Proximal Humerus Fractures
Directory of Open Access Journals (Sweden)
Ekaterina Khmelnitskaya
2012-01-01
Full Text Available Proximal humerus fractures are common injuries, especially among older osteoporotic women. Restoration of function requires a thorough understanding of the neurovascular, musculotendinous, and bony anatomy. This paper addresses the relevant anatomy and highlights various management options, including indication for arthroplasty. In the vast majority of cases, proximal humerus fractures may be treated nonoperatively. In the case of displaced fractures, when surgical intervention may be pursued, numerous constructs have been investigated. Of these, the proximal humerus locking plate is the most widely used. Arthroplasty is generally reserved for comminuted 4-part fractures, head-split fractures, or fractures with significant underlying arthritic changes. Reverse total shoulder arthroplasty is reserved for patients with a deficient rotator cuff, or highly comminuted tuberosities.
The Life Saving Effects of Hospital Proximity
DEFF Research Database (Denmark)
Bertoli, Paola; Grembi, Veronica
We assess the lifesaving effect of hospital proximity using data on fatality rates of road-traffic accidents. While most of the literature on this topic is based on changes in distance to the nearest hospital triggered by hospital closures and use OLS estimates, our identification comes from......) increases the fatality rate by 13.84% on the sample average. This is equal to a 0.92 additional death per every 100 accidents. We show that OLS estimates provide a downward biased measure of the real effect of hospital proximity because they do not fully solve spatial sorting problems. Proximity matters...... more when the road safety is low; the emergency service is not properly organized, and the nearest hospital has lower quality standards....
Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto
2003-01-01
Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.
Complex proximal deposition during the Plinian eruptions of 1912 at Novarupta, Alaska
Houghton, Bruce F.; Wilson, C.J.N.; Fierstein, J.; Hildreth, W.
2004-01-01
Proximal (Smokes ignimbrite. The proximal products include alternations and mixtures of both locally and regionally dispersed fall ejecta, and numerous thin complex deposits of pyroclastic density currents (PDCs) with no regional analogs. The locally dispersed component of the fall deposits forms sector-confined wedges of material whose thicknesses halve radially from and concentrically about the vent over distances of 100-300 m (cf. several kilometers for the medial-distal fall deposits). This locally dispersed fall material (and many of the associated PDC deposits) is rich in andesitic and banded pumices and richer in shallow-derived wall-rock lithics in comparison with the coeval medial fall units of almost entirely dacitic composition. There are no marked contrasts in grain size in the near-vent deposits, however, between locally and widely dispersed beds, and all samples of the proximal fall deposits plot as a simple continuation of grain size trends for medial-distal samples. Associated PDC deposits form a spectrum of facies from fines-poor, avalanched beds through thin-bedded, landscape-mantling beds to channelized lobes of pumice-block-rich ignimbrite. The origins of the Novarupta near-vent deposits are considered within a spectrum of four transport regimes: (1) sustained buoyant plume, (2) fountaining with co-current flow, (3) fountaining with counter-current flow, and (4) direct lateral ejection. The Novarupta deposits suggest a model where buoyant, stable, regime-1 plumes characterized most of episodes II and III, but were accompanied by transient and variable partitioning of clasts into the other three regimes. Only one short period of vent blockage and cessation of the Plinian plume occurred, separating episodes II and III, which was followed by a single PDC interpreted as an overpressured "blast" involving direct lateral ejection. In contrast, regimes 2 and 3 were reflected by spasmodic sedimentation from the margins of the jet and perhaps lower plume
Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok
2014-04-01
Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.
Biomechanical optimization of different fixation modes for a proximal femoral L-osteotomy
Directory of Open Access Journals (Sweden)
Chen Hsih-Hao
2009-09-01
Full Text Available Abstract Background Numerous proposed surgical techniques have had minimal success in managing greater trochanter overgrowth secondary to retarded growth of the femoral capital epiphysis. For reconstruction of residual hip deformities, a novel type of proximal femur L-osteotomy was performed with satisfactory results. Although the clinical outcome was good, the biomechanical characteristics of the femur after such an osteotomy have not been clearly elucidated. Therefore, this study presents a three dimensional finite element analysis designed to understand the mechanical characteristics of the femur after the L-osteotomy. Methods A patient with left hip dysplasia was recruited as the study model for L-osteotomy. The normal right hip was used as a reference for performing the corrective surgery. Four FEA models were constructed using different numbers of fixation screws but the same osteotomy lengths together with four FEA models with the same number of fixation screws but different osteotomy lengths. The von Mises stress distributions and femoral head displacements were analyzed and compared. Results The results revealed the following: 1. The fixation devices (plate and screws sustained most of the external loading, and the peak value of von Mises stress on the fixation screws decreased with an increasing number of screws. 2. Additional screws are more beneficial on the proximal segment than on the distal segment for improving the stability of the postoperative femur. 3. The extent of osteotomy should be limited because local stress might be concentrated in the femoral neck region with increasing length of the L-osteotomy. Conclusion Additional screw placement on the proximal segment improves stability in the postoperative femur. The cobra-type plate with additional screw holes in the proximal area might improve the effectiveness of L-osteotomies.
Proximal Focal Femoral Deficiency in Ibadan a Developing ...
African Journals Online (AJOL)
The cultural aversion to amputation in our environment makes it difficult to employ that option of treatment. Proximal focal femoral deficiency in Ibadan a developing country's perspective and a review of the literature. Keywords: Proximal focal femoral deficiency , congenital malformations , limb malformations , lower limb ...
Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru
2007-01-01
Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.
DEFF Research Database (Denmark)
Hernandez Castellano, Lorenzo E; Morales-delaNuez, Antonio; Moreno-Indias, Isabel
2013-01-01
of this study, therefore, was to evaluate local and imported carcasses and meat quality in order to promote the consumption of local breeds, using the Canary Islands (Spain) as a model for other subtropical outermost regions. For this study 20 half-carcasses from Palmera breed and 20 imported half...
[Avulsion of the Proximal Hamstring Insertion. Case Reports].
Mizera, R; Harcuba, R; Kratochvíl, J
2016-01-01
Proximal hamstring avulsion is an uncommon muscle injury with a lack of consensus on indications and the timing and technique of surgery. Poor clinical symptoms and difficulties in the diagnostic process can lead to a false diagnosis. The authors present three cases of proximal hamstring avulsion, two complete and one partial ruptures of the biceps femoris muscle. MRI and ultrasound scans were used for optimal treatment alignment. Acute surgery reconstruction (hamstring strength. Two interesting systematic reviews published on the treatment of proximal hamstring avulsion are discussed in the final part of the paper. Key words: hamstring, rupture, avulsion.
A dual-mode proximity sensor with integrated capacitive and temperature sensing units
International Nuclear Information System (INIS)
Qiu, Shihua; Huang, Ying; He, Xiaoyue; Sun, Zhiguang; Liu, Ping; Liu, Caixia
2015-01-01
The proximity sensor is one of the most important devices in the field of robot application. It can accurately provide the proximity information to assistant robots to interact with human beings and the external environment safely. In this paper, we have proposed and demonstrated a dual-mode proximity sensor composed of capacitive and resistive sensing units. We defined the capacitive type proximity sensor perceiving the proximity information as C-mode and the resistive type proximity sensor detecting as R-mode. Graphene nanoplatelets (GNPs) were chosen as the R-mode sensing material because of its high performance. The dual-mode proximity sensor presents the following features: (1) the sensing distance of the dual-mode proximity sensor has been enlarged compared with the single capacitive proximity sensor in the same geometrical pattern; (2) experiments have verified that the proposed sensor can sense the proximity information of different materials; (3) the proximity sensing capability of the sensor has been improved by two modes perceive collaboratively, for a plastic block at a temperature of 60 °C: the R-mode will perceive the proximity information when the distance d between the sensor and object is 6.0–17.0 mm and the C-mode will do that when their interval is 0–2.0 mm; additionally two modes will work together when the distance is 2.0–6.0 mm. These features indicate our transducer is very valuable in skin-like sensing applications. (paper)
Ruegg, C E; Gandolfi, A J; Nagle, R B; Brendel, K
1987-09-15
The innate susceptibility of renal cell types to these agents was investigated using precision-cut rabbit renal cortical slices made perpendicular to the cortical-papillary axis. Slices were incubated in DME/F12 medium containing 10 microM, 100 microM, or 1 mM concentrations of either metal for 12 hr or in Krebs-Hepes buffer gassed with nitrogen (100%) for 0.75 to 5 hr of hypoxic exposure. To simulate postischemic reperfusion, some slices were transferred to vessels gassed with oxygen after an initial hypoxic period. Mercuric chloride (100 microM) exposure resulted in damage to the straight regions of proximal tubules by 12 hr leaving convoluted regions unaffected. Hypoxia (2.25 hr) and potassium dichromate (100 microM for 12 hr) both caused injury to the convoluted proximal tubules without affecting straight proximal tubular regions. Mercury concentrations of 10 microM and 1 mM had no effect or injured all cell types within the slice, respectively. Similar results were observed for hypoxic periods less than 1.5 hr or greater than 3 hr of exposure. Potassium dichromate had no measurable affect at 10 microM, but at 1 mM focal lesions were observed after 4 hr of exposure, and by 12 hr all cell types within the slice were affected. Intracellular potassium content normalized to DNA correlated well, but always preceded the pathological lesions observed. These results demonstrate that injury to specific regions of the proximal tubule by these agents relates to an innate susceptibility of the intoxicated cell type independent of physiologic feedback or blood delivery patterns proposed as mechanisms of selective injury from in vivo studies.
A Regularized Algorithm for the Proximal Split Feasibility Problem
Directory of Open Access Journals (Sweden)
Zhangsong Yao
2014-01-01
Full Text Available The proximal split feasibility problem has been studied. A regularized method has been presented for solving the proximal split feasibility problem. Strong convergence theorem is given.
Doyle, Joyce; Atkinson-Briggs, Sharon; Atkinson, Petah; Firebrace, Bradley; Calleja, Julie; Reilly, Rachel; Cargo, Margaret; Riley, Therese; Crumpen, Tui; Rowley, Kevin
2016-11-10
Aboriginal Community Controlled Organisations (ACCOs) provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1) identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2) evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %). Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to achieve change. First Peoples' health promotion in the
Proximity approach to problems in topology and analysis
Naimpally, Somashekhar
2009-01-01
Dieses Buch konzentriert das aktuelle Gesamtwissen zum Proximity-Konzept und stellt es dem Leser in gut strukturierter Form dar. Hauptaugenmerk liegt auf den vielfältigen Möglichkeiten, die sich aus dem Proximity-Konzept der räumlichen Nähe und seiner Verallgemeinerung im Nearness-Konzept ergeben.
Proximity effects in ferromagnet/superconductor structures
International Nuclear Information System (INIS)
Yu, H.L.; Sun, G.Y.; Yang, L.Y.; Xing, D.Y.
2004-01-01
The Nambu spinor Green's function approach is applied to study proximity effects in ferromagnet/superconductor (FM/SC) structures. They include the induced superconducting order parameter and density of states (DOS) with superconducting feature on the FM side, and spin-dependent DOS within the energy gap on the SC side. The latter indicates an appearance of gapless superconductivity and a coexistence of ferromagnetism and superconductivity in a small regime near the interface. The influence of exchange energy in FM and barrier strength at interface on the proximity effects is discussed
Brünisholz, Hervé P; Hagen, Regine; Fürst, Anton E; Kuemmerle, Jan M
2015-10-01
To characterize the configuration of incomplete proximal fractures of the proximal phalanx (P1) in horses not used for racing and compare radiographic with computed tomography (CT) findings. Historical cohort. Twenty-four horses with incomplete fractures of P1. Medical records of horses not used for racing diagnosed with an incomplete proximal fracture of P1 based on clinical and radiographic examination and confirmed by CT between 2008 and 2013 were retrieved. Radiographs and CT studies of these horses were analyzed using a subjective grading system and by measuring variables that characterized fracture configuration. Twenty-four horses were included (20 Warmbloods) with a mean age of 9.5 years and mean body weight of 574 kg. Fourteen forelimbs and 10 hind limbs were affected. Mean duration of lameness was 8.7 weeks. Computed tomography was superior to radiography in both identifying the fracture and determining fracture size and location. On CT, 92% of fractures were located in the mid-sagittal plane. Mean proximodistal length of the fracture was 13 mm. Fractures were frequently not bicortical. Fractures in forelimbs were located significantly more dorsally than fractures in hind limbs. A distinct fracture pattern with 2 subchondral lines running parallel in close proximity to each other was identified in 54% of cases. Incomplete proximal fractures of P1 have significant variation in their configurations, especially their dorsopalmar/-plantar location. Computed tomography examination allowed clear identification of the fracture configurations and was superior to radiography. © Copyright 2015 by The American College of Veterinary Surgeons.
Penta Rao, Tamarba; Rajendra Prasad, P.
2018-04-01
Entry region swirl promoters gain importance in industry because of its effectiveness in augmentation of mass and heat transfer augmentation. Design of equipment needs momentum transfer data along with mass or heat transfer data. Hence an experimental investigation was carried out with coaxially placed entry region spiral coil as turbulence promoters on momentum transfer in forced convection flow of electrolyte in circular conduits. Aqueous solution of sodium hydroxide and 0.01 M equimolal Ferri-ferro cyanide system was chosen for the study. The study covered parameters like effect of pitch of the coil, effect of length of the coil, diameter of the coil, diameter of the coil wire, diameter of the annular rod. The promoter is measured by limiting current technique using diffusion controlled electrochemical reactions. The study comprises of evaluation of momentum transfer rates at the outer wall of the electrochemical cell. Pressure drop measurements were also made to obtain the energy consumption pattern. Within the range of variables covered. The results are correlated by the momentum transfer similarity function. Momentum transfer coefficients were evaluated from measured limiting currents. Effect of each parameter was studied in terms of friction factor. A model was developed for momentum transfer. The experimental data on momentum transfer was modeled in terms of momentum transfer function and Reynolds number, geometric parameters.
International Nuclear Information System (INIS)
Kim, S.H.; Lee, J.S.; Kwon, O.K.; Han, M.K.; Kim, J.H.
2005-01-01
Purpose: To evaluate the prevalence of proximal vertebral artery stenosis, compared with those of the distal vertebral/basilar artery and extracranial internal carotid artery, in a large population of stroke and non-stroke patients. Material and Methods: Nine-hundred-and-thirty-five patients who underwent high-resolution contrast-enhanced magnetic resonance angiography in a regional general hospital were categorized into six groups based on neurological symptoms and disease: an asymptomatic group (n ∼ 182), a minor symptom group with headache or dizziness (n ∼ 519), a cardiac group with coronary artery steno-occlusive disease (n ∼ 15), a hemorrhagic group with old cerebral hemorrhage (n ∼ 26), an anterior circulation infarct group (n ∼ 121), and posterior circulation infarct group (n ∼ 72). Prevalence of stenosis of the proximal vertebral artery, distal vertebral/basilar artery, and internal carotid artery was analyzed. Results: The prevalence of stenosis of the proximal vertebral artery, distal vertebral/basilar artery, and internal carotid artery was 12.9%, 5.5%, and 7.2%, respectively, in the study population, and rose as the age increased (P <0.0001 for all arteries). The prevalence of stenosis of the proximal vertebral artery, distal vertebral/basilar artery, and internal carotid artery was 3.3%, 0.5%, and.1%, respectively, in the asymptomatic group; 8.3%, 2.1%, and 3.7%, respectively, in the minor symptom group; 13.3%, 6.7%, and 6.7%, respectively, in the cardiac group; 19.2%, 7.7%, and 7.7%, respectively, in the hemorrhagic group; 27.3%, 8.3%, and 25.6%, respectively, in the anterior circulation infarct group; and 44.4%, 36.1%, and 16.7%, respectively, in the posterior circulation infarct group. This increasing tendency of stenosis accordingly was statistically significant ( P <0.0001 for all arteries). Conclusion: The prevalence of proximal vertebral artery stenosis was highest, compared with those of the distal vertebral/basilar artery and
Samsom, M.; Roelofs, J. M.; Akkermans, L. M.; van Berge Henegouwen, G. P.; Smout, A. J.
1998-01-01
Disordered gastric emptying occurs in 30-50% of patients with diabetes mellitus. Although the rate of gastric emptying is dependent on the integration of motor activity in different regions of the stomach, there is limited information about the function of the proximal stomach in diabetes mellitus.
Two-Step Proximal Gradient Algorithm for Low-Rank Matrix Completion
Directory of Open Access Journals (Sweden)
Qiuyu Wang
2016-06-01
Full Text Available In this paper, we propose a two-step proximal gradient algorithm to solve nuclear norm regularized least squares for the purpose of recovering low-rank data matrix from sampling of its entries. Each iteration generated by the proposed algorithm is a combination of the latest three points, namely, the previous point, the current iterate, and its proximal gradient point. This algorithm preserves the computational simplicity of classical proximal gradient algorithm where a singular value decomposition in proximal operator is involved. Global convergence is followed directly in the literature. Numerical results are reported to show the efficiency of the algorithm.
Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel
1987-01-01
Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
International Nuclear Information System (INIS)
Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi
2005-01-01
Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β
Proximity operations concept design study, task 6
Williams, A. N.
1990-01-01
The feasibility of using optical technology to perform the mission of the proximity operations communications subsystem on Space Station Freedom was determined. Proximity operations mission requirements are determined and the relationship to the overall operational environment of the space station is defined. From this information, the design requirements of the communication subsystem are derived. Based on these requirements, a preliminary design is developed and the feasibility of implementation determined. To support the Orbital Maneuvering Vehicle and National Space Transportation System, the optical system development is straightforward. The requirements on extra-vehicular activity are such as to allow large fields of uncertainty, thus exacerbating the acquisition problem; however, an approach is given that could mitigate this problem. In general, it is found that such a system could indeed perform the proximity operations mission requirement, with some development required to support extra-vehicular activity.
Saify, Khyber; Saadat, Iraj; Saadat, Mostafa
2014-11-30
Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Core Promoter Structure in the Oomycete Phytophthora infestans
McLeod, Adele; Smart, Christine D.; Fry, William E.
2004-01-01
We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940
Proximate analysis of Lentinus squarrosulus (Mont.) Singer and ...
African Journals Online (AJOL)
Each of the mushroom species was separated into its stipe and pileus and used for proximate analysis. There was a highly significant difference (p<0.01) in the proximate composition of the two species. P. atroumbonata had significantly higher crude protein, crude fibre and moisture content than L. squarrosulus while the ...
Genetics Home Reference: proximal 18q deletion syndrome
... characteristic features. Most cases of proximal 18q deletion syndrome are the result of a new (de novo) deletion and are not inherited from a ... J, Fox PT, Stratton RF, Perry B, Hale DE. Recurrent interstitial deletions of proximal 18q: a new syndrome involving expressive speech delay. Am J Med Genet ...
Superconducting proximity effect in topological materials
Reeg, Christopher R.
In recent years, there has been a renewed interest in the proximity effect due to its role in the realization of topological superconductivity. In this dissertation, we discuss several results that have been obtained in the field of proximity-induced superconductivity and relate the results to the search for Majorana fermions. First, we show that repulsive electron-electron interactions can induce a non-Majorana zero-energy bound state at the interface between a conventional superconductor and a normal metal. We show that this state is very sensitive to disorder, owing to its lack of topological protection. Second, we show that Rashba spin-orbit coupling, which is one of the key ingredients in engineering a topological superconductor, induces triplet pairing in the proximity effect. When the spin-orbit coupling is strong (i.e., when the characteristic energy scale for spin-orbit coupling is comparable to the Fermi energy), the induced singlet and triplet pairing amplitudes can be comparable in magnitude. Finally, we discuss how the size of the proximity-induced gap, which appears in a low-dimensional material coupled to a superconductor, evolves as the thickness of the (quasi-)low-dimensional material is increased. We show that the induced gap can be comparable to the bulk energy gap of the underlying superconductor in materials that are much thicker than the Fermi wavelength, even in the presence of an interfacial barrier and strong Fermi surface mismatch. This result has important experimental consequences for topological superconductivity, as a sizable gap is required to isolate and detect the Majorana modes.
Towler, D A; Bennett, C D; Rodan, G A
1994-05-01
A detailed analysis of the transcriptional machinery responsible for osteoblast-specific gene expression should provide tools useful for understanding osteoblast commitment and differentiation. We have defined three cis-elements important for basal activity of the rat osteocalcin (OC) promoter, located at about -200 to -180, -170 to -138, and -121 to -64 relative to the transcription initiation site. A motif (TCTGATTGTGT) present in the region between -200 and -170 that binds a multisubunit CP1/NFY/CBF-like CAAT factor complex contributes significantly to high level basal activity and presumably functions as the CAAT box for the rat OC promoter. We show that the region -121 to 32 is sufficient to confer osteoblastic cell type specificity in transient transfection assays of cultured cell lines using luciferase as a reporter. The basal promoter is active in rodent osteoblastic cell lines, but not in rodent fibroblastic or muscle cell lines. Although the rat OC box (-100 to -74) contains a CAAT motif, we could not detect CP1-like CAAT factor binding to this region. In fact, we demonstrate that a Msx-1 (Hox 7.1) homeodomain binding motif (ACTAATTG; bottom strand) in the 3'-end of the rat OC box is necessary for high level activity of the rat OC basal promoter in osteoblastic cells. A nuclear factor that recognizes this motif appears to be present in osteoblastic ROS 17/2.8 cells, which produce OC, but not in fibroblastic ROS 25/1 cells, which fail to express OC. This ROS 17/2.8 nuclear factor also recognizes the A/T-rich DNA cognates of the homeodomain-containing POU family of transcription factors. Taken together, these data suggest that a ubiquitous CP1-like CAAT factor and a cell type-restricted homeodomain containing (Msx or POU family) transcription factor interact with the proximal rat OC promoter to direct appropriate basal OC transcription in osteoblastic cells.
Expression of the Arabidopsis Sigma Factor SIG5 Is Photoreceptor and Photosynthesis Controlled
Directory of Open Access Journals (Sweden)
Marina Mellenthin
2014-08-01
Full Text Available Two collections of Arabidopsis GAL4 enhancer trap lines were screened for light-intensity dependent reporter gene activation. Line N9313 was isolated for its strong light-intensity regulation. The T-DNA element trapped distant enhancers of the SIG5 promoter, which drives expression of a sigma factor involved in regulation of chloroplast genes for photosystem II core proteins. The T-DNA insertion 715 bp upstream of the transcription initiation site splits the promoter in a distal and proximal part. Both parts are sensitive to blue and red light and depend on photosynthetic electron transport activity between photosystem II and the plastoquinone pool. The mainblue-light sensitivity is localized within a 196-bp sequence (–887 to –691 bp in the proximal promoter region It is preferentially CRY1 and PHYB controlled. Type-I and type-II phytochromes mediate red-light sensitivity via various promoter elements spread over the proximal and distal upstream region. This work characterizes SIG5 as an anterograde control factor of chloroplast gene expression, which is controlled by chloroplast signals in a retrograde manner.
Proximal focal femoral deficiency: A case report
Directory of Open Access Journals (Sweden)
Shashank Sharma
2015-01-01
Full Text Available Proximal focal femoral deficiency (PFFD is a rare congenital anomaly resulting in limb shortening and disability in young. The exact cause of the disease is not known and it may present as varying grades of affection involving the proximal femur and the acetabulum. Recognition of this rare abnormality on radiographs can help manage these cases better since early institution of therapy may help in achieving adequate growth of the femur.
The Hounsfield value for cortical bone geometry in the proximal humerus - an in vitro study
International Nuclear Information System (INIS)
Lim Fat, Daren; Kennedy, Jim; Galvin, Rose; O'Brien, Fergal; Mc Grath, Frank; Mullett, Hannan
2012-01-01
Fractures of the proximal humerus represent a major osteoporotic burden. Recent developments in CT imaging have emphasized the importance of cortical bone thickness distribution in the prevention and management of fragility fractures. We aimed to experimentally define the CT density of cortical bone in the proximal humerus for building cortical geometry maps. With ethical approval, we used ten fresh-frozen human proximal humeri. These were stripped of all soft tissue and high-resolution CT images were then taken. The humeral heads were then subsequently resected to allow access to the metaphyseal area. Using curettes, cancellous bone was removed down to hard cortical bone. Another set of CT images of the reamed specimen was then taken. Using CT imaging software and a CAD interface, we then compared cortical contours at different CT density thresholds to the reference inner cortical contour of our reamed specimens. Working with 3D model representations of these cortical maps, we were able to accurately make distance comparison analyses based on different CT thresholds. We could compute a single closest value at 700 HU. No difference was found in the HU-based contours generated along the 500-900 HU pixels (p = 1.000). The contours were significantly different from those generated at 300, 400, 1,000, and 1,100 HU. A Hounsfield range of 500-900 HU can accurately depict cortical bone geometry in the proximal humerus. Thresholding outside this range leads to statistically significant inaccuracies. Our results concur with a similar range reported in the literature for the proximal femur. Knowledge of regional variations in cortical bone thickness has direct implications for basic science studies on osteoporosis and its treatment, but is also important for the orthopedic surgeon since our decision for treatment options is often guided by local bone quality. (orig.)
Matsutani Sachiko
2004-01-01
Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...
Systemic calciphylaxis presenting as a painful, proximal myopathy.
Edelstein, C. L.; Wickham, M. K.; Kirby, P. A.
1992-01-01
A renal transplant patient who presented with a painful, proximal myopathy due to systemic calciphylaxis is described. The myopathy preceded the characteristic skin and soft tissue necrosis. Systemic calciphylaxis should be considered in a dialysis or a renal transplant patient presenting with a painful proximal myopathy even in the absence of necrotic skin lesions.
Anatomy and Biomechanics of the Finger Proximal Interphalangeal Joint.
Pang, Eric Quan; Yao, Jeffrey
2018-05-01
A complete understanding of the normal anatomy and biomechanics of the proximal interphalangeal joint is critical when treating pathology of the joint as well as in the design of new reconstructive treatments. The osseous anatomy dictates the principles of motion at the proximal interphalangeal joint. Subsequently, the joint is stabilized throughout its motion by the surrounding proximal collateral ligament, accessory collateral ligament, and volar plate. The goal of this article is to review the normal anatomy and biomechanics of the proximal interphalangeal joint and its associated structures, most importantly the proper collateral ligament, accessory collateral ligament, and volar plate. Copyright © 2017 Elsevier Inc. All rights reserved.
Chen, Chih-Ping; Lee, Meng-Ju; Chern, Schu-Rern; Wu, Peih-Shan; Su, Jun-Wei; Chen, Yu-Ting; Lee, Meng-Shan; Wang, Wayseen
2013-10-25
We present prenatal diagnosis of de novo proximal interstitial deletion of chromosome 4p (4p15.2→p14) and molecular cytogenetic characterization of the deletion using uncultured amniocytes. We review the phenotypic abnormalities of previously reported patients with similar proximal interstitial 4p deletions, and we discuss the functions of the genes of RBPJ, CCKAR, STIM2, PCDH7 and ARAP2 that are deleted within this region. © 2013.
Computerized bone density analysis of the proximal phalanx of the horse
International Nuclear Information System (INIS)
Thompson, K.N.; Cheung, T.K.; Putnam, M.
1996-01-01
This study utilized computed tomography to determine the density patterns and the subchondral bone thickness of the first phalanx of the horse. An image processing system and commercially available software were used to process the computed tomographic slices obtained from the first phalanges of a 2-year-old Thoroughbred horse. The thickness and density of the medial and lateral cortices in the mid-shaft of the bone were similar; however, the cortex on the dorsal aspect was more dense and extended farther toward the proximal and distal aspects of the bone than the cortex on the palmar aspect. Density of the cortical bone was highest at the region of the bone with the smallest diameter. The cortical bone density at mid-shaft was approximately 3.5 times the cancellous bone density at the proximal aspect and 2.5 times that at the distal aspect of the bone. A moderate correlation (r = 0.53, p < 0.01)was found between the subchondral bone density and thickness. Despite limited numbers of specimens used, this study demonstrated the potential applications of computed tomography for investigating equine joint mechanics and diseases
Directory of Open Access Journals (Sweden)
Cleidson Nogueira Dias
2014-12-01
Full Text Available This research paper examines the importance of inter-organizational network management as a government policy tool to promote regional development. This pattern requires Federal Government intervention so as to compensate for the imbalance that this causes and to guarantee that economic growth resulting from government actions leads to development in all regions of the country, thereby avoiding the traditional mechanisms of wealth concentration. For this, a methodology of content analysis was used based on a relevant public policy aimed at promoting development within Brazil and by analyzing the data collected in relation to the current theory related to strategy, local development and inter-organizational networks in general. The analysis results show that, when the policy studied in this work, applied in the federal network of professional education, science & technology, was implemented the networks had a positive influence on the outcome of the policy objectives and represented an extremely powerful support tool, being one of the most important factors to boost development.
Husted, L; Sanchez, L C; Olsen, S N; Baptiste, K E; Merritt, A M
2008-06-01
Stall housing has been suggested as a risk factor for ulcer development in the equine stomach; however, the exact pathogenesis for this has not been established. To investigate the effect of 3 environmental situations (grass paddock, stall alone or stall with adjacent companion) on pH in the proximal and the ventral stomach. Six horses with permanently implanted gastric cannulae were used in a randomised, cross-over, block design. Each horse rotated through each of three 24 h environmental situations. Horses remained on their normal diet (grass hay ad libitum and grain b.i.d.) throughout the study. Intragastric pH was measured continuously for 72 h just inside the lower oesophageal sphincter (proximal stomach) and via a pH probe in the gastric cannula (ventral stomach). Neither proximal nor ventral 24 h gastric pH changed significantly between the 3 environmental situations. Mean hourly proximal gastric pH decreased significantly in the interval from 01.00-09.00 h compared to the interval from 13.00-20.00 h, regardless of environmental situation. Median hourly proximal pH only differed in the interval from 06.00-07.00 h compared to the interval 14.00-19.00 h. Neither mean nor median hourly ventral gastric pH varied significantly with the time of day. The change in housing status used in the current study did not affect acid exposure within either region of the equine stomach. The pH in the ventral stomach was uniformly stable throughout the study, while the proximal pH demonstrated a 24 h circadian pattern.
Context-Aware Community Construction in Proximity-Based Mobile Networks
Directory of Open Access Journals (Sweden)
Na Yu
2015-01-01
Full Text Available Sensor-equipped mobile devices have allowed users to participate in various social networking services. We focus on proximity-based mobile social networking environments where users can share information obtained from different places via their mobile devices when they are in proximity. Since people are more likely to share information if they can benefit from the sharing or if they think the information is of interest to others, there might exist community structures where users who share information more often are grouped together. Communities in proximity-based mobile networks represent social groups where connections are built when people are in proximity. We consider information influence (i.e., specify who shares information with whom as the connection and the space and time related to the shared information as the contexts. To model the potential information influences, we construct an influence graph by integrating the space and time contexts into the proximity-based contacts of mobile users. Further, we propose a two-phase strategy to detect and track context-aware communities based on the influence graph and show how the context-aware community structure improves the performance of two types of mobile social applications.
Huisman, Elise S; Andersson, Gustav; Scott, Alexander; Reno, Carol R; Hart, David A; Thornton, Gail M
2014-05-01
The aim of this study was: (i) to analyze the morphology and expression of extracellular matrix genes in six different regions of the Achilles tendon complex of intact normal rabbits; and (ii) to assess the effect of ovariohysterectomy (OVH) on the regional expression of these genes. Female New Zealand White rabbits were separated into two groups: (i) intact normal rabbits (n = 4); and (ii) OVH rabbits (n = 8). For each rabbit, the Achilles tendon complex was dissected into six regions: distal gastrocnemius (DG); distal flexor digitorum superficialis; proximal lateral gastrocnemius (PLG); proximal medial gastrocnemius; proximal flexor digitorum superficialis; and paratenon. For each of the regions, hematoxylin and eosin staining was performed for histological evaluation of intact normal rabbit tissues and mRNA levels for proteoglycans, collagens and genes associated with collagen regulation were assessed by real-time reverse transcription-quantitative polymerase chain reaction for both the intact normal and OVH rabbit tissues. The distal regions displayed a more fibrocartilaginous phenotype. For intact normal rabbits, aggrecan mRNA expression was higher in the distal regions of the Achilles tendon complex compared with the proximal regions. Collagen Type I and matrix metalloproteinase-2 expression levels were increased in the PLG compared to the DG in the intact normal rabbit tissues. The tendons from OVH rabbits had lower gene expressions for the proteoglycans aggrecan, biglycan, decorin and versican compared with the intact normal rabbits, although the regional differences of increased aggrecan expression in distal regions compared with proximal regions persisted. The tensile and compressive forces experienced in the examined regions may be related to the regional differences found in gene expression. The lower mRNA expression of the genes examined in the OVH group confirms a potential effect of systemic estrogen on tendon. © 2014 Anatomical Society.
Hybrid external fixation of the proximal tibia: strategies to improve frame stability.
Roberts, Craig S; Dodds, James C; Perry, Kelvin; Beck, Dennis; Seligson, David; Voor, Michael J
2003-07-01
To determine the specific frame construction strategies that can increase the stability of hybrid (ring with tensioned wires proximally connected by bars to half-pins distally) external fixation of proximal tibia fractures. DESIGN Repeated measures biomechanical testing. Laboratory. Composite fiberglass tibias. Using the Heidelberg and Ilizarov systems, external fixators were tested on composite fiberglass tibias with a 1-cm proximal osteotomy (OTA fracture classification 41-A3.3) in seven frame configurations: unilateral frames with 5-mm diameter half-pins and 6-mm diameter half-pins; hybrid (as described above), with and without a 6-mm anterior proximal half-pin; a "box" hybrid (additional ring group distal to the fracture connected by symmetrically spaced bars to the proximal rings) with and without an anterior, proximal half-pin; and a full, four-ring configuration. Each configuration was loaded in four positions (central, medial, posterior, and posteromedial). Displacement at point of loading of proximal fragment. The "box" hybrid was stiffer than the standard hybrid for all loading positions. The addition of an anterior half-pin stiffened the standard hybrid and the "box" hybrid. The most dramatic improvements in the stability of hybrid frames used for proximal tibial fractures result from addition of an anterior, proximal half-pin.
Endomedullar nail of metacarpal and proximal phalanges
International Nuclear Information System (INIS)
Mendez Olaya, Francisco Javier; Sanchez Mesa, Pedro Antonio
2002-01-01
Prospective study, series of cases; it included patients with diaphysis fractures and union diaphysis-neck or union diaphysis-base of metacarpal and proximal phalanges, in whom was practiced anterograde intramedullary nailing previous closed reduction of the fracture, using prevent intramedullary nail of 1.6 mm. (cem 16) for the metacarpal fractures, and two nail prevent of 1.0 mm. (cem 10) for the proximal phalangeal fractures. Indications: transverse and oblique short fractures, spiral and with comminuting bicortical. Pursuit average is 5.7 months. Frequency surgical intervened patient: 2.2 each month, using this surgical technique a total of 20 (twenty) patients have been operated, 21 (twenty one) fractures; 16 (sixteen) metacarcal fractures and 5 (five) proximal phalangeal fractures, all of them tested using clinical and radiological parameters. Results: good 82%, regular 18%, and bad 0% obtaining bony consolidation and early rehabilitation with incorporation to their habitual works
MR imaging of proximal femur: age-related changes
International Nuclear Information System (INIS)
Kim, Ju Heon; Jeon, Woo Jin; Sohn, Cheol Ho; Park, Mi Ok; Lee, Seong Mun; Joo, Yang Gu; Suh, Soo Jhi; Pyun, Young Sik
1995-01-01
The purpose of this study is to illustrate MR patterns of signal intensity of proximal femur in normal subjects according to the age distribution. T1-weighted MR images of the proximal femur in 125 subjects, aged 13 days to 25 years, were retrospectively analyzed. Age distribution was classified to 4 groups; below 4 months, 5 months to 4 years, 5 years to 14 years, and 15 years to 25 years. By the age of 4 months, the non-ossified femoral epiphysis was seen as intermediate-signal-intensity cartilage. At 5 months-4 years, the ossified femoral capital epiphysis was seen within intermediate-signal-intensity cartilage and appeared as decreased or increased signal-intensity red or yellow marrow surrounded by a rim of low-signal-intensity cortical bone. At 5-14 years, the ossified femoral capital and greater trochanteric epiphysis were seen within the intermediate-signal-intensity cartilage and appeared as decreased or increased signal-intensity red or yellow marrow. At 15-25 years, the proximal metaphyseal marrow showed increased signal intensity. Four patterns of the metaphyseal marrow were recognized by Ricci et al. The frequency of pattern 1 a progressively decreased with age. Pattern 2 and 3 were visible in the 15-25 years age group. An understanding of the spectrum of normal age-related change of the proximal femoral cartilage and marrow patterns serves as the foundation for interpretation of proximal femur pathologies
Childhood leukemia and residential proximity to industrial and urban sites
International Nuclear Information System (INIS)
García-Pérez, Javier; López-Abente, Gonzalo; Gómez-Barroso, Diana; Morales-Piga, Antonio; Pardo Romaguera, Elena; Tamayo, Ibon; Fernández-Navarro, Pablo
2015-01-01
Background: Few risk factors for the childhood leukemia are well established. While a small fraction of cases of childhood leukemia might be partially attributable to some diseases or ionizing radiation exposure, the role of industrial and urban pollution also needs to be assessed. Objectives: To ascertain the possible effect of residential proximity to both industrial and urban areas on childhood leukemia, taking into account industrial groups and toxic substances released. Methods: We conducted a population-based case–control study of childhood leukemia in Spain, covering 638 incident cases gathered from the Spanish Registry of Childhood Tumors and for those Autonomous Regions with 100% coverage (period 1990-2011), and 13,188 controls, individually matched by year of birth, sex, and autonomous region of residence. Distances were computed from the respective subject’s residences to the 1068 industries and the 157 urban areas with ≥10,000 inhabitants, located in the study area. Using logistic regression, odds ratios (ORs) and 95% confidence intervals (95%CIs) for categories of distance to industrial and urban pollution sources were calculated, with adjustment for matching variables. Results: Excess risk of childhood leukemia was observed for children living near (≤2.5 km) industries (OR=1.31; 95%CI=1.03–1.67) – particularly glass and mineral fibers (OR=2.42; 95%CI=1.49–3.92), surface treatment using organic solvents (OR=1.87; 95%CI=1.24–2.83), galvanization (OR=1.86; 95%CI=1.07–3.21), production and processing of metals (OR=1.69; 95%CI=1.22–2.34), and surface treatment of metals (OR=1.62; 95%CI=1.22–2.15) – , and urban areas (OR=1.36; 95%CI=1.02–1.80). Conclusions: Our study furnishes some evidence that living in the proximity of industrial and urban sites may be a risk factor for childhood leukemia. - Highlights: • We studied proximity to both industrial and urban sites on childhood leukemia. • We conducted a case–control study in
Childhood leukemia and residential proximity to industrial and urban sites
Energy Technology Data Exchange (ETDEWEB)
García-Pérez, Javier, E-mail: jgarcia@isciii.es [Cancer and Environmental Epidemiology Unit, National Center for Epidemiology, Carlos III Institute of Health, Madrid (Spain); CIBER Epidemiología y Salud Pública (CIBERESP) (Spain); López-Abente, Gonzalo, E-mail: glabente@isciii.es [Cancer and Environmental Epidemiology Unit, National Center for Epidemiology, Carlos III Institute of Health, Madrid (Spain); CIBER Epidemiología y Salud Pública (CIBERESP) (Spain); Gómez-Barroso, Diana, E-mail: dgomez@externos.isciii.es [CIBER Epidemiología y Salud Pública (CIBERESP) (Spain); National Center for Epidemiology, Carlos III Institute of Health, Madrid (Spain); Morales-Piga, Antonio, E-mail: amorales@isciii.es [Rare Disease Research Institute (IIER), Carlos III Institute of Health, Madrid (Spain); Consortium for Biomedical Research in Rare Diseases (CIBERER), Madrid (Spain); Pardo Romaguera, Elena, E-mail: elena.pardo@uv.es [Spanish Registry of Childhood Tumors (RETI-SEHOP), University of Valencia, Valencia (Spain); Tamayo, Ibon, E-mail: ibontama@gmail.com [Public Health Division of Gipuzkoa, BIODonostia Research Institute, Department of Health of the Regional Government of the Basque Country, Donostia (Spain); Fernández-Navarro, Pablo, E-mail: pfernandezn@isciii.es [Cancer and Environmental Epidemiology Unit, National Center for Epidemiology, Carlos III Institute of Health, Madrid (Spain); CIBER Epidemiología y Salud Pública (CIBERESP) (Spain); and others
2015-07-15
Background: Few risk factors for the childhood leukemia are well established. While a small fraction of cases of childhood leukemia might be partially attributable to some diseases or ionizing radiation exposure, the role of industrial and urban pollution also needs to be assessed. Objectives: To ascertain the possible effect of residential proximity to both industrial and urban areas on childhood leukemia, taking into account industrial groups and toxic substances released. Methods: We conducted a population-based case–control study of childhood leukemia in Spain, covering 638 incident cases gathered from the Spanish Registry of Childhood Tumors and for those Autonomous Regions with 100% coverage (period 1990-2011), and 13,188 controls, individually matched by year of birth, sex, and autonomous region of residence. Distances were computed from the respective subject’s residences to the 1068 industries and the 157 urban areas with ≥10,000 inhabitants, located in the study area. Using logistic regression, odds ratios (ORs) and 95% confidence intervals (95%CIs) for categories of distance to industrial and urban pollution sources were calculated, with adjustment for matching variables. Results: Excess risk of childhood leukemia was observed for children living near (≤2.5 km) industries (OR=1.31; 95%CI=1.03–1.67) – particularly glass and mineral fibers (OR=2.42; 95%CI=1.49–3.92), surface treatment using organic solvents (OR=1.87; 95%CI=1.24–2.83), galvanization (OR=1.86; 95%CI=1.07–3.21), production and processing of metals (OR=1.69; 95%CI=1.22–2.34), and surface treatment of metals (OR=1.62; 95%CI=1.22–2.15) – , and urban areas (OR=1.36; 95%CI=1.02–1.80). Conclusions: Our study furnishes some evidence that living in the proximity of industrial and urban sites may be a risk factor for childhood leukemia. - Highlights: • We studied proximity to both industrial and urban sites on childhood leukemia. • We conducted a case–control study in
Topology of digital images visual pattern discovery in proximity spaces
Peters, James F
2014-01-01
This book carries forward recent work on visual patterns and structures in digital images and introduces a near set-based a topology of digital images. Visual patterns arise naturally in digital images viewed as sets of non-abstract points endowed with some form of proximity (nearness) relation. Proximity relations make it possible to construct uniform topolo- gies on the sets of points that constitute a digital image. In keeping with an interest in gaining an understanding of digital images themselves as a rich source of patterns, this book introduces the basics of digital images from a computer vision perspective. In parallel with a computer vision perspective on digital images, this book also introduces the basics of prox- imity spaces. Not only the traditional view of spatial proximity relations but also the more recent descriptive proximity relations are considered. The beauty of the descriptive proximity approach is that it is possible to discover visual set patterns among sets that are non-overlapping ...
Energy Technology Data Exchange (ETDEWEB)
Cretton, M.; Rost, E.; Mazzuca-Sobczuk, T.; Mazzuca, M.
2016-07-01
The fish processing operations in Patagonia produce large amounts of waste. The main fishery resource in Argentina is the Argentine hake (Merluccius hubbsi). The ports of the province of Chubut (the most important of which are Puerto Madryn, Rawson and Comodoro Rivadavia), together with Caleta Paula Port (province of Santa Cruz), in the Argentine Patagonia, capture more than 82,000 tons of hake annualy, 80% of which are of M. hubbsi, which is mostly converted into fillets. From this capture, about 2,296 tons of liver would be available for the extraction of oil. To promote the recovery and industrial use of fish oil, in the present study, we determined the variation in the proximate composition and fatty acid profile of Argentine hake waste from the ports mentioned above at different catch times. Proximate composition was determined according of the Official Methods of Analysis (AOAC). Fatty acid profile was analyzed by gas chromatography of the fatty acid methyl esters (FAMEs). A standard mixture of FAMEs was run under identical conditions to identify the compounds on the basis of their retention times. Fatty acids were quantified using heptadecanoic acid (C17:0) as internal standard. The highest lipid recovery (27.0 to 41.8% of total lipids) was obtained from the liver fraction. Palmitic acid (C16:0), oleic acid (18:1 n9), docosahexaenoic acid (22:6 n3), eicosapentaenoic acid (20:5 n3) and palmitoleic acid (16:1) were the main constituents. Protein levels in viscera without livers (V-L) were higher than those in the liver. The extraction of marine fish oil and the production of fish offal meal from waste from fish factories would contribute to the sustainability of the regional industry, because it would also decrease the volume of waste, with benefits to the environment. (Author)
Donahue, Craig J.; Rais, Elizabeth A.
2009-01-01
This lab experiment illustrates the use of thermogravimetric analysis (TGA) to perform proximate analysis on a series of coal samples of different rank. Peat and coke are also examined. A total of four exercises are described. These are dry exercises as students interpret previously recorded scans. The weight percent moisture, volatile matter,…
Energy Technology Data Exchange (ETDEWEB)
Amos-Landgraf J.; Nicholls, R.D. [Case Western Reserve Univ., Cleveland, OH (United States); Gottlieb, W. [Univ. of Florida, Gainesville, FL (United States)] [and others
1994-09-01
Prader-Willi (PWS) and Angelman (AS) syndromes most commonly arise from large deletions of 15q11-q13. Deletions in PWS are paternal in origin, while those in AS are maternal in origin, clearly demonstrating genomic imprinting in these clinically distinct neurobehavioural disorders. In at least 90% of PWS and AS deletion patients, the same 4 Mb region within 15q11-q13 is deleted with breakpoints clustering in single YAC clones at the proximal and distal ends. To study the mechanism of chromosome breakage in PWS and AS, we have previously isolated 25 independent clones from these three YACs using Alu-vector PCR. Four clones were selected that appear to detect a low copy repeat that is located in the proximal and distal breakpoint regions of chromosome 15q11-q13. Three clones detect the same 4 HindIII bands in genomic DNA, all from 15q11-q13, with differing intensities for the probes located at the proximal or distal breakpoints region, respectively. This suggests that these probes detect related members of a low-copy repeat at either location. Moreover, the 254RL2 probe detects a novel HindIII band in two unrelated PWS deletion patients, suggesting that this may represent a breakpoint fragment, with recombination occurring within a similar interval in both patients. A fourth clone, 318RL3 detects 5 bands in HindIII-digested genomic DNA, all from 15q11-q13. This YAC endclone itself is not deleted in PWS and AS deletion patients, as seen by an invariant strong band. Two other strong bands are variably intact or deleted in different PWS or AS deletion patients, suggesting a relationship of this sequence to the breakpoints. Moreover, PCR using 318RL3 primers from the distal 93C9 YAC led to the isolation of a related clone with 96% identity, demonstrating the existence of a low-copy repeat with members close to the proximal and distal breakpoints. Taken together, our data suggest a complex, low-copy repeat with members at both the proximal and distal boundaries.
DEFF Research Database (Denmark)
Ekstrand, K R; Alloza, Alvaro Luna; Promisiero, L
2011-01-01
This study aimed to determine the reliability and accuracy of the ICDAS and radiographs in detecting and estimating the depth of proximal lesions on extracted teeth. The lesions were visible to the naked eye. Three trained examiners scored a total of 132 sound/carious proximal surfaces from 106 p...
Cancer rates after the Three Mile Island nuclear accident and proximity of residence to the plant.
Hatch, M C; Wallenstein, S; Beyea, J; Nieves, J W; Susser, M
1991-06-01
In the light of a possible link between stress and cancer promotion or progression, and of previously reported distress in residents near the Three Mile Island (TMI) nuclear power plant, we attempted to evaluate the impact of the March 1979 accident on community cancer rates. Proximity of residence to the plant, which related to distress in previous studies, was taken as a possible indicator of accident stress; the postaccident pattern in cancer rates was examined in 69 "study tracts" within a 10-mile radius of TMI, in relation to residential proximity. A modest association was found between postaccident cancer rates and proximity (OR = 1.4; 95% CI = 1.3, 1.6). After adjusting for a gradient in cancer risk prior to the accident, the odds ratio contrasting those closest to the plant with those living farther out was 1.2 (95% CI = 1.0, 1.4). A postaccident increase in cancer rates near the Three Mile Island plant was notable in 1982, persisted for another year, and then declined. Radiation emissions, as modeled mathematically, did not account for the observed increase. Interpretation in terms of accident stress is limited by the lack of an individual measure of stress and by uncertainty about whether stress has a biological effect on cancer in humans. An alternative mechanism for the cancer increase near the plant is through changes in care-seeking and diagnostic practice arising from postaccident concern.
Promoting a smokers' quitline in Ontario, Canada: an evaluation of an academic detailing approach.
Kirst, Maritt; Schwartz, Robert
2015-06-01
This study assesses the impact of an academic detailing quitline promotional outreach program on integration of patient referrals to the quitline by fax in healthcare settings and quitline utilization in Ontario, Canada. The study employed a mixed methods approach for evaluation, with trend analysis of quitline administrative data from the year before program inception (2005) to 2011 and qualitative interviews with quitline stakeholders. Participants in the qualitative interviews included academic detailing program staff, regional tobacco control stakeholders and quitline promotion experts. Quantitative outcomes included the number of fax referral partners and fax referrals received, and quitline reach. Trends in proximal and distal outreach program outcomes were assessed. The qualitative data were analysed through a process of data coding involving the constant comparative technique derived from grounded theory methods. The study identified that the outreach program has had some success in integrating the fax referral program in healthcare settings through evidence of increased fax referrals since program inception. However, organizational barriers to program partner engagement have been encountered. While referral from health professionals through the fax referral programs has increased since the inception of the outreach program, the overall reach of the quitline has not increased. The study findings highlight that an academic detailing approach to quitline promotion can have some success in achieving increased fax referral program integration in healthcare settings. However, findings suggest that investment in a comprehensive promotional strategy, incorporating academic detailing, media and the provision of free cessation medications may be a more effective approach to quitline promotion. © The Author (2013). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Calreticulin discriminates the proximal region at the N-glycosylation site of Glc1Man9GlcNAc2 ligand
Energy Technology Data Exchange (ETDEWEB)
Hirano, Makoto; Adachi, Yuka [Department of Materials and Life Science, Seikei University, 3-3-1 Kichijoji-kita, Musashino, Tokyo 180-8633 (Japan); Ito, Yukishige [Synthetic Cellular Chemistry Laboratory, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); ERATO, Japan Science and Technology Agency, Ito Glycotrilogy Project, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Totani, Kiichiro, E-mail: ktotani@st.seikei.ac.jp [Department of Materials and Life Science, Seikei University, 3-3-1 Kichijoji-kita, Musashino, Tokyo 180-8633 (Japan)
2015-10-23
Calreticulin (CRT) is well known as a lectin-like chaperone that recognizes Glc1Man9GlcNAc2 (G1M9)-glycoproteins in the endoplasmic reticulum (ER). However, whether CRT can directly interact with the aglycone moiety (protein portion) of the glycoprotein remains controversial. To improve our understanding of CRT interactions, structure-defined G1M9-derivatives with different aglycones (–OH, –Gly–NH{sub 2}, and –Gly–Glu–{sup t}Bu) were used as CRT ligands, and their interactions with recombinant CRT were analyzed using thermal shift analysis. The results showed that CRT binds strongly to a G1M9-ligand in the order –Gly–Glu–{sup t}Bu > –Gly–NH{sub 2} > –OH, which is the same as that of the reglucosylation of Man9GlcNAc2 (M9)-derivatives by the folding sensor enzyme UGGT (UDP-glucose: glycoprotein glucosyltransferase). Our results indicate that, similar to UGGT, CRT discriminates the proximal region at the N-glycosylation site, suggesting a similar mechanism mediating the recognition of aglycone moieties in the ER glycoprotein quality control system. - Highlights: • Glc1Man9GlcNAc2 (G1M9) ligands with different aglycones were chemically prepared. • Calreticulin (CRT) discriminates the aglycone of Glc1Man9GlcNAc2 (G1M9) ligand. • CRT binds with G1M9 ligands in a similar manner to folding sensor enzyme.
Directory of Open Access Journals (Sweden)
Joyce Doyle
2016-11-01
achieve change. Conclusion First Peoples’ health promotion in the Goulburn-Murray Rivers region encompasses a broad range of social, cultural, lifestyle and community development activities, including reclaiming and strengthening cultural identity and social connectedness as a response to colonisation.
[Growth behaviour after fractures of the proximal radius: differences to the rest of the skeleton].
Hell, A K; von Laer, L
2014-12-01
Fractures of the proximal end of the radius in the growth phase have three characteristics: the head of the radius articulates with two joint partners and is therefore indispensable for an undisturbed function of the elbow. The blood supply of the proximal end of the radius is via periosteal vessels in the sense of a terminal circulation which makes it extremely vulnerable. Severe trauma caused either by accidents or treatment, can result in partial or complete necrosis with deformity of the head and neck region of the radius. Radioulnar synostosis and chronic epiphysiolysis are irreversible complications which can occur after excessive physiotherapy. Despite a low potency growth plate, in young patients the proximal end of the radius shows an enormous spontaneous correction of dislocations. Side to side shifts, however, will not be remodeled. Therapy should be as atraumatic as possible. Due to the blood supply situation, with the appropriate indications the spontaneous correction and a brief period of immobilization without physiotherapy should be integrated into the therapy concept. If an operation is necessary, repeated traumatic repositioning maneuvers should be avoided and in case of doubt closed or careful open repositioning can be achieved with intramedullary nailing. In order to take the special characteristics of the proximal radius into consideration, the vulnerability and correction potential must be weighed up against each other. Therapy must be as atraumatic as possible. The spontaneous correction potential should be integrated into the primary therapy without overestimating this potential with respect to the extent and age of the patient.
Correlation between social proximity and mobility similarity.
Fan, Chao; Liu, Yiding; Huang, Junming; Rong, Zhihai; Zhou, Tao
2017-09-20
Human behaviors exhibit ubiquitous correlations in many aspects, such as individual and collective levels, temporal and spatial dimensions, content, social and geographical layers. With rich Internet data of online behaviors becoming available, it attracts academic interests to explore human mobility similarity from the perspective of social network proximity. Existent analysis shows a strong correlation between online social proximity and offline mobility similarity, namely, mobile records between friends are significantly more similar than between strangers, and those between friends with common neighbors are even more similar. We argue the importance of the number and diversity of common friends, with a counter intuitive finding that the number of common friends has no positive impact on mobility similarity while the diversity plays a key role, disagreeing with previous studies. Our analysis provides a novel view for better understanding the coupling between human online and offline behaviors, and will help model and predict human behaviors based on social proximity.
Bone mineral density of lumbar spine and proximal femur in healthy males
International Nuclear Information System (INIS)
Akin, S.; Isikli, S.; Korkusuz, F.; Ungan, M.; Senkoylu, A.
2004-01-01
Relationship between BMD and age at lumbar spine and proximal femur in Turkish males was investigated. Two hundred ninety healthy males (aged 20-59 years) were investigated. BMD of the lumbar spine had its peak at ages 30-39, however, the peak for the proximal femur was between the ages of 20 and 29. There was a significant decrease in BMD at proximal femur after these peak values with increasing age. There was a significant correlation between age and the proximal femoral BMD in males and age has a strong predictive power on proximal femur BMD score. (author)
Proximal soil sensors and data fusion for precision agriculture
Mahmood, H.S.
2013-01-01
different remote and proximal soil sensors are available today that can scan entire fields and give detailed information on various physical, chemical, mechanical and biological soil properties. The first objective of this thesis was to evaluate different proximal soil sensors available today and to
Proximal caries detection: Sirona Sidexis versus Kodak Ektaspeed Plus.
Khan, Emad A; Tyndall, Donald A; Ludlow, John B; Caplan, Daniel
2005-01-01
This study compared the accuracy of intraoral film and a charge-coupled device (CCD) receptor for proximal caries detection. Four observers evaluated images of the proximal surfaces of 40 extracted posterior teeth. The presence or absence of caries was scored using a five-point confidence scale. The actual status of each surface was determined from ground section histology. Responses were evaluated by means of receiver operating characteristic (ROC) analysis. Areas under ROC curves (Az) were assessed through a paired t-test. The performance of the CCD-based intraoral sensor was not different statistically from Ektaspeed Plus film in detecting proximal caries.
Atgl gene deletion predisposes to proximal tubule damage by impairing the fatty acid metabolism
International Nuclear Information System (INIS)
Chen, Wen; Zhang, Qiong; Cheng, Shiwu; Huang, Jie; Diao, Ge; Han, Jian
2017-01-01
Fibrosis is the final common pathway of chronic kidney disease (CKD). Normal lipid metabolism is integral to renal physiology, and disturbances of renal lipid metabolism are increasingly being linked with CKD, including the fibrosis. Adipose triglyceride lipase (ATGL) is the rate-limiting enzyme of lipolysis. In the present study, we used Atgl −/− mice to investigate whether ATGL played a role in the regulation of proximal convoluted tubule (PCT) lipid metabolism and renal fibrosis development. ATGL deficiency led to lipid vacuolation of PCT and tubulointerstitial fibrosis, accompanied by massive albuminuria and decreased creatinine clearance rate (Ccr). In vitro experiments indicated that inhibition of ATGL in proximal tubular cell line HK-2 promoted intracellular lipid deposition, reactive oxygen species (ROS) accumulation and cell apoptosis. Both in vitro and in vivo experiments showed that ATGL inhibition decreased the renal peroxisome proliferator-activated receptorα(PPARα) expression, which implied the suppressed lipid metabolism. The antioxidant N-acetylcysteine (NAC) could partially reverse the effect of ROS accumulation and cell apoptosis, but could not restore the PPARαdecrease. These data raise the possibility that ATGL deficiency could impair the renal fatty acid metabolism though inhibiting PPARαexpression, which may lead to lipid deposition and cell apoptosis of PCT, and finally contribute to the renal fibrosis and dysfunction. - Highlights: • Atgl −/− mice develop tubulointerstitial damage and renal dysfunction. • ATGL deficiency results in lipid accumulation and apoptosis of proximal tubular cells. • ROS scavenger alleviates the ATGL-knockdown mediated lipid accumulation and apoptosis. • PPARαdown-regulation is the reason of ROS elevating in ATGL-knockdown HK-2 cells.
Diniz, Eva; DeSousa, Diogo; Koller, Silvia H; Volling, Brenda L
2016-05-01
Adolescent mothers often come from vulnerable backgrounds which might impact the quality of both maternal and infant behavior. Despite the negative impact of adolescent motherhood for maternal and infant behavior, social support may decrease the risks and promote maternal behavior toward the infant. The aim of this study was to investigate longitudinally the effects of proximal (maternal behavior) and distal (mother's perceived social support) variables on infant development in a sample of Brazilian adolescent mothers and their infants. Thirty-nine adolescent mothers (Mage=17.26years; SD=1.71) were observed interacting with their infants at 3 and 6 months postpartum and reported on social support. Results revealed that maternal and infant behavior were associated within and across times. Mothers' perceived social support at 3 months had an indirect effect on infant behavior at 6 months, totally mediated by maternal behavior at 6 months. Our findings revealed the mutual influence between maternal and infant behavior, revealing a proximal process. The results also underscored the importance of the passage of time in the interplay between mother-infant interactions and their developmental context. Copyright © 2016 Elsevier Inc. All rights reserved.
Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters
2016-08-01
levels, and in some cases be useful in early stage disease or watchful waiting, and in other cases castration resistant prostate cancer (CRPC...dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Molecular endocrinology 13, 376 (Mar, 1999). 9...analyses and in mouse xenograft experiments, as planned. We will also continue to probe the molecular mechanism by which dox elicits these differential
Seal, S N; Davis, D L; Burch, J B
1991-05-01
The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.
DEFF Research Database (Denmark)
van der Beek, Christina M; Canfora, Emanuel E; Lenaerts, Kaatje
2016-01-01
, circulating hormones or inflammatory markers. In conclusion distal colonic acetate infusions affected whole-body substrate metabolism, with a pronounced increase in fasting fat oxidation and plasma PYY. Modulating colonic acetate may be a nutritional target to treat or prevent metabolic disorders.......Gut microbial-derived short-chain fatty acids (SCFA) are believed to affect host metabolism and cardiometabolic risk factors. The present study aim was to investigate the effects of proximal and distal colonic infusions with the SCFA acetate on fat oxidation and other metabolic parameters in men...... in the colon for three consecutive test days, enabling colonic acetate (100 or 180 mmol/l) or placebo infusion during fasting conditions and after an oral glucose load (postprandial). Fat oxidation and energy expenditure were measured using an open-circuit ventilated hood system and blood samples were...
Gel shift analysis of the empA promoter region in Vibrio anguillarum
Directory of Open Access Journals (Sweden)
Denkin Steven M
2004-10-01
Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V
Directory of Open Access Journals (Sweden)
J Stephen Dumler
2016-09-01
Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.
Indications for computed tomography (CT-) diagnostics in proximal humeral fractures
DEFF Research Database (Denmark)
Bahrs, Christian; Rolauffs, Bernd; Südkamp, Norbert P
2009-01-01
diagnostics depending on the fractured parts. METHODS: In a prospective diagnostic study in two level 1 trauma centers, 44 patients with proximal humeral fractures were diagnosed with conventional X-rays (22 AP + axillary views, 22 AP + scapular Y-views) and CT (multi-planar reconstruction (MPR) and maximum...... diagnostic methods was assessed according to the number of fractured parts (Bonferroni-Holm adjustment). RESULTS: There was significantly more overlap of the fractured region on the scapular Y-views (mean 71.5%, range 45-90%) than on axillary views (mean 56.2%, range 10.5-100%). CT-diagnostics allowed...... a significantly better assessment of the relevant structures than conventional diagnostics (p diagnostics of the fracture...
Computational proximity excursions in the topology of digital images
Peters, James F
2016-01-01
This book introduces computational proximity (CP) as an algorithmic approach to finding nonempty sets of points that are either close to each other or far apart. Typically in computational proximity, the book starts with some form of proximity space (topological space equipped with a proximity relation) that has an inherent geometry. In CP, two types of near sets are considered, namely, spatially near sets and descriptivelynear sets. It is shown that connectedness, boundedness, mesh nerves, convexity, shapes and shape theory are principal topics in the study of nearness and separation of physical aswell as abstract sets. CP has a hefty visual content. Applications of CP in computer vision, multimedia, brain activity, biology, social networks, and cosmology are included. The book has been derived from the lectures of the author in a graduate course on the topology of digital images taught over the past several years. Many of the students have provided important insights and valuable suggestions. The topics in ...
Zhang, Z L; Li, J P; Li, G; Ma, X C
2017-02-09
Objective: To establish and validate a computer program used to aid the detection of dental proximal caries in the images cone beam computed tomography (CBCT) images. Methods: According to the characteristics of caries lesions in X-ray images, a computer aided detection program for proximal caries was established with Matlab and Visual C++. The whole process for caries lesion detection included image import and preprocessing, measuring average gray value of air area, choosing region of interest and calculating gray value, defining the caries areas. The program was used to examine 90 proximal surfaces from 45 extracted human teeth collected from Peking University School and Hospital of Stomatology. The teeth were then scanned with a CBCT scanner (Promax 3D). The proximal surfaces of the teeth were respectively detected by caries detection program and scored by human observer for the extent of lesions with 6-level-scale. With histologic examination serving as the reference standard, the caries detection program and the human observer performances were assessed with receiver operating characteristic (ROC) curves. Student t -test was used to analyze the areas under the ROC curves (AUC) for the differences between caries detection program and human observer. Spearman correlation coefficient was used to analyze the detection accuracy of caries depth. Results: For the diagnosis of proximal caries in CBCT images, the AUC values of human observers and caries detection program were 0.632 and 0.703, respectively. There was a statistically significant difference between the AUC values ( P= 0.023). The correlation between program performance and gold standard (correlation coefficient r (s)=0.525) was higher than that of observer performance and gold standard ( r (s)=0.457) and there was a statistically significant difference between the correlation coefficients ( P= 0.000). Conclusions: The program that automatically detects dental proximal caries lesions could improve the
International Nuclear Information System (INIS)
Sassone-Corsi, P.; Borrelli, E.
1987-01-01
The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection
E4orf1 Enhances Glucose Uptake Independent of Proximal Insulin Signaling
Na, Ha-Na; Hegde, Vijay; Dubuisson, Olga; Dhurandhar, Nikhil V.
2016-01-01
Impaired proximal insulin signaling is often present in diabetes. Hence, approaches to enhance glucose disposal independent of proximal insulin signaling are desirable. Evidence indicates that Adenovirus-derived E4orf1 protein may offer such an approach. This study determined if E4orf1 improves insulin sensitivity and downregulates proximal insulin signaling in vivo and enhances cellular glucose uptake independent of proximal insulin signaling in vitro. High fat fed mice were injected with a ...
The female geriatric proximal humeral fracture: protagonist for straight antegrade nailing?
Lindtner, Richard A; Kralinger, Franz S; Kapferer, Sebastian; Hengg, Clemens; Wambacher, Markus; Euler, Simon A
2017-10-01
Straight antegrade humeral nailing (SAHN) has become a standard technique for the surgical fixation of proximal humeral fractures, which predominantly affect elderly females. The nail's proximal anchoring point has been demonstrated to be critical to ensure reliable fixation in osteoporotic bone and to prevent iatrogenic damage to the superior rotator cuff bony insertion. Anatomical variations of the proximal humerus, however, may preclude satisfactory anchoring of the nail's proximal end and may bare the risk of rotator cuff violation, even though the nail is inserted as recommended. The aim of this study was to evaluate the anatomical suitability of proximal humeri of geriatric females aged 75 years and older for SAHN. Specifically, we sought to assess the proportion of humeri not anatomically amenable to SAHN for proximal humeral fracture. A total of 303 proximal humeri of 241 females aged 75 years and older (mean age 84.5 ± 5.0 years; range 75-102 years) were analyzed for this study. Multiplanar two-dimensional reformations (true ap, true lateral, and axial) were reconstructed from shoulder computed tomography (CT) data sets. The straight antegrade nail's ideal entry point, "critical point" (CP), and critical distance (CD; distance between ideal entry point and CP) were determined. The rate of proximal humeri not anatomically suitable for SAHN (critical type) was assessed regarding proximal reaming diameters of currently available straight antegrade humeral nails. Overall, 35.6% (108/303) of all proximal humeri were found to be "critical types" (CD straight antegrade nails currently in use. Moreover, 43.2% (131/303) of the humeri were considered "critical types" with regard to the alternatively used larger proximal reaming diameter of 11.5 mm. Mean CD was 9.0 ± 1.7 mm (range 3.5-13.5 mm) and did not correlate with age (r = -0.04, P = 0.54). No significant differences in CD and rate of "critical types" were found between left and right humeri
HEMATOMA OF THE PROXIMAL NAIL FOLD. REPORT OF 41 CASES
Directory of Open Access Journals (Sweden)
Chang Patricia
2011-04-01
Full Text Available Background: The proximal fold is an important part of the nail apparatus it contributes to the formation of the nail plate and through the cuticle acts as an impermeable barrier protecting it from any cause.Objective: To know the proximal nail fold hematoma caused by the use of pulse oximeter.Material and Methods: A descriptive study was conducted in 41 patients with proximal nail hematoma secondary to the use of oximetry in patients hospitalized in the Intermediate and Intensive Care Unit at the Hospital General de Enfermedades from December 1, 2007 to December 31, 2010.Results: We studied 41 patients with proximal nail fold hematoma secondary to the use of oximeter, 30 (73.1% were males and 11 (26.8% females. The numbers of fingers affected by pulse oximeter were in one digit. 30 (73.1% cases, in two digits 6 (14.6%, in three digits 3 (7.3%, in 4 digits 1 (2.4% and in 5 digits 1 (2.4% case. The most affected proximal nail fold was right index: 24 (58.5%, right middle 11 (26.8%, right ring 6 (14.6%, left index 12 (29.2%, and left middle 6 (14.6% cases.Conclusions: Hematomas of the proximal nail fold may be caused by different traumatisms. The use of pulse oximeter is one of them.
International Nuclear Information System (INIS)
Lloyd, K.C.K.; Koblik, P.; Ragle, C.; Wheat, J.D.; Lakritz, J.
1988-01-01
In 4 adult horses, simple, non displaced, incomplete fracture of the proximal extremity of the third metacarpal bone (MC3) was identified radiographically only on the dorsopalmar projection. Lameness was slight to moderate. Although nerve blocks of the foot and fetlock did not alter the lameness, high palmar regional nerve block improved the gait in 1 of the 2 horses on which it was performed. Pain on palpation or swollen distal accessory (inferior check) ligament, flexor tendons, and suspensory ligament were not found in any horse. The fracture was localized to the palmar surface of the proximal extremity of the MC3 on the basis of the intense uptake of radiopharmaceutical (99MTc-labeled sodium medronate) observed in that area during the soft tissue and delayed bone phases of a nuclear scintigraphic examination (nuclear scan) performed concurrently with radiography. Of 4 horses evaluated 6 months after the initial diagnosis, 3 had medullary sclerosis without radiographic evidence of fracture; results of follow-up nuclear scintigraphy performed in one of these horses at the same time were normal. Incomplete fracture also was suspected in another 6 adult horses with clinical lameness referable to the proximal extremity of the MC3. Although a fracture line could not be seen radiographically, trabecular hypertrophy and/or medullary sclerosis of the proximal extremity of the MC3 were detected on the dorsopalmar projection. Further, during nuclear scintigraphy, an intense uptake of the radiopharmaceutical was observed on the palmar aspect of the proximal extremity of the MC3 in all 6 horses
Molecular population genetics of inversion breakpoint regions in Drosophila pseudoobscura.
Wallace, Andre G; Detweiler, Don; Schaeffer, Stephen W
2013-07-08
Paracentric inversions in populations can have a profound effect on the pattern and organization of nucleotide variability along a chromosome. Regions near inversion breakpoints are expected to have greater levels of differentiation because of reduced genetic exchange between different gene arrangements whereas central regions in the inverted segments are predicted to have lower levels of nucleotide differentiation due to greater levels of genetic flux among different karyotypes. We used the inversion polymorphism on the third chromosome of Drosophila pseudoobscura to test these predictions with an analysis of nucleotide diversity of 18 genetic markers near and away from inversion breakpoints. We tested hypotheses about how the presence of different chromosomal arrangements affects the pattern and organization of nucleotide variation. Overall, markers in the distal segment of the chromosome had greater levels of nucleotide heterozygosity than markers within the proximal segment of the chromosome. In addition, our results rejected the hypothesis that the breakpoints of derived inversions will have lower levels of nucleotide variability than breakpoints of ancestral inversions, even when strains with gene conversion events were removed. High levels of linkage disequilibrium were observed within all 11 breakpoint regions as well as between the ends of most proximal and distal breakpoints. The central region of the chromosome had the greatest levels of linkage disequilibrium compared with the proximal and distal regions because this is the region that experiences the highest level of recombination suppression. These data do not fully support the idea that genetic exchange is the sole force that influences genetic variation on inverted chromosomes.
Proximal-Type Epithelioid Sarcoma: Report of an Unusual Case in the Uterine Cervix.
Suárez-Zamora, David Alfonso; Barrera-Herrera, Luis Eduardo; Rodríguez-Urrego, Paula Andrea; Palau-Lázaro, Mauricio Alfonso
2017-08-01
Epithelioid sarcoma is a rare malignant mesenchymal neoplasm (less than 1% of all sarcomas) with epithelioid morphology. Among the 2 subtypes, proximal represents only one-third of cases and commonly involves deep tissues of pelvic region, including the perineum, genital area, and groin, and occurs more frequently in older patients who present a more aggressive course. In the female genital tract, proximal-type epithelioid sarcoma (PES) mainly affects the vulva and is extremely uncommon in the uterus. To our knowledge, only a few cases of PES involving the cervix and uterine body have been previously reported in the literature. We report a 23-year-old woman who presented with abnormal vaginal bleeding. She was found to have a cervical mass, which was resected and diagnosed as a hemangioendothelioma. However, 2 months later, the mass recurred and the histopathological analysis at our institution demonstrated a PES confined to the uterine cervix. It is important to include this neoplasm in the differential diagnosis of epithelioid tumors that can involve the female genital tract because it has a significant impact on prognosis and treatment.
Inter-proximal enamel reduction in contemporary orthodontics.
Pindoria, J; Fleming, P S; Sharma, P K
2016-12-16
Inter-proximal enamel reduction has gained increasing prominence in recent years being advocated to provide space for orthodontic alignment, to refine contact points and to potentially improve long-term stability. An array of techniques and products are available ranging from hand-held abrasive strips to handpiece mounted burs and discs. The indications for inter-proximal enamel reduction and the importance of formal space analysis, together with the various techniques and armamentarium which may be used to perform it safely in both the labial and buccal segments are outlined.
Directory of Open Access Journals (Sweden)
Weise Kuno
2009-04-01
Full Text Available Abstract Background Precise indications for computed tomography (CT in proximal humeral fractures are not established. The purpose of this study was a comparison of conventional radiographic views with different CT reconstructions with 2 D and 3 D imaging to establish indications for additional CT diagnostics depending on the fractured parts. Methods In a prospective diagnostic study in two level 1 trauma centers, 44 patients with proximal humeral fractures were diagnosed with conventional X-rays (22 AP + axillary views, 22 AP + scapular Y-views and CT (multi-planar reconstruction (MPR and maximum intensity projection (MIP with 2 D and 3 D imaging. 3 observers assessed the technical image quality, the assessment of the relevant anatomical structures (2-sample-t-test and the percentage of the osseous overlap of the proximal humerus (Welch-test using a scoring system. The quality of the different diagnostic methods was assessed according to the number of fractured parts (Bonferroni-Holm adjustment. Results There was significantly more overlap of the fractured region on the scapular Y-views (mean 71.5%, range 45–90% than on axillary views (mean 56.2%, range 10.5–100%. CT-diagnostics allowed a significantly better assessment of the relevant structures than conventional diagnostics (p Conclusion Conventional X-rays with AP view and a high-quality axillary view are useful for primary diagnostics of the fracture and often but not always show a clear presentation of the relevant bony structures such as both tuberosities, the glenoid and humeral head. CT with thin slices technology and additional 3 D imaging provides always a clear presentation of the fractured region. Clinically, a CT should be performed – independently of the number of fractured parts – when the proximal humerus and the shoulder joint are not presented with sufficient X-ray-quality to establish a treatment plan.
Treatment of proximal ulna and olecranon fractures by dorsal plating
Kloen, Peter; Buijze, Geert A.
2009-01-01
OBJECTIVE : Anatomic reconstruction of proximal ulna and olecranon fractures allowing early mobilization and prevention of ulnohumeral arthritis. INDICATIONS : Comminuted olecranon or proximal ulna fractures (including Monteggia fractures), olecranon fractures extending distally from the coronoid
Enhancing traffic performance in hierarchical DHT system by exploiting network proximity
Zhong, Haifeng; Wu, Wei; Pei, Canhao; Zhang, Chengfeng
2009-08-01
Nowadays P2P systems have become increasingly popular for object distribution and file sharing, and the majority of Internet traffic is generated by P2P file sharing applications. However, those applications usually ignored the underlying proximity of physical nodes and regionalization of file accessing. As a result, they generate a large amount of unnecessary interdomain transit traffic and increase response latency. In this paper, we proposed a new traffic control approach to enhance p2p traffic locality and reduce the cross-group transfer. Using analysis, we show that the method substantially improves node transfer efficiency and significantly reduces file access latency compared with native P2P applications.
Inexact proximal Newton methods for self-concordant functions
DEFF Research Database (Denmark)
Li, Jinchao; Andersen, Martin Skovgaard; Vandenberghe, Lieven
2016-01-01
with an application to L1-regularized covariance selection, in which prior constraints on the sparsity pattern of the inverse covariance matrix are imposed. In the numerical experiments the proximal Newton steps are computed by an accelerated proximal gradient method, and multifrontal algorithms for positive definite...... matrices with chordal sparsity patterns are used to evaluate gradients and matrix-vector products with the Hessian of the smooth component of the objective....
Proximity effects in topological insulator heterostructures
International Nuclear Information System (INIS)
Li Xiao-Guang; Wu Guang-Fen; Zhang Gu-Feng; Culcer Dimitrie; Zhang Zhen-Yu; Chen Hua
2013-01-01
Topological insulators (TIs) are bulk insulators that possess robust helical conducting states along their interfaces with conventional insulators. A tremendous research effort has recently been devoted to Tl-based heterostructures, in which conventional proximity effects give rise to a series of exotic physical phenomena. This paper reviews our recent studies on the potential existence of topological proximity effects at the interface between a topological insulator and a normal insulator or other topologically trivial systems. Using first-principles approaches, we have realized the tunability of the vertical location of the topological helical state via intriguing dual-proximity effects. To further elucidate the control parameters of this effect, we have used the graphene-based heterostructures as prototypical systems to reveal a more complete phase diagram. On the application side of the topological helical states, we have presented a catalysis example, where the topological helical state plays an essential role in facilitating surface reactions by serving as an effective electron bath. These discoveries lay the foundation for accurate manipulation of the real space properties of the topological helical state in TI-based heterostructures and pave the way for realization of the salient functionality of topological insulators in future device applications. (topical review - low-dimensional nanostructures and devices)
El-Awa, Fatimah M S; El Naga, Randa Abou; Labib, Sahar; Latif, Nisreen Abdel
2018-04-05
Tobacco use and placement of tobacco products in television (TV) productions and movies is a way to promote tobacco use while avoiding tobacco advertising bans that exist in most countries. The fact that such productions are broadcast widely and viewed by millions, including children and young people, is of concern. This paper reviews the evidence on the use of tobacco advertising, promotion and sponsorship (TAPS) in TV and films in the Eastern Mediterranean Region and the ways to combat it. Evidence from Egypt shows considerable and increasing use of tobacco products by actors on screen, including female actors, in programmes aired during Ramadan in 2015-2017. A study of Iranian movies in 2015 showed that tobacco scenes in Iranian movies were increasing. In 2014, the WHO Regional Office for the Eastern Mediterranean held a consultative meeting on TAPS in drama. The consultation recommended regulating the tobacco presence in movies and TV through complete implementation of Article 13 of the WHO FCTC, and raising the issue to the WHO FCTC Conference of the Parties. In 2016, the Conference of the Parties called on parties to consider scaling up the implementation of WHO FCTC Article 13 and monitoring the use of TAPS in entertainment media in accordance with national legislation. A comprehensive approach is essential to end the tobacco industry's use of TV productions and movies to promote their products. Copyright © World Health Organization (WHO) 2018. Some rights reserved. This work is available under the CC BY-NC-SA 3.0 IGO license (https://creativecommons.org/licenses/by-nc-sa/3.0/igo).
Welch, Martha G; Stark, Raymond I; Grieve, Philip G; Ludwig, Robert J; Isler, Joseph R; Barone, Joseph L; Myers, Michael M
2017-12-01
Premature delivery and maternal separation during hospitalisation increase infant neurodevelopmental risk. Previously, a randomised controlled trial of Family Nurture Intervention (FNI) in the neonatal intensive care unit demonstrated improvement across multiple mother and infant domains including increased electroencephalographic (EEG) power in the frontal polar region at term age. New aims were to quantify developmental changes in EEG power in all brain regions and frequencies and correlate developmental changes in EEG power among regions. EEG (128 electrodes) was obtained at 34-44 weeks postmenstrual age from preterm infants born 26-34 weeks. Forty-four infants were treated with Standard Care and 53 with FNI. EEG power was computed in 10 frequency bands (1-48 Hz) in 10 brain regions and in active and quiet sleep. Percent change/week in EEG power was increased in FNI in 132/200 tests (p regional independence in those developmental rates of change. This study strengthens the conclusion that FNI promotes cerebral cortical development of preterm infants. The findings indicate that developmental changes in EEG may provide biomarkers for risk in preterm infants as well as proximal markers of effects of FNI. ©2017 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.
comparative proximate composition and antioxidant vitamins
African Journals Online (AJOL)
DR. AMINU
Keywords: Comparative, proximate composition, antioxidant vitamins, honey. INTRODUCTION ... solution of inverted sugars and complex mixture of other saccharides ... enzymatic browning in apple slices and grape juice. (Khan, 1985).
Mapping subsurface in proximity to newly-developed sinkhole along roadway.
2013-02-01
MS&T acquired electrical resistivity tomography profiles in immediate proximity to a newly-developed sinkhole in Nixa Missouri : The sinkhole has closed a well-traveled municipal roadway and threatens proximal infrastructure. The intent of this inves...
Kaatz, Glenn W.; Thyagarajan, Rama V.; Seo, Susan M.
2005-01-01
NorA is a Staphylococcus aureus multidrug transporter that confers resistance to structurally distinct compounds. The MgrA global regulatory protein is reported to augment norA expression when mgrA is overexpressed from an undefined plasmid-based promoter. Further details about norA regulatory mechanisms are scant. A chromosomal norA::lacZ transcriptional fusion was constructed in different S. aureus strains, and allele replacement was used to define the relevance of promoter region sequences...
Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.
Wyszyńska-Koko, J; Kurył, J
2004-01-01
MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.
Directory of Open Access Journals (Sweden)
Horel Scott A
2011-05-01
Full Text Available Abstract Objective The objective of this study is to examine the relationship between residential exposure to fast-food entrées, using two measures of potential spatial access: proximity (distance to the nearest location and coverage (number of different locations, and weekly consumption of fast-food meals. Methods Traditional fast-food restaurants and non-traditional fast-food outlets, such as convenience stores, supermarkets, and grocery stores, from the 2006 Brazos Valley Food Environment Project were linked with individual participants (n = 1409 who completed the nutrition module in the 2006 Brazos Valley Community Health Assessment. Results Increased age, poverty, increased distance to the nearest fast food, and increased number of different traditional fast-food restaurants, non-traditional fast-food outlets, or fast-food opportunities were associated with less frequent weekly consumption of fast-food meals. The interaction of gender and proximity (distance or coverage (number indicated that the association of proximity to or coverage of fast-food locations on fast-food consumption was greater among women and opposite of independent effects. Conclusions Results provide impetus for identifying and understanding the complex relationship between access to all fast-food opportunities, rather than to traditional fast-food restaurants alone, and fast-food consumption. The results indicate the importance of further examining the complex interaction of gender and distance in rural areas and particularly in fast-food consumption. Furthermore, this study emphasizes the need for health promotion and policy efforts to consider all sources of fast-food as part of promoting healthful food choices.
2011-01-01
Objective The objective of this study is to examine the relationship between residential exposure to fast-food entrées, using two measures of potential spatial access: proximity (distance to the nearest location) and coverage (number of different locations), and weekly consumption of fast-food meals. Methods Traditional fast-food restaurants and non-traditional fast-food outlets, such as convenience stores, supermarkets, and grocery stores, from the 2006 Brazos Valley Food Environment Project were linked with individual participants (n = 1409) who completed the nutrition module in the 2006 Brazos Valley Community Health Assessment. Results Increased age, poverty, increased distance to the nearest fast food, and increased number of different traditional fast-food restaurants, non-traditional fast-food outlets, or fast-food opportunities were associated with less frequent weekly consumption of fast-food meals. The interaction of gender and proximity (distance) or coverage (number) indicated that the association of proximity to or coverage of fast-food locations on fast-food consumption was greater among women and opposite of independent effects. Conclusions Results provide impetus for identifying and understanding the complex relationship between access to all fast-food opportunities, rather than to traditional fast-food restaurants alone, and fast-food consumption. The results indicate the importance of further examining the complex interaction of gender and distance in rural areas and particularly in fast-food consumption. Furthermore, this study emphasizes the need for health promotion and policy efforts to consider all sources of fast-food as part of promoting healthful food choices. PMID:21599955
Directory of Open Access Journals (Sweden)
Mitrugno Valentina
2010-11-01
Full Text Available Abstract Background Basal-like carcinoma are aggressive breast cancers that frequently carry p53 inactivating mutations, lack estrogen receptor-α (ERα and express the cancer stem cell markers CD133 and CD44. These tumors also over-express Interleukin 6 (IL-6, a pro-inflammatory cytokine that stimulates the growth of breast cancer stem/progenitor cells. Results Here we show that p53 deficiency in breast cancer cells induces a loss of methylation at IL-6 proximal promoter region, which is maintained by an IL-6 autocrine loop. IL-6 also elicits the loss of methylation at the CD133 promoter region 1 and of CD44 proximal promoter, enhancing CD133 and CD44 gene transcription. In parallel, IL-6 induces the methylation of estrogen receptor (ERα promoter and the loss of ERα mRNA expression. Finally, IL-6 induces the methylation of IL-6 distal promoter and of CD133 promoter region 2, which harbour putative repressor regions. Conclusion We conclude that IL-6, whose methylation-dependent autocrine loop is triggered by the inactivation of p53, induces an epigenetic reprogramming that drives breast carcinoma cells towards a basal-like/stem cell-like gene expression profile.
Kalrn promoter usage and isoform expression respond to chronic cocaine exposure
Directory of Open Access Journals (Sweden)
Ma Xin-Ming
2011-02-01
Full Text Available Abstract Background The long-term effects of cocaine on behavior are accompanied by structural changes in excitatory glutamatergic synapses onto the medium spiny neurons of the striatum. The Kalrn gene encodes several functionally distinct isoforms; these multidomain guanine nucleotide exchange factors (GEFs contain additional domains known to interact with phosphatidylinositides as well as with a number of different proteins. Through their activation of Rho proteins and their interactions with other proteins, the different Kalirin isoforms affect cytoskeletal organization. Chronic exposure of adult male rodents to cocaine increases levels of Kalirin 7 in the striatum. When exposed chronically to cocaine, mice lacking Kalirin 7, the major adult isoform, fail to show an increase in dendritic spine density in the nucleus accumbens, show diminished place preference for cocaine, and exhibit increased locomotor activity in response to cocaine. Results The use of alternate promoters and 3'-terminal exons of the mouse Kalrn gene were investigated using real-time quantitative polymerase chain reaction. While the two most distal full-length Kalrn promoters are used equally in the prefrontal cortex, the more proximal of these promoters accounts for most of the transcripts expressed in the nucleus accumbens. The 3'-terminal exon unique to the Kalirin 7 isoform accounts for a greater percentage of the Kalrn transcripts in prefrontal cortex than in nucleus accumbens. Western blot analyses confirmed these differences. Chronic cocaine treatment increases usage of the promoter encoding the Δ-Kalirin isoforms but does not alter full-length Kalirin promoter usage. Usage of the 3'-terminal exon unique to Kalirin 7 increases following chronic cocaine exposure. Conclusions Kalrn promoter and 3'-terminal exon utilization are region-specific. In the nucleus accumbens, cocaine-mediated alterations in promoter usage and 3'-terminal exon usage favor expression of
Martelli, Luisa; Venegoni, Mauro
2013-06-01
Italian Regions and the Italian regulatory agency share a common interest in promoting the appropriateness of drug use, containing drug expenditure and acquiring additional evidence on the effectiveness and safety of drugs. Drug registries can help attaining these objectives. Specifically, the registries implemented in Italy were able to cover the first two objectives, whereas some critical issues were raised on the third one. For instance, the data recorded in the registries are not available at regional level to conduct safety and effectiveness investigations. This is a paradox, when considering that drugs included in the registries have a risk-benefit profile that is only partially defined at the moment of marketing. Currently, researchers and regions can conduct epidemiological research (cohort and case control studies), on the basis of record-linkage procedures, on all drugs prescribed in general practice (which are older drugs with a better defined risk-benefit profile). The expected outcomes of registries should be more clearly defined: when the main aim is to promote appropriateness, the recording of only a very limited amount of data should be required (to avoid a bureaucratic burden on clinicians).The Italian centers of the ENCePP network might play an important role in planning and conducting drug registries: through the presence in the steering committees of the registries, and in conducting epidemiological studies that make the most of this powerful instrument.
Energy Technology Data Exchange (ETDEWEB)
Forbes, S.A.; Brennan, L.; Richardson, M. [Queen Charlotte`s Hospital, London (United Kingdom)] [and others
1996-01-01
The gene for X-linked cleft palate (CPX) has previously been mapped in an Icelandic kindred between the unordered proximal markers DXS1002/DXS349/DXS95 and the distal marker DXYS1X, which maps to the proximal end of the X-Y homology region in Xq21.3. Using six sequence-tagged sites (STSs) within the region, a total of 91 yeast artificial chromosome (YAC) clones were isolated and overlapped in a single contig that spans approximately 3.1 Mb between DXS1002 and DXYS1X. The order of microsatellite and STS markers in this was established as DXS1002-DXS1168-DXS349-DXS95-DXS364-DXS1196-DXS472-DXS1217-DXYS1X. A long-range restriction map of this region was created using eight nonchimeric, overlapping YAC clones. Analysis of newly positioned polymorphic markers in recombinant individuals from the Icelandic family has enabled us to identify DXS1196 and DXS1217 as the flanking markers for CPX. The maximum physical distance containing the CPX gene has been estimated to be 2.0 Mb, which is spanned by a minimum set of five nonchimeric YAC clones. In addition, YAC end clone and STS analyses have pinpointed the location of the proximal boundary of the X-Y homology region within the map. 40 refs., 2 figs., 2 tabs.
International Nuclear Information System (INIS)
Abe, Hajime; Ogawa, Takashi; Wang, Liyun; Kimura, Masayuki; Tanaka, Takeshi; Morita, Reiko; Yoshida, Toshinori; Shibutani, Makoto
2014-01-01
Thioacetamide (TAA) has been used to develop a rodent model for hepatocarcinogenesis. To determine the genes with epigenetic modifications in early hepatocarcinogenesis, we did a genome-wide scan for hypermethylated promoter regions using CpG island microarrays in TAA-promoted rat liver tissue. Eight genes were selected based on the microarray profile; of these, Yy1 and Wdr45b were confirmed to be hypermethylated by methylation-specific polymerase chain reaction (PCR) and pyrosequencing and downregulated by real-time reverse transcription PCR. Non-neoplastic liver cells had nuclear Yy1 immunoreactivity, while preneoplastic foci with glutathione S-transferase placental form (GST-P) immunoreactivity had decreased Yy1 immunoreactivity. The incidence of these foci was proportional to the dose of TAA administered. Co-expression analysis of gene products downstream of Yy1 revealed increased nuclear phospho-c-Myc + foci as well as nuclear and cytoplasmic p21 Cip1+ foci in Yy1 − or GST-P + foci in response to TAA-promotion dose. Although the absolute number of cells was low, the incidence of death receptor 5 − foci was increased in Yy1 − foci in proportion to the TAA dose. Yy1 − /GST-P + foci revealed a higher number of proliferating cell nuclear antigen (PCNA)-immunoreactive cells than Yy1 + /GST-P + foci, while cleaved caspase-3 + cells were unchanged between Yy1 – /GST-P + and Yy1 + /GST-P + foci. In the case of Wdr45b, most GST-P + foci were Wdr45b – and were not increased by TAA promotion. These results suggest involvement of Yy1 in the epigenetic gene regulation at the early stages of TAA promoted cell proliferation and concomitant cell cycle arrest in preneoplastic lesions. - Highlights: • Epigenetically downregulated genes were searched in TAA-promnoted rat livers. • Yy1 and Wdr45b showed promoter-region hypermethylation and mRNA downregulation. • TAA promoted increase of preneoplastic Yy1 – /GST-P + foci showing high proliferation. • TAA
Comparison of different proximity potentials for asymmetric colliding nuclei
International Nuclear Information System (INIS)
Dutt, Ishwar; Puri, Rajeev K.
2010-01-01
Using the different versions of phenomenological proximity potential as well as other parametrizations within the proximity concept, we perform a detailed comparative study of fusion barriers for asymmetric colliding nuclei with asymmetry parameter as high as 0.23. In all, 12 different proximity potentials are robust against the experimental data of 60 reactions. Our detailed study reveals that the surface energy coefficient as well as radius of the colliding nuclei depend significantly on the asymmetry parameter. All models are able to explain the fusion barrier heights within ±10% on the average. The potentials due to Bass 80, AW 95, and Denisov DP explain nicely the fusion cross sections at above- as well as below-barrier energies.
Fractures of the proximal humerus involving the intertubercular groove
International Nuclear Information System (INIS)
Ahovuo, J.; Paavolainen, P.; Bjoerkenheim, J.M.; Helsinki Univ. Central Hospital
1989-01-01
The purpose of this study was to analyse the involvement of the gliding surface of the biceps tendon in fractures of the proximal humerus. Fifteen patients had a fracture of the proximal humerus verified with antero-posterior and axillary radiographs. Tangential radiographs of the intertubercular groove, obtained from the shoulder joint, showed involvement of the intertubercular groove in 13 patients (87%), which could not be shown with other projections. Groove radiographs revealed in 3 patients a dislocation of the fragments of the greater tuberosity large enough to require surgical treatment, but which had not been found using conventional techniques. Therefore, a groove radiograph should be used to precise fractures of the proximal humerus. (orig.)
Geographic proximity to coal plants and U.S. public support for extending the Production Tax Credit
International Nuclear Information System (INIS)
Goldfarb, Jillian L.; Buessing, Marric; Kriner, Douglas L.
2016-01-01
The Production Tax Credit (PTC) is an important policy instrument through which the federal government promotes renewable energy development in the United States. However, the efficacy of the PTC is hampered by repeated expirations and short-term extensions, and by the general uncertainty surrounding its future status. We examine the factors driving variation in public support for the extension of the PTC using a nationally representative, internet-based survey. Americans living near a coal-fired power plant are significantly more likely to support extending the PTC than are their peers who are more insulated from the externalities of burning coal. The evidence for this dynamic was strongest and most statistically significant among subjects experimentally primed to think about the adverse health effects of burning coal. Raising awareness of the public health ramifications of generating electricity from fossil fuels holds the potential to increase support for renewable energy policies among those living in proximity to coal plants, even in a highly politicized policy debate. - Highlights: • Proximity to coal power plant increases support for Production Tax Credit. • Attitudes toward global warming influence support for PTC. • Raising awareness of health threat increases PTC support if living near coal plant.
International Nuclear Information System (INIS)
Gillen, V.A.
1990-09-01
The Regional Co-operative Arrangement for the Promotion of Nuclear Science and Technology in Latin America, ARCAL, has completed its first five-year phase (1985-1989). This booklet summarizes the first phase of the ARCAL programme and contains descriptions of projects in the fields of agriculture, medicine, industry and energy
International Nuclear Information System (INIS)
Takahashi, S.; Lin, A.K.L.; Ho, C.
1982-01-01
Proton nuclear magnetic resonance spectroscopy at 250 MHz has been used to investigate the conformations of proximal histidyl residues of human normal adult hemoglobin, hemoglobin Kempsey [K145(HC2) Tyr #betta# Asp], and hemoglobin McKees Rocks [K145(HC2) Tyr #betta# Term] around neutral pH in H 2 O at 27 0 C, all in the deoxy form. Two resonances that occur between 58 and 76 ppm downfield from the water proton signal have been assigned to the hyperfine shifted proximal histidyl NH-exchangeable protons of the J and K-chains of deoxyhemoglobin. These two resonances are sensitive to the quaternary state of hemoglobin, amino acid substitutions in the J 1 K 2 -subunit interface and in the carboxy-terminal region of the K-chain, and the addition of organic phosphates. The experimental results show that there are differences in the heme pockets among these four hemoglobins studied. The structural and dynamic information derived from the hyperfine shifted proximal histidyl NH-exchangeable proton resonances complement that obtained from the ferrous hyperfine shifted and exchangeable proton resonances of deoxyhemoglobin over the spectral region from 5 to 20 ppm downfield from H 2 O. The relationship between these findings and Perutz's stereochemical mechanism for the cooperative oxygenation of hemoglobin is discussed
Giacometti, Paolo; Perdue, Katherine L; Diamond, Solomon G
2014-05-30
Interpretation and analysis of electroencephalography (EEG) measurements relies on the correspondence of electrode scalp coordinates to structural and functional regions of the brain. An algorithm is introduced for automatic calculation of the International 10-20, 10-10, and 10-5 scalp coordinates of EEG electrodes on a boundary element mesh of a human head. The EEG electrode positions are then used to generate parcellation regions of the cerebral cortex based on proximity to the EEG electrodes. The scalp electrode calculation method presented in this study effectively and efficiently identifies EEG locations without prior digitization of coordinates. The average of electrode proximity parcellations of the cortex were tabulated with respect to structural and functional regions of the brain in a population of 20 adult subjects. Parcellations based on electrode proximity and EEG sensitivity were compared. The parcellation regions based on sensitivity and proximity were found to have 44.0 ± 11.3% agreement when demarcated by the International 10-20, 32.4 ± 12.6% by the 10-10, and 24.7 ± 16.3% by the 10-5 electrode positioning system. The EEG positioning algorithm is a fast and easy method of locating EEG scalp coordinates without the need for digitized electrode positions. The parcellation method presented summarizes the EEG scalp locations with respect to brain regions without computation of a full EEG forward model solution. The reference table of electrode proximity versus cortical regions may be used by experimenters to select electrodes that correspond to anatomical and functional regions of interest. Copyright © 2014 Elsevier B.V. All rights reserved.
Exploiting Proximity-Based Mobile Apps for Large-Scale Location Privacy Probing
Directory of Open Access Journals (Sweden)
Shuang Zhao
2018-01-01
Full Text Available Proximity-based apps have been changing the way people interact with each other in the physical world. To help people extend their social networks, proximity-based nearby-stranger (NS apps that encourage people to make friends with nearby strangers have gained popularity recently. As another typical type of proximity-based apps, some ridesharing (RS apps allowing drivers to search nearby passengers and get their ridesharing requests also become popular due to their contribution to economy and emission reduction. In this paper, we concentrate on the location privacy of proximity-based mobile apps. By analyzing the communication mechanism, we find that many apps of this type are vulnerable to large-scale location spoofing attack (LLSA. We accordingly propose three approaches to performing LLSA. To evaluate the threat of LLSA posed to proximity-based mobile apps, we perform real-world case studies against an NS app named Weibo and an RS app called Didi. The results show that our approaches can effectively and automatically collect a huge volume of users’ locations or travel records, thereby demonstrating the severity of LLSA. We apply the LLSA approaches against nine popular proximity-based apps with millions of installations to evaluate the defense strength. We finally suggest possible countermeasures for the proposed attacks.
Czolowski, Eliza D; Santoro, Renee L; Srebotnjak, Tanja; Shonkoff, Seth B C
2017-08-23
Higher risk of exposure to environmental health hazards near oil and gas wells has spurred interest in quantifying populations that live in proximity to oil and gas development. The available studies on this topic lack consistent methodology and ignore aspects of oil and gas development of value to public health-relevant assessment and decision-making. We aim to present a methodological framework for oil and gas development proximity studies grounded in an understanding of hydrocarbon geology and development techniques. We geospatially overlay locations of active oil and gas wells in the conterminous United States and Census data to estimate the population living in proximity to hydrocarbon development at the national and state levels. We compare our methods and findings with existing proximity studies. Nationally, we estimate that 17.6 million people live within 1,600m (∼1 mi) of at least one active oil and/or gas well. Three of the eight studies overestimate populations at risk from actively producing oil and gas wells by including wells without evidence of production or drilling completion and/or using inappropriate population allocation methods. The remaining five studies, by omitting conventional wells in regions dominated by historical conventional development, significantly underestimate populations at risk. The well inventory guidelines we present provide an improved methodology for hydrocarbon proximity studies by acknowledging the importance of both conventional and unconventional well counts as well as the relative exposure risks associated with different primary production categories (e.g., oil, wet gas, dry gas) and developmental stages of wells. https://doi.org/10.1289/EHP1535.
Directory of Open Access Journals (Sweden)
Yan Chen
2016-01-01
Full Text Available Estrogen induces oligodendrocyte remyelination in response to demyelination in the central nervous system. Our objective was to determine the effects of 17β-estradiol (E2 on Schwann cell function and peripheral nerve remyelination after injury. Adult male C57BL/6J mice were used to prepare the sciatic nerve transection injury model and were randomly categorized into control and E2 groups. To study myelination in vitro, dorsal root ganglion (DRG explant culture was prepared using 13.5-day-old mouse embryos. Primary Schwann cells were isolated from the sciatic nerves of 1- to 3-day-old Sprague–Dawley rats. Immunostaining for myelin basic protein (MBP expression and toluidine blue staining for myelin sheaths demonstrated that E2 treatment accelerates early remyelination in the “nerve bridge” region between the proximal and distal stumps of the transection injury site in the mouse sciatic nerve. The 5-bromo-2′-deoxyuridine incorporation assay revealed that E2 promotes Schwann cell proliferation in the bridge region and in the primary culture, which is blocked using AKT inhibitor MK2206. The in vitro myelination in the DRG explant culture determined showed that the MBP expression in the E2-treated group is higher than that in the control group. These results show that E2 promotes Schwann cell proliferation and myelination depending on AKT activation.
Chen, Yan; Guo, Wenjie; Li, Wenjuan; Cheng, Meng; Hu, Ying; Xu, Wenming
2016-01-01
Estrogen induces oligodendrocyte remyelination in response to demyelination in the central nervous system. Our objective was to determine the effects of 17β-estradiol (E2) on Schwann cell function and peripheral nerve remyelination after injury. Adult male C57BL/6J mice were used to prepare the sciatic nerve transection injury model and were randomly categorized into control and E2 groups. To study myelination in vitro, dorsal root ganglion (DRG) explant culture was prepared using 13.5-day-old mouse embryos. Primary Schwann cells were isolated from the sciatic nerves of 1- to 3-day-old Sprague–Dawley rats. Immunostaining for myelin basic protein (MBP) expression and toluidine blue staining for myelin sheaths demonstrated that E2 treatment accelerates early remyelination in the “nerve bridge” region between the proximal and distal stumps of the transection injury site in the mouse sciatic nerve. The 5-bromo-2′-deoxyuridine incorporation assay revealed that E2 promotes Schwann cell proliferation in the bridge region and in the primary culture, which is blocked using AKT inhibitor MK2206. The in vitro myelination in the DRG explant culture determined showed that the MBP expression in the E2-treated group is higher than that in the control group. These results show that E2 promotes Schwann cell proliferation and myelination depending on AKT activation. PMID:27872858
J.A.J.B.M. Maas (Janneke); D.O. Mook-Kanamori (Dennis); L. Ay (Lamise); R.P.M. Steegers-Theunissen (Régine); P. Tikka-Kleemola (Päivi); A. Hofman (Albert); A.C.S. Hokken-Koelega (Anita); V.W.V. Jaddoe (Vincent)
2010-01-01
textabstractObjective: The objective of this study was to examine the associations between insulin gene variable number of tandem repeats (INS VNTR) and insulin-like growth factor 1 (IGF1) gene promoter region polymorphisms with body composition in early childhood. Methods: This study was embedded
Comparative morphometric analysis of the proximal femur of African hominids and felids
Directory of Open Access Journals (Sweden)
Andrew Gallagher
2015-09-01
Full Text Available Size and shape of the mammalian proximal femur and taxon-specific distinctions in the relative proportions of the proximal articulation, the femoral neck and the proximal femoral diaphysis, are critical determinants in its adaptation to differential biomechanical stresses and observed locomotor habitus in different taxa. The morphometrics of the proximal femur are considered equally critical in the assessment of locomotor habitus of extinct fossil mammals, particularly extinct Miocene anthropoids and Plio-Pleistocene hominins. Analyses of size and shape of k=10 dimensions of the proximal femur were undertaken for a large sample series of two extant mammal families the Felidae and Hominidae using conventional multivariate statistical procedures, commonly used size-correction methods, and post-hoc tests of significance. While significant differences in form do exist, there are equally striking convergences in the functional morphology of extant hominid and felid taxa. Multivariate and bivariate allometric analyses confirm that the proximal femur of these two mammalian families share a common underlying structure manifest in a shared first common principal component. Nevertheless, while considerable convergences in general form of the proximal femur of African hominids and large-bodied felids are apparent, there exist equally discreet distinctions which are consistent with the differential structural demands imposed by their distinct locomotor and behavioural habitus.
Detailed investigations of proximal tubular function in Imerslund-Grasbeck syndrome
DEFF Research Database (Denmark)
Storm, Tina; Zeitz, Christina; Cases, Olivier
2013-01-01
expressed in the small intestine as well as the proximal tubules of the kidney and exhibit an interdependent relationship for post-translational processing and trafficking. In the proximal tubules cubilin is involved in the reabsorption of several filtered plasma proteins including vitamin carriers...
Eren, M; Painter, C A; Gleaves, L A; Schoenhard, J A; Atkinson, J B; Brown, N J; Vaughan, D E
2003-11-01
Numerous studies have described regulatory factors and sequences that control transcriptional responses in vitro. However, there is a paucity of information on the qualitative and quantitative regulation of heterologous promoters using transgenic strategies. In order to investigate the physiological regulation of human plasminogen activator inhibitor type-1 (hPAI-1) expression in vivo compared to murine PAI-1 (mPAI-1) and to test the physiological relevance of regulatory mechanisms described in vitro, we generated transgenic mice expressing enhanced green fluorescent protein (EGFP) driven by the proximal -2.9 kb of the hPAI-1 promoter. Transgenic animals were treated with Ang II, TGF-beta1 and lipopolysaccharide (LPS) to compare the relative activation of the human and murine PAI-1 promoters. Ang II increased EGFP expression most effectively in brain, kidney and spleen, while mPAI-1 expression was quantitatively enhanced most prominently in heart and spleen. TGF-beta1 failed to induce activation of the hPAI-1 promoter but potently stimulated mPAI-1 in kidney and spleen. LPS administration triggered robust expression of mPAI-1 in liver, kidney, pancreas, spleen and lung, while EGFP was induced only modestly in heart and kidney. These results indicate that the transcriptional response of the endogenous mPAI-1 promoter varies widely in terms of location and magnitude of response to specific stimuli. Moreover, the physiological regulation of PAI-1 expression likely involves a complex interaction of transcription factors and DNA sequences that are not adequately replicated by in vitro functional studies focused on the proximal -2.9 kb promoter.
Energy Technology Data Exchange (ETDEWEB)
Rasi, S.; Havukainen, J.; Uusitalo, V.; Andersson, R.; Manninen, K.; Aro-Heinilae, E.; Rintala, J.
2012-11-01
The main objective of the project was to promote biogas production and its use as transport fuel. The aims in the four Finnish and two Estonian case areas were to reduce the amount and improve the sustainable use of waste and sludge, to promote biogas production, to start biogas use as transport fuel and to provide tools for implementing the aims. The total biomethane potential in the Helsinki region corresponds to approximately 450 GWh/a. The most potential user for biomethane is public transport. The total amount of biomethane would suffice for 80% of the busses operating in the Helsinki region. Using biogas as a transport fuel instead of energy production in the Helsinki region would result in emission reductions (13 000 t{sub CO2,eq}/a). However if the fuel replacing biogas in energy production would be renewable, the emission reductions would be significantly greater. The economical assessment indicates that the production of biogas is economically feasible if all the produced gas can be sold. Biogas produced near the natural gas grid can also be transported to the Helsinki region where there are better possibilities to find uses for it. In this way, for example, gas that is produced in Kymenlaakso but is not consumed there can be transported via the natural gas grid, assuming that the production plant is reasonably close to the grid. (orig.)
Singh, Ashutosh Kumar; Narsaria, Nidi; G R, Arun; Srivastava, Vivek
Unstable trochanteric femur fractures are common fractures that are difficult to manage. We conducted a prospective study to compare functional outcomes and complications of 2 different implant designs, proximal femur nail (PFN) and proximal femur locking compression plate (PFLCP), used in internal fixation of unstable trochanteric femur fractures. On hospital admission, 48 patients with unstable trochanteric fractures were randomly assigned (using a sealed envelope method) to treatment with either PFN (24 patients) or PFLCP (24 patients). Perioperative data and complications were recorded. All cases were followed up for 2 years. The groups did not differ significantly (P > .05) in operative time, reduction quality, complications, hospital length of stay, union rate, or time to union. Compared with the PFLCP group, the PFN group had shorter incisions and less blood loss. Regarding functional outcomes, there was no significant difference in mean Harris Hip Score (P = .48) or Palmer and Parker mobility score (P = .58). Both PFN and PFLCP are effective in internal fixation of unstable trochanteric femur fractures.
Two Stages repair of proximal hypospadias: Review of 33 cases
African Journals Online (AJOL)
HussamHassan
Background/Purpose: Proximal hypospadias with chordee is the most challenging variant of hypospadias to reconstruct. During the last 10 years, the approach to sever hypospadias has been controversial. Materials & Methods: During the period from June 2002 to December 2009, I performed 33 cases with proximal.
Promoters of Escherichia coli versus promoter islands: function and structure comparison.
Directory of Open Access Journals (Sweden)
Valeriy V Panyukov
Full Text Available Expression of bacterial genes takes place under the control of RNA polymerase with exchangeable σ-subunits and multiple transcription factors. A typical promoter region contains one or several overlapping promoters. In the latter case promoters have the same or different σ-specificity and are often subjected to different regulatory stimuli. Genes, transcribed from multiple promoters, have on average higher expression levels. However, recently in the genome of Escherichia coli we found 78 regions with an extremely large number of potential transcription start points (promoter islands, PIs. It was shown that all PIs interact with RNA polymerase in vivo and are able to form transcriptionally competent open complexes both in vitro and in vivo but their transcriptional activity measured by oligonucleotide microarrays was very low, if any. Here we confirmed transcriptional defectiveness of PIs by analyzing the 5'-end specific RNA-seq data, but showed their ability to produce short oligos (9-14 bases. This combination of functional properties indicated a deliberate suppression of transcriptional activity within PIs. According to our data this suppression may be due to a specific conformation of the DNA double helix, which provides an ideal platform for interaction with both RNA polymerase and the histone-like nucleoid protein H-NS. The genomic DNA of E.coli contains therefore several dozen sites optimized by evolution for staying in a heterochromatin-like state. Since almost all promoter islands are associated with horizontally acquired genes, we offer them as specific components of bacterial evolution involved in acquisition of foreign genetic material by turning off the expression of toxic or useless aliens or by providing optimal promoter for beneficial genes. The putative molecular mechanism underlying the appearance of promoter islands within recipient genomes is discussed.
Correction of Misclassifications Using a Proximity-Based Estimation Method
Directory of Open Access Journals (Sweden)
Shmulevich Ilya
2004-01-01
Full Text Available An estimation method for correcting misclassifications in signal and image processing is presented. The method is based on the use of context-based (temporal or spatial information in a sliding-window fashion. The classes can be purely nominal, that is, an ordering of the classes is not required. The method employs nonlinear operations based on class proximities defined by a proximity matrix. Two case studies are presented. In the first, the proposed method is applied to one-dimensional signals for processing data that are obtained by a musical key-finding algorithm. In the second, the estimation method is applied to two-dimensional signals for correction of misclassifications in images. In the first case study, the proximity matrix employed by the estimation method follows directly from music perception studies, whereas in the second case study, the optimal proximity matrix is obtained with genetic algorithms as the learning rule in a training-based optimization framework. Simulation results are presented in both case studies and the degree of improvement in classification accuracy that is obtained by the proposed method is assessed statistically using Kappa analysis.
A micropuncture study of proximal tubular transport of lithium during osmotic diuresis
DEFF Research Database (Denmark)
Leyssac, P P; Holstein-Rathlou, N H; Skøtt, P
1990-01-01
Lithium and sodium are normally reabsorbed in parallel with water by the renal proximal tubule whereby their tubular fluid-to-plasma concentration ratios (TF/P) remain close to unity throughout the proximal convoluted segment. During osmotic diuresis, the late proximal (TF/P)Na is known to decrease....... The present experiments were undertaken to study whether the late proximal TF/P for Li decreases like that of Na during osmotic diuresis. Data were obtained in a control period (C) and in two successive periods during mannitol diuresis (P1, P2). Glomerular filtration rate decreased gradually during osmotic...
Inter-organizational proximity in the context of logistics – research challenges
Directory of Open Access Journals (Sweden)
Patrycja Klimas
2015-03-01
Full Text Available Background: One of major areas of modern research econnected with management issues covers inter-organizational networks (including supply chains and cooperation processes aimed at improvement of the effectiveness of their performance to be found in such networks. The logistics is the main factor responsible for effectiveness of the supply chain. A possible and a quite new direction of research in the area of the performance of processes of the inter-organizational cooperation is the proximity hypothesis that is considered in five dimensions (geographical, organizational, social, cognitive, and institutional. However, according to many authors, there is a lack of research on supply chains conducted from the logistics point of view. The proximity hypothesis in this area of research can be seen as a kind of novum. Therefore, this paper presents the proximity concept from the perspective of the management science, the overview of prior research covering the inter-organizational proximity with supply chain from the logistics point of view as well as the possible future directions of the empirical efforts. Methods: The aim of this paper is to present previous theoretical and empirical results of research covering inter-organizational proximity in logistics and to show current and up-to-date research challenges in this area. The method of the critical analysis of literature is used to realize the goal constructed this way. Results: Knowledge about the influence of the inter-organizational proximity on the performance of supply chains is rather limited, and the research conducted so far, is rather fragmentary and not free of limitations of the conceptual and methodological nature. Additional rationales for further research in this area include knowledge and cognitive gaps indentified in this paper. According to authors the aim of future empirical research should be as follows: (1 unification and update of used conceptual and methodological approaches
Event-triggered Decision Propagation in Proximity Networks
Directory of Open Access Journals (Sweden)
Soumik eSarkar
2014-12-01
Full Text Available This paper proposes a novel event-triggered formulation as an extension of the recently develo-ped generalized gossip algorithm for decision/awareness propagation in mobile sensor networksmodeled as proximity networks. The key idea is to expend energy for communication (messagetransmission and reception only when there is any event of interest in the region of surveillance.The idea is implemented by using an agent’s belief about presence of a hotspot as feedback tochange its probability of (communication activity. In the original formulation, the evolution ofnetwork topology and the dynamics of decision propagation were completely decoupled whichis no longer the case as a consequence of this feedback policy. Analytical results and numeri-cal experiments are presented to show a significant gain in energy savings with no change inthe first moment characteristics of decision propagation. However, numerical experiments showthat the second moment characteristics may change and theoretical results are provided forupper and lower bounds for second moment characteristics. Effects of false alarms on networkformation and communication activity are also investigated.
The shape of the hominoid proximal femur: a geometric morphometric analysis
Harmon, Elizabeth H
2007-01-01
As part of the hip joint, the proximal femur is an integral locomotor component. Although a link between locomotion and the morphology of some aspects of the proximal femur has been identified, inclusive shapes of this element have not been compared among behaviourally heterogeneous hominoids. Previous analyses have partitioned complex proximal femoral morphology into discrete features (e.g. head, neck, greater trochanter) to facilitate conventional linear measurements. In this study, three-dimensional geometric morphometrics are used to examine the shape of the proximal femur in hominoids to determine whether femoral shape co-varies with locomotor category. Fourteen landmarks are recorded on adult femora of Homo, Pan, Gorilla, Pongo and Hylobates. Generalized Procrustes analysis (GPA) is used to adjust for position, orientation and scale among landmark configurations. Principal components analysis is used to collapse and compare variation in residuals from GPA, and thin-plate spline analysis is used to visualize shape change among taxa. The results indicate that knucklewalking African apes are similar to one another in femoral shape, whereas the more suspensory Asian apes diverge from the African ape pattern. The shape of the human and orangutan proximal femur converge, a result that is best explained in terms of the distinct requirements for locomotion in each group. These findings suggest that the shape of the proximal femur is brought about primarily by locomotor behaviour. PMID:17310545
Energy Technology Data Exchange (ETDEWEB)
Kim, Ha Youn; Park, Sung Tae; Bae, Won Kyoung; Goo, Dong Erk [Dept. of Radiology, Soonchunhyang University Hospital, Seoul (Korea, Republic of)
2014-12-15
We studied the influence of proximal geometry on the results of computational fluid dynamics (CFD). We made five models of different proximal geometry from three dimensional angiography of 63-year-old women with intracranial aneurysm. CFD results were analyzed as peak systolic velocity (PSV) at inlet and outlet as well as flow velocity profile at proximal level of internal carotid artery (ICA) aneurysm. Modified model of cavernous one with proximal tubing showed faster PSV at outlet than that at inlet. The PSV of outlets of other models were slower than that of inlets. The flow velocity profiles at immediate proximal to ICA aneurysm showed similar patterns in all models, suggesting that proximal vessel geometries could affect CFD results.
Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence
International Nuclear Information System (INIS)
Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.
2015-01-01
The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)
Proximate analysis of female population of wild feather back fish ...
African Journals Online (AJOL)
User
2011-05-09
May 9, 2011 ... Key words: Body composition, Notopterus notopterus, condition factor, wild fish. INTRODUCTION. Proximate body composition is the analysis of water, fat, protein and ash contents of the fish (Love, 1980). Proximate composition is a good indicator of physiology which is needed for routine analysis of ...
Electrical stimulation promotes regeneration of injured oculomotor nerves in dogs
Directory of Open Access Journals (Sweden)
Lei Du
2016-01-01
Full Text Available Functional recovery after oculomotor nerve injury is very poor. Electrical stimulation has been shown to promote regeneration of injured nerves. We hypothesized that electrical stimulation would improve the functional recovery of injured oculomotor nerves. Oculomotor nerve injury models were created by crushing the right oculomotor nerves of adult dogs. Stimulating electrodes were positioned in both proximal and distal locations of the lesion, and non-continuous rectangular, biphasic current pulses (0.7 V, 5 Hz were administered 1 hour daily for 2 consecutive weeks. Analysis of the results showed that electrophysiological and morphological recovery of the injured oculomotor nerve was enhanced, indicating that electrical stimulation improved neural regeneration. Thus, this therapy has the potential to promote the recovery of oculomotor nerve dysfunction.
Directory of Open Access Journals (Sweden)
Kazunobu Fukuhara
Full Text Available Recent studies have reported that skilled tennis players are likely to use proximal body information for anticipating the direction of their opponent's forehand shot. However, in these studies, the visual stimuli did not include visual information about the ball. Skilled players may have used proximal information owing to the lack of distal information. To address this issue, we developed a novel methodological approach using computer graphics (CG images in which the entire body was presented by a combination of point-light display (i.e., poor graphical information, PLD and polygons (i.e., rich graphical information. Using our novel methodological approach, we examined whether skilled tennis players use proximal body information when anticipating shot directions.Fifteen skilled tennis players and fifteen novice players tried to anticipate shot directions by observing four CG forehand strokes (ALPOL: all body parts were represented with polygon; RAPLD: racket and arm were represented with PLD; BOPLD: body parts without racket and arm were represented with PLD; and ALPLD: all body parts were represented with PLD. Our intention in creating CG models with such combinations (i.e., RAPLD and BOPLD was that because of the richer graphical information provided by polygons compared to PLD, the participant's anticipatory judgment would be influenced more by body parts expressed with polygons. The results showed that for skilled players, anticipatory judgment was more accurate when they observed RAPLD than when they observed BOPLD and ALPLD. In contrast, for novice players, there were no differences in the accuracy of anticipatory judgments with the four CG models.Only skilled players made more accurate anticipatory judgments when body regions were expressed with rich graphical information, and the racket and arm were expressed with poor graphical information. These suggest that skilled players used proximal information to effectively anticipate shot
Proximate, Mineral and Phytochemical Composition of Dioscorea ...
African Journals Online (AJOL)
ADOWIE PERE
Keywords: Dioscorea dumetorum, proximate composition, mineral analysis, phytochemical screening ... were analyzed using atomic absorption ... determined using a Hack Dr/200 Spectrophotometer. ... Lead Acetate. +. +. + .... cosmetics.
Proximate composition and antinutrient content of pumpkin ...
African Journals Online (AJOL)
Proximate composition and antinutrient content of pumpkin ( Cucurbita pepo ) and sorghum ( Sorghum bicolor ) flour blends fermented with Lactobacillus plantarum , Aspergillus niger and Bacillus subtilis.
Promoting regional energy co-operation in South Asia
International Nuclear Information System (INIS)
Srivastava, Leena; Misra, Neha
2007-01-01
Energy is a key ingredient of the socio-economic development of any region. South Asia is not only one of the fastest growing regions in the world; it is also one of the poorest, which thus puts energy at the very heart of the development process in the region. This paper looks at the challenges faced by the South Asia sub-region for economic co-operation (SASEC) comprised of Bangladesh, Bhutan, India and Nepal, and also at the role of greater regional energy co-operation therein. The region is characterized by pressures of growing economies and increasing population. While the per capita energy consumption is one of the lowest in the world, energy intensity continues to be very high. A large portion of the population lacks access to modern sources of energy and depends on traditional sources that are not only inefficient but also have severe health and environmental problems associated with them. Increasing oil import dependency and huge investment needs for energy market development pose a further challenge. The region has a good resource potential and tremendous scope for energy co-operation, which can play a key role in addressing many of these energy security concerns and in putting it on the path of sustainable development. It is ironic that the record in the area has been so limited and that too in the most basic form of co-operation, i.e. bilateral arrangements between countries. This paper puts forth a multi-pronged strategy for sub-regional energy co-operation encompassing softer options aimed at confidence building to more substantial and larger scale co-operation efforts. Delays in decision making to ensure stronger and mutually beneficial co-operation efforts are associated with high costs not only to the energy sector but also for the entire development agenda. With the precarious energy situation in the region and unprecedented increases in international oil prices seen in recent times, it is high time for policy makers, financing institutions, NGOs
Radiological appearance of air introduced during equine regional limb anaesthesia
International Nuclear Information System (INIS)
Kirberger, R.M.; Gottschalk, R.D.; Guthrie, A.J.
1996-01-01
Twelve horses were injected intra-articularly into the metacarpophalangeal joint and extra-articularly in the region of the lateral palmar digital nerve with 1 ml air and local anaesthetic to simulate gas accidentally introduced during regional anaesthesia. Half the horses underwent limited exercise after which all horses were radiographed at 15 and 45 min and then every 24 h until all evidence of gas had disappeared. Intra-articular gas appeared as gas capped radiolucencies (GCR) in the proximal aspect of the joint. Extra-articular gas appeared as linear radiolucencies (LR) which initially tended to migrate proximally. There was no significant difference in gas resorption in exercised and nonexercised horses. All gas was resorbed within 96 h with most of the gas already gone at 48 h
Efficient Proximity Computation Techniques Using ZIP Code Data for Smart Cities †.
Murdani, Muhammad Harist; Kwon, Joonho; Choi, Yoon-Ho; Hong, Bonghee
2018-03-24
In this paper, we are interested in computing ZIP code proximity from two perspectives, proximity between two ZIP codes ( Ad-Hoc ) and neighborhood proximity ( Top-K ). Such a computation can be used for ZIP code-based target marketing as one of the smart city applications. A naïve approach to this computation is the usage of the distance between ZIP codes. We redefine a distance metric combining the centroid distance with the intersecting road network between ZIP codes by using a weighted sum method. Furthermore, we prove that the results of our combined approach conform to the characteristics of distance measurement. We have proposed a general and heuristic approach for computing Ad-Hoc proximity, while for computing Top-K proximity, we have proposed a general approach only. Our experimental results indicate that our approaches are verifiable and effective in reducing the execution time and search space.
Efficient Proximity Computation Techniques Using ZIP Code Data for Smart Cities †
Directory of Open Access Journals (Sweden)
Muhammad Harist Murdani
2018-03-01
Full Text Available In this paper, we are interested in computing ZIP code proximity from two perspectives, proximity between two ZIP codes (Ad-Hoc and neighborhood proximity (Top-K. Such a computation can be used for ZIP code-based target marketing as one of the smart city applications. A naïve approach to this computation is the usage of the distance between ZIP codes. We redefine a distance metric combining the centroid distance with the intersecting road network between ZIP codes by using a weighted sum method. Furthermore, we prove that the results of our combined approach conform to the characteristics of distance measurement. We have proposed a general and heuristic approach for computing Ad-Hoc proximity, while for computing Top-K proximity, we have proposed a general approach only. Our experimental results indicate that our approaches are verifiable and effective in reducing the execution time and search space.
Proximate and anti-nutritional composition of leaves and seeds of ...
African Journals Online (AJOL)
Proximate and anti-nutrient composition of the leaves and seeds of ten provenances of Moringa oleifera from parts of Nigeria, were examined at Nsukka, Nigeria in 2012. Results indicated absence of significant main effect on any of the proximate traits evaluated while protein content responded significantly to plant part, ...
Proximal-type epithelioid sarcoma: a new case report and literature ...
African Journals Online (AJOL)
Proximal-type epithelioid sarcoma is a rare soft tissue neoplasm which arises from the more proximal part of body and occurs more often in young people; the definite diagnosis depends mainly on the pathological examination; early detection and complete excision remain the foundation of treatment. Due to its aggressive ...
Residential proximity to major roads and obstetrical complications.
Yorifuji, Takashi; Naruse, Hiroo; Kashima, Saori; Murakoshi, Takeshi; Doi, Hiroyuki
2015-03-01
Exposure to air pollution is linked with an increased risk of preterm births. To provide further evidence on this relationship, we evaluated the association between proximity to major roads--as an index for air pollution exposure--and various obstetrical complications. Data were extracted from a database maintained by the perinatal hospital in Shizuoka, Japan. We restricted the analysis to mothers with singleton pregnancies of more than 22 weeks of gestation from 1997 to 2012 (n=19,077). Using the geocoded residential information, each mother was assigned proximity to major roads. We then estimated multivariate adjusted odds ratios and their 95% confidence intervals (CIs) for the effects of proximity to major roads on various obstetrical complications (preeclampsia, gestational diabetes mellitus, placenta abruption, placenta previa, preterm premature rupture of membrane (pPROM), preterm labor, and preterm births). We found positive associations of proximity to major roads with preeclampsia and pPROM. Living within 200 m increased the odds of preeclampsia by 1.3 times (95% CI, 1.0-1.8) and pPROM by 1.6 times (95% CI, 1.1-2.2). Furthermore, living within 200 m increased the odds of preterm births by 1.4 fold (95% CI, 1.2-1.7). Exposure to traffic-related air pollution increased the risk of preeclampsia and pPROM in this study. We propose a mechanism responsible for the association between air pollution and preterm births. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Cristiane Borges Patroclo
2009-09-01
Full Text Available We report four Brazilian siblings with Autosomal Dominant Hereditary Motor Sensory Neuropathy with Proximal Dominant Involvement (HMSN-P, a rare form of HMSN, that was characterized by proximal dominant muscle weakness and atrophy onset after the age of 30 years, fasciculation, arreflexia and sensory disturbances with autosomal dominant inheritance. Electrophysiological study and sural nerve biopsy were in the accordance with axonal sensory motor polyneuropathy and laboratorial analysis disclosed serum lipids and muscle enzymes abnormalities. Our report is the first done by a group outside Japan, where the disease initially seemed to be restricted and stressed the phenotypic variability from the original report.Relatamos os casos de quatro irmãos brasileiros com Neuropatia Sensitivo Motora Hereditária com Envolvimento Proximal Dominante (HMSN-P, uma forma rara de HMSN caracterizada por fraqueza muscular de predomínio proximal e atrofia de instalação após os 30 anos, fasciculações, arreflexia, distúrbios sensitivos e padrão de herança autossômica dominante. Os estudos eletrofisiológicos e de biópsia do nervo sural confirmaram o diagnóstico de polineuropatia sensitivo-motora com padrão lesional axonal. Laboratorialmente foram constatadas anormalidades séricas no metabolismo lipídico e enzimas musculares. Nosso relato é o primeiro feito por um grupo fora do Japão, onde a doença parecia restrita até então e ressalta a variabilidade fenotípica apresentada nos casos Brasileiros.
Ishiura, Hiroyuki; Sako, Wataru; Yoshida, Mari; Kawarai, Toshitaka; Tanabe, Osamu; Goto, Jun; Takahashi, Yuji; Date, Hidetoshi; Mitsui, Jun; Ahsan, Budrul; Ichikawa, Yaeko; Iwata, Atsushi; Yoshino, Hiide; Izumi, Yuishin; Fujita, Koji; Maeda, Kouji; Goto, Satoshi; Koizumi, Hidetaka; Morigaki, Ryoma; Ikemura, Masako; Yamauchi, Naoko; Murayama, Shigeo; Nicholson, Garth A; Ito, Hidefumi; Sobue, Gen; Nakagawa, Masanori; Kaji, Ryuji; Tsuji, Shoji
2012-08-10
Hereditary motor and sensory neuropathy with proximal dominant involvement (HMSN-P) is an autosomal-dominant neurodegenerative disorder characterized by widespread fasciculations, proximal-predominant muscle weakness, and atrophy followed by distal sensory involvement. To date, large families affected by HMSN-P have been reported from two different regions in Japan. Linkage and haplotype analyses of two previously reported families and two new families with the use of high-density SNP arrays further defined the minimum candidate region of 3.3 Mb in chromosomal region 3q12. Exome sequencing showed an identical c.854C>T (p.Pro285Leu) mutation in the TRK-fused gene (TFG) in the four families. Detailed haplotype analysis suggested two independent origins of the mutation. Pathological studies of an autopsied patient revealed TFG- and ubiquitin-immunopositive cytoplasmic inclusions in the spinal and cortical motor neurons. Fragmentation of the Golgi apparatus, a frequent finding in amyotrophic lateral sclerosis, was also observed in the motor neurons with inclusion bodies. Moreover, TAR DNA-binding protein 43 kDa (TDP-43)-positive cytoplasmic inclusions were also demonstrated. In cultured cells expressing mutant TFG, cytoplasmic aggregation of TDP-43 was demonstrated. These findings indicate that formation of TFG-containing cytoplasmic inclusions and concomitant mislocalization of TDP-43 underlie motor neuron degeneration in HMSN-P. Pathological overlap of proteinopathies involving TFG and TDP-43 highlights a new pathway leading to motor neuron degeneration. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Krappe, H.J.
1989-01-01
The contribution of inelastic excitations to radial and tangential friction form-factors in heavy-ion collisions is investigated in the frame-work of perturbation theory. The dependence of the form factors on the essential geometrical and level-density parameters of the scattering system is exhibited in a rather closed form. The conditions for the existence of time-local friction coefficients are discussed. Results are compared to form factors from other models, in particular the transfer-related proximity friction. For the radial friction coefficient the inelastic excitation mechanism seems to be the dominant contribution in peripheral collisions. (orig.)
Characterization of a Suppressive Cis-acting Element in the Epstein–Barr Virus LMP1 Promoter
Directory of Open Access Journals (Sweden)
Masahiro Yoshida
2017-11-01
Full Text Available Latent membrane protein 1 (LMP1 is a major oncogene encoded by Epstein–Barr virus (EBV and is essential for immortalization of B cells by the virus. Previous studies suggested that several transcription factors, such as PU.1, RBP-Jκ, NFκB, EBF1, AP-2 and STAT, are involved in LMP1 induction; however, the means by which the oncogene is negatively regulated remains unclear. Here, we introduced short mutations into the proximal LMP1 promoter that includes recognition sites for the E-box and Ikaros transcription factors in the context of EBV-bacterial artificial chromosome. Upon infection, the mutant exhibited increased LMP1 expression and EBV-mediated immortalization of B cells. However, single mutations of either the E-box or Ikaros sites had limited effects on LMP1 expression and transformation. Our results suggest that this region contains a suppressive cis-regulatory element, but other transcriptional repressors (apart from the E-box and Ikaros transcription factors may remain to be discovered.
Kocatepe, Demet; Turan, Hülya
2012-06-01
The proximate and fatty acid compositions of the commercially important fish species (Engraulis encrasicolus, Alosa alosa, Belone belone, Scorpaena porcus, Pomatomus saltatrix, Mullus barbatus) from the Sinop region of the Black Sea were examined. The fat contents ranged from 1.26% (for scorpion fish) to 18.12% (for shad). The protein contents were min 14.54% (for red mullet) and maximum 20.26% (for belone). The fatty acid compositions of the fish ranged from 27.83 to 35.91% for saturated fatty acids, 19.50-33.80% for monounsaturated fatty acids and 15.25-40.02% for polyunsaturated fatty acids. Among the saturated fatty acids, palmitic acid (16:0) (17.75-22.20%) was the dominant fatty acid for all the fish species. As a second saturated fatty acid, myristic acid (14:0) was observed in four of the fish species and its content ranged from 4.72 to 7.31%. Whereas, for the other two fish species, the second saturated fatty acid was stearic acid (18:0) ranging between 4.54 and 10.64%. Among the monounsaturated fatty acids, those occurring in the highest proportions were oleic acid (18:1n-9c) (11.67-22.45%) and palmitoleic acid (16:1) (4.50-9.40%). Docosahexaenoic acid (22:6n-3) (5.41-28.52%), eicosapentaenoic acid (20:5n-3) (4.68-11.06) and linoleic acid (18:2n-6) (1.38-3.49%) were dominant polyunsaturated fatty acids, respectively. All the species, in particular the belone, the anchovy and the shad had high levels of the n-3 series.
Distal and proximal predictors of snacking at work: A daily-survey study.
Sonnentag, Sabine; Pundt, Alexander; Venz, Laura
2017-02-01
This study aimed at examining predictors of healthy and unhealthy snacking at work. As proximal predictors we looked at food-choice motives (health motive, affect-regulation motive); as distal predictors we included organizational eating climate, emotional eating, and self-control demands at work. We collected daily survey data from 247 employees, over a period of 2 workweeks. Multilevel structural equation modeling showed that organizational eating climate predicted health as food-choice motive, whereas emotional eating and self-control demands predicted affect regulation as food-choice motive. The health motive, in turn, predicted consuming more fruits and more cereal bars and less sweet snacks; the affect-regulation motive predicted consuming more sweet snacks. Findings highlight the importance of a health-promoting eating climate within the organization and point to the potential harm of high self-control demands at work. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Proximal migration of a 5 French pancreatic stent during bile stone ...
African Journals Online (AJOL)
2013-06-16
Jun 16, 2013 ... proximal migration retrieval of pancreatic stent retrieval. Further studies are ... with a series of factors. The length of the ... 7 cm was associated with an increased risk for proximal migration. ... formation and chronic pancreatitis.
Novel Treatment of a Scapholunate Ligament Injury with Proximal Pole Scaphoid Nonunion
Gaspar, Michael P.; Kane, Patrick M.; Jacoby, Sidney M.; Culp, Randall W.
2016-01-01
Background Nonunion of scaphoid proximal pole fractures presents a challenging management dilemma to hand surgeons. This problem is further complicated in the uncommon concurrence of scapholunate (SL) ligament disruption. Case Description A 39-year-old male patient presented with new-onset wrist pain following a remote history of a proximal pole scaphoid fracture sustained as a teenager, which was treated nonoperatively. Six months before presentation, the patient sustained a fall while snowboarding. The patient was found to have a chronic nonunion of his scaphoid proximal pole with an associated SL ligament disruption. As the proximal fragment was too small to be amenable to fixation, the patient was treated with an arthroscopic partial scaphoid excision and SL ligament reconstruction using a scapholunateintercarpal screw placed percutaneously. At 26 months, the patient exhibited no pain, near-normal strength, and wrist motion, and expressed a high-level of satisfaction from his surgery. Literature Review Although cases of SL ligament disruption with concomitant proximal scaphoid fractures have been reported, to our knowledge, this is the first report of SL ligament rupture occurring in the setting of a preexisting proximal pole scaphoid nonunion. Clinical Relevance We report the use of SL ligament reconstruction augmented with intercarpal screw fixation, and excision of the proximal pole scaphoid nonunion. This minimallyinvasive approach may be a particularly useful option in young, active patients such as our own, where a motion-sacrificing salvage procedure would be less than ideal. PMID:27616829
Morality, responsibility and risk: negative gay men's perceived proximity to HIV.
Keogh, Peter
2008-05-01
In order to examine the ways in which men's perceptions of their social surroundings influence how they experience and negotiate sexual risk, we conducted a qualitative study with 36 men who lived in London or Birmingham, had five or more male partners in the previous year and believed themselves to be HIV negative. Men were recruited into two sub-samples (18 men each). The high proximity group personally knew someone with HIV and had a positive sexual partner in the year prior to interview. The low proximity group had never personally known anyone with HIV and had never had a sexual partner who they knew or believed to be HIV positive. Data was collected via semi-structured interviews. Men in the low proximity groups used moral discourses to articulate beliefs and social norms around the disclosure of HIV which may act as a deterrent to sexual partners disclosing. Although most expected positive sexual partners to disclose, they had difficulty in articulating how they would respond to disclosure and how they would manage any consequent sexual risk. For the men in the high proximity group, living around HIV constituted a part of everyday life. Disclosure and discussion of HIV did not violate their social norms. The majority did not expect positive sexual partners to disclose to them and knew how they would respond to such disclosure if it occurred. Men in this group did not use moral discourses but talked practically about better and worse ways of managing disclosure. Proximity to HIV is mediated by strong social norms and self-perpetuating moral discourses which effectively creates a social divide between men who perceive themselves to be in low proximity to HIV and their HIV positive contacts and sexual partners. Men with perceived low proximity to HIV are appropriate as a target group for HIV prevention.
Microshear bonding effectiveness of different dentin regions
Directory of Open Access Journals (Sweden)
Anelise F Montagner
2015-01-01
Full Text Available Aim: The aim of this in vitro study was to evaluate the influence of dentin surfaces with different tubule orientation on bond strength of a multimode adhesive system. Materials and Methods: Twenty human molars were selected and prepared in different ways in order to produce different dentin regions. The teeth were randomized (n = 5 according to the application modes of a multimode adhesive system (etch-and-rinse and self-etching and to the dentin region (occlusal and proximal - 1.5 mm depth from dentinoenamel junction. Cylindrical restorations were performed on dentin with a starch tube. The samples remained immersed in distilled water for 24 h and the microshear bond strength (μSBS test was performed. The μSBS values were expressed in MPa and analyzed with ANOVA and Tukey′s test (P < 0.05. Results: There was no significant difference in the bond strength values between the application modes of the adhesive system (P = 0.19; however, the dentin regions (P < 0.05 significantly affected the μSBS. The proximal dentin presented higher bond strength values than occlusal dentin. Conclusion: The dentin surfaces with different tubule orientation influenced the bonding effectiveness of the adhesive system tested.
Proximity to Sports Facilities and Sports Participation for Adolescents in Germany
Reimers, Anne K.; Wagner, Matthias; Alvanides, Seraphim; Steinmayr, Andreas; Reiner, Miriam; Schmidt, Steffen; Woll, Alexander
2014-01-01
Objectives To assess the relationship between proximity to specific sports facilities and participation in the corresponding sports activities for adolescents in Germany. Methods A sample of 1,768 adolescents aged 11–17 years old and living in 161 German communities was examined. Distances to the nearest sports facilities were calculated as an indicator of proximity to sports facilities using Geographic Information Systems (GIS). Participation in specific leisure-time sports activities in sports clubs was assessed using a self-report questionnaire and individual-level socio-demographic variables were derived from a parent questionnaire. Community-level socio-demographics as covariates were selected from the INKAR database, in particular from indicators and maps on land development. Logistic regression analyses were conducted to examine associations between proximity to the nearest sports facilities and participation in the corresponding sports activities. Results The logisitic regression analyses showed that girls residing longer distances from the nearest gym were less likely to engage in indoor sports activities; a significant interaction between distances to gyms and level of urbanization was identified. Decomposition of the interaction term showed that for adolescent girls living in rural areas participation in indoor sports activities was positively associated with gym proximity. Proximity to tennis courts and indoor pools was not associated with participation in tennis or water sports, respectively. Conclusions Improved proximity to gyms is likely to be more important for female adolescents living in rural areas. PMID:24675689
Proximity to sports facilities and sports participation for adolescents in Germany.
Directory of Open Access Journals (Sweden)
Anne K Reimers
Full Text Available To assess the relationship between proximity to specific sports facilities and participation in the corresponding sports activities for adolescents in Germany.A sample of 1,768 adolescents aged 11-17 years old and living in 161 German communities was examined. Distances to the nearest sports facilities were calculated as an indicator of proximity to sports facilities using Geographic Information Systems (GIS. Participation in specific leisure-time sports activities in sports clubs was assessed using a self-report questionnaire and individual-level socio-demographic variables were derived from a parent questionnaire. Community-level socio-demographics as covariates were selected from the INKAR database, in particular from indicators and maps on land development. Logistic regression analyses were conducted to examine associations between proximity to the nearest sports facilities and participation in the corresponding sports activities.The logistic regression analyses showed that girls residing longer distances from the nearest gym were less likely to engage in indoor sports activities; a significant interaction between distances to gyms and level of urbanization was identified. Decomposition of the interaction term showed that for adolescent girls living in rural areas participation in indoor sports activities was positively associated with gym proximity. Proximity to tennis courts and indoor pools was not associated with participation in tennis or water sports, respectively.Improved proximity to gyms is likely to be more important for female adolescents living in rural areas.
SINA: A test system for proximity fuses
Ruizenaar, M. G. A.
1989-04-01
SINA, a signal generator that can be used for testing proximity fuses, is described. The circuitry of proximity fuses is presented; the output signal of the RF circuit results from a mixing of the emitted signal and received signal that is Doppler shifted in frequency by the relative motion of the fuse with respect to the reflecting target of surface. With SINA, digitized and stored target and clutter signals (previously measured) can be transformed to Doppler signals, for example during a real flight. SINA can be used for testing fuse circuitry, for example in the verification of results of computer simulations of the low frequency Doppler signal processing. The software of SINA and its use are explained.
Directory of Open Access Journals (Sweden)
Vinzenz eVon Tscharner
2014-06-01
Full Text Available The penniform gastrocnemius muscle contains multiple heads in the proximal regions and the aponeuroses are attached to the Achilles tendon. The multiple head structure lead to the assumption that different regions of the muscle must be activated compartment wise. The purpose of this study was to compare the correlation and coherence of EMG-currents within and between proximal and distal compartments of the medial gastrocnemius muscle, which reflect underling synchronization of motor units. It was hypothesized and shown that phase-inverted signals represent a property that discriminates compartments. However, the phase-inverted and non-inverted signals showed values of correlations that were indicative for highly synchronized signals. The correlation increased with the complexity of the task and was higher for the calf-rising movement than while balancing in a tiptoe position. Because the muscle fibers do not span the whole length of the muscles one has to conclude that the MUs were synchronized by synchronizing the various motor nerves. This study shows that it is essential to measure monopolar signals and use non-isometric contractions to observe synchronization of the EMG-signals. One could speculate that compartmental differences can only be observed if more complex movements that generate rotational forces at the knee or ankle are used.
Janssen, Paddy K C; Zwinderman, Aeilko H; Olivier, Berend; Waldinger, Marcel D
PURPOSE: To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). MATERIALS AND METHODS: This was a prospective study of 10 weeks of paroxetine
A single-copy galK promoter cloning vector suitable for cloning strong promoters
DEFF Research Database (Denmark)
Dandanell, Gert; Court, Donald L.; Hammer, Karin
1986-01-01
We report the construction of lambda galK promoter cloning vectors for cloning and characterization of strong promoters. This phage, which contains a unique HindIII cloning site, was applied to the cloning and analysis of transcription initiations of the regulatory region of the deo-operon of...
Directory of Open Access Journals (Sweden)
Enrique Yamil Alul González
2010-12-01
Full Text Available The Regional Productive Development Agencies implemented in Chile in 2006, were developed as a way to answer the longing desire to territorially decentralize, and that the own Regions be whom define their future. The Agencies have the responsibility to develop innovation and productive development Agendas in participative processes, which means with public, academic and private actors. Also, the Agencies have the mission to implement Competitive Improvement Plans-PMC (clusters in prioritized economic sectors by the own region. These PMC are leaded by private actors in each sector.
Directory of Open Access Journals (Sweden)
Satish Koti
2016-11-01
Full Text Available BACKGROUND Fractures of proximal femur and hip are relatively common injuries in elderly individuals constituting 11.6% of total fractures. The latest implant for management of intertrochanteric fracture is Proximal Femoral Locking Compression Plate (PF-LCP. In this study, we compare the clinical outcome of fractures treated by proximal femoral nail with that of proximal femur locking compression plate. MATERIALS AND METHODS The present study consists of 24 elderly patients of peritrochanteric factures of femur satisfying the inclusion criteria who were treated with PF-LCP or PFN in Department of Orthopaedics, S.V.R.R.G.G.H, Tirupati, during a period between December 2013 to October 2015. RESULTS 24 cases were treated with PF-LCP or PFN in a randomised pattern who satisfied inclusion criteria. Intraoperative complication were found to be more with PF-LCP in contrast to PFN. Postoperative rehabilitation was easier with PFN though not statistically significant functional and anatomical outcomes were found to be better with PFN. CONCLUSION Both PFN and PF-LCP have good effectiveness in the treatment of intertrochanteric fractures with the lateral unsubstantial femoral wall in the elderly patients. Each has its own advantages and disadvantages. Further studies with large number of patients and long-term follow up is needed to determine the optimal implant for the internal fixation of comminuted pertrochanteric femoral fractures.
DEFF Research Database (Denmark)
Hansen, Martin A; Nielsen, John E; Retelska, Dorota
2008-01-01
, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...
Portes, Maria Teresa; Figueiredo-Ribeiro, Rita de Cássia L; de Carvalho, Maria Angela M
2008-10-09
In addition to the storage function, fructans in Asteraceae from floras with seasonal growth have been associated with drought and freezing tolerance. Vernonia herbacea, native of the Brazilian Cerrado, bears underground reserve organs, rhizophores, accumulating inulin-type fructans. The rhizophore is a cauline branched system with positive geotropic growth, with the apex (distal region) presenting younger tissues; sprouting of new shoots occurs by development of buds located on the opposite end (proximal region). Plants induced to sprouting by excision of the aerial organs present increased 1-fructan exohydrolase (1-FEH) activity in the proximal region, while plants at the vegetative stage present high 1-sucrose:sucrose fructosyltransferase (1-SST) in the distal region. The aim of the present study was to analyze how low temperature (5 degrees C) could affect fructan-metabolizing enzymes and fructan composition in the different regions of the rhizophores of intact and excised plants. 1-SST and 1-fructan:fructan fructosyltransferase (1-FFT) were higher in the distal region decreasing towards the proximal region in intact plants at the vegetative phase, and were drastically diminished when cold and/or excision were imposed. In contrast, 1-FEH increased in the proximal region of treated plants, mainly in excised plants subjected to cold. The ratio fructo-oligo to fructo-polysaccharides was significantly higher in plants exposed to low temperature (1.17 in intact plants and 1.64 in excised plants) than in plants exposed to natural temperature conditions (0.84 in intact vegetative plants and 0.58 in excised plants), suggesting that oligosaccharides are involved in the tolerance of plants to low temperature via 1-FEH, in addition to 1-FFT. Principal component analysis indicated different response mechanisms in fructan metabolism under defoliation and low temperature, which could be interpreted as part of the strategies to undergo unfavorable environmental conditions
Proximal patellar tendinosis and abnormalities of patellar tracking
International Nuclear Information System (INIS)
Allen, G.M.; Tauro, P.G.; Ostlere, S.J.
1999-01-01
Objective. To assess whether an association exists between patellar tendinosis and abnormal patellar tracking. Design and patients. The MRI examinations of 630 patients (i.e. 860 knees) referred with anterior knee pain over a 4-year period were assessed in retrospect for the presence of patellar tendinosis and abnormal patellar tracking. The images of the patients with patellar tendinosis were reviewed and the location within the patellar tendon was recorded. Results. There were 44 knees with proximal patellar tendinosis. Twenty-four of these were considered to have normal patellar tracking and 20 to have abnormal patellar tracking. In the group of 816 knees without proximal patellar tendinosis, 581 were considered to have normal patellar tracking and 235 knees to have abnormal patellar tracking. When the two groups were compared there was a statistically significant difference in the ratio of patients with and without abnormal tracking. Conclusion. In patients referred with anterior knee pain or suspected abnormal patellar tracking there is a significant association between proximal patellar tendinosis and abnormal patellar tracking. (orig.)
Proximal focal femoral deficiency: evaluation by MR imaging
International Nuclear Information System (INIS)
Biko, David M.; Davidson, Richard; Pena, Andres; Jaramillo, Diego
2012-01-01
Proximal focal femoral deficiency (PFFD) is a rare congenital anomaly characterized by abnormal development of the proximal femur. The most common radiographic classification (Aitken) does not evaluate the cartilaginous and soft-tissue abnormalities. To demonstrate MR findings of PFFD focusing on features not seen with radiographs. Nine MR examinations of the hip and femurs of seven children with PFFD were retrospectively reviewed. Imaging was quantitatively and qualitatively assessed comparing the affected limb to the contralateral limb and age-matched controls. The children were classified via the Aitken classification. All children had at least mild acetabular dysplasia, and one type D patient had no acetabulum. MR demonstrated that 4/6 children had labral hypertrophy with a decreased distance from the greater trochanter to the acetabular rim, suggesting impingement (P < 0.05). The proximal femoral physis was abnormal in all cases. The connection between the femoral head and shaft if present was fibrous or fibrocartilaginous. MRI can help in evaluation of PFFD by defining the anatomy. MR demonstrates features of the acetabulum and cartilaginous femoral epiphysis and depicts ligamentous abnormalities of the knee. (orig.)
Proximal focal femoral deficiency: evaluation by MR imaging
Energy Technology Data Exchange (ETDEWEB)
Biko, David M. [National Naval Medical Center, Department of Radiology, Bethesda, MD (United States); Uniformed Services University of Health Sciences, Department of Radiology and Radiological Sciences, Bethesda, MD (United States); Davidson, Richard [The Children' s Hospital of Philadelphia, Department of Orthopedic Surgery, Philadelphia, PA (United States); Pena, Andres; Jaramillo, Diego [The Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States)
2012-01-15
Proximal focal femoral deficiency (PFFD) is a rare congenital anomaly characterized by abnormal development of the proximal femur. The most common radiographic classification (Aitken) does not evaluate the cartilaginous and soft-tissue abnormalities. To demonstrate MR findings of PFFD focusing on features not seen with radiographs. Nine MR examinations of the hip and femurs of seven children with PFFD were retrospectively reviewed. Imaging was quantitatively and qualitatively assessed comparing the affected limb to the contralateral limb and age-matched controls. The children were classified via the Aitken classification. All children had at least mild acetabular dysplasia, and one type D patient had no acetabulum. MR demonstrated that 4/6 children had labral hypertrophy with a decreased distance from the greater trochanter to the acetabular rim, suggesting impingement (P < 0.05). The proximal femoral physis was abnormal in all cases. The connection between the femoral head and shaft if present was fibrous or fibrocartilaginous. MRI can help in evaluation of PFFD by defining the anatomy. MR demonstrates features of the acetabulum and cartilaginous femoral epiphysis and depicts ligamentous abnormalities of the knee. (orig.)
Günther, Christian Max; Müller, Peter Ernst; Mutschler, Wolf; Sprecher, Christoph Martin; Milz, Stefan; Braunstein, Volker
2014-01-01
In the management of proximal humeral fractures intramedullary implants with bent and straight shape of the proximal part of nail are available. Based on data from previous studies on bone distribution in the humeral head, we hypothesized, that higher densities might exist in the bone stock surrounding straight nails in comparison to their angulated counterparts. With a known positive correlation between bone density and mechanical stability, this could indicate potentially higher rigidity of osteosyntheses done with straight implants. We performed high resolution peripheral quantitative computed tomographies of the potential straight and bent implant bearing regions of 27 cadaveric proximal humeri. The acquired data were analyzed for differences between straight and bent Volumes of Interest as well as intra- and interindividual bone stock distribution. For both straight and bent volumes of interest a considerably declining bone mineral density was found in craniocaudal direction. Mean densities of bent volumes were significantly lower in comparison to their corresponding straight counterparts (p straight shaped implants can be assumed. Since we found a rapid decrease of bone density in cranio-caudal direction, intramedullary implants should be anchored as proximally in the subcortical area as possible to minimize the risk of displacement or cutout. The high correlation between the Volumes of Interest of the corresponding right and left sides could aid in preoperative planning when considering an intra- or extramedullary approach.
Directory of Open Access Journals (Sweden)
A. Stępniak
2015-01-01
Full Text Available Here, we present the first systematic study on the temperature dependence of the extension of the superconducting proximity effect in a 1–2 atomic layer thin metallic film, surrounding a superconducting Pb island. Scanning tunneling microscopy/spectroscopy (STM/STS measurements reveal the spatial variation of the local density of state on the film from 0.38 up to 1.8 K. In this temperature range the superconductivity of the island is almost unaffected and shows a constant gap of a 1.20 ± 0.03 meV. Using a superconducting Nb-tip a constant value of the proximity length of 17 ± 3 nm at 0.38 and 1.8 K is found. In contrast, experiments with a normal conductive W-tip indicate an apparent decrease of the proximity length with increasing temperature. This result is ascribed to the thermal broadening of the occupation of states of the tip, and it does not reflect an intrinsic temperature dependence of the proximity length. Our tunneling spectroscopy experiments shed fresh light on the fundamental issue of the temperature dependence of the proximity effect for atomic monolayers, where the intrinsic temperature dependence of the proximity effect is comparably weak.
Motivation Counts: Autonomous But Not Obligated Sharing Promotes Happiness in Preschoolers
Zhen Wu; Zhen Zhang; Zhen Zhang; Rui Guo; Julie Gros-Louis
2017-01-01
Research has demonstrated that prosocial sharing is emotionally rewarding, which leads to further prosocial actions; such a positive feedback loop suggests a proximal mechanism of human’s tendency to act prosocially. However, it leaves open a question as to how the emotional benefits from sharing develop in young children and whether sharing under pressure promotes happiness as well. The current study directly compared 3- and 5-year-old Chinese children’s happiness when sharing was autonomous...
Yi, Hyun Ah; Diaz-Rohrer, Barbara; Saminathan, Priyanka; Jacobs, Amy
2015-01-01
The transmembrane subunit (gp41) of the HIV envelope protein complex (Env) mediates the viral fusion step of HIV entry. The membrane-proximal external region (MPER), one of the functional domains of gp41, has been the focus of a great deal of research because it is a target for neutralizing antibodies. In this study, we examined 23 amino acid residues in MPER (660-683) in both a CXCR4 co-receptor utilizing strain (HXB2) and a CCR5 utilizing strain (JRFL) by alanine scanning mutagenesis. Despite the high degree of gp41 sequence conservation, the effects of alanine mutation in the MPER were different between the two strains. Most mutations in HXB2 had fusogenicity and protein expression levels not less than 50% of wild type in the case of cell-cell fusion. However, about thirty percent of the mutants in HXB2 showed a severe defect in fusogenicity in viral entry. Mutations in the MPER of strain JRFL had more dramatic effects than HXB2 in cell-cell fusion and viral entry. The fact that there are large differences in the effects of mutation between two strains suggests the potential for MPER interaction with non-conserved sequences such as the fusion peptide and/or other NHR domains as well as potential long-range structural effects on the conformational changes that occur with the Env complex during membrane fusion. PMID:25649507
Janssen, Paddy K. C.; Zwinderman, Aeilko H.; Olivier, Berend; Waldinger, Marcel D.
2014-01-01
To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE.
Detection method of proximal caries using line profile in digital intra-oral radiography
Energy Technology Data Exchange (ETDEWEB)
Choi, Yong Suk; Kim, Gyu Tae; Hwang, Eui Hwan; Lee, Min Ja; Choi, Sam Jin; Park, Hun Kuk [Department of Oral and Maxillofacial Radiology, School of Dentistry and Institute of Oral Biology, Kyung Hee University, Seoul (Korea, Republic of); Park, Jeong Hoon [Department of Biomedical Engineering, College of Medicine, Kyung Hee University, Seoul (Korea, Republic of)
2009-12-15
The purpose of this study was to investigate how to detect proximal caries using line profile and validate linear measurements of proximal caries lesions by basic digital manipulation of radiographic images. The X-ray images of control group (15) and caries teeth (15) from patients were used. For each image, the line profile at the proximal caries-susceptible zone was calculated. To evaluate the contrast as a function of line profile to detect proximal caries, a difference coefficient (D) that indicates the relative difference between caries and sound dentin or intact enamel was measured. Mean values of D were 0.0354 {+-} 0.0155 in non-caries and 0.2632 {+-} 0.0982 in caries (p<0.001). The mean values of caries group were higher than non-caries group and there was correlation between proximal dental caries and D. It is demonstrated that the mean value of D from caries group was higher than that of control group. From the result, values of D possess great potentiality as a new detection parameter for proximal dental caries.
Detection method of proximal caries using line profile in digital intra-oral radiography
International Nuclear Information System (INIS)
Choi, Yong Suk; Kim, Gyu Tae; Hwang, Eui Hwan; Lee, Min Ja; Choi, Sam Jin; Park, Hun Kuk; Park, Jeong Hoon
2009-01-01
The purpose of this study was to investigate how to detect proximal caries using line profile and validate linear measurements of proximal caries lesions by basic digital manipulation of radiographic images. The X-ray images of control group (15) and caries teeth (15) from patients were used. For each image, the line profile at the proximal caries-susceptible zone was calculated. To evaluate the contrast as a function of line profile to detect proximal caries, a difference coefficient (D) that indicates the relative difference between caries and sound dentin or intact enamel was measured. Mean values of D were 0.0354 ± 0.0155 in non-caries and 0.2632 ± 0.0982 in caries (p<0.001). The mean values of caries group were higher than non-caries group and there was correlation between proximal dental caries and D. It is demonstrated that the mean value of D from caries group was higher than that of control group. From the result, values of D possess great potentiality as a new detection parameter for proximal dental caries.
Residential proximity to major roads and placenta/birth weight ratio.
Yorifuji, Takashi; Naruse, Hiroo; Kashima, Saori; Murakoshi, Takeshi; Tsuda, Toshihide; Doi, Hiroyuki; Kawachi, Ichiro
2012-01-01
Exposure to air pollution has been demonstrated to increase the risk of preterm birth and low birth weight. We examined whether proximity to major roads (as a marker of exposure to air pollution) is associated with increased placenta/birth weight ratio (as a biomarker of the placental transport function). Data on parental characteristics and birth outcomes were extracted from the database maintained by a major hospital in Shizuoka Prefecture, Japan. We restricted the analysis to mothers who delivered liveborn single births from 1997 to 2008 (n = 14,189). Using geocoded residential information, each birth was classified according to proximity to major roads. We examined the association between proximity to major roads and the placenta/birth weight ratio, using multiple linear regression. Proximity to major roads was associated with higher placenta/birth weight ratio. After adjusting for potential confounders, living within 200 m of a major road increased the ratio by 0.48% (95% CI = 0.15 to 0. 80). In addition, proximity to major roads was associated with lower placenta weight and birth weight. These observed associations were stronger among participants living closer to major roads. Exposure to traffic-related air pollution is associated with higher placenta/birth weight ratio. Impaired placental oxygen and nutrient transport function might be a mechanism for explaining the observed association between air pollution and low birth weight as well as preterm birth. Copyright © 2011 Elsevier B.V. All rights reserved.
Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng
2017-01-01
Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.
Surgical treatment of proximal humerus fractures using PHILOS plate
Directory of Open Access Journals (Sweden)
Vijay Sharma
2014-10-01
Full Text Available 【Abstract】Objective: To evaluate functional outcome and complications of open reduction and internal fixation with proximal humeral internal locking system (PHILOS plate for proximal humerus fractures. Methods: We reviewed 51 patients who underwent open reduction and internal fixation with PHILOS plate between the years 2007 to 2012. There were 35 men and 16 women with a mean age of 38 years (range 24-68. There were 41 patients in the age group of <60 years and 10 patients in the age group of >60 years. According to Neer classification system, 8, 15 and 23 patients had 2-part, 3-part, and 4-part fractures, respectively and 5 patients had 4-part fracture dislocation. All surgeries were carried out at our tertiary care trauma centre. Functional evaluation of the shoulder at final follow-up was done using Constant-Murley score. Results: The mean follow-up period was 30 months (range 12-44 months. Two patients were lost to followup. Of the remaining 49 patients, all fractures were united clinically and radiologically. The mean time for radiological union was 12 weeks (range 8-20 weeks. At the final follow-up the mean Constant-Murley score was 79 (range 50-100. The results were excellent in 25 patients, good in 13 patients, fair in 6 atients and poor in 5 patients. During the follow-up, four cases of varus malunion, one case of subacromial impingement, one case of deep infection, one case of intraarticular screw penetration and one case of failure of fi xation were noted. No cases of avascular necrosis, hardware failure, locking screw loosening or nonunion were noted. Conclusion: PHILOS provides stable fixation in proximal humerus fractures. To prevent potential complications like avascular necrosis, meticulous surgical dissection to preserve vascularity of humeral head is necessary. Key words: Proximal humerus fracture; Fracture fixation, internal; Proximal humeral internal locking system
International Nuclear Information System (INIS)
Lill, H.; Hepp, P.; Korner, J.; Josten, C.; Gowin, W.; Oestmann, J.W.; Haas, N.P.; Duda, G.N.
2002-01-01
Purpose: To evaluate age- and gender-related mechanical properties and bone mineral density (BMD) of the proximal humerus at different levels and regions. Materials and methods: Mechanical indentation testing, DXA, QCT, pQCT and the radiogrammetry (Cortical Index, CI) were carried out in 70 freshly harvested humeri from 46 human cadavers (23 females, 23-males; median age 70.5 years). Results: In the female group, a high correlation between age and BMD was found (ρ=0.62 to -0.70, p [de
Active lithium transport by rat renal proximal tubule: a micropuncture study
DEFF Research Database (Denmark)
Leyssac, P P; Frederiksen, O; Holstein-Rathlou, N H
1994-01-01
We tested the hypothesis that proximal tubular Li+ reabsorption is due to passive transport. Clearances of [14C]inulin (CIn) and Li+ (CLi), proximal transepithelial electrical potential difference (PD), and tubular fluid-to-plasma Li+ concentration ratios [(TF/P)Li] were measured in anesthetized ...
Digital three-dimensional reconstruction and ultrastructure of the mouse proximal tubule
DEFF Research Database (Denmark)
Zhai, X.Y.; Birn, H.; Jensen, K.B.
2003-01-01
. In the medullary rays, these are arranged in layers outside the clusters of more superficial tubules. In contrast to rat and human kidney, no major segmental variation in the ultrastructure of the proximal tubule was identified, and no parameters enabled definition of distinct segments in this strain of mice......, detailed analyses of normal mouse kidney structure and organization are lacking. This study describes the 3D organization and ultrastructural, segmental variation of the mouse kidney proximal tubule. A total of 160 proximal tubules in three C57/BL/6J mouse kidneys were analyzed on 800 serial sections from...
Effect of angiotensin II receptor blockade on proximal tubular fluid reabsorption
DEFF Research Database (Denmark)
Leyssac, P P; Karlsen, F M; Holstein-Rathlou, N H
1997-01-01
flow rate decreased by 2.0 +/- 0.8 nl/min, and early distal NaCl concentration decreased by 4.3 +/- 0.8 mM (mean +/- SE). No changes were observed after microperfusion with saline. Because the tubuloglomerular feedback mechanism was operating in the closed-loop mode, the decreased NaCl load...... to the macula densa will be compensated by an increase in the single-nephron glomerular filtration rate. In agreement with this, the early proximal flow rate, measured proximal to the site of losartan administration, increased by 5.7 +/- 1.3 nl/min. The increase in the rate of proximal reabsorption between...
Directory of Open Access Journals (Sweden)
Gary Jacobs
2014-03-01
Full Text Available This focused review article underscores how metal reduction promoters can impact deactivation phenomena associated with cobalt Fischer-Tropsch synthesis catalysts. Promoters can exacerbate sintering if the additional cobalt metal clusters, formed as a result of the promoting effect, are in close proximity at the nanoscale to other cobalt particles on the surface. Recent efforts have shown that when promoters are used to facilitate the reduction of small crystallites with the aim of increasing surface Co0 site densities (e.g., in research catalysts, ultra-small crystallites (e.g., <2–4.4 nm formed are more susceptible to oxidation at high conversion relative to larger ones. The choice of promoter is important, as certain metals (e.g., Au that promote cobalt oxide reduction can separate from cobalt during oxidation-reduction (regeneration cycles. Finally, some elements have been identified to promote reduction but either poison the surface of Co0 (e.g., Cu, or produce excessive light gas selectivity (e.g., Cu and Pd, or Au at high loading. Computational studies indicate that certain promoters may inhibit polymeric C formation by hindering C-C coupling.
Best Proximity Points of Contractive-type and Nonexpansive-type Mappings
Directory of Open Access Journals (Sweden)
R. Kavitha
2018-02-01
Full Text Available The purpose of this paper is to obtain best proximity point theorems for multivalued nonexpansive-type and contractive-type mappings on complete metric spaces and on certain closed convex subsets of Banach spaces. We obtain a convergence result under some assumptions and we prove the existence of common best proximity points for a sequence of multivalued contractive-type mappings.
Raijmakers, MTM; Jansen, PLM; Steegers, EAP; Peters, WHM
Background/Aims: Gilbert's syndrome is a benign form of a deficiency in bilirubin glucuronidation. It is associated with a homozygous polymorphism, A(TA)(7)TAA instead of A(TA)(6)TAA, in the TATA-box of the promoter region of the bilirubin UDP-glucuronyltransferase gene. In this study the
Kedzierska, Barbara; Lee, David J.; Węgrzyn, Grzegorz; Busby, Stephen J. W.; Thomas, Mark S.
2004-01-01
The bacteriophage λ CII protein stimulates the activity of three phage promoters, pE, pI and paQ, upon binding to a site overlapping the –35 element at each promoter. Here we used preparations of RNA polymerase carrying a DNA cleavage reagent attached to specific residues in the C-terminal domain of the RNA polymerase α subunit (αCTD) to demonstrate that one αCTD binds near position –41 at pE, whilst the other αCTD binds further upstream. The αCTD bound near position –41 is oriented such that its 261 determinant is in close proximity to σ70. The location of αCTD in CII-dependent complexes at the pE promoter is very similar to that found at many activator-independent promoters, and represents an alternative configuration for αCTD at promoters where activators bind sites overlapping the –35 region. We also used an in vivo alanine scan analysis to show that the DNA-binding determinant of αCTD is involved in stimulation of the pE promoter by CII, and this was confirmed by in vitro transcription assays. We also show that whereas the K271E substitution in αCTD results in a drastic decrease in CII-dependent activation of pE, the pI and paQ promoters are less sensitive to this substitution, suggesting that the role of αCTD at the three lysogenic promoters may be different. PMID:14762211
Disability occurrence and proximity to death
Klijs, Bart; Mackenbach, Johan P.; Kunst, Anton E.
2010-01-01
Purpose. This paper aims to assess whether disability occurrence is related more strongly to proximity to death than to age. Method. Self reported disability and vital status were available from six annual waves and a subsequent 12-year mortality follow-up of the Dutch GLOBE longitudinal study.
South Asia's health promotion kaleidoscope.
Mukhopadhyay, Alok
2007-01-01
South Asia has 22 percent of the world's population but only 1.3 percent of the global income. Consequently 40 percent of the population is living in absolute poverty. However the health transition in some of its countries including India and Sri Lanka is a testimony to the fact that there are proven solutions to the problems of health and development within the region. The countries of the region have much in common, including a democratic political system, four major religions, a vibrant and living tradition of voluntarism and an extensive health infrastructure which is operating well below par. Despite the underlying unity, South Asia enjoys enormous cultural, linguistic and ethnic diversity. In this large, complex and vibrant region, health promotion is a challenging task, but it also holds the key to a dramatic change in the global health situation. Many of these solutions lie in wider areas of socio-political action. There are much needed shifts in the health promotion and development efforts, particularly in the area of poverty and social justice; gender inequity; population stabilisation; health and environment; control of communicable and non-communicable diseases; and urban health strategies. The principle of cooperation, partnership and intersectoral collaboration for health will be explored. Developing an appropriate, sustainable and people centred health and development strategy in the coming decades is an enormous challenge. There has been an attempt to focus on the emerging needs of the region, which call for health promotion, and involvement of civil society, private sector and the governments bestowed with the increased responsibility of ensuring health security for people. Strengthening the existing health systems, allocating adequate resources for health development and ensuring community participation are all prerequisites to the success of health promotion in the region.
Biomechanical Strength of Retrograde Fixation in Proximal Third Scaphoid Fractures.
Daly, Charles A; Boden, Allison L; Hutton, William C; Gottschalk, Michael B
2018-04-01
Current techniques for fixation of proximal pole scaphoid fractures utilize antegrade fixation via a dorsal approach endangering the delicate vascular supply of the dorsal scaphoid. Volar and dorsal approaches demonstrate equivalent clinical outcomes in scaphoid wrist fractures, but no study has evaluated the biomechanical strength for fractures of the proximal pole. This study compares biomechanical strength of antegrade and retrograde fixation for fractures of the proximal pole of the scaphoid. A simulated proximal pole scaphoid fracture was produced in 22 matched cadaveric scaphoids, which were then assigned randomly to either antegrade or retrograde fixation with a cannulated headless compression screw. Cyclic loading and load to failure testing were performed and screw length, number of cycles, and maximum load sustained were recorded. There were no significant differences in average screw length (25.5 mm vs 25.6 mm, P = .934), average number of cyclic loading cycles (3738 vs 3847, P = .552), average load to failure (348 N vs 371 N, P = .357), and number of catastrophic failures observed between the antegrade and retrograde fixation groups (3 in each). Practical equivalence between the 2 groups was calculated and the 2 groups were demonstrated to be practically equivalent (upper threshold P = .010). For this model of proximal pole scaphoid wrist fractures, antegrade and retrograde screw configuration have been proven to be equivalent in terms of biomechanical strength. With further clinical study, we hope surgeons will be able to make their decision for fixation technique based on approaches to bone grafting, concern for tenuous blood supply, and surgeon preference without fear of poor biomechanical properties.
Proximal supination osteotomy of the first metatarsal for hallux valgus.
Yasuda, Toshito; Okuda, Ryuzo; Jotoku, Tsuyoshi; Shima, Hiroaki; Hida, Takashi; Neo, Masashi
2015-06-01
Risk factors for hallux valgus recurrence include postoperative round-shaped lateral edge of the first metatarsal head and postoperative incomplete reduction of the sesamoids. To prevent the occurrence of such conditions, we developed a proximal supination osteotomy of the first metatarsal. Our aim was to describe this novel technique and report the outcomes in this report. Sixty-six patients (83 feet) underwent a distal soft tissue procedure combined with a proximal supination osteotomy. After the proximal crescentic osteotomy, the proximal fragment was pushed medially, and the distal fragment was abducted, and then the distal fragment of the first metatarsal was manually supinated. Outcomes were assessed using the American Orthopaedic Foot & Ankle Society (AOFAS) score and radiographic examinations. The average follow-up duration was 34 (range, 25 to 52) months. The mean AOFAS score improved significantly from 58.0 points preoperatively to 93.8 points postoperatively (P hallux valgus and intermetatarsal angle decreased significantly from 38.6 and 18.0 degrees preoperatively to 11.0 and 7.9 degrees postoperatively, respectively (both, P hallux valgus, defined as a hallux valgus angle ≥ 25 degrees. The rates of occurrence of a positive round sign and incomplete reduction of the sesamoids significantly decreased postoperatively, which may have contributed to the low hallux valgus recurrence rates. We conclude that a proximal supination osteotomy was an effective procedure for correction of hallux valgus and can achieve a low rate of hallux valgus recurrence. Level IV, retrospective case series. © The Author(s) 2015.
Directory of Open Access Journals (Sweden)
L. Minieri
2010-04-01
Full Text Available A region of glucokinase (GCK gene was sequenced in 14 horses of 14 different breeds. The resulting GCK nucleotide sequence (GenBank number EF136885 showed 77% homology with human GCK gene portion containing the upstream promoter region and the corresponding 5’ UTR of the exon 1. Conserved regulatory sequences near the putative transcriptional start site were identified. The obtained sequences were aligned to detect polymorphism. A new C>T transition within the 5’ UTR of exon 1 was found. Allele frequencies of this polymorphism were studied by PCR-RFLP in 193 horses of 14 breeds (Bardigiano, 21; Esperia Pony, 5; Haflinger, 10; Italian Heavy Draught Horse, 28; Italian Saddle, 25; Italian Trotter, 16; Lipizzan, 12; Maremmano, 15; Murgese, 14; Norico, 10; Salernitano, 12; Thoroughbred, 10; Tolfetano, 7 and Ventasso Horse, 8. The polymorphism was found in all breeds and differences in allelic frequencies among the breeds were observed. The new SNP identified within a regulative region of GCK gene, which plays an important role in insulin secretion and feeding behaviour, could be used for association studies with performance traits of the horses.
Proximity and Gaze Influences Facial Temperature: A Thermal Infrared Imaging Study.
Directory of Open Access Journals (Sweden)
Stephanos eIoannou
2014-08-01
Full Text Available Direct gaze and interpersonal proximity are known to lead to changes in psycho-physiology, behaviour and brain function. We know little, however, about subtler facial reactions such as rise and fall in temperature, which may be sensitive to contextual effects and functional in social interactions. Using thermal infrared imaging cameras 18 female adult participants were filmed at two interpersonal distances (intimate and social and two gaze conditions (averted and direct. The order of variation in distance was counterbalanced: half the participants experienced a female experimenter’s gaze at the social distance first before the intimate distance (a socially ‘normal’ order and half experienced the intimate distance first and then the social distance (an odd social order. At both distances averted gaze always preceded direct gaze. We found strong correlations in thermal changes between six areas of the face (forehead, chin, cheeks, nose, maxilliary and periorbital regions for all experimental conditions and developed a composite measure of thermal shifts for all analyses. Interpersonal proximity led to a thermal rise, but only in the ‘normal’ social order. Direct gaze, compared to averted gaze, led to a thermal increase at both distances with a stronger effect at intimate distance, in both orders of distance variation. Participants reported direct gaze as more intrusive than averted gaze, especially at the intimate distance. These results demonstrate the powerful effects of another person’s gaze on psycho-physiological responses, even at a distance and independent of context.
Spatial scaling of regional strategic programmes in Finland
DEFF Research Database (Denmark)
Makkonen, Teemu; Inkinen, Tommi
2014-01-01
framework. Spatial scales proved to be a black box for regional strategies in Finland. Regional strategic programmes use a similar language that ignores the spatial variations of their locations. Clusters and regional innovation systems should be considered as parts of vertical and horizontal interlinkages...... within the economy and not as individual islands of organizational proximities in isolated contexts. It is argued here that an imprecise understanding of the innovation systems and cluster approaches, both conceptually and practically, has led to some ambiguity, resulting in the use of these terms...
Banerjee, Joydeep; Sahoo, Dipak Kumar; Dey, Nrisingha; Houtz, Robert L.; Maiti, Indu Bhushan
2013-01-01
On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985) are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS) in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85) showed stronger expression (about 3.5 fold) compared to the At4g35987 promoter (P87). The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold) under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications. PMID:24260266
Directory of Open Access Journals (Sweden)
Joydeep Banerjee
Full Text Available On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985 are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85 showed stronger expression (about 3.5 fold compared to the At4g35987 promoter (P87. The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications.
Modular endoprosthetic replacement for metastatic tumours of the proximal femur
Directory of Open Access Journals (Sweden)
Carter Simon R
2008-11-01
Full Text Available Abstract Background and aims Endoprosthetic replacements of the proximal femur are commonly required to treat destructive metastases with either impending or actual pathological fractures at this site. Modular prostheses provide an off the shelf availability and can be adapted to most reconstructive situations for proximal femoral replacements. The aim of this study was to assess the clinical and functional outcomes following modular tumour prosthesis reconstruction of the proximal femur in 100 consecutive patients with metastatic tumours and to compare them with the published results of patients with modular and custom made endoprosthetic replacements. Methods 100 consecutive patients who underwent modular tumour prosthetic reconstruction of the proximal femur for metastases using the METS system from 2001 to 2007 were studied. The patient, tumour and treatment factors in relation to overall survival, local control, implant survival and complications were analysed. Functional scores were obtained from surviving patients. Results and conclusion There were 45 male and 55 female patients. The mean age was 60.2 years. The indications were metastases. Seventy five patients presented with pathological fracture or with failed fixation and 25 patients were at a high risk of developing a fracture. The mean follow up was 15.9 months [range 0–77]. Three patients died within 2 weeks following surgery. 69 patients have died and 31 are alive. Of the 69 patients who were dead 68 did not need revision surgery indicating that the implant provided single definitive treatment which outlived the patient. There were three dislocations (2/5 with THR and 1/95 with unipolar femoral heads. 6 patients had deep infections. The estimated five year implant survival (Kaplan-Meier analysis was 83.1% with revision as end point. The mean TESS score was 64% (54%–82%. We conclude that METS modular tumour prosthesis for proximal femur provides versatility; low implant related
Hand proximity facilitates spatial discrimination of auditory tones
Directory of Open Access Journals (Sweden)
Philip eTseng
2014-06-01
Full Text Available The effect of hand proximity on vision and visual attention has been well documented. In this study we tested whether such effect(s would also be present in the auditory modality. With hands placed either near or away from the audio sources, participants performed an auditory-spatial discrimination (Exp 1: left or right side, pitch discrimination (Exp 2: high, med, or low tone, and spatial-plus-pitch (Exp 3: left or right; high, med, or low discrimination task. In Exp 1, when hands were away from the audio source, participants consistently responded faster with their right hand regardless of stimulus location. This right hand advantage, however, disappeared in the hands-near condition because of a significant improvement in left hand’s reaction time. No effect of hand proximity was found in Exp 2 or 3, where a choice reaction time task requiring pitch discrimination was used. Together, these results suggest that the effect of hand proximity is not exclusive to vision alone, but is also present in audition, though in a much weaker form. Most important, these findings provide evidence from auditory attention that supports the multimodal account originally raised by Reed et al. in 2006.
Proximate composition and nutritional characterization of Chia ...
African Journals Online (AJOL)
... dairy product associated with several beneficial nutritional and health effects. ... The results for amino acids showed that the essential and non-essential amino ... proximate composition and nutritional (amino acids, fatty acids, and minerals ...
Proximate composition, bread characteristics and sensory ...
African Journals Online (AJOL)
This study was carried out to investigate proximate composition, bread characteristics and sensory evaluation of cocoyam-wheat composite breads at different levels of cocoyam flour substitution for human consumption.A whole wheat bread (WWB) and cocoyam-composite breads (CCB1,CCB 2 and CCB 3) were prepared ...
Safaee, Michael M; Deviren, Vedat; Dalle Ore, Cecilia; Scheer, Justin K; Lau, Darryl; Osorio, Joseph A; Nicholls, Fred; Ames, Christopher P
2018-05-01
OBJECTIVE Proximal junctional kyphosis (PJK) is a well-recognized, yet incompletely defined, complication of adult spinal deformity surgery. There is no standardized definition for PJK, but most studies describe PJK as an increase in the proximal junctional angle (PJA) of greater than 10°-20°. Ligament augmentation is a novel strategy for PJK reduction that provides strength to the upper instrumented vertebra (UIV) and adjacent segments while also reducing junctional stress at those levels. METHODS In this study, ligament augmentation was used in a consecutive series of adult spinal deformity patients at a single institution. Patient demographics, including age; sex; indication for surgery; revision surgery; surgical approach; and use of 3-column osteotomies, vertebroplasty, or hook fixation at the UIV, were collected. The PJA was measured preoperatively and at last follow-up using 36-inch radiographs. Data on change in PJA and need for revision surgery were collected. Univariate and multivariate analyses were performed to identify factors associated with change in PJA and proximal junctional failure (PJF), defined as PJK requiring surgical correction. RESULTS A total of 200 consecutive patients were included: 100 patients before implementation of ligament augmentation and 100 patients after implementation of this technique. The mean age of the ligament augmentation cohort was 66 years, and 67% of patients were women. Over half of these cases (51%) were revision surgeries, with 38% involving a combined anterior or lateral and posterior approach. The mean change in PJA was 6° in the ligament augmentation group compared with 14° in the control group (p historical cohort, ligament augmentation is associated with a significant decrease in PJK and PJF. These data support the implementation of ligament augmentation in surgery for adult spinal deformity, particularly in patients with a high risk of developing PJK and PJF.
A STUDY ON PROXIMAL HUMERAL FRACTURES STABILISED WITH PHILOS PLATE
Directory of Open Access Journals (Sweden)
Praveen Sivakumar K
2017-02-01
Full Text Available BACKGROUND Techniques for treating complex proximal humeral fractures vary and include fixations using tension bands, percutaneous pins, bone suture, T-plates, intramedullary nails, double tubular plates, hemiarthroplasty, plant tan humerus fixator plates, Polaris nails and blade plates. Complications of these techniques include cutout or back out of the screws and plates, avascular necrosis, nonunion, malunion, nail migration, rotator cuff impairment and impingement syndromes. Insufficient anchorage from conventional implants may lead to early loosening and failure, especially in osteoporotic bones. In general, nonoperative treatment of displaced three and four-part fractures of the proximal humerus leads to poor outcome due to intraarticular nature of injury and inherent instability of the fragments. Comminuted fractures of the proximal humerus are at risk of fixation failure, screw loosening and fracture displacement. Open reduction and internal fixation with conventional plate and screws has been associated with unacceptably high incidence of screw pull out. PHILOS (the proximal humeral internal locking system plate is an internal fixation system that enables angled stabilisation with multiple interlocking screws for fractures of the proximal humerus. MATERIALS AND METHODS 30 patients with proximal humerus fractures who were admitted in the Department of Orthopaedics, Government General Hospital, Kakinada, during the period November 2014 - November 2016 were taken up for study according to inclusion criteria. All patients were treated with PHILOS plate. These proximal humerus fractures were classified according to Neer’s classification. Patients were followed up at 6 weeks, 12 weeks and 6 months’ interval. Functional outcomes for pain, range of motion and muscle power and function were assessed using the Constant-Murley scoring system. Collected data analysed with independent t-test and ANNOVA test. RESULTS The outcome of the study was 1
Gordon, Tessa; Eva, Placheta; Borschel, Gregory H
2015-10-01
Despite the capacity of Schwann cells to support peripheral nerve regeneration, functional recovery after nerve injuries is frequently poor, especially for proximal injuries that require regenerating axons to grow over long distances to reinnervate distal targets. Nerve transfers, where small fascicles from an adjacent intact nerve are coapted to the nerve stump of a nearby denervated muscle, allow for functional return but at the expense of reduced numbers of innervating nerves. A 1-hour period of 20 Hz electrical nerve stimulation via electrodes proximal to an injury site accelerates axon outgrowth to hasten target reinnervation in rats and humans, even after delayed surgery. A novel strategy of enticing donor axons from an otherwise intact nerve to grow through small nerve grafts (cross-bridges) into a denervated nerve stump, promotes improved axon regeneration after delayed nerve repair. The efficacy of this technique has been demonstrated in a rat model and is now in clinical use in patients undergoing cross-face nerve grafting for facial paralysis. In conclusion, brief electrical stimulation, combined with the surgical technique of promoting the regeneration of some donor axons to 'protect' chronically denervated Schwann cells, improves nerve regeneration and, in turn, functional outcomes in the management of peripheral nerve injuries.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
International Nuclear Information System (INIS)
Chattopadhyay, Anasuya; Schmidt, Martin C.; Khan, Saleem A.
2005-01-01
Human papillomaviruses (HPVs) replicate as nuclear plasmids in infected cells. Since the DNA replication machinery is generally conserved between humans and Saccharomyces cerevisiae, we studied whether HPV-1 DNA can replicate in yeast. Plasmids containing a selectable marker (with or without a yeast centromere) and either the full-length HPV-1 genome or various regions of the viral long control region (LCR) and the 3' end of the L1 gene were introduced into S. cerevisiae and their ability to replicate episomally was investigated. Our results show that HPV-1 sequences promote episomal replication of plasmids although the yeast centromere is required for plasmid retention. We have mapped the autonomously replicating sequence activity of HPV-1 DNA to a 450 base-pair sequence (HPV-1 nt 6783-7232) that includes 293 nucleotides from the 5' region of the viral LCR and 157 nucleotides from the 3' end of the L1 gene. The HPV-1 ARS does not include the binding sites for the viral E1 and E2 proteins, and these proteins are dispensable for replication in S. cerevisiae
Morfología femoral proximal en fracturas de cadera
Calvo de Mora Rebollo, María Jesús; Albareda Albareda, Jorge Cruz; Seral García, Belén; Martín Ruiz, G.; Lasierra Sanromán, José Manuel; Seral Iñigo, Fernando
2003-01-01
Es frecuente observar como pacientes que han sufrido una fractura de cadera, si se fracturan posteriormente la cadera contralateral, es del mismo tipo que la primera fractura. El objetivo de este trabajo es tratar de relacional la morfología femoral proximal con la producción de un tipo determinado de fractura. Para ello hemos realizado un estudio prospectivo en 50 pacientes mayores de 65 años, sin distinción de sexo, que han ingresado en nuestro servicio por fractura femoral proximal, 25 ...
Proximity effect on patterning characteristics of hole patterns in synchrotron radiation lithography
International Nuclear Information System (INIS)
Somemura, Yoh; Deguchi, Kimiyoshi; Miyoshi, Kazunori
1994-01-01
This paper reports the results of analyzing the proximity effect on the patterning characteristics for plural neighboring hole patterns in synchrotron radiation lithography. Fresnel diffraction simulation was used and pattern replication experiments were performed with pattern pitch, proximity gap, and mask contrast as parameters. Even when the pattern pitch (hole:space) is 1:1, pattern sizes down to 0.2 μm can be replicated with a large dose margin under a large proximity gap condition up to 40 μm, irrespective of the mask contrast. A low-contrast (2.5) mask has an advantage over the conventional-contrast (7) mask in that it allows the use of a larger proximity gap when replicating hole patterns with a size of 0.1-0.2 μm. Moreover, the phase-shifting mask we previously proposed improves the exposure latitude and widens the proximity gap, so that it is possible to use a 20-μm gap to replicate 0.1-μm hole patterns for a pitch of 1:1 and to use a 30-μm gap for a pitch of 1:2. (author)
Proximal Tibia Bone Graft: An alternative Donor Source especially for Foot and Ankle Procedures
Directory of Open Access Journals (Sweden)
Jia TY
2015-03-01
Full Text Available Among the many donor sites for harvesting autologous bone graft, the iliac crest has been the most commonly used. However, for foot and ankle procedures the proximal tibia has gained popularity as an alternative donor site due to its anatomic proximity to the primary surgical site. In this article we evaluated the possible complications associated with harvesting proximal tibia bone graft. Our study showed the low incidence of morbidity in harvesting proximal tibia bone graft, thereby providing a good alternative donor for foot and ankle procedures.
Residential proximity to gasoline service stations and preterm birth.
Huppé, Vicky; Kestens, Yan; Auger, Nathalie; Daniel, Mark; Smargiassi, Audrey
2013-10-01
Preterm birth (PTB) is a growing public health problem potentially associated with ambient air pollution. Gasoline service stations can emit atmospheric pollutants, including volatile organic compounds potentially implicated in PTB. The objective of this study was to evaluate the relationship between residential proximity to gasoline service stations and PTB. Singleton live births on the Island of Montreal from 1994 to 2006 were obtained (n=267,478). Gasoline service station locations, presence of heavy-traffic roads, and neighborhood socioeconomic status (SES) were determined using a geographic information system. Multivariable logistic regression was used to analyze the association between PTB and residential proximity to gasoline service stations (50, 100, 150, 200, 250, and 500 m), accounting for maternal covariates, neighborhood SES, and heavy-traffic roads. For all distance categories beyond 50 m, presence of service stations was associated with a greater odds of PTB. Associations were robust to adjustment for maternal covariates for distance categories of 150 and 200 m but were nullified when adjusting for neighborhood SES. In analyses accounting for the number of service stations, the likelihood of PTB within 250 m was statistically significant in unadjusted models. Associations were, however, nullified in models accounting for maternal covariates or neighborhood SES. Our results suggest that there is no clear association between residential proximity to gasoline service stations in Montreal and PTB. Given the correlation between proximity of gasoline service stations and SES, it is difficult to delineate the role of these factors in PTB.
Geoheritage promotion of Thonon-les-Bains (Fr) region by the development of a geotourism product
Fanguin, Pauline
2014-05-01
Since 2012, the Chablais region (only in France) has acquired the Geopark label. This Geopark contributes to sustainable economic development of the region through geotourism. Moreover, the three Chablais (figure 1) are concerned by an Interreg IV program since 2009 (program of cooperation between European countries). The main objective of this program is to enhance the heritage resources (nature, culture and lifestyle of the region) (www.interreg-francesuisse.org). Therefore, the geotourism offer in this area just waiting to expand. The geodidactics models like the simplification of the scientific content are essential for geoheritage promotion, because this content must be available to a wide audience, allowing thereby the geoheritage recognition. The geotourism permits to apply different models (Cayla et al. 2010, Sellier, 2009) through a wide range of geotourism products, like guide, educational panels, thematic hikes and recently developed, new medias (website, smartphone applications). A geotourism product is based on four areas of questioning and was developed by Martin et al. (2010): (1) site (choice of sites to be valued), (2) public (a family public, good example of heterogeneous public), (3) contents (reasoning on geodidactics models) and (4) support (smartphone application). These four areas are very fundamental before the creation of any geotourism product. These reflexions aim to obtain a mediation product that integrates into geotourism offer of a region and contributes to its development and meets public expectations. New media, such as digital media - smartphone, tablets, website - become geotourism products more and more attractive. In addition, the necessary technologies to develop new media help to integrate a high interactivity potential with the public and thus get their attention. The architecture of this geotourism product is based on the new application developed by the Institute of Geography and sustainability, and the Bureau Relief. One
Directory of Open Access Journals (Sweden)
Imbuldeniya Arjuna
2012-02-01
Full Text Available Abstract Introduction Atypical insufficiency fractures of the femur in patients on long-term bisphosphonate therapy have been well described in recent literature. The majority of cases are associated with minimal or no trauma and occur in the subtrochanteric or diaphyseal region. Case presentation We describe the case of a 76-year-old British Caucasian woman who presented initially to an emergency department and then to her primary care physician with a long-standing history of bilateral knee pain after minor trauma. Plain radiographs showed subtle linear areas of sclerosis bilaterally in her proximal tibiae. Magnetic resonance imaging confirmed the presence of insufficiency fractures in these areas along with her left distal femur. There are very few reports of atypical insufficiency fractures involving the tibia in patients on long-term bisphosphonate therapy and this appears to be the only documented bilateral case involving the metaphyseal regions of the proximal tibia and distal femur. Conclusion In addition to existing literature describing atypical fractures in the proximal femur and femoral shaft, there is a need for increased awareness that these fractures can also occur in other weight-bearing areas of the skeleton. All clinicians involved in the care of patients taking long-term bisphosphonates need to be aware of the growing association between new onset lower limb pain and atypical insufficiency fractures.
Localization and regulation of bacteriophage Mu promoters
International Nuclear Information System (INIS)
Stoddard, S.F.; Howe, M.M.
1989-01-01
Mu promoters active during the lytic cycle were located by isolating RNA at various times after induction of Mu prophages, radiolabeling it by capping in vitro, and hybridizing it to Mu DNA fragments on Southern blots. Signals were detected from four new promoters in addition to the previously characterized P e (early), P cM (repressor), and P mom (late) promoters. A major signal upstream of C was first observed at 12 min and intensified thereafter with RNA from cts and C amber but not replication-defective prophages; these characteristics indicate that this signal arises from a middle promoter, which we designate P m . With 20- and 40-min RNA, four additional major signals originated in the C-lys, F-G-I, N-P, and com-mom regions. These signals were missing with RNA from C amber and replication-defective prophages and therefore reflected the activity of late promoters, one of which we presume was P mom . Uninduced lysogens showed weak signals from five regions, one from the early regulatory region, three between genes B and lys, and one near the late genes K, L, and M. The first of these probably resulted from P cM activity; the others remain to be identified
International Nuclear Information System (INIS)
Cheng Xiaoguang; Liu Xia; Wang Yusheng; Li Jin; Qu Hui; Li Jing; Genant, H.; Lang, T.
2009-01-01
Objective: To evaluate the bone mineral density (BMD) and structure of proximal femur in elderly Chinese women by quantatitive computed tomography (QCT) and dual energy X-ray absorptiometry (DXA), and to further compare the results of these two methods. Methods: Sixty-six healthy Chinese women over 65 years old participated in this study. The left hips of all subjects were measured with DXA and the BMD of femoral neck and trochanteric region were calculated. With QCT, the BMD and tissue volume of cortical, trabecular and integral bone were calculated for femoral neck, trochanteric and total femur regions in both hips. Appropriate statistical analyses were performed with SPSS 11.5. Results: The BMD and structural parameters in different regions and different compartments of the proximal femur could be precisely assessed with QCT technique. The BMD of cortical bone in femoral neck [(0.52±0.04) g/cm 3 ], BMD of cortical bone in trochanteric region [(0.49±0.03) g/cm 3 ] and BMD of integral bone in troehanteric region [(0.22±0.04) g/cm 3 ] were greater in the fight than those in the left [(0.51±0.04), (0.48±0.03), (0.21±0.04)g/cm 3 ]. The difference had statistical signification (P 2 (0.78±0.13) g/cm 2 , 5.80 cm 3 (0.06±0.03) g/cm 3 , (5.19 ± 1.40) cm 3 , (0.25 ± 0.04)g/cm 3 , 15.66 cm 3 , (21.74±3.43) cm 3 , (0.08 ± 0.03)g/cm 3 , (34.27±6.09) cm 3 and (76.12±11.11) cm 3 respectively, in the fight the corresponding parameters being (0.52±0.10) g/cm 2 (0.78±0.13) g/cm 2 6.01 cm 3 , (0.06±0.02) g/cm 3 , (5.17±1.27) cm 3 , (0.25±0.04)g/cm 3 , 15.62 cm 3 , (22.12±3.60) cm 3 , (0.09±0.03) g/cm 3 , (34.17±5.94) cm 3 and (76.53±10.71) cm 3 respectively. There were no significant difference between the left and right parameters above (P>0.0 ). All QCT parameters of the right hip correlated well with their corresponding ones of left hip with correlation coefficients ranging from 0.656-0.955, P<0.05. QCT-derived simulated DXA femoral neck and trochanteric
Directory of Open Access Journals (Sweden)
Hirata Yoko
2010-11-01
Full Text Available Abstract Background Recently, we identified cysteine-rich with EGF-like domains 2 (CRELD2 as a novel endoplasmic reticulum (ER stress-inducible gene and characterized its transcriptional regulation by ATF6 under ER stress conditions. Interestingly, the CRELD2 and asparagine-linked glycosylation 12 homolog (ALG12 genes are arranged as a bidirectional (head-to-head gene pair and are separated by less than 400 bp. In this study, we characterized the transcriptional regulation of the mouse CRELD2 and ALG12 genes that is mediated by a common bidirectional promoter. Results This short intergenic region contains an ER stress response element (ERSE sequence and is well conserved among the human, rat and mouse genomes. Microarray analysis revealed that CRELD2 and ALG12 mRNAs were induced in Neuro2a cells by treatment with thapsigargin (Tg, an ER stress inducer, in a time-dependent manner. Other ER stress inducers, tunicamycin and brefeldin A, also increased the expression of these two mRNAs in Neuro2a cells. We then tested for the possible involvement of the ERSE motif and other regulatory sites of the intergenic region in the transcriptional regulation of the mouse CRELD2 and ALG12 genes by using variants of the bidirectional reporter construct. With regards to the promoter activities of the CRELD2-ALG12 gene pair, the entire intergenic region hardly responded to Tg, whereas the CRELD2 promoter constructs of the proximal region containing the ERSE motif showed a marked responsiveness to Tg. The same ERSE motif of ALG12 gene in the opposite direction was less responsive to Tg. The direction and the distance of this motif from each transcriptional start site, however, has no impact on the responsiveness of either gene to Tg treatment. Additionally, we found three putative sequences in the intergenic region that antagonize the ERSE-mediated transcriptional activation. Conclusions These results show that the mouse CRELD2 and ALG12 genes are arranged as a
THE PROXIMATE COMPOSITION OF AFRICAN BUSH MANGO ...
African Journals Online (AJOL)
BIG TIMMY
Information regarding previous studies on these physico-chemical ... This behaviour may be attributed to its high myristic acid ... The authors express deep appreciation to the. Heads of ... of a typical rural processing method on the proximate ...
Dahan, M; Anract, P; Babinet, A; Larousserie, F; Biau, D
2017-11-01
The proximal femuris is an uncommon site of osteosarcoma. The unusual manifestations at this site may lead to diagnostic and therapeutic mistakes. We therefore performed a retrospective study to estimate the proportions of patients with imaging study findings and/or clinical manifestations typical for osteosarcoma and/or inappropriate treatment decisions. Proximal femoral osteosarcoma often produces atypical clinical and radiological presentations. Consecutive patients who underwent surgery at our center to treat proximal femoral osteosarcoma were included. For each patient, we collected the epidemiological characteristics, clinical symptoms, imaging study findings, treatment, and tumor outcome. Proportions were computed with their confidence intervals. Twelve patients had surgery for proximal femoral osteosarcoma between 1986 and 2015. Imaging findings were typical in 1 (8%) patient; they consisted of ill-defined osteolysis in 11/12 (92%) patients, a periosteal reaction in 1/12 (8%) patient, soft tissue involvement in 7/12 (58%) patients, and immature osteoid matrix in 11/12 (92%) patients. No patient had the typical combination of pain with a soft tissue swelling. Management was inappropriate in 2/12 (17%) patients, who did not undergo all the recommended imaging studies before surgery and were treated in another center before the correct diagnosis was established. At last follow-up, 4 patients had died (after a mean of 7 years) and 8 were alive (after a mean of 4 years). Proximal femoral osteosarcoma is uncommon and rarely produces the typical clinical and imaging study findings. The atypical presentation often results in diagnostic errors and inappropriate treatments. Ill-defined osteolysis on standard radiographs should prompt computed tomography or magnetic resonance imaging of the proximal femur. Treatment in a specialized center is imperative. IV, retrospective study. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Oppentocht, JE; van Delden, W; van de Zande, L
The nucleotide sequences of the Adh and Adhr genes of Drosophila kuntzei were derived from combined overlapping sequences of clones isolated from a genomic library and from cloned PCR and inverse-PCR fragments. Only a proximal promoter was detected upstream of the Adh gene, indicating that D.
DEFF Research Database (Denmark)
Laursen, Keld; Reichstein, Toke; Salter, Ammon
2011-01-01
Exploring the effect of geographical proximity and university quality on university–industry collaboration in the United Kingdom, Regional Studies. This paper concerns the geographical distance between a firm and the universities in its local area. It is argued that firms' decisions to collaborat...... collaboration. However, it is also found that if faced with the choice, firms appear to give preference to the research quality of the university partner over geographical closeness. This is particularly true for high-research and development intensive firms....
Trends in epidemiology and patho-anatomical pattern of proximal humeral fractures
DEFF Research Database (Denmark)
Bahrs, Christian; Stojicevic, Tanja; Tanja, Stojicevic
2014-01-01
PURPOSE: Proximal humeral fractures are common and frequently associated with osteoporosis. Little is known about the association between the patho-anatomical fracture pattern of proximal humeral fractures and patient characteristics. The purpose of this six year longitudinal registry analysis...... of proximal humeral fractures was to study overall numbers, certain predefined pathoanatomical patterns and distribution compared with specific patient characteristics. METHODS: Data of patients treated between 2006 and 2011 in a country hospital that provides care >95 % of the city's hospitalised patients...... with fractures was retrospectively reviewed. Data were analysed according to patient characteristics of age, gender, comorbidity, accompanying injuries and radiological analysis of pathoanatomical fracture patterns based on Neer and Arbeitsgemeinschaft für Osteosynthesefragen (AO) classification. RESULTS: Eight...
Electromagnetic Signal Feedback Control for Proximity Detection Systems
Smith, Adam K.
Coal is the most abundant fossil fuel in the United States and remains an essential source of energy. While more than half of coal production comes from surface mining, nearly twice as many workers are employed by underground operations. One of the key pieces of equipment used in underground coal mining is the continuous mining machine. These large and powerful machines are operated in confined spaces by remote control. Since 1984, 40 mine workers in the U. S. have been killed when struck or pinned by a continuous mining machine. It is estimated that a majority of these accidents could have been prevented with the application of proximity detection systems. While proximity detection systems can significantly increase safety around a continuous mining machine, there are some system limitations. Commercially available proximity warning systems for continuous mining machines use magnetic field generators to detect workers and establish safe work areas around the machines. Several environmental factors, however, can influence and distort the magnetic fields. To minimize these effects, a control system has been developed using electromagnetic field strength and generator current to stabilize and control field drift induced by internal and external environmental factors. A laboratory test set-up was built using a ferrite-core magnetic field generator to produce a stable magnetic field. Previous work based on a field-invariant magnetic flux density model, which generically describes the electromagnetic field, is expanded upon. The analytically established transferable shell-based flux density distribution model is used to experimentally validate the control system. By controlling the current input to the ferrite-core generator, a more reliable and consistent magnetic field is produced. Implementation of this technology will improve accuracy and performance of existing commercial proximity detection systems. These research results will help reduce the risk of traumatic
A proximity effect in adults' contamination intuitions
Directory of Open Access Journals (Sweden)
Laura R. Kim
2011-04-01
Full Text Available Magical beliefs about contagion via contact (Rozin, Nemeroff, Wane, and Sherrod, 1989 may emerge when people overgeneralize real-world mechanisms of contamination beyond their appropriate boundaries (Lindeman and Aarnio, 2007. Do people similarly overextend knowledge of airborne contamination mechanisms? Previous work has shown that very young children believe merely being close to a contamination source can contaminate an item (Springer and Belk 1994; we asked whether this same hyper-avoidant intuition is also reflected in adults' judgments. In two studies, we measured adults' ratings of the desirability of an object that had made contact with a source of contamination, an object nearby that had made no contact with the contaminant, and an object far away that had also made no contact. Adults showed a clear proximity effect, wherein objects near the contamination source were perceived to be less desirable than those far away, even though a separate group of adults unanimously acknowledged that contaminants could not possibly have made contact with either the nearby or far-away object (Study 1. The proximity effect also remained robust when a third group of adults was explicitly told that no contaminating particles had made contact with the objects at any time (Study 2. We discuss implications of our findings for extending the scope of magical contagion effects beyond the contact principle, for understanding the persistence of intuitive theories despite broad acceptance of science-based theories, and for constraining interpretations of the developmental work on proximity beliefs.