WorldWideScience

Sample records for proximal promoter regions

  1. Determination of single-nucleotide polymorphism in the proximal promoter region of apolipoprotein M gene in coronary artery diseases

    Directory of Open Access Journals (Sweden)

    Lu Zheng

    2009-09-01

    Full Text Available Lu Zheng1, Guanghua Luo1, Xiaoying Zhang1, Jun Zhang1, Jiang Zhu1, Jiang Wei1, Qinfeng Mu1, Lujun Chen1, Peter Nilsson-Ehle2, Ning Xu21Comprehensive Laboratory, The Third Affiliated Hospital, Suzhou University, Changzhou China; 2Division of Clinical Chemistry and Pharmacology, Department of Laboratory Medicine, Lund University, Lund, SwedenObjective: It has been reported that single-nucleotide polymorphism (SNP in the proximal promoter region of apolipoprotein M (apoM gene may confer the risk in the development of type 2 diabetes (T2D and coronary artery disease (CAD in the Han Chinese. However, in a recent study demonstrated that plasma apoM level did not correlated to the coronary heart disease. In the present studies, we investigated the SNP T-778C of apoM gene in CAD patients and controls in the Han Chinese population. Moreover we examined whether serum apoM levels could be influenced by this promoter mutation.Material and methods: One hundred twenty-six CAD patients and 118 non-CAD patients were subjected in the present study. All patients were confirmed by the angiography. The genotyping of polymorphisms T-778C in apoM promoter was determined by real-time polymerase chain reaction. Serum apoM levels were semi-quantitatively determined by the dot-blotting analysis. Results: Distribution of apoM T-778C genotype in non-CAD patients was as following: 84.7% were T/T, 15.3% were T/C and 0.0% was C/C. T allele frequencies were 92.4% and C allele, 7.6%. In the CAD patients, 99 patients (78.6% had the T/T genotype, 25 patients (19.8% with T/C genotype and 2 patients (1.6% with C/C genotype. The allele frequency was 88.5% for the T allele and 11.5% for the C allele. There was no statistical significant difference of serum apoM levels found in these three genotypes.Conclusions: There was no significant difference in allele or genotype frequencies between CAD patients and non-CAD patients. Binary logistic regression analysis with adjustments for age

  2. Promoting proximal formative assessment with relational discourse

    Science.gov (United States)

    Scherr, Rachel E.; Close, Hunter G.; McKagan, Sarah B.

    2012-02-01

    The practice of proximal formative assessment - the continual, responsive attention to students' developing understanding as it is expressed in real time - depends on students' sharing their ideas with instructors and on teachers' attending to them. Rogerian psychology presents an account of the conditions under which proximal formative assessment may be promoted or inhibited: (1) Normal classroom conditions, characterized by evaluation and attention to learning targets, may present threats to students' sense of their own competence and value, causing them to conceal their ideas and reducing the potential for proximal formative assessment. (2) In contrast, discourse patterns characterized by positive anticipation and attention to learner ideas increase the potential for proximal formative assessment and promote self-directed learning. We present an analysis methodology based on these principles and demonstrate its utility for understanding episodes of university physics instruction.

  3. Down-regulation of human topoisomerase IIα expression correlates with relative amounts of specificity factors Sp1 and Sp3 bound at proximal and distal promoter regions

    Directory of Open Access Journals (Sweden)

    Isaacs Richard J

    2007-05-01

    Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site

  4. Promoter proximal polyadenylation sites reduce transcription activity

    DEFF Research Database (Denmark)

    Andersen, Pia Kjølhede; Lykke-Andersen, Søren; Jensen, Torben Heick

    2012-01-01

    Gene expression relies on the functional communication between mRNA processing and transcription. We previously described the negative impact of a point-mutated splice donor (SD) site on transcription. Here we demonstrate that this mutation activates an upstream cryptic polyadenylation (CpA) site......, which in turn causes reduced transcription. Functional depletion of U1 snRNP in the context of the wild-type SD triggers the same CpA event accompanied by decreased RNA levels. Thus, in accordance with recent findings, U1 snRNP can shield premature pA sites. The negative impact of unshielded pA sites...... on transcription requires promoter proximity, as demonstrated using artificial constructs and supported by a genome-wide data set. Importantly, transcription down-regulation can be recapitulated in a gene context devoid of splice sites by placing a functional bona fide pA site/transcription terminator within ∼500...

  5. Genetic variation in the proximal promoter of ABC and SLC superfamilies: liver and kidney specific expression and promoter activity predict variation.

    Directory of Open Access Journals (Sweden)

    Stephanie E Hesselson

    2009-09-01

    Full Text Available Membrane transporters play crucial roles in the cellular uptake and efflux of an array of small molecules including nutrients, environmental toxins, and many clinically used drugs. We hypothesized that common genetic variation in the proximal promoter regions of transporter genes contribute to observed variation in drug response. A total of 579 polymorphisms were identified in the proximal promoters (-250 to +50 bp and flanking 5' sequence of 107 transporters in the ATP Binding Cassette (ABC and Solute Carrier (SLC superfamilies in 272 DNA samples from ethnically diverse populations. Many transporter promoters contained multiple common polymorphisms. Using a sliding window analysis, we observed that, on average, nucleotide diversity (pi was lowest at approximately 300 bp upstream of the transcription start site, suggesting that this region may harbor important functional elements. The proximal promoters of transporters that were highly expressed in the liver had greater nucleotide diversity than those that were highly expressed in the kidney consistent with greater negative selective pressure on the promoters of kidney transporters. Twenty-one promoters were evaluated for activity using reporter assays. Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. Collectively, these results suggest that the proximal promoter region of membrane transporters is rich in variation and that variants in these regions may play a role in interindividual variation in drug disposition and response.

  6. Promoting regional mobility

    DEFF Research Database (Denmark)

    Jensen, Anne

    Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...

  7. Decreased expression of lysyl hydroxylase 2 (LH2) in skin fibroblasts from three Ehlers-Danlos patients does not result from mutations in either the coding or proximal promoter region of the LH2 gene.

    Science.gov (United States)

    Walker, L C; Teebi, A S; Marini, J C; De Paepe, A; Malfait, F; Atsawasuwan, P; Yamauchi, M; Yeowell, H N

    2004-12-01

    The Ehlers-Danlos syndromes (EDS) are a heterogeneous group of inherited connective tissue disorders characterized by tissue fragility, hyperelasticity of the skin and joint hypermobility. This phenotype, accompanied by kyphoscoliosis and/or ocular fragility, is present in patients with the autosomal recessive type VI form of EDS. These patients have significantly decreased levels of lysyl hydroxylase (LH) activity, due to mutations in the LH1 gene. LH hydroxylates specific lysine residues in the collagen molecule that are precursors for the formation of cross-links which provide collagen with its tensile strength. No disorder has been directly linked to decreased expression of LH2 and LH3, two other isoforms of LH. This study describes 3 patients with mixed phenotypes of EDS, who have significantly decreased mRNAs for LH2, but normal levels of LH1 and LH3 mRNAs, in their skin fibroblasts. In contrast to the effect of LH1 deficiency in EDS VI patients, the decreased expression of LH2 does not affect LH activity, bifunctional collagen cross-links (measured after reduction as dihydroxylysinonorleucine (DHLNL) and hydroxylysinonorleucine (HLNL)), or helical lysine hydroxylation in these cell lines. Sequence analysis of full length LH2 cDNAs and 1kb of the promoter region of LH2 does not show mutations that could explain the decreased expression of LH2. These results suggest that the deficiency of LH2 in these fibroblasts may be caused by changes in other factors required for the expression of LH2.

  8. AKT increases VEGF expression in tumor cells by transactivating the proximal VEGF promoter

    International Nuclear Information System (INIS)

    Pore, N.; Bernhard, E.J.; Shu, H.-K.; Li, B.; O'Rourke, D.M.; Maity, A.; Haas-Kogan, D.

    2003-01-01

    Vascular endothelial growth factor (VEGF) is overexpressed in many cancers including glioblastomas and may contribute to their growth. Epidermal growth factor receptor (EGFR) amplification and loss of PTEN, commonly found in glioblastomas leading to increase phosphatidylinositol-3-kinase (PI3K) activity and VEGF expression. In the current study we show that AKT, which is downstream of PI3K, regulates VEGF expression. U87MG human glioblastoma cells lack wildtype PTEN and express high levels of phosphorylated AKT. Over expression of AKT either by stable expression in immortalized human astrocytes or by transduction with adenovirus containing activated myristoylated AKT in SF188 glioblastoma cells increases VEGF expression. Moreover the elevation of angiogenesis by constitutively expressed AKT is further confirmed by in vivo matrigel plug assay in nude mice. The upregulation of VEGF by AKT is mediated through a region in the proximal promoter located between -88 and -70 (+1 is transcription start site). In transient transfection activity of a luciferase reporter containing the -88/+54 region of the VEGF promoter is increased by cotransfection with myristoylated AKT and downregulated by a dominant negative AKT expression vector. Mutation of the putative Sp1 binding sites located in the -88/-70 region we show that AKT acts through Sp1 to transactivate the VEGF promoter. Cotransfection of the VEGF promoter reporter with both Sp1 and myristoylated AKT expression vectors increases promoter activity to a greater extent than either Sp1 or Akt by itself. In vivo phosphate labeling of proteins reveals that AKT leads to increased Sp1 phosphorylation. Gel shift assays using a radio labeled probe corresponding to nucleotides -88 through -66 in the promoter show increased binding with nuclear extracts from cells transduced with adenovirus expressing myristoylated AKT. In conclusion, our results suggest that loss of PTEN leads to increased VEGF expression by increasing AKT

  9. Tumor-promoting phorbol esters effect alkalinization of canine renal proximal tubular cells

    International Nuclear Information System (INIS)

    Mellas, J.; Hammerman, M.R.

    1986-01-01

    We have demonstrated the presence of specific receptors for tumor-promoting phorbol esters in the plasma membrane of the canine renal proximal tubular cell. These compounds affect proximal tubular metabolism in vitro. For example, we have shown that they inhibit gluconeogenesis in canine renal proximal tubular segments. Tumor-promoting phorbol esters have been shown to effect alkalinization of non-renal cells, by enhancing Na + -H + exchange across the plasma membrane. To determine whether the actions of tumor-promoting phorbol esters in proximal tubular segments might be mediated by a similar process, we incubated suspensions of segments from dog kidney with these compounds and measured changes in intracellular pH using [ 14 C]-5,5-dimethoxazoladine-2-4-dione (DMO) and flow dialysis. Incubation of segments with phorbol 12,13 dibutyrate, but not inactive phorbol ester, 4 γ phorbol, effected alkalinization of cells within the segments in a concentration-dependent manner. Alkalinization was dependent upon the presence of extracellular [Na + ] > intracellular [Na + ], was prevented by amiloride and was demonstrable in the presence of SITS. Our findings suggest that tumor-promoting esters stimulate the Na + -H + exchanger known to be present in the brush border membrane of the renal proximal tubular cell. It is possible that the stimulation reflects a mechanism by which phorbol esters affect metabolic processes in these cells

  10. Transactivation of the proximal promoter of human oxytocin gene by TR4 orphan receptor

    International Nuclear Information System (INIS)

    Wang, C.-P.; Lee, Y.-F.; Chang, C.; Lee, H.-J.

    2006-01-01

    The human testicular receptor 4 (TR4) shares structural homology with members of the nuclear receptor superfamily. Some other members of this superfamily were able to regulate the transcriptional activity of the human oxytocin (OXT) promoter by binding to the first DR0 regulatory site. However, little investigation was conducted systematically in the study of the second dDR4 site of OXT proximal promoter, and the relationship between the first and the second sites of OXT promoter. Here, we demonstrated for the first time that TR4 could increase the proximal promoter activity of the human OXT gene via DR0, dDR4, and OXT (both DR0 and dDR4) elements, respectively. TR4 might induce OXT gene expression through the OXT element in a dose-dependent manner. However, there is no synergistic effect between DR0 and dDR4 elements during TR4 transactivation. Taken together, these results suggested that TR4 should be one of important regulators of OXT gene expression

  11. Analysis of the AHR gene proximal promoter GGGGC-repeat polymorphism in lung, breast, and colon cancer

    International Nuclear Information System (INIS)

    Spink, Barbara C.; Bloom, Michael S.; Wu, Susan; Sell, Stewart; Schneider, Erasmus; Ding, Xinxin; Spink, David C.

    2015-01-01

    The aryl hydrocarbon receptor (AhR) regulates expression of numerous genes, including those of the CYP1 gene family. With the goal of determining factors that control AHR gene expression, our studies are focused on the role of the short tandem repeat polymorphism, (GGGGC) n , located in the proximal promoter of the human AHR gene. When luciferase constructs containing varying GGGGC repeats were transfected into cancer cell lines derived from the lung, colon, and breast, the number of GGGGC repeats affected AHR promoter activity. The number of GGGGC repeats was determined in DNA from 327 humans and from 38 samples representing 5 species of non-human primates. In chimpanzees and 3 species of macaques, only (GGGGC) 2 alleles were observed; however, in western gorilla, (GGGGC) n alleles with n = 2, 4, 5, 6, 7, and 8 were identified. In all human populations examined, the frequency of (GGGGC) n was n = 4 > 5 ≫ 2, 6. When frequencies of the (GGGGC) n alleles in DNA from patients with lung, colon, or breast cancer were evaluated, the occurrence of (GGGGC) 2 was found to be 8-fold more frequent among lung cancer patients in comparison with its incidence in the general population, as represented by New York State neonates. Analysis of matched tumor and non-tumor DNA samples from the same individuals provided no evidence of microsatellite instability. These studies indicate that the (GGGGC) n short tandem repeats are inherited, and that the (GGGGC) 2 allele in the AHR proximal promoter region should be further investigated with regard to its potential association with lung cancer susceptibility. - Highlights: • The AHR proximal promoter contains a polymorphism, (GGGGC) n , where n = 4 > 5 ≫ 2, 6 • Matched tumor and non-tumor DNA did not show (GGGGC) n microsatellite instability • AHR promoter activity of a construct with (GGGGC) 2 was lower than that of (GGGGC) 4 • The frequency of (GGGGC) 2 in lung cancer patients was 8-fold higher than in neonates • The

  12. Analysis of the AHR gene proximal promoter GGGGC-repeat polymorphism in lung, breast, and colon cancer

    Energy Technology Data Exchange (ETDEWEB)

    Spink, Barbara C. [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Bloom, Michael S. [Department of Environmental Health Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Wu, Susan [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Sell, Stewart; Schneider, Erasmus [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Department of Biomedical Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Ding, Xinxin [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Department of Environmental Health Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Department of Biomedical Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States); Spink, David C., E-mail: spink@wadsworth.org [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States); Department of Environmental Health Sciences, School of Public Health, University at Albany, State University of New York, Albany, NY 12201 (United States)

    2015-01-01

    The aryl hydrocarbon receptor (AhR) regulates expression of numerous genes, including those of the CYP1 gene family. With the goal of determining factors that control AHR gene expression, our studies are focused on the role of the short tandem repeat polymorphism, (GGGGC){sub n}, located in the proximal promoter of the human AHR gene. When luciferase constructs containing varying GGGGC repeats were transfected into cancer cell lines derived from the lung, colon, and breast, the number of GGGGC repeats affected AHR promoter activity. The number of GGGGC repeats was determined in DNA from 327 humans and from 38 samples representing 5 species of non-human primates. In chimpanzees and 3 species of macaques, only (GGGGC){sub 2} alleles were observed; however, in western gorilla, (GGGGC){sub n} alleles with n = 2, 4, 5, 6, 7, and 8 were identified. In all human populations examined, the frequency of (GGGGC){sub n} was n = 4 > 5 ≫ 2, 6. When frequencies of the (GGGGC){sub n} alleles in DNA from patients with lung, colon, or breast cancer were evaluated, the occurrence of (GGGGC){sub 2} was found to be 8-fold more frequent among lung cancer patients in comparison with its incidence in the general population, as represented by New York State neonates. Analysis of matched tumor and non-tumor DNA samples from the same individuals provided no evidence of microsatellite instability. These studies indicate that the (GGGGC){sub n} short tandem repeats are inherited, and that the (GGGGC){sub 2} allele in the AHR proximal promoter region should be further investigated with regard to its potential association with lung cancer susceptibility. - Highlights: • The AHR proximal promoter contains a polymorphism, (GGGGC){sub n}, where n = 4 > 5 ≫ 2, 6 • Matched tumor and non-tumor DNA did not show (GGGGC){sub n} microsatellite instability • AHR promoter activity of a construct with (GGGGC){sub 2} was lower than that of (GGGGC){sub 4} • The frequency of (GGGGC){sub 2} in lung

  13. On evaluating the robustness of spatial-proximity-based regionalization methods.

    OpenAIRE

    Lebecherel , L.; Andréassian , V.; Perrin , C.

    2016-01-01

    International audience; In absence of streamflow data to calibrate a hydrological model, its parameters are to be inferred by a regionalization method. In this technical note, we discuss a specific class of regionalization methods, those based on spatial proximity, which transfers hydrological information (typically calibrated parameter sets) from neighbor gauged stations to the target ungauged station. The efficiency of any spatialproximity-based regionalization method will depend on the den...

  14. On evaluating the robustness of spatial-proximity-based regionalization methods.

    OpenAIRE

    Lebecherel, L.; Andréassian, V.; Perrin, C.

    2016-01-01

    In absence of streamflow data to calibrate a hydrological model, its parameters are to be inferred by a regionalization method. In this technical note, we discuss a specific class of regionalization methods, those based on spatial proximity, which transfers hydrological information (typically calibrated parameter sets) from neighbor gauged stations to the target ungauged station. The efficiency of any spatialproximity-based regionalization method will depend on the density of the available st...

  15. Socio-cultural proximity, daily life and shopping tourism in the Dutch–German border region

    NARCIS (Netherlands)

    Szytniewski, Bianca B.; Spierings, Bas; van der Velde, Martin

    2017-01-01

    This paper analyses feelings of socio-cultural proximity and distance with a specific focus on the tourist experience in cross-border shopping and everyday life practices in border regions. We examined shopping practices of Dutch border crossers who visit the German town Kleve in the Dutch–German

  16. Radiographic anatomy of soft tissue attachments in the equine metacarpophalangeal and proximal phalangeal region

    International Nuclear Information System (INIS)

    Weaver, J.C.B.; Stover, S.M.; O'Brien, T.R.

    1992-01-01

    The sites of bony attachment of the tendons, ligaments, and fibrous portion of the joint capsules of the equine metacarpophalangeal (fetlock) joint region were determined by gross dissection. These sites were transposed to standard radiographic views of the fetlock joint to yield illustrations that can be used as an aid in the diagnosis of soft tissue pathology from radiographs. Evidence of direct attachment of the common digital extensor tendon to the proximal phalanx was not found. Branches of the superficial digital flexor tendon were found to insert only on the middle phalanx. The recently described sites of insertion of the branches of the superficial digital flexor tendon to the proximal phalanx were found to be sites for attachment of the deep axial palmar ligaments of the proximal interphalangeal joint

  17. Proximity and scientific collaboration in Northern European “cross-border regional innovation systems”

    DEFF Research Database (Denmark)

    Makkonen, Teemu; Williams, Allan

    2015-01-01

    A novel approach, namely cross-border regional innovation system, has been recently introduced to the literature on economic geography as a framework for studying innovation and scientific collaboration in a cross-border context. However, despite the importance of the topic for cross-border regions......, there are no existing empirical accounts comprehensively validating the concept. Here an attempt to shed some light into this “black box” is made by addressing this research gap via empirical material from Northern European cross-border regions. Specifically this is done by applying data on publications, sectoral...... and cultural statistics together with measures for accessibility and institutional and organisational similarity. These measures are linked to the varying types of proximity discussed in the literature on innovation and scientific collaboration; the impacts of proximity on the volume of cross-border scientific...

  18. Regionalization of municipal solid waste management in Japan: balancing the proximity principle with economic efficiency.

    Science.gov (United States)

    Okuda, Itaru; Thomson, Vivian E

    2007-07-01

    The proximity principle - disposing of waste close to its origin - has been a central value in municipal solid waste (MSW) management in Japan for the last 30 years and its widespread adoption has helped resolve numerous "Not in My Backyard" issues related to MSW management. However, MSW management costs have soared, in large part because of aggressive recycling efforts and because most MSW is incinerated in a country that has scarce landfill capacity. In addition, smaller, less sophisticated incinerators have been closed because of high dioxin emissions. Rising costs combined with the closure of smaller incinerators have shifted MSW management policy toward regionalization, which is the sharing of waste management facilities across municipalities. Despite the increased use of regionalized MSW facilities, the proximity principle remains the central value in Japanese MSW management. Municipal solid waste management has become increasingly regionalized in the United States, too, but different driving forces are at work in these two countries. The transition to regionalized MSW management in Japan results from strong governmental control at all levels, with the central government providing funds and policy direction and prefectures and municipalities being the primary implementing authorities. By contrast, market forces are a much stronger force with US MSW management, where local governments - with state government oversight - have primary responsibility for MSW management. We describe recent changes in Japan's MSW programs. We examine the connections between MSW facility regionalization, on the one hand, and, on the other hand, the proximity principle, coordination among local governments, central government control, and financing mechanisms.

  19. Identify fracture-critical regions inside the proximal femur using statistical parametric mapping

    Science.gov (United States)

    Li, Wenjun; Kornak, John; Harris, Tamara; Keyak, Joyce; Li, Caixia; Lu, Ying; Cheng, Xiaoguang; Lang, Thomas

    2009-01-01

    We identified regions inside the proximal femur that are most strongly associated with hip fracture. Bone densitometry based on such fracture-critical regions showed improved power in discriminating fracture patients from controls. Introduction Hip fractures typically occur in lateral falls, with focal mechanical failure of the sub-volumes of tissue in which the applied stress exceeds the strength. In this study, we describe a new methodology to identify proximal femoral tissue elements with highest association with hip fracture. We hypothesize that bone mineral density (BMD) measured in such sub-volumes discriminates hip fracture risk better than BMD in standard anatomic regions such as the femoral neck and trochanter. Materials and Methods We employed inter-subject registration to transform hip QCT images of 37 patients with hip fractures and 38 age-matched controls into a voxel-based statistical atlas. Within voxels, we performed t-tests between the two groups to identify the regions which differed most. We then randomly divided the 75 scans into a training set and a test set. From the training set, we derived a fracture-driven region of interest (ROI) based on association with fracture. In the test set, we measured BMD in this ROI to determine fracture discrimination efficacy using ROC analysis. Additionally, we compared the BMD distribution differences between the 29 patients with neck fractures and the 8 patients with trochanteric fractures. Results By evaluating fracture discrimination power based on ROC analysis, the fracture-driven ROI had an AUC (area under curve) of 0.92, while anatomic ROIs (including the entire proximal femur, the femoral neck, trochanter and their cortical and trabecular compartments) had AUC values between 0.78 and 0.87. We also observed that the neck fracture patients had lower BMD (p=0.014) in a small region near the femoral neck and the femoral head, and patients with trochanteric fractures had lower BMD in trochanteric regions

  20. On evaluating the robustness of spatial-proximity-based regionalization methods

    Science.gov (United States)

    Lebecherel, Laure; Andréassian, Vazken; Perrin, Charles

    2016-08-01

    In absence of streamflow data to calibrate a hydrological model, its parameters are to be inferred by a regionalization method. In this technical note, we discuss a specific class of regionalization methods, those based on spatial proximity, which transfers hydrological information (typically calibrated parameter sets) from neighbor gauged stations to the target ungauged station. The efficiency of any spatial-proximity-based regionalization method will depend on the density of the available streamgauging network, and the purpose of this note is to discuss how to assess the robustness of the regionalization method (i.e., its resilience to an increasingly sparse hydrometric network). We compare two options: (i) the random hydrometrical reduction (HRand) method, which consists in sub-sampling the existing gauging network around the target ungauged station, and (ii) the hydrometrical desert method (HDes), which consists in ignoring the closest gauged stations. Our tests suggest that the HDes method should be preferred, because it provides a more realistic view on regionalization performance.

  1. Some observations on lameness associated with pain in the proximal metacarpal region

    International Nuclear Information System (INIS)

    Dyson, S.

    1988-01-01

    The carpus and metacarpus of 40 horses which were free from lameness and 40 horses with lameness associated with the metacarpophalangeal joint or more distal limb were examined radiographically (Group A). The opacity of the proximal third of the third metacarpal bone was regular, with a uniform trabecular pattern. Osseous cyst-like lesions (OCLLs) were identified in the radial carpal bone (1), the ulnar carpal bone (2), the second carpal bone (15) and the fourth carpal bone (1). Thirty-one of 638 horses (4.8 percent) with forelimb lameness had pain localised to the proximal metacarpal region using local anaesthesia (Group B). All these horses were examined radiographically and an ultrasonographic examination was performed in seven. No definitive diagnosis was reached in 16 horses, seven of which had an OCLL in one of the carpal bones or the second metacarpal bone. One horse had, in addition to a poorly defined lucent area in the second carpal bone, radiographic evidence of degenerative joint disease of the carpometacarpal joint and an hypoechoic lesion in the accessory ligament of the deep digital flexor tendon. One horse had an hypoechoic lesion in the proximal part of the suspensory ligament. Abnormalities of the trabecular structure of the third metacarpal bone were identified in 13 horses. In 11 of these there was a vertically orientated lucent line, usually surrounded by sclerotic bone. These lucent lines may represent fatigue fractures seen end on. In one horse an horizontal lucent line was seen. One of these 13 horses also had a lesion in the proximal part of the suspensory ligament. Ten of the 13 (77 per cent) horses with presumed fractures of the third metacarpal bone recovered completely, whereas only eight of the 16 (50 per cent) horses in which no definitive diagnosis was reached returned to their former function

  2. Far infrared radiation promotes rabbit renal proximal tubule cell proliferation and functional characteristics, and protects against cisplatin-induced nephrotoxicity.

    Science.gov (United States)

    Chiang, I-Ni; Pu, Yeong-Shiau; Huang, Chao-Yuan; Young, Tai-Horng

    2017-01-01

    Far infrared radiation, a subdivision of the electromagnetic spectrum, is beneficial for long-term tissue healing, anti-inflammatory effects, growth promotion, sleep modulation, acceleration of microcirculation, and pain relief. We investigated if far infrared radiation is beneficial for renal proximal tubule cell cultivation and renal tissue engineering. We observed the effects of far infrared radiation on renal proximal tubules cells, including its effects on cell proliferation, gene and protein expression, and viability. We also examined the protective effects of far infrared radiation against cisplatin, a nephrotoxic agent, using the human proximal tubule cell line HK-2. We found that daily exposure to far infrared radiation for 30 min significantly increased rabbit renal proximal tubule cell proliferation in vitro, as assessed by MTT assay. Far infrared radiation was not only beneficial to renal proximal tubule cell proliferation, it also increased the expression of ATPase Na+/K+ subunit alpha 1 and glucose transporter 1, as determined by western blotting. Using quantitative polymerase chain reaction, we found that far infrared radiation enhanced CDK5R1, GNAS, NPPB, and TEK expression. In the proximal tubule cell line HK-2, far infrared radiation protected against cisplatin-mediated nephrotoxicity by reducing apoptosis. Renal proximal tubule cell cultivation with far infrared radiation exposure resulted in better cell proliferation, significantly higher ATPase Na+/K+ subunit alpha 1 and glucose transporter 1 expression, and significantly enhanced expression of CDK5R1, GNAS, NPPB, and TEK. These results suggest that far infrared radiation improves cell proliferation and differentiation. In HK-2 cells, far infrared radiation mediated protective effects against cisplatin-induced nephrotoxicity by reducing apoptosis, as indicated by flow cytometry and caspase-3 assay.

  3. The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes.

    Science.gov (United States)

    Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A

    2010-01-01

    Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

  4. RGmatch: matching genomic regions to proximal genes in omics data integration

    Directory of Open Access Journals (Sweden)

    Pedro Furió-Tarí

    2016-11-01

    Full Text Available Abstract Background The integrative analysis of multiple genomics data often requires that genome coordinates-based signals have to be associated with proximal genes. The relative location of a genomic region with respect to the gene (gene area is important for functional data interpretation; hence algorithms that match regions to genes should be able to deliver insight into this information. Results In this work we review the tools that are publicly available for making region-to-gene associations. We also present a novel method, RGmatch, a flexible and easy-to-use Python tool that computes associations either at the gene, transcript, or exon level, applying a set of rules to annotate each region-gene association with the region location within the gene. RGmatch can be applied to any organism as long as genome annotation is available. Furthermore, we qualitatively and quantitatively compare RGmatch to other tools. Conclusions RGmatch simplifies the association of a genomic region with its closest gene. At the same time, it is a powerful tool because the rules used to annotate these associations are very easy to modify according to the researcher’s specific interests. Some important differences between RGmatch and other similar tools already in existence are RGmatch’s flexibility, its wide range of user options, compatibility with any annotatable organism, and its comprehensive and user-friendly output.

  5. Complete dissociation of the HIV-1 gp41 ectodomain and membrane proximal regions upon phospholipid binding

    International Nuclear Information System (INIS)

    Roche, Julien; Louis, John M.; Aniana, Annie; Ghirlando, Rodolfo; Bax, Ad

    2015-01-01

    The envelope glycoprotein gp41 mediates the process of membrane fusion that enables entry of the HIV-1 virus into the host cell. Strong lipid affinity of the ectodomain suggests that its heptad repeat regions play an active role in destabilizing membranes by directly binding to the lipid bilayers and thereby lowering the free-energy barrier for membrane fusion. In such a model, immediately following the shedding of gp120, the N-heptad and C-heptad helices dissociate and melt into the host cell and viral membranes, respectively, pulling the destabilized membranes into juxtaposition, ready for fusion. Post-fusion, reaching the final 6-helix bundle (6HB) conformation then involves competition between intermolecular interactions needed for formation of the symmetric 6HB trimer and the membrane affinity of gp41’s ectodomain, including its membrane-proximal regions. Our solution NMR study of the structural and dynamic properties of three constructs containing the ectodomain of gp41 with and without its membrane-proximal regions suggests that these segments do not form inter-helical interactions until the very late steps of the fusion process. Interactions between the polar termini of the heptad regions, which are not associating with the lipid surface, therefore may constitute the main driving force initiating formation of the final post-fusion states. The absence of significant intermolecular ectodomain interactions in the presence of dodecyl phosphocholine highlights the importance of trimerization of gp41’s transmembrane helix to prevent complete dissociation of the trimer during the course of fusion

  6. Complete dissociation of the HIV-1 gp41 ectodomain and membrane proximal regions upon phospholipid binding

    Energy Technology Data Exchange (ETDEWEB)

    Roche, Julien; Louis, John M.; Aniana, Annie [National Institute of Diabetes and Digestive and Kidney Diseases, Laboratory of Chemical Physics (United States); Ghirlando, Rodolfo [National Institutes of Health, Laboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases (United States); Bax, Ad, E-mail: bax@nih.gov [National Institute of Diabetes and Digestive and Kidney Diseases, Laboratory of Chemical Physics (United States)

    2015-04-15

    The envelope glycoprotein gp41 mediates the process of membrane fusion that enables entry of the HIV-1 virus into the host cell. Strong lipid affinity of the ectodomain suggests that its heptad repeat regions play an active role in destabilizing membranes by directly binding to the lipid bilayers and thereby lowering the free-energy barrier for membrane fusion. In such a model, immediately following the shedding of gp120, the N-heptad and C-heptad helices dissociate and melt into the host cell and viral membranes, respectively, pulling the destabilized membranes into juxtaposition, ready for fusion. Post-fusion, reaching the final 6-helix bundle (6HB) conformation then involves competition between intermolecular interactions needed for formation of the symmetric 6HB trimer and the membrane affinity of gp41’s ectodomain, including its membrane-proximal regions. Our solution NMR study of the structural and dynamic properties of three constructs containing the ectodomain of gp41 with and without its membrane-proximal regions suggests that these segments do not form inter-helical interactions until the very late steps of the fusion process. Interactions between the polar termini of the heptad regions, which are not associating with the lipid surface, therefore may constitute the main driving force initiating formation of the final post-fusion states. The absence of significant intermolecular ectodomain interactions in the presence of dodecyl phosphocholine highlights the importance of trimerization of gp41’s transmembrane helix to prevent complete dissociation of the trimer during the course of fusion.

  7. Economic development, place-based development strategies and the conceptualization of proximity in European urban regions

    NARCIS (Netherlands)

    Dogaru, Dora; van Oort, Frank; Thissen, M.

    2014-01-01

    The discussion on proximity has evolved in various theoretical, conceptual and empirical directions since the seminal contributions by Torre and Rallet (2005) and Boschma (2005). One of the main arguments for conceptualizing proximities other than physical proximities is embedded in the ever-growing

  8. Brain region's relative proximity as marker for Alzheimer's disease based on structural MRI

    DEFF Research Database (Denmark)

    Erleben, Lene Lillemark; Sørensen, Lauge Emil; Pai, Akshay Sadananda Uppinakudru

    2014-01-01

    BACKGROUND:Alzheimer's disease (AD) is a progressive, incurable neurodegenerative disease and the most common type of dementia. It cannot be prevented, cured or drastically slowed, even though AD research has increased in the past 5-10 years. Instead of focusing on the brain volume or on the single...... brain structures like hippocampus, this paper investigates the relationship and proximity between regions in the brain and uses this information as a novel way of classifying normal control (NC), mild cognitive impaired (MCI), and AD subjects.METHODS:A longitudinal cohort of 528 subjects (170 NC, 240...... to whole brain and hippocampus volume.RESULTS:We found that both our markers was able to significantly classify the subjects. The surface connectivity marker showed the best results with an area under the curve (AUC) at 0.877 (p...

  9. An Alphavirus E2 Membrane-Proximal Domain Promotes Envelope Protein Lateral Interactions and Virus Budding

    Directory of Open Access Journals (Sweden)

    Emily A. Byrd

    2017-11-01

    Full Text Available Alphaviruses are members of a group of small enveloped RNA viruses that includes important human pathogens such as Chikungunya virus and the equine encephalitis viruses. The virus membrane is covered by a lattice composed of 80 spikes, each a trimer of heterodimers of the E2 and E1 transmembrane proteins. During virus endocytic entry, the E1 glycoprotein mediates the low-pH-dependent fusion of the virus membrane with the endosome membrane, thus initiating virus infection. While much is known about E1 structural rearrangements during membrane fusion, it is unclear how the E1/E2 dimer dissociates, a step required for the fusion reaction. A recent Alphavirus cryo-electron microscopy reconstruction revealed a previously unidentified D subdomain in the E2 ectodomain, close to the virus membrane. A loop within this region, here referred to as the D-loop, contains two highly conserved histidines, H348 and H352, which were hypothesized to play a role in dimer dissociation. We generated Semliki Forest virus mutants containing the single and double alanine substitutions H348A, H352A, and H348/352A. The three D-loop mutations caused a reduction in virus growth ranging from 1.6 to 2 log but did not significantly affect structural protein biosynthesis or transport, dimer stability, virus fusion, or specific infectivity. Instead, growth reduction was due to inhibition of a late stage of virus assembly at the plasma membrane. The virus particles that are produced show reduced thermostability compared to the wild type. We propose the E2 D-loop as a key region in establishing the E1-E2 contacts that drive glycoprotein lattice formation and promote Alphavirus budding from the plasma membrane.

  10. Characteristics of lentiviral vectors harboring the proximal promoter of the vav proto-oncogene: a weak and efficient promoter for gene therapy.

    Science.gov (United States)

    Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A

    2007-08-01

    Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.

  11. Characterization of the FoxL2 proximal promoter and coding sequence from the common snapping turtle (Chelydra serpentina).

    Science.gov (United States)

    Guo, Lei; Rhen, Turk

    2017-10-01

    Sex is determined by temperature during embryogenesis in snapping turtles, Chelydra serpentina. Previous studies in this species show that dihydrotestosterone (DHT) induces ovarian development at temperatures that normally produce males or mixed sex ratios. The feminizing effect of DHT is associated with increased expression of FoxL2, suggesting that androgens regulate transcription of FoxL2. To test this hypothesis, we cloned the proximal promoter (1.6kb) and coding sequence for snapping turtle FoxL2 (tFoxL2) in frame with mCherry to produce a fluorescent reporter. The tFoxL2-mCherry fusion plasmid or mCherry control plasmid were stably transfected into mouse KK1 granulosa cells. These cells were then treated with 0, 1, 10, or 100nM DHT to assess androgen effects on tFoxL2-mCherry expression. In contrast to the main hypothesis, DHT did not alter expression of the tFoxL2-mCherry reporter. However, normal serum increased expression of tFoxL2-mCherry when compared to charcoal-stripped serum, indicating that the cloned region of tFoxL2 contains cis regulatory elements. We also used the tFoxL2-mCherry plasmid as an expression vector to test the hypothesis that DHT and tFoxL2 interact to regulate expression of endogenous genes in granulosa cells. While tFoxL2-mCherry and DHT had independent effects on mouse FoxL2, FshR, GnRHR, and StAR expression, tFoxL2-mCherry potentiated low concentration DHT effects on mouse aromatase expression. Further studies will be required to determine whether synergistic regulation of aromatase by DHT and FoxL2 also occurs in turtle gonads during the sex-determining period, which would explain the feminizing effect of DHT in this species. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Magnetic resonance study on the anatomical relationship between the posterior proximal region of the tibia and the popliteal artery ☆

    Directory of Open Access Journals (Sweden)

    Rogério Franco de Araujo Goes

    2015-08-01

    Full Text Available ABSTRACTOBJECTIVE: To analyze and describe the distance from the popliteal artery to three specific areas of the proximal region of the tibia, with the knee extended, by means of magnetic resonance. METHODS: Images of 100 knees of patients who underwent magnetic resonance examinations were analyzed. The location of the popliteal artery was measured in three different areas of the posterior proximal region of the tibia. The first measurement was made at the level of the knee joint (tibial plateau. The second was 9 mm distally to the tibial plateau. The third was at the level of the anterior tuberosity of the tibia (ATT. RESULTS: The distances between the popliteal artery and the tibial plateau and ATT region were significantly greater in males than in females. The distances between the popliteal artery and the regions 9 mm distally to the tibial plateau and the ATT were significantly greater in the age group over 36 years than in the group ≤36 years. CONCLUSION: Knowledge of the anatomical position of the popliteal artery, as demonstrated through magnetic resonance studies, is of great relevance in planning surgical procedures that involve the knee joint. In this manner, devastating iatrogenic injuries can be avoided, particularly in regions that are proximal to the tibial plateau and in young patients.

  13. A Classification of Subaqueous Density Flows Based on Transformations From Proximal to Distal Regions

    Science.gov (United States)

    Hermidas, Navid; Eggenhuisen, Joris; Luthi, Stefan; Silva Jacinto, Ricardo; Toth, Ferenc; Pohl, Florian

    2017-04-01

    Transformations of a subaqueous density flow from proximal to distal regions are investigated. A classification of these transformations based on the state of the free shear and boundary layers and existence of a plug layer during transition from a debris flow to a turbidity current is presented. A connection between the emplaced deposit by the flow and the relevant flow type is drawn through the results obtained from a series of laboratory flume experiments. These were performed using 9%, 15%, and 21% sediment mixture concentrations composed of sand, silt, clay, and tap water, on varying bed slopes of 6°, 8°, and 9.5°, and with discharge rates of 10[m3/h] and 15[m3/h]. Stress-controlled rheometry experiments were performed on the mixtures to obtain apparent viscosity data. A classification was developed based on the imposed flow conditions, where a cohesive flow may fall within one of five distinct flow types: 1) a cohesive plug flow (PF) with a laminar free shear and boundary layers, 2) a top transitional plug flow (TTPF) containing a turbulent free shear layer, a plug layer, and a laminar boundary layer, 3) a complete transitional plug flow (CTPF) consisting of a turbulent free shear and boundary layers and a plug, 4) a transitional turbidity current (TTC) with a turbulent free shear layer and a laminar boundary layer, and, 5) a completely turbulent turbidity current (TC). During the experiments, flow type PF resulted in en masse deposition of a thick uniform ungraded muddy sand mixture, which was emplaced once the yield stress overcame the gravitational forces within the tail region of the flow. Flow type TTPF resulted in deposition of a thin ungraded basal clean sand layer during the run. This layer was covered by a muddy sand deposit from the tail. Flow type TTC did not deposit any sediment during the run. A uniform muddy sand mixture was emplaced by the tail of the flow. Flow type TC resulted in deposition of poorly sorted massive bottom sand layer. This

  14. Regulation of Neurospora Catalase-3 by global heterochromatin formation and its proximal heterochromatin region.

    Science.gov (United States)

    Wang, Yajun; Dong, Qing; Ding, Zhaolan; Gai, Kexin; Han, Xiaoyun; Kaleri, Farah Naz; He, Qun; Wang, Ying

    2016-10-01

    Catalase-3 (CAT-3) constitutes the main catalase activity in growing hyphae of Neurospora crassa, and its activity increases during exponential growth or is induced under different stress conditions. Although extensive progress has been made to identify catalase regulators, the regulation mechanism of CAT-3 at the chromatin level still remains unclear. Here, we aim at investigating the molecular regulation mechanisms of cat-3 at the chromatin level. We found that CAT-3 protein levels increased in mutants defective in proper global heterochromatin formation. Bioinformatics analysis identified a 5-kb AT-rich sequence adjacent to the cat-3 promoter as a heterochromatin region because of its enrichment of H3K9me3 and HP1. Expression of CAT-3 was induced by H 2 O 2 treatment in wild-type and such change occurred along with the accumulation of histone H3 acetylation at 5-kb heterochromatin boundaries and cat-3 locus, but without alteration of its H3K9me3 repressive modification. Moreover, disruption of 5-kb heterochromatin region results in elevated cat-3 expression, and higher levels of cat-3 expression were promoted by the combination with global heterochromatin defective mutants. Interestingly, the molecular weight and activity bands of CAT-3 protein are different in heterochromatin defective mutants compared with those in wild-type, suggesting that its N-terminal processing and modification may be altered. Our study indicates that the local chromatin structure creates a heterochromatin repressive environment to repress nearby gene expression. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Unveiling DNA structural properties of promoter regions of ...

    Indian Academy of Sciences (India)

    Aditya Kumar

    Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...

  16. Identification and annotation of promoter regions in microbial ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    2007-06-15

    Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.

  17. [Health-Promoting Schools Regional Initiative of the Americas].

    Science.gov (United States)

    Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia

    2005-01-01

    In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen

  18. Chromatin immunoprecipitation assays revealed CREB and serine 133 phospho-CREB binding to the CART gene proximal promoter.

    Science.gov (United States)

    Rogge, George A; Shen, Li-Ling; Kuhar, Michael J

    2010-07-16

    Both over expression of cyclic AMP response element binding protein (CREB) in the nucleus accumbens (NAc), and intra-accumbal injection of cocaine- and amphetamine-regulated transcript (CART) peptides, have been shown to decrease cocaine reward. Also, over expression of CREB in the rat NAc increased CART mRNA and peptide levels, but it is not known if this was due to a direct action of P-CREB on the CART gene promoter. The goal of this study was to test if CREB and P-CREB bound directly to the CRE site in the CART promoter, using chromatin immunoprecipitation (ChIP) assays. ChIP assay with anti-CREB antibodies showed an enrichment of the CART promoter fragment containing the CRE region over IgG precipitated material, a non-specific control. Forskolin, which was known to increase CART mRNA levels in GH3 cells, was utilized to show that the drug increased levels of P-CREB protein and P-CREB binding to the CART promoter CRE-containing region. A region of the c-Fos promoter containing a CRE cis-regulatory element was previously shown to bind P-CREB, and it was used here as a positive control. These data suggest that the effects of CREB over expression on blunting cocaine reward could be, at least in part, attributed to the increased expression of the CART gene by direct interaction of P-CREB with the CART promoter CRE site, rather than by some indirect action. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  19. Identification and annotation of promoter regions in microbial

    Indian Academy of Sciences (India)

    2007-06-15

    Jun 15, 2007 ... Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the ...

  20. A influência da proximidade tecnológica e geográfica sobre a inovação regional no Brasil The influence of the technological proximity and the geographical proximity on Brazilian regional innovation

    Directory of Open Access Journals (Sweden)

    Eduardo Gonçalves

    2011-04-01

    Full Text Available O objetivo deste trabalho é verificar a influência da proximidade geográfica e da proximidade tecnológica sobre a inovação regional no Brasil, medida por depósitos de patentes no período 1999-2001 para mesorregiões geográficas. Para tanto, utilizaram-se técnicas de Análise Exploratória de Dados Espaciais (AEDE e de econometria espacial. Os dados de patentes foram organizados em quatro clusters tecnológicos segundo critérios de proximidade cognitiva, como biofarmacêutico, desenvolvimento de novos materiais, bens mecânicos e de consumo e tecnologias eletroeletrônicas, revelando um padrão de concentração da atividade tecnológica em poucas mesorregiões brasileiras. Além disso, foi calculada a medida de proximidade tecnológica de Jaffe para ponderar a vizinhança geográfica pelo grau de similaridade tecnológica das mesorregiões. Os resultados confirmam a hipótese de transbordamentos de conhecimento mediados tecnológica e geograficamente.The aim of this paper is to determine the influence of technological proximity and geographical proximity on Brazilian regional innovation, measured by patent applications over the period 1999-2001 for Brazilian geographical mesoregions. First, the paper undertakes an Exploratory Spatial Data Analysis (ESDA and then uses spatial econometric techniques. According with procedures based on cognitive proximity the patent data are organized into four technological clusters such as chemical and bio-pharmaceutical, new materials, mechanical and process technologies and electrical and electronic technologies. The four aforementioned clusters exhibit a concentrated regional pattern of technological activity over few Brazilian mesoregions. Moreover, the paper uses a Jaffe's measure of technological distance in order to construct a matrix in which the technological similarity is weighted by the geographical proximity. The results corroborate the hypothesis of geographically and technologically

  1. Structural and functional characterization of EIAV gp45 fusion peptide proximal region and asparagine-rich layer

    Energy Technology Data Exchange (ETDEWEB)

    Duan, Liangwei; Du, Jiansen [State Key Laboratory of Medicinal Chemical Biology, College of Life Sciences, Nankai University, Tianjin 300071 (China); Wang, Xuefeng; Zhou, Jianhua; Wang, Xiaojun [State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin 150001 (China); Liu, Xinqi, E-mail: liu2008@nankai.edu.cn [State Key Laboratory of Medicinal Chemical Biology, College of Life Sciences, Nankai University, Tianjin 300071 (China)

    2016-04-15

    Equine infectious anaemia virus (EIAV) and human immunodeficiency virus (HIV) are members of the lentiviral genus. Similar to HIV gp41, EIAV gp45 is a fusogenic protein that mediates fusion between the viral particle and the host cell membrane. The crystal structure of gp45 reported reveals a different conformation in the here that includes the fusion peptide proximal region (FPPR) and neighboring asparagine-rich layer compared with previous HIV-1 gp41 structures. A complicated hydrogen-bond network containing a cluster of solvent molecules appears to be critical for the stability of the gp45 helical bundle. Interestingly, viral replication was relatively unaffected by site-directed mutagenesis of EIAV, in striking contrast to that of HIV-1. Based on these observations, we speculate that EIAV is more adaptable to emergent mutations, which might be important for the evolution of EIAV as a quasi-species, and could potentially contribute to the success of the EIAV vaccine. - Highlights: • The crystal structure of EIAV gp45 was determined. • The fusion peptide proximal region adopts a novel conformation different to HIV-1. • The asparagine-rich layer includes an extensive hydrogen-bond network. • These regions of EIAV are highly tolerant to mutations. • The results provide insight into the mechanism of gp41/gp45-mediated membrane fusion.

  2. Perspectives on Promoting Regional Renewable Energy Research and Development

    International Nuclear Information System (INIS)

    Dresselhaus, M.

    2008-01-01

    Recent discussions at the Washington International Renewable Energy Conference (WIREC), hosted in March 2008 by the United States Government, with nearly 9000 participants including 103 ministers from 126 countries, concluded that a major acceleration in the adoption of renewable energy technologies was needed by mid-century. Because of different climatic conditions and societal preferences, regional cooperation is expected to play a major role in the efficient adoption of appropriate renewable energy technologies, and countries with special expertise in specific technologies seem eager to collaborate internationally to promote global goals in renewable energy. A review will be given of what we learned from this conference about renewable energy research and development strategies with a special focus given to using this basic knowledge base to promote the development of renewable energy technologies appropriate to specific regions of the world.(author)

  3. Proximate, mineral composition and antioxidant activity of traditional small millets cultivated and consumed in Rayalaseema region of south India.

    Science.gov (United States)

    Vali Pasha, Kotwal; Ratnavathi, Chamarthy Venkata; Ajani, Jayanna; Raju, Dugyala; Manoj Kumar, Sriramoju; Beedu, Sashidhar Rao

    2018-01-01

    Millets are a diverse group of small seeded grasses, widely grown around the world as cereal foods. This communication details the proximate, mineral profile and antioxidant activity of six different small millets (Finger, Foxtail, Proso, Little, Barnyard and Kodo millets) and their 21 cultivars that are traditionally cultivated and consumed in the region of Ralayaseema, south India. The proximate analysis revealed that these millets are rich in protein, fat, ash (mineral), total dietary fibre and total phenols with appreciable antioxidant activity. However, starch and amylose content was comparatively lower as compared to major millet sorghum. ICP-MS analysis of small millets demonstrated that they are rich in minerals such as Ca, P, K, Mg, Fe, Cu, Zn, Mn, Cr, Mo and Se. Finger and kodo millets were found to be nutritionally superior over other small millets. The results suggest that small millets have a potential to provide food security and can combat micronutrient malnutrition. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  4. Mechanosensitive promoter region in the human HB-GAM gene

    DEFF Research Database (Denmark)

    Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

    2009-01-01

    Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

  5. DGCR6 at the proximal part of the DiGeorge critical region is involved in conotruncal heart defects

    Science.gov (United States)

    Gao, Wenming; Higaki, Takashi; Eguchi-Ishimae, Minenori; Iwabuki, Hidehiko; Wu, Zhouying; Yamamoto, Eiichi; Takata, Hidemi; Ohta, Masaaki; Imoto, Issei; Ishii, Eiichi; Eguchi, Mariko

    2015-01-01

    Cardiac anomaly is one of the hallmarks of DiGeorge syndrome (DGS), observed in approximately 80% of patients. It often shows a characteristic morphology, termed as conotruncal heart defects. In many cases showing only the conotruncal heart defect, deletion of 22q11.2 region cannot be detected by fluorescence in situ hybridization (FISH), which is used to detect deletion in DGS. We investigated the presence of genomic aberrations in six patients with congenital conotruncal heart defects, who show no deletion at 22q11.2 in an initial screening by FISH. In these patients, no abnormalities were identified in the coding region of the TBX1 gene, one of the key genes responsible for the phenotype of DGS. However, when copy number alteration was analyzed by high-resolution array analysis, a small deletion or duplication in the proximal end of DiGeorge critical region was detected in two patients. The affected region contains the DGCR6 and PRODH genes. DGCR6 has been reported to affect the expression of the TBX1 gene. Our results suggest that altered dosage of gene(s) other than TBX1, possibly DGCR6, may also be responsible for the development of conotruncal heart defects observed in patients with DGS and, in particular, in those with stand-alone conotruncal heart defects. PMID:27081520

  6. Dissociation of 5' proximal helical regions in messenger RNAs by eukaryotic initiation factors 4F, 4A, and 4B

    International Nuclear Information System (INIS)

    Thach, R.E.; Lawson, T.G.; Lee, K.A.; Abramson, R.D.; Merrick, W.C.

    1987-01-01

    Ray, et al. demonstrated that the susceptibility of mRNAs to cleavage by ribonucleases is greatly increased by eIF-4A and eIF-4F in an ATP-dependent reaction, and that this reaction is enhanced by the presence of eIF-4B. They now report direct evidence for the dissociation of helical regions at the 5' ends of mRNAs by these factors. Helices were generated at the 5' ends of reovirus and rabbit globin mRNAs by hybridizing to them 32 P-labeled cDNA pentadecamers. The dissociation of the cDNAs from the mRNAs was monitored by Sephadex gel filtration. Addition of eIF-4F to hybrids caused the dissociation of small amounts of cDNAs, and this dissociation required ATP. Addition of eIF-4B stimulated this activity. Neither eIF-4B nor eIF-4A alone caused significant ATP-dependent dissociation, but they did so in combination. Interestingly, cDNAs that were hybridized to 5' distal regions were dissociated with efficiencies and rates similar to those of 5' proximal cDNAs. The presence of unlabelled cDNAs hybridized 5' proximally did not affect distal cDNA dissociation. These results confirm the earlier suggestion that eIF-4A, eIF-4B and eIF-4F play important roles in the disruption of mRNA secondary structure during initiation

  7. Label retaining cells (LRCs with myoepithelial characteristic from the proximal acinar region define stem cells in the sweat gland.

    Directory of Open Access Journals (Sweden)

    Yvonne Leung

    Full Text Available Slow cycling is a common feature shared among several stem cells (SCs identified in adult tissues including hair follicle and cornea. Recently, existence of unipotent SCs in basal and lumenal layers of sweat gland (SG has been described and label retaining cells (LRCs have also been localized in SGs; however, whether these LRCs possess SCs characteristic has not been investigated further. Here, we used a H2BGFP LRCs system for in vivo detection of infrequently dividing cells. This system allowed us to specifically localize and isolate SCs with label-retention and myoepithelial characteristics restricted to the SG proximal acinar region. Using an alternative genetic approach, we demonstrated that SG LRCs expressed keratin 15 (K15 in the acinar region and lineage tracing determined that K15 labeled cells contributed long term to the SG structure but not to epidermal homeostasis. Surprisingly, wound healing experiments did not activate proximal acinar SG cells to participate in epidermal healing. Instead, predominantly non-LRCs in the SG duct actively divided, whereas the majority of SG LRCs remained quiescent. However, when we further challenged the system under more favorable isolated wound healing conditions, we were able to trigger normally quiescent acinar LRCs to trans-differentiate into the epidermis and adopt its long term fate. In addition, dissociated SG cells were able to regenerate SGs and, surprisingly, hair follicles demonstrating their in vivo plasticity. By determining the gene expression profile of isolated SG LRCs and non-LRCs in vivo, we identified several Bone Morphogenetic Protein (BMP pathway genes to be up-regulated and confirmed a functional requirement for BMP receptor 1A (BMPR1A-mediated signaling in SG formation. Our data highlight the existence of SG stem cells (SGSCs and their primary importance in SG homeostasis. It also emphasizes SGSCs as an alternative source of cells in wound healing and their plasticity for

  8. A segment of the apospory-specific genomic region is highly microsyntenic not only between the apomicts Pennisetum squamulatum and buffelgrass, but also with a rice chromosome 11 centromeric-proximal genomic region.

    Science.gov (United States)

    Gualtieri, Gustavo; Conner, Joann A; Morishige, Daryl T; Moore, L David; Mullet, John E; Ozias-Akins, Peggy

    2006-03-01

    Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory.

  9. A Segment of the Apospory-Specific Genomic Region Is Highly Microsyntenic Not Only between the Apomicts Pennisetum squamulatum and Buffelgrass, But Also with a Rice Chromosome 11 Centromeric-Proximal Genomic Region1[W

    Science.gov (United States)

    Gualtieri, Gustavo; Conner, Joann A.; Morishige, Daryl T.; Moore, L. David; Mullet, John E.; Ozias-Akins, Peggy

    2006-01-01

    Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory. PMID:16415213

  10. Nucleopolis for promoting the nuclear excellence of the Normandy region

    International Nuclear Information System (INIS)

    2016-01-01

    Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)

  11. Transcriptional Inhibition of Matrix Metal loproteinase 9 (MMP-9 Activity by a c-fos/Estrogen Receptor Fusion Protein is Mediated by the Proximal AP-1 Site of the MMP-9 Promoter and Correlates with Reduced Tumor Cell Invasion

    Directory of Open Access Journals (Sweden)

    David L. Crowe

    1999-10-01

    Full Text Available Tumor cell invasion of basement membranes is one of the hallmarks of malignant transformation. Tumor cells secrete proteolytic enzymes known as matrix metalloproteinases (MMPs which degrade extracellular matrix molecules. Increased expression of MMP-9 has been associated with acquisition of invasive phenotype in many tumors. However, multiple mechanisms for regulation of MMP-9 gene expression by tumor cell lines have been proposed. A number of transcription factor binding sites have been characterized in the upstream regulatory region of the MMP-9 gene, including those for AP-1. To determine how a specific AP-1 family member, c-fos, regulates MMP-9 promoter activity through these sites, we used an expression vector containing the c-fos coding region fused to the estrogen receptor (ER ligand binding domain. This construct is activated upon binding estradiol. Stable expression of this construct in ER negative squamous cell carcinoma (SCC lines produced an estradiol dependent decrease in the number of cells that migrated through a reconstituted basement membrane. This decreased invasiveness was accompanied by estradiol dependent downregulation of MMP-9 activity as determined by gelatin zymography. Estradiol also produced transcriptional downregulation of an MMP-9 promoter construct in cells transiently transfected with the c-fosER expression vector. This downregulation was mediated by the AP-1 site at —79 by in the MMP-9 promoter. We concluded that the proximal AP-1 site mediated the transcriptional downregulation of the MMP-9 promoter by a conditionally activated c-fos fusion protein.

  12. Crystal Structure of the Carboxy-Terminal Region of the Bacteriophage T4 Proximal Long Tail Fiber Protein Gp34

    Directory of Open Access Journals (Sweden)

    Meritxell Granell

    2017-06-01

    Full Text Available Long tail fibers of bacteriophage T4 are formed by proteins gp34, gp35, gp36, and gp37, with gp34 located at the phage-proximal end and gp37 at the phage-distal, receptor-binding end. We have solved the structure of the carboxy-terminal region of gp34, consisting of amino acids 894–1289, by single-wavelength anomalous diffraction and extended the structure to amino acids 744–1289 using data collected from crystals containing longer gp34-fragments. The structure reveals three repeats of a mixed α-β fibrous domain in residues 744 to 877. A triple-helical neck connects to an extended triple β-helix domain (amino acids 900–1127 punctuated by two β-prism domains. Next, a β-prism domain decorated with short helices and extended β-helices is present (residues 1146–1238, while the C-terminal end is capped with another short β-helical region and three β-hairpins. The structure provides insight into the stability of the fibrous gp34 protein.

  13. Proximal Region of the Gene Encoding Cytadherence-Related Protein Permits Molecular Typing of Mycoplasma genitalium Clinical Strains by PCR-Restriction Fragment Length Polymorphism

    Science.gov (United States)

    Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.

    2006-01-01

    Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921

  14. Modulating immunogenic properties of HIV-1 gp41 membrane-proximal external region by destabilizing six-helix bundle structure

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, Saikat; Shi, Heliang; Habte, Habtom H.; Qin, Yali; Cho, Michael W., E-mail: mcho@iastate.edu

    2016-03-15

    The C-terminal alpha-helix of gp41 membrane-proximal external region (MPER; {sup 671}NWFDITNWLWYIK{sup 683}) encompassing 4E10/10E8 epitopes is an attractive target for HIV-1 vaccine development. We previously reported that gp41-HR1-54Q, a trimeric protein comprised of the MPER in the context of a stable six-helix bundle (6HB), induced strong immune responses against the helix, but antibodies were directed primarily against the non-neutralizing face of the helix. To better target 4E10/10E8 epitopes, we generated four putative fusion intermediates by introducing double point mutations or deletions in the heptad repeat region 1 (HR1) that destabilize 6HB in varying degrees. One variant, HR1-∆10-54K, elicited antibodies in rabbits that targeted W672, I675 and L679, which are critical for 4E10/10E8 recognition. Overall, the results demonstrated that altering structural parameters of 6HB can influence immunogenic properties of the MPER and antibody targeting. Further exploration of this strategy could allow development of immunogens that could lead to induction of 4E10/10E8-like antibodies. - Highlights: • Four gp41 MPER-based immunogens that resemble fusion intermediates were generated. • C-terminal region of MPER that contains 4E10/10E8 epitopes was highly immunogenic. • Altering 6HB structure can influence immunogenic properties of the MPER. • Induced antibodies targeted multiple residues critical for 4E10/10E8 binding. • Development of immunogens based on fusion intermediates is a promising strategy.

  15. Exploring the determinants of health and wellbeing in communities living in proximity to coal seam gas developments in regional Queensland.

    Science.gov (United States)

    Mactaggart, Fiona; McDermott, Liane; Tynan, Anna; Gericke, Christian A

    2017-08-03

    There is some concern that coal seam gas mining may affect health and wellbeing through changes in social determinants such as living and working conditions, local economy and the environment. The onward impact of these conditions on health and wellbeing is often not monitored to the same degree as direct environmental health impacts in the mining context, but merits attention. This study reports on the findings from a recurrent theme that emerged from analysis of the qualitative component of a comprehensive Health Needs Assessment (HNA) conducted in regional Queensland: that health and wellbeing of communities was reportedly affected by nearby coal seam gas (CSG) development beyond direct environmental impacts. Qualitative analysis was initially completed using the Framework Method to explore key themes from 11 focus group discussions, 19 in-depth interviews, and 45 key informant interviews with health and wellbeing service providers and community members. A key theme emerged from the analysis that forms the basis of this paper. This study is part of a larger comprehensive HNA involving qualitative and quantitative data collection to explore the health and wellbeing needs of three communities living in proximity to CSG development in regional Queensland, Australia. Communities faced social, economic and environmental impacts from the rapid growth of CSG development, which were perceived to have direct and indirect effects on individual lifestyle factors such as alcohol and drug abuse, family relationships, social capital and mental health; and community-level factors including social connectedness, civic engagement and trust. Outer regional communities discussed the effects of mining activity on the fabric of their town and community, whereas the inner regional community that had a longer history of industrial activity discussed the impacts on families and individual health and wellbeing. The findings from this study may inform future health service planning in

  16. Exploring the determinants of health and wellbeing in communities living in proximity to coal seam gas developments in regional Queensland

    Directory of Open Access Journals (Sweden)

    Fiona Mactaggart

    2017-08-01

    Full Text Available Abstract Background There is some concern that coal seam gas mining may affect health and wellbeing through changes in social determinants such as living and working conditions, local economy and the environment. The onward impact of these conditions on health and wellbeing is often not monitored to the same degree as direct environmental health impacts in the mining context, but merits attention. This study reports on the findings from a recurrent theme that emerged from analysis of the qualitative component of a comprehensive Health Needs Assessment (HNA conducted in regional Queensland: that health and wellbeing of communities was reportedly affected by nearby coal seam gas (CSG development beyond direct environmental impacts. Methods Qualitative analysis was initially completed using the Framework Method to explore key themes from 11 focus group discussions, 19 in-depth interviews, and 45 key informant interviews with health and wellbeing service providers and community members. A key theme emerged from the analysis that forms the basis of this paper. This study is part of a larger comprehensive HNA involving qualitative and quantitative data collection to explore the health and wellbeing needs of three communities living in proximity to CSG development in regional Queensland, Australia. Results Communities faced social, economic and environmental impacts from the rapid growth of CSG development, which were perceived to have direct and indirect effects on individual lifestyle factors such as alcohol and drug abuse, family relationships, social capital and mental health; and community-level factors including social connectedness, civic engagement and trust. Conclusions Outer regional communities discussed the effects of mining activity on the fabric of their town and community, whereas the inner regional community that had a longer history of industrial activity discussed the impacts on families and individual health and wellbeing. The

  17. Promotion and regional development. Implementation of regional productive development agencies. The case of Maule region, Chile

    Directory of Open Access Journals (Sweden)

    Enrique Yamil Alul González

    2010-12-01

    Full Text Available The Regional Productive Development Agencies implemented in Chile in 2006, were developed as a way to answer the longing desire to territorially decentralize, and that the own Regions be whom define their future. The Agencies have the responsibility to develop innovation and productive development Agendas in participative processes, which means with public, academic and private actors. Also, the Agencies have the mission to implement Competitive Improvement Plans-PMC (clusters in prioritized economic sectors by the own region. These PMC are leaded by private actors in each sector.

  18. Distal, not proximal, colonic acetate infusions promote fat oxidation and improve metabolic markers in overweight/obese men

    DEFF Research Database (Denmark)

    van der Beek, Christina M; Canfora, Emanuel E; Lenaerts, Kaatje

    2016-01-01

    , circulating hormones or inflammatory markers. In conclusion distal colonic acetate infusions affected whole-body substrate metabolism, with a pronounced increase in fasting fat oxidation and plasma PYY. Modulating colonic acetate may be a nutritional target to treat or prevent metabolic disorders.......Gut microbial-derived short-chain fatty acids (SCFA) are believed to affect host metabolism and cardiometabolic risk factors. The present study aim was to investigate the effects of proximal and distal colonic infusions with the SCFA acetate on fat oxidation and other metabolic parameters in men...... in the colon for three consecutive test days, enabling colonic acetate (100 or 180 mmol/l) or placebo infusion during fasting conditions and after an oral glucose load (postprandial). Fat oxidation and energy expenditure were measured using an open-circuit ventilated hood system and blood samples were...

  19. Genetic recombination is targeted towards gene promoter regions in dogs.

    Science.gov (United States)

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  20. Proximate and fatty acid composition of some commercially important fish species from the Sinop region of the Black Sea.

    Science.gov (United States)

    Kocatepe, Demet; Turan, Hülya

    2012-06-01

    The proximate and fatty acid compositions of the commercially important fish species (Engraulis encrasicolus, Alosa alosa, Belone belone, Scorpaena porcus, Pomatomus saltatrix, Mullus barbatus) from the Sinop region of the Black Sea were examined. The fat contents ranged from 1.26% (for scorpion fish) to 18.12% (for shad). The protein contents were min 14.54% (for red mullet) and maximum 20.26% (for belone). The fatty acid compositions of the fish ranged from 27.83 to 35.91% for saturated fatty acids, 19.50-33.80% for monounsaturated fatty acids and 15.25-40.02% for polyunsaturated fatty acids. Among the saturated fatty acids, palmitic acid (16:0) (17.75-22.20%) was the dominant fatty acid for all the fish species. As a second saturated fatty acid, myristic acid (14:0) was observed in four of the fish species and its content ranged from 4.72 to 7.31%. Whereas, for the other two fish species, the second saturated fatty acid was stearic acid (18:0) ranging between 4.54 and 10.64%. Among the monounsaturated fatty acids, those occurring in the highest proportions were oleic acid (18:1n-9c) (11.67-22.45%) and palmitoleic acid (16:1) (4.50-9.40%). Docosahexaenoic acid (22:6n-3) (5.41-28.52%), eicosapentaenoic acid (20:5n-3) (4.68-11.06) and linoleic acid (18:2n-6) (1.38-3.49%) were dominant polyunsaturated fatty acids, respectively. All the species, in particular the belone, the anchovy and the shad had high levels of the n-3 series.

  1. US-India Technical Collaboration to Promote Regional Stability

    International Nuclear Information System (INIS)

    Killinger, Mark H.; Griggs, James R.; Apt, Kenneth E.; Doyle, James E.

    2001-01-01

    Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, DOE has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US agencies and the Indian government and scientific communities to identify appropriate non-sensitive areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national/international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes research done on the Indian scientific organization and infrastructure, potential areas for collaboration, the approach for this engagement, and current status of the initiative.

  2. US-INDIA TECHNICAL COLLABORATION TO PROMOTE REGIONAL STABILITY

    International Nuclear Information System (INIS)

    Killinger, M.H.; Griggs, J.R.; Apt, Kenneth E.; Doyle, J.E.

    2001-01-01

    Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, the US Department of Energy (DOE) has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US government agencies to identify appropriate non-sensitive, non-nuclear areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national and international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes the approach for this engagement, the Indian scientific organization and infrastructure, potential areas for collaboration, and current status of the initiative.

  3. Proximal Humerus

    NARCIS (Netherlands)

    Diercks, Ron L.; Bain, Gregory; Itoi, Eiji; Di Giacomo, Giovanni; Sugaya, Hiroyuki

    2015-01-01

    This chapter describes the bony structures of the proximal humerus. The proximal humerus is often regarded as consisting of four parts, which assists in understanding function and, more specially, describes the essential parts in reconstruction after fracture or in joint replacement. These are the

  4. Nef decreases HIV-1 sensitivity to neutralizing antibodies that target the membrane-proximal external region of TMgp41.

    Directory of Open Access Journals (Sweden)

    Rachel P J Lai

    2011-12-01

    Full Text Available Primate lentivirus nef is required for sustained virus replication in vivo and accelerated progression to AIDS. While exploring the mechanism by which Nef increases the infectivity of cell-free virions, we investigated a functional link between Nef and Env. Since we failed to detect an effect of Nef on the quantity of virion-associated Env, we searched for qualitative changes by examining whether Nef alters HIV-1 sensitivity to agents that target distinct features of Env. Nef conferred as much as 50-fold resistance to 2F5 and 4E10, two potent neutralizing monoclonal antibodies (nAbs that target the membrane proximal external region (MPER of TMgp41. In contrast, Nef had no effect on HIV-1 neutralization by MPER-specific nAb Z13e1, by the peptide inhibitor T20, nor by a panel of nAbs and other reagents targeting gp120. Resistance to neutralization by 2F5 and 4E10 was observed with Nef from a diverse range of HIV-1 and SIV isolates, as well as with HIV-1 virions bearing Env from CCR5- and CXCR4-tropic viruses, clade B and C viruses, or primary isolates. Functional analysis of a panel of Nef mutants revealed that this activity requires Nef myristoylation but that it is genetically separable from other Nef functions such as the ability to enhance virus infectivity and to downregulate CD4. Glycosylated-Gag from MoMLV substituted for Nef in conferring resistance to 2F5 and 4E10, indicating that this activity is conserved in a retrovirus that does not encode Nef. Given the reported membrane-dependence of MPER-recognition by 2F5 and 4E10, in contrast to the membrane-independence of Z13e1, the data here is consistent with a model in which Nef alters MPER recognition in the context of the virion membrane. Indeed, Nef and Glycosylated-Gag decreased the efficiency of virion capture by 2F5 and 4E10, but not by other nAbs. These studies demonstrate that Nef protects lentiviruses from one of the most broadly-acting classes of neutralizing antibodies. This newly

  5. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  6. Business networking for SMEs as a means to promote regional competitiveness: A Theoretical Framework

    OpenAIRE

    Vitor Braga

    2004-01-01

    The competitiveness of regions, as a means of promoting the competitiveness of a country as a whole, has been one of the main topics on the agenda of policy makers over the last decades. Several attempts at promoting competitiveness have been made with different degrees of success. In most cases, public investment in the regions was perceived as the solution to promote regional competitiveness and top-down policies were implemented. However, competitiveness also has an important dimension tha...

  7. Constructing a State Policy To Promote Regionalism in School Government.

    Science.gov (United States)

    Zukowsky, Jerome; And Others.

    This paper defines regionalism, sets some tentative directions for the concept, and raises difficult questions related to its application in New York State. Regionalism, which offers an alternative to a State-local school governing system, is used to decentralize the planning and management of public services. A regional unit permits district…

  8. DNA methylation of PTEN gene promoter region is not correlated ...

    African Journals Online (AJOL)

    Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...

  9. Cap-proximal nucleotides via differential eIF4E binding and alternative promoter usage mediate translational response to energy stress.

    Science.gov (United States)

    Tamarkin-Ben-Harush, Ana; Vasseur, Jean-Jacques; Debart, Françoise; Ulitsky, Igor; Dikstein, Rivka

    2017-02-08

    Transcription start-site (TSS) selection and alternative promoter (AP) usage contribute to gene expression complexity but little is known about their impact on translation. Here we performed TSS mapping of the translatome following energy stress. Assessing the contribution of cap-proximal TSS nucleotides, we found dramatic effect on translation only upon stress. As eIF4E levels were reduced, we determined its binding to capped-RNAs with different initiating nucleotides and found the lowest affinity to 5'cytidine in correlation with the translational stress-response. In addition, the number of differentially translated APs was elevated following stress. These include novel glucose starvation-induced downstream transcripts for the translation regulators eIF4A and Pabp, which are also translationally-induced despite general translational inhibition. The resultant eIF4A protein is N-terminally truncated and acts as eIF4A inhibitor. The induced Pabp isoform has shorter 5'UTR removing an auto-inhibitory element. Our findings uncovered several levels of coordination of transcription and translation responses to energy stress.

  10. The far and distal enhancers in the CYP3A4 gene co-ordinate the proximal promoter in responding similarly to the pregnane X receptor but differentially to hepatocyte nuclear factor-4alpha.

    Science.gov (United States)

    Liu, Fu-Jun; Song, Xiulong; Yang, Dongfang; Deng, Ruitang; Yan, Bingfang

    2008-01-01

    CYP3A4 (cytochrome P450 3A4) is involved in the metabolism of more than 50% of drugs and other xenobiotics. The expression of CYP3A4 is induced by many structurally dissimilar compounds. The PXR (pregnane X receptor) is recognized as a key regulator for the induction, and the PXR-directed transactivation of the CYP3A4 gene is achieved through a co-ordinated mechanism of the distal module with the proximal promoter. Recently, a far module was found to support constitutive expression of CYP3A4. The far module, like the distal module, is structurally clustered by a PXR response element (F-ER6) and elements recognized by HNF-4alpha (hepatocyte nuclear receptor-4alpha). We hypothesized that the far module supports PXR transactivation of the CYP3A4 gene. Consistent with the hypothesis, fusion of the far module to the proximal promoter of CYP3A4 markedly increased rifampicin-induced reporter activity. The increase was synergistically enhanced when both the far and distal modules were fused to the proximal promoter. The increase, however, was significantly reduced when the F-ER6 was disrupted. Chromatin immunoprecipitation detected the presence of PXR in the far module. Interestingly, HNF-4alpha increased the activity of the distal-proximal fused promoter, but decreased the activity of the far-proximal fused promoter. Given the fact that induction of CYP3A4 represents an important detoxification mechanism, the functional redundancy and synergistic interaction in supporting PXR transactivation suggest that the far and distal modules ensure the induction of CYP3A4 during chemical insults. The difference in responding to HNF-4alpha suggests that the magnitude of the induction is under control through various transcriptional networks.

  11. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  12. Promoting regional energy co-operation in South Asia

    International Nuclear Information System (INIS)

    Srivastava, Leena; Misra, Neha

    2007-01-01

    Energy is a key ingredient of the socio-economic development of any region. South Asia is not only one of the fastest growing regions in the world; it is also one of the poorest, which thus puts energy at the very heart of the development process in the region. This paper looks at the challenges faced by the South Asia sub-region for economic co-operation (SASEC) comprised of Bangladesh, Bhutan, India and Nepal, and also at the role of greater regional energy co-operation therein. The region is characterized by pressures of growing economies and increasing population. While the per capita energy consumption is one of the lowest in the world, energy intensity continues to be very high. A large portion of the population lacks access to modern sources of energy and depends on traditional sources that are not only inefficient but also have severe health and environmental problems associated with them. Increasing oil import dependency and huge investment needs for energy market development pose a further challenge. The region has a good resource potential and tremendous scope for energy co-operation, which can play a key role in addressing many of these energy security concerns and in putting it on the path of sustainable development. It is ironic that the record in the area has been so limited and that too in the most basic form of co-operation, i.e. bilateral arrangements between countries. This paper puts forth a multi-pronged strategy for sub-regional energy co-operation encompassing softer options aimed at confidence building to more substantial and larger scale co-operation efforts. Delays in decision making to ensure stronger and mutually beneficial co-operation efforts are associated with high costs not only to the energy sector but also for the entire development agenda. With the precarious energy situation in the region and unprecedented increases in international oil prices seen in recent times, it is high time for policy makers, financing institutions, NGOs

  13. The Digital North Denmark Programme -Promoting Regional Change?

    DEFF Research Database (Denmark)

    Østergaard, Christian Richter

    2007-01-01

    The Digital North Denmark (DDN) was an IT programme running from 2000 to 2003 in the North Jutland County in Denmark with national government support of € 23 million. The Danish government initiated the programme with the aim of further strengthening regions with an already proven ICT capability...... (Dybkjær and Lindegaard, 1999, p.96-100). The declared approach was to build on the existing competencies in industry as well as at universities. The national government chose two regions – Ørestaden, a new concentration of knowledge-based institutions near Copenhagen Airport, and North Jutland......-offers within four themes. The participants - meant to be project consortia of ideally private firms, public or private organisations as well as regional and municipal government bodies - could get a maximum national government support of one third of the total project sum.This chapter investigates how...

  14. Proximal femoral fractures

    DEFF Research Database (Denmark)

    Palm, Henrik; Teixidor, Jordi

    2015-01-01

    searched the homepages of the national heath authorities and national orthopedic societies in West Europe and found 11 national or regional (in case of no national) guidelines including any type of proximal femoral fracture surgery. RESULTS: Pathway consensus is outspread (internal fixation for un...

  15. A new polymorphism in goat β-lactoglobulin promoter region

    Directory of Open Access Journals (Sweden)

    Mirella Graziano

    2003-01-01

    Full Text Available An individual variability in β-lactoglobulin content has been previously observed in Girgentana goat milk by HPLC analysis. To identify eventual mutations affecting the transcription level of the gene, the prooter region was characterized in goats showing an anomalous phenotype, consisting in a reduced content of β-lactoglobulin respect to α-lactoalbumine. A single nucleotide substitution not previously reported has been detected. A PCR-RFLP procedure was developed for fast detection of the mutation in different goat breeds: Girgentana, Garganica, Sarda, Alpine, Montefalcone and Saanen. The Montefalcone goat showed the highest frequency of the mutation, confirming one more the peculiarity of this breed.

  16. Graduate Management Project (GMP) Retrospective Analysis of Promotional Mediums for Tricare Prime in Tricare Region 11

    National Research Council Canada - National Science Library

    Carpenter, Steven

    1997-01-01

    This study provides retrospective market research information about the population who enrolled in TRICARE Prime in TRICARE Region 11 and the advertising mediums used to promote enrollment in the TRICARE Prime program...

  17. Microclones derived from the mouse chromosome 7 D-E bands map within the proximal region of the c14CoS deletion in albino mutant mice

    International Nuclear Information System (INIS)

    Toenjes, R.R.W.; Weith, A.; Rinchik, E.M.; Winking, H.; Carnwath, J.W.; Kaliner, B.; Paul, D.

    1991-01-01

    A group of radiation-induced perinatal-lethal deletions that include the albino (c) locus on mouse chromosome 7 causes failure of expression of various hepatocyte-specific genes when homozygous. The transcription of such genes could be controlled in trans by a regulatory gene(s) located within the proximal region of the C14CoS deletion. To identify this potential regulatory gene, a microclone library was established from microdissected D and E bands of chromosome 7. Three nonoverlapping microclones (E305, E336B, and E453B) hybridizing with wildtype but not with C14CoS/C14CoS DNA were isolated. E336B represents a single-copy DNA fragment, whereas E305 and E453B hybridized with 3 and 10 EcoRI DNA restriction fragments, respectively. All fragments map exclusively within the deletion. The microclones hybridized to DNA of viable C6H/C14CoS deletion heterozygotes but not to DNA of homozygotes for the lethal mutation c10R75M, which belongs to the same complementation group as c14CoS. DNA of viable homozygous mutant C62DSD, which carries a deletion breakpoint proximal to that of c6H, hybridized only with E453B. This microclone identified 6 EcoRI restriction fragments in C62DSD/C62DSD DNA. The results demonstrate that of the isolated microclones, E453B identifies a locus (D7RT453B) that maps closest to the hsdr-1 (hepatocyte-specific developmental regulation) locus, which maps between the proximal breakpoints of deletions c10R75M and c62DSD

  18. Active sales promotion in urban regions; Aktive Verkaufsfoerderung in Verdichtungsgebieten

    Energy Technology Data Exchange (ETDEWEB)

    Becker, H.D. [Oeffentlichkeitsarbeit, Maingas AG, Frankfurt am Main (Germany)

    1995-03-01

    The first step in any worthwhile marketing strategy for urban regions is to make a survey of all real estates without a gas supply. The data stock thus obtained serves as a short, medium, and long-term basis for all further activity. It cal be used to set up yearly personnel and activity plans. The activities are rounded off by incentives in the form of conversion aids or financing offers and additional measures presented within a Full Service Package Defining clear aims makes it easier to evaluate the success of the activities. (orig.) [Deutsch] Der erste Schritt zu einer erfolgreichen Marktbearbeitung in Verdichtungsgebieten ist die Erhebung aller Liegenschaften ohne Gasversorgung. Der gewonnene Datenbestand dient kurz-, mittel- und langfristig als Grundlage aller Aktivitaeten. Eine Personal- und Aktivitaetenplanung kann jaehrlich daraus abgeleitet werden. Kaufanreize in Form von Umstellhilfen, Finanzierungsangeboten und zusaetzlichen Dienstleistungen im Rahmen eines Full-Service-Angebotes runden die Aktivitaeten ab. Die klare Vorgabe von Zielen erleichert die Erfolgskontrolle. (orig.)

  19. Social Media Marketing as a tool for promoting the regional investment portals

    Directory of Open Access Journals (Sweden)

    Alisa Yu. Fadeyeva

    2016-01-01

    Full Text Available Objective to investigate the potential of Social Media Marketing as a tool for promoting regional investment portals in the information environment to identify the most effective ways of its implementation and to determine the level of mastering of this tool by the Russian regions. Methods general scientific methods observation comparison analysis induction deduction analogy classification. Results the analysis showed that today Social Media Marketing is an essential tool for interaction with the investment community and one of the most effective ways to promote the regional portal which allows to increase the knowledge of and loyalty to the brand to increase the targeted website traffic to increase the awareness of investors about the specific features of the portal and the regional development agenciesrsquo functioning to promptly receive information about the investment environment and to establish contacts with investors. At the same time the study of SMMactivity in the Russian regions revealed a very low level of quality of communication with investors through social networks. Scientific novelty for the first time the article investigates the significance and makes the comparative analysis of the Social Media Marketing channels with regard to investment promotion agencies as well as the results of the regional structures functioning for effective communication through social networks. Practical significance the main results of the research can be used by the regional investment agencies in order to promote their websites increase the quality of communication with investors and promote the investment attractiveness of the region as a whole. nbsp

  20. Genome-wide analysis of regions similar to promoters of histone genes

    KAUST Repository

    Chowdhary, Rajesh

    2010-05-28

    Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that

  1. Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C.

    Science.gov (United States)

    Hitrik, Anna; Popliker, Malka; Gancz, Dana; Mukamel, Zohar; Lifshitz, Aviezer; Schwartzman, Omer; Tanay, Amos; Gilboa, Lilach

    2016-11-01

    The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation.

  2. How to promote the regional cooperation in Asia

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Masayuki [International Affairs and Safeguards Division, Atomic Energy Bureau, Science and Technology Agency, Tokyo (Japan)

    2000-12-01

    The Tenth International Conference for Nuclear Cooperation in Asia was held in Tokyo on March 10, 1999. Representatives participated from Australia, China, Indonesia, Japan, Korea, Malaysia, the Philippines, Thailand, and Vietnam as well as IAEA as an observer. The countries reflected on the positive achievements of the past ten years and affirmed the major goals for the future, the major theme of the meeting being the evolution of the framework. Some typical cooperative activities have result in: (a) new varieties of plants with greater productivity under a range of environmental conditions (b) development and adoptions of improved analytical procedures to track air pollution in major cities where the identification of the major sources will facilitate remediation measures (c) coordinated trials for radiation therapy of cervical cancer and the development of rigorous protocols (d) training of staff in research reactor operation and in the use of research reactors for the study of new materials. The participating countries have committed to reviewing the six existing sub-categories, namely (1) utilization of research reactors, (2,3) application of radiation and radioisotope in the agriculture and the medical fields, (4) public acceptance of nuclear energy, (5) radioactive waste management, and (6) nuclear safety culture. To share knowledge on human resources development within the region and to consider measures for the further development of human resources in relevant fields, a seminar for human resources development, sponsored by Japan, will be held in Japan. The conference will be renamed as (Forum for Nuclear Cooperation in Asia) beginning with the next conference. The Forum for Nuclear Cooperation in Asia will be held in Japan and in a participating country other than Japan in alternating years. To enhance the regional nuclear cooperation activities under this framework, each participating country will register a Coordinator and Project Leaders to facilitate

  3. How to promote the regional cooperation in Asia

    International Nuclear Information System (INIS)

    Nakano, Masayuki

    2000-01-01

    The Tenth International Conference for Nuclear Cooperation in Asia was held in Tokyo on March 10, 1999. Representatives participated from Australia, China, Indonesia, Japan, Korea, Malaysia, the Philippines, Thailand, and Vietnam as well as IAEA as an observer. The countries reflected on the positive achievements of the past ten years and affirmed the major goals for the future, the major theme of the meeting being the evolution of the framework. Some typical cooperative activities have result in: (a) new varieties of plants with greater productivity under a range of environmental conditions (b) development and adoptions of improved analytical procedures to track air pollution in major cities where the identification of the major sources will facilitate remediation measures (c) coordinated trials for radiation therapy of cervical cancer and the development of rigorous protocols (d) training of staff in research reactor operation and in the use of research reactors for the study of new materials. The participating countries have committed to reviewing the six existing sub-categories, namely (1) utilization of research reactors, (2,3) application of radiation and radioisotope in the agriculture and the medical fields, (4) public acceptance of nuclear energy, (5) radioactive waste management, and (6) nuclear safety culture. To share knowledge on human resources development within the region and to consider measures for the further development of human resources in relevant fields, a seminar for human resources development, sponsored by Japan, will be held in Japan. The conference will be renamed as (Forum for Nuclear Cooperation in Asia) beginning with the next conference. The Forum for Nuclear Cooperation in Asia will be held in Japan and in a participating country other than Japan in alternating years. To enhance the regional nuclear cooperation activities under this framework, each participating country will register a Coordinator and Project Leaders to facilitate

  4. Importance of a distal proximal contact on load transfer by implant-supported single adjacent crowns in posterior region of the mandible: a photoelastic study

    Directory of Open Access Journals (Sweden)

    Fabio Afranio de Aguiar Junior

    2013-09-01

    Full Text Available OBJECTIVE: This study aimed to evaluate the importance of a distal proximal contact on the load transfer to the posterior region of the mandible by non-splinted adjacent implant-supported crowns using photoelastic stress analysis. MATERIAL AND METHODS: A rectangular model (68x30x15 mm was made of polymethylmethacrylate resin to simulate half of the mandibular arch. One model was completed with resin replicas representing the first premolar and second molar and with two 3.75 mm dia.x11 mm internal hexagon threaded implants replacing the second premolar and first molar. The other model was manufactured in the same way but without the second molar. Both models were duplicated using photoelastic resin. The roots of the teeth replicas were covered with a layer of polyether impression material to simulate the periodontal ligament. Two different vertical loads were applied to the crowns as follows: 1 - single static point load alternately applied to the crowns replacing the second premolar and first molar (50 N; 2 - simultaneous static point loads applied to both of the crowns replacing the second premolar and first molar (100 N. The resulting isochromatic fringe pattern in the photoelastic model was monitored and photographed. RESULTS: All loading conditions studied showed that the presence of the second molar has changed the load transmission and the pattern of stresses. CONCLUSION: Results showed that the presence of a second molar proximal contact can help minimize the stresses around the implants.

  5. Regional differences in gender promotion and scholarly productivity in otolaryngology.

    Science.gov (United States)

    Eloy, Jean Anderson; Mady, Leila J; Svider, Peter F; Mauro, Kevin M; Kalyoussef, Evelyne; Setzen, Michael; Baredes, Soly; Chandrasekhar, Sujana S

    2014-03-01

    To identify whether regional differences exist in gender disparities in scholarly productivity and faculty rank among academic otolaryngologists. Academic otolaryngologists' bibliometric data analyses. Online faculty listings from 98 otolaryngology departments were organized by gender, academic rank, fellowship training status, and institutional location. The Scopus database was used to assess bibliometrics of these otolaryngologists, including the h-index, number of publications, and publication experience. Analysis included 1127 otolaryngologists, 916 men (81.3%) and 211 women (18.7%). Female faculty comprised 15.4% in the Midwest, 18.8% in the Northeast, 21.3% in the South, and 19.0% in the West (P = .44). Overall, men obtained significantly higher senior academic ranks (associate professor or professor) compared to women (59.8% vs. 40.2%, P .05). Gender disparities in academic rank and scholarly productivity exist most notably in the Northeast, where women in otolaryngology are most underrepresented relative to men at senior academic ranks and in scholarly productivity.

  6. Regional patterns and proximal causes of the recent snowpack decline in the Rocky Mountains, U.S.

    Science.gov (United States)

    Pederson, Gregory T.; Betancourt, Julio L.; McCabe, Gregory J.

    2013-01-01

    We used a first-order, monthly snow model and observations to disentangle seasonal influences on 20th century,regional snowpack anomalies in the Rocky Mountains of western North America, where interannual variations in cool-season (November–March) temperatures are broadly synchronous, but precipitation is typically antiphased north to south and uncorrelated with temperature. Over the previous eight centuries, regional snowpack variability exhibits strong, decadally persistent north-south (N-S) antiphasing of snowpack anomalies. Contrary to the normal regional antiphasing, two intervals of spatially synchronized snow deficits were identified. Snow deficits shown during the 1930s were synchronized north-south by low cool-season precipitation, with spring warming (February–March) since the 1980s driving the majority of the recent synchronous snow declines, especially across the low to middle elevations. Spring warming strongly influenced low snowpacks in the north after 1958, but not in the south until after 1980. The post-1980, synchronous snow decline reduced snow cover at low to middle elevations by ~20% and partly explains earlier and reduced streamflow and both longer and more active fire seasons. Climatologies of Rocky Mountain snowpack are shown to be seasonally and regionally complex, with Pacific decadal variability positively reinforcing the anthropogenic warming trend.

  7. Multiple 5' ends of human cytomegalovirus UL57 transcripts identify a complex, cycloheximide-resistant promoter region that activates oriLyt

    International Nuclear Information System (INIS)

    Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.

    2003-01-01

    The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation

  8. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  9. Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

    Directory of Open Access Journals (Sweden)

    Carlos Guerrero-Bosagna

    2010-09-01

    Full Text Available Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a was found to be due to a copy number variation (CNV and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.

  10. Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

    Science.gov (United States)

    Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K

    2010-09-30

    Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.

  11. Microdeletion/microduplication of proximal 15q11.2 between BP1 and BP2: a susceptibility region for neurological dysfunction including developmental and language delay.

    Science.gov (United States)

    Burnside, Rachel D; Pasion, Romela; Mikhail, Fady M; Carroll, Andrew J; Robin, Nathaniel H; Youngs, Erin L; Gadi, Inder K; Keitges, Elizabeth; Jaswaney, Vikram L; Papenhausen, Peter R; Potluri, Venkateswara R; Risheg, Hiba; Rush, Brooke; Smith, Janice L; Schwartz, Stuart; Tepperberg, James H; Butler, Merlin G

    2011-10-01

    The proximal long arm of chromosome 15 has segmental duplications located at breakpoints BP1-BP5 that mediate the generation of NAHR-related microdeletions and microduplications. The classical Prader-Willi/Angelman syndrome deletion is flanked by either of the proximal BP1 or BP2 breakpoints and the distal BP3 breakpoint. The larger Type I deletions are flanked by BP1 and BP3 in both Prader-Willi and Angelman syndrome subjects. Those with this deletion are reported to have a more severe phenotype than individuals with either Type II deletions (BP2-BP3) or uniparental disomy 15. The BP1-BP2 region spans approximately 500 kb and contains four evolutionarily conserved genes that are not imprinted. Reports of mutations or disturbed expression of these genes appear to impact behavioral and neurological function in affected individuals. Recently, reports of deletions and duplications flanked by BP1 and BP2 suggest an association with speech and motor delays, behavioral problems, seizures, and autism. We present a large cohort of subjects with copy number alteration of BP1 to BP2 with common phenotypic features. These include autism, developmental delay, motor and language delays, and behavioral problems, which were present in both cytogenetic groups. Parental studies demonstrated phenotypically normal carriers in several instances, and mildly affected carriers in others, complicating phenotypic association and/or causality. Possible explanations for these results include reduced penetrance, altered gene dosage on a particular genetic background, or a susceptibility region as reported for other areas of the genome implicated in autism and behavior disturbances.

  12. Identification of functional DNA variants in the constitutive promoter region of MDM2

    Directory of Open Access Journals (Sweden)

    Lalonde Marie-Eve

    2012-09-01

    Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.

  13. Growing Significance of EU Institutions in Promotion of Inter-regional policies

    Directory of Open Access Journals (Sweden)

    Ella V. Ermakova

    2014-01-01

    Full Text Available The article explores the variety of tools and vehicles applied within the EU to expand the prerogative of the regions of the EU member states. The author uses as an example the inter-regional policies in Belgium in respect of the Flemish Region and the Walloon Region. The author analyzes the mechanisms of promotion of external regional relations in Belgium as a means of addressing different problems both on national and all-European level, supporting the arguments and conclusions by examples of relevant EU initiatives. The article details the activities of the EU Regional Committee (RC, the EU advisory body with the powers of political initiative, upholding the principle ofsubsidarity in the implementation of the EU member states' regional policies. The involvement of the Flemish Region and the Walloon Region in the activities of EU RC is described and summarized. As a case study, the article deals with Belgium's rotating six months presidency in the EUin 2010 when the country, which was going through a severe political crisis with no federal government in place, was represented by the two regions. The special focus of the article is on the strategic EU program "Europe2020" and its implementation by the regions of Belgium. There is an account of the initiatives undertaken by the Flemish Region and the Walloon Region within the framework of this program outlining the interaction of the two regions. The author provides a comprehensive analysis of the involvement of the Flemish Region and the Walloon Region with various EU institutions describing how each party achieves the promotion of its regional interests. Within this context, it is a noteworthy development that the Flemish Region is participating in the international program "Pact 2020" on energy all by its own. The article features quotations by Flemish and Walloon political figures which serve as an illustration of the prevailing attitudes in the Belgian society to the process of

  14. Does FDI promote regional development? Evidence from local and regional productivity spillovers in Greece

    Directory of Open Access Journals (Sweden)

    Vassilis MONASTIRIOTIS

    2010-12-01

    Full Text Available Studies on the productivity spillovers of FDI have concentrated on the nationalsectoral level. As a result, little is known about the impact of FDI on absolute and relative regional economic performance. In this paper we examine this issue by relying on a unique dataset of over 20,000 Greek firms for the period 2002-2006 covering all sectors of economic activity. We examine the spatial distribution of foreign-owned firms in the country and analyse the effect that their presence – at the local, regional and national levels – has on the productivity of domestic firms. We find strong evidence suggesting that foreignowned firms self-select into regions and sectors of high productivity. Net of this selection effect, the impact of foreign presence on domestic productivity is negative – although at the very local level some positive spillover effects are identifiable. The bulk of the effects concentrate in non-manufacturing activities, high-tech sectors, and medium-sized high-productivity firms. Importantly, this effect is not constant across space however. Productivity spillovers tend to be negative in the regions hosting the main urban areas in the country but positive in smaller and more peripheral regions. In this way, despite the tendency of FDI to concentrate in a limited number of areas within the country – those of the highest level of development – the externalities that FDI activity generates to the local economies appear to be of a rather equilibrating character.

  15. Proximal femoral fractures.

    Science.gov (United States)

    Webb, Lawrence X

    2002-01-01

    Fractures of the proximal femur include fractures of the head, neck, intertrochanteric, and subtrochanteric regions. Head fractures commonly accompany dislocations. Neck fractures and intertrochanteric fractures occur with greatest frequency in elderly patients with a low bone mineral density and are produced by low-energy mechanisms. Subtrochanteric fractures occur in a predominantly strong cortical osseous region which is exposed to large compressive stresses. Implants used to address these fractures must be able to accommodate significant loads while the fractures consolidate. Complications secondary to these injuries produce significant morbidity and include infection, nonunion, malunion, decubitus ulcers, fat emboli, deep venous thrombosis, pulmonary embolus, pneumonia, myocardial infarction, stroke, and death.

  16. Functional, non-clonal IgMa-restricted B cell receptor interactions with the HIV-1 envelope gp41 membrane proximal external region.

    Directory of Open Access Journals (Sweden)

    Laurent Verkoczy

    Full Text Available The membrane proximal external region (MPER of HIV-1 gp41 has several features that make it an attractive antibody-based vaccine target, but eliciting an effective gp41 MPER-specific protective antibody response remains elusive. One fundamental issue is whether the failure to make gp41 MPER-specific broadly neutralizing antibodies like 2F5 and 4E10 is due to structural constraints with the gp41 MPER, or alternatively, if gp41 MPER epitope-specific B cells are lost to immunological tolerance. An equally important question is how B cells interact with, and respond to, the gp41 MPER epitope, including whether they engage this epitope in a non-canonical manner i.e., by non-paratopic recognition via B cell receptors (BCR. To begin understanding how B cells engage the gp41 MPER, we characterized B cell-gp41 MPER interactions in BALB/c and C57BL/6 mice. Surprisingly, we found that a significant (approximately 7% fraction of splenic B cells from BALB/c, but not C57BL/6 mice, bound the gp41 MPER via their BCRs. This strain-specific binding was concentrated in IgM(hi subsets, including marginal zone and peritoneal B1 B cells, and correlated with enriched fractions (approximately 15% of gp41 MPER-specific IgM secreted by in vitro-activated splenic B cells. Analysis of Igh(a (BALB/c and Igh(b (C57BL/6 congenic mice demonstrated that gp41 MPER binding was controlled by determinants of the Igh(a locus. Mapping of MPER gp41 interactions with IgM(a identified MPER residues distinct from those to which mAb 2F5 binds and demonstrated the requirement of Fc C(H regions. Importantly, gp41 MPER ligation produced detectable BCR-proximal signaling events, suggesting that interactions between gp41 MPER and IgM(a determinants may elicit partial B cell activation. These data suggest that low avidity, non-paratopic interactions between the gp41 MPER and membrane Ig on naïve B cells may interfere with or divert bnAb responses.

  17. Role of regional policies in promoting networking and innovation activity of firms

    OpenAIRE

    Kirsi Mukkala; Jari Ritsilä

    2004-01-01

    The success of firms and regions is increasingly defined by their innovation and learning capabilities. It has been emphasized in several studies that a local operational environment may have a positive impact on innovation activity of firms. From policy point of view, the relationship between firms and their local environment is an important research topic. The purpose of this paper is to explore whether there is a demand for regional policy makers in promoting innovative and networking acti...

  18. Characterization of the promoter region of the human c-erbB-2 protooncogene

    International Nuclear Information System (INIS)

    Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.

    1987-01-01

    Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors

  19. A study of the frequency of methylation of gene promoter regions in ...

    Indian Academy of Sciences (India)

    2013-04-02

    Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.

  20. Cytosine deletion at AP2-box region of HSP70 promoter and its ...

    Indian Academy of Sciences (India)

    Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...

  1. Identification and characterization of a liver stage-specific promoter region of the malaria parasite Plasmodium.

    Directory of Open Access Journals (Sweden)

    Susanne Helm

    Full Text Available During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE. Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and

  2. Clinical significance of promoter region hypermethylation of microRNA-148a in gastrointestinal cancers

    Directory of Open Access Journals (Sweden)

    Sun JX

    2014-05-01

    Full Text Available Jingxu Sun,1,* Yongxi Song,1,* Zhenning Wang,1 Guoli Wang,2 Peng Gao,1 Xiaowan Chen,1 Zhaohua Gao,1 Huimian Xu1 1Department of Surgical Oncology and General Surgery, First Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Biochemistry and Molecular Biology, China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: MicroRNAs are associated with tumor genesis and progression in various carcinomas. MicroRNA-148a (miR-148a was reported to have low expression in gastrointestinal cancers, and might be regulated by promoter region DNA methylation. Methods: Bisulfite-modified sequencing was used to determine the promoter region DNA methylation status of human gastrointestinal cancer cell lines. Expression levels of miR-148a in cell lines treated with 5-aza-2′-deoxycytidine were determined by quantitative real-time polymerase chain reaction. Total DNA was extracted from the tissues of 64 patients with gastric cancer and 51 patients with colorectal cancer. Methylation status was determined by methylation-specific polymerase chain reaction. All statistical analyses were performed with SPSS 17.0 software. Results: The promoter regions of genes in human gastrointestinal cancer cell lines were all hypermethylated, except for HT-29, and the expression of miR-148a tended to be higher than in controls after treatment with 5-aza-2′-deoxycytidine. The methylation-specific polymerase chain reaction results showed that 56.25% of gastric cancer tissues and 19.61% of colorectal cancer tissues were hypermethylated. A strong correlation was found between the expression of miR-148a and the methylation status of promoter regions (P<0.001, chi-square test and Pearson’s correlation. Furthermore, promoter region CpG site hypermethylation of miR-148a was correlated with increased tumor size (P=0.01 in gastric cancer after analyzing the correlation between

  3. The system of Regional Contact Offices for promoting GMES services and the use of Space Technologies in European Regions.

    Science.gov (United States)

    Carrara, Paola; Antoninetti, Massimo; Bacai, Hina; Basoni, Anna; Bosc, Christelle; Clave, Magali; Cornacchia, Carmela; L'Astorina, Alba; Monbet, Philippe; Mueller, Bastian; Nicolau, Sonia; Pergola, Nicola; Rampini, Anna; Tramutoli, Valerio; Schumacher, Volker; Wells, Alan; Zepeda Juarez, Jesus; Zolotikova, Svetlana

    2013-04-01

    which have significant impact on the economy, environment and the quality of life of the citizens To this aim since 2011 the system of Regional Contact Offices (RCOs) was promoted by the EU FP7 DORIS_Net (Downsteam Observatory organized by Regions Active in Space - Network, http://www.doris-net.eu/) project as the regional link to the services provided by the European GMES programme. Since then a first nucleus of 12 pilot European Regions were working together establishing 6 first RCOs around Europe. This paper will present RCOs network goals, achievements and perspectives as well as its planned actions devoted to improve quality of Space Technology products from one side, to promote awareness and use of them by potential end-users (and particularly LRAs), from the other side.

  4. Membrane proximal external region of gp41 from HIV-1 strains HXB2 and JRFL has different sensitivity to alanine mutation

    Science.gov (United States)

    Yi, Hyun Ah; Diaz-Rohrer, Barbara; Saminathan, Priyanka; Jacobs, Amy

    2015-01-01

    The transmembrane subunit (gp41) of the HIV envelope protein complex (Env) mediates the viral fusion step of HIV entry. The membrane-proximal external region (MPER), one of the functional domains of gp41, has been the focus of a great deal of research because it is a target for neutralizing antibodies. In this study, we examined 23 amino acid residues in MPER (660-683) in both a CXCR4 co-receptor utilizing strain (HXB2) and a CCR5 utilizing strain (JRFL) by alanine scanning mutagenesis. Despite the high degree of gp41 sequence conservation, the effects of alanine mutation in the MPER were different between the two strains. Most mutations in HXB2 had fusogenicity and protein expression levels not less than 50% of wild type in the case of cell-cell fusion. However, about thirty percent of the mutants in HXB2 showed a severe defect in fusogenicity in viral entry. Mutations in the MPER of strain JRFL had more dramatic effects than HXB2 in cell-cell fusion and viral entry. The fact that there are large differences in the effects of mutation between two strains suggests the potential for MPER interaction with non-conserved sequences such as the fusion peptide and/or other NHR domains as well as potential long-range structural effects on the conformational changes that occur with the Env complex during membrane fusion. PMID:25649507

  5. DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.

    Directory of Open Access Journals (Sweden)

    Mads Dyrvig

    Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.

  6. A composite method based on formal grammar and DNA structural features in detecting human polymerase II promoter region.

    Directory of Open Access Journals (Sweden)

    Sutapa Datta

    Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.

  7. A Composite Method Based on Formal Grammar and DNA Structural Features in Detecting Human Polymerase II Promoter Region

    Science.gov (United States)

    Datta, Sutapa; Mukhopadhyay, Subhasis

    2013-01-01

    An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045

  8. Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.

    Science.gov (United States)

    Ogino; Itakura; Kato; Aoki; Sato

    1999-07-01

    : Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but

  9. Regional Cooperation Efforts in the Mekong River Basin: Mitigating river-related security threats and promoting regional development

    Directory of Open Access Journals (Sweden)

    Susanne Schmeier

    2009-01-01

    Full Text Available The development of international rivers is often perceived as leading to conflicts or even water wars. However, as the development of the Mekong River shows, cooperation has not only prevailed in the last decades, but River Basin Organizations (RBOs, established to mitigate river-related conflicts and/or develop the river basin, have also contributed to the emergence of more general cooperation structures, mainly by creating spill-over effects in other issue-areas, bringing cooperation to policy fields beyond the river itself. This article assesses the contribution of the Mekong River Commission (MRC and the Greater Mekong Sub-Region (GMS to the sustainable development of the Mekong Region as well as to the promotion of regional cooperation in mainland South-East Asia in general. --- Die Entwicklung grenzüberschreitender Flüsse wird oft mit Konflikten oder gar Kriegen um Wasser assoziiert. Wie jedoch die Entwicklung im Mekong-Becken zeigt, waren die vergangenen Jahrzehnte nicht nur von Kooperation gezeichnet, sondern Flussbeckenorganisationen konnten außerdem dazu beitragen, weitreichendere Kooperationsstrukturen zu entwickeln, die sich auf andere Politikfelder ausdehnen. Dieser Artikel beschäftigt sich mit dem Beitrag der Mekong River Commission (MRC und der Greater Mekong Sub-Region (GMS zur nachhaltigen Entwicklung in der Mekong Region sowie zur Förderung allgemeiner regionaler Kooperation im Festländischen Südostasien.

  10. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.

    2013-02-19

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

  11. Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze

    Directory of Open Access Journals (Sweden)

    Bekier-Jaworska Ewa

    2015-03-01

    Full Text Available Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and methods. Studies were conducted on a group of students studying tourism and recreation at State Higher School of Vocational Education (PWSZ in Zamość using a questionnaire. Results. The questionnaire provided an assessment of the levels of knowledge of regional cuisine among Polish and Ukrainian students, identified the most characteristic dishes and selected brand products, and helped to arrive at a suitable method of promotion. Conclusions. Nationality, family customs and selection of local restaurants highly influence knowledge of regional cuisine. Interviewees decided that the most outstanding products from Roztocze were Zwierzyniec beer, and Biłgoraj pie. Regional products should be used as a tourist attraction in Roztocze.

  12. Tumour MLH1 promoter region methylation testing is an effective prescreen for Lynch Syndrome (HNPCC).

    Science.gov (United States)

    Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G

    2014-12-01

    Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  13. Calreticulin discriminates the proximal region at the N-glycosylation site of Glc1Man9GlcNAc2 ligand

    Energy Technology Data Exchange (ETDEWEB)

    Hirano, Makoto; Adachi, Yuka [Department of Materials and Life Science, Seikei University, 3-3-1 Kichijoji-kita, Musashino, Tokyo 180-8633 (Japan); Ito, Yukishige [Synthetic Cellular Chemistry Laboratory, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); ERATO, Japan Science and Technology Agency, Ito Glycotrilogy Project, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Totani, Kiichiro, E-mail: ktotani@st.seikei.ac.jp [Department of Materials and Life Science, Seikei University, 3-3-1 Kichijoji-kita, Musashino, Tokyo 180-8633 (Japan)

    2015-10-23

    Calreticulin (CRT) is well known as a lectin-like chaperone that recognizes Glc1Man9GlcNAc2 (G1M9)-glycoproteins in the endoplasmic reticulum (ER). However, whether CRT can directly interact with the aglycone moiety (protein portion) of the glycoprotein remains controversial. To improve our understanding of CRT interactions, structure-defined G1M9-derivatives with different aglycones (–OH, –Gly–NH{sub 2}, and –Gly–Glu–{sup t}Bu) were used as CRT ligands, and their interactions with recombinant CRT were analyzed using thermal shift analysis. The results showed that CRT binds strongly to a G1M9-ligand in the order –Gly–Glu–{sup t}Bu > –Gly–NH{sub 2} > –OH, which is the same as that of the reglucosylation of Man9GlcNAc2 (M9)-derivatives by the folding sensor enzyme UGGT (UDP-glucose: glycoprotein glucosyltransferase). Our results indicate that, similar to UGGT, CRT discriminates the proximal region at the N-glycosylation site, suggesting a similar mechanism mediating the recognition of aglycone moieties in the ER glycoprotein quality control system. - Highlights: • Glc1Man9GlcNAc2 (G1M9) ligands with different aglycones were chemically prepared. • Calreticulin (CRT) discriminates the aglycone of Glc1Man9GlcNAc2 (G1M9) ligand. • CRT binds with G1M9 ligands in a similar manner to folding sensor enzyme.

  14. Genome-wide function of H2B ubiquitylation in promoter and genic regions.

    Science.gov (United States)

    Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin

    2011-11-01

    Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).

  15. Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer

    Directory of Open Access Journals (Sweden)

    Jae Sook Sung

    2012-09-01

    Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.

  16. Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration

    Science.gov (United States)

    Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

    2015-01-01

    Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832

  17. A protein binding AT-rich sequence in the soybean leghemoglobin c3 promoter is a general cis element that requires proximal DNA elements to stimulate transcription

    DEFF Research Database (Denmark)

    Laursen, N B; Larsen, K; Knudsen, J Y

    1994-01-01

    in combination with other trans-acting factor(s) to increase expression. The finding of NAT2-like binding activities in different plant organs and the specific expression of the hybrid NAT2 BS1/-312 rbcS-8B promoter in leaves suggest that NAT2 is a general activator of transcription. Udgivelsesdato: 1994-May...

  18. Governmental promotion of the Information Society in the Spanish Region of Valencia

    Directory of Open Access Journals (Sweden)

    Emilio Feliu-García, Ph.D.

    2011-01-01

    Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.

  19. The promotion of regional integration of electricity markets: Lessons for developing countries

    International Nuclear Information System (INIS)

    Oseni, Musiliu O.; Pollitt, Michael G.

    2016-01-01

    This paper focuses on how to promote regional cooperation in electricity. We begin by discussing the theory of international trade cooperation in electricity, with a view to discussing what preconditions might be important in facilitating wide area trading across national borders. We then develop lessons based on the comparison of four case studies. These include three regional developing country power pools – the Southern African Power pool (SAPP), West African Power pool (WAPP) and the Central American Power Market (MER). We contrast these with Northern Europe's Nord Pool. These cases highlight both the potential and difficulty of having cross-jurisdictional power pools. In the light of the theory and evidence we present, we draw key lessons in the areas of: preconditions for trading; necessary institutional arrangements; practicalities of timetabling; reasons to be hopeful about future prospects. - Highlights: • This paper focuses on how to promote regional electricity cooperation. • We develop lessons based on comparison of four international case studies. • The cases highlight both the potential and difficulty of power pools. • We identify preconditions, institutional arrangements and timetabling. • We conclude that the future prospects for regional power pools are good.

  20. Quantifying Surface Coal-Mining Patterns to Promote Regional Sustainability in Ordos, Inner Mongolia

    Directory of Open Access Journals (Sweden)

    Xiaoji Zeng

    2018-04-01

    Full Text Available Ordos became the new “coal capital” of China within a few decades since the country’s economic reform in 1978, as large-scale surface coal mining dramatically propelled its per capita GDP from being one of the lowest to one of the highest in China, exceeding Hong Kong in 2009. Surface coal-mining areas (SCMAs have continued to expand in this region during recent decades, resulting in serious environmental and socioeconomic consequences. To understand these impacts and promote regional sustainability, quantifying the spatiotemporal patterns of SCMAs is urgently needed. Thus, the main objectives of this study were to quantify the spatiotemporal patterns of SCMAs in the Ordos region from 1990 to 2015, and to examine some of the major environmental and socioeconomic impacts in the study region. We extracted the SCMAs using remote-sensing data, and then quantified their spatiotemporal patterns using landscape metrics. The loss of natural habitat and several socioeconomic indicators were examined in relation to surface coal mining. Our results show that the area of SCMAs increased from 7.12 km2 to 355.95 km2, an increase of nearly 49 times from 1990 to 2015 in the Ordos region. The number of SCMAs in this region increased from 82 to 651, a nearly seven-fold increase. In particular, Zhungeer banner (an administrative division, Yijinhuoluo banner, Dongsheng District and Dalate banner in the north-eastern part of the Ordos region had higher growth rates of SCMAs. The income gap between urban and rural residents increased along with the growth in SCMAs, undermining social equity in the Ordos region. Moreover, the rapid increase in SCMAs resulted in natural habitat loss (including grasslands, forests, and deserts across this region. Thus, we suggest that regional sustainability in Ordos needs to emphasize effective measures to curb large-scale surface coal mining in order to reduce the urban–rural income gap, and to restore degraded natural

  1. The fusion loops and membrane proximal region of Epstein-Barr virus glycoprotein B (gB) can function in the context of herpes simplex virus 1 gB when substituted individually but not in combination.

    Science.gov (United States)

    Zago, Anna; Connolly, Sarah A; Spear, Patricia G; Longnecker, Richard

    2013-01-01

    Among the herpesvirus glycoprotein B (gB) fusion proteins, the hydrophobic content of fusion loops and membrane proximal regions (MPRs) are inversely correlated with each other. We examined the functional importance of the hydrophobicity of these regions by replacing them in herpes simplex virus type 1 gB with corresponding regions from Epstein-Barr virus gB. We show that fusion activity is dependent on the structural context in which the specific loops and MPR sequences exist, rather than a simple hydrophobic relationship. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Boundary Dpp promotes growth of medial and lateral regions of the Drosophila wing.

    Science.gov (United States)

    Barrio, Lara; Milán, Marco

    2017-07-04

    The gradient of Decapentaplegic (Dpp) in the Drosophila wing has served as a paradigm to characterize the role of morphogens in regulating patterning. However, the role of this gradient in regulating tissue size is a topic of intense debate as proliferative growth is homogenous. Here, we combined the Gal4/UAS system and a temperature-sensitive Gal80 molecule to induce RNAi-mediated depletion of dpp and characterise the spatial and temporal requirement of Dpp in promoting growth. We show that Dpp emanating from the AP compartment boundary is required throughout development to promote growth by regulating cell proliferation and tissue size. Dpp regulates growth and proliferation rates equally in central and lateral regions of the developing wing appendage and reduced levels of Dpp affects similarly the width and length of the resulting wing. We also present evidence supporting the proposal that graded activity of Dpp is not an absolute requirement for wing growth.

  3. Association between VNTR polymorphism in promoter region of prodynorphin (PDYN) gene and heroin dependence.

    Science.gov (United States)

    Saify, Khyber; Saadat, Iraj; Saadat, Mostafa

    2014-11-30

    Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  4. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  5. The Flavonoid Apigenin Ameliorates Cisplatin-Induced Nephrotoxicity through Reduction of p53 Activation and Promotion of PI3K/Akt Pathway in Human Renal Proximal Tubular Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Sung Min Ju

    2015-01-01

    Full Text Available Apigenin is a member of the flavone subclass of flavonoids present in fruits and vegetables. Apigenin has long been considered to have various biological activities, such as antioxidant, anti-inflammatory, and antitumorigenic properties, in various cell types. Cisplatin was known to exhibit cytotoxic effect to renal cells by inducing apoptosis through activation of p53. The present study investigated the antiapoptotic effects of apigenin on the cisplatin-treated human renal proximal tubular epithelial (HK-2 cells. HK-2 cells were pretreated with apigenin (5, 10, 20 μM for 1 h and then treated with 40 μM cisplatin for various times. Apigenin inhibited the cisplatin-induced apoptosis of HK-2 cells. Interestingly, apigenin itself exerted cytostatic activity because of its ability to induce cell cycle arrest. Apigenin inhibited caspase-3 activity and PARP cleavage in cisplatin-treated cells. Apigenin reduced cisplatin-induced phosphorylation and expression of p53, with no significant influence on production of ROS that is known to induce p53 activation. Furthermore, apigenin promoted cisplatin-induced Akt phosphorylation, suggesting that enhanced Akt activation may be involved in cytoprotection. Taken together, these results suggest that apigenin ameliorates cisplatin-induced apoptosis through reduction of p53 activation and promotion of PI3K/Akt pathway in HK-2 cells.

  6. The role of COMESA in promoting intra-regional agricultural trade: Case study of Sudan

    Directory of Open Access Journals (Sweden)

    Azharia Abdelbagi Elbushra

    2011-06-01

    Full Text Available African countries have created many regional trade agreements with the economic objectives of reducing trade barriers and encouraging economic growth. The COMESA is an example of regional integration singed on 1993 by 19 African countries including Sudan. COMESA represents a chance for member countries to enhance their economic and social relations through increasing intra-trade. The objective of this paper is to assess the role of COMESA in promoting intra-regional agricultural trade between Sudan and COMESA countries. A multi-market model with Armington non-linear specification was applied. The paper results showed that there is a great potential for Sudan to increase its agricultural exports to other COMESA countries. The domestic agricultural markets are expected to be hampered by imports surge and increase in competition, while the producers of agricultural export commodities will be better off. In order to compete and benefit from potential in the COMESA markets, the paper recommended improving efficiency in the Sudanese agricultural sector through increasing productivity, lowering cost of production, enhancing marketing services, attaining economies of scale and attracting foreign investment.

  7. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  8. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  9. Evidence of young, proximal and primary (YPP diamond source occurring in alluviums in the Santo Antônio do Bonito, Santo Inácio and Douradinho rivers in Coromandel region, Minas Gerais

    Directory of Open Access Journals (Sweden)

    Rogério Silvestre Pereira

    Full Text Available ABSTRACT: Magmatism associated with the Alto Paranaíba structural high comprises kimberlites, kamafugites, and alkaline complexes, forming an approximately 400 x 150 km NW-SE belt in the southern São Francisco Craton. Dating of some intrusions reveals ages between 120 and 75 Ma. Chemical analyses of garnet recovered in alluvium from traditional diamond digging areas indicate peridotitic garnet windows in Três Ranchos and Coromandel. Six hundred and eighty (680 diamonds acquired or recovered during mineral exploration in the digging areas of Romaria, Estrela do Sul, Três Ranchos and Coromandel show unique characteristics, certain populations indicating young, proximal and primary sources (YPP. Analyses of 201 stones from Santo Antônio do Bonito, Santo Inácio and Douradinho rivers alluvium, Coromandel, present no evidence of transport, characterizing a proximal source. Within these river basins, exposures of the Late Cretaceous Capacete Formation basal conglomerate contain mainly small rounded and/or angular quartzite pebbles and of basic and ultrabasic rocks, as well as kimberlite minerals (garnet, ilmenite, spinel, sometimes diamond. A magnetotelluric profile between the Paraná and Sanfranciscana basins shows that the thick underlying lithosphere in the Coromandel region coincides with the peridotitic garnet window and with a diamond population displaying proximal source characteristics. Diamond-bearing kimberlite intrusions occur in different areas of Alto Paranaíba.

  10. Proximity credentials: A survey

    International Nuclear Information System (INIS)

    Wright, L.J.

    1987-04-01

    Credentials as a means of identifying individuals have traditionally been a photo badge and more recently, the coded credential. Another type of badge, the proximity credential, is making inroads in the personnel identification field. This badge can be read from a distance instead of being veiewed by a guard or inserted into a reading device. This report reviews proximity credentials, identifies the companies marketing or developing proximity credentials, and describes their respective credentials. 3 tabs

  11. Allelic polymorphisms in the repeat and promoter regions of the interleukin-4 gene and malaria severity in Ghanaian children

    DEFF Research Database (Denmark)

    Gyan, B A; Goka, B; Cvetkovic, J T

    2004-01-01

    Immunoglobulin E has been associated with severe malaria suggesting a regulatory role for interleukin (IL)-4 and/or IgE in the pathogenesis of severe malaria. We have investigated possible associations between polymorphisms in the IL-4 repeat region (intron 3) and promoter regions (IL-4 +33CT and...

  12. Proximal Probes Facility

    Data.gov (United States)

    Federal Laboratory Consortium — The Proximal Probes Facility consists of laboratories for microscopy, spectroscopy, and probing of nanostructured materials and their functional properties. At the...

  13. Identification of a single-nucleotide insertion in the promoter region affecting the sodC promoter activity in Brucella neotomae.

    Directory of Open Access Journals (Sweden)

    Dina A Moustafa

    Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.

  14. Assessing the effects of data selection and representation on the development of reliable E. coli sigma 70 promoter region predictors.

    Directory of Open Access Journals (Sweden)

    Mostafa M Abbas

    Full Text Available As the number of sequenced bacterial genomes increases, the need for rapid and reliable tools for the annotation of functional elements (e.g., transcriptional regulatory elements becomes more desirable. Promoters are the key regulatory elements, which recruit the transcriptional machinery through binding to a variety of regulatory proteins (known as sigma factors. The identification of the promoter regions is very challenging because these regions do not adhere to specific sequence patterns or motifs and are difficult to determine experimentally. Machine learning represents a promising and cost-effective approach for computational identification of prokaryotic promoter regions. However, the quality of the predictors depends on several factors including: i training data; ii data representation; iii classification algorithms; iv evaluation procedures. In this work, we create several variants of E. coli promoter data sets and utilize them to experimentally examine the effect of these factors on the predictive performance of E. coli σ70 promoter models. Our results suggest that under some combinations of the first three criteria, a prediction model might perform very well on cross-validation experiments while its performance on independent test data is drastically very poor. This emphasizes the importance of evaluating promoter region predictors using independent test data, which corrects for the over-optimistic performance that might be estimated using the cross-validation procedure. Our analysis of the tested models shows that good prediction models often perform well despite how the non-promoter data was obtained. On the other hand, poor prediction models seems to be more sensitive to the choice of non-promoter sequences. Interestingly, the best performing sequence-based classifiers outperform the best performing structure-based classifiers on both cross-validation and independent test performance evaluation experiments. Finally, we propose a

  15. Public health and health promotion capacity at national and regional level: a review of conceptual frameworks

    Directory of Open Access Journals (Sweden)

    Christoph Aluttis

    2014-04-01

    Full Text Available The concept of capacity building for public health has gained much attention during the last decade. National as well as international organizations increasingly focus their efforts on capacity building to improve performance in the health sector. During the past two decades, a variety of conceptual frameworks have been developed which describe relevant dimensions for public health capacity. Notably, these frameworks differ in design and conceptualization. This paper therefore reviews the existing conceptual frameworks and integrates them into one framework, which contains the most relevant dimensions for public health capacity at the country or regional level. A comprehensive literature search was performed to identify frameworks addressing public health capacity building at the national or regional level. We content-analysed these frameworks to identify the core dimensions of public health capacity. The dimensions were subsequently synthesized into a set of thematic areas to construct a conceptual framework which describes the most relevant dimensions for capacities at the national or regional level. The systematic review resulted in the identification of seven core domains for public health capacity: resources, organizational structures, workforce, partnerships, leadership and governance, knowledge development and country specific context. Accordingly, these dimensions were used to construct a framework, which describes these core domains more in detail. Our research shows that although there is no generally agreed upon model of public health capacity, a number of key domains for public health and health promotion capacity are consistently recurring in existing frameworks, regardless of their geographical location or thematic area. As only little work on the core concepts of public health capacities has yet taken place, this study adds value to the discourse by identifying these consistencies across existing frameworks and by synthesising

  16. Mutational analysis of the promoter and the coding region of the 5-HT1A gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others

    1994-09-01

    Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.

  17. Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

    International Nuclear Information System (INIS)

    Cui Wei; Yin Lingling; Dong Lingyue

    2012-01-01

    Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)

  18. Selection for Unequal Densities of Sigma70 Promoter-like Signalsin Different Regions of Large Bacterial Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio

    2006-03-01

    The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential

  19. Two negative cis-regulatory regions involved in fruit-specific promoter activity from watermelon (Citrullus vulgaris S.).

    Science.gov (United States)

    Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei

    2009-01-01

    A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.

  20. Geoheritage promotion of Thonon-les-Bains (Fr) region by the development of a geotourism product

    Science.gov (United States)

    Fanguin, Pauline

    2014-05-01

    Since 2012, the Chablais region (only in France) has acquired the Geopark label. This Geopark contributes to sustainable economic development of the region through geotourism. Moreover, the three Chablais (figure 1) are concerned by an Interreg IV program since 2009 (program of cooperation between European countries). The main objective of this program is to enhance the heritage resources (nature, culture and lifestyle of the region) (www.interreg-francesuisse.org). Therefore, the geotourism offer in this area just waiting to expand. The geodidactics models like the simplification of the scientific content are essential for geoheritage promotion, because this content must be available to a wide audience, allowing thereby the geoheritage recognition. The geotourism permits to apply different models (Cayla et al. 2010, Sellier, 2009) through a wide range of geotourism products, like guide, educational panels, thematic hikes and recently developed, new medias (website, smartphone applications). A geotourism product is based on four areas of questioning and was developed by Martin et al. (2010): (1) site (choice of sites to be valued), (2) public (a family public, good example of heterogeneous public), (3) contents (reasoning on geodidactics models) and (4) support (smartphone application). These four areas are very fundamental before the creation of any geotourism product. These reflexions aim to obtain a mediation product that integrates into geotourism offer of a region and contributes to its development and meets public expectations. New media, such as digital media - smartphone, tablets, website - become geotourism products more and more attractive. In addition, the necessary technologies to develop new media help to integrate a high interactivity potential with the public and thus get their attention. The architecture of this geotourism product is based on the new application developed by the Institute of Geography and sustainability, and the Bureau Relief. One

  1. The membrane-proximal tryptophan-rich region in the transmembrane glycoprotein ectodomain of feline immunodeficiency virus is important for cell entry

    International Nuclear Information System (INIS)

    Giannecchini, Simone; Bonci, Francesca; Pistello, Mauro; Matteucci, Donatella; Sichi, Olimpia; Rovero, Paolo; Bendinelli, Mauro

    2004-01-01

    The mechanisms whereby feline immunodeficiency virus (FIV) adsorbs and enters into susceptible cells are poorly understood. Here, we investigated the role exerted in such functions by the tryptophan (Trp)-rich motif present membrane-proximally in the ectodomain of the FIV transmembrane glycoprotein. Starting from p34TF10, which encodes the entire genome of FIV Petaluma, we produced 11 mutated clones having the Trp-rich motif scrambled or variously deleted or substituted. All mutated progenies adsorbed normally to cells, but the ones with severe disruptions of the motif failed to generate proviral DNA. In the latter mutants, proviral DNA formation was restored by providing an independent source of intact FIV envelope glycoproteins or by addition of the fusing agent polyethylene glycol, thus clearly indicating that their defect resided primarily at the level of cell entry. In addition, the replication-competent mutants exhibited a generally enhanced susceptibility to selected entry inhibitory synthetic peptides, suggestive of a reduced efficiency of the entry step

  2. Gel shift analysis of the empA promoter region in Vibrio anguillarum

    Directory of Open Access Journals (Sweden)

    Denkin Steven M

    2004-10-01

    Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V

  3. Electromagnetic properties of proximity systems

    Science.gov (United States)

    Kresin, Vladimir Z.

    1985-07-01

    Magnetic screening in the proximity system Sα-Mβ, where Mβ is a normal metal N, semiconductor (semimetal), or a superconductor, is studied. Main attention is paid to the low-temperature region where nonlocality plays an important role. The thermodynamic Green's-function method is employed in order to describe the behavior of the proximity system in an external field. The temperature and thickness dependences of the penetration depth λ are obtained. The dependence λ(T) differs in a striking way from the dependence in usual superconductors. The strong-coupling effect is taken into account. A special case of screening in a superconducting film backed by a size-quantizing semimetal film is considered. The results obtained are in good agreement with experimental data.

  4. Electromagnetic properties of proximity systems

    International Nuclear Information System (INIS)

    Kresin, V.Z.

    1985-01-01

    Magnetic screening in the proximity system S/sub α/-M/sub β/, where M/sub β/ is a normal metal N, semiconductor (semimetal), or a superconductor, is studied. Main attention is paid to the low-temperature region where nonlocality plays an important role. The thermodynamic Green's-function method is employed in order to describe the behavior of the proximity system in an external field. The temperature and thickness dependences of the penetration depth lambda are obtained. The dependence lambda(T) differs in a striking way from the dependence in usual superconductors. The strong-coupling effect is taken into account. A special case of screening in a superconducting film backed by a size-quantizing semimetal film is considered. The results obtained are in good agreement with experimental data

  5. “Fear or Love Thy Neighbour”? The EU Framework for Promoting Regional Cooperation in the South Caucasus

    Directory of Open Access Journals (Sweden)

    Nelli Babayan

    2011-12-01

    Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.

  6. Regional Differences in Correlates of Daily Walking among Middle Age and Older Australian Rural Adults: Implications for Health Promotion

    Directory of Open Access Journals (Sweden)

    James Dollman

    2016-01-01

    Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.

  7. Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

    Science.gov (United States)

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

    2014-08-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

  8. Carcass and meat quality determination as a tool to promote local meat consumption in outermost regions of Europe

    DEFF Research Database (Denmark)

    Hernandez Castellano, Lorenzo E; Morales-delaNuez, Antonio; Moreno-Indias, Isabel

    2013-01-01

    of this study, therefore, was to evaluate local and imported carcasses and meat quality in order to promote the consumption of local breeds, using the Canary Islands (Spain) as a model for other subtropical outermost regions. For this study 20 half-carcasses from Palmera breed and 20 imported half...

  9. Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis.

    Science.gov (United States)

    Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida

    2015-09-29

    Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

  10. Neighborhoods and manageable proximity

    Directory of Open Access Journals (Sweden)

    Stavros Stavrides

    2011-08-01

    Full Text Available The theatricality of urban encounters is above all a theatricality of distances which allow for the encounter. The absolute “strangeness” of the crowd (Simmel 1997: 74 expressed, in its purest form, in the absolute proximity of a crowded subway train, does not generally allow for any movements of approach, but only for nervous hostile reactions and submissive hypnotic gestures. Neither forced intersections in the course of pedestrians or vehicles, nor the instantaneous crossing of distances by the technology of live broadcasting and remote control give birth to places of encounter. In the forced proximity of the metropolitan crowd which haunted the city of the 19th and 20th century, as well as in the forced proximity of the tele-presence which haunts the dystopic prospect of the future “omnipolis” (Virilio 1997: 74, the necessary distance, which is the stage of an encounter between different instances of otherness, is dissipated.

  11. New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.

    Science.gov (United States)

    Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja

    2017-02-01

    Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.

  12. A prospective evaluation of first people's health promotion program design in the goulburn-murray rivers region.

    Science.gov (United States)

    Doyle, Joyce; Atkinson-Briggs, Sharon; Atkinson, Petah; Firebrace, Bradley; Calleja, Julie; Reilly, Rachel; Cargo, Margaret; Riley, Therese; Crumpen, Tui; Rowley, Kevin

    2016-11-10

    Aboriginal Community Controlled Organisations (ACCOs) provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1) identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2) evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %). Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to achieve change. First Peoples' health promotion in the

  13. A prospective evaluation of first people’s health promotion program design in the goulburn-murray rivers region

    Directory of Open Access Journals (Sweden)

    Joyce Doyle

    2016-11-01

    achieve change. Conclusion First Peoples’ health promotion in the Goulburn-Murray Rivers region encompasses a broad range of social, cultural, lifestyle and community development activities, including reclaiming and strengthening cultural identity and social connectedness as a response to colonisation.

  14. Opposite phenotypes of muscle strength and locomotor function in mouse models of partial trisomy and monosomy 21 for the proximal Hspa13-App region.

    Directory of Open Access Journals (Sweden)

    Véronique Brault

    2015-03-01

    Full Text Available The trisomy of human chromosome 21 (Hsa21, which causes Down syndrome (DS, is the most common viable human aneuploidy. In contrast to trisomy, the complete monosomy (M21 of Hsa21 is lethal, and only partial monosomy or mosaic monosomy of Hsa21 is seen. Both conditions lead to variable physiological abnormalities with constant intellectual disability, locomotor deficits, and altered muscle tone. To search for dosage-sensitive genes involved in DS and M21 phenotypes, we created two new mouse models: the Ts3Yah carrying a tandem duplication and the Ms3Yah carrying a deletion of the Hspa13-App interval syntenic with 21q11.2-q21.3. Here we report that the trisomy and the monosomy of this region alter locomotion, muscle strength, mass, and energetic balance. The expression profiling of skeletal muscles revealed global changes in the regulation of genes implicated in energetic metabolism, mitochondrial activity, and biogenesis. These genes are downregulated in Ts3Yah mice and upregulated in Ms3Yah mice. The shift in skeletal muscle metabolism correlates with a change in mitochondrial proliferation without an alteration in the respiratory function. However, the reactive oxygen species (ROS production from mitochondrial complex I decreased in Ms3Yah mice, while the membrane permeability of Ts3Yah mitochondria slightly increased. Thus, we demonstrated how the Hspa13-App interval controls metabolic and mitochondrial phenotypes in muscles certainly as a consequence of change in dose of Gabpa, Nrip1, and Atp5j. Our results indicate that the copy number variation in the Hspa13-App region has a peripheral impact on locomotor activity by altering muscle function.

  15. Opposite phenotypes of muscle strength and locomotor function in mouse models of partial trisomy and monosomy 21 for the proximal Hspa13-App region.

    Science.gov (United States)

    Brault, Véronique; Duchon, Arnaud; Romestaing, Caroline; Sahun, Ignasi; Pothion, Stéphanie; Karout, Mona; Borel, Christelle; Dembele, Doulaye; Bizot, Jean-Charles; Messaddeq, Nadia; Sharp, Andrew J; Roussel, Damien; Antonarakis, Stylianos E; Dierssen, Mara; Hérault, Yann

    2015-03-01

    The trisomy of human chromosome 21 (Hsa21), which causes Down syndrome (DS), is the most common viable human aneuploidy. In contrast to trisomy, the complete monosomy (M21) of Hsa21 is lethal, and only partial monosomy or mosaic monosomy of Hsa21 is seen. Both conditions lead to variable physiological abnormalities with constant intellectual disability, locomotor deficits, and altered muscle tone. To search for dosage-sensitive genes involved in DS and M21 phenotypes, we created two new mouse models: the Ts3Yah carrying a tandem duplication and the Ms3Yah carrying a deletion of the Hspa13-App interval syntenic with 21q11.2-q21.3. Here we report that the trisomy and the monosomy of this region alter locomotion, muscle strength, mass, and energetic balance. The expression profiling of skeletal muscles revealed global changes in the regulation of genes implicated in energetic metabolism, mitochondrial activity, and biogenesis. These genes are downregulated in Ts3Yah mice and upregulated in Ms3Yah mice. The shift in skeletal muscle metabolism correlates with a change in mitochondrial proliferation without an alteration in the respiratory function. However, the reactive oxygen species (ROS) production from mitochondrial complex I decreased in Ms3Yah mice, while the membrane permeability of Ts3Yah mitochondria slightly increased. Thus, we demonstrated how the Hspa13-App interval controls metabolic and mitochondrial phenotypes in muscles certainly as a consequence of change in dose of Gabpa, Nrip1, and Atp5j. Our results indicate that the copy number variation in the Hspa13-App region has a peripheral impact on locomotor activity by altering muscle function.

  16. Exploring DNA methylation changes in promoter, intragenic, and intergenic regions as early and late events in breast cancer formation

    International Nuclear Information System (INIS)

    Rauscher, Garth H.; Kresovich, Jacob K.; Poulin, Matthew; Yan, Liying; Macias, Virgilia; Mahmoud, Abeer M.; Al-Alem, Umaima; Kajdacsy-Balla, Andre; Wiley, Elizabeth L.; Tonetti, Debra; Ehrlich, Melanie

    2015-01-01

    Breast cancer formation is associated with frequent changes in DNA methylation but the extent of very early alterations in DNA methylation and the biological significance of cancer-associated epigenetic changes need further elucidation. Pyrosequencing was done on bisulfite-treated DNA from formalin-fixed, paraffin-embedded sections containing invasive tumor and paired samples of histologically normal tissue adjacent to the cancers as well as control reduction mammoplasty samples from unaffected women. The DNA regions studied were promoters (BRCA1, CD44, ESR1, GSTM2, GSTP1, MAGEA1, MSI1, NFE2L3, RASSF1A, RUNX3, SIX3 and TFF1), far-upstream regions (EN1, PAX3, PITX2, and SGK1), introns (APC, EGFR, LHX2, RFX1 and SOX9) and the LINE-1 and satellite 2 DNA repeats. These choices were based upon previous literature or publicly available DNA methylome profiles. The percent methylation was averaged across neighboring CpG sites. Most of the assayed gene regions displayed hypermethylation in cancer vs. adjacent tissue but the TFF1 and MAGEA1 regions were significantly hypomethylated (p ≤0.001). Importantly, six of the 16 regions examined in a large collection of patients (105 – 129) and in 15-18 reduction mammoplasty samples were already aberrantly methylated in adjacent, histologically normal tissue vs. non-cancerous mammoplasty samples (p ≤0.01). In addition, examination of transcriptome and DNA methylation databases indicated that methylation at three non-promoter regions (far-upstream EN1 and PITX2 and intronic LHX2) was associated with higher gene expression, unlike the inverse associations between cancer DNA hypermethylation and cancer-altered gene expression usually reported. These three non-promoter regions also exhibited normal tissue-specific hypermethylation positively associated with differentiation-related gene expression (in muscle progenitor cells vs. many other types of normal cells). The importance of considering the exact DNA region analyzed and the

  17. Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

    Science.gov (United States)

    Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

    2016-02-09

    Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

  18. Tumour MLH1 promoter region methylation testing is an effective pre-screen for Lynch Syndrome (HNPCC)

    Science.gov (United States)

    Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG

    2016-01-01

    Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751

  19. Hypermethylation of the DPYD promoter region is not a major predictor of severe toxicity in 5-fluorouracil based chemotherapy

    Directory of Open Access Journals (Sweden)

    Aebi Stefan

    2008-10-01

    Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.

  20. Targets of DNA-binding proteins in bacterial promoter regions present enhanced probabilities for spontaneous thermal openings

    International Nuclear Information System (INIS)

    Apostolaki, Angeliki; Kalosakas, George

    2011-01-01

    We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties

  1. Proximal collagenous gastroenteritides:

    DEFF Research Database (Denmark)

    Nielsen, Ole Haagen; Riis, Lene Buhl; Danese, Silvio

    2014-01-01

    AIM: While collagenous colitis represents the most common form of the collagenous gastroenteritides, the collagenous entities affecting the proximal part of the gastrointestinal tract are much less recognized and possibly overlooked. The aim was to summarize the latest information through a syste...

  2. Proximate Analysis of Coal

    Science.gov (United States)

    Donahue, Craig J.; Rais, Elizabeth A.

    2009-01-01

    This lab experiment illustrates the use of thermogravimetric analysis (TGA) to perform proximate analysis on a series of coal samples of different rank. Peat and coke are also examined. A total of four exercises are described. These are dry exercises as students interpret previously recorded scans. The weight percent moisture, volatile matter,…

  3. Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

    OpenAIRE

    Matsutani Sachiko

    2004-01-01

    Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...

  4. Promoting effect of ethanol on dewetting transition in the confined region of melittin tetramer

    International Nuclear Information System (INIS)

    Ren Xiuping; Zhou Bo; Wang Chunlei

    2012-01-01

    To study the influence of ethanol molecules on the melittin tetramer folding, we investigated the dewetting transition of the melittin tetramer immersed in pure water and 8% aqueous ethanol solution (mass fraction) by the molecular dynamics simulations. We found that the marked dewetting transitions occurred inside a nanoscale channel of the melittin tetramer both in pure water and in aqueous ethanol solution. Also, ethanol molecules promoted this dewetting transition. We attributed this promoting effect to ethanol molecules which prefer to locate at the liquid-vapor interface and decrease the liquid-vapor surface energy. The results provide insight into the effect of ethanol on the water dewetting phenomena. (authors)

  5. A Participatory Regional Partnership Approach to Promote Nutrition and Physical Activity Through Environmental and Policy Change in Rural Missouri.

    Science.gov (United States)

    Barnidge, Ellen K; Baker, Elizabeth A; Estlund, Amy; Motton, Freda; Hipp, Pamela R; Brownson, Ross C

    2015-06-11

    Rural residents are less likely than urban and suburban residents to meet recommendations for nutrition and physical activity. Interventions at the environmental and policy level create environments that support healthy eating and physical activity. Healthier Missouri Communities (Healthier MO) is a community-based research project conducted by the Prevention Research Center in St. Louis with community partners from 12 counties in rural southeast Missouri. We created a regional partnership to leverage resources and enhance environmental and policy interventions to improve nutrition and physical activity in rural southeast Missouri. Partners were engaged in a participatory action planning process that included prioritizing, implementing, and evaluating promising evidence-based interventions to promote nutrition and physical activity. Group interviews were conducted with Healthier MO community partners post intervention to evaluate resource sharing and sustainability efforts of the regional partnership. Community partners identified the benefits and challenges of resource sharing within the regional partnership as well as the opportunities and threats to long-term partnership sustainability. The partners noted that the regional participatory process was difficult, but the benefits outweighed the challenges. Regional rural partnerships may be an effective way to leverage relationships to increase the capacity of rural communities to implement environmental and policy interventions to promote nutrition and physical activity.

  6. Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents.

    Science.gov (United States)

    Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z

    2014-03-01

    The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.

  7. Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

    Directory of Open Access Journals (Sweden)

    Li Mei-zhi

    2010-10-01

    Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

  8. Evaluation of methylation pattern in promoter region of E-cadherin ...

    African Journals Online (AJOL)

    user

    2011-03-07

    Mar 7, 2011 ... promoter methylation in CDH1 gene inactivation in breast cancer, the CpG methylation status of E- ..... 5'CpG island of CDH1 in prostate, lung, liver, bladder, .... and estrogen receptor alpha from Sp1 sites to induce cell cycle.

  9. The effect of mutations in the AmpC promoter region on β-lactam ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... between the -10 and -35 boxes affects the resistance of bacteria to β-lactam antibiotics. .... The chromosomal cephalosporinase gene, ampC, of E. .... mutation in the ampC promoter increasing resistance to β-lactams in.

  10. Promoting University and Industry Links at the Regional Level: Comparing China's Reform and International Experience

    Science.gov (United States)

    Po, Yang; Cai, Yuzhuo; Lyytinen, Anu; Hölttä, Seppo

    2016-01-01

    This paper intends to learn from international experiences in order to facilitating China's ongoing regional university transformation with an ultimate goal to enhance the role of university in regional economic development and innovation. In so doing, this paper compares major models of universities of applied sciences (UAS) around the world from…

  11. Murine leukemia virus vector integration favors promoter regions and regional hot spots in a human T-cell line

    International Nuclear Information System (INIS)

    Tsukahara, Tomonori; Agawa, Hideyuki; Matsumoto, Sayori; Matsuda, Mizuho; Ueno, Shuichi; Yamashita, Yuki; Yamada, Koichiro; Tanaka, Nobuyuki; Kojima, Katsuhiko; Takeshita, Toshikazu

    2006-01-01

    Genomic analysis of integration will be important in evaluating the safety of human gene therapy with retroviral vectors. Here, we investigated MLV vector integration sites in human T-cells, since they are amenable to gene transfer studies, and have been used therapeutically in clinical trials. We mapped 340 MLV vector integration sites in the infected human T-cell clones we established. The data showed that MLV preferred integration near the transcription start sites (±5 kb), near CpG islands (±1 kb), and within the first intron of RefSeq genes. We also identified MLV integration hot spots that contained three or more integrations within a 100 kb region. RT-PCR revealed that mRNA-levels of T-cell clones that contained MLV integrations near transcription start sites or introns were dysregulated compared to the uninfected cells. These studies help define the profile of MLV integration in T-cells and the risks associated with MLV-based gene therapy

  12. Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan.

    Science.gov (United States)

    Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul

    2010-05-14

    The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society.

  13. Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan

    Science.gov (United States)

    Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul

    2010-01-01

    The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society. PMID:20640020

  14. Promotion of physical activity in the European region: content analysis of 27 national policy documents

    DEFF Research Database (Denmark)

    Daugbjerg, Signe B; Kahlmeier, Sonja; Racioppi, Francesca

    2009-01-01

    . Population groups most in need such as people with low levels of physical activity were rarely specifically targeted. Most policies emphasized the importance of an evaluation. However, only about half of them indicated a related intention or requirement. CONCLUSION: In recent years there has been......BACKGROUND: Over the past years there has been increasing interest in physical activity promotion and the development of appropriate policy. So far, there has been no comprehensive overview of the activities taking place in Europe in this area of public health policy. METHODS: Using different...... search methods, 49 national policy documents on physical activity promotion were identified. An analysis grid covering key features was developed for the analysis of the 27 documents published in English. RESULTS: Analysis showed that many general recommendations for policy developments are being...

  15. Analysis of the Impact of the Flow of Migrant Workers on Regional Economy: Based on the Thought about the Promotion of Jiangxi Regional Economic Competitiveness

    Directory of Open Access Journals (Sweden)

    Sun Yuping

    2016-03-01

    Full Text Available Labor resource is the necessary productive factor in regional economic development, and one of important indexes to evaluate regional economic competitiveness. The great economic achievement brought by the 30-year reform and opening up of China is due to the fact that China brought the backward advantage of “demographic dividend” into play, promoted the fast development of industrialization and urbanization, and became the second largest economy in the world. The entity of “demographic dividend” is the non-agricultural migrant population, i.e., migrant workers. The transfer employment of migrant workers has typical regional liquidity, and the imbalance of regional economy causes the flow of many migrant workers. In order to achieve harmonious development and coordinated development, underdeveloped areas must understand the character and regulation, adopt positive industrial policy and supportive policy, guide the reasonable flow of migrant workers, and realize the transfer of local employment and citizenization of migrant workers, which can enhance regional economic competitiveness

  16. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-12-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  17. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-01-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  18. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    Directory of Open Access Journals (Sweden)

    Xian-E Peng

    Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.

  19. DNMT 1 maintains hypermethylation of CAG promoter specific region and prevents expression of exogenous gene in fat-1 transgenic sheep.

    Science.gov (United States)

    Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng

    2017-01-01

    Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.

  20. Association of the Resistin Gene Promoter Region Polymorphism with Kawasaki Disease in Chinese Children

    Directory of Open Access Journals (Sweden)

    Ruixi Liu

    2012-01-01

    Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.

  1. Quantum Proximity Resonances

    International Nuclear Information System (INIS)

    Heller, E.J.

    1996-01-01

    It is well known that at long wavelengths λ an s-wave scatterer can have a scattering cross section σ on the order of λ 2 , much larger than its physical size, as measured by the range of its potential. Very interesting phenomena can arise when two or more identical scatterers are placed close together, well within one wavelength. We show that, for a pair of identical scatterers, an extremely narrow p-wave open-quote open-quote proximity close-quote close-quote resonance develops from a broader s-wave resonance of the individual scatterers. A new s-wave resonance of the pair also appears. The relation of these proximity resonances (so called because they appear when the scatterers are close together) to the Thomas and Efimov effects is discussed. copyright 1996 The American Physical Society

  2. Developing regionally specific grazing practices to promote production, profitability, and environmental quality

    Science.gov (United States)

    Rangelands are valued for their capacity to provide diverse suites of ecosystem services, from food production to carbon storage to biological diversity. Although rangelands worldwide share common characteristics, differences among biogeographic regions result in differences in the types of opportun...

  3. Cytosine deletion at AP2-box region of HSP70 promoter and its ...

    Indian Academy of Sciences (India)

    of thermotolerance in cells (Leung et al. 1996). ... region of HSP70 significantly affected cellular thermotol- erance ... The double PCR-RFLP using ScrFI confirmed the occur- ... suade of HSP70 on defense of proteins related to respiration.

  4. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.; Rizzu, Patrizia; Francescatto, Margherita; Vitezic, Morana; Leday, Gwenaë l G.R.; Sanchez, Javier Simon; Khamis, Abdullah M.; Takahashi, Hazuki; van de Berg, Wilma D.J.; Medvedeva, Yulia A.; van de Wiel, Mark A.; Daub, Carsten O.; Carninci, Piero; Heutink, Peter

    2013-01-01

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites

  5. Development of model for studies on momentum transfer in electrochemical cells with entry region coil as turbulence promoter

    Science.gov (United States)

    Penta Rao, Tamarba; Rajendra Prasad, P.

    2018-04-01

    Entry region swirl promoters gain importance in industry because of its effectiveness in augmentation of mass and heat transfer augmentation. Design of equipment needs momentum transfer data along with mass or heat transfer data. Hence an experimental investigation was carried out with coaxially placed entry region spiral coil as turbulence promoters on momentum transfer in forced convection flow of electrolyte in circular conduits. Aqueous solution of sodium hydroxide and 0.01 M equimolal Ferri-ferro cyanide system was chosen for the study. The study covered parameters like effect of pitch of the coil, effect of length of the coil, diameter of the coil, diameter of the coil wire, diameter of the annular rod. The promoter is measured by limiting current technique using diffusion controlled electrochemical reactions. The study comprises of evaluation of momentum transfer rates at the outer wall of the electrochemical cell. Pressure drop measurements were also made to obtain the energy consumption pattern. Within the range of variables covered. The results are correlated by the momentum transfer similarity function. Momentum transfer coefficients were evaluated from measured limiting currents. Effect of each parameter was studied in terms of friction factor. A model was developed for momentum transfer. The experimental data on momentum transfer was modeled in terms of momentum transfer function and Reynolds number, geometric parameters.

  6. No evidence for promoter region methylation of the succinate dehydrogenase and fumarate hydratase tumour suppressor genes in breast cancer

    Directory of Open Access Journals (Sweden)

    Dobrovic Alexander

    2009-09-01

    Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.

  7. Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

    Directory of Open Access Journals (Sweden)

    Matsutani Sachiko

    2004-08-01

    Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants

  8. Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III.

    Science.gov (United States)

    Matsutani, Sachiko

    2004-08-09

    In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.

  9. Perceptions of health promoters about health promotion programmes for families with adolescents orphaned as a result of AIDS in the rural Hammanskraal region in South Africa

    Directory of Open Access Journals (Sweden)

    Maseapo P. Mthobeni

    2013-02-01

    Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information.Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering

  10. Perceptions of health promoters about health promotion programmes for families with adolescents orphaned as a result of AIDS in the rural Hammanskraal region in South Africa

    Directory of Open Access Journals (Sweden)

    Maseapo P. Mthobeni

    2013-02-01

    Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information. Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering

  11. MICB gene diversity and balancing selection on its promoter region in Yao population in southern China.

    Science.gov (United States)

    Chen, Xiang; Liu, Xuexiang; Wei, Xiaomou; Meng, Yuming; Liu, Limin; Qin, Shini; Liu, Yanyu; Dai, Shengming

    2016-12-01

    To comprehensively examine the MICB gene polymorphism and identify its differences in Chinese Yao population from other ethnic groups, we investigated the polymorphism in the 5'-upstream regulation region (5'-URR), coding region (exons 2-4), and the 3'-untranslated region (3'-UTR) of MICB gene by using PCR-SBT method in 125 healthy unrelated Yao individuals in Guangxi Zhuang Autonomous Region. Higher polymorphism was observed in the 5'-URR, nine single nucleotide polymorphisms (SNPs) and a two base pairs deletion at position -139/-138 were found in our study. Only five different variation sites, however, were detected in exons 2-4 and three were observed in the 3'-UTR. The minor allele frequencies of all variants were greater than 5%, except for rs3828916, rs3131639, rs45627734, rs113620316, rs779737471, and the variation at position +11803 in the 3'-UTR. The first nine SNPs of 5'-URR and rs1065075, rs1051788 of the coding region showed significant linkage disequilibrium with each other. Ten different MICB extended haplotypes (EH) encompassing the 5'-URR, exons 2-4, and 3'-UTR were found in this population, and the most frequent was EH1 (23.2%). We provided several evidences for balancing selection effect on the 5'-URR of MICB gene in Yao population. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  12. Hypermethylation of the FANCC and FANCL Promoter Regions in Sporadic Acute Leukaemia

    Directory of Open Access Journals (Sweden)

    C. J. Hess

    2008-01-01

    Full Text Available Objective: Inactivation of the FA-BRCA pathway results in chromosomal instability. Fanconi anaemia (FA patients have an inherited defect in this pathway and are strongly predisposed to the development of acute myeloid leukaemia (AML. Studies in sporadic cancers have shown promoter methylation of the FANCF gene in a significant proportion of various solid tumours. However, only a single leukaemic case with methylation of one of the FA-BRCA genes has been described to date, i.e. methylation of FANCF in cell line CHRF-288. We investigated the presence of aberrant methylation in 11 FA-BRCA genes in sporadic cases of leukaemia.

  13. CAGE-defined promoter regions of the genes implicated in Rett Syndrome

    DEFF Research Database (Denmark)

    Vitezic, Morana; Bertin, Nicolas; Andersson, Robin

    2014-01-01

    BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...

  14. Fish farming as an innovative strategy for promoting food security in drought risk regions of Zimbabwe

    Directory of Open Access Journals (Sweden)

    Elvin Shava

    2017-11-01

    Full Text Available This article examines the implementation of fish farming as an innovative and economic strategy for promoting food security and dietary diversities among vulnerable households in drought risk areas of Zimbabwe. The declining climatic conditions and lack of economic opportunities in Mwenezi district of Zimbabwe attracted the attention of three nongovernmental organisations (NGOs to implement fish farming as an innovative mechanism to stimulate food security and generate employment in the district. The article used a qualitative research approach that includes semi-structured interviews and secondary data. The purposive sampling technique was adopted to interview participants in Mwenezi district who were involved in fish farming to assess and explore the experiences and benefits they derive from such development projects. Results for the article revealed that fish farming was well embraced by local communities as it led to improvements in food security, household income and employment regeneration. The local government including traditional leadership (Chiefs and Headmen’s supported the NGO activities as they benefited local communities. The article concludes that although fish farming was instrumental in regenerating employment, some participants still fail to participate because of laziness and desire to maintain dependency syndrome. The article recommends the NGOs to launch awareness campaigns in rural communities and increase networking with the donor community which is fundamental in attracting sustainable funding. The government can also promote fish farming in vulnerable rural communities by providing funding and capacity building programmes.

  15. Polymorphism in the oxytocin promoter region in patients with lactase non-persistence is not related to symptoms

    Directory of Open Access Journals (Sweden)

    Simrén Magnus

    2009-11-01

    Full Text Available Abstract Background Oxytocin and the oxytocin receptor have been demonstrated in the gastrointestinal (GI tract and have been shown to exert physiological effects on gut motility. The role for oxytocin in the pathophysiology of GI complaints is unknown. The aim of this study was to examine genetic variations or polymorphism of oxytocin (OXT and its receptor (OXTR genes in patients with GI complaints without visible organic abnormalities. Methods Genetic variants in the OXT promoter region, and in the OXTR gene in DNA samples from 131 rigorously evaluated patients with Irritable Bowel Syndrome (IBS, 408 homozygous subjects referred for lactase (LCT-13910 C>T, rs4988235 genotyping, and 299 asymptomatic blood donors were compared. One polymorphism related to the OXT gene (rs6133010 A>G and 4 related to the OXTR gene (rs1465386 G>T, rs3806675 G>A, rs968389 A>G, rs1042778 G>T were selected for genotyping using Applied Biosystems 7900 HT allele discrimination assays. Results There were no statistically significant differences in the genotype or allele frequencies in any of the SNPs when IBS patients were compared to healthy controls. Among subjects referred for lactase genotyping, the rs6133010 A>G OXT promoter A/G genotype tended to be more common in the 154 non-persistent (27.3% subjects than in the 254 lactase persistant (18.1% subjects and in the healthy controls (19.4% (p = 0.08. When direct comparing, the A/G genotype was less common in the OXT promoter region in controls (p = 0.09 and in subjects with lactase persistence (p = 0.03 compared to subjects with lactase non-persistence. When healthy controls were viewed according to their own LCT-13910 genotypes, the C/C lactase non-persistent controls had a higher frequency for the OXT promoter A/G genotype than LCT-13910 T/T lactase persistent controls (41.2% vs 13.1%. No significant differences in frequencies of the investigated OXTR SNPs were noted in this study. Conclusion The results suggest

  16. Genetic polymorphisms within tumor necrosis factor gene promoter region: a role for susceptibility to ventilator-associated pneumonia.

    Science.gov (United States)

    Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J

    2012-08-01

    Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Regional efforts to promote forestry best management practices: a southern success story

    Science.gov (United States)

    Herb Nicholson; John Colberg; Hughes Simpson; Tom Gerow; Wib Owen

    2016-01-01

    The Southern Group of State Foresters has a long history of water resource protection efforts, providing leadership in BMP development, improvement, and implementation, enhancing state BMP programs, establishing effective partnerships, and standardizing an approach to consistently monitor implementation across the region.

  18. Evaluation of methylation pattern in promoter region of E-cadherin ...

    African Journals Online (AJOL)

    The epithelial cadherin gene (CDH1) has been identified as a tumor suppressor gene located within the 16q22.1 region. The CDH1 gene encodes a transmembrane glycoprotein involved in cell to cell adhesion and loss of CDH1 expression contributes to increased proliferation, invasion and metastasis in breast carcinoma.

  19. Proximity friction reexamined

    International Nuclear Information System (INIS)

    Krappe, H.J.

    1989-01-01

    The contribution of inelastic excitations to radial and tangential friction form-factors in heavy-ion collisions is investigated in the frame-work of perturbation theory. The dependence of the form factors on the essential geometrical and level-density parameters of the scattering system is exhibited in a rather closed form. The conditions for the existence of time-local friction coefficients are discussed. Results are compared to form factors from other models, in particular the transfer-related proximity friction. For the radial friction coefficient the inelastic excitation mechanism seems to be the dominant contribution in peripheral collisions. (orig.)

  20. Echosonography with proximity sensors

    International Nuclear Information System (INIS)

    Thaisiam, W; Laithong, T; Meekhun, S; Chaiwathyothin, N; Thanlarp, P; Danworaphong, S

    2013-01-01

    We propose the use of a commercial ultrasonic proximity sensor kit for profiling an altitude-varying surface by employing echosonography. The proximity sensor kit, two identical transducers together with its dedicated operating circuit, is used as a profiler for the construction of an image. Ultrasonic pulses are emitted from one of the transducers and received by the other. The time duration between the pulses allows us to determine the traveling distance of each pulse. In the experiment, the circuit is used with the addition of two copper wires for directing the outgoing and incoming signals to an oscilloscope. The time of flight of ultrasonic pulses can thus be determined. Square grids of 5 × 5 cm 2 are made from fishing lines, forming pixels in the image. The grids are designed to hold the detection unit in place, about 30 cm above a flat surface. The surface to be imaged is constructed to be height varying and placed on the flat surface underneath the grids. Our result shows that an image of the profiled surface can be created by varying the location of the detection unit along the grid. We also investigate the deviation in relation to the time of flight of the ultrasonic pulse. Such an experiment should be valuable for conveying the concept of ultrasonic imaging to physical and medical science undergraduate students. Due to its simplicity, the setup could be made in any undergraduate laboratory relatively inexpensively and it requires no complex parts. The results illustrate the concept of echosonography. (paper)

  1. Epigenetic changes within the promoter region of the HLA-G gene in ovarian tumors

    Directory of Open Access Journals (Sweden)

    Matyunina Lilya V

    2008-05-01

    Full Text Available Abstract Background Previous findings have suggested that epigenetic-mediated HLA-G expression in tumor cells may be associated with resistance to host immunosurveillance. To explore the potential role of DNA methylation on HLA-G expression in ovarian cancer, we correlated differences in HLA-G expression with methylation changes within the HLA-G regulatory region in an ovarian cancer cell line treated with 5-aza-deoxycytidine (5-aza-dC and in malignant and benign ovarian tumor samples and ovarian surface epithelial cells (OSE isolated from patients with normal ovaries. Results A region containing an intact hypoxia response element (HRE remained completely methylated in the cell line after treatment with 5-aza-dC and was completely methylated in all of the ovarian tumor (malignant and benign samples examined, but only variably methylated in normal OSE samples. HLA-G expression was significantly increased in the 5-aza-dC treated cell line but no significant difference was detected between the tumor and OSE samples examined. Conclusion Since HRE is the binding site of a known repressor of HLA-G expression (HIF-1, we hypothesize that methylation of the region surrounding the HRE may help maintain the potential for expression of HLA-G in ovarian tumors. The fact that no correlation exists between methylation and HLA-G gene expression between ovarian tumor samples and OSE, suggests that changes in methylation may be necessary but not sufficient for HLA-G expression in ovarian cancer.

  2. Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene

    International Nuclear Information System (INIS)

    Shannon, M.F.; Gamble, J.R.; Vadas, M.A.

    1988-01-01

    The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription

  3. Inter-organizational relations for regional development: an expansion policy promoted by the federal network of professional education, science & technology

    Directory of Open Access Journals (Sweden)

    Cleidson Nogueira Dias

    2014-12-01

    Full Text Available This research paper examines the importance of inter-organizational network management as a government policy tool to promote regional development. This pattern requires Federal Government intervention so as to compensate for the imbalance that this causes and to guarantee that economic growth resulting from government actions leads to development in all regions of the country, thereby avoiding the traditional mechanisms of wealth concentration. For this, a methodology of content analysis was used based on a relevant public policy aimed at promoting development within Brazil and by analyzing the data collected in relation to the current theory related to strategy, local development and inter-organizational networks in general.  The analysis results show that, when the policy studied in this work, applied in the federal network of professional education, science & technology, was implemented the networks had a positive influence on the outcome of the policy objectives and represented an extremely powerful support tool, being one of the most important factors to boost development.

  4. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  5. Export Promotion Aims and Reality: A Comparison of the Iberian, Baltic and Central European Region

    Directory of Open Access Journals (Sweden)

    Éltető Andrea

    2017-06-01

    Full Text Available As a consequence of the international crisis in 2008-2009, the role of exports in economic growth came into focus in most countries. Exports of EU Member States gained momentum from 2010 onward but with certain changes in their structure and direction. In several countries, the turn towards non-EU areas, such as China or Latin America was part of the state export strategy. On the one hand, our article describes these foreign trade strategies and their institutional framework of the Iberian, Baltic and Central European governments, detecting possible similarities. On the other hand, we analyse recent export data. This way we can get a picture on the structure and direction of exports of periphery economies and this can be compared to the aims of the given states. Our hypothesis is that there is a gap between the reality and the intentions of the governments. The size of this gap varies and is influenced by certain factors such as the different involvement of multinational companies in foreign trade or the different economic structure of these countries. In our paper we list which countries adopted a government strategy and with what aim. We provide a short literature review on state trade promotion policies and discuss these policies and their institutions in the Baltic, Visegrád and Iberian countries.

  6. Methylation of Promoter Regions of Genes of the Human Intrauterine Renin Angiotensin System and Their Expression

    Directory of Open Access Journals (Sweden)

    Shane D. Sykes

    2015-01-01

    Full Text Available The intrauterine renin angiotensin system (RAS is implicated in placentation and labour onset. Here we investigate whether promoter methylation of RAS genes changes with gestation or labour and if it affects gene expression. Early gestation amnion and placenta were studied, as were term amnion, decidua, and placenta collected before labour (at elective caesarean section or after spontaneous labour and delivery. The expression and degree of methylation of the prorenin receptor (ATP6AP2, angiotensin converting enzyme (ACE, angiotensin II type 1 receptor (AGTR1, and two proteases that can activate prorenin (kallikrein, KLK1, and cathepsin D, CTSD were measured by qPCR and a DNA methylation array. There was no effect of gestation or labour on the methylation of RAS genes and CTSD. Amnion and decidua displayed strong correlations between the percent hypermethylation of RAS genes and CTSD, suggestive of global methylation. There were no correlations between the degree of methylation and mRNA abundance of any genes studied. KLK1 was the most methylated gene and the proportion of hypermethylated KLK1 alleles was lower in placenta than decidua. The presence of intermediate methylated alleles of KLK1 in early gestation placenta and in amnion after labour suggests that KLK1 methylation is uniquely dynamic in these tissues.

  7. Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty.

    Science.gov (United States)

    Toro, Carlos A; Wright, Hollis; Aylwin, Carlos F; Ojeda, Sergio R; Lomniczi, Alejandro

    2018-01-04

    Polycomb group (PcG) proteins control the timing of puberty by repressing the Kiss1 gene in hypothalamic arcuate nucleus (ARC) neurons. Here we identify two members of the Trithorax group (TrxG) of modifiers, mixed-lineage leukemia 1 (MLL1), and 3 (MLL3), as central components of an activating epigenetic machinery that dynamically counteracts PcG repression. Preceding puberty, MLL1 changes the chromatin configuration at the promoters of Kiss1 and Tac3, two genes required for puberty to occur, from repressive to permissive. Concomitantly, MLL3 institutes a chromatin structure that changes the functional status of a Kiss1 enhancer from poised to active. RNAi-mediated, ARC-specific Mll1 knockdown reduced Kiss1 and Tac3 expression, whereas CRISPR-Cas9-directed epigenome silencing of the Kiss1 enhancer selectively reduced Kiss1 activity. Both interventions delay puberty and disrupt reproductive cyclicity. Our results demonstrate that an epigenetic switch from transcriptional repression to activation is crucial to the regulatory mechanism controlling the timing of mammalian puberty.

  8. Tobacco advertising, promotion and sponsorship in entertainment media: a phenomenon requiring stronger controls in the Eastern Mediterranean Region.

    Science.gov (United States)

    El-Awa, Fatimah M S; El Naga, Randa Abou; Labib, Sahar; Latif, Nisreen Abdel

    2018-04-05

    Tobacco use and placement of tobacco products in television (TV) productions and movies is a way to promote tobacco use while avoiding tobacco advertising bans that exist in most countries. The fact that such productions are broadcast widely and viewed by millions, including children and young people, is of concern. This paper reviews the evidence on the use of tobacco advertising, promotion and sponsorship (TAPS) in TV and films in the Eastern Mediterranean Region and the ways to combat it. Evidence from Egypt shows considerable and increasing use of tobacco products by actors on screen, including female actors, in programmes aired during Ramadan in 2015-2017. A study of Iranian movies in 2015 showed that tobacco scenes in Iranian movies were increasing. In 2014, the WHO Regional Office for the Eastern Mediterranean held a consultative meeting on TAPS in drama. The consultation recommended regulating the tobacco presence in movies and TV through complete implementation of Article 13 of the WHO FCTC, and raising the issue to the WHO FCTC Conference of the Parties. In 2016, the Conference of the Parties called on parties to consider scaling up the implementation of WHO FCTC Article 13 and monitoring the use of TAPS in entertainment media in accordance with national legislation. A comprehensive approach is essential to end the tobacco industry's use of TV productions and movies to promote their products. Copyright © World Health Organization (WHO) 2018. Some rights reserved. This work is available under the CC BY-NC-SA 3.0 IGO license (https://creativecommons.org/licenses/by-nc-sa/3.0/igo).

  9. Cloning and analysis of the promoter region of the human fibronectin gene

    International Nuclear Information System (INIS)

    Dean, D.C.; Bowlus, C.L.; Bourgeois, S.

    1987-01-01

    Human fibronectin (FN) genomic clones were isolated by screening a human genomic library with a 75-base oligonucleotide. The sequence of the oligonucleotide corresponds to a region near the 5' end of the human FN cDNA clone pFH6 that contains the amino-terminal coding sequences but does not extend to the 5' end of the mRNA. The 5' end of the FN gene is found on a 3.7-kilobase-pair EcoRI fragment that contains about 2.7 kilobase pairs of flanking sequence. The first exon is 414 base pairs long, with a 5' untranslated region of 267 base pairs. As deduced on the basis of the position of the initiation codon, FN is synthesized with a 31-residue amino acid extension on the amion terminus that is not present in the mature polypeptide. This amino-terminal extension appears to contain both a signal peptide and a propeptide. The first 200 base pairs of 5'-flanking sequence is very G+C rich. Upstream of this the sequence becomes relatively A+T rich. The sequence ATATAA is found at -25 and the sequence CAAT is present at -150. The sequence GGGGCGGGGC at -102 exhibits homology to the binding site for the transcription factor SP1, and the sequence TGACGTCA at -173 exhibits homology to 5'-flanking sequences important for induction by cAMP

  10. Efforts to promote regional security dialogue and cooperation in the North Pacific

    International Nuclear Information System (INIS)

    Mason, P.

    1994-01-01

    Indifference to the new realities of the post-cold war era does nothing to preserve the traditional priorities laid down in the Final Document of the first special session on disarmament. On the contrary, such attitudes directly contribute to the trend towards marginalization which began when publics no longer feared the threat of a nuclear holocaust. It is believed that the expertise of forty years of multilateral arms control and disarmament efforts is directly relevant to the broader efforts of the international community to restore, maintain and promote international peace and security. Who can deny that confidence-building is central to preventive diplomacy? Or that the arms control component-from disarming to demobilization-is not equally central to peace operations whether they be traditional peace-keeping or post-conflict peace-building? Indeed the success or failure of the disarmament aspect of a peace operation is often critical to its overall success-Somalia surely being one recent sad example. The multilateral disarmament community must apply itself more directly and systematically to these broader problems - just as the United Nations Secretariat has increasingly begun to do - or risk indifference from Governments forced to make tough choices against a range of competing priorities. It is undeniably true that the post-cold war has significantly increased the potential for the international community to negotiate historic new multilateral disarmament treaties. And this window of opportunity must be utilized to the fullest. At the same time, due account must be taken of the hard fact that, for an increasing number of countries, expensive obligations in relation to advanced unconventional weapons which neither they nor their neighbours seek to possess may count for less than practical assistance in finding solutions to more parochial, but no less urgent, problems

  11. Clinicopathologic Risk Factor Distributions for MLH1 Promoter Region Methylation in CIMP-Positive Tumors.

    Science.gov (United States)

    Levine, A Joan; Phipps, Amanda I; Baron, John A; Buchanan, Daniel D; Ahnen, Dennis J; Cohen, Stacey A; Lindor, Noralane M; Newcomb, Polly A; Rosty, Christophe; Haile, Robert W; Laird, Peter W; Weisenberger, Daniel J

    2016-01-01

    The CpG island methylator phenotype (CIMP) is a major molecular pathway in colorectal cancer. Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations, and family colorectal cancer history with MLH1 methylation status in a large population-based sample of CIMP-positive colorectal cancers defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, and more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR, 0.50; 95% confidence interval, 0.31-0.82). These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. MLH1 DNA methylation status should be taken into account in etiologic studies. ©2015 American Association for Cancer Research.

  12. Clinicopathological risk factor distributions for MLH1 promoter region methylation in CIMP positive tumors

    Science.gov (United States)

    Levine, A. Joan; Phipps, Amanda I.; Baron, John A.; Buchanan, Daniel D.; Ahnen, Dennis J.; Cohen, Stacey A.; Lindor, Noralane M.; Newcomb, Polly A.; Rosty, Christophe; Haile, Robert W.; Laird, Peter W.; Weisenberger, Daniel J.

    2015-01-01

    Background The CpG Island Methylator Phenotype (CIMP) is a major molecular pathway in colorectal cancer (CRC). Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. Methods We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations and family CRC history with MLH1 methylation status in a large population-based sample of CIMP-positive CRCs defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Results Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR=0.50; 95% Confidence Interval (0.31, 0.82)). Conclusions These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. Impact MLH1 DNA methylation status should be taken into account in etiologic studies. PMID:26512054

  13. Promoting Vehicle to Grid (V2G) in the Nordic Region

    DEFF Research Database (Denmark)

    Kester, Johannes; Noel, Lance; Zarazua de Rubens, Gerardo

    2018-01-01

    Vehicle to Grid (V2G) holds the promise of cheap, flexible, and fast-responding storage through the use of electric vehicle batteries. Unfortunately, infrastructure, battery degradation and consumer awareness are only some of the challenges to a faster development of this technology. This paper...... offers a qualitative comparative analysis that draws on a subsample of 227 semistructured interviews on electric vehicles with both transportation and electricity experts from 201 institutions and 17 cities within the Nordic region to discuss the reasoning and arguments behind V2G incentives and policy...... mechanisms. A frequency analysis of the most coded V2G responses favoured an update of the electricity market regulation – in particular in relation to electricity taxation and aggregator markets – and support for pilot projects. However, the analysis overall implies that V2G, in contrast to EVs...

  14. Cis-acting elements in the promoter region of the human aldolase C gene.

    Science.gov (United States)

    Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F

    1993-08-16

    We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

  15. Children's proximal societal conditions

    DEFF Research Database (Denmark)

    Stanek, Anja Hvidtfeldt

    2018-01-01

    that is above or outside the institutional setting or the children’s everyday life, but something that is represented through societal structures and actual persons participating (in political ways) within the institutional settings, in ways that has meaning to children’s possibilities to participate, learn...... and develop. Understanding school or kindergarten as (part of) the children’s proximal societal conditions for development and learning, means for instance that considerations about an inclusive agenda are no longer simply thoughts about the school – for economic reasons – having space for as many pupils...... as possible (schools for all). Such thoughts can be supplemented by reflections about which version of ‘the societal’ we wish to present our children with, and which version of ‘the societal’ we wish to set up as the condition for children’s participation and development. The point is to clarify or sharpen...

  16. Proximity detection system underground

    Energy Technology Data Exchange (ETDEWEB)

    Denis Kent [Mine Site Technologies (Australia)

    2008-04-15

    Mine Site Technologies (MST) with the support ACARP and Xstrata Coal NSW, as well as assistance from Centennial Coal, has developed a Proximity Detection System to proof of concept stage as per plan. The basic aim of the project was to develop a system to reduce the risk of the people coming into contact with vehicles in an uncontrolled manner (i.e. being 'run over'). The potential to extend the developed technology into other areas, such as controls for vehicle-vehicle collisions and restricting access of vehicle or people into certain zones (e.g. non FLP vehicles into Hazardous Zones/ERZ) was also assessed. The project leveraged off MST's existing Intellectual Property and experience gained with our ImPact TRACKER tagging technology, allowing the development to be fast tracked. The basic concept developed uses active RFID Tags worn by miners underground to be detected by vehicle mounted Readers. These Readers in turn provide outputs that can be used to alert a driver (e.g. by light and/or audible alarm) that a person (Tag) approaching within their vicinity. The prototype/test kit developed proved the concept and technology, the four main components being: Active RFID Tags to send out signals for detection by vehicle mounted receivers; Receiver electronics to detect RFID Tags approaching within the vicinity of the unit to create a long range detection system (60 m to 120 m); A transmitting/exciter device to enable inner detection zone (within 5 m to 20 m); and A software/hardware device to process & log incoming Tags reads and create certain outputs. Tests undertaken in the laboratory and at a number of mine sites, confirmed the technology path taken could form the basis of a reliable Proximity Detection/Alert System.

  17. Activation of JAK3, but not JAK1, is critical to interleukin-4 (IL4) stimulated proliferation and requires a membrane-proximal region of IL4 receptor alpha.

    Science.gov (United States)

    Malabarba, M G; Kirken, R A; Rui, H; Koettnitz, K; Kawamura, M; O'Shea, J J; Kalthoff, F S; Farrar, W L

    1995-04-21

    The tyrosine kinases JAK1 and JAK3 have been shown to undergo tyrosine phosphorylation in response to interleukin-2 (IL), IL4, IL7, and IL9, cytokines which share the common IL2 receptor gamma-chain (IL2R gamma), and evidence has been found for a preferential coupling of JAK3 to IL2R gamma and JAK1 to IL2R beta. Here we show, using human premyeloid TF-1 cells, that IL4 stimulates JAK3 to a larger extent than JAK1, based upon three different evaluation criteria. These include a more vigorous tyrosine phosphorylation of JAK3 as measured by anti-phosphotyrosine immunoblotting, a more marked activation of JAK3 as determined by in vitro tyrosine kinase assays and a more manifest presence of JAK3 in activated IL4-receptor complexes. These observations suggest that IL4 receptor signal transduction does not depend on equimolar heterodimerization of JAK1 and JAK3 following IL4-induced heterodimerization of IL4R alpha and IL2R gamma. Indeed, when human IL4R alpha was stably expressed in mouse BA/F3 cells, robust IL4-induced proliferation and JAK3 activation occurred without detectable involvement of JAK1, JAK2, or TYK2. The present study suggests that JAK1 plays a subordinate role in IL4 receptor signaling, and that in certain cells exclusive JAK3 activation may mediate IL4-induced cell growth. Moreover, mutational analysis of human IL4R alpha showed that a membrane-proximal cytoplasmic region was critical for JAK3 activation, while the I4R motif was not, which is compatible with a role of JAK3 upstream of the recruitment of the insulin receptor substrate-1/4PS signaling proteins by IL4 receptors.

  18. Revolutionising engineering education in the Middle East region to promote earthquake-disaster mitigation

    Science.gov (United States)

    Baytiyeh, Hoda; Naja, Mohamad K.

    2014-09-01

    Due to the high market demands for professional engineers in the Arab oil-producing countries, the appetite of Middle Eastern students for high-paying jobs and challenging careers in engineering has sharply increased. As a result, engineering programmes are providing opportunities for more students to enrol on engineering courses through lenient admission policies that do not compromise academic standards. This strategy has generated an influx of students who must be carefully educated to enhance their professional knowledge and social capital to assist in future earthquake-disaster risk-reduction efforts. However, the majority of Middle Eastern engineering students are unaware of the valuable acquired engineering skills and knowledge in building the resilience of their communities to earthquake disasters. As the majority of the countries in the Middle East are exposed to seismic hazards and are vulnerable to destructive earthquakes, engineers have become indispensable assets and the first line of defence against earthquake threats. This article highlights the contributions of some of the engineering innovations in advancing technologies and techniques for effective disaster mitigation and it calls for the incorporation of earthquake-disaster-mitigation education into academic engineering programmes in the Eastern Mediterranean region.

  19. Possible association between serotonin transporter promoter region polymorphism and extremely violent crime in Chinese males.

    Science.gov (United States)

    Liao, Ding-Lieh; Hong, Chen-Jee; Shih, Hao-Ling; Tsai, Shih-Jen

    2004-01-01

    The neurotransmitter, serotonin, has been implicated in aggressive behavior. The serotonin transporter (5-HTT), which reuptakes serotonin into the nerve terminal, plays a critical role in the regulation of serotonergic function. Previous western reports have demonstrated that the low-activity short (S) allele of the 5-HTT gene-linked polymorphic-region (5-HTTLPR) polymorphism is associated with aggressive behavior and associated personality traits. In the present study, we investigated this 5-HTTLPR genetic polymorphism in a group of Chinese males who had been convicted for extremely violent crime (n = 135) and a normal control group (n = 111). The proportion of S-allele carriers was significantly higher in the criminal group than in the controls (p = 0.006). A significant association was not demonstrated for the relationship between the 5-HTTLPR polymorphism and antisocial personality disorder, substance abuse or alcohol abuse in the criminal group. Our findings demonstrate that carriage of the low-activity S allele is associated with extremely violent criminal behavior in Chinese males, and suggests that the 5-HTT may be implicated in the mechanisms underlying violent behaviors.

  20. E-Cigarettes: Implications for Health Promotion in the Asian Pacific Region.

    Science.gov (United States)

    Jancey, Jonine; Maycock, Bruce; McCausland, Kahlia; Howat, Peter

    2018-03-01

    Since their introduction to the United States in 2007, electronic cigarettes (e-cigarettes) use has grown exponentially. This rapid growth in e-cigarette use has been heralded by some as a potential important public health measure that could ultimately replace tobacco cigarettes, while others recommend a cautionary approach until there is clear evidence they will not become "new tobacco" bringing a possible myriad of other problems. E-cigarettes may have real benefits, however they do expose users and those nearby to organic compounds, solvents and particulate matter, with there being limited data relating to their health impact. It is unclear as to whether this relatively new device has the potential to exacerbate nicotine addictions, or play a part in reducing harm and smoking cessation. The fundamental requirement of public health practice is to do no harm and from the inconclusive evidence we have to date on e-cigarettes, it appears a cautious approach is warranted. This commentary reviews evidence that supports a cautious approach to e-cigarette availability in Australia and the Asian Pacific region.

  1. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  2. Identification of a 450-bp region of human papillomavirus type 1 that promotes episomal replication in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Chattopadhyay, Anasuya; Schmidt, Martin C.; Khan, Saleem A.

    2005-01-01

    Human papillomaviruses (HPVs) replicate as nuclear plasmids in infected cells. Since the DNA replication machinery is generally conserved between humans and Saccharomyces cerevisiae, we studied whether HPV-1 DNA can replicate in yeast. Plasmids containing a selectable marker (with or without a yeast centromere) and either the full-length HPV-1 genome or various regions of the viral long control region (LCR) and the 3' end of the L1 gene were introduced into S. cerevisiae and their ability to replicate episomally was investigated. Our results show that HPV-1 sequences promote episomal replication of plasmids although the yeast centromere is required for plasmid retention. We have mapped the autonomously replicating sequence activity of HPV-1 DNA to a 450 base-pair sequence (HPV-1 nt 6783-7232) that includes 293 nucleotides from the 5' region of the viral LCR and 157 nucleotides from the 3' end of the L1 gene. The HPV-1 ARS does not include the binding sites for the viral E1 and E2 proteins, and these proteins are dispensable for replication in S. cerevisiae

  3. Analysis of upstream promoter region and corresponding 5’ UTR of glucokinase (GCK gene in horse breeds

    Directory of Open Access Journals (Sweden)

    L. Minieri

    2010-04-01

    Full Text Available A region of glucokinase (GCK gene was sequenced in 14 horses of 14 different breeds. The resulting GCK nucleotide sequence (GenBank number EF136885 showed 77% homology with human GCK gene portion containing the upstream promoter region and the corresponding 5’ UTR of the exon 1. Conserved regulatory sequences near the putative transcriptional start site were identified. The obtained sequences were aligned to detect polymorphism. A new C>T transition within the 5’ UTR of exon 1 was found. Allele frequencies of this polymorphism were studied by PCR-RFLP in 193 horses of 14 breeds (Bardigiano, 21; Esperia Pony, 5; Haflinger, 10; Italian Heavy Draught Horse, 28; Italian Saddle, 25; Italian Trotter, 16; Lipizzan, 12; Maremmano, 15; Murgese, 14; Norico, 10; Salernitano, 12; Thoroughbred, 10; Tolfetano, 7 and Ventasso Horse, 8. The polymorphism was found in all breeds and differences in allelic frequencies among the breeds were observed. The new SNP identified within a regulative region of GCK gene, which plays an important role in insulin secretion and feeding behaviour, could be used for association studies with performance traits of the horses.

  4. Nonrandom community assembly and high temporal turnover promote regional coexistence in tropics but not temperate zone.

    Science.gov (United States)

    Freestone, Amy L; Inouye, Brian D

    2015-01-01

    A persistent challenge for ecologists is understanding the ecological mechanisms that maintain global patterns of biodiversity, particularly the latitudinal diversity gradient of peak species richness in the tropics. Spatial and temporal variation in community composition contribute to these patterns of biodiversity, but how this variation and its underlying processes change across latitude remains unresolved. Using a model system of sessile marine invertebrates across 25 degrees of latitude, from the temperate zone to the tropics, we tested the prediction that spatial and temporal patterns of taxonomic richness and composition, and the community assembly processes underlying these patterns, will differ across latitude. Specifically, we predicted that high beta diversity (spatial variation in composition) and high temporal turnover contribute to the high species richness of the tropics. Using a standardized experimental approach that controls for several confounding factors that hinder interpretation of prior studies, we present results that support our predictions. In the temperate zone, communities were more similar across spatial scales from centimeters to tens of kilometers and temporal scales up to one year than at lower latitudes. Since the patterns at northern latitudes were congruent with a null model, stochastic assembly processes are implicated. In contrast, the communities in the tropics were a dynamic spatial and temporal mosaic, with low similarity even across small spatial scales and high temporal turnover at both local and regional scales. Unlike the temperate zone, deterministic community assembly processes such as predation likely contributed to the high beta diversity in the tropics. Our results suggest that community assembly processes and temporal dynamics vary across latitude and help structure and maintain latitudinal patterns of diversity.

  5. PROXIMITY MANAGEMENT IN CRISIS CONDITIONS

    Directory of Open Access Journals (Sweden)

    Ion Dorin BUMBENECI

    2010-01-01

    Full Text Available The purpose of this study is to evaluate the level of assimilation for the terms "Proximity Management" and "Proximity Manager", both in the specialized literature and in practice. The study has two parts: the theoretical research of the two terms, and an evaluation of the use of Proximity management in 32 companies in Gorj, Romania. The object of the evaluation resides in 27 companies with less than 50 employees and 5 companies with more than 50 employees.

  6. Transverse and Longitudinal proximity effect

    Science.gov (United States)

    Jalan, Pryianka; Chand, Hum; Srianand, Raghunathan

    2018-04-01

    With close pairs (˜1.5arcmin) of quasars (QSOs), absorption in the spectra of a background quasar in the vicinity of a foreground quasar can be used to study the environment of the latter quasar at kpc-Mpc scales. For this we used a sample of 205 quasar pairs from the Sloan Digital Sky-Survey Data Release 12 (SDSS DR12) in the redshift range of 2.5 to 3.5 by studying their H I Ly-α absorption. We study the environment of QSOs both in the longitudinal as well as in the transverse direction by carrying out a statistical comparison of the Ly-α absorption lines in the quasar vicinity to that of the absorption lines caused by the inter-galactic medium (IGM). This comparison was done with IGM, matched in absorption redshift and signal-to-noise ratio (SNR) to that of the proximity region. In contrast to the measurements along the line-of-sight, the regions transverse to the quasars exhibit enhanced H I Ly-α absorption. This discrepancy can either be interpreted as due to an anisotropic emission from the quasars or as a consequence of their finite lifetime.

  7. The effect of phenobarbital on the methylation level of the p16 promoter region in rat liver

    International Nuclear Information System (INIS)

    Kostka, Grazyna; Urbanek, Katarzyna; Ludwicki, Jan K.

    2007-01-01

    It has been suggested that non-genotoxic carcinogens (NGCs) may cause modification of the DNA methylation status. We studied the effects of phenobarbital (PB) - a non-genotoxic rodent liver carcinogen - on the methylation level of the promoter region of the p16 suppressor gene, as well as on hepatomegaly, DNA synthesis, and DNA-methyltransferase (DNMTs) activity in the rat liver. Male Wistar rats received PB in 1, 3 or 14 daily oral doses (at 24-h intervals), each equivalent to 1/10 of the LD 50 value. The study showed that PB has caused persistent elevation in relative liver weight (RLW) as well as a transient increase in DNA synthesis. This suggests that the PB-induced increase in RLW was due to a combination of both hyperplasia and hypertrophy of liver cells. The effect of PB on DNA synthesis corresponded to an increase in the methylation pattern of the p16 promoter sequence. Methylation of cytosine in the analyzed CpG sites of the p16 gene was found after short exposure of the animals to PB. Treatment of rats with PB for 1 and 3 days also produced an increase in nuclear DNMTs activity. After prolonged administration (14 days), DNA synthesis declined, returning to the control level. No changes in methylation of the p16 gene nor in DNMTs activity were observed. The reversibility of early induced changes in target tissues is a mark characteristic of tumor promoters. Thus, transient changes in methylation of the p16 gene, although their direct role in the mechanisms of PB toxicity, including its carcinogenic action, remains doubtful, may therefore be a significant element of such processes

  8. THE ANALYSIS OF THE ASYMMETRICAL RISK IN TOURISM FOR THE DEVELOPMENT AND PROMOTION OF A LASTING REGIONAL TOURISM IDENTITY

    Directory of Open Access Journals (Sweden)

    Alexandru NEDELEA

    2009-06-01

    Full Text Available In order to establish an adequate balance between tourists' welfare, the needs of the natural and cultural environment, as well as to develop tourist destinations and organizations' competitiveness, it is necessary to carry out a global and integrated approach, where all interested parties share the same goals regarding the durability of tourism and the approached challenges. The purpose of this work is to identify the factors of reduced risk having a major impact over the sustainability of the tourist region under analysis and to highlight the risk factors' connections and impact in order to minimize and eliminate them, with direct effects over the awareness of tourist industry's values. The identification of lasting development's indicators will take into account all these three aspects of the durable development of tourism, namely ecological, economical and social factors, that play a part in highlighting the real performance of a tourist destination. All these aspects are absolutely necessary for the promotion of the Danube's tourist potential, achievable through the emphasis of the relevant values from the tourist patrimony of the county of Galati. The promotion of the Danube' tourist potential presupposes a series of objectives that are subordinated to the general direction that is marked at the national level, respectively Romania's transformation into a qualitative tourist destination based on its natural and cultural patrimony, in order to correspond to the European Union standards. The new policy regarding tourism proposed by the European Commission aims at offering constant support for this industry to be able to face different challenges, by promoting also competitiveness in general.

  9. High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver

    Energy Technology Data Exchange (ETDEWEB)

    Ohashi, Koji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Munetsuna, Eiji [Department of Biochemistry, Fujita Health University School of Medicine, Toyoake (Japan); Yamada, Hiroya, E-mail: hyamada@fujita-hu.ac.jp [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan); Ando, Yoshitaka [Department of Joint Research Laboratory of Clinical Medicine, Fujita Health University Hospital, Toyoake (Japan); Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Suzuki, Koji [Department of Public Health, Fujita Health University School of Health Sciences, Toyoake (Japan); Teradaira, Ryoji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Hashimoto, Shuji [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan)

    2015-12-04

    DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.

  10. Competitive Promoter-Associated Matrix Attachment Region Binding of the Arid3a and Cux1 Transcription Factors

    Directory of Open Access Journals (Sweden)

    Dongkyoon Kim

    2017-12-01

    Full Text Available Arid3a/Bright/Dril1 is a B cell-specific transactivator that regulates immunoglobulin heavy chain (IgH gene transcription by binding promoter and enhancer-associated matrix attachment regions (MARs within the IgH gene locus. Promoter MAR-mediated Arid3a transactivation is antagonized by direct competition of MAR binding by Cux1/CDP—a ubiquitously expressed repressor originally termed NF-μNR. We report that the NF-μNR complex includes Arid3a in B cells but not in non-B cells through mobility shift assays. The binding activity of NF-μNR and Arid3a in B cells is reciprocally altered during the cell division cycle and by the B cell mitogen lipopolysaccharide LPS. LPS treatment had no effect on Arid3a localization but increased its total abundance within the nucleus and cytoplasm. We show that this increased level of Arid3a is capable of displacing Cux from the MARs to facilitate IgH gene transcription. Finally, we showed that the MARs (termed Bf150 and Tx125 associated with the VH1 rearranged variable region expressed in the S107 murine plasmacytoma, can repress reporter gene transcription in non-B cells and that they can relieve the repression mediated by Eμ enhancer in B cells. These results have significant implications for early human development and demonstrate that MARs in IgH locus, NF-µNR and Arid3a regulate IgH gene expression in a concerted fashion. This paves the way for future studies examining the misregulation of this pathway in pediatric disease.

  11. High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver

    International Nuclear Information System (INIS)

    Ohashi, Koji; Munetsuna, Eiji; Yamada, Hiroya; Ando, Yoshitaka; Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki; Suzuki, Koji; Teradaira, Ryoji; Hashimoto, Shuji

    2015-01-01

    DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.

  12. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

    Science.gov (United States)

    Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

    2009-11-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

  13. Green Tourism in Mountain Regions - Reducing Vulnerability and Promoting People and Place Centric Development in the Himalayas

    Institute of Scientific and Technical Information of China (English)

    R. B. Singh; D. K. Mishra

    2004-01-01

    In recent years, mountain regions are attracting great attention to Indian tourists in general and foreign tourists in particular. The potential mountain resources for promoting green tourism are enormous in the form of natural and cultural heritage such as biosphere reserves, flora and fauna, lakes and rivers and traditional rural resources. In order to utilise tourism industry market, uncontrolled numbers of tourists and related haphazard infrastructural facilities in the vulnerable mountain regions pose serious environmental implications. The ecological pressures are threatening land, water and wild life resources through direct and indirect environmental impacts together with generation of solid and liquid wastes, so green tourism is emerging as an important task in order to develop new relationship between communities, government agencies and private sectors. The strategy focuses on ecological understanding, environmental protection and ecodevelopment. The major attributes of the green tourism include environmental conservation and education and distribution of income to local people based on strong partnership. Various knowledge systems go a long way for achieving the goals of the green tourism, which creates awareness about the value of environmental resources.Mountains have ecological, recreational, educational and scientific values, which need to be utilised in sustainable way. Various tourist activities and facilities need to be diversified in order to achieve multiple benefits including scientific field excursion,recreation in natural and cultural areas, community festivals and sport tourisms. Green tourism considers tourism development as an integral part of a national and regional development. The paper discusses the social, economic and environmental dimensions of the green tourism with particular reference to village tourism development programme taking empirical evidences from the Himalaya. Such programme also minimises biophysical and human

  14. Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

    Science.gov (United States)

    König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

    2013-01-01

    G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

  15. DNA methylation in Cosmc promoter region and aberrantly glycosylated IgA1 associated with pediatric IgA nephropathy.

    Directory of Open Access Journals (Sweden)

    Qiang Sun

    Full Text Available IgA nephropathy (IgAN is one of the most common glomerular diseases leading to end-stage renal failure. Elevation of aberrantly glycosylated IgA1 is a key feature of it. The expression of the specific molecular chaperone of core1ß1, 3galactosyl transferase (Cosmc is known to be reduced in IgAN. We aimed to investigate whether the methylation of CpG islands of Cosmc gene promoter region could act as a possible mechanism responsible for down-regulation of Cosmc and related higher secretion of aberrantly glycosylated IgA1in lymphocytes from children with IgA nephropathy. Three groups were included: IgAN children (n = 26, other renal diseases (n = 11 and healthy children (n = 13. B-lymphocytes were isolated and cultured, treated or not with IL-4 or 5-Aza-2'-deoxycytidine (AZA. The levels of DNA methylation of Cosmc promotor region were not significantly different between the lymphocytes of the three children populations (P = 0.113, but there were significant differences between IgAN lymphocytes and lymphocytes of the other two children populations after IL-4 (P<0.0001 or AZA (P<0.0001. Cosmc mRNA expression was low in IgAN lymphocytes compared to the other two groups (P<0.0001. The level of aberrantly glycosylated IgA1 was markedly higher in IgAN group compared to the other groups (P<0.0001. After treatment with IL-4, the levels of Cosmc DNA methylation and aberrantly glycosylated IgA1 in IgAN lymphocytes were remarkably higher than the other two groups (P<0.0001 with more markedly decreased Cosmc mRNA content (P<0.0001. After treatment with AZA, the levels in IgAN lymphocytes were decreased, but was still remarkably higher than the other two groups (P<0.0001, while Cosmc mRNA content in IgAN lymphocytes were more markedly increased than the other two groups (P<0.0001. The alteration of DNA methylation by IL-4 or AZA specifically correlates in IgAN lymphocytes with alterations in Cosmc mRNA expression and with the level of aberrantly glycosylated

  16. Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S. [Univ. of Bonn (Germany)] [and others

    1995-10-09

    In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains a functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.

  17. Increased fire frequency promotes stronger spatial genetic structure and natural selection at regional and local scales in Pinus halepensis Mill.

    Science.gov (United States)

    Budde, Katharina B; González-Martínez, Santiago C; Navascués, Miguel; Burgarella, Concetta; Mosca, Elena; Lorenzo, Zaida; Zabal-Aguirre, Mario; Vendramin, Giovanni G; Verdú, Miguel; Pausas, Juli G; Heuertz, Myriam

    2017-04-01

    The recurrence of wildfires is predicted to increase due to global climate change, resulting in severe impacts on biodiversity and ecosystem functioning. Recurrent fires can drive plant adaptation and reduce genetic diversity; however, the underlying population genetic processes have not been studied in detail. In this study, the neutral and adaptive evolutionary effects of contrasting fire regimes were examined in the keystone tree species Pinus halepensis Mill. (Aleppo pine), a fire-adapted conifer. The genetic diversity, demographic history and spatial genetic structure were assessed at local (within-population) and regional scales for populations exposed to different crown fire frequencies. Eight natural P. halepensis stands were sampled in the east of the Iberian Peninsula, five of them in a region exposed to frequent crown fires (HiFi) and three of them in an adjacent region with a low frequency of crown fires (LoFi). Samples were genotyped at nine neutral simple sequence repeats (SSRs) and at 251 single nucleotide polymorphisms (SNPs) from coding regions, some of them potentially important for fire adaptation. Fire regime had no effects on genetic diversity or demographic history. Three high-differentiation outlier SNPs were identified between HiFi and LoFi stands, suggesting fire-related selection at the regional scale. At the local scale, fine-scale spatial genetic structure (SGS) was overall weak as expected for a wind-pollinated and wind-dispersed tree species. HiFi stands displayed a stronger SGS than LoFi stands at SNPs, which probably reflected the simultaneous post-fire recruitment of co-dispersed related seeds. SNPs with exceptionally strong SGS, a proxy for microenvironmental selection, were only reliably identified under the HiFi regime. An increasing fire frequency as predicted due to global change can promote increased SGS with stronger family structures and alter natural selection in P. halepensis and in plants with similar life history traits

  18. Analysis of polymorphisms in the promoter region and protein levels of interleukin-6 gene among gout patients.

    Science.gov (United States)

    Tsai, P-C; Chen, C-J; Lai, H-M; Chang, S-J

    2008-01-01

    To explore the associations between the polymorphisms and protein levels of interleukin-6 (IL-6) gene and gout disease. A total of 120 male gout patients and 184 healthy controls were enrolled. Each patient was matched with 1-2 gout-free controls by age within three years. Four polymorphisms in the promoter of IL-6 gene, including -597G/A, -572C/G, -373A(m)T(n), and -174G/C, and the IL-6 levels were analyzed. The clinical characteristics and biochemical markers in plasma were measured, including age of gout onset, duration of gout history, tophus number, gout attack frequency, uric acid, total cholesterol, triglycerides and creatinine. The mean IL-6 level for gout patients was 9.80 (+/-11.76 pg/ml) which showed no significant difference from the controls (7.06+/-7.58 pg/ml, p=0.230). When the IL-6 levels were dichotomized according to the median value (5 pg/ml), there were significantly higher proportions of the gout patients (59.66%) than controls (44%) with high IL-6 levels (OR=1.88, 95% CI=1.17-3.02, p=0.008). Unique genotype was found at polymorphisms -174G/C and -597G/A. Neither the polymorphisms -572C/G nor -373A(m)T(n) in the genotype or allele distributions showed a significant association related to clinical characteristics, biochemical markers, IL-6 levels or gout disease (all p>0.05). Those with gout disease have greater proportions of high IL-6 levels in plasma than controls, and there is no significant association between the four polymorphisms in the promoter region of IL-6 gene and gout disease.

  19. Effect of Promoter Region Mutations and mgrA Overexpression on Transcription of norA, Which Encodes a Staphylococcus aureus Multidrug Efflux Transporter

    OpenAIRE

    Kaatz, Glenn W.; Thyagarajan, Rama V.; Seo, Susan M.

    2005-01-01

    NorA is a Staphylococcus aureus multidrug transporter that confers resistance to structurally distinct compounds. The MgrA global regulatory protein is reported to augment norA expression when mgrA is overexpressed from an undefined plasmid-based promoter. Further details about norA regulatory mechanisms are scant. A chromosomal norA::lacZ transcriptional fusion was constructed in different S. aureus strains, and allele replacement was used to define the relevance of promoter region sequences...

  20. ProxImaL: efficient image optimization using proximal algorithms

    KAUST Repository

    Heide, Felix; Diamond, Steven; Nieß ner, Matthias; Ragan-Kelley, Jonathan; Heidrich, Wolfgang; Wetzstein, Gordon

    2016-01-01

    domain-specific language and compiler for image optimization problems that makes it easy to experiment with different problem formulations and algorithm choices. The language uses proximal operators as the fundamental building blocks of a variety

  1. A proximal point algorithm with generalized proximal distances to BEPs

    OpenAIRE

    Bento, G. C.; Neto, J. X. Cruz; Lopes, J. O.; Soares Jr, P. A.; Soubeyran, A.

    2014-01-01

    We consider a bilevel problem involving two monotone equilibrium bifunctions and we show that this problem can be solved by a proximal point method with generalized proximal distances. We propose a framework for the convergence analysis of the sequences generated by the algorithm. This class of problems is very interesting because it covers mathematical programs and optimization problems under equilibrium constraints. As an application, we consider the problem of the stability and change dyna...

  2. Fractures of the proximal humerus

    DEFF Research Database (Denmark)

    Brorson, Stig

    2013-01-01

    Fractures of the proximal humerus have been diagnosed and managed since the earliest known surgical texts. For more than four millennia the preferred treatment was forceful traction, closed reduction, and immobilization with linen soaked in combinations of oil, honey, alum, wine, or cerate......, classification of proximal humeral fractures remains a challenge for the conduct, reporting, and interpretation of clinical trials. The evidence for the benefits of surgery in complex fractures of the proximal humerus is weak. In three systematic reviews I studied the outcome after locking plate osteosynthesis...

  3. Polymorphism of the promoter region and exon 1 of the CTLA4 gene in endemic pemphigus foliaceus (fogo selvagem

    Directory of Open Access Journals (Sweden)

    D.P. Pavoni

    2006-09-01

    Full Text Available Endemic pemphigus foliaceus (EPF is an autoimmune bullous skin disease characterized by acantholysis and antibodies against a desmosomal protein, desmoglein 1. Genetic and environmental factors contribute to development of this multifactorial disease. HLA class II and some cytokine gene polymorphisms are the only genetic markers thus far known to be associated with susceptibility to or protection from EPF. The cytotoxic T-lymphocyte antigen-4 gene (CTLA4 encodes a key immunoreceptor molecule that regulates and inhibits T-cell proliferation. It participates in the regulatory process controlling autoreactivity and therefore has been considered a strong candidate gene in autoimmune diseases. In the search for genes that might influence EPF pathogenesis, we analyzed variants of the CTLA4 gene in a sample of 118 patients and 291 controls from a Brazilian population. This is the first study investigating the possible role of polymorphisms of the 2q33 chromosomal region in differential susceptibility to pemphigus foliaceus. Promoter region and exon 1 single nucleotide polymorphisms -318 (C,T and 49 (A,G were genotyped using sequence-specific oligonucleotide probes after amplification by the polymerase chain reaction. The allelic and genotypic frequencies did not differ significantly between the patient and the control groups (-318T: 9.8 and 10.9%, 49G: 33.0 and 35.2% were the allelic frequencies in patients and controls, respectively. In addition, no significant difference was found when the patient and control population samples were stratified by the presence of HLA-DRB1 alleles. We conclude that the CTLA4 -318 (C,T and 49 (A,G polymorphisms do not play a major role in EPF development.

  4. RNA polymerase II interacts with the promoter region of the noninduced hsp70 gene in Drosophila melanogaster cells

    International Nuclear Information System (INIS)

    Gilmour, D.S.; Lis, J.T.

    1986-01-01

    By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation

  5. A novel -192c/g mutation in the proximal P2 promoter of the hepatocyte nuclear factor-4 alpha gene (HNF4A) associates with late-onset diabetes

    DEFF Research Database (Denmark)

    Ek, Jakob; Hansen, Sara P; Lajer, Maria

    2006-01-01

    Recently, it has been shown that mutations in the P2 promoter of the hepatocyte nuclear factor (HNF)-4 alpha gene (HNF4A) cause maturity-onset diabetes of the young (MODY), while single nucleotide polymorphisms in this locus are associated with type 2 diabetes. In this study, we examined 1,189 bp...... of the P2 promoter and the associated exon 1D of HNF4A for variations associated with diabetes in 114 patients with type 2 diabetes, 72 MODYX probands, and 85 women with previous gestational diabetes mellitus. A -192c/g mutation was found in five patients. We screened 1,587 diabetic subjects and 4......,812 glucose-tolerant subjects for the -192c/g mutation and identified 5 diabetic and 1 glucose-tolerant mutation carriers (P=0.004). Examination of the families showed that carriers of the -192c/g mutation had a significantly impaired glucose-stimulated insulin release and lower levels of serum total...

  6. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

    Science.gov (United States)

    Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

    2009-01-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

  7. The relationship in Japanese infants between a genetic polymorphism in the promoter region of the insulin-like growth factor I gene and the plasma level.

    Science.gov (United States)

    Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru

    2007-01-01

    Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.

  8. ARCAL. Regional co-operative arrangements for the promotion of nuclear science and technology in Latin America, Phase I (1985-1990)

    International Nuclear Information System (INIS)

    Gillen, V.A.

    1990-09-01

    The Regional Co-operative Arrangement for the Promotion of Nuclear Science and Technology in Latin America, ARCAL, has completed its first five-year phase (1985-1989). This booklet summarizes the first phase of the ARCAL programme and contains descriptions of projects in the fields of agriculture, medicine, industry and energy

  9. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

    NARCIS (Netherlands)

    Janssen, Paddy K. C.; Zwinderman, Aeilko H.; Olivier, Berend; Waldinger, Marcel D.

    2014-01-01

    To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE.

  10. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

    NARCIS (Netherlands)

    Janssen, Paddy K C; Zwinderman, Aeilko H; Olivier, Berend; Waldinger, Marcel D

    PURPOSE: To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). MATERIALS AND METHODS: This was a prospective study of 10 weeks of paroxetine

  11. Insulin VNTR and IGF-1 promoter region polymorphisms are not associated with body composition in early childhood: The generation R study

    NARCIS (Netherlands)

    J.A.J.B.M. Maas (Janneke); D.O. Mook-Kanamori (Dennis); L. Ay (Lamise); R.P.M. Steegers-Theunissen (Régine); P. Tikka-Kleemola (Päivi); A. Hofman (Albert); A.C.S. Hokken-Koelega (Anita); V.W.V. Jaddoe (Vincent)

    2010-01-01

    textabstractObjective: The objective of this study was to examine the associations between insulin gene variable number of tandem repeats (INS VNTR) and insulin-like growth factor 1 (IGF1) gene promoter region polymorphisms with body composition in early childhood. Methods: This study was embedded

  12. Association of human liver bilirubin UDP-glucuronyltransferase activity with a polymorphism in the promoter region of the UGT1A1 gene

    NARCIS (Netherlands)

    Raijmakers, MTM; Jansen, PLM; Steegers, EAP; Peters, WHM

    Background/Aims: Gilbert's syndrome is a benign form of a deficiency in bilirubin glucuronidation. It is associated with a homozygous polymorphism, A(TA)(7)TAA instead of A(TA)(6)TAA, in the TATA-box of the promoter region of the bilirubin UDP-glucuronyltransferase gene. In this study the

  13. Bridging the Scales from Field to Region with Practical Tools to Couple Time- and Space-Synchronized Data from Flux Towers and Networks with Proximal and Remote Sensing Data

    Science.gov (United States)

    Burba, G. G.; Avenson, T.; Burkart, A.; Gamon, J. A.; Guan, K.; Julitta, T.; Pastorello, G.; Sakowska, K.

    2017-12-01

    Many hundreds of flux towers are presently operational as standalone projects and as parts of regional networks. However, the vast majority of these towers do not allow straightforward coupling with remote sensing (drone, aircraft, satellite, etc.) data, and even fewer have optical sensors for validation of remote sensing products, and upscaling from field to regional levels. In 2016-2017, new tools to collect, process, and share time-synchronized flux data from multiple towers were developed and deployed globally. Originally designed to automate site and data management, and to streamline flux data analysis, these tools allow relatively easy matching of tower data with remote sensing data: GPS-driven PTP time protocol synchronizes instrumentation within the station, different stations with each other, and all of these to remote sensing data to precisely align remote sensing and flux data in time Footprint size and coordinates computed and stored with flux data help correctly align tower flux footprints and drone, aircraft or satellite motion to precisely align optical and flux data in space Full snapshot of the remote sensing pixel can then be constructed, including leaf-level, ground optical sensor, and flux tower measurements from the same footprint area, closely coupled with the remote sensing measurements to help interpret remote sensing data, validate models, and improve upscaling Additionally, current flux towers can be augmented with advanced ground optical sensors and can use standard routines to deliver continuous products (e.g. SIF, PRI, NDVI, etc.) based on automated field spectrometers (e.g., FloX and RoX, etc.) and other optical systems. Several dozens of new towers already operational globally can be readily used for the proposed workflow. Over 500 active traditional flux towers can be updated to synchronize their data with remote sensing measurements. This presentation will show how the new tools are used by major networks, and describe how this

  14. [Augmentation technique on the proximal humerus].

    Science.gov (United States)

    Scola, A; Gebhard, F; Röderer, G

    2015-09-01

    The treatment of osteoporotic fractures is still a challenge. The advantages of augmentation with respect to primary in vitro stability and the clinical use for the proximal humerus are presented in this article. In this study six paired human humeri were randomized into an augmented and a non-augmented group. Osteosynthesis was performed with a PHILOS plate (Synthes®). In the augmented group the two screws finding purchase in the weakest cancellous bone were augmented. The specimens were tested in a 3-part fracture model in a varus bending test. The augmented PHILOS plates withstood significantly more load cycles until failure. The correlation to bone mineral density (BMD) showed that augmentation could partially compensate for low BMD. The augmentation of the screws in locked plating in a proximal humerus fracture model is effective in improving the primary stability in a cyclic varus bending test. The targeted augmentation of two particular screws in a region of low bone quality within the humeral head was almost as effective as four screws with twice the amount of bone cement. Screw augmentation combined with a knowledge of the local bone quality could be more effective in enhancing the primary stability of a proximal humerus locking plate because the effect of augmentation can be exploited more effectively limiting it to the degree required. The technique of augmentation is simple and can be applied in open and minimally invasive procedures. When the correct procedure is used, complications (cement leakage into the joint) can be avoided.

  15. Comparative analyses of bidirectional promoters in vertebrates

    Directory of Open Access Journals (Sweden)

    Taylor James

    2008-05-01

    Full Text Available Abstract Background Orthologous genes with deep phylogenetic histories are likely to retain similar regulatory features. In this report we utilize orthology assignments for pairs of genes co-regulated by bidirectional promoters to map the ancestral history of the promoter regions. Results Our mapping of bidirectional promoters from humans to fish shows that many such promoters emerged after the divergence of chickens and fish. Furthermore, annotations of promoters in deep phylogenies enable detection of missing data or assembly problems present in higher vertebrates. The functional importance of bidirectional promoters is indicated by selective pressure to maintain the arrangement of genes regulated by the promoter over long evolutionary time spans. Characteristics unique to bidirectional promoters are further elucidated using a technique for unsupervised classification, known as ESPERR. Conclusion Results of these analyses will aid in our understanding of the evolution of bidirectional promoters, including whether the regulation of two genes evolved as a consequence of their proximity or if function dictated their co-regulation.

  16. Preliminary study on leadership proximity

    Directory of Open Access Journals (Sweden)

    Ghinea Valentina Mihaela

    2017-07-01

    Full Text Available In general, it is agreed that effective leadership requires a certain degree of proximity, either physical or mental, which enables leaders to maintain control over their followers and communicate their vision. Although we agree with the leadership proximity principles which states that leaders are able to efficiently serve only those people with whom they interact frequently, in this article we focus instead on the disadvantages of being too close and the way in which close proximity can actually hurt the effectiveness of leadership. The main effects that we discuss regard the way in which proximity and familiarity allow followers to see the weaknesses and faults of the leader much more easily and thus diminish the leader’s heroic aura, and the emotional bias that results from a leader being too familiar with his followers which will impede the process of rational decision making. As a result, we argue that there exists a functional proximity which allows the leader the necessary space in which to perform effective identity work and to hide the backstage aspects of leadership, while also allowing him an emotional buffer zone which will enable him to maintain the ability to see clearly and make rational decisions.

  17. The sooner, the better: exercise outcome proximity and intrinsic motivation.

    Science.gov (United States)

    Evans, M Blair; Cooke, Lisa M; Murray, Robyn A; Wilson, Anne E

    2014-11-01

    Despite evidence that outcomes are highly valued when they are expected sooner rather than further into the future (Ainslie, 1975), limited research effort has been devoted to understanding the role of exercise outcome proximity. The purpose of this study was to examine how temporal proximity to positive outcomes influences exercisers' intrinsic motivation. We expected that focusing people on temporally proximal exercise outcomes would increase intrinsic motivation, especially among low-frequency exercisers. This online experimental study was completed by 135 community exercisers (Mage  = 31.11, SD = 10.29; 62% female) who reported an average of 4.86 exercise bouts per week (SD = 2.12). Participants were randomly assigned to a condition that primed temporally proximal positive exercise outcomes (i.e. experienced during or directly following an exercise bout) or temporally distal outcomes (i.e. experienced after days, months, or years of regular exercise). Participants then reported perceptions of behavioral regulation in exercise. As expected, the proximal exercise outcome condition elicited increased intrinsic regulation among those participants who exercised less frequently (i.e. 1 SD below the mean). This study reveals the importance of considering proximity as an important dimension of exercise outcomes-particularly when promoting intrinsic motivation among relatively infrequent exercisers. © 2014 The International Association of Applied Psychology.

  18. Proximal iliotibial band syndrome: case report

    Directory of Open Access Journals (Sweden)

    Guilherme Guadagnini Falotico

    2013-08-01

    Full Text Available OBJECTIVE: The overuse injuries in the hip joint occur commonly in sports practitioners and currently due to technical advances in diagnostic imaging, especially magnetic resonance imaging (MRI, are often misdiagnosed. Recently, a group of people were reported, all female, with pain and swelling in the pelvic region.T2-weighted MRI showed increased signal in the enthesis of the iliotibial band (ITB along the lower border of the iliac tubercle. We report a case of a 34 year old woman, non-professional runner, with pain at the iliac crest with no history of trauma and whose MRI was compatible with the proximal iliotibial band syndrome.

  19. Noise measurements on proximity effect bridges

    International Nuclear Information System (INIS)

    Decker, S.K.; Mercereau, J.E.

    1975-01-01

    Audio frequency noise density measurements were performed on weakly superconducting proximity effect bridges on using a cooled transformer and room temperature low noise preamplifier. The noise temperature of the measuring system is approximately 4 0 K for a 0.9 Ω resistor. Noise density was measured as a function of bias current and temperature for the bridges. Excess noise above that expected from Johnson noise for a resistor equal to the dynamic resistance of the bridges was observed in the region near the critical current of the device. At high currents compared to the critical current, the noise density closely approaches that given by Johnson noise

  20. TSA-induced DNMT1 down-regulation represses hTERT expression via recruiting CTCF into demethylated core promoter region of hTERT in HCT116.

    Science.gov (United States)

    Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho

    2010-01-01

    Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.

  1. IkappaBalpha polymorphism at promoter region (rs2233408) influences the susceptibility of gastric cancer in Chinese.

    Science.gov (United States)

    Wang, Shiyan; Tian, Linwei; Zeng, Zhirong; Zhang, Mingdong; Wu, Kaichun; Chen, Minhu; Fan, Daiming; Hu, Pinjin; Sung, Joseph J Y; Yu, Jun

    2010-02-05

    Nuclear factor of kappa B inhibitor alpha (I kappaB alpha) protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of I kappaB alpha to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in I kappaB alpha were analyzed by TaqMan SNP genotyping assay. Both rs2233408 T homozygote (TT) and T heterozygotes (TC and TT) had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037), compared with rs2233408 C homozygote (CC). rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014), but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40) (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02). rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006), but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. I kappaB alpha rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.

  2. Variability in the precore and core promoter regions of HBV strains in Morocco: characterization and impact on liver disease progression.

    Directory of Open Access Journals (Sweden)

    Bouchra Kitab

    Full Text Available BACKGROUND: Hepatitis B virus (HBV is one of the most common human pathogens that cause aggressive hepatitis and advanced liver disease (AdLD, including liver cirrhosis and Hepatocellular Carcinoma. The persistence of active HBV replication and liver damage after the loss of hepatitis B e antigen (HBeAg has been frequently associated with mutations in the pre-core (pre-C and core promoter (CP regions of HBV genome that abolish or reduce HBeAg expression. The purpose of this study was to assess the prevalence of pre-C and CP mutations and their impact on the subsequent course of liver disease in Morocco. METHODS/PRINCIPAL FINDINGS: A cohort of 186 patients with HBeAg-negative chronic HBV infection was studied (81 inactive carriers, 69 with active chronic hepatitis, 36 with AdLD. Pre-C and CP mutations were analyzed by PCR-direct sequencing method. The pre-C stop codon G1896A mutation was the most frequent (83.9% and was associated with a lower risk of AdLD development (OR, 0.4; 95% CI, 0.15-1.04; p = 0.04. HBV-DNA levels in patients with G1896A were not significantly different from the other patients carrying wild-type strains (p = 0.84. CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were associated with higher HBV-DNA level and increased liver disease severity. Multiple logistic regression analysis showed that older age (≥ 40 years, male sex, high viral load (>4.3 log(10 IU/mL and CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were independent risk factors for AdLD development. Combination of these mutations was significantly associated with AdLD (OR, 7.52; 95% CI, 4.8-8; p<0.0001. CONCLUSIONS: This study shows for the first time the association of HBV viral load and CP mutations with the severity of liver disease in Moroccan HBV chronic carriers. The examination of CP mutations alone or in combination could be helpful for prediction of the clinical outcome.

  3. IκBα polymorphism at promoter region (rs2233408 influences the susceptibility of gastric cancer in Chinese

    Directory of Open Access Journals (Sweden)

    Sung Joseph JY

    2010-02-01

    Full Text Available Abstract Background Nuclear factor of kappa B inhibitor alpha (IκBα protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of IκBα to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. Methods A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in IκBα were analyzed by TaqMan SNP genotyping assay. Results Both rs2233408 T homozygote (TT and T heterozygotes (TC and TT had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037, compared with rs2233408 C homozygote (CC. rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014, but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40 (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02. rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006, but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. Conclusions IκBα rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.

  4. Congenital anomalies and proximity to landfill sites.

    LENUS (Irish Health Repository)

    Boyle, E

    2004-01-01

    The occurrence of congenital anomalies in proximity to municipal landfill sites in the Eastern Region (counties Dublin, Kildare, Wicklow) was examined by small area (district electoral division), distance and clustering tendancies in relation to 83 landfills, five of which were major sites. The study included 2136 cases of congenital anomaly, 37,487 births and 1423 controls between 1986 and 1990. For the more populous areas of the region 50% of the population lived within 2-3 km of a landfill and within 4-5 km for more rural areas. In the area-level analysis, the standardised prevalence ratios, empirical and full Bayesian modelling, and Kulldorff\\'s spatial scan statistic found no association between the residential area of cases and location of landfills. In the case control analysis, the mean distance of cases and controls from the nearest landfill was similar. The odds ratios of cases compared to controls for increasing distances from all landfills and major landfills showed no significant difference from the baseline value of 1. The kernel and K methods showed no tendency of cases to cluster in relationship to landfills. In conclusion, congenital anomalies were not found to occur more commonly in proximity to municipal landfills.

  5. The first year experience of occupational therapy students at an Australian regional university: Promoting student retention and developing a regional and remote workforce.

    Science.gov (United States)

    Boehm, Jackie; Cordier, Reinie; Thomas, Yvonne; Tanner, Bronwyn; Salata, Karen

    2017-02-01

    Student retention at regional universities is important in addressing regional and remote workforce shortages. Students attending regional universities are more likely to work in regional areas. First year experience at university plays a key role in student retention. This study aimed to explore factors influencing the first year experience of occupational therapy students at a regional Australian university. Surveys were administered to 58 second year occupational therapy students in the first week of second year. Data were analysed using descriptive statistics, inferential statistics (Pearson χ 2 ; Spearman rho) and summarising descriptive responses. An Australian regional university. Second year undergraduate occupational therapy students. Factors influencing students' decisions to study and continue studying occupational therapy; factors enhancing first year experience of university. Fifty-four students completed the survey (93.1%). A quarter (25.9%) of students considered leaving the course during the first year. The primary influence for continuing was the teaching and learning experience. Most valued supports were orientation week (36.7%) and the first year coordinator (36.7%). The importance of the first year experience in retaining occupational therapy students is highlighted. Engagement with other students and staff and academic support are important factors in facilitating student retention. It is important to understand the unique factors influencing students' decisions, particularly those from regional and remote areas, to enter and continue in tertiary education to assist in implementing supports and strategies to improve student retention. © 2015 National Rural Health Alliance Inc.

  6. Regional differences in awareness of tobacco advertising and promotion in China: findings from the ITC China Survey.

    Science.gov (United States)

    Yang, Yan; Li, Lin; Yong, Hua-Hie; Borland, Ron; Wu, Xi; Li, Qiang; Wu, Changbao; Foong, Kin

    2010-04-01

    To examine whether levels of, and factors related to, awareness of tobacco advertising and promotion differ across six cities in China. Data from wave 1 of the International Tobacco Control (ITC) China Survey (April to August 2006) were analysed. The ITC China Survey employed a multistage sampling design in Beijing, Shenyang, Shanghai, Changsha, Guangzhou and Yinchuan. Face-to-face interviews were conducted with a total of 4763 smokers and 1259 non-smokers. Multivariate logistic regression models were used to identify factors associated with awareness of tobacco advertising and promotion. The overall levels of noticing advertisements varied considerably by city. Cities reporting lower levels of advertising tended to report higher levels of point of sale activity. Noticing tobacco industry promotions was associated with more positive attitudes to tobacco companies. The awareness of tobacco advertising and promotional activities was not homogeneous across the six Chinese cities, suggesting variations in the tobacco industry's activities and the diversity of implementing a central set of laws to restrict tobacco promotion. This study clearly demonstrates the need to work with the implementation agencies if national laws are to be properly enforced.

  7. Identification of the promoter region required for human adiponectin gene transcription: Association with CCAAT/enhancer binding protein-β and tumor necrosis factor-α

    International Nuclear Information System (INIS)

    Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi

    2005-01-01

    Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β

  8. Promoter-region hypermethylation and expression downregulation of Yy1 (Yin yang 1) in preneoplastic liver lesions in a thioacetamide rat hepatocarcinogenesis model

    International Nuclear Information System (INIS)

    Abe, Hajime; Ogawa, Takashi; Wang, Liyun; Kimura, Masayuki; Tanaka, Takeshi; Morita, Reiko; Yoshida, Toshinori; Shibutani, Makoto

    2014-01-01

    Thioacetamide (TAA) has been used to develop a rodent model for hepatocarcinogenesis. To determine the genes with epigenetic modifications in early hepatocarcinogenesis, we did a genome-wide scan for hypermethylated promoter regions using CpG island microarrays in TAA-promoted rat liver tissue. Eight genes were selected based on the microarray profile; of these, Yy1 and Wdr45b were confirmed to be hypermethylated by methylation-specific polymerase chain reaction (PCR) and pyrosequencing and downregulated by real-time reverse transcription PCR. Non-neoplastic liver cells had nuclear Yy1 immunoreactivity, while preneoplastic foci with glutathione S-transferase placental form (GST-P) immunoreactivity had decreased Yy1 immunoreactivity. The incidence of these foci was proportional to the dose of TAA administered. Co-expression analysis of gene products downstream of Yy1 revealed increased nuclear phospho-c-Myc + foci as well as nuclear and cytoplasmic p21 Cip1+ foci in Yy1 − or GST-P + foci in response to TAA-promotion dose. Although the absolute number of cells was low, the incidence of death receptor 5 − foci was increased in Yy1 − foci in proportion to the TAA dose. Yy1 − /GST-P + foci revealed a higher number of proliferating cell nuclear antigen (PCNA)-immunoreactive cells than Yy1 + /GST-P + foci, while cleaved caspase-3 + cells were unchanged between Yy1 – /GST-P + and Yy1 + /GST-P + foci. In the case of Wdr45b, most GST-P + foci were Wdr45b – and were not increased by TAA promotion. These results suggest involvement of Yy1 in the epigenetic gene regulation at the early stages of TAA promoted cell proliferation and concomitant cell cycle arrest in preneoplastic lesions. - Highlights: • Epigenetically downregulated genes were searched in TAA-promnoted rat livers. • Yy1 and Wdr45b showed promoter-region hypermethylation and mRNA downregulation. • TAA promoted increase of preneoplastic Yy1 – /GST-P + foci showing high proliferation. • TAA

  9. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  10. PTSD and DNA Methylation in Select Immune Function Gene Promoter Regions: A Repeated Measures Case-control Study of U.S. Military Service Members

    Science.gov (United States)

    2013-06-24

    other relevant exposures which may influ- ence DNA methylation , such as dietary factors ( folate , vitamin B12 intake) (Fenech, 2001; Piyathilake and...ARTICLE published: 24 June 2013 doi: 10.3389/fpsyt.2013.00056 PTSD and DNA methylation in select immune function gene promoter regions: a repeated measures...largely unknown. Dis- tinct expression signatures for PTSD have been found, in particular for immune activation transcripts. DNA methylation may be

  11. Regional economic impacts of the unconventional promotion of natural gas (Hydraulic Fracturing). Preliminary study; Regionaloekonomische Auswirkungen der unkonventionellen Erdgasfoerderung (Hydraulic Fracturing). Vorstudie

    Energy Technology Data Exchange (ETDEWEB)

    Bizer, Kilian; Bossmeyer, Christoph

    2012-07-01

    Actually, there is a controversial public discussion on the exploitation of conventional natural gas by means of hydraulic fracturing (Fracking). The contribution under consideration examines the geologic, toxicological or technical as well as legal points of contact with respect to the different effects for the actor groups. Based on the existing scientific realizations, the regional economic effects of the fracking technology and the subsequent promotion of unconventional natural gas deposits have to be worked out.

  12. ProxImaL: efficient image optimization using proximal algorithms

    KAUST Repository

    Heide, Felix

    2016-07-11

    Computational photography systems are becoming increasingly diverse, while computational resources-for example on mobile platforms-are rapidly increasing. As diverse as these camera systems may be, slightly different variants of the underlying image processing tasks, such as demosaicking, deconvolution, denoising, inpainting, image fusion, and alignment, are shared between all of these systems. Formal optimization methods have recently been demonstrated to achieve state-of-the-art quality for many of these applications. Unfortunately, different combinations of natural image priors and optimization algorithms may be optimal for different problems, and implementing and testing each combination is currently a time-consuming and error-prone process. ProxImaL is a domain-specific language and compiler for image optimization problems that makes it easy to experiment with different problem formulations and algorithm choices. The language uses proximal operators as the fundamental building blocks of a variety of linear and nonlinear image formation models and cost functions, advanced image priors, and noise models. The compiler intelligently chooses the best way to translate a problem formulation and choice of optimization algorithm into an efficient solver implementation. In applications to the image processing pipeline, deconvolution in the presence of Poisson-distributed shot noise, and burst denoising, we show that a few lines of ProxImaL code can generate highly efficient solvers that achieve state-of-the-art results. We also show applications to the nonlinear and nonconvex problem of phase retrieval.

  13. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset.

    Science.gov (United States)

    Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A

    2014-01-01

    The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  14. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

    Directory of Open Access Journals (Sweden)

    Elena V. Ignatieva

    2014-03-01

    Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  15. Identification, occurrence, and validation of DRE and ABRE Cis-regulatory motifs in the promoter regions of genes of Arabidopsis thaliana.

    Science.gov (United States)

    Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok

    2014-04-01

    Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.

  16. International Regional Patterns of R&D Networks Involving Low Tech SMEs

    Directory of Open Access Journals (Sweden)

    Aurora A.C. Teixeira

    2013-03-01

    Full Text Available A large number of studies have emphasized the spatial proximity of economic activity and its relation to the spatiality of knowledge creation in various types of connections. Far less attention has been paid to the understanding of the determinants of ‘cultural’ and geographical proximity in international R&D cooperation projects involving SMEs and the role of the quality of the Regional Innovation System (RIS. Using a database of completed European Cooperative Research projects, we conclude that: 1 technologically more complex projects are more likely to involve ‘culturally’ and geographically distant partners; 2 RIS related variables determine ‘cultural’ proximity but not geographical proximity; 3 at first sight surprisingly, international cooperation projects involving the 1st promoters of innovation-led regions (high patent propensity and high human capital levels are culturally more distant.

  17. Isolation and analysis of a multifunctional triterpene synthase KcMS promoter region from mangrove plant kandelia candel

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of Kandelia candel KcMS gene has previously been cloned and encoded a multifunctional triterpene synthase. In this study, the KcMS gene promoter was cloned through Genome walking, sequenced, and analyzed. A 1,358 bp genomic DNA fragment of KcMS promoter was obtained. PLACE and PlantCARE analysis of the KcMS promoter revealed that there was some regulatory elements in response to environmental signals and involved in the regulation of gene expression. Results showed that four kinds of elements are regulated by hormone binding, namely 2 MeJA-responsiveness elements (CGTCA-motif and TGACG-motif), the ABRE (TACGTG) involved in abscisic acid responsiveness, gibberellin-related GARE-motif (AAACAGA), and the TGA-element (AACGAC) as an auxin-responsive element. Several elements in the KcMS have been shown in other plants to be responsive to abiotic stress. These motifs were MBS (CAACTG), TC-rich repeats, and eight light responsive elements. The KcMS promoter was also involved in the activation of defense genes in plants such as HSE (AAAAAATTC) and four circadian control elements (CAANNNNATC). The presence of multipotential regulatory motifs suggested that KcMS may be involved in regulation of plant tolerance to several types of stresses.

  18. Promoting sustainable potato agriculture in the Andean region by supplemental calcium nutrition and breeding for frost tolerance

    Science.gov (United States)

    Collaborative research in Peru sought to promote sustainable potato production and, mitigate adverse impacts of climate change through two approaches: first calcium amendments to increase crop yield and, second to enhance frost tolerance in native potatoes. All the multi-year, multi-location experim...

  19. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    for the ACBP DR-1 element. Addition of peroxisome proliferators (PP) to H4IIEC3 rat hepatoma cells led to an increase in the ACBP mRNA level, indicating that the DR-1 element could be a functional peroxisome proliferator responsive element (PPRE). Analysis of the ACBP promoter by transient transfection showed...

  20. DNA methylation of specific CpG sites in the promoter region regulates the transcription of the mouse oxytocin receptor.

    Directory of Open Access Journals (Sweden)

    Shimrat Mamrut

    Full Text Available Oxytocin is a peptide hormone, well known for its role in labor and suckling, and most recently for its involvement in mammalian social behavior. All central and peripheral actions of oxytocin are mediated through the oxytocin receptor, which is the product of a single gene. Transcription of the oxytocin receptor is subject to regulation by gonadal steroid hormones, and is profoundly elevated in the uterus and mammary glands during parturition. DNA methylation is a major epigenetic mechanism that regulates gene transcription, and has been linked to reduced expression of the oxytocin receptor in individuals with autism. Here, we hypothesized that transcription of the mouse oxytocin receptor is regulated by DNA methylation of specific sites in its promoter, in a tissue-specific manner. Hypothalamus-derived GT1-7, and mammary-derived 4T1 murine cell lines displayed negative correlations between oxytocin receptor transcription and methylation of the gene promoter, and demethylation caused a significant enhancement of oxytocin receptor transcription in 4T1 cells. Using a reporter gene assay, we showed that methylation of specific sites in the gene promoter, including an estrogen response element, significantly inhibits transcription. Furthermore, methylation of the oxytocin receptor promoter was found to be differentially correlated with oxytocin receptor expression in mammary glands and the uterus of virgin and post-partum mice, suggesting that it plays a distinct role in oxytocin receptor transcription among tissues and under different physiological conditions. Together, these results support the hypothesis that the expression of the mouse oxytocin receptor gene is epigenetically regulated by DNA methylation of its promoter.

  1. Genome-wide Anaplasma phagocytophilum AnkA-DNA interactions are enriched in intergenic regions and gene promoters and correlate with infection-induced differential gene expression.

    Directory of Open Access Journals (Sweden)

    J Stephen Dumler

    2016-09-01

    Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.

  2. Symmetry-based reciprocity: evolutionary constraints on a proximate mechanism.

    Science.gov (United States)

    Campennì, Marco; Schino, Gabriele

    2016-01-01

    Background. While the evolution of reciprocal cooperation has attracted an enormous attention, the proximate mechanisms underlying the ability of animals to cooperate reciprocally are comparatively neglected. Symmetry-based reciprocity is a hypothetical proximate mechanism that has been suggested to be widespread among cognitively unsophisticated animals. Methods. We developed two agent-based models of symmetry-based reciprocity (one relying on an arbitrary tag and the other on interindividual proximity) and tested their ability both to reproduce significant emergent features of cooperation in group living animals and to promote the evolution of cooperation. Results. Populations formed by agents adopting symmetry-based reciprocity showed differentiated "social relationships" and a positive correlation between cooperation given and received: two common aspects of animal cooperation. However, when reproduction and selection across multiple generations were added to the models, agents adopting symmetry-based reciprocity were outcompeted by selfish agents that never cooperated. Discussion. In order to evolve, hypothetical proximate mechanisms must be able to stand competition from alternative strategies. While the results of our simulations require confirmation using analytical methods, we provisionally suggest symmetry-based reciprocity is to be abandoned as a possible proximate mechanism underlying the ability of animals to reciprocate cooperative interactions.

  3. Building an Entrepreneurial University in Brazil: The Role and Potential of University-Industry Linkages in Promoting Regional Economic Development

    Science.gov (United States)

    Amaral, Marcelo; Ferreira, Andre; Teodoro, Pitias

    2011-01-01

    This study is part of a broader research project, conducted by the Triple Helix Research Group--Brazil, focusing on university-industry-government linkages in the state of Rio de Janeiro. The case study reported here is that of the Regional University of Volta Redonda: the aim was to develop an understanding of how a regional university can be…

  4. Proximity effect at Millikelvin temperatures

    International Nuclear Information System (INIS)

    Mota, A.C.

    1986-01-01

    Proximity effects have been studied extensively for the past 25 years. Typically, they are in films several thousand angstroms thick at temperatures not so far below T/sub CNS/, the transition temperature of the NS system. Interesting is, however, the proximity effect at temperatures much lower than T/sub CNS/. In this case, the Cooper-pair amplitudes are not small and very long pair penetration lengths into the normal metal can be expected. Thus, we have observed pair penetration lengths. For these investigations very suitable specimens are commercial wires of one filament of NbTi or Nb embedded in a copper matrix. The reasons are the high transmission coefficient at the interface between the copper and the superconductor and the fact that the copper in these commercial wires is rather clean with electron free paths between 5 to 10 μm long. In this paper, the magnetic properties of thick proximity systems in the range of temperatures between T/sub CNS/ and 5 x 10/sup -4/ T/sub CNS/ in both low and high magnetic fields are discussed

  5. Promoting biogas production and using it as transport fuel in the Helsinki region; Suunnitelma liikennebiokaasun tuotannon ja kaeytoen edistaemiseksi Helsingin seudulla

    Energy Technology Data Exchange (ETDEWEB)

    Rasi, S.; Havukainen, J.; Uusitalo, V.; Andersson, R.; Manninen, K.; Aro-Heinilae, E.; Rintala, J.

    2012-11-01

    The main objective of the project was to promote biogas production and its use as transport fuel. The aims in the four Finnish and two Estonian case areas were to reduce the amount and improve the sustainable use of waste and sludge, to promote biogas production, to start biogas use as transport fuel and to provide tools for implementing the aims. The total biomethane potential in the Helsinki region corresponds to approximately 450 GWh/a. The most potential user for biomethane is public transport. The total amount of biomethane would suffice for 80% of the busses operating in the Helsinki region. Using biogas as a transport fuel instead of energy production in the Helsinki region would result in emission reductions (13 000 t{sub CO2,eq}/a). However if the fuel replacing biogas in energy production would be renewable, the emission reductions would be significantly greater. The economical assessment indicates that the production of biogas is economically feasible if all the produced gas can be sold. Biogas produced near the natural gas grid can also be transported to the Helsinki region where there are better possibilities to find uses for it. In this way, for example, gas that is produced in Kymenlaakso but is not consumed there can be transported via the natural gas grid, assuming that the production plant is reasonably close to the grid. (orig.)

  6. Health-care users, key community informants and primary health care workers' views on health, health promotion, health assets and deficits: qualitative study in seven Spanish regions.

    Science.gov (United States)

    Pons-Vigués, Mariona; Berenguera, Anna; Coma-Auli, Núria; Pombo-Ramos, Haizea; March, Sebastià; Asensio-Martínez, Angela; Moreno-Peral, Patricia; Mora-Simón, Sara; Martínez-Andrés, Maria; Pujol-Ribera, Enriqueta

    2017-06-13

    Although some articles have analysed the definitions of health and health promotion from the perspective of health-care users and health care professionals, no published studies include the simultaneous participation of health-care users, primary health care professionals and key community informants. Understanding the perception of health and health promotion amongst these different stakeholders is crucial for the design and implementation of successful, equitable and sustainable measures that improve the health and wellbeing of populations. Furthermore, the identification of different health assets and deficits by the different informants will generate new evidence to promote healthy behaviours, improve community health and wellbeing and reduce preventable inequalities. The objective of this study is to explore the concept of health and health promotion and to compare health assets and deficits as identified by health-care users, key community informants and primary health care workers with the ultimate purpose to collect the necessary data for the design and implementation of a successful health promotion intervention. A descriptive-interpretive qualitative research was conducted with 276 participants from 14 primary care centres of 7 Spanish regions. Theoretical sampling was used for selection. We organized 11 discussion groups and 2 triangular groups with health-care users; 30 semi-structured interviews with key community informants; and 14 discussion groups with primary health care workers. A thematic content analysis was carried out. Health-care users and key community informants agree that health is a complex, broad, multifactorial concept that encompasses several interrelated dimensions (physical, psychological-emotional, social, occupational, intellectual, spiritual and environmental). The three participants' profiles consider health promotion indispensable despite defining it as complex and vague. In fact, most health-care users admit to having

  7. Omeprazole promotes proximal duodenal mucosal bicarbonate secretion in humans

    DEFF Research Database (Denmark)

    Mertz-Nielsen, Anette; Hillingsø, J; Bukhave, Klaus

    1996-01-01

    this incidental finding is explained by more potent gastric acid inhibition by omeprazole or might be caused by the different mode of drug action. Basal and stimulated gastric and duodenal bicarbonate secretion rates were measured in the same subjects in control experiments (n=17) and after pretreatment with high......H 6.9 v 6.8; p>0.05). Omeprazole caused higher rates of basal (mean (SEM)) (597 (48) v 351 (39) mu mol/h; pstimulated (834 (72) v 474 (66) mu mol/h; pstimulated (3351 (678) v 2550 (456) mu mol/h; p>0.05) duodenal bicarbonate secretion compared with control...... experiments. Also the combination of omeprazole and ranitidine increased (p=0.05) duodenal bicarbonate secretion, while ranitidine alone caused no change in either basal or stimulated secretion. In the stomach basal as well as vagally stimulated bicarbonate secretion was independent of the means of acid...

  8. Omeprazole promotes proximal duodenal mucosal bicarbonate secretion in humans

    DEFF Research Database (Denmark)

    Mertz-Nielsen, A; Hillingsø, Jens; Bukhave, K

    1996-01-01

    with control experiments. Also the combination of omeprazole and ranitidine increased (p = 0.05) duodenal bicarbonate secretion, while ranitidine alone caused no change in either basal or stimulated secretion. In the stomach basal as well as vagally stimulated bicarbonate secretion was independent of the means...

  9. Attitudes, Beliefs and Predictors of Male Circumcision Promotion among Medical University Students in a Traditionally Non-Circumcising Region

    Directory of Open Access Journals (Sweden)

    Maria Ganczak

    2017-09-01

    Full Text Available Objective: To evaluate the beliefs of medical university students regarding male circumcision (MC, as well as attitudes and the predictors of its promotion in the case of adults at risk of HIV. Methods: A cross-sectional survey was conducted between 2013–2016 at the Medical University in Szczecin, Poland, among final year Polish/foreign students from Northern Europe, using a standardized questionnaire. Results: There were 539 participants, median age 25 years, 40.8% males, and 66.8% were Polish nationals. The MC rate was 16.7%. Regarding HIV/AIDS knowledge, 66.6% of the students scored more than 75%; and, 34.2% knew that MC reduces the risk of HIV infection. One in eleven respondents (9.1% believed that circumcised men felt more intense sexual pleasure. More than half of the respondents (54.8% declared that they would recommend MC to adult patients at risk for HIV. The belief that circumcised men felt more intense sexual pleasure, and knowledge on MC regarding HIV risk reduction was associated with greater odds of recommending adult MC (OR = 3.35 and OR = 2.13, respectively. Conclusions: Poor knowledge of its benefits and a low willingness to promote the procedure—strongly dependent on personal beliefs—suggest that medical students may need additional training to help them to discuss MC more openly with adult men at risk for HIV infection. Knowledge may be an effective tool when making decisions regarding MC promotion.

  10. Allelic variation of the inducible costimulator (ICOS) gene: detection of polymorphisms, analysis of the promoter region, and extended haplotype estimation

    DEFF Research Database (Denmark)

    Andersen, A.D.H.; Lange, Marianne; Lillevang, S.T.

    2003-01-01

    The human chromosome region 2q33 including the three costimulatory molecules CD28, CTLA-4 and ICOS, has been subject to much attention due to its linkage to a number of autoimmune diseases. The search for the causal relationship of this linkage has revealed several polymorphisms, but no variations...... in the amino acid sequences except for one polymorphism in, the leader sequence of CTLA-4. In the present study, we examined the ICOS gene of an unrelated group of healthy donors from the Danish population. We were able to report 16 intronic SNP, one intronic G-insert and two repeat regions in intron 4......, consistent with the [T](n) and the [GT](n) regions reported in a Japanese study. Putative haplotypes for the established SNP and repeat polymorphisms have been estimated by computational analysis. Sequencing of similar to3500 by of the upstream region of ICOS revealed an additional eight SNP of which two...

  11. 3. Promotion of environment protection of sea and near-sea region. Swinoujscie 12-14 October 1994

    International Nuclear Information System (INIS)

    1994-01-01

    The great number of problems connected with environment protection near shore marine zone, beach protection, effluent transport in ground and surface waters in region of North Port of Poland as well as technical solutions of water purification and legal problems have been discussed during the conference. All observations and experimental works have been carried out in that region. Among reported works two of them have been devoted to application of nuclear methods in interesting merit

  12. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  13. Promoter trans-activation of protooncogenes c-fos and c-myc, but not c-Ha-ras, by products of adenovirus early region 1A

    International Nuclear Information System (INIS)

    Sassone-Corsi, P.; Borrelli, E.

    1987-01-01

    The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection

  14. A Peptide Derived from the HIV-1 gp120 Coreceptor-Binding Region Promotes Formation of PAP248-286 Amyloid Fibrils to Enhance HIV-1 Infection.

    Directory of Open Access Journals (Sweden)

    Jinquan Chen

    Full Text Available Semen is a major vehicle for HIV transmission. Prostatic acid phosphatase (PAP fragments, such as PAP248-286, in human semen can form amyloid fibrils to enhance HIV infection. Other endogenous or exogenous factors present during sexual intercourse have also been reported to promote the formation of seminal amyloid fibrils.Here, we demonstrated that a synthetic 15-residue peptide derived from the HIV-1 gp120 coreceptor-binding region, designated enhancing peptide 2 (EP2, can rapidly self-assemble into nanofibers. These EP2-derivated nanofibers promptly accelerated the formation of semen amyloid fibrils by PAP248-286, as shown by Thioflavin T (ThT and Congo red assays. The amyloid fibrils presented similar morphology, assessed via transmission electron microscopy (TEM, in the presence or absence of EP2. Circular dichroism (CD spectroscopy revealed that EP2 accelerates PAP248-286 amyloid fibril formation by promoting the structural transition of PAP248-286 from a random coil into a cross-β-sheet. Newly formed semen amyloid fibrils effectively enhanced HIV-1 infection in TZM-bl cells and U87 cells by promoting the binding of HIV-1 virions to target cells.Nanofibers composed of EP2 promote the formation of PAP248-286 amyloid fibrils and enhance HIV-1 infection.

  15. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    International Nuclear Information System (INIS)

    Ghazal, P.; Lubon, H.; Hennighausen, L.

    1988-01-01

    Repeat sequence motifs as well as unique sequences between nucleotides -150 and -22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides -91 and -65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene

  16. [Drug registries: post-marketing evaluation of the benefit-risk profile and promotion of appropriateness. The regional point of view].

    Science.gov (United States)

    Martelli, Luisa; Venegoni, Mauro

    2013-06-01

    Italian Regions and the Italian regulatory agency share a common interest in promoting the appropriateness of drug use, containing drug expenditure and acquiring additional evidence on the effectiveness and safety of drugs. Drug registries can help attaining these objectives. Specifically, the registries implemented in Italy were able to cover the first two objectives, whereas some critical issues were raised on the third one. For instance, the data recorded in the registries are not available at regional level to conduct safety and effectiveness investigations. This is a paradox, when considering that drugs included in the registries have a risk-benefit profile that is only partially defined at the moment of marketing. Currently, researchers and regions can conduct epidemiological research (cohort and case control studies), on the basis of record-linkage procedures, on all drugs prescribed in general practice (which are older drugs with a better defined risk-benefit profile). The expected outcomes of registries should be more clearly defined: when the main aim is to promote appropriateness, the recording of only a very limited amount of data should be required (to avoid a bureaucratic burden on clinicians).The Italian centers of the ENCePP network might play an important role in planning and conducting drug registries: through the presence in the steering committees of the registries, and in conducting epidemiological studies that make the most of this powerful instrument.

  17. Equilibrium properties of proximity effect

    International Nuclear Information System (INIS)

    Esteve, D.; Pothier, H.; Gueron, S.; Birge, N.O.; Devoret, M.

    1996-01-01

    The proximity effect in diffusive normal-superconducting (NS) nano-structures is described by the Usadel equations for the electron pair correlations. We show that these equations obey a variational principle with a potential which generalizes the Ginzburg-Landau energy functional. We discuss simple examples of NS circuits using this formalism. In order to test the theoretical predictions of the Usadel equations, we have measured the density of states as a function of energy on a long N wire in contact with a S wire at one end, at different distances from the NS interface. (authors)

  18. Equilibrium properties of proximity effect

    Energy Technology Data Exchange (ETDEWEB)

    Esteve, D.; Pothier, H.; Gueron, S.; Birge, N.O.; Devoret, M.

    1996-12-31

    The proximity effect in diffusive normal-superconducting (NS) nano-structures is described by the Usadel equations for the electron pair correlations. We show that these equations obey a variational principle with a potential which generalizes the Ginzburg-Landau energy functional. We discuss simple examples of NS circuits using this formalism. In order to test the theoretical predictions of the Usadel equations, we have measured the density of states as a function of energy on a long N wire in contact with a S wire at one end, at different distances from the NS interface. (authors). 12 refs.

  19. CRA-1 uncovers a double-strand break-dependent pathway promoting the assembly of central region proteins on chromosome axes during C. elegans meiosis.

    Science.gov (United States)

    Smolikov, Sarit; Schild-Prüfert, Kristina; Colaiácovo, Mónica P

    2008-06-06

    The synaptonemal complex (SC), a tripartite proteinaceous structure that forms between homologous chromosomes during meiosis, is crucial for faithful chromosome segregation. Here we identify CRA-1, a novel and conserved protein that is required for the assembly of the central region of the SC during C. elegans meiosis. In the absence of CRA-1, central region components fail to extensively localize onto chromosomes at early prophase and instead mostly surround the chromatin at this stage. Later in prophase, central region proteins polymerize along chromosome axes, but for the most part fail to connect the axes of paired homologous chromosomes. This defect results in an inability to stabilize homologous pairing interactions, altered double-strand break (DSB) repair progression, and a lack of chiasmata. Surprisingly, DSB formation and repair are required to promote the polymerization of the central region components along meiotic chromosome axes in cra-1 mutants. In the absence of both CRA-1 and any one of the C. elegans homologs of SPO11, MRE11, RAD51, or MSH5, the polymerization observed along chromosome axes is perturbed, resulting in the formation of aggregates of the SC central region proteins. While radiation-induced DSBs rescue this polymerization in cra-1; spo-11 mutants, they fail to do so in cra-1; mre-11, cra-1; rad-51, and cra-1; msh-5 mutants. Taken together, our studies place CRA-1 as a key component in promoting the assembly of a tripartite SC structure. Moreover, they reveal a scenario in which DSB formation and repair can drive the polymerization of SC components along chromosome axes in C. elegans.

  20. High-throughput determination of RNA structure by proximity ligation.

    Science.gov (United States)

    Ramani, Vijay; Qiu, Ruolan; Shendure, Jay

    2015-09-01

    We present an unbiased method to globally resolve RNA structures through pairwise contact measurements between interacting regions. RNA proximity ligation (RPL) uses proximity ligation of native RNA followed by deep sequencing to yield chimeric reads with ligation junctions in the vicinity of structurally proximate bases. We apply RPL in both baker's yeast (Saccharomyces cerevisiae) and human cells and generate contact probability maps for ribosomal and other abundant RNAs, including yeast snoRNAs, the RNA subunit of the signal recognition particle and the yeast U2 spliceosomal RNA homolog. RPL measurements correlate with established secondary structures for these RNA molecules, including stem-loop structures and long-range pseudoknots. We anticipate that RPL will complement the current repertoire of computational and experimental approaches in enabling the high-throughput determination of secondary and tertiary RNA structures.

  1. Sequential Proximal Tibial Stress Fractures associated with Prolonged usage of Methotrexate and Corticosteroids: A Case Report

    Directory of Open Access Journals (Sweden)

    Tan TJL

    2015-11-01

    Full Text Available Stress fractures of the proximal tibia metaphysis are rare in the elderly. We present a case of a 65-year old male who developed sequential proximal tibia stress fractures associated with prolonged usage of methotrexate and prednisolone within a span of 18 months. Magnetic Resonance Imaging revealed an incomplete stress fracture involving the medial proximal tibial region. The patient was treated with stemmed total knee arthroplasty (TKA bilaterally. Stress fractures should be considered in patients with atypical knee pain who have a history of methotrexate and prednisolone usage. TKA is an effective treatment in stress fractures of the proximal tibia.

  2. E4orf1 Enhances Glucose Uptake Independent of Proximal Insulin Signaling.

    Science.gov (United States)

    Na, Ha-Na; Hegde, Vijay; Dubuisson, Olga; Dhurandhar, Nikhil V

    2016-01-01

    Impaired proximal insulin signaling is often present in diabetes. Hence, approaches to enhance glucose disposal independent of proximal insulin signaling are desirable. Evidence indicates that Adenovirus-derived E4orf1 protein may offer such an approach. This study determined if E4orf1 improves insulin sensitivity and downregulates proximal insulin signaling in vivo and enhances cellular glucose uptake independent of proximal insulin signaling in vitro. High fat fed mice were injected with a retrovirus plasmid expressing E4orf1, or a null vector. E4orf1 significantly improved insulin sensitivity in response to a glucose load. Yet, their proximal insulin signaling in fat depots was impaired, as indicated by reduced tyrosine phosphorylation of insulin receptor (IR), and significantly increased abundance of ectonucleotide pyrophosphatase/phosphodiesterase-1 (ENPP1). In 3T3-L1 pre-adipocytes E4orf1 expression impaired proximal insulin signaling. Whereas, treatment with rosiglitazone reduced ENPP1 abundance. Unaffected by IR-KD (insulin receptor knockdown) with siRNA, E4orf1 significantly up-regulated distal insulin signaling pathway and enhanced cellular glucose uptake. In vivo, E4orf1 impairs proximal insulin signaling in fat depots yet improves glycemic control. This is probably explained by the ability of E4orf1 to promote cellular glucose uptake independent of proximal insulin signaling. E4orf1 may provide a therapeutic template to enhance glucose disposal in the presence of impaired proximal insulin signaling.

  3. E4orf1 Enhances Glucose Uptake Independent of Proximal Insulin Signaling.

    Directory of Open Access Journals (Sweden)

    Ha-Na Na

    Full Text Available Impaired proximal insulin signaling is often present in diabetes. Hence, approaches to enhance glucose disposal independent of proximal insulin signaling are desirable. Evidence indicates that Adenovirus-derived E4orf1 protein may offer such an approach. This study determined if E4orf1 improves insulin sensitivity and downregulates proximal insulin signaling in vivo and enhances cellular glucose uptake independent of proximal insulin signaling in vitro. High fat fed mice were injected with a retrovirus plasmid expressing E4orf1, or a null vector. E4orf1 significantly improved insulin sensitivity in response to a glucose load. Yet, their proximal insulin signaling in fat depots was impaired, as indicated by reduced tyrosine phosphorylation of insulin receptor (IR, and significantly increased abundance of ectonucleotide pyrophosphatase/phosphodiesterase-1 (ENPP1. In 3T3-L1 pre-adipocytes E4orf1 expression impaired proximal insulin signaling. Whereas, treatment with rosiglitazone reduced ENPP1 abundance. Unaffected by IR-KD (insulin receptor knockdown with siRNA, E4orf1 significantly up-regulated distal insulin signaling pathway and enhanced cellular glucose uptake. In vivo, E4orf1 impairs proximal insulin signaling in fat depots yet improves glycemic control. This is probably explained by the ability of E4orf1 to promote cellular glucose uptake independent of proximal insulin signaling. E4orf1 may provide a therapeutic template to enhance glucose disposal in the presence of impaired proximal insulin signaling.

  4. Sequence analysis of the Epstein-Barr virus (EBV) latent membrane protein-1 gene and promoter region

    DEFF Research Database (Denmark)

    Sandvej, Kristian; Gratama, J W; Munch, M

    1997-01-01

    Sequence variations in the Epstein-Barr virus (EBV) encoded latent membrane protein-1 (LMP-1) gene have been described in a Chinese nasopharyngeal carcinoma-derived isolate (CAO), and in viral isolates from various EBV-associated tumors. It has been suggested that these genetic changes, which...... include loss of a Xho I restriction site (position 169425) and a C-terminal 30-base pair (bp) deletion (position 168287-168256), define EBV genotypes associated with increased tumorigenicity or with disease among particular geographic populations. To determine the frequency of LMP-1 variations in European...... wild-type virus isolates, we sequenced the LMP-1 promoter and gene in EBV from lymphoblastoid cell lines from healthy carriers and patients without EBV-associated disease. Sequence changes were often present, and defined at least four main groups of viral isolates, which we designate Groups A through D...

  5. Temporal transcription of the lactococcal temperate phage TP901-1 and DNA sequence of the early promoter region

    DEFF Research Database (Denmark)

    Madsen, Hans Peter Lynge; Hammer, Karin

    1998-01-01

    to a phage repressor, a single-stranded DNA-binding protein, a topoisomerase, a Cro-like protein and two other phage proteins of unknown function were detected. The gene arrangement in the early transcribed region of TP901-1 thus consists of two transcriptional units: one from PR containing four genes......, of which at least two (the integrase gene and putative repressor) are needed for lysogeny, and the divergent and longer transcriptional unit from PL, presumably encoding functions required for the lytic life cycle. ORFs with homology to proteins involved in DNA replication were identified on the latter......Transcriptional analysis by Northern blotting identified clusters of early, middle and late transcribed regions of the temperate lactococcal bacteriophage TP901-1 during one-step growth experiments. The latent period was found to be 65 min and the burst size 40 +/- 10. The eight early transcripts...

  6. Effect of price and in-store promotion on sales: a study of distinct regions in an emerging market

    OpenAIRE

    Sanchez, Juan Machado

    2016-01-01

    Increasing competition caused by globalization, high growth of some emerging markets and stagnation of developed economies motivate Consumer Packaged Goods (CPGs) manufacturers to drive their attention to emerging markets. These companies are expected to adapt their marketing activities to the particularities of these markets in order to succeed. In a country classified as emerging market, regions are not alike and some contrasts can be identified. In addition, divergences of marketing variab...

  7. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    International Nuclear Information System (INIS)

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-01-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection

  8. ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumor tissue in breast cancer patients

    International Nuclear Information System (INIS)

    Martínez-Galán, Joaquina; Ríos, Sandra; Delgado, Juan Ramón; Torres-Torres, Blanca; Núñez, María Isabel; López-Peñalver, Jesús; Del Moral, Rosario; Ruiz De Almodóvar, José Mariano; Menjón, Salomón; Concha, Ángel; Chamorro, Clara

    2014-01-01

    Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment

  9. Realities of proximity facility siting

    International Nuclear Information System (INIS)

    DeMott, D.L.

    1981-01-01

    Numerous commercial nuclear power plant sites have 2 to 3 reactors located together, and a group of Facilities with capabilities for fuel fabrication, a nuclear reactor, a storage area for spent fuel, and a maintenance area for contaminated equipment and radioactive waste storage are being designed and constructed in the US. The proximity of these facilities to each other provides that the ordinary flow of materials remain within a limited area. Interactions between the various facilities include shared resources such as communication, fire protection, security, medical services, transportation, water, electrical, personnel, emergency planning, transport of hazardous material between facilities, and common safety and radiological requirements between facilities. This paper will explore the advantages and disadvantages of multiple facilities at one site. Problem areas are identified, and recommendations for planning and coordination are discussed

  10. Workshop to promote the ratification of the protocol on heavy metals across the entire UN ECE region

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2009-12-15

    Within the workshop of the German Federal Environment Agency (Dessau-Rosslau, Federal Republic of Germany) at 14th to 16th May, 2008 in Yerevan (Armenia), the following lectures were held: (1) The convention and its protocols - framework and requirements (Tea Aulavuo); (2) Development of the heavy metals protocol up to now (D. Jost); (3) Experiences in transposing the obligations of the HM protocol into national law (Ivan Angelov); (4) Evaluation of concentrations of air pollutants and depositions of HM over the EECCA region (Ilia Ilyin); (5) The effectiveness of the HM protocol - emission reductions and costs (TNO-study) (M. van het Bolscher); (6) Technologies and techniques and their emission reduction potential and costs (Andre Peeters Weem); (7) Synergies of reduction of HM and particulate matter (Katja Kraus); (8) Critical loads / critical levels and effects of HM - integrated assessment (Jean-Paul Hettelingh); (9) Additional technical measures / options and their reduction potential (M. van het Bolscher); (10) Overview of the situation in the EECCA region - evaluation of a questionnaire of the Secretariat of the LRTAP Convention and ideas on revising the protocol and its annexes (Johan Sliggers); (11) Future aims of the TF (Katja Kraus).

  11. Effects of changes in Italian bioenergy promotion schemes for agricultural biogas projects: Insights from a regional optimization model

    International Nuclear Information System (INIS)

    Chinese, D.; Patrizio, P.; Nardin, G.

    2014-01-01

    Italy has witnessed an extraordinary growth in biogas generation from livestock effluents and agricultural activities in the last few years as well as a severe isomorphic process, leading to a market dominance of 999 kW power plants owned by “entrepreneurial farms”. Under the pressure of the economic crisis in the country, the Italian government has restructured renewable energy support schemes, introducing a new program in 2013. In this paper, the effects of the previous and current support schemes on the optimal plant size, feedstock mix and profitability were investigated by introducing a spatially explicit biogas supply chain optimization model, which accounts for different incentive structures. By applying the model to a regional case study, homogenization observed to date is recognized as a result of former incentive structures. Considerable reductions in local economic potentials for agricultural biogas power plants without external heat use, are estimated. New plants are likely to be manure-based and due to the lower energy density of such feedstock, wider supply chains are expected although optimal plant size will be smaller. The new support scheme will therefore most likely eliminate past distortions but also slow down investments in agricultural biogas plants. - Highlights: • We review the evolution of agricultural biogas support schemes in Italy over last 20 years. • A biogas supply chain optimization model which accounts for feed-in-tariffs is introduced. • The model is applied to a regional case study under the two most recent support schemes. • Incentives in force until 2013 caused homogenization towards maize based 999 kW el plants. • Wider, manure based supply chains feeding smaller plants are expected with future incentives

  12. Control of growth promotion (CGP) and screening for malnutrition in central region and Lomé-Commune, January to June 2013 Togo

    International Nuclear Information System (INIS)

    Touglo, Adavi Lonlon; Bouraima, Mouawiyatou; Agbozouhoue, A. Eya; Bebou, Midassirou; Tchapo, Dapou; Akolly, Koffi

    2014-01-01

    Full text: Background: Control of Growth Promotion (CGP) is an activity that can detect early if the child has a developmental problem and investigate the cause and take appropriate decisions to overcome the consequences. In Togo, the goal in 2013 is to weigh at least 80 % of children 0-5 years during the sessions of CGP. What are the levels achieved this goal after the first semester and the problems of malnutrition detected? Method: We conducted a descriptive cross-sectional study data collected in the quarterly reports in two regions of Togo, Lomé - Commune in the South and Central Region in the North. The study involved data from the first semester of 2013 in all districts of the two regions. Database monitoring activities at national level CGP was used. Data from the two regions were separated and analyzed using Excel. Comparison tests of proportions were made using Epi Info 7. Results: Detection rate of nutritional status by the CGP in the first half of 2013 was 29% of the total target of 155,423 children under 5 years in the two regions. This rate was higher for the Central region (33 %) than for Lomé-Commune (26 %). No district has reached half of the goals. Their rates vary from 17.9 % and 18 % respectively for District No. 2 and District No. 4 of Lomé-Commune to 39.7% for the District of Tchaoudjo. The malnutrition rate was 8.8 %. This rate is higher in the Central region (10.9 %) than in Lomé-Commune (6.8 %) with a RR = 1.59, 95% CI = [1.50 to 1.69]. Severe malnutrition was 1.4 %. It is predominant in Lomé-commune (1.7 %) than in the Central region (1.1%) with a RR = 1.55, 95% CI = [1.32 to 1.82]. Conclusion: All districts in the two regions are below the target detection rate in the first half. The CGP has detected cases of moderate and severe malnutrition. To compare that rates with the survey data, the screening tools must be standard and adequate. (author)

  13. C-terminal region of MAP7 domain containing protein 3 (MAP7D3 promotes microtubule polymerization by binding at the C-terminal tail of tubulin.

    Directory of Open Access Journals (Sweden)

    Saroj Yadav

    Full Text Available MAP7 domain containing protein 3 (MAP7D3, a newly identified microtubule associated protein, has been shown to promote microtubule assembly and stability. Its microtubule binding region has been reported to consist of two coiled coil motifs located at the N-terminus. It possesses a MAP7 domain near the C-terminus and belongs to the microtubule associated protein 7 (MAP7 family. The MAP7 domain of MAP7 protein has been shown to bind to kinesin-1; however, the role of MAP7 domain in MAP7D3 remains unknown. Based on the bioinformatics analysis of MAP7D3, we hypothesized that the MAP7 domain of MAP7D3 may have microtubule binding activity. Indeed, we found that MAP7 domain of MAP7D3 bound to microtubules as well as enhanced the assembly of microtubules in vitro. Interestingly, a longer fragment MDCT that contained the MAP7 domain (MD with the C-terminal tail (CT of the protein promoted microtubule polymerization to a greater extent than MD and CT individually. MDCT stabilized microtubules against dilution induced disassembly. MDCT bound to reconstituted microtubules with an apparent dissociation constant of 3.0 ± 0.5 µM. An immunostaining experiment showed that MDCT localized along the length of the preassembled microtubules. Competition experiments with tau indicated that MDCT shares its binding site on microtubules with tau. Further, we present evidence indicating that MDCT binds to the C-terminal tail of tubulin. In addition, MDCT could bind to tubulin in HeLa cell extract. Here, we report a microtubule binding region in the C-terminal region of MAP7D3 that may have a role in regulating microtubule assembly dynamics.

  14. the impact of proximity to urban center on crop production choice

    African Journals Online (AJOL)

    Rahel

    of the Amhara Regional State in 2006, it has been found that proximity to ... at Department for Agricultural Economics and Rural Development, University of .... major factors for this is believed to be a poorly developed transport network and.

  15. comparative proximate composition and antioxidant vitamins

    African Journals Online (AJOL)

    DR. AMINU

    Keywords: Comparative, proximate composition, antioxidant vitamins, honey. INTRODUCTION ... solution of inverted sugars and complex mixture of other saccharides ... enzymatic browning in apple slices and grape juice. (Khan, 1985).

  16. Proximate, Mineral and Phytochemical Composition of Dioscorea ...

    African Journals Online (AJOL)

    ADOWIE PERE

    Keywords: Dioscorea dumetorum, proximate composition, mineral analysis, phytochemical screening ... were analyzed using atomic absorption ... determined using a Hack Dr/200 Spectrophotometer. ... Lead Acetate. +. +. + .... cosmetics.

  17. Proximate composition and antinutrient content of pumpkin ...

    African Journals Online (AJOL)

    Proximate composition and antinutrient content of pumpkin ( Cucurbita pepo ) and sorghum ( Sorghum bicolor ) flour blends fermented with Lactobacillus plantarum , Aspergillus niger and Bacillus subtilis.

  18. Methylation in the promoter regions of WT1, NKX6-1 and DBC1 genes in cervical cancer tissues of Uygur women in Xinjiang

    Directory of Open Access Journals (Sweden)

    Dan Wu

    Full Text Available Abstract This study aimed to explore: 1 DNA methylation in the promoter regions of Wilms tumor gene 1 (WT1, NK6 transcription factor related locus 1 gene (NKX6-1 and Deleted in bladder cancer 1 (DBC1 gene in cervical cancer tissues of Uygur women in Xinjiang, and 2 the correlation of gene methylation with the infection of HPV16/18 viruses. We detected HPV16/18 infection in 43 normal cervical tissues, 30 cervical intraepithelial neoplasia lesions (CIN and 48 cervical cancer tissues with polymerase chain reaction (PCR method. Methylation in the promoter regions of the WT1, NKX6-1 and DBC1 genes in the above-mentioned tissues was measured by methylation-specific PCR (MSP and cloning sequencing. The expression level of these three genes was measured by real-time PCR (qPCR in 10 methylation-positive cervical cancer tissues and 10 methylation-negative normal cervical tissues. We found that the infection of HPV16 in normal cervical tissues, CIN and cervical cancer tissues was 14.0, 36.7 and 66.7%, respectively. The infection of HPV18 was 0, 6.7 and 10.4%, respectively. The methylation rates of WT1, NKX6-1 and DBC1 genes were 7.0, 11.6 and 23.3% in normal cervical tissues, 36.7, 46.7 and 30.0% in CIN tissues, and 89.6, 77.1 and 85.4% in cervical cancer tissues. Furthermore, WT1, NKX6-1 and DBC1 genes were hypermethylated in the high-grade squamous intraepithelial lesion (CIN2, CIN3 and in the cervical cancer tissues with infection of HPV16/18 (both P< 0.05. The expression of WT1, NKX6-1 and DBC1 was significantly lower in the methylation-positive cervical cancer tissues than in methylation-negative normal cervical tissues. Our findings indicated that methylation in the promoter regions of WT1, NKX6-1 and DBC1 is correlated with cervical cancer tumorigenesis in Uygur women. The infection of HPV16/18 might be correlated with methylation in these genes. Gene inactivation caused by methylation might be related to the incidence and development of cervical

  19. The OSMATER project: promotion of stone materials from the Verbano-Cusio-Ossola region (Italy) and the Canton Ticino (Switzerland).

    Science.gov (United States)

    Cavallo, Alessandro; Antonella Dino, Giovanna

    2013-04-01

    The OSMATER (sub-Alpine Observatory Materials Territory Restoration) project, funded by the Piedmont Region (Italy) and the European Community, involved four Italian scientific bodies (Polytechnic of Turin, University of Turin, University of Milan-Bicocca, University of Bologna) and Switzerland (SUPSI). The aim was to investigate the present and historical quarrying and processing activities in the cross-border area between the Ossola Valley (Italy) and the Canton Ticino (Switzerland), and the use of dimension stones in local and national architecture. These materials are in many ways a "unique case", for their abundance and lithological variety. In the past, their extraction, processing and application characterized in a decisive way the architectural and constructive culture, both in terms of prestigious architecture and civil buildings, establishing a relationship between "stones and culture", "territory and its resources". In recent years, many of these traditions are losing importance and interest: this results in a loss of knowledge and historical memory, due mainly to the drastic changes in the market. The loss of this knowledge is likely to become irreversible in the short term, with the disappearance of people and social groups depositary of tradition. We can deduce that the creation of an "observatory", like OSMATER, is desirable and essential indeed, if we want to preserve the historical memory of the stone industry of an entire production area. The OSMATER project aimed the knowledge, recovery and enhancement of the architectural and cultural heritage of the cross-border area, through the census and classification of rocks, quarries (both active and historical - since Roman age), monuments and construction techniques typical of the sub-Alpine region, in order to create a documentation centre through a dedicated website. The first phase of the project was devoted to the identification of architectural works built with stone materials, with particular

  20. Eukaryotic elongation factor 1-beta interacts with the 5' untranslated region of the M gene of Nipah virus to promote mRNA translation.

    Science.gov (United States)

    Uchida, Shotaro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko

    2016-09-01

    Nipah virus belongs to the genus Henipavirus in the family Paramyxoviridae, and its RNA genome is larger than those of other paramyxoviruses because it has long untranslated regions (UTRs) in each gene. However, the functions of these UTRs are not fully understood. In this study, we investigated the functions of the 5' UTRs and found that the 5' UTR of the M gene upregulated the translation of a reporter gene. Using an RNA pull-down assay, we showed that eukaryotic elongation factor 1-beta (EEF1B2) interacts with nucleotides 81-100 of the M 5' UTR and specifically enhances its translation efficiency. Our results suggest that the M 5' UTR promotes the production of M protein and viral budding by recruiting EEF1B2.

  1. Factor H binds to the hypervariable region of many Streptococcus pyogenes M proteins but does not promote phagocytosis resistance or acute virulence

    DEFF Research Database (Denmark)

    Gustafsson, Caj Ulrik Mattias; Lannergård, Jonas; Nilsson, Olof Rickard

    2013-01-01

    Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against...... represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited...... to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed...

  2. Imperial Tax System and Regional Development in the Eighteenth Century. The Monopoly of Tobacco as a Means for Economic Promotion in Louisiana

    Directory of Open Access Journals (Sweden)

    Laura Náter

    2004-07-01

    Full Text Available This paper analyzes Spain's Eighteenth-century tobacco policies in Louisiana, where it created a fiscal institution for mainly political reasons, subordinating economical yields and revenues to the  region's political  and  strategic needs.  This  case contrasts with the management  and exploitation of the same institution in other  Spanish colonial  properties,  which  also held monopolies of different products, including tobacco.  This study  shows that the tobacco monopoly was during the Eighteenth-century one of the Real Hacienda's favorite fiscal instruments for increasing revenues with which to promote economic development in certain colonies. The author's main conclusions refer to the mechanisms  through which the Real Hacienda de la Nueva  España used tobacco revenues to strengthen the economy of Louisiana.

  3. A Specific Mutation in the Promoter Region of the Silent cel Cluster Accounts for the Appearance of Lactose-Utilizing Lactococcus lactis MG1363

    Science.gov (United States)

    Solopova, Ana; Bachmann, Herwig; Teusink, Bas; Kok, Jan; Neves, Ana Rute

    2012-01-01

    The Lactococcus lactis laboratory strain MG1363 has been described to be unable to utilize lactose. However, in a rich medium supplemented with lactose as the sole carbon source, it starts to grow after prolonged incubation periods. Transcriptome analyses showed that L. lactis MG1363 Lac+ cells expressed celB, encoding a putative cellobiose-specific phosphotransferase system (PTS) IIC component, which is normally silent in MG1363 Lac− cells. Nucleotide sequence analysis of the cel cluster of a Lac+ isolate revealed a change from one of the guanines to adenine in the promoter region. We showed here that one particular mutation, taking place at increased frequency, accounts for the lactose-utilizing phenotype occurring in MG1363 cultures. The G-to-A transition creates a −10 element at an optimal distance from the −35 element. Thus, a fully active promoter is created, allowing transcription of the otherwise cryptic cluster. Nuclear magnetic resonance (NMR) spectroscopy results show that MG1363 Lac+ uses a novel pathway of lactose utilization. PMID:22660716

  4. Clinical significance of SNP (rs2596542 in histocompatibility complex class I-related gene A promoter region among hepatitis C virus related hepatocellular carcinoma cases

    Directory of Open Access Journals (Sweden)

    Amal A. Mohamed

    2017-07-01

    Full Text Available The major histocompatibility complex class I-related gene A (MICA is an antigen induced by stress and performs an integral role in immune responses as an anti-infectious and antitumor agent. This work was designed to investigate whether (SNP rs2596542C/T in MICA promoter region is predictive of liver cirrhosis (LC and hepatocellular carcinoma (HCC or not. Forty-seven healthy controls and 94 HCV-infected patients, subdivided into 47 LC and 47 HCC subjects were enrolled in this study. SNP association was studied using real time PCR and soluble serum MICA concentration was measured using ELISA. Results showed that heterozygous genotype rs2596542CT was significantly (P = 0.022 distributed between HCC and LC related CHC patients. The sMICA was significantly higher (P = 0.0001 among HCC and LC. No significant association (P = 0.56 between rs2596542CT genotypes and sMICA levels was observed. Studying SNP rs2596542C/T association with HCC and LC susceptibility revealed that statistical significant differences (P = 0.013, P = 0.027 were only observed between SNP rs2596542C/T and each of HCC and LC, respectively, versus healthy controls, indicating that the rs2596542C/T genetic variation is not a significant contributor to HCC development in LC patients. Moreover, the T allele was considered a risk factor for HCC and LC vulnerability in HCV patients (OR = 1.93 and 2.1, respectively, while the C allele contributes to decreasing HCC risk. Therefore, SNP (rs2596542C/T in MICA promoter region and sMICA levels might be potential useful markers in the assessment of liver disease progression to LC and HCC.

  5. Effect of metallothionein core promoter region polymorphism on cadmium, zinc and copper levels in autopsy kidney tissues from a Turkish population

    International Nuclear Information System (INIS)

    Kayaalti, Zeliha; Mergen, Goerkem; Soeylemezoglu, Tuelin

    2010-01-01

    Metallothioneins (MTs) are metal-binding, low molecular weight proteins and are involved in pathophysiological processes like metabolism of essential metals, metal ion homeostasis and detoxification of heavy metals. Metallothionein expression is induced by various heavy metals especially cadmium, mercury and zinc; MTs suppress toxicity of heavy metals by binding themselves to these metals. The aim of this study was to investigate the association between the - 5 A/G metallothionein 2A (MT2A) single nucleotide polymorphism (SNP) and Cd, Zn and Cu levels in the renal cortex from autopsy cases. MT2A core promoter region - 5 A/G SNP was analyzed by PCR-RFLP method using 114 autopsy kidney tissues and the genotype frequencies of this polymorphism were found as 87.7% homozygote typical (AA), 11.4% heterozygote (AG) and 0.9% homozygote atypical (GG). In order to assess the Cd, Zn and Cu levels in the same autopsy kidney tissues, a dual atomic absorption spectrophotometer system was used and the average levels of Cd, Zn and Cu were measured as 95.54 ± 65.58 μg/g, 181.20 ± 87.72 μg/g and 17.14 ± 16.28 μg/g, respectively. As a result, no statistical association was found between the - 5 A/G SNP in the MT2A gene and the Zn and Cu levels in the renal cortex (p > 0.05), but considerably high accumulation of Cd was monitored for individuals having AG (151.24 ± 60.21 μg/g) and GG genotypes (153.09 μg/g) compared with individuals having AA genotype (87.72 ± 62.98 μg/g) (p < 0.05). These results show that the core promoter region polymorphism of metallothionein 2A increases the accumulation of Cd in human renal cortex.

  6. Proximal onychomycosis due to Malassezia furfur: a case report

    Directory of Open Access Journals (Sweden)

    Zareei M

    2013-03-01

    Full Text Available Background: The etiologic role of Malassezia furfur in onychomycosis, because of its controversial keratinolytic ability, has not been proven. The most reported cases are distal subungual onychomycosis (DSO. In our knowledge no cases of proximal onychomycosis (PO has been reported. For the first time we report proximal onychomycosis. This case report describes the isolation of Malassezia furfur from fingernails. Case presentation: An Iranian 56- year- old women had been referred to mycology lab with hyperkeratosis in proximal regions of right hand nails and clinical diagnosis of onychomycosis without paronychia in May 2012. She used several medicines for her cardiac disease, mental illness, severe stress and blood glucose fluctuation diseases. Scraping and sampling from nail lesions were done, budding yeast cells with broadband connections were observed in 15% KOH wet mounts. Also, other differentiation tests, consist of staining with methylen blue, cultures and biochemical tests were done. In order to rejecting the probable etiologic role of any dermatophytic or non-dermatophytic fungi in this case, samples were collected from other parts of the body by scotch tape and scraping with scalpel blade too, but the results of direct microscopy and culture were negative. Finally, Malassezia furfur was identified as the causative agent of onychomycosis.Conclusion: Despite failure to prove Malassezia furfur keratinolytic ability, it can be the etiologic agent of proximal onychomycosis that shows the aggressive properties of this species. Its clinical importance is the easier transmission to hospitalized patients and other people.

  7. Proximal Participation: A Pathway into Work

    Science.gov (United States)

    Chan, Selena

    2013-01-01

    In a longitudinal case study of apprentices, the term proximal participation was coined to describe the entry process of young people, with unclear career destinations, into the trade of baking. This article unravels the significance of proximal participation in the decision-making processes of young people who enter a trade through initial…

  8. Bimalleolar ankle fracture with proximal fibular fracture

    NARCIS (Netherlands)

    Colenbrander, R. J.; Struijs, P. A. A.; Ultee, J. M.

    2005-01-01

    A 56-year-old female patient suffered a bimalleolar ankle fracture with an additional proximal fibular fracture. This is an unusual fracture type, seldom reported in literature. It was operatively treated by open reduction and internal fixation of the lateral malleolar fracture. The proximal fibular

  9. Environmental stress affects DNA methylation of a CpG rich promoter region of serotonin transporter gene in a nurse cohort.

    Directory of Open Access Journals (Sweden)

    Jukka S Alasaari

    Full Text Available Shift-working nurses are exposed to a stressful work environment, which puts them at an increased risk for burnout and depression. We explored the effect of environmental stress on serotonin transporter gene (SLC6A4 promoter methylation among nurses from high and low work stress environments.Using bisulfite sequencing, we investigated the methylation status of five CpG residues of a CpG-rich region in the promoter of SLC6A4 by comparing female shift working nurses from a high work stress environment (n = 24 to low work stress environment (n = 25. We also analyzed the association of 5-HTTLPR polymorphism at 5' end of SLC6A4. Work stress was assessed by the Karasek's Model and possible signs of burnout or depression were measured by the Maslach Burnout Index General Survey and Beck Depression Index. Methylation levels were assessed by bisulfite sequencing of DNA extracted from peripheral blood leucocytes. Restriction enzyme treatment followed by standard PCR was used to identify 5-HTTLPR genotypes.We found that nurses in the high stress environment had significantly lower promoter methylation levels at all five CpG residues compared to nurses in the low stress environment (p<0.01. There was no significant interaction of 5-HTTLPR genotype and work stress with methylation (p = 0.58. In unadjusted (bivariate analysis, burnout was not significantly associated to methylation levels. However, when mutually adjusted for both, burnout and work stress were significant contributors (p = 0.038 and p<0.0001 respectively to methylation levels.Our findings show that environmental stress is concurrent with decreased methylation of the SLC6A4 promoter. This may lead to increased transcriptional activity of the gene, increased reuptake of serotonin from synaptic clefts, and termination of the activity of serotonin. This could present a possible coping mechanism for environmental stress in humans that could eventually increase risk for disturbed functional

  10. Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1991-12-01

    promoter resides in a small region extending only 50 bases upstream of the cap site and that this activity is the result of a cooperative interaction of at least three distinct proximal promoter elements.

  11. Distinct Prion Domain Sequences Ensure Efficient Amyloid Propagation by Promoting Chaperone Binding or Processing In Vivo.

    Directory of Open Access Journals (Sweden)

    Christine R Langlois

    2016-11-01

    Full Text Available Prions are a group of proteins that can adopt a spectrum of metastable conformations in vivo. These alternative states change protein function and are self-replicating and transmissible, creating protein-based elements of inheritance and infectivity. Prion conformational flexibility is encoded in the amino acid composition and sequence of the protein, which dictate its ability not only to form an ordered aggregate known as amyloid but also to maintain and transmit this structure in vivo. But, while we can effectively predict amyloid propensity in vitro, the mechanism by which sequence elements promote prion propagation in vivo remains unclear. In yeast, propagation of the [PSI+] prion, the amyloid form of the Sup35 protein, has been linked to an oligopeptide repeat region of the protein. Here, we demonstrate that this region is composed of separable functional elements, the repeats themselves and a repeat proximal region, which are both required for efficient prion propagation. Changes in the numbers of these elements do not alter the physical properties of Sup35 amyloid, but their presence promotes amyloid fragmentation, and therefore maintenance, by molecular chaperones. Rather than acting redundantly, our observations suggest that these sequence elements make complementary contributions to prion propagation, with the repeat proximal region promoting chaperone binding to and the repeats promoting chaperone processing of Sup35 amyloid.

  12. Proximal Alternating Direction Method with Relaxed Proximal Parameters for the Least Squares Covariance Adjustment Problem

    Directory of Open Access Journals (Sweden)

    Minghua Xu

    2014-01-01

    Full Text Available We consider the problem of seeking a symmetric positive semidefinite matrix in a closed convex set to approximate a given matrix. This problem may arise in several areas of numerical linear algebra or come from finance industry or statistics and thus has many applications. For solving this class of matrix optimization problems, many methods have been proposed in the literature. The proximal alternating direction method is one of those methods which can be easily applied to solve these matrix optimization problems. Generally, the proximal parameters of the proximal alternating direction method are greater than zero. In this paper, we conclude that the restriction on the proximal parameters can be relaxed for solving this kind of matrix optimization problems. Numerical experiments also show that the proximal alternating direction method with the relaxed proximal parameters is convergent and generally has a better performance than the classical proximal alternating direction method.

  13. Staphylococcus aureus RNAIII binds to two distant regions of coa mRNA to arrest translation and promote mRNA degradation.

    Directory of Open Access Journals (Sweden)

    Clément Chevalier

    2010-03-01

    Full Text Available Staphylococcus aureus RNAIII is the intracellular effector of the quorum sensing system that temporally controls a large number of virulence factors including exoproteins and cell-wall-associated proteins. Staphylocoagulase is one major virulence factor, which promotes clotting of human plasma. Like the major cell surface protein A, the expression of staphylocoagulase is strongly repressed by the quorum sensing system at the post-exponential growth phase. Here we used a combination of approaches in vivo and in vitro to analyze the mechanism used by RNAIII to regulate the expression of staphylocoagulase. Our data show that RNAIII represses the synthesis of the protein through a direct binding with the mRNA. Structure mapping shows that two distant regions of RNAIII interact with coa mRNA and that the mRNA harbors a conserved signature as found in other RNAIII-target mRNAs. The resulting complex is composed of an imperfect duplex masking the Shine-Dalgarno sequence of coa mRNA and of a loop-loop interaction occurring downstream in the coding region. The imperfect duplex is sufficient to prevent the formation of the ribosomal initiation complex and to repress the expression of a reporter gene in vivo. In addition, the double-strand-specific endoribonuclease III cleaves the two regions of the mRNA bound to RNAIII that may contribute to the degradation of the repressed mRNA. This study validates another direct target of RNAIII that plays a role in virulence. It also illustrates the diversity of RNAIII-mRNA topologies and how these multiple RNAIII-mRNA interactions would mediate virulence regulation.

  14. Integration Host Factor (IHF binds to the promoter region of the phtD operon involved in phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121

    Directory of Open Access Journals (Sweden)

    Álvarez-Morales Ariel

    2011-05-01

    Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.

  15. Proximal Hamstring Tendinosis and Partial Ruptures.

    Science.gov (United States)

    Startzman, Ashley N; Fowler, Oliver; Carreira, Dominic

    2017-07-01

    Proximal hamstring tendinosis and partial hamstring origin ruptures are painful conditions of the proximal thigh and hip that may occur in the acute, chronic, or acute on chronic setting. Few publications exist related to their diagnosis and management. This systematic review discusses the incidence, treatment, and prognosis of proximal hamstring tendinosis and partial hamstring ruptures. Conservative treatment measures include nonsteroidal anti-inflammatory drugs, physical therapy, rest, and ice. If these measures fail, platelet-rich plasma or shockwave therapy may be considered. When refractory to conservative management, these injuries may be treated with surgical debridement and hamstring reattachment. [Orthopedics. 2017; 40(4):e574-e582.]. Copyright 2017, SLACK Incorporated.

  16. A common polymorphism in the promoter region of the TNFSF4 gene is associated with lower allele-specific expression and risk of myocardial infarction.

    Directory of Open Access Journals (Sweden)

    Massimiliano Ria

    Full Text Available BACKGROUND: The TNFSF4/TNFRSF4 system, along with several other receptor-ligand pairs, is involved in the recruitment and activation of T-cells and is therefore tentatively implicated in atherosclerosis and acute coronary syndromes. We have previously shown that genetic variants in TNFSF4 are associated with myocardial infarction (MI in women. This prompted functional studies of TNFSF4 expression. METHODS AND RESULTS: Based on a screening of the TNFSF4 genomic region, a promoter polymorphism (rs45454293 and a haplotype were identified, conceivably involved in gene regulation. The rs45454293T-allele, in agreement with the linked rs3850641G-allele, proved to be associated with increased risk of MI in women. Haplotype-specific chromatin immunoprecipitation of activated polymerase II, as a measure of transcriptional activity in vivo, suggested that the haplotype including the rs45454293 and rs3850641 polymorphisms is functionally important, the rs45454293T- and rs3850641G-alleles being associated with lower transcriptional activity in cells heterozygous for both polymorphisms. The functional role of rs45454293 on transcriptional levels of TNFSF4 was clarified by luciferase reporter assays, where the rs45454293T-allele decreased gene expression when compared with the rs45454293C-allele, while the rs3850641 SNP did not have any effect on TNFSF4 promoter activity. Electromobility shift assay showed that the rs45454293 polymorphism, but not rs3850641, affects the binding of nuclear factors, thus suggesting that the lower transcriptional activity is attributed to binding of one or more transcriptional repressor(s to the T-allele. CONCLUSIONS: Our data indicate that the TNFSF4 rs45454293T-allele is associated with lower TNFSF4 expression and increased risk of MI.

  17. SRSF1-3 contributes to diversification of the immunoglobulin variable region gene by promoting accumulation of AID in the nucleus.

    Science.gov (United States)

    Kawaguchi, Yuka; Nariki, Hiroaki; Kawamoto, Naoko; Kanehiro, Yuichi; Miyazaki, Satoshi; Suzuki, Mari; Magari, Masaki; Tokumitsu, Hiroshi; Kanayama, Naoki

    2017-04-01

    Activation-induced cytidine deaminase (AID) is essential for diversification of the Ig variable region (IgV). AID is excluded from the nucleus, where it normally functions. However, the molecular mechanisms responsible for regulating AID localization remain to be elucidated. The SR-protein splicing factor SRSF1 is a nucleocytoplasmic shuttling protein, a splicing isoform of which called SRSF1-3, has previously been shown to contribute to IgV diversification in chicken DT40 cells. In this study, we examined whether SRSF1-3 functions in IgV diversification by promoting nuclear localization of AID. AID expressed alone was localized predominantly in the cytoplasm. In contrast, co-expression of AID with SRSF1-3 led to the nuclear accumulation of both AID and SRSF1-3 and the formation of a protein complex that contained them both, although SRSF1-3 was dispensable for nuclear import of AID. Expression of either SRSF1-3 or a C-terminally-truncated AID mutant increased IgV diversification in DT40 cells. However, overexpression of exogenous SRSF1-3 was unable to further enhance IgV diversification in DT40 cells expressing the truncated AID mutant, although SRSF1-3 was able to form a protein complex with the AID mutant. These results suggest that SRSF1-3 promotes nuclear localization of AID probably by forming a nuclear protein complex, which might stabilize nuclear AID and induce IgV diversification in an AID C-terminus-dependent manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. An Intergenic Region Shared by At4g35985 and At4g35987 in Arabidopsis thaliana Is a Tissue Specific and Stress Inducible Bidirectional Promoter Analyzed in Transgenic Arabidopsis and Tobacco Plants

    Science.gov (United States)

    Banerjee, Joydeep; Sahoo, Dipak Kumar; Dey, Nrisingha; Houtz, Robert L.; Maiti, Indu Bhushan

    2013-01-01

    On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985) are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS) in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85) showed stronger expression (about 3.5 fold) compared to the At4g35987 promoter (P87). The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold) under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications. PMID:24260266

  19. An intergenic region shared by At4g35985 and At4g35987 in Arabidopsis thaliana is a tissue specific and stress inducible bidirectional promoter analyzed in transgenic arabidopsis and tobacco plants.

    Directory of Open Access Journals (Sweden)

    Joydeep Banerjee

    Full Text Available On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985 are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85 showed stronger expression (about 3.5 fold compared to the At4g35987 promoter (P87. The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications.

  20. The effect of metallothionein 2A core promoter region single-nucleotide polymorphism on accumulation of toxic metals in sinonasal inverted papilloma tissues

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Bryś, Magdalena; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek; Pietkiewicz, Piotr [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Lewy-Trenda, Iwona; Danilewicz, Marian [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); Krześlak, Anna [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland)

    2015-06-15

    Metallothioneins (MTs) are intracellular thiol-rich heavy metal-binding proteins which join trace metal ions protecting cells against heavy metal toxicity and regulate metal distribution and donation to various enzymes and transcription factors. The goal of this study was to identify the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene, and to investigate its effect on allele-specific gene expression and Cd, Zn, Cu and Ni content in sinonasal inverted papilloma tissue (IP), with non-cancerous sinonasal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was identified by restriction fragment length polymorphism using 117 IP and 132 NCM. MT2A gene analysis was performed by quantitative real-time PCR. Metal levels were analyzed by flame atomic absorption spectrometry. The frequency of A allele carriage was 99.2% and 100% in IP and NCM, respectively. The G allele carriage was detected in 23.9% of IP and in 12.1% of the NCM samples. As a result, a significant association of − 5 A/G SNP in MT2A gene with mRNA expression in both groups was determined. A significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. A highly significant association was detected between the rs28366003 genotype and Cd and Zn content in IP. Furthermore, significant differences were identified between A/A and A/G genotype with regard to the type of metal contaminant. The Spearman rank correlation results showed the MT2A gene expression and both Cd and Cu levels were negatively correlated. The results obtained in this study suggest that the − 5 A/G SNP in the MT2A gene may have an effect on allele-specific gene expression and toxic metal accumulation in sinonasal inverted papilloma. - Highlights: • MT2A gene expression and metal content in sinonasal inverted papilloma tissues • Association between SNP (rs28366003) and expression of MT2A • Significant

  1. Polymorphisms in the presumptive promoter region of the SLC2A9 gene are associated with gout in a Chinese male population.

    Science.gov (United States)

    Li, Changgui; Chu, Nan; Wang, Binbin; Wang, Jing; Luan, Jian; Han, Lin; Meng, Dongmei; Wang, Yunlong; Suo, Peisu; Cheng, Longfei; Ma, Xu; Miao, Zhimin; Liu, Shiguo

    2012-01-01

    Glucose transporter 9 (GLUT9) is a high-capacity/low-affinity urate transporter. To date, several recent genome-wide association studies (GWAS) and follow-up studies have identified genetic variants of SLC2A9 associated with urate concentrations and susceptibility to gout. We therefore investigated associations between gout and polymorphisms and haplotypes in the presumptive promoter region of GLUT9 in Chinese males. The approximately 2000 bp presumptive promoter region upstream of the start site of exon 1 of GLUT9 was sequenced and subjected to genetic analysis. A genotype-phenotype correlation was performed and polymorphisms-induced changes in transcription factor binding sites were predicted. Of 21 SNPs identified in GLUT9, five had not been previously reported. Two of the SNPs (rs13124007 and rs6850166) were associated with susceptibility to gout (p = 0.009 and p = 0.042, respectively). The C allele of rs13124007 appeared to be the risk allele for predisposition to gout (p = 0.006, OR 1.709 [95% CI 1.162-2.514]). For rs6850166, an increased risk of gout was associated with the A allele (p = 0.029, OR 1.645 [95% CI 1.050-2.577]). After Bonferroni correction, there was statistically difference in rs13124007 allele frequencies between gout cases and controls (P = 0.042). Haplotype analyses showed that haplotype GG was a protective haplotype (p = 0.0053) and haplotype CA was associated with increased risk of gout (p = 0.0326). Genotype-phenotype analysis among gout patients revealed an association of rs13124007 with serum triglycerides levels (P = 0.001). The C to G substitution in polymorphism rs13124007 resulted in a loss of a binding site for transcription factor interferon regulatory factor 1 (IRF-1). Polymorphisms rs13124007 and rs6850166 are associated with susceptibility to gout in Chinese males.

  2. THE PROXIMATE COMPOSITION OF AFRICAN BUSH MANGO ...

    African Journals Online (AJOL)

    BIG TIMMY

    Information regarding previous studies on these physico-chemical ... This behaviour may be attributed to its high myristic acid ... The authors express deep appreciation to the. Heads of ... of a typical rural processing method on the proximate ...

  3. Proximate composition and nutritional characterization of Chia ...

    African Journals Online (AJOL)

    ... dairy product associated with several beneficial nutritional and health effects. ... The results for amino acids showed that the essential and non-essential amino ... proximate composition and nutritional (amino acids, fatty acids, and minerals ...

  4. Proximal focal femoral deficiency: A case report

    Directory of Open Access Journals (Sweden)

    Shashank Sharma

    2015-01-01

    Full Text Available Proximal focal femoral deficiency (PFFD is a rare congenital anomaly resulting in limb shortening and disability in young. The exact cause of the disease is not known and it may present as varying grades of affection involving the proximal femur and the acetabulum. Recognition of this rare abnormality on radiographs can help manage these cases better since early institution of therapy may help in achieving adequate growth of the femur.

  5. Factor H Binds to the Hypervariable Region of Many Streptococcus pyogenes M Proteins but Does Not Promote Phagocytosis Resistance or Acute Virulence

    Science.gov (United States)

    Kristensen, Bodil M.; Olsen, John E.; Harris, Claire L.; Ufret-Vincenty, Rafael L.; Stålhammar-Carlemalm, Margaretha; Lindahl, Gunnar

    2013-01-01

    Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR) of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems. PMID:23637608

  6. Factor H binds to the hypervariable region of many Streptococcus pyogenes M proteins but does not promote phagocytosis resistance or acute virulence.

    Directory of Open Access Journals (Sweden)

    Mattias C U Gustafsson

    Full Text Available Many pathogens express a surface protein that binds the human complement regulator factor H (FH, as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems.

  7. Proximity sensor system development. CRADA final report

    International Nuclear Information System (INIS)

    Haley, D.C.; Pigoski, T.M.

    1998-01-01

    Lockheed Martin Energy Research Corporation (LMERC) and Merritt Systems, Inc. (MSI) entered into a Cooperative Research and Development Agreement (CRADA) for the development and demonstration of a compact, modular proximity sensing system suitable for application to a wide class of manipulator systems operated in support of environmental restoration and waste management activities. In teleoperated modes, proximity sensing provides the manipulator operator continuous information regarding the proximity of the manipulator to objects in the workspace. In teleoperated and robotic modes, proximity sensing provides added safety through the implementation of active whole arm collision avoidance capabilities. Oak Ridge National Laboratory (ORNL), managed by LMERC for the United States Department of Energy (DOE), has developed an application specific integrated circuit (ASIC) design for the electronics required to support a modular whole arm proximity sensing system based on the use of capacitive sensors developed at Sandia National Laboratories. The use of ASIC technology greatly reduces the size of the electronics required to support the selected sensor types allowing deployment of many small sensor nodes over a large area of the manipulator surface to provide maximum sensor coverage. The ASIC design also provides a communication interface to support sensor commands from and sensor data transmission to a distributed processing system which allows modular implementation and operation of the sensor system. MSI is a commercial small business specializing in proximity sensing systems based upon infrared and acoustic sensors

  8. Proximity sensor system development. CRADA final report

    Energy Technology Data Exchange (ETDEWEB)

    Haley, D.C. [Oak Ridge National Lab., TN (United States); Pigoski, T.M. [Merrit Systems, Inc. (United States)

    1998-01-01

    Lockheed Martin Energy Research Corporation (LMERC) and Merritt Systems, Inc. (MSI) entered into a Cooperative Research and Development Agreement (CRADA) for the development and demonstration of a compact, modular proximity sensing system suitable for application to a wide class of manipulator systems operated in support of environmental restoration and waste management activities. In teleoperated modes, proximity sensing provides the manipulator operator continuous information regarding the proximity of the manipulator to objects in the workspace. In teleoperated and robotic modes, proximity sensing provides added safety through the implementation of active whole arm collision avoidance capabilities. Oak Ridge National Laboratory (ORNL), managed by LMERC for the United States Department of Energy (DOE), has developed an application specific integrated circuit (ASIC) design for the electronics required to support a modular whole arm proximity sensing system based on the use of capacitive sensors developed at Sandia National Laboratories. The use of ASIC technology greatly reduces the size of the electronics required to support the selected sensor types allowing deployment of many small sensor nodes over a large area of the manipulator surface to provide maximum sensor coverage. The ASIC design also provides a communication interface to support sensor commands from and sensor data transmission to a distributed processing system which allows modular implementation and operation of the sensor system. MSI is a commercial small business specializing in proximity sensing systems based upon infrared and acoustic sensors.

  9. Mutagenesis of the lac promoter region in M13 mp10 phage DNA by 4'-hydroxymethyl-4,5',8-trimethylpsoralen

    International Nuclear Information System (INIS)

    Piette, J.; Decuyper-Debergh, D.; Gamper, H.

    1985-01-01

    Double-stranded M13 phage DNA (M13 mp10 replicative form) was photoreacted with 4'-hydroxymethyl-4,5',8-trimethylpsoralen, using light of wavelength greater than 320 nm or greater than 390 nm to generate predominantly crosslinks or monoadducts, respectively. The damaged DNAs were scored for inactivation and mutagenesis after transfection into Escherichia coli. The appearance of light-blue or colorless plaques on indicator medium showed that mutation had occurred in the lac insert of the viral DNA. A comparison of the consequences of the two phototreatments with psoralen supports the idea that crosslinks are both more lethal and more mutagenic than monoadducts. Numerous mutant clones partially or totally deficient in beta-galactosidase were plaque-purified and amplified. The viral DNA of each clone was sequenced by the dideoxy chain-terminating procedure. All of the observed base-pair changes were mapped to the lac promoter region and consisted of 3 transition, 14 transversion, and 6 single base-pair frame-shift mutations. The predominant mutation was a T.A----G.C transversion

  10. A multistakeholder platform to promote health and prevent noncommunicable diseases in the region of the Americas: the Pan American Health Organization partners forum for action.

    Science.gov (United States)

    Hospedales, C James; Jané-Llopis, Eva

    2011-08-01

    Noncommunicable diseases (NCDs) and obesity are the most serious health problem facing the countries of the Americas in terms of avoidable deaths as well as costs to governments, families, and business. The main causes are ageing of the population, and widespread risks such as tobacco use, unhealthy diet, physical inactivity, and harmful use of alcohol, linked to major changes in the way we live and work, to public policies, cultural norms, and private sector forces. Underlying determinants are globalization, urbanization, poverty, education, gender, ethnicity, and access to health services. Yet, approximately 80% of cardiovascular disease and diabetes, and 40% of cancer, are preventable through a range of cost-effective population and individual measures for those at high risk of living with NCDs. However, the multisectoral nature of NCDs requires a cross-sector response to succeed. Several governments have commenced intersectoral efforts, and civil society and private sector also have many initiatives, but the responses are fragmented and skewed. The Partners Forum is being launched by the Pan American Health Organization in collaboration with the World Economic Forum and a set of partners including member states, partners in civil society, and partners in the private sector, as a multisector platform to catalyze, recognize, and scale up collaborative action to promote health and prevent and control NCDs at regional, subregional, and country level. The principles of partnership and lessons learned from other partnership experiences are being used in its design.

  11. The -2549 insertion/deletion polymorphism in the promoter region of VEGF is associated with the risk of recurrent spontaneous abortion.

    Science.gov (United States)

    Hashemi, Mohammad; Danesh, Hiva; Bizhani, Fatemeh; Mokhtari, Mojgan; Bahari, Gholamreza; Tabasi, Farhad; Taheri, Mohsen

    2018-03-01

    Recurrent spontaneous abortion (RSA) is a common health problem affecting women of reproductive age. Altered expression of vascular endothelial growth factor ( VEGF ) has been associated with spontaneous abortion. The present case-control study aimed to evaluate the impact of the 18-bp insertion/deletion (ins/del) polymorphism (rs35569394) in the promoter region of the VEGF gene on idiopathic RSA. Genomic DNA from 93 patients with RSA and 93 healthy fertile women of southeastern Iran was isolated using the salting-out method. Genotyping of the rs35569394 variant was performed by a polymerase chain reaction (PCR) method. The findings indicated that the VEGF 18-bp ins/del variant significantly increased the risk of RSA under codominant (ins/ins vs. del/del; OR=2.85, 95% CI=1.31-6.22, P=0.019), dominant (del/ins+ins/ins vs. del/del; OR=2.19, 95% CI=1.20-4.01, P=0.015) and allelic (ins vs. del; OR=1.90, 95% CI=1.25-2.88, P=0.003) inheritance models. In summary, the findings propose a significant association between the VEGF 18-bp ins/del polymorphism and risk of RSA in a sample of the southeast Iranian population. Further studies on larger sample sizes and different ethnicities are required to validate the present findings.

  12. Adult and Child Development in the Zone of Proximal Development: Socratic Dialogue in a Playworld

    Science.gov (United States)

    Ferholt, Beth; Lecusay, Robert

    2010-01-01

    This article analyses adult and child development in the zone of proximal development in an educational practice based in Vygotsky's theories of play: the playworld educational practice. The playworld educational practice is a central component of a Scandinavian play pedagogy that promotes shared responsibility amongst adults and children for…

  13. Understanding, promoting and protecting geodiversity and geoheritage of the Piemonte region (Italy) through innovative techniques and public engagement in Earth Science studies

    Science.gov (United States)

    Giardino, Marco; Lozar, Francesca; Perotti, Luigi; Palomba, Mauro; Groppo, Chiara; Natalicchio, Marcello; Ghiraldi, Luca; Beltramo, Riccardo; Lombardo, Vincenzo

    2016-04-01

    The onset of Antropocene demonstrates the importance of considering both 1) geodiversity and 2) geoheritage as parts of the landscape "interfaces" where relationships between natural and socio-economic systems can be studied and interpreted. By definition: 1) is the variety, recognizable in nature ("diversity"), of geological features (rocks, minerals, fossils…), of geomorphological environments (and related forms and processes) and of soil characteristics; 2) is an integral part of the global natural heritage focusing on unique, special and representative sites of geological interests (geosites l.s.). In the Antropocene, both 1) and 2) hold a dynamic character, as the result of actions and interactions of natural and/or human factors. Therefore, geodiversity and geoheritage studies are essential for breaking down geological environments and human territories into their main parts and to understand the variables and mechanisms that control their changes. In this perspective, results of the multidisciplinary project PROGEO-Piemonte ("PROactive management of GEOlogical heritage in the Piemonte Region") are presented here: an innovative approach for assessing geodiversity in order to select areas of high potential value of geoheritage to be enhanced by targeted management actions. Since the geodiversity of Piemonte is materialized by elements of high scientific, educational, tourism, etc. value, the geosites where this geoheritage is preserved have been comprehensively analysed and characterized for encompassing both public and private interests. 9 strategic geothematic areas have been selected in the Piemonte Region to test this approach, and to improve social engagement aimed at protecting and promoting geodiversity ad geoheritage. The investigated areas represent the multifaceted geodiversity of Piemonte; each area is characterized by high potential for scientific studies, enhancement of public understanding of science, recreation activities and for economic

  14. [MRI characteristic of proximal femur bone marrow edema syndrome].

    Science.gov (United States)

    Wu, Xi-Yuan

    2014-07-01

    To study the MRI features of proximal femur bone marrow edema syndrome for further improve the understanding of the disease. MRI imaging of 10 patients with proximal femur bone marrow edema syndrome was retrospectively reviewed,including 6 males and 4 females with an average age of 41.5 years old ranging from 36 to 57. The courses of diseases ranged from 1 week to 3 months. Among them, 9 cases had clinical manifestations of sudden hip pain, 7 cases had limited ability of walking and hip movement;all patients had no obvious injury history, non of the female patients was pregnant. All patients were followed up from 3 to 12 months, the following-up were topped after MRI when the symptoms disappeared for 3 months. The MRI demonstrated diffuse bone marrow edema involving the femoral head, neck and the inter-trochanteric region, 13 hips of 10 patients with bone marrow edema included 6 cases in grade 1, 5 cases in grade 2,2 cases in grade 3; 9 hips with hip hydrarthrosis included 6 hips in grade I ,1 hip in grade II, 2 hips in grade III. After treatment for 3 to 12 months the hip symptoms of the patients disappeared and MRI images were normal. MRI is useful in defining the location and extent of proximal femur bone marrow edema syndrome.

  15. Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

    International Nuclear Information System (INIS)

    Zare, Maryam; Jazii, Ferdous Rastgar; Alivand, Mohammad Reza; Nasseri, Negin Karimi; Malekzadeh, Reza; Yazdanbod, Mansour

    2009-01-01

    Squamous cell carcinoma of esophagus (SCCE) occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC) promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP) was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4%) tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect to promoter hypermethylation showed a lower rate of

  16. Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

    Directory of Open Access Journals (Sweden)

    Nasseri Negin

    2009-01-01

    Full Text Available Abstract Background Squamous cell carcinoma of esophagus (SCCE occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. Methods For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Results Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4% tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect

  17. Locking plate fixation for proximal humerus fractures.

    LENUS (Irish Health Repository)

    Burke, Neil G

    2012-02-01

    Locking plates are increasingly used to surgically treat proximal humerus fractures. Knowledge of the bone quality of the proximal humerus is important. Studies have shown the medial and dorsal aspects of the proximal humeral head to have the highest bone strength, and this should be exploited by fixation techniques, particularly in elderly patients with osteoporosis. The goals of surgery for proximal humeral fractures should involve minimal soft tissue dissection and achieve anatomic reduction of the head complex with sufficient stability to allow for early shoulder mobilization. This article reviews various treatment options, in particular locking plate fixation. Locking plate fixation is associated with a high complication rate, such as avascular necrosis (7.9%), screw cutout (11.6%), and revision surgery (13.7%). These complications are frequently due to the varus deformation of the humeral head. Strategic screw placement in the humeral head would minimize the possibility of loss of fracture reduction and potential hardware complications. Locking plate fixation is a good surgical option for the management of proximal humerus fractures. Complications can be avoided by using better bone stock and by careful screw placement in the humeral head.

  18. Giant proximity effect in ferromagnetic bilayers

    Science.gov (United States)

    Ramos, Silvia; Charlton, Tim; Quintanilla, Jorge; Suter, Andreas; Moodera, Jagadeesh; Prokscha, Thomas; Salman, Zaher; Forgan, Ted

    2013-03-01

    The proximity effect is a phenomenon where an ordered state leaks from a material into an adjacent one over some finite distance, ξ. For superconductors, this distance is ~ the coherence length. Nevertheless much longer-range, ``giant'' proximity effects have been observed in cuprate junctions. This surprising effect can be understood as a consequence of critical opalescence. Since this occurs near all second order phase transitions, giant proximity effects should be very general and, in particular, they should be present in magnetic systems. The ferromagnetic proximity effect has the advantage that its order parameter (magnetization) can be observed directly. We investigate the above phenomenon in Co/EuS bilayer films, where both materials undergo ferromagnetic transitions but at rather different temperatures (bulk TC of 1400K for Co and 16.6K for EuS). A dramatic increase in the range of the proximity effect is expected near the TC of EuS. We present the results of our measurements of the magnetization profiles as a function of temperature, carried out using the complementary techniques of low energy muon rotation and polarized neutron reflectivity. Work supported by EPSRC, STFC and ONR grant N00014-09-1-0177 and NSF grant DMR 0504158.

  19. Susceptibility to gastric cancer and polymorphisms of insertion/deletion at the intron 3 of the XRCC4 and VNTR at the promoter region of the XRCC5.

    Science.gov (United States)

    Saadat, Mostafa; Pashaei, Samira; Amerizade, Foroozan

    2015-07-01

    The genes encoding X-ray repair cross-complementing group 4 (XRCC4; OMIM: 194363) and 5 (XRCC5; OMIM: 194364) are involved in repair of DNA double-strand breaks. To investigating the associations between polymorphisms of Insertion/Deletion (I/D, rs28360071) in the intron 3 of the XRCC4 and VNTR in the promoter region of the XRCC5 and risk of gastric cancer, the present study was carried out. We included 159 (56 females, 103 males) with gastric cancer and 242 (75 females, 167 males) healthy blood donors frequency matched for age and gender. Using PCR-based methods, the genotypes of the study polymorphisms were determined. The alleles of VNTR XRCC5 polymorphism divided into two groups: L (0 and 1 repeats) and H (2 and 3 repeats) alleles. For the I/D XRCC4 polymorphism, after stratification of the subjects according to their family history (FH) of cancer, either the ID (OR = 3.19, 95%CI: 1.35-7.50, P = 0.008) or the DD genotypes (OR = 4.62, 95%CI: 1.63-13.0, P = 0.004) among positive FH persons, increased the risk of gastric cancer compared with the reference group (persons who have negative FH and II genotype). For the VNTR XRCC5 polymorphism, the LH + HH genotypes among positive FH persons, increased the risk of gastric cancer compared with the reference group (persons who have negative FH and LL genotype) (OR = 2.88, 95%CI: 1.34-6.18, P = 0.006). Sensitivity analysis showed that the above mentioned associations were not occurred due to the maldistribution of the genotypes among missing data. The present study suggests that both polymorphisms of the XRCC4 and XRCC5 might be risk factors for gastric cancer development especially among persons with positive FH.

  20. Wake-promoting actions of median nerve stimulation in TBI-induced coma: An investigation of orexin-A and orexin receptor 1 in the hypothalamic region.

    Science.gov (United States)

    Zhong, Ying-Jun; Feng, Zhen; Wang, Liang; Wei, Tian-Qi

    2015-09-01

    A coma is a serious complication, which can occur following traumatic brain injury (TBI), for which no effective treatment has been established. Previous studies have suggested that neural electrical stimulation, including median nerve stimulation (MNS), may be an effective method for treating patients in a coma, and orexin‑A, an excitatory hypothalamic neuropeptide, may be involved in wakefulness. However, the exact mechanisms underlying this involvement remain to be elucidated. The present study aimed to examine the arousal‑promoting role of MNS in rats in a TBI‑induced coma and to investigate the potential mechanisms involved. A total of 90 rats were divided into three groups, comprising a control group, sham‑stimulated (TBI) group and a stimulated (TBI + MNS) group. MNS was performed on the animals, which were in a TBI‑induced comatose state. Changes in the behavior of the rats were observed following MNS. Subsequently, hypothalamic tissues were extracted from the rats 6, 12 and 24 h following TBI or MNS, respectively. The expression levels of orexin‑A and orexin receptor‑1 (OX1R) in the hypothalamus were examined using immunohistochemistry, western blotting and an enzyme‑linked immunosorbent assay. The results demonstrated that 21 rats subjected to TBI‑induced coma exhibited a restored righting reflex and response to pain stimuli following MNS. In addition, ignificant differences in the expression levels of orexin‑A and OXIR were observed among the three groups and among the time‑points. Orexin‑A and OX1R were upregulated following MNS. The rats in the stimulated group reacted to the MNS and exhibited a re‑awakening response. The results of the present study indicated that MNS may be a therapeutic option for TBI‑induced coma. The mechanism may be associated with increasing expression levels of the excitatory hypothalamic neuropeptide, orexin-A, and its receptor, OX1R, in the hypothalamic region.

  1. Influence of A-21T and C-262T genetic polymorphisms at the promoter region of the catalase (CAT) on gene expression.

    Science.gov (United States)

    Saify, Khyber; Saadat, Iraj; Saadat, Mostafa

    2016-09-01

    Catalase (CAT, OMIM: 115500) is one of the major antioxidant enzymes, which plays an important role in the clearance of reactive oxygen species. Three genetic polymorphisms of A-21T (rs7943316), C-262T (rs1001179), and C-844T (rs769214) in the promoter region of the CAT have been reported. It has been suggested that these polymorphisms may alter the recognition sites of transcriptional factors, therefore it might be concluded that these polymorphisms may alter the expression levels of the gene. The aim of the present study is to evaluate the associations between these genetic variations and the CAT mRNA levels in human peripheral blood cells. The present study consisted of 47 healthy students of Shiraz University (south-west Iran). Genotypes of the CAT polymorphisms were determined by PCR based method. The quantitative CAT mRNA expression levels were investigated using quantitative real-time PCR. Analysis of variance revealed significant differences between the study genotypes (For A-21T polymorphism: F = 7.45; df = 2, 44; P = 0.002; For C-262T polymorphism: F = 15.17; df = 2, 44; P CAT in the AC/TT, TC/TC, TC/TT, and TC/TC diplotypes significantly were higher than the mRNA levels in AC/AC diplotype. There was a significant difference between the study genotypes (F = 9.24; df = 5, 41; P CAT mRNA levels compared with the AC/AC diplotype. The present findings indicated that these polymorphisms were significantly associated with the gene expression.

  2. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

    Science.gov (United States)

    Janssen, Paddy K.C.; Zwinderman, Aeilko H.; Olivier, Berend

    2014-01-01

    Purpose To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). Materials and Methods This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE. Intravaginal ejaculation latency time (IELT) was measured by stopwatch. Controls consisted of 92 Caucasian men. All men with LPE were genotyped for the 5-HTTLPR polymorphism. Allele frequencies and genotypes of short (S) and long (L) variants of the polymorphism were compared between patients and controls. Associations between the LL, SL, and SS genotypes and fold increase of mean IELT were investigated. Results Of the 54 patients, 43 (79.6%) responded to 20-mg paroxetine treatment with an ejaculation delay, whereas 11 patients (20.4%) did not respond; 44%, 18%, and 18% of the patients showed a fold increase in mean IELT of 2-10, 10-20, and more than 20, respectively. Of the 54 men, 14 (25.9%) had the LL genotype, 29 (53.7%) had the SL genotype, and 11 (20.4%) had the SS genotype. In the 92 controls, the LL, SL, and SS genotypes were present in 27 (29.3%), 41 (44.6%), and 24 (26.1%), respectively. No statistically significant differences were found in 5-HTTLPR allelic variations or in 5-HTTLPR gene variations. In all men treated with 20 mg paroxetine, analysis of variance of the natural logarithm of fold increase in the IELT showed no statistically significant difference according to genotype (p=0.83). Conclusions The 5-HTTLPR polymorphism is not associated with daily 20-mg paroxetine treatment-induced ejaculation delay in men with LPE. PMID:24578810

  3. Factors affecting minority population proximity to hazardous facilities

    Energy Technology Data Exchange (ETDEWEB)

    Nieves, L.A. [Argonne National Lab., IL (United States); Nieves, A.L. [Wheaton Coll., IL (United States)]|[Argonne National Lab., IL (United States)

    1995-04-01

    Disproportionate exposure of minority groups to environmental hazards has been attributed to ``environmental racism`` by some authors, without systematic investigation of the factors underlying this exposure pattern. This study examines regional differences in the proximity of African-Americans, Hispanics, Asians, and non-Hispanic Whites to a broad range of facility types and explores the effects of urban and income factors. A statistically significant inverse relationship is found between the percentage of non-Hispanic Whites and virtually all facility categories in all regions. Except for Hispanics in the South, all such associations for minority groups show a direct relationship, though some are nonsignificant. The geographic concentration of facilities is more closely tied to urbanization than to economic factors. Controlling for both urban and economic factors, minority population concentration is still a significant explanatory variable for some facility types in some regions. This finding is most consistent for African-Americans.

  4. Proximity operations concept design study, task 6

    Science.gov (United States)

    Williams, A. N.

    1990-01-01

    The feasibility of using optical technology to perform the mission of the proximity operations communications subsystem on Space Station Freedom was determined. Proximity operations mission requirements are determined and the relationship to the overall operational environment of the space station is defined. From this information, the design requirements of the communication subsystem are derived. Based on these requirements, a preliminary design is developed and the feasibility of implementation determined. To support the Orbital Maneuvering Vehicle and National Space Transportation System, the optical system development is straightforward. The requirements on extra-vehicular activity are such as to allow large fields of uncertainty, thus exacerbating the acquisition problem; however, an approach is given that could mitigate this problem. In general, it is found that such a system could indeed perform the proximity operations mission requirement, with some development required to support extra-vehicular activity.

  5. Endomedullar nail of metacarpal and proximal phalanges

    International Nuclear Information System (INIS)

    Mendez Olaya, Francisco Javier; Sanchez Mesa, Pedro Antonio

    2002-01-01

    Prospective study, series of cases; it included patients with diaphysis fractures and union diaphysis-neck or union diaphysis-base of metacarpal and proximal phalanges, in whom was practiced anterograde intramedullary nailing previous closed reduction of the fracture, using prevent intramedullary nail of 1.6 mm. (cem 16) for the metacarpal fractures, and two nail prevent of 1.0 mm. (cem 10) for the proximal phalangeal fractures. Indications: transverse and oblique short fractures, spiral and with comminuting bicortical. Pursuit average is 5.7 months. Frequency surgical intervened patient: 2.2 each month, using this surgical technique a total of 20 (twenty) patients have been operated, 21 (twenty one) fractures; 16 (sixteen) metacarcal fractures and 5 (five) proximal phalangeal fractures, all of them tested using clinical and radiological parameters. Results: good 82%, regular 18%, and bad 0% obtaining bony consolidation and early rehabilitation with incorporation to their habitual works

  6. Correlation between social proximity and mobility similarity.

    Science.gov (United States)

    Fan, Chao; Liu, Yiding; Huang, Junming; Rong, Zhihai; Zhou, Tao

    2017-09-20

    Human behaviors exhibit ubiquitous correlations in many aspects, such as individual and collective levels, temporal and spatial dimensions, content, social and geographical layers. With rich Internet data of online behaviors becoming available, it attracts academic interests to explore human mobility similarity from the perspective of social network proximity. Existent analysis shows a strong correlation between online social proximity and offline mobility similarity, namely, mobile records between friends are significantly more similar than between strangers, and those between friends with common neighbors are even more similar. We argue the importance of the number and diversity of common friends, with a counter intuitive finding that the number of common friends has no positive impact on mobility similarity while the diversity plays a key role, disagreeing with previous studies. Our analysis provides a novel view for better understanding the coupling between human online and offline behaviors, and will help model and predict human behaviors based on social proximity.

  7. Evaluation and Management of Proximal Humerus Fractures

    Directory of Open Access Journals (Sweden)

    Ekaterina Khmelnitskaya

    2012-01-01

    Full Text Available Proximal humerus fractures are common injuries, especially among older osteoporotic women. Restoration of function requires a thorough understanding of the neurovascular, musculotendinous, and bony anatomy. This paper addresses the relevant anatomy and highlights various management options, including indication for arthroplasty. In the vast majority of cases, proximal humerus fractures may be treated nonoperatively. In the case of displaced fractures, when surgical intervention may be pursued, numerous constructs have been investigated. Of these, the proximal humerus locking plate is the most widely used. Arthroplasty is generally reserved for comminuted 4-part fractures, head-split fractures, or fractures with significant underlying arthritic changes. Reverse total shoulder arthroplasty is reserved for patients with a deficient rotator cuff, or highly comminuted tuberosities.

  8. The Life Saving Effects of Hospital Proximity

    DEFF Research Database (Denmark)

    Bertoli, Paola; Grembi, Veronica

    We assess the lifesaving effect of hospital proximity using data on fatality rates of road-traffic accidents. While most of the literature on this topic is based on changes in distance to the nearest hospital triggered by hospital closures and use OLS estimates, our identification comes from......) increases the fatality rate by 13.84% on the sample average. This is equal to a 0.92 additional death per every 100 accidents. We show that OLS estimates provide a downward biased measure of the real effect of hospital proximity because they do not fully solve spatial sorting problems. Proximity matters...... more when the road safety is low; the emergency service is not properly organized, and the nearest hospital has lower quality standards....

  9. Proximity functions for general right cylinders

    International Nuclear Information System (INIS)

    Kellerer, A.M.

    1981-01-01

    Distributions of distances between pairs of points within geometrical objects, or the closely related proximity functions and geometric reduction factors, have applications to dosimetric and microdosimetric calculations. For convex bodies these functions are linked to the chord-length distributions that result from random intersections by straight lines. A synopsis of the most important relations is given. The proximity functions and related functions are derived for right cylinders with arbitrary cross sections. The solution utilizes the fact that the squares of the distances between two random points are sums of independently distributed squares of distances parallel and perpendicular to the axis of the cylinder. Analogous formulas are derived for the proximity functions or geometric reduction factors for a cylinder relative to a point. This requires only a minor modification of the solution

  10. Industrial Computed Tomography using Proximal Algorithm

    KAUST Repository

    Zang, Guangming

    2016-04-14

    In this thesis, we present ProxiSART, a flexible proximal framework for robust 3D cone beam tomographic reconstruction based on the Simultaneous Algebraic Reconstruction Technique (SART). We derive the proximal operator for the SART algorithm and use it for minimizing the data term in a proximal algorithm. We show the flexibility of the framework by plugging in different powerful regularizers, and show its robustness in achieving better reconstruction results in the presence of noise and using fewer projections. We compare our framework to state-of-the-art methods and existing popular software tomography reconstruction packages, on both synthetic and real datasets, and show superior reconstruction quality, especially from noisy data and a small number of projections.

  11. Characterization of the distal promoter of the human pyruvate carboxylase gene in pancreatic beta cells.

    Directory of Open Access Journals (Sweden)

    Ansaya Thonpho

    Full Text Available Pyruvate carboxylase (PC is an enzyme that plays a crucial role in many biosynthetic pathways in various tissues including glucose-stimulated insulin secretion. In the present study, we identify promoter usage of the human PC gene in pancreatic beta cells. The data show that in the human, two alternative promoters, proximal and distal, are responsible for the production of multiple mRNA isoforms as in the rat and mouse. RT-PCR analysis performed with cDNA prepared from human liver and islets showed that the distal promoter, but not the proximal promoter, of the human PC gene is active in pancreatic beta cells. A 1108 bp fragment of the human PC distal promoter was cloned and analyzed. It contains no TATA box but possesses two CCAAT boxes, and other putative transcription factor binding sites, similar to those of the distal promoter of rat PC gene. To localize the positive regulatory region in the human PC distal promoter, 5'-truncated and the 25-bp and 15-bp internal deletion mutants of the human PC distal promoter were generated and used in transient transfections in INS-1 832/13 insulinoma and HEK293T (kidney cell lines. The results indicated that positions -340 to -315 of the human PC distal promoter serve as (an activator element(s for cell-specific transcription factor, while the CCAAT box at -71/-67, a binding site for nuclear factor Y (NF-Y, as well as a GC box at -54/-39 of the human PC distal promoter act as activator sequences for basal transcription.

  12. [Partial replantation following proximal limb injury].

    Science.gov (United States)

    Dubert, T; Malikov, S A; Dinh, A; Kupatadze, D D; Oberlin, C; Alnot, J Y; Nabokov, B B

    2000-11-01

    Proximal replantation is a technically feasible but life-threatening procedure. Indications must be restricted to patients in good condition with a good functional prognosis. The goal of replantation must be focused not only on reimplanting the amputated limb but also on achieving a good functional outcome. For the lower limb, simple terminalization remains the best choice in many cases. When a proximal amputation is not suitable for replantation, the main aim of the surgical procedure must be to reconstruct a stump long enough to permit fitting a prosthesis preserving the function of the adjacent joint. If the proximal stump beyond the last joint is very short, it may be possible to restore some length by partial replantation of spared tissues from the amputated part. We present here the results we obtained following this policy. This series included 16 cases of partial replantations, 14 involving the lower limb and 2 the upper limb. All were osteocutaneous microsurgical transfers. For the lower limb, all transfers recovered protective sensitivity following tibial nerve repair. The functional calcaeoplantar unit was used in 13 cases. The transfer of this specialized weight bearing tissue provided a stable distal surface making higher support unnecessary. In one case, we raised a 13-cm vascularized tibial segment covered with foot skin for additional length. For the upper limb, the osteocutaneous transfer, based on the radial artery, was not reinnervated, but this lack of sensitivity did not impair prosthesis fitting. One vascular failure was finally amputated. This was the only unsuccessful result. For all other patients, the surgical procedure facilitated prosthesis fitting and preserved the proximal joint function despite an initially very proximal amputation. The advantages of partial replantation are obvious compared with simple terminalization or secondary reconstruction. There is no secondary donor site and, because there is no major muscle mass in the

  13. The developmental spectrum of proximal radioulnar synostosis

    Energy Technology Data Exchange (ETDEWEB)

    Elliott, Alison M. [University of Manitoba, Winnipeg Regional Health Association Program of Genetics and Metabolism, Winnipeg, MB (Canada); University of Manitoba, Department of Paediatrics and Child Health, Winnipeg, MB (Canada); University of Manitoba, Department of Biochemistry and Medical Genetics, Winnipeg, MB (Canada); University of Manitoba, WRHA Program of Genetics and Metabolism, Departments of Paediatrics and Child Health, Biochemistry and Medical Genetics, Winnipeg, MB (Canada); Kibria, Lisa [University of Manitoba, Department of School of Medical Rehabilitation, Winnipeg, MB (Canada); Reed, Martin H. [University of Manitoba, Department of Paediatrics and Child Health, Winnipeg, MB (Canada); University of Manitoba, Department of Biochemistry and Medical Genetics, Winnipeg, MB (Canada); University of Manitoba, Department of Diagnostic Imaging, Winnipeg, MB (Canada)

    2010-01-15

    Proximal radioulnar synostosis is a rare upper limb malformation. The elbow is first identifiable at 35 days (after conception), at which stage the cartilaginous anlagen of the humerus, radius and ulna are continuous. Subsequently, longitudinal segmentation produces separation of the distal radius and ulna. However, temporarily, the proximal ends are united and continue to share a common perichondrium. We investigated the hypothesis that posterior congenital dislocation of the radial head and proximal radioulnar fusion are different clinical manifestations of the same primary developmental abnormality. Records were searched for ''proximal radioulnar fusion/posterior radial head dislocation'' in patients followed at the local Children's Hospital and Rehabilitation Centre for Children. Relevant radiographic, demographic and clinical data were recorded. Ethics approval was obtained through the University Research Ethics Board. In total, 28 patients met the inclusion criteria. The majority of patients (16) had bilateral involvement; eight with posterior dislocation of the radial head only; five had posterior radial head dislocation with radioulnar fusion and two had radioulnar fusion without dislocation. One patient had bilateral proximal radioulnar fusion and posterior dislocation of the left radial head. Nine patients had only left-sided involvement, and three had only right-sided involvement.The degree of proximal fusion varied, with some patients showing 'complete' proximal fusion and others showing fusion that occurred slightly distal to the radial head: 'partially separated.' Associated disorders in our cohort included Poland syndrome (two patients), Cornelia de Lange syndrome, chromosome anomalies (including tetrasomy X) and Cenani Lenz syndactyly. The suggestion of a developmental relationship between posterior dislocation of the radial head and proximal radioulnar fusion is supported by the fact that both anomalies

  14. Proximity effects in ferromagnet/superconductor structures

    International Nuclear Information System (INIS)

    Yu, H.L.; Sun, G.Y.; Yang, L.Y.; Xing, D.Y.

    2004-01-01

    The Nambu spinor Green's function approach is applied to study proximity effects in ferromagnet/superconductor (FM/SC) structures. They include the induced superconducting order parameter and density of states (DOS) with superconducting feature on the FM side, and spin-dependent DOS within the energy gap on the SC side. The latter indicates an appearance of gapless superconductivity and a coexistence of ferromagnetism and superconductivity in a small regime near the interface. The influence of exchange energy in FM and barrier strength at interface on the proximity effects is discussed

  15. Ultimate and proximate explanations of strong reciprocity.

    Science.gov (United States)

    Vromen, Jack

    2017-08-23

    Strong reciprocity (SR) has recently been subject to heated debate. In this debate, the "West camp" (West et al. in Evol Hum Behav 32(4):231-262, 2011), which is critical of the case for SR, and the "Laland camp" (Laland et al. in Science, 334(6062):1512-1516, 2011, Biol Philos 28(5):719-745, 2013), which is sympathetic to the case of SR, seem to take diametrically opposed positions. The West camp criticizes advocates of SR for conflating proximate and ultimate causation. SR is said to be a proximate mechanism that is put forward by its advocates as an ultimate explanation of human cooperation. The West camp thus accuses advocates of SR for not heeding Mayr's original distinction between ultimate and proximate causation. The Laland camp praises advocates of SR for revising Mayr's distinction. Advocates of SR are said to replace Mayr's uni-directional view on the relation between ultimate and proximate causes by the bi-directional one of reciprocal causation. The paper argues that both the West camp and the Laland camp misrepresent what advocates of SR are up to. The West camp is right that SR is a proximate cause of human cooperation. But rather than putting forward SR as an ultimate explanation, as the West camp argues, advocates of SR believe that SR itself is in need of ultimate explanation. Advocates of SR tend to take gene-culture co-evolutionary theory as the correct meta-theoretical framework for advancing ultimate explanations of SR. Appearances notwithstanding, gene-culture coevolutionary theory does not imply Laland et al.'s notion of reciprocal causation. "Reciprocal causation" suggests that proximate and ultimate causes interact simultaneously, while advocates of SR assume that they interact sequentially. I end by arguing that the best way to understand the debate is by disambiguating Mayr's ultimate-proximate distinction. I propose to reserve "ultimate" and "proximate" for different sorts of explanations, and to use other terms for distinguishing

  16. Infiltrating/sealing proximal caries lesions

    DEFF Research Database (Denmark)

    Martignon, S; Ekstrand, K R; Gomez, J

    2012-01-01

    This randomized split-mouth controlled clinical trial aimed at assessing the therapeutic effects of infiltration vs. sealing for controlling caries progression on proximal surfaces. Out of 90 adult students/patients assessed at university clinics and agreeing to participate, 39, each with 3...... differences in lesion progression between infiltration and placebo (P = 0.0012) and between sealing and placebo (P = 0.0269). The study showed that infiltration and sealing are significantly better than placebo treatment for controlling caries progression on proximal lesions. No significant difference...

  17. Uncemented allograft-prosthetic composite reconstruction of the proximal femur

    Directory of Open Access Journals (Sweden)

    Li Min

    2014-01-01

    Full Text Available Background: Allograft-prosthetic composite can be divided into three groups names cemented, uncemented, and partially cemented. Previous studies have mainly reported outcomes in cemented and partially cemented allograft-prosthetic composites, but have rarely focused on the uncemented allograft-prosthetic composites. The objectives of our study were to describe a surgical technique for using proximal femoral uncemented allograft-prosthetic composite and to present the radiographic and clinical results. Materials and Methods: Twelve patients who underwent uncemented allograft-prosthetic composite reconstruction of the proximal femur after bone tumor resection were retrospectively evaluated at an average followup of 24.0 months. Clinical records and radiographs were evaluated. Results: In our series, union occurred in all the patients (100%; range 5-9 months. Until the most recent followup, there were no cases with infection, nonunion of the greater trochanter, junctional bone resorption, dislocation, allergic reaction, wear of acetabulum socket, recurrence, and metastasis. But there were three periprosthetic fractures which were fixed using cerclage wire during surgery. Five cases had bone resorption in and around the greater trochanter. The average Musculoskeletal Tumor Society (MSTS score and Harris hip score (HHS were 26.2 points (range 24-29 points and 80.6 points (range 66.2-92.7 points, respectively. Conclusions: These results showed that uncemented allograft-prosthetic composite could promote bone union through compression at the host-allograft junction and is a good choice for proximal femoral resection. Although this technology has its own merits, long term outcomes are yet not validated.

  18. Regulation of the intronic promoter of rat estrogen receptor alpha gene, responsible for truncated estrogen receptor product-1 expression.

    Science.gov (United States)

    Schausi, Diane; Tiffoche, Christophe; Thieulant, Marie-Lise

    2003-07-01

    We have characterized the intronic promoter of the rat estrogen receptor (ER) alpha gene, responsible for the lactotrope-specific truncated ER product (TERP)-1 isoform expression. Transcriptional regulation was investigated by transient transfections using 5'-deletion constructs. TERP promoter constructs were highly active in MMQ cells, a pure lactotrope cell line, whereas a low basal activity was detected in alphaT3-1 gonadotrope cells or in COS-7 monkey kidney cells. Serial deletion analysis revealed that 1) a minimal -693-bp region encompassing the TATA box is sufficient to allow lactotrope-specific expression; 2) the promoter contains strong positive cis-acting elements both in the distal and proximal regions, and 3) the region spanning the -1698/-1194 region includes repressor elements. Transient transfection studies, EMSAs, and gel shifts demonstrated that estrogen activates the TERP promoter via an estrogen-responsive element (ERE1) located within the proximal region. Mutation of ERE1 site completely abolishes the estradiol-dependent transcription, indicating that ERE1 site is sufficient to confer estrogen responsiveness to TERP promoter. In addition, ERalpha action was synergized by transfection of the pituitary-specific factor Pit-1. EMSAs showed that a single Pit-1 DNA binding element in the vicinity of the TATA box is sufficient to confer response by the TERP promoter. In conclusion, we demonstrated, for the first time, that TERP promoter regulation involves ERE and Pit-1 cis-elements and corresponding trans-acting factors, which could play a role in the physiological changes that occur in TERP-1 transcription in lactotrope cells.

  19. Phytochemical screening, proximate analysis and acute toxicity ...

    African Journals Online (AJOL)

    Phytochemical screening results indicate the presence of saponins, flavonoids, phytosterols and phenols. Acute toxicity study showed there was no mortality at 8000 mg/kg of the extract. The results indicate that the plant is rich in phytochemicals and is relatively safe. Key words: Phytochemicals, acute toxicity, proximate ...

  20. PROXIMATE AND ELEMENTAL COMPOSITION OF WHITE GRUBS

    African Journals Online (AJOL)

    DR. AMINU

    This study determined the proximate and mineral element composition of whole white grubs using standard methods of analysis. ... and 12.75 ± 3.65% respectively. Mineral contents of white grub in terms of relative concentration .... of intracellular Ca, bone mineralization, blood coagulation, and plasma membrane potential ...

  1. Phytochemical Screening and Proximate Analysis of Newbouldia ...

    African Journals Online (AJOL)

    The study was conducted to assess the phytochemical and proximate composition of Newboudia laevis leaves and Allium sativum bulb extracts. The leaves and bulbs extracts were analyzed for their chemical composition and antinutritional factors (ANFs) which include moisture, crude protein, crude fat, crude fiber, total ash ...

  2. Phytochemical Screening, Proximate and Mineral Composition of ...

    African Journals Online (AJOL)

    Leaves of sweet potato (Ipomoea batatas) grown in Tepi area was studied for their class of phytochemicals, mineral and proximate composition using standard analytical methods. The phytochemical screening revealed the presence of alkaloids, flavonoid, terpenoids, saponins, quinones, phenol, tannins, amino acid and ...

  3. Phytochemical screening, proximate and elemental analysis of ...

    African Journals Online (AJOL)

    Citrus sinensis was screened for its phytochemical composition and was evaluated for the proximate and elemental analysis. The phytochemical analysis indicated the presence of reducing sugar, saponins, cardiac glycosides, tannins and flavonoids. The elemental analysis indicated the presence of the following mineral ...

  4. Modified Koyanagi Technique in Management of Proximal ...

    African Journals Online (AJOL)

    xp

    Modified Koyanagi Technique in Management of Proximal Hypospadias. Adham Elsaied, Basem Saied, and Mohammed El- ... All operations were performed by the authors,using fine instruments and under 3.5X loupe ... the other needed an operation to close the fistula six months later. The case with meatal recession had ...

  5. Proximity focusing RICH with TOF capabilities

    International Nuclear Information System (INIS)

    Korpar, S.; Adachi, I.; Fujita, K.; Fukushima, T.; Gorisek, A.; Hayashi, D.; Iijima, T.; Ikado, T.; Ishikawa, T.; Kawai, H.; Kozakai, Y.; Krizan, P.; Kuratani, A.; Mazuka, Y.; Nakagawa, T.; Nishida, S.; Ogawa, S.; Pestotnik, R.; Seki, T.; Sumiyoshi, T.; Tabata, M.; Unno, Y.

    2007-01-01

    A proximity focusing RICH counter with a multi-channel micro-channel plate (MCP) PMT was tested as a time-of-flight counter. Cherenkov photons emitted in the radiator medium as well as in the entrance window of the PMT were used for the time-of-flight measurement, and an excellent performance of the counter could be demonstrated

  6. Proximate composition and mycological characterization of peanut ...

    African Journals Online (AJOL)

    SARAH

    2013-12-30

    Dec 30, 2013 ... ABSTRACT. Objective: The aim of this work was to contribute to the food safety of Ivorian consumers by investigating the proximate composition and the toxic fungal contamination of peanut butters offered for retail sale on the different markets of Abidjan. Methodology and results: Peanut butter samples (45) ...

  7. Prosthetic replacement for proximal humeral fractures.

    Science.gov (United States)

    Kontakis, George; Tosounidis, Theodoros; Galanakis, Ioannis; Megas, Panagiotis

    2008-12-01

    The ideal management of complex proximal humeral fractures continues to be debatable. Evolution of proximal humeral fracture management, during the past decade, led to the implementation of many innovations in surgical treatment. Even though the pendulum of treatment seems to swing towards new trends such as locked plating, hemiarthroplasty remains a valid and reliable option that serves the patient's needs well. Hemiarthroplasty is indicated for complex proximal humeral fractures in elderly patients with poor bone stock and when internal fixation is difficult or unreliable. Hemiarthroplasty provides a better result when it is performed early post-injury. Stem height, retroversion and tuberosity positioning are technical aspects of utmost importance. Additionally reverse total shoulder arthroplasty is an alternative new modality that can be used as a primary solution in selected patients with proximal humeral fracture treatment. Failed hemiarthroplasty and fracture sequelae can be successfully managed with reverse total shoulder arthroplasty. Individual decision-making and tailored treatment that takes into consideration the personality of the fracture and the patient's characteristics should be used.

  8. Phytochemistry and proximate composition of ginger ( Zingiber ...

    African Journals Online (AJOL)

    The results of the phytochemical screening showed that alkaloids, carbohydrates, glycosides, proteins, saponins, steroids, flavonoids and terpenoids were present, while reducing sugars, tannins, oils and acid compounds were absent. Similarly, the results of the proximate analysis of the rhizome showed that ginger ...

  9. Disability occurrence and proximity to death

    NARCIS (Netherlands)

    Klijs, Bart; Mackenbach, Johan P.; Kunst, Anton E.

    2010-01-01

    Purpose. This paper aims to assess whether disability occurrence is related more strongly to proximity to death than to age. Method. Self reported disability and vital status were available from six annual waves and a subsequent 12-year mortality follow-up of the Dutch GLOBE longitudinal study.

  10. Proximate composition, bread characteristics and sensory ...

    African Journals Online (AJOL)

    This study was carried out to investigate proximate composition, bread characteristics and sensory evaluation of cocoyam-wheat composite breads at different levels of cocoyam flour substitution for human consumption.A whole wheat bread (WWB) and cocoyam-composite breads (CCB1,CCB 2 and CCB 3) were prepared ...

  11. A meta-analysis of the effects of the 5-hydroxytryptamine transporter gene-linked promoter region polymorphism on susceptibility to lifelong premature ejaculation.

    Directory of Open Access Journals (Sweden)

    Lijie Zhu

    Full Text Available OBJECTIVE: Premature ejaculation (PE has been reported as the most common male sexual dysfunction with global prevalence rates estimated at approximately 30%. The neurobiogenesis of ejaculation is very complex and involves the serotoninergic (5-hydroxytryptamine, 5-HT system. Recently, genetic polymorphisms located on SLC6A4 gene codifying for 5-HT transporter (5-HTT, the major regulator of serotonic neurotransmission, have been linked with the pathogenesis and risk of PE. Apparently studies of this type of polymorphism in PE have show conflicting results. METHODS: A meta-analysis was performed that are available in relation with 5-HTT gene-linked promoter region (5-HTTLPR polymorphism and the risk of lifelong PE (LPE in men to clarify this relationship. We searched Pubmed and Embase (last search updated on Aug 2012 using 'premature ejaculation', 'polymorphism or variant', 'genotype', 'ejaculatory function', and 'rapid ejaculation' as keywords and reference lists of studies corresponded to the inclusion criteria for meta-analysis. These studies involved the total number of 481 LPE men and 466 health control men subjects. Odds ratio (OR and 95% confidence intervals (CIs were used to evaluate this relationship. RESULTS: In the overall analysis, significant associations between LPE risk and 5-HTTLPR polymorphism were found (L-allele vs. S-allele OR = 0.86, 95% CI = 0.79-0.95, P = 0.002; LL vs. SS: OR = 0.80, 95% CI = 0.68-0.95, P = 0.009; LS vs. SS: OR = 0.85, 95% CI = 0.76-0.97, P = 0.012 and LL+LS vs. SS: OR = 0.88, 95% CI = 0.81-0.95, P = 0.002. Moreover, in subgroup analysis based on ethnicity, similar significant associations were detected. The Egger's test did not reveal presence of a publication bias. CONCLUSIONS: Our investigations demonstrate that 5-HTTLPR (L>S polymorphism might protect men against LPE risk. Further studies based on larger sample size and gene-environment interactions should

  12. Profile, knowledge, and work patterns of a cadre of maternal, newborn, and child health CHWs focusing on preventive and promotive services in Morogoro Region, Tanzania.

    Science.gov (United States)

    LeFevre, Amnesty E; Mpembeni, Rose; Chitama, Dereck; George, Asha S; Mohan, Diwakar; Urassa, David P; Gupta, Shivam; Feldhaus, Isabelle; Pereira, Audrey; Kilewo, Charles; Chebet, Joy J; Cooper, Chelsea M; Besana, Giulia; Lutale, Harriet; Bishanga, Dunstan; Mtete, Emmanuel; Semu, Helen; Baqui, Abdullah H; Killewo, Japhet; Winch, Peter J

    2015-12-24

    Despite impressive decreases in under-five mortality, progress in reducing maternal and neonatal mortality in Tanzania has been slow. We present an evaluation of a cadre of maternal, newborn, and child health community health worker (MNCH CHW) focused on preventive and promotive services during the antenatal and postpartum periods in Morogoro Region, Tanzania. Study findings review the effect of several critical design elements on knowledge, time allocation, service delivery, satisfaction, and motivation. A quantitative survey on service delivery and knowledge was administered to 228 (of 238 trained) MNCH CHWs. Results are compared against surveys administered to (1) providers in nine health centers (n = 88) and (2) CHWs (n = 53) identified in the same districts prior to the program's start. Service delivery outputs were measured by register data and through a time motion study conducted among a sub-sample of 33 randomly selected MNCH CHWs. Ninety-seven percent of MNCH CHWs (n = 228) were interviewed: 55% male, 58% married, and 52% with secondary school education or higher. MNCH CHWs when compared to earlier CHWs were more likely to be unmarried, younger, and more educated. Mean MNCH CHW knowledge scores were <50% for 8 of 10 MNCH domains assessed and comparable to those observed for health center providers but lower than those for earlier CHWs. MNCH CHWs reported covering a mean of 186 households and were observed to provide MNCH services for 5 h weekly. Attendance of monthly facility-based supervision meetings was nearly universal and focused largely on registers, yet data quality assessments highlighted inconsistencies. Despite program plans to provide financial incentives and bicycles for transport, only 56% of CHWs had received financial incentives and none received bicycles. Initial rollout of MNCH CHWs yields important insights into addressing program challenges. The social profile of CHWs was not significantly associated with knowledge or

  13. Method to Measure Tone of Axial and Proximal Muscle

    Science.gov (United States)

    Gurfinkel, Victor S.; Cacciatore, Timothy W.; Cordo, Paul J.; Horak, Fay B.

    2011-01-01

    The control of tonic muscular activity remains poorly understood. While abnormal tone is commonly assessed clinically by measuring the passive resistance of relaxed limbs1, no systems are available to study tonic muscle control in a natural, active state of antigravity support. We have developed a device (Twister) to study tonic regulation of axial and proximal muscles during active postural maintenance (i.e. postural tone). Twister rotates axial body regions relative to each other about the vertical axis during stance, so as to twist the neck, trunk or hip regions. This twisting imposes length changes on axial muscles without changing the body's relationship to gravity. Because Twister does not provide postural support, tone must be regulated to counteract gravitational torques. We quantify this tonic regulation by the restive torque to twisting, which reflects the state of all muscles undergoing length changes, as well as by electromyography of relevant muscles. Because tone is characterized by long-lasting low-level muscle activity, tonic control is studied with slow movements that produce "tonic" changes in muscle length, without evoking fast "phasic" responses. Twister can be reconfigured to study various aspects of muscle tone, such as co-contraction, tonic modulation to postural changes, tonic interactions across body segments, as well as perceptual thresholds to slow axial rotation. Twister can also be used to provide a quantitative measurement of the effects of disease on axial and proximal postural tone and assess the efficacy of intervention. PMID:22214974

  14. Downstream Antisense Transcription Predicts Genomic Features That Define the Specific Chromatin Environment at Mammalian Promoters.

    Directory of Open Access Journals (Sweden)

    Christopher A Lavender

    2016-08-01

    Full Text Available Antisense transcription is a prevalent feature at mammalian promoters. Previous studies have primarily focused on antisense transcription initiating upstream of genes. Here, we characterize promoter-proximal antisense transcription downstream of gene transcription starts sites in human breast cancer cells, investigating the genomic context of downstream antisense transcription. We find extensive correlations between antisense transcription and features associated with the chromatin environment at gene promoters. Antisense transcription downstream of promoters is widespread, with antisense transcription initiation observed within 2 kb of 28% of gene transcription start sites. Antisense transcription initiates between nucleosomes regularly positioned downstream of these promoters. The nucleosomes between gene and downstream antisense transcription start sites carry histone modifications associated with active promoters, such as H3K4me3 and H3K27ac. This region is bound by chromatin remodeling and histone modifying complexes including SWI/SNF subunits and HDACs, suggesting that antisense transcription or resulting RNA transcripts contribute to the creation and maintenance of a promoter-associated chromatin environment. Downstream antisense transcription overlays additional regulatory features, such as transcription factor binding, DNA accessibility, and the downstream edge of promoter-associated CpG islands. These features suggest an important role for antisense transcription in the regulation of gene expression and the maintenance of a promoter-associated chromatin environment.

  15. A pilot study investigating of the nature of point-of-sale alcohol promotions in bottle shops in a large Australian regional city.

    Science.gov (United States)

    Jones, Sandra C; Lynch, Melissa

    2007-08-01

    The promotion of alcohol by retailers and media can contribute to a culture of excessive alcohol consumption, but the effect of non-advertising alcohol promotions has largely been neglected. This study sought to gather initial data on this important area. An observational study of alcohol point-of-sale promotions in the Wollongong CBD area, conducted in July-August 2005. We identified 17 different promotions in three categories: gift with purchase; competitions; and buy some, get some free. Given previous research demonstrating the relationship between increased alcohol consumption and both ownership of alcohol-related merchandise and reduced per unit price, it appears that point-of-sale promotions may have the potential to further increase alcohol consumption among young people. Only when the extent and impact of such promotions is demonstrated will we be in a position to effectively advocate for appropriate regulations to ensure young people are not exposed to marketing strategies that further increase their exposure to alcohol-related harms.

  16. HDAC inhibitors TSA and sodium butyrate enhanced the human IL-5 expression by altering histone acetylation status at its promoter region.

    Science.gov (United States)

    Han, Songyan; Lu, Jun; Zhang, Yu; Cheng, Cao; Li, Lin; Han, Liping; Huang, Baiqu

    2007-02-15

    The expression of IL-5 correlated tightly with the maturation and differentiation of eosinophils, and is considered as a cytokine responsible for allergic inflammation. We report here that inhibition of HDAC activity by Trichostatin A (TSA) and sodium butyrate (NaBu), the two specific HDAC inhibitors, resulted in the elevation of both endogenous and exogenous activity of IL-5 promoter. We demonstrated that both the mRNA expression and protein production of IL-5 were stimulated by TSA and NaBu treatments. ChIP assays showed that treatments of TSA and NaBu caused hyperacetylation of histones H3 and H4 on IL-5 promoter in Jurkat cells, which consequently promoted the exogenous luciferase activity driven by this promoter. Moreover, site-directed mutagenesis studies showed that the binding sites for transcription factors NFAT, GATA3 and YY1 on IL-5 promoter were critical for the effects of TSA and NaBu, suggesting that the transcriptional activation of IL-5 gene by these inhibitors was achieved by affecting HDAC function on IL-5 promoter via transcription factors. These data will contribute to elucidating the unique mechanism of IL-5 transcriptional control and to the therapy of allergic disorders related to IL-5.

  17. Repair of esophageal atresia with proximal fistula using endoscopic magnetic compression anastomosis (magnamosis) after staged lengthening.

    Science.gov (United States)

    Dorman, Robert M; Vali, Kaveh; Harmon, Carroll M; Zaritzky, Mario; Bass, Kathryn D

    2016-05-01

    We describe the treatment of a patient with long-gap esophageal atresia with an upper pouch fistula, mircogastria and minimal distal esophageal remnant. After 4.5 months of feeding via gastrostomy, a proximal fistula was identified by bronchoscopy and a thoracoscopic modified Foker procedure was performed reducing the gap from approximately 7-5 cm over 2 weeks of traction. A second stage to ligate the fistula and suture approximate the proximal and distal esophagus resulted in a gap of 1.5 cm. IRB and FDA approval was then obtained for endoscopic placement of 10-French catheter mounted magnets in the proximal and distal pouches promoting a magnetic compression anastomosis (magnamosis). Magnetic coupling occurred at 4 days and after magnet removal at 13 days an esophagram demonstrated a 10 French channel without leak. Serial endoscopic balloon dilation has allowed drainage of swallowed secretions as the baby learns bottling behavior at home.

  18. Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

    Science.gov (United States)

    Tencomnao, T; Yu, R K; Kapitonov, D

    2001-02-16

    UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

  19. Proximal tubular hypertrophy and enlarged glomerular and proximal tubular urinary space in obese subjects with proteinuria.

    Directory of Open Access Journals (Sweden)

    Ana Tobar

    Full Text Available BACKGROUND: Obesity is associated with glomerular hyperfiltration, increased proximal tubular sodium reabsorption, glomerular enlargement and renal hypertrophy. A single experimental study reported an increased glomerular urinary space in obese dogs. Whether proximal tubular volume is increased in obese subjects and whether their glomerular and tubular urinary spaces are enlarged is unknown. OBJECTIVE: To determine whether proximal tubules and glomerular and tubular urinary space are enlarged in obese subjects with proteinuria and glomerular hyperfiltration. METHODS: Kidney biopsies from 11 non-diabetic obese with proteinuria and 14 non-diabetic lean patients with a creatinine clearance above 50 ml/min and with mild or no interstitial fibrosis were retrospectively analyzed using morphometric methods. The cross-sectional area of the proximal tubular epithelium and lumen, the volume of the glomerular tuft and of Bowman's space and the nuclei number per tubular profile were estimated. RESULTS: Creatinine clearance was higher in the obese than in the lean group (P=0.03. Proteinuria was similarly increased in both groups. Compared to the lean group, the obese group displayed a 104% higher glomerular tuft volume (P=0.001, a 94% higher Bowman's space volume (P=0.003, a 33% higher cross-sectional area of the proximal tubular epithelium (P=0.02 and a 54% higher cross-sectional area of the proximal tubular lumen (P=0.01. The nuclei number per proximal tubular profile was similar in both groups, suggesting that the increase in tubular volume is due to hypertrophy and not to hyperplasia. CONCLUSIONS: Obesity-related glomerular hyperfiltration is associated with proximal tubular epithelial hypertrophy and increased glomerular and tubular urinary space volume in subjects with proteinuria. The expanded glomerular and urinary space is probably a direct consequence of glomerular hyperfiltration. These effects may be involved in the pathogenesis of obesity

  20. Health Promotion Behaviours and Level of Activities of Daily Living and Instrumental Activities of Daily Living Among Elderly People in West Region of Tehran: A Cross-Sectional Survey

    Directory of Open Access Journals (Sweden)

    Aghil Habibi Sola

    2007-10-01

    Full Text Available Objectives: As individuals live longer, health promotion behaviors get even more important, particularly with regard to maintaining functional independence and improving quality of life. The purpose of this study was to explore the relationship between health promotion behaviors and level of Activities of Daily Living (ADL and Instrumental Activities of Daily Living (IADL among elderly people in west region of Tehran. Methods & Materials: This was a descriptive-correlational study. A multi-stage sample of 410 community residents who were over 60 years old were selected from west region of Tehran. Participants who consented to participate in the study were interviewed with a structured questionnaire. The questionnaire consisted of 2-part; Health Promotion Behavior Checklist and questions related to status of physical functioning, which includes activities of daily living (ADLs and instrumental activities of daily living (IADLs. Descriptive statistics and T-test were used to data analysis. Results: The results of the study showed that there were significant relations between ADLs and ' exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Furthermore there were significant relations between the IADLs and 'smoking cessation', 'alcohol abstinence', 'exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Conclusion: Study showed, health promotion behaviors and level of ADL and IADL are related meaningfully. Health care professionals should enhance the physical functioning in elderly people by facilitating health promotion behaviors through formal health promotion programs which focus on regular diet, exercise, and regular physical check-ups which will maintain and increase a healthy and active life.

  1. Computed tomography-based anatomic characterization of proximal aortic dissection with consideration for endovascular candidacy.

    Science.gov (United States)

    Moon, Michael C; Greenberg, Roy K; Morales, Jose P; Martin, Zenia; Lu, Qingsheng; Dowdall, Joseph F; Hernandez, Adrian V

    2011-04-01

    Proximal aortic dissections are life-threatening conditions that require immediate surgical intervention to avert an untreated mortality rate that approaches 50% at 48 hours. Advances in computed tomography (CT) imaging techniques have permitted increased characterization of aortic dissection that are necessary to assess the design and applicability of new treatment paradigms. All patients presenting during a 2-year period with acute proximal aortic dissections who underwent CT scanning were reviewed in an effort to establish a detailed assessment of their aortic anatomy. Imaging studies were assessed in an effort to document the location of the primary proximal fenestration, the proximal and distal extent of the dissection, and numerous morphologic measurements pertaining to the aortic valve, root, and ascending aorta to determine the potential for an endovascular exclusion of the ascending aorta. During the study period, 162 patients presented with proximal aortic dissections. Digital high-resolution preoperative CT imaging was performed on 76 patients, and 59 scans (77%) were of adequate quality to allow assessment of anatomic suitability for treatment with an endograft. In all cases, the dissection plane was detectable, yet the primary intimal fenestration was identified in only 41% of the studies. Scans showed 24 patients (32%) appeared to be anatomically amenable to such a repair (absence of valvular involvement, appropriate length and diameter of proximal sealing regions, lack of need to occlude coronary vasculature). Of the 42 scans that were determined not to be favorable for endovascular repair, the most common exclusion finding was the absence of a proximal landing zone (n = 15; 36%). Appropriately protocoled CT imaging provides detailed anatomic information about the aortic root and ascending aorta, allowing the assessment of which dissections have proximal fenestrations that may be amenable to an endovascular repair. Copyright © 2011 Society for

  2. Large-scale chromatin immunoprecipitation with promoter sequence microarray analysis of the interaction of the NSs protein of Rift Valley fever virus with regulatory DNA regions of the host genome.

    Science.gov (United States)

    Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette

    2012-10-01

    Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.

  3. SINA: A test system for proximity fuses

    Science.gov (United States)

    Ruizenaar, M. G. A.

    1989-04-01

    SINA, a signal generator that can be used for testing proximity fuses, is described. The circuitry of proximity fuses is presented; the output signal of the RF circuit results from a mixing of the emitted signal and received signal that is Doppler shifted in frequency by the relative motion of the fuse with respect to the reflecting target of surface. With SINA, digitized and stored target and clutter signals (previously measured) can be transformed to Doppler signals, for example during a real flight. SINA can be used for testing fuse circuitry, for example in the verification of results of computer simulations of the low frequency Doppler signal processing. The software of SINA and its use are explained.

  4. Isolated Proximal Tibiofibular Dislocation during Soccer

    Directory of Open Access Journals (Sweden)

    Casey Chiu

    2015-01-01

    Full Text Available Proximal tibiofibular dislocations are rarely encountered in the Emergency Department (ED. We present a case involving a man presenting to the ED with left knee pain after making a sharp left turn on the soccer field. His physical exam was only remarkable for tenderness over the lateral fibular head. His X-rays showed subtle abnormalities of the tibiofibular joint. The dislocation was reduced and the patient was discharged from the ED with orthopedic follow-up.

  5. Superconducting proximity effect in topological materials

    Science.gov (United States)

    Reeg, Christopher R.

    In recent years, there has been a renewed interest in the proximity effect due to its role in the realization of topological superconductivity. In this dissertation, we discuss several results that have been obtained in the field of proximity-induced superconductivity and relate the results to the search for Majorana fermions. First, we show that repulsive electron-electron interactions can induce a non-Majorana zero-energy bound state at the interface between a conventional superconductor and a normal metal. We show that this state is very sensitive to disorder, owing to its lack of topological protection. Second, we show that Rashba spin-orbit coupling, which is one of the key ingredients in engineering a topological superconductor, induces triplet pairing in the proximity effect. When the spin-orbit coupling is strong (i.e., when the characteristic energy scale for spin-orbit coupling is comparable to the Fermi energy), the induced singlet and triplet pairing amplitudes can be comparable in magnitude. Finally, we discuss how the size of the proximity-induced gap, which appears in a low-dimensional material coupled to a superconductor, evolves as the thickness of the (quasi-)low-dimensional material is increased. We show that the induced gap can be comparable to the bulk energy gap of the underlying superconductor in materials that are much thicker than the Fermi wavelength, even in the presence of an interfacial barrier and strong Fermi surface mismatch. This result has important experimental consequences for topological superconductivity, as a sizable gap is required to isolate and detect the Majorana modes.

  6. [Proximity and breastfeeding at the maternity hospital].

    Science.gov (United States)

    Fradin-Charrier, Anne-Claire

    2015-01-01

    The establishment of breastfeeding, as well as its duration, are facilitated through the proximity of the mother with her new baby. However, in maternity hospitals, breastfeeding mothers very often leave their baby in the nursery at night time. A study carried out in 2014 in several maternity hospitals put forward suggestions and highlighted areas to improve in everyday practice. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  7. Proximity effects in topological insulator heterostructures

    International Nuclear Information System (INIS)

    Li Xiao-Guang; Wu Guang-Fen; Zhang Gu-Feng; Culcer Dimitrie; Zhang Zhen-Yu; Chen Hua

    2013-01-01

    Topological insulators (TIs) are bulk insulators that possess robust helical conducting states along their interfaces with conventional insulators. A tremendous research effort has recently been devoted to Tl-based heterostructures, in which conventional proximity effects give rise to a series of exotic physical phenomena. This paper reviews our recent studies on the potential existence of topological proximity effects at the interface between a topological insulator and a normal insulator or other topologically trivial systems. Using first-principles approaches, we have realized the tunability of the vertical location of the topological helical state via intriguing dual-proximity effects. To further elucidate the control parameters of this effect, we have used the graphene-based heterostructures as prototypical systems to reveal a more complete phase diagram. On the application side of the topological helical states, we have presented a catalysis example, where the topological helical state plays an essential role in facilitating surface reactions by serving as an effective electron bath. These discoveries lay the foundation for accurate manipulation of the real space properties of the topological helical state in TI-based heterostructures and pave the way for realization of the salient functionality of topological insulators in future device applications. (topical review - low-dimensional nanostructures and devices)

  8. A proximity effect in adults' contamination intuitions

    Directory of Open Access Journals (Sweden)

    Laura R. Kim

    2011-04-01

    Full Text Available Magical beliefs about contagion via contact (Rozin, Nemeroff, Wane, and Sherrod, 1989 may emerge when people overgeneralize real-world mechanisms of contamination beyond their appropriate boundaries (Lindeman and Aarnio, 2007. Do people similarly overextend knowledge of airborne contamination mechanisms? Previous work has shown that very young children believe merely being close to a contamination source can contaminate an item (Springer and Belk 1994; we asked whether this same hyper-avoidant intuition is also reflected in adults' judgments. In two studies, we measured adults' ratings of the desirability of an object that had made contact with a source of contamination, an object nearby that had made no contact with the contaminant, and an object far away that had also made no contact. Adults showed a clear proximity effect, wherein objects near the contamination source were perceived to be less desirable than those far away, even though a separate group of adults unanimously acknowledged that contaminants could not possibly have made contact with either the nearby or far-away object (Study 1. The proximity effect also remained robust when a third group of adults was explicitly told that no contaminating particles had made contact with the objects at any time (Study 2. We discuss implications of our findings for extending the scope of magical contagion effects beyond the contact principle, for understanding the persistence of intuitive theories despite broad acceptance of science-based theories, and for constraining interpretations of the developmental work on proximity beliefs.

  9. Ultrasonographic assessment of the proximal digital annular ligament in the equine forelimb

    International Nuclear Information System (INIS)

    Dik, K.J.; Boroffka, S.; Stolk, P.

    1994-01-01

    Ultrasonography was used with 6 normal cadaver forelimbs of Dutch Warmblood horses to delineate the ultrasonographic anatomy of the palmar pastern region, with emphasis on the proximal digital annular ligament. Using a 5.5 MHz sector scanner, the thin proximal digital annular ligament was not visible on offset sonograms. Only if the digital sheath in the normal limb was distended was the distal border of this ligament outlined. In all normal limbs the palmarodistal thickness of the combined skin-proximal digital annular ligament layer in the mid-pastern region was 2 mm. The flexor tendons and distal sesamoidean ligaments were easily identified as hyperechoic structures. Distension of the digital sheath in the normal limbs clearly outlined the anechoic digital sheath pouches. In 4 lame horses ultrasonography aided the diagnosis of functional proximal digital annular ligament constriction. In all 4 diseased forelimbs ultrasonography demonstrated thickening of the skin-proximal digital annular ligament layer and distension of the digital sheath. In one of these limbs the distended digital sheath was also thickened. The flexor tendons and distal sesamoidean ligaments were normal. There was no radiographic evidence of additional bone or joint lesions

  10. Ultrasonographic assessment of the proximal digital annular ligament in the equine forelimb.

    Science.gov (United States)

    Dik, K J; Boroffka, S; Stolk, P

    1994-01-01

    Ultrasonography was used with 6 normal cadaver forelimbs of Dutch Warmblood horses to delineate the ultrasonographic anatomy of the palmar pastern region, with emphasis on the proximal digital annular ligament. Using a 5.5 MHz sector scanner, the thin proximal digital annular ligament was not visible on offset sonograms. Only if the digital sheath in the normal limb was distended was the distal border of this ligament outlined. In all normal limbs the palmarodistal thickness of the combined skin-proximal digital annular ligament layer in the mid-pastern region was 2 mm. The flexor tendons and distal sesamoidean ligaments were easily identified as hyperechoic structures. Distension of the digital sheath in the normal limbs clearly outlined the anechoic digital sheath pouches. In 4 lame horses ultrasonography aided the diagnosis of functional proximal digital annular ligament constriction. In all 4 diseased forelimbs ultrasonography demonstrated thickening of the skin-proximal digital annular ligament layer and distension of the digital sheath. In one of these limbs the distended digital sheath was also thickened. The flexor tendons and distal sesamoidean ligaments were normal. There was no radiographic evidence of additional bone or joint lesions.

  11. The Effect of Point of Sale Promotions on the Alcohol Purchasing Behaviour of Young People in Metropolitan, Regional and Rural Australia

    Science.gov (United States)

    Jones, Sandra C.; Smith, Kylie M.

    2011-01-01

    This study, part of a larger project examining marketing and alcohol, looked specifically at the effects of point of sale (POS) promotions on young people, with a view to providing evidence which could be used to inform policy and regulation in this area. A series of focus groups were conducted in three different locations with young people aged…

  12. A 200 bp region of the pea ENOD12 promoter is sufficient for nodule-specific and nod factor induced expression

    DEFF Research Database (Denmark)

    Vijn, I; Christiansen, H; Lauridsen, P

    1995-01-01

    previously described. The isolation and characterization of a PsENOD12A genomic clone is presented in this paper. By using a Vicia hirsuta-Agrobacterium rhizogenes transformation system it is shown that both genes have a similar expression pattern in transgenic V. hirsuta root nodules. Promoter analyses...

  13. Domains of apolipoprotein E contributing to triglyceride and cholesterol homeostasis in vivo. Carboxyl-terminal region 203-299 promotes hepatic very low density lipoprotein-triglyceride secretion

    NARCIS (Netherlands)

    Kypreos, K.E.; Dijk, K.W. van; Zee, A. van der; Havekes, L.M.; Zannis, V.I.

    2001-01-01

    Apolipoprotein (apo) E has been implicated in cholesterol and triglyceride homeostasis in humans. At physiological concentration apoE promotes efficient clearance of apoE-containing lipoprotein remnants. However, high apoE plasma levels correlate with high plasma triglyceride levels. We have used

  14. Proximal-type epithelioid sarcoma - Case report Sarcoma epitelióide tipo proximal - Relato de caso

    Directory of Open Access Journals (Sweden)

    Luciana Mendes dos Santos

    2013-06-01

    Full Text Available Epithelioid sarcoma, first described by Enzinger in 1970, is a rare soft-tissue sarcoma typically presenting as a subcutaneous or deep dermal mass in distal portions of the extremities of adolescents and young adults. In 1997, Guillou et al. described a different type of epithelioid sarcoma, called proximal-type epithelioid sarcoma, which is found mostly in the pelvic and perineal regions and genital tracts of young to middle-aged adults. It is characterized by a proliferation of epithelioid-like cells with rhabdoid features and the absence of a granuloma-like pattern. In this paper we present a case of proximal-type epithelioid sarcoma with an aggressive clinical course, including distant metastasis and death nine months after diagnosis.O sarcoma epitelióide, primeiramente descrito por Enzinger, em 1970, é uma neoplasia de partes moles que ocorre principalmente nas extremidades distais de adolescentes e adultos jovens. Em 1997, Guillou e cols. descreveram um tipo diferente de sarcoma epitelióide, que afetava frequentemente a região pélvica, períneo e áreas genitais de pacientes de média idade, com exame histológico caracterizado pela proliferação de células com aspecto epitelióide. Neste trabalho, descreve-se caso de paciente que apresentava há três meses duas lesões na região glútea, cujo exame histológico confirmou diagnóstico de sarcoma epitelioide do tipo proximal, já com presença de metástases pulmonares e cerebrais e que foi a óbito nove meses após o diagnóstico.

  15. Enhancement of RNA synthesis by promoter duplication in tombusviruses

    International Nuclear Information System (INIS)

    Panavas, T.; Panaviene, Z.; Pogany, J.; Nagy, P.D.

    2003-01-01

    Replication of tombusviruses, small plus-strand RNA viruses of plants, is regulated by cis-acting elements present in the viral RNA. The role of cis-acting elements can be studied in vitro by using a partially purified RNA-dependent RNA polymerase (RdRp) preparation obtained from tombusvirus-infected plants , Virology 276, 279- 288). Here, we demonstrate that the minus-strand RNA of tombusviruses contains, in addition to the 3'-terminal minimal plus-strand initiation promoter, a second cis-acting element, termed the promoter proximal enhancer (PPE). The PPE element enhanced RNA synthesis by almost threefold from the adjacent minimal promoter in the in vitro assay. The sequence of the PPE element is 70% similar to the minimal promoter, suggesting that sequence duplication of the minimal promoter may have been the mechanism leading to the generation of the PPE. Consistent with this proposal, replacement of the PPE element with the minimal promoter, which resulted in a perfectly duplicated promoter region, preserved its enhancer-like function. In contrast, mutagenesis of the PPE element or its replacement with an artificial G/C-rich sequence abolished its stimulative effect on initiation of RNA synthesis in vitro. In vivo experiments are also consistent with the role of the PPE element in enhancement of tombusvirus replication. Sequence comparison of several tombusviruses and related carmoviruses further supports the finding that duplication of minimal promoter sequences may have been an important mechanism during the evolution of cis-acting elements in tombusviruses and related RNA viruses

  16. Case report A Rare Cause of Sub-Acute Proximal Intestinal ...

    African Journals Online (AJOL)

    KIGZ

    A Rare Cause of Sub-Acute Proximal Intestinal Obstruction Due to Annular Pancreas. Weledji EP, Ngowe M, Mokake M. Department of Surgery, Regional Hospital Buea, Cameroon. Correspondence to: E P Weledji, P.O Box 126, Limbe, Cameroon. Email:elroypat@yahoo.co.uk. Summary. Background: Annular pancreas is a ...

  17. A Regularized Algorithm for the Proximal Split Feasibility Problem

    Directory of Open Access Journals (Sweden)

    Zhangsong Yao

    2014-01-01

    Full Text Available The proximal split feasibility problem has been studied. A regularized method has been presented for solving the proximal split feasibility problem. Strong convergence theorem is given.

  18. Treatment of proximal ulna and olecranon fractures by dorsal plating

    NARCIS (Netherlands)

    Kloen, Peter; Buijze, Geert A.

    2009-01-01

    OBJECTIVE : Anatomic reconstruction of proximal ulna and olecranon fractures allowing early mobilization and prevention of ulnohumeral arthritis. INDICATIONS : Comminuted olecranon or proximal ulna fractures (including Monteggia fractures), olecranon fractures extending distally from the coronoid

  19. An allelic polymorphism within the human tumor necrosis factor alpha promoter region is strongly associated with HLA A1, B8, and DR3 alleles

    NARCIS (Netherlands)

    Wilson, A. G.; de Vries, N. [=Niek; Pociot, F.; di Giovine, F. S.; van der Putte, L. B.; Duff, G. W.

    1993-01-01

    The tumor necrosis factor (TNF) alpha gene lies within the class III region of the major histocompatibility complex (MHC), telomeric to the class II and centromeric to the class I region. We have recently described the first polymorphism within the human TNF-alpha locus. This is biallelic and lies

  20. Small scale integrated agriculture: a tool of poverty alleviation, gender equality promotion and improving food security at household level in coastal region of Bangladesh

    Directory of Open Access Journals (Sweden)

    MR Begum

    2015-12-01

    Full Text Available The chemical composition of four edible plant foods species, three fish species and one prawn were analyzed in Food Chemistry Laboratory of Behbahan Khatam Alanbia University of Technology, Behbahan, Iran in 2014. The analysis of fatty acid and sugars composition were performed by gas liquid chromatography and high performance liquid chromatography, respectively. Protein and lipid content were founded higher in baked and fried in fish S. commersonnianus (74.29%, (20.20%, fish Sphyraena helleri (88.12% and (17.77%, respectively. Ash content in fish S. commersonnianus varies from 9.80% to 15.34%, and in fish S. helleri from 5.83% to 7.68%. Based on the proximate analysis, it can be calculated that an edible portion of 100 g of studied edible plant foods provides, on average, around 303.9±1.04 kcal. The plant Portulaca neglecta is suitable for high temperature food processes. The macronutrient profile in general revealed that the wild plant foods were with rich sources of protein and carbohydrates, and had low amounts of fat. The highest protein, the lowest fat and energy contents were found in boiled in both fish species; therefore, boiling can be recommended as the best cooking method for healthy diet.

  1. Strong Proximities on Smooth Manifolds and Vorono\\" i Diagrams

    OpenAIRE

    Peters, J. F.; Guadagni, C.

    2015-01-01

    This article introduces strongly near smooth manifolds. The main results are (i) second countability of the strongly hit and far-miss topology on a family $\\mathcal{B}$ of subsets on the Lodato proximity space of regular open sets to which singletons are added, (ii) manifold strong proximity, (iii) strong proximity of charts in manifold atlases implies that the charts have nonempty intersection. The application of these results is given in terms of the nearness of atlases and charts of proxim...

  2. Critical Proximity as a Methodological Move in Techno-Anthropology

    DEFF Research Database (Denmark)

    Birkbak, Andreas; Petersen, Morten Krogh; Elgaard Jensen, Torben

    2015-01-01

    proximity.’ Critical proximity offers an alternative to critical distance, especially with respect to avoiding premature references to abstract panoramas such as democratization and capitalist exploitation in the quest to conduct ‘critical’ analysis. Critical proximity implies, instead, granting the beings...

  3. 75 FR 5009 - Proximity Detection Systems for Underground Mines

    Science.gov (United States)

    2010-02-01

    ... Proximity Detection Systems for Underground Mines AGENCY: Mine Safety and Health Administration, Labor... information regarding whether the use of proximity detection systems would reduce the risk of accidents where... . Information on MSHA-approved proximity detection systems is available on the Internet at http://www.msha.gov...

  4. Performance of health product risk management and surveillance conducted by health personnel at sub-district health promotion hospitals in the northeast region of Thailand

    OpenAIRE

    Kanjanarach, Tipaporn; Jaisa-ard, Raksaworn; Poonaovarat, Nantawan

    2014-01-01

    Tipaporn Kanjanarach,1,2 Raksaworn Jaisa-ard,1,2 Nantawan Poonaovarat3 1Faculty of Pharmaceutical Sciences, Khon Kaen University, Khon Kaen, Thailand; 2Center for Research and Development of Herbal Health Products, Khon Kaen University, Khon Kaen, Thailand; 3Health Consumer Protection, Chaiyapum Health Provincial Office, Chaiyapum, Thailand Background: Health personnel at sub-district health promotion hospitals (SD-HPHs) are assigned to take responsibility for 15 activities related to health...

  5. An HDAC2-TET1 switch at distinct chromatin regions significantly promotes the maturation of pre-iPS to iPS cells

    Science.gov (United States)

    Wei, Tingyi; Chen, Wen; Wang, Xiukun; Zhang, Man; Chen, Jiayu; Zhu, Songcheng; Chen, Long; Yang, Dandan; Wang, Guiying; Jia, Wenwen; Yu, Yangyang; Duan, Tao; Wu, Minjuan; Liu, Houqi; Gao, Shaorong; Kang, Jiuhong

    2015-01-01

    The maturation of induced pluripotent stem cells (iPS) is one of the limiting steps of somatic cell reprogramming, but the underlying mechanism is largely unknown. Here, we reported that knockdown of histone deacetylase 2 (HDAC2) specifically promoted the maturation of iPS cells. Further studies showed that HDAC2 knockdown significantly increased histone acetylation, facilitated TET1 binding and DNA demethylation at the promoters of iPS cell maturation-related genes during the transition of pre-iPS cells to a fully reprogrammed state. We also found that HDAC2 competed with TET1 in the binding of the RbAp46 protein at the promoters of maturation genes and knockdown of TET1 markedly prevented the activation of these genes. Collectively, our data not only demonstrated a novel intrinsic mechanism that the HDAC2-TET1 switch critically regulates iPS cell maturation, but also revealed an underlying mechanism of the interplay between histone acetylation and DNA demethylation in gene regulation. PMID:25934799

  6. THE MULTIPLE SIDES OF THE PORTUGUESE REGIONAL PRESS: THE REGIONAL JOURNALISM IN THE CONTEXT OF COMMUNITY COMMUNICATION

    Directory of Open Access Journals (Sweden)

    João Carlos Ferreira Correia

    2012-04-01

    Full Text Available The main objective of this paper is to analyze the means of proximity (regional, local as privileged actors in the development of an interaction with the public to act as construction of general welfare. The sustainable development of the community is discussed from the communitarian, participatory and deliberative views, originated from the European and American tradition, as well as from the theoretical framework of the Latin American community communication, which developed its own approach. The promotion of a dialogue between public and media is discussed, understood as social actors committed to the promotion of development, though not coincident in their concession on it. The proximity articulates with concepts such as those of 'community', 'civil society', 'development' and 'citizenship', which help to structure the analysis of struggles and processes of discussion on models of development. However, it is recognized that the regional media have specific settings that show a tension between the roots of the community and its organizational nature. Thus, throughout the text, is resorted to a study case prepared in Portugal along with several regional means to illustrate this tension.

  7. Identification of distal regulatory regions in the human alpha IIb gene locus necessary for consistent, high-level megakaryocyte expression.

    Science.gov (United States)

    Thornton, Michael A; Zhang, Chunyan; Kowalska, Maria A; Poncz, Mortimer

    2002-11-15

    The alphaIIb/beta3-integrin receptor is present at high levels only in megakaryocytes and platelets. Its presence on platelets is critical for hemostasis. The tissue-specific nature of this receptor's expression is secondary to the restricted expression of alphaIIb, and studies of the alphaIIb proximal promoter have served as a model of a megakaryocyte-specific promoter. We have examined the alphaIIb gene locus for distal regulatory elements. Sequence comparison between the human (h) and murine (m) alphaIIb loci revealed high levels of conservation at intergenic regions both 5' and 3' to the alphaIIb gene. Additionally, deoxyribonuclease (DNase) I sensitivity mapping defined tissue-specific hypersensitive (HS) sites that coincide, in part, with these conserved regions. Transgenic mice containing various lengths of the h(alpha)IIb gene locus, which included or excluded the various conserved/HS regions, demonstrated that the proximal promoter was sufficient for tissue specificity, but that a region 2.5 to 7.1 kb upstream of the h(alpha)IIb gene was necessary for consistent expression. Another region 2.2 to 7.4 kb downstream of the gene enhanced expression 1000-fold and led to levels of h(alpha)IIb mRNA that were about 30% of the native m(alpha)IIb mRNA level. These constructs also resulted in detectable h(alpha)IIb/m(beta)3 on the platelet surface. This work not only confirms the importance of the proximal promoter of the alphaIIb gene for tissue specificity, but also characterizes the distal organization of the alphaIIb gene locus and provides an initial localization of 2 important regulatory regions needed for the expression of the alphaIIb gene at high levels during megakaryopoiesis.

  8. Indications for computed tomography (CT-) diagnostics in proximal humeral fractures

    DEFF Research Database (Denmark)

    Bahrs, Christian; Rolauffs, Bernd; Südkamp, Norbert P

    2009-01-01

    diagnostics depending on the fractured parts. METHODS: In a prospective diagnostic study in two level 1 trauma centers, 44 patients with proximal humeral fractures were diagnosed with conventional X-rays (22 AP + axillary views, 22 AP + scapular Y-views) and CT (multi-planar reconstruction (MPR) and maximum...... diagnostic methods was assessed according to the number of fractured parts (Bonferroni-Holm adjustment). RESULTS: There was significantly more overlap of the fractured region on the scapular Y-views (mean 71.5%, range 45-90%) than on axillary views (mean 56.2%, range 10.5-100%). CT-diagnostics allowed...... a significantly better assessment of the relevant structures than conventional diagnostics (p diagnostics of the fracture...

  9. Proximal sensing for soil carbon accounting

    Science.gov (United States)

    England, Jacqueline R.; Viscarra Rossel, Raphael A.

    2018-05-01

    Maintaining or increasing soil organic carbon (C) is vital for securing food production and for mitigating greenhouse gas (GHG) emissions, climate change, and land degradation. Some land management practices in cropping, grazing, horticultural, and mixed farming systems can be used to increase organic C in soil, but to assess their effectiveness, we need accurate and cost-efficient methods for measuring and monitoring the change. To determine the stock of organic C in soil, one requires measurements of soil organic C concentration, bulk density, and gravel content, but using conventional laboratory-based analytical methods is expensive. Our aim here is to review the current state of proximal sensing for the development of new soil C accounting methods for emissions reporting and in emissions reduction schemes. We evaluated sensing techniques in terms of their rapidity, cost, accuracy, safety, readiness, and their state of development. The most suitable method for measuring soil organic C concentrations appears to be visible-near-infrared (vis-NIR) spectroscopy and, for bulk density, active gamma-ray attenuation. Sensors for measuring gravel have not been developed, but an interim solution with rapid wet sieving and automated measurement appears useful. Field-deployable, multi-sensor systems are needed for cost-efficient soil C accounting. Proximal sensing can be used for soil organic C accounting, but the methods need to be standardized and procedural guidelines need to be developed to ensure proficient measurement and accurate reporting and verification. These are particularly important if the schemes use financial incentives for landholders to adopt management practices to sequester soil organic C. We list and discuss requirements for developing new soil C accounting methods based on proximal sensing, including requirements for recording, verification, and auditing.

  10. Keldysh proximity action for disordered superconductors

    International Nuclear Information System (INIS)

    Feigel'man, M.V.; Larkin, A.I.; Skvortsov, M.A.

    2005-01-01

    We review a novel approach to the superconductive proximity effect in disordered normal-superconducting (N-S) structures. The method is based on the multicharge Keldysh action and is suitable for the treatment of interaction and fluctuation effects. As an application of the formalism, we study the subgap conductance and noise in two-dimensional N-S system in the presence of the electron-electron interaction in the Cooper channel. It is shown that singular nature of the interaction correction at large scales leads to a nonmonotonous temperature, voltage and magnetic field dependence of the Andreev conductance. (author)

  11. Phonon structure in proximity tunnel junctions

    International Nuclear Information System (INIS)

    Zarate, H.G.; Carbotte, J.P.

    1985-01-01

    We have iterated to convergence, for the first time, a set of four coupled real axis Eliashberg equations for the superconducting gap and renormalization functions on each side of a proximity sandwich. We find that the phenomenological procedures developed to extract the size of the normal side electron-phonon interaction from tunneling data are often reasonable but may in some cases need modifications. In all the cases considered the superconducting phonon structure reflected on the normal side, as well as other structures, shows considerable agreement with experiment as to size, shape, and variation with barrier transmission coefficient. Finally, we study the effects of depairing on these structures

  12. Effect of TNFα on activities of different promoters of human apolipoprotein A-I gene

    International Nuclear Information System (INIS)

    Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.

    2010-01-01

    Research highlights: → TNFα stimulates the distal alternative promoter of human apoA-I gene. → TNFα acts by weakening of promoter competition within apoA-I gene (promoter switching). → MEK1/2 and nuclear receptors PPARα and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1β and TNFα. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNFα-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNFα on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNFα leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNFα. The MEK1/2-ERK1/2 cascade and nuclear receptors PPARα and LXRs are important for TNFα-mediated apoA-I promoter switching.

  13. Childhood leukemia and residential proximity to industrial and urban sites

    International Nuclear Information System (INIS)

    García-Pérez, Javier; López-Abente, Gonzalo; Gómez-Barroso, Diana; Morales-Piga, Antonio; Pardo Romaguera, Elena; Tamayo, Ibon; Fernández-Navarro, Pablo

    2015-01-01

    Background: Few risk factors for the childhood leukemia are well established. While a small fraction of cases of childhood leukemia might be partially attributable to some diseases or ionizing radiation exposure, the role of industrial and urban pollution also needs to be assessed. Objectives: To ascertain the possible effect of residential proximity to both industrial and urban areas on childhood leukemia, taking into account industrial groups and toxic substances released. Methods: We conducted a population-based case–control study of childhood leukemia in Spain, covering 638 incident cases gathered from the Spanish Registry of Childhood Tumors and for those Autonomous Regions with 100% coverage (period 1990-2011), and 13,188 controls, individually matched by year of birth, sex, and autonomous region of residence. Distances were computed from the respective subject’s residences to the 1068 industries and the 157 urban areas with ≥10,000 inhabitants, located in the study area. Using logistic regression, odds ratios (ORs) and 95% confidence intervals (95%CIs) for categories of distance to industrial and urban pollution sources were calculated, with adjustment for matching variables. Results: Excess risk of childhood leukemia was observed for children living near (≤2.5 km) industries (OR=1.31; 95%CI=1.03–1.67) – particularly glass and mineral fibers (OR=2.42; 95%CI=1.49–3.92), surface treatment using organic solvents (OR=1.87; 95%CI=1.24–2.83), galvanization (OR=1.86; 95%CI=1.07–3.21), production and processing of metals (OR=1.69; 95%CI=1.22–2.34), and surface treatment of metals (OR=1.62; 95%CI=1.22–2.15) – , and urban areas (OR=1.36; 95%CI=1.02–1.80). Conclusions: Our study furnishes some evidence that living in the proximity of industrial and urban sites may be a risk factor for childhood leukemia. - Highlights: • We studied proximity to both industrial and urban sites on childhood leukemia. • We conducted a case–control study in

  14. Childhood leukemia and residential proximity to industrial and urban sites

    Energy Technology Data Exchange (ETDEWEB)

    García-Pérez, Javier, E-mail: jgarcia@isciii.es [Cancer and Environmental Epidemiology Unit, National Center for Epidemiology, Carlos III Institute of Health, Madrid (Spain); CIBER Epidemiología y Salud Pública (CIBERESP) (Spain); López-Abente, Gonzalo, E-mail: glabente@isciii.es [Cancer and Environmental Epidemiology Unit, National Center for Epidemiology, Carlos III Institute of Health, Madrid (Spain); CIBER Epidemiología y Salud Pública (CIBERESP) (Spain); Gómez-Barroso, Diana, E-mail: dgomez@externos.isciii.es [CIBER Epidemiología y Salud Pública (CIBERESP) (Spain); National Center for Epidemiology, Carlos III Institute of Health, Madrid (Spain); Morales-Piga, Antonio, E-mail: amorales@isciii.es [Rare Disease Research Institute (IIER), Carlos III Institute of Health, Madrid (Spain); Consortium for Biomedical Research in Rare Diseases (CIBERER), Madrid (Spain); Pardo Romaguera, Elena, E-mail: elena.pardo@uv.es [Spanish Registry of Childhood Tumors (RETI-SEHOP), University of Valencia, Valencia (Spain); Tamayo, Ibon, E-mail: ibontama@gmail.com [Public Health Division of Gipuzkoa, BIODonostia Research Institute, Department of Health of the Regional Government of the Basque Country, Donostia (Spain); Fernández-Navarro, Pablo, E-mail: pfernandezn@isciii.es [Cancer and Environmental Epidemiology Unit, National Center for Epidemiology, Carlos III Institute of Health, Madrid (Spain); CIBER Epidemiología y Salud Pública (CIBERESP) (Spain); and others

    2015-07-15

    Background: Few risk factors for the childhood leukemia are well established. While a small fraction of cases of childhood leukemia might be partially attributable to some diseases or ionizing radiation exposure, the role of industrial and urban pollution also needs to be assessed. Objectives: To ascertain the possible effect of residential proximity to both industrial and urban areas on childhood leukemia, taking into account industrial groups and toxic substances released. Methods: We conducted a population-based case–control study of childhood leukemia in Spain, covering 638 incident cases gathered from the Spanish Registry of Childhood Tumors and for those Autonomous Regions with 100% coverage (period 1990-2011), and 13,188 controls, individually matched by year of birth, sex, and autonomous region of residence. Distances were computed from the respective subject’s residences to the 1068 industries and the 157 urban areas with ≥10,000 inhabitants, located in the study area. Using logistic regression, odds ratios (ORs) and 95% confidence intervals (95%CIs) for categories of distance to industrial and urban pollution sources were calculated, with adjustment for matching variables. Results: Excess risk of childhood leukemia was observed for children living near (≤2.5 km) industries (OR=1.31; 95%CI=1.03–1.67) – particularly glass and mineral fibers (OR=2.42; 95%CI=1.49–3.92), surface treatment using organic solvents (OR=1.87; 95%CI=1.24–2.83), galvanization (OR=1.86; 95%CI=1.07–3.21), production and processing of metals (OR=1.69; 95%CI=1.22–2.34), and surface treatment of metals (OR=1.62; 95%CI=1.22–2.15) – , and urban areas (OR=1.36; 95%CI=1.02–1.80). Conclusions: Our study furnishes some evidence that living in the proximity of industrial and urban sites may be a risk factor for childhood leukemia. - Highlights: • We studied proximity to both industrial and urban sites on childhood leukemia. • We conducted a case–control study in

  15. A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

    Science.gov (United States)

    Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

    1997-09-05

    To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient

  16. Proximal hamstring morphology and morphometry in men: an anatomic and MRI investigation.

    Science.gov (United States)

    Storey, R N; Meikle, G R; Stringer, M D; Woodley, S J

    2016-12-01

    The proximal musculo-tendinous junction (MTJ) is a common site of hamstring strain injury but the anatomy of this region is not well defined. A morphometric analysis of the proximal MTJs of biceps femoris long head (BFlh), semitendinosus (ST), and semimembranosus (SM) was undertaken from dissection of 10 thighs from five male cadavers and magnetic resonance imaging of 20 thighs of 10 active young men. The length, volume, and cross-sectional area of the proximal tendon, MTJ and muscle belly, and muscle-tendon interface area were calculated. In both groups, MTJs were reconstructed three-dimensionally. The proximal tendons and MTJs were expansive, particularly within SM and BFlh. Morphology varied between muscles although length measurements within individual muscles were similar in cadavers and young men. Semimembranosus had the longest proximal tendon (cadavers: mean 33.6 ± 2.0 cm; young men: mean 31.7 ± 1.6 cm) and MTJ (>20 cm in both groups) and the greatest muscle-tendon interface area, followed by BFlh and ST. Mean muscle belly volumes were more than three times greater in young men than elderly male cadavers (P hamstring anatomy, an important factor in the pathogenesis of hamstring strain injury. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Obesity and supermarket access: proximity or price?

    Science.gov (United States)

    Drewnowski, Adam; Aggarwal, Anju; Hurvitz, Philip M; Monsivais, Pablo; Moudon, Anne V

    2012-08-01

    We examined whether physical proximity to supermarkets or supermarket price was more strongly associated with obesity risk. The Seattle Obesity Study (SOS) collected and geocoded data on home addresses and food shopping destinations for a representative sample of adult residents of King County, Washington. Supermarkets were stratified into 3 price levels based on average cost of the market basket. Sociodemographic and health data were obtained from a telephone survey. Modified Poisson regression was used to test the associations between obesity and supermarket variables. Only 1 in 7 respondents reported shopping at the nearest supermarket. The risk of obesity was not associated with street network distances between home and the nearest supermarket or the supermarket that SOS participants reported as their primary food source. The type of supermarket, by price, was found to be inversely and significantly associated with obesity rates, even after adjusting for individual-level sociodemographic and lifestyle variables, and proximity measures (adjusted relative risk=0.34; 95% confidence interval=0.19, 0.63) Improving physical access to supermarkets may be one strategy to deal with the obesity epidemic; improving economic access to healthy foods is another.

  18. Using the ANGELO model to develop the children's healthy living program multilevel intervention to promote obesity preventing behaviors for young children in the U.S.-affiliated Pacific Region.

    Science.gov (United States)

    Braun, Kathryn L; Nigg, Claudio R; Fialkowski, Marie K; Butel, Jean; Hollyer, James R; Barber, L Robert; Bersamin, Andrea; Coleman, Patricia; Teo-Martin, Ursula; Vargo, Agnes M; Novotny, Rachel

    2014-12-01

    Almost 40% of children are overweight or obese by age 8 years in the US-Affiliated Pacific, inclusive of the five jurisdictions of Alaska, Hawaii, American Samoa, Guam, and the Commonwealth of the Northern Mariana Islands. This article describes how the Children's Healthy Living (CHL) Program used the ANGELO (Analysis Grid for Environments/Elements Linked to Obesity) model to design a regional intervention to increase fruit and vegetable intake, water consumption, physical activity, and sleep duration and decrease recreational screen time and sugar-sweetened beverage consumption in young children ages 2-8 years. Using the ANGELO model, CHL (1) engaged community to identify preferred intervention strategies, (2) reviewed scientific literature, (3) merged findings from community and literature, and (4) formulated the regional intervention. More than 900 community members across the Pacific helped identify intervention strategies on importance and feasibility. Nine common intervention strategies emerged. Participants supported the idea of a regional intervention while noting that cultural and resource differences would require flexibility in its implementation in the five jurisdictions. Community findings were merged with the effective obesity-reducing strategies identified in the literature, resulting in a regional intervention with four cross-cutting functions: (1) initiate or strengthen school wellness policies; (2) partner and advocate for environmental change; (3) promote CHL messages; and (4) train trainers to promote CHL behavioral objectives for children ages 2-8 years. These broad functions guided intervention activities and allowed communities to tailor activities to maximize intervention fit. Using the ANGELO model assured that the regional intervention was evidence based while recognizing jurisdiction context, which should increase effectiveness and sustainability.

  19. Variation in the proximate composition and fatty acid profile recovered from Argentine hake (Merluccius hubbsi) waste from Patagonia

    Energy Technology Data Exchange (ETDEWEB)

    Cretton, M.; Rost, E.; Mazzuca-Sobczuk, T.; Mazzuca, M.

    2016-07-01

    The fish processing operations in Patagonia produce large amounts of waste. The main fishery resource in Argentina is the Argentine hake (Merluccius hubbsi). The ports of the province of Chubut (the most important of which are Puerto Madryn, Rawson and Comodoro Rivadavia), together with Caleta Paula Port (province of Santa Cruz), in the Argentine Patagonia, capture more than 82,000 tons of hake annualy, 80% of which are of M. hubbsi, which is mostly converted into fillets. From this capture, about 2,296 tons of liver would be available for the extraction of oil. To promote the recovery and industrial use of fish oil, in the present study, we determined the variation in the proximate composition and fatty acid profile of Argentine hake waste from the ports mentioned above at different catch times. Proximate composition was determined according of the Official Methods of Analysis (AOAC). Fatty acid profile was analyzed by gas chromatography of the fatty acid methyl esters (FAMEs). A standard mixture of FAMEs was run under identical conditions to identify the compounds on the basis of their retention times. Fatty acids were quantified using heptadecanoic acid (C17:0) as internal standard. The highest lipid recovery (27.0 to 41.8% of total lipids) was obtained from the liver fraction. Palmitic acid (C16:0), oleic acid (18:1 n9), docosahexaenoic acid (22:6 n3), eicosapentaenoic acid (20:5 n3) and palmitoleic acid (16:1) were the main constituents. Protein levels in viscera without livers (V-L) were higher than those in the liver. The extraction of marine fish oil and the production of fish offal meal from waste from fish factories would contribute to the sustainability of the regional industry, because it would also decrease the volume of waste, with benefits to the environment. (Author)

  20. The Role of National Human Rights Institutions (NHRIs) and Regional Networks in Promoting Human Rights and Health related to Sexual Orientation and Gender Identity (SOGI) in Southeast Asia

    NARCIS (Netherlands)

    Holzhacker, Ronald

    The UN is increasingly a place where a critical discussion about human rights and sexual orientation and gender identity is taking place. An important institutional component of the UN system of protection of human rights is the creation of National Human Rights Institutions (NHRIs). The regional

  1. Early life adversity and serotonin transporter gene variation interact to affect DNA methylation of the corticotropin-releasing factor gene promoter region in the adult rat brain

    NARCIS (Netherlands)

    Doelen, R.H.A. van der; Arnoldussen, I.A.C.; Ghareh, H.; Och, L. van; Homberg, J.R.; Kozicz, L.T.

    2015-01-01

    The interaction between childhood maltreatment and the serotonin transporter (5-HTT) gene linked polymorphic region has been associated with increased risk to develop major depression. This Gene x Environment interaction has furthermore been linked with increased levels of anxiety and glucocorticoid

  2. Health disparities among the western, central and eastern rural regions of China after a decade of health promotion and disease prevention programming.

    Science.gov (United States)

    Zhang, Xi-Fan; Tian, Xiang-Yang; Cheng, Yu-Lan; Feng, Zhan-Chun; Wang, Liang; Southerland, Jodi

    2015-08-01

    Health disparities between the western, central and eastern regions of rural China, and the impact of national health improvement policies and programming were assessed. A total of 400 counties were randomly sampled. ANOVA and Logistic regression modeling were employed to estimate differences in health outcomes and determinants. Significant differences were found between the western, central and eastern rural regions in community infrastructure and health outcomes. From 2000 to 2010, health indicators in rural China were improved significantly, and the infant mortality rate (IMR), maternal mortality rate (MMR) and under 5 mortality rate (U5MR) had fallen by 62.79%, 71.74% and 61.92%, respectively. Central rural China had the greatest decrease in IMR (65.05%); whereas, western rural China had the greatest reduction in MMR (72.99%) but smallest reduction in U5MR (57.36%). Despite these improvements, Logistic regression analysis showed regional differences in key health outcome indicators (odds ratios): IMR (central: 2.13; western: 5.31), U5MR (central: 2.25; western: 5.69), MMR (central: 1.94; western: 3.31), and prevalence of infectious diseases (central: 1.62; western: 3.58). The community infrastructure and health outcomes of the western and central rural regions of China have been improved markedly during the first decade of the 21st century. However, health disparities still exist across the three regions. National efforts to increase per capita income, community empowerment and mobilization, community infrastructure, capacity of rural health facilities, and health literacy would be effective policy options to attain health equity.

  3. [Clonage of the "malA" region of "Escherichia coli" K12: nucleotide sequence of the regulatory region and the promoters, identification and purification of the MalT-activator protein (author's transl)].

    Science.gov (United States)

    Raibaud, O; Débarbouillé, M; Cossart, P

    1982-01-01

    A 5,800-bp (base pair) HindIII-EcoRI DNA fragment containing malT, the positive regulator gene of the maltose regulon, and most of malP, the structural gene for maltodextrin phosphorylase, was cloned into pBR322. A sequence of 802 bp was established in a DNA segment containing the promotor for malPQ and the promoter for malT. A total of 611 bp separates the initiation codons for these two genes, which are transcribed in opposite directions. The malT product was identified as a 94,000 dalton polypeptide.

  4. Fluid mechanical consequences of pendular activity, segmentation and pyloric outflow in the proximal duodenum of the rat and the guinea pig.

    Science.gov (United States)

    de Loubens, Clément; Lentle, Roger G; Love, Richard J; Hulls, Corrin; Janssen, Patrick W M

    2013-06-06

    We conducted numerical experiments to study the influence of non-propagating longitudinal and circular contractions, i.e. pendular activity and segmentation, respectively, on flow and mixing in the proximal duodenum. A lattice-Boltzmann numerical method was developed to simulate the fluid mechanical consequences for each of 22 randomly selected sequences of high-definition video of real longitudinal and radial contractile activity in the isolated proximal duodenum of the rat and guinea pig. During pendular activity in the rat duodenum, the flow was characterized by regions of high shear rate. Mixing was so governed by shearing deformation of the fluid that increased the interface between adjacent domains and accelerated their inter-diffusion (for diffusion coefficients approx. less than 10(-8) m² s(-1)). When pendular activity was associated with a slow gastric outflow characteristic of post-prandial period, the dispersion was also improved, especially near the walls. Mixing was not promoted by isolated segmentative contractions in the guinea pig duodenum and not notably influenced by pylorus outflow. We concluded that pendular activity generates mixing of viscous fluids 'in situ' and accelerates the diffusive mass transfer, whereas segmentation may be more important in mixing particulate suspensions with high solid volume ratios.

  5. Fluid mechanical consequences of pendular activity, segmentation and pyloric outflow in the proximal duodenum of the rat and the guinea pig

    Science.gov (United States)

    de Loubens, Clément; Lentle, Roger G.; Love, Richard J.; Hulls, Corrin; Janssen, Patrick W. M.

    2013-01-01

    We conducted numerical experiments to study the influence of non-propagating longitudinal and circular contractions, i.e. pendular activity and segmentation, respectively, on flow and mixing in the proximal duodenum. A lattice-Boltzmann numerical method was developed to simulate the fluid mechanical consequences for each of 22 randomly selected sequences of high-definition video of real longitudinal and radial contractile activity in the isolated proximal duodenum of the rat and guinea pig. During pendular activity in the rat duodenum, the flow was characterized by regions of high shear rate. Mixing was so governed by shearing deformation of the fluid that increased the interface between adjacent domains and accelerated their inter-diffusion (for diffusion coefficients approx. less than 10−8 m² s−1). When pendular activity was associated with a slow gastric outflow characteristic of post-prandial period, the dispersion was also improved, especially near the walls. Mixing was not promoted by isolated segmentative contractions in the guinea pig duodenum and not notably influenced by pylorus outflow. We concluded that pendular activity generates mixing of viscous fluids ‘in situ’ and accelerates the diffusive mass transfer, whereas segmentation may be more important in mixing particulate suspensions with high solid volume ratios. PMID:23536539

  6. Decreased expression of 17β-hydroxysteroid dehydrogenase type 1 is associated with DNA hypermethylation in colorectal cancer located in the proximal colon

    International Nuclear Information System (INIS)

    Rawłuszko, Agnieszka Anna; Horbacka, Karolina; Krokowicz, Piotr; Jagodziński, Paweł Piotr

    2011-01-01

    The importance of 17β-estradiol (E2) in the prevention of large bowel tumorigenesis has been shown in many epidemiological studies. Extragonadal E2 may form by the aromatase pathway from androstenedione or the sulfatase pathway from estrone (E1) sulfate followed by E1 reduction to E2 by 17-β-hydroxysteroid dehydrogenase (HSD17B1), so HSD17B1 gene expression may play an important role in the production of E2 in peripheral tissue, including the colon. HSD17B1 expression was analyzed in colorectal cancer cell lines (HT29, SW707) and primary colonic adenocarcinoma tissues collected from fifty two patients who underwent radical colon surgical resection. Histopathologically unchanged colonic mucosa located at least 10-20 cm away from the cancerous lesions was obtained from the same patients. Expression level of HSD17B1 using quantitative PCR and western blot were evaluated. DNA methylation level in the 5' flanking region of HSD17B1 CpG rich region was assessed using bisulfite DNA sequencing and HRM analysis. The influence of DNA methylation on HSD17B1 expression was further evaluated by ChIP analysis in HT29 and SW707 cell lines. The conversion of estrone (E1) in to E2 was determined by electrochemiluminescence method. We found a significant decrease in HSD17B1 transcript (p = 0.0016) and protein (p = 0.0028) levels in colorectal cancer (CRC) from the proximal but not distal colon and rectum. This reduced HSD17B1 expression was associated with significantly increased DNA methylation (p = 0.003) in the CpG rich region located in the 5' flanking sequence of the HSD17B1 gene in CRC in the proximal but not distal colon and rectum. We also showed that 5-dAzaC induced demethylation of the 5' flanking region of HSD17B1, leading to increased occupation of the promoter by Polymerase II, and increased transcript and protein levels in HT29 and SW707 CRC cells, which contributed to the increase in E2 formation. Our results showed that reduced HSD17B1 expression can

  7. Geothermal development promotion survey report. No. 26. Akan region; 1988-1991 chinetsu kaihatsu sokushin chosa hokokusho. No. 26 Akan chiiki

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1992-03-01

    The results of surveys conducted in the Akan region, Hokkaido, in fiscal 1988-1990 are compiled in this report. Conducted were a geological/alteration zone survey, geochemical survey, gravity prospecting, electromagnetic surveillance (simplified magnetotelluric method), electric prospecting (Schlumberger method), electric prospecting (mise-a-la-masse method), heat flow rate survey, test boring, geothermal water survey, environmental impact survey, and so forth. The surveys resulted in conclusions mentioned below. Fractures running NE-SW are dominant, and those closely related to prominent geothermal signs are found in the Akan Seibu fault group in the western part of the Akan region. The test boring results show that there are high-temperature zones of 292.1 degrees C, 194.9 degrees C, and 245.9 degrees C. Geothermal fluids were discharged by well N2-AK-7 at a rate of 4.7-4.8 t/h in steam and 0.3-0.4 t/h in neutral SO{sub 4}-HCO{sub 3} type geothermal water. High-temperature steam-dominated geothermal resources are expected to exist deep in the ground in this region, and the area where the Akan Seibu fault group is distributed may be named as a location containing promising geothermal resources. (NEDO)

  8. Report of the researcher exchange promotion project on the environmental issues in the Asia-Pacific region; Asia/Taiheiyo chiiki kankyo mondai kenkyusha koryu sokushin jigyo hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    Proposals have been made for the establishment of a network (ETERNET-APR) linking those involved in the research and development of environmental technology in the Asia-Pacific region in order to limit the environmental impact of industrial activity. By pursuing active exchanges of information and personnel, researchers in environmental technology in the Asia-Pacific region have been making serious efforts to establish such a network. This fiscal year, the Internet Web site of the ETERNET-APR has been created using the data collected to date. This database includes information on some 350 researchers and 200 research projects from seven countries. The first international symposium was successfully held at Environmental Research Institute of Chulalongkorn University in Thailand (ERIC), hosting 200 environmental researchers from 10 countries in the Asia-Pacific region. Tripartite sister laboratories ties among the National Institute for Resources and Environment (NIRE) and three Korean laboratories were forged. The sister laboratory project between ICETT and ERIC is also proving effective. These successes prove that intraregional joint research, the objective of ETERNET-APR, has begun to take shape in this year

  9. Luminal uptake and intracellular transport of insulin in renal proximal tubules

    International Nuclear Information System (INIS)

    Hellfritzsch, M.; Christensen, E.I.; Sonne, O.

    1986-01-01

    It is generally accepted that proteins taken up from the renal tubular fluid are transported into lysosomes in proximal tubule cells. Recently, however, it has been postulated that insulin in isolated perfused rat kidneys did not accumulate in lysosomes but to a certain degree in the Golgi region. The present study was undertaken to investigate the intracellular handling of biologically unaltered insulin in rat renal proximal tubule cells. Rats were prepared for in vivo micropuncture and either a colloidal gold insulin complex or insulin monoiodinated in the A-14 position ( 125 I-insulin) was microinfused into proximal tubules. After 5, 10, 25 or 60 min the tubules were fixed by microinfusion of glutaraldehyde and processed for electron microscopy or electron microscope autoradiography. A qualitative analysis of tubules infused with colloidal gold insulin or 125 I-insulin showed that insulin was taken up by endocytosis and transported to lysosomes, and a quantitative autoradiographic analysis of the 125 I-insulin microinfused tubules showed that the grain density after five min was significantly increased for endocytic vacuoles and for lysosomes. After 60 min the grain density was still significant over lysosomes. The accumulation of grains was non-significant over all other areas analyzed at any time. This study shows that insulin is taken up from the luminal side of the proximal tubule by endocytosis and transported to the lysosomes. There was no significant transport to the Golgi region

  10. Children’s proximal societal conditions

    DEFF Research Database (Denmark)

    Stanek, Anja Hvidtfeldt

    or the children’s everyday life, but something that is represented through societal structures and actual persons participating (in political ways) within the institutional settings, in ways that has meaning to children’s possibilities to participate, learn and develop. Understanding school or daycare as (part of......) the children’s proximal societal conditions for development and learning, means for instance that considerations about an inclusive agenda in a (Danish) welfare state with well-developed school- and daycare system, are no longer simply thoughts about the school having space for as many pupils as possible...... (schools for all). Such thoughts can or should be supplemented by reflections about which version of ‘the societal’ we wish to present our children with, and which version of ‘the societal’ we wish to set up as the condition for children’s participation and development. These questions require an ethical...

  11. Single nucleotide polymorphisms in the promoter region of the IL1B gene influence outcome in multiple myeloma patients treated with high-dose chemotherapy independently of relapse treatment with thalidomide and bortezomib

    DEFF Research Database (Denmark)

    Vangsted, Annette J.; Klausen, Tobias W.; Abildgaard, Niels

    2011-01-01

    the impact on outcome of HDT, INF-α maintenance treatment, and treatment with thalidomide and bortezomib at relapse, in relation to the major identified functional polymorphisms in the promoter region of IL1B. The wild-type C-allele of IL1B C-3737T and non-carriage of the IL1B promoter haplotype TGT (−3737T...... carrying the wild-type C-allele of IL1B C-3737T (HR, 1.6 (1.1–2.4)). Furthermore, among INF-α treated patients, gene–gene interaction studies on IL1B C-3737T and NFКB1-94ins/del ATTG revealed a fourfold increase in TTF for homozygous carriers of wild-type alleles at both loci as compared to variant allele...... carriers at both loci. No relation to genotype and outcome was found for relapse patients treated with thalidomide or bortezomib. Our results indicate that a subpopulation of myeloma patients carrying the wild-type C-allele of IL1B C-3737T and non-carriers of the promoter haplotype TGT (−3737T, −1464G...

  12. Effects of SGLT2 inhibition in human kidney proximal tubular cells--renoprotection in diabetic nephropathy?

    Directory of Open Access Journals (Sweden)

    Usha Panchapakesan

    Full Text Available Sodium/glucose cotransporter 2 (SGLT2 inhibitors are oral hypoglycemic agents used to treat patients with diabetes mellitus. SGLT2 inhibitors block reabsorption of filtered glucose by inhibiting SGLT2, the primary glucose transporter in the proximal tubular cell (PTC, leading to glycosuria and lowering of serum glucose. We examined the renoprotective effects of the SGLT2 inhibitor empagliflozin to determine whether blocking glucose entry into the kidney PTCs reduced the inflammatory and fibrotic responses of the cell to high glucose. We used an in vitro model of human PTCs. HK2 cells (human kidney PTC line were exposed to control 5 mM, high glucose (HG 30 mM or the profibrotic cytokine transforming growth factor beta (TGFβ1; 0.5 ng/ml in the presence and absence of empagliflozin for up to 72 h. SGLT1 and 2 expression and various inflammatory/fibrotic markers were assessed. A chromatin immunoprecipitation assay was used to determine the binding of phosphorylated smad3 to the promoter region of the SGLT2 gene. Our data showed that TGFβ1 but not HG increased SGLT2 expression and this occurred via phosphorylated smad3. HG induced expression of Toll-like receptor-4, increased nuclear deoxyribonucleic acid binding for nuclear factor kappa B (NF-κB and activator protein 1, induced collagen IV expression as well as interleukin-6 secretion all of which were attenuated with empagliflozin. Empagliflozin did not reduce high mobility group box protein 1 induced NF-κB suggesting that its effect is specifically related to a reduction in glycotoxicity. SGLT1 and GLUT2 expression was not significantly altered with HG or empagliflozin. In conclusion, empagliflozin reduces HG induced inflammatory and fibrotic markers by blocking glucose transport and did not induce a compensatory increase in SGLT1/GLUT2 expression. Although HG itself does not regulate SGLT2 expression in our model, TGFβ increases SGLT2 expression through phosphorylated smad3.

  13. Proximal tubular dysfunction as an indicator of chronic graft dysfunction

    Directory of Open Access Journals (Sweden)

    N.O.S. Câmara

    2009-03-01

    Full Text Available New strategies are being devised to limit the impact of renal sclerosis on graft function. Individualization of immunosuppression, specifically the interruption of calcineurin-inhibitors has been tried in order to promote better graft survival once chronic graft dysfunction has been established. However, the long-term impact of these approaches is still not totally clear. Nevertheless, patients at higher risk for tubular atrophy and interstitial fibrosis (TA/IF development should be carefully monitored for tubular function as well as glomerular performance. Since tubular-interstitial impairment is an early event in TA/IF pathogenesis and associated with graft function, it seems reasonable that strategies directed at assessing tubular structural integrity and function would yield important functional and prognostic data. The measurement of small proteins in urine such as α-1-microglobulin, N-acetyl-beta-D-glucosaminidase, alpha/pi S-glutathione transferases, β-2 microglobulin, and retinol binding protein is associated with proximal tubular cell dysfunction. Therefore, its straightforward assessment could provide a powerful tool in patient monitoring and ongoing clinical assessment of graft function, ultimately helping to facilitate longer patient and graft survival associated with good graft function.

  14. An ethnographic action research study to investigate the experiences of Bindjareb women participating in the cooking and nutrition component of an Aboriginal health promotion programme in regional Western Australia.

    Science.gov (United States)

    Nilson, Caroline; Kearing-Salmon, Karrie-Anne; Morrison, Paul; Fetherston, Catherine

    2015-12-01

    To investigate the experiences of women participating in a cooking and nutrition component of a health promotion research initiative in an Australian Aboriginal regional community. Weekly facilitated cooking and nutrition classes were conducted during school terms over 12 months. An ethnographic action research study was conducted for the programme duration with data gathered by participant and direct observation, four yarning groups and six individual yarning sessions. The aim was to determine the ways the cooking and nutrition component facilitated lifestyle change, enabled engagement, encouraged community ownership and influenced community action. Regional Bindjareb community in the Nyungar nation of Western Australia. A sample of seventeen Aboriginal women aged between 18 and 60 years from the two kinships in two towns in one shire took part in the study. The recruitment and consent process was managed by community Elders and leaders. Major themes emerged highlighting the development of participants and their recognition of the need for change: the impact of history on current nutritional health of Indigenous Australians; acknowledging shame; challenges of change around nutrition and healthy eating; the undermining effect of mistrust and limited resources; the importance of community control when developing health promotion programmes; finding life purpose through learning; and the need for planning and partnerships to achieve community determination. Suggested principles for developing cooking and nutrition interventions are: consideration of community needs; understanding the impact of historical factors on health; understanding family and community tensions; and the engagement of long-term partnerships to develop community determination.

  15. SRSF1-3 contributes to diversification of the immunoglobulin variable region gene by promoting accumulation of AID in the nucleus

    OpenAIRE

    Kawaguchi, Yuka; Nariki, Hiroaki; Kawamoto, Naoko; Kanehiro, Yuichi; Miyazaki, Satoshi; Suzuki, Mari; Magari, Masaki; Tokumitsu, Hiroshi; Kanayama, Naoki

    2017-01-01

     Activation-induced cytidine deaminase (AID) is essential for diversification of the Ig variable region (IgV). AID is excluded from the nucleus, where it normally functions. However, the molecular mechanisms responsible for regulating AID localization remain to be elucidated. The SR-protein splicing factor SRSF1 is a nucleocytoplasmic shuttling protein, a splicing isoform of which called SRSF1-3, has previously been shown to contribute to IgV diversification in chicken DT40 cells. In this stu...

  16. Investigation of -308G>A and -1031T>C polymorphisms in the TNFA promoter region in Polish peptic ulcer patients.

    Science.gov (United States)

    Sałagacka, Aleksandra; Żebrowska, Marta; Jeleń, Agnieszka; Mirowski, Marek; Balcerczak, Ewa

    2014-11-01

    Tumor necrosis factor α (TNF-α) encoded by TNFA is a key mediator in inflammation, a precursor condition for peptic ulceration. Promoter polymorphisms of TNFA that influence its transcriptional activity and TNF-α production are known. TNFA-308G>A (rs1800629) and TNFA-1031T>C (rs1799964), which are responsible for increased TNFA transcription, could influence the risk of peptic ulceration. This study aimed to investigate these polymorphisms and to evaluate their association with peptic ulcer disease and Helicobacter pylori infection in the Polish population. Gastric mucosa specimens obtained from 177 Polish peptic ulcer patients were used to conduct rapid urease tests and to assess the investigated polymorphisms by polymerase chain reaction-restriction fragment length polymorphism. Genotyping data were compared with the results obtained from healthy individuals of Polish origin. There were no significant differences in genotype and allele frequency of the investigated polymorphisms between peptic ulcer patients and healthy individuals. No associations between the frequencies of particular genotypes and alleles for both single-nucleotide polymorphisms (SNPs) and the presence of H. pylori infection in peptic ulcer patients and in subgroups of men and women with peptic ulcer disease were found. The investigated SNPs are not risk factors for either peptic ulcer or H. pylori infection development in the Polish population. The results require verification in a larger cohort.

  17. Effect of a feed/fast protocol on pH in the proximal equine stomach.

    Science.gov (United States)

    Husted, L; Sanchez, L C; Baptiste, K E; Olsen, S N

    2009-09-01

    Risk factors for the development of gastric squamous ulcers include various management procedures, such as intermittent feed deprivation that can occur during weight management regimens or stall and dry lot confinement. To investigate the effect of intermittent feed deprivation relative to continuous feed intake on proximal intragastric pH, specifically in the region of the squamous mucosa of the lesser curvature. In 6 horses, pH electrodes were placed just inside of the oesophageal sphincter in the stomach for each of two 72 h protocols (A and B) in a randomised, cross-over design. Protocol A consisted of 12 h fed, 12 h fasted, 24 h fed and 24 h fasted, in sequence. Protocol B consisted of 72 h fed. During the fed periods of each protocol, horses had ad libitum access to coastal Bermuda hay and were fed sweet feed (1 kg, b.i.d.). Horses had ad libitum access to water at all times. Proximal intragastric pH was significantly lower during protocol A, than during protocol B. However, hourly mean pH was significantly different only during the day and evening hours between protocols. During protocol B, mean proximal pH decreased significantly from 03.00 to 09.00 compared to 19.00 to 23.00 h. A moderate positive correlation of hay intake vs. proximal gastric pH could be established. Intermittent feed deprivation decreased proximal gastric pH in horses relative to those horses for which feed was not restricted. However, the effect was only significant when fasting occurred during the day and evening hours, as a nocturnal decrease in pH occurred simultaneously in the fed horses. Episodes of daytime feed deprivation should be avoided if possible, as proximal gastric acid exposure rapidly increases during such events.

  18. Maternal residential proximity to nuclear facilities and low birth weight in offspring in Texas

    International Nuclear Information System (INIS)

    Gong, Xi; Lin, Yan; Benjamin Zhan, F.

    2017-01-01

    Health effects of close residential proximity to nuclear facilities have been a concern for both the general public and health professionals. Here, a study is reported examining the association between maternal residential proximity to nuclear facilities and low birth weight (LBW) in offspring using data from 1996 through 2008 in Texas, USA. A case-control study design was used together with a proximity-based model for exposure assessment. First, the LBW case/control births were categorized into multiple proximity groups based on distances between their maternal residences and nuclear facilities. Then, a binary logistic regression model was used to examine the association between maternal residential proximity to nuclear facilities and low birth weight in offspring. The odds ratios were adjusted for birth year, public health region of maternal residence, child's sex, gestational weeks, maternal age, education, and race/ethnicity. In addition, sensitivity analyses were conducted for the model. Compared with the reference group (more than 50 km from a nuclear facility), the exposed groups did not show a statistically significant increase in LBW risk [adjusted odds ratio (aOR) 0.91 (95% confidence interval (CI): 0.81, 1.03) for group 40-50 km; aOR 0.98 (CI 0.84, 1.13) for group 30-40 km; aOR 0.95 (CI 0.79, 1.15) for group 20-30 km; aOR 0.86 (CI 0.70, 1.04) for group 10-20 km; and aOR 0.98 (CI 0.59, 1.61) for group 0-10 km]. These results were also confirmed by results of the sensitivity analyses. The results suggest that maternal residential proximity to nuclear facilities is not a significant factor for LBW in offspring. (orig.)

  19. Maternal residential proximity to nuclear facilities and low birth weight in offspring in Texas

    Energy Technology Data Exchange (ETDEWEB)

    Gong, Xi; Lin, Yan [University of New Mexico, Department of Geography and Environmental Studies, Albuquerque, NM (United States); Benjamin Zhan, F. [Texas State University, Department of Geography, Texas Center for Geographic Information Science, San Marcos, TX (United States)

    2017-03-15

    Health effects of close residential proximity to nuclear facilities have been a concern for both the general public and health professionals. Here, a study is reported examining the association between maternal residential proximity to nuclear facilities and low birth weight (LBW) in offspring using data from 1996 through 2008 in Texas, USA. A case-control study design was used together with a proximity-based model for exposure assessment. First, the LBW case/control births were categorized into multiple proximity groups based on distances between their maternal residences and nuclear facilities. Then, a binary logistic regression model was used to examine the association between maternal residential proximity to nuclear facilities and low birth weight in offspring. The odds ratios were adjusted for birth year, public health region of maternal residence, child's sex, gestational weeks, maternal age, education, and race/ethnicity. In addition, sensitivity analyses were conducted for the model. Compared with the reference group (more than 50 km from a nuclear facility), the exposed groups did not show a statistically significant increase in LBW risk [adjusted odds ratio (aOR) 0.91 (95% confidence interval (CI): 0.81, 1.03) for group 40-50 km; aOR 0.98 (CI 0.84, 1.13) for group 30-40 km; aOR 0.95 (CI 0.79, 1.15) for group 20-30 km; aOR 0.86 (CI 0.70, 1.04) for group 10-20 km; and aOR 0.98 (CI 0.59, 1.61) for group 0-10 km]. These results were also confirmed by results of the sensitivity analyses. The results suggest that maternal residential proximity to nuclear facilities is not a significant factor for LBW in offspring. (orig.)

  20. Geothermal development promotion survey report. No. 25. Hishikari region; 1987-1989 chinetsu kaihatsu sokushin chosa hokokusho. No. 22 Hishikari chiiki

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1990-03-01

    The results of surveys conducted in the Hishikari region, Kagoshima Prefecture, in fiscal 1987-1989 are compiled in this report. Conducted were a geological/alteration zone survey, geochemical survey, electric prospecting, electromagnetic surveillance, gravity prospecting, heat flow rate survey, test boring, environmental impact survey, and so forth. The surveys resulted in conclusions mentioned below. According to the underground temperature distribution based on the results of the heat flow rate survey, test boring, and so forth, temperature is low at the western part of the Hishikari region where there is a low gravity anomaly and high in the zone in the ENE-WSW direction where there is a high gravity anomaly. The present ground temperature is lower than the fluid inclusion homogenization temperature by approximately 120-140 degrees C. It is deduced that the geothermal water reservoir lies in the Quatenary volcanic rocks or in a fracture zone that develops in the Shimanto supergroup. It is inferred that the geothermal water producing the hot spring water all originates in meteoric water staying long in the ground. It is also inferred that volcanic gas or the like contributes but a little to the formation of the geothermal system but that the contribution is great of the heat supplied from the magma pool. (NEDO)

  1. Geothermal development promotion survey report. No. 28. Eastern part of Obanazawa region; 1988-1990 chinetsu kaihatsu sokushin chosa hokokusho. No. 28 Obanazawa tobu chiiki

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    The results of surveys conducted in the eastern part of Obanazawa region, Yamagata Prefecture, in fiscal 1988-1989 are compiled in this report. Conducted were a geological/alteration zone survey, geochemical survey, electromagnetic surveillance (TDEM - time domain electromagnetic method), gravity prospecting (review of gravity data), electric prospecting (Schlumberger method), heat flow rate survey, test boring, environmental impact survey, and so forth. Conclusions are mentioned below. It is inferred that the water of the Ginzan hot spring of the neutral Cl-SO{sub 4} type originates in meteoric water in mountains high above the mean sea level in the western side and that the hot spring water is produced when water heated to approximately 170 degrees C at a depth (1,500-2,000 meters below mean sea level) in the Ginzan hot spring district, where the ground temperature is the highest in this region, is diluted by groundwater near the surface at its ultimate stage of ascent. The survey results disclose that possibilities are quite low that a high-temperature sector of 200 degrees C or higher is found at a level not deeper than 2,000 meters from the ground surface. Accordingly, no geothermal development by flash steam power generation is feasible at the present stage at any economically acceptable depth. (NEDO)

  2. Geothermal development promotion survey report. No. 29. Upper reach region of Oita river; 1988-1990 chinetsu kaihatsu sokushin chosa hokokusho. No. 29 Oitagawa joryu chiiki

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    The results of surveys conducted in the Oita river region, Oita Prefecture, in fiscal 1988-1989 are compiled in this report. Conducted were a geological/alteration zone survey, geochemical survey, electric prospecting (Schlumberger method), electromagnetic surveillance (simplified magnetotelluric method), electromagnetic surveillance (EMAP - Environmental Monitoring and Assessment Program method), heat flow rate survey, test boring, environmental impact survey, and so forth. Conclusions are mentioned below. It is inferred that the geothermal fluid results from groundwater originating in meteoric water, that the meteoric water takes many years to flow from the mountainous region into the ground where it is stored mainly in the Shonai stratum, that the stored water is warmed by heat from rocks in the neighborhood for development into a geothermal fluid, and that the geothermal fluid finally forms a hot spring water reservoir. Hot spring water reservoirs are found widely distributed in the basin of the Oita river. In view of the ground temperature distribution and the hot spring water geochemical temperature determined by structure boring, it is concluded that possibilities are quite low that there exists a high-temperature geothermal fluid usable for power generation. (NEDO)

  3. Anatomical study of the proximal origin of hamstring muscles.

    Science.gov (United States)

    Sato, Kengo; Nimura, Akimoto; Yamaguchi, Kumiko; Akita, Keiichi

    2012-09-01

    It is relatively well accepted that the long head of the biceps femoris and the semitendinosus both originate from the ischial tuberosity as a common tendon. However, it is also widely known that the biceps femoris is consistently injured more than the semitendinosus. The purpose of this study was to examine the origins of the hamstring muscles, to find an anatomic basis for diagnosis and treatment of injuries of the posterior thigh regions. Twenty-eight hips of fourteen adult Japanese cadavers were used in this study. In twenty hips of ten cadavers, the positional relationships among the origins on the ischial tuberosity were examined. In eight hips of four cadavers, histological examination of the origins of the hamstrings was also performed. The origin of the long head of the biceps femoris adjoined that of the semitendinosus. In the proximal regions of these muscles, the long head consisted of the tendinous part; however, the semitendinosus mainly consisted of the muscular part. Some of the fibers of the biceps tendon extended to fuse with the sacrotuberous ligament. The semimembranosus muscle broadly originated from the lateral surface of the ischial tuberosity. The origins of the long head of the biceps femoris and the semitendinosus are found to be almost independent, and the tendon of the long head is partly fused with the sacrotuberous ligament. The high incidence of injuries to the long head of the biceps femoris could be explained by these anatomical configurations.

  4. Proximity Effect Induced Spin Injection in Phosphorene on Magnetic Insulator.

    Science.gov (United States)

    Chen, Haoqi; Li, Bin; Yang, Jinlong

    2017-11-08

    Black phosphorus is a promising candidate for future nanoelectronics with a moderate electronic band gap and a high carrier mobility. Introducing the magnetism into black phosphorus will widely expand its application scope and may present a bright prospect in spintronic nanodevices. Here, we report our first-principles calculations of spin-polarized electronic structure of monolayer black phosphorus (phosphorene) adsorbed on a magnetic europium oxide (EuO) substrate. Effective spin injection into the phosphorene is realized by means of interaction with the nearby EuO(111) surface, i.e., proximity effect, which results in spin-polarized electrons in the 3p orbitals of phosphorene, with the spin polarization at Fermi level beyond 30%, together with an exchange-splitting energy of ∼0.184 eV for conduction-band minimum of the adsorbed phosphorene corresponding to an energy region where only one spin channel is conductive. The energy region of these exchange-splitting and spin-polarized band gaps of the adsorbed phosphorene can be effectively modulated by in-plane strain. Intrinsically high and anisotropic carrier mobilities at the conduction-band minimum of the phosphorene also become spin-polarized mainly due to spin polarization of deformation potentials and are not depressed significantly after the adsorption. These extraordinary properties would endow black phosphorus with great potentials in the future spintronic nanodevices.

  5. Distributed Autonomous Control of Multiple Spacecraft During Close Proximity Operations

    National Research Council Canada - National Science Library

    McCamish, Shawn B

    2007-01-01

    This research contributes to multiple spacecraft control by developing an autonomous distributed control algorithm for close proximity operations of multiple spacecraft systems, including rendezvous...

  6. Serotonin transporter promoter region (5-HTTLPR) polymorphism is associated with the intravaginal ejaculation latency time in Dutch men with lifelong premature ejaculation.

    Science.gov (United States)

    Janssen, Paddy K C; Bakker, Steven C; Réthelyi, Janos; Zwinderman, Aeilko H; Touw, Daan J; Olivier, Berend; Waldinger, Marcel D

    2009-01-01

    Lifelong premature ejaculation (LPE) is characterized by persistent intravaginal ejaculation latency times (IELTs) of less than 1 minute, and has been postulated as a neurobiological dysfunction with genetic vulnerability for the short IELTs, related to disturbances of central serotonin (5-hydroxytryptamine [5-HT]) neurotransmission and 5-HT receptor functioning. To investigate the relationship between 5-HT transporter gene-linked polymorphism (5-HTTLPR) and short IELTs in men with lifelong PE. A prospective study was conducted in 89 Dutch Caucasian men with lifelong PE. IELT during coitus was assessed by stopwatch over a 1-month period. Controls consisted of 92 Dutch Caucasian men. All men with LPE were genotyped for a 5-HTT-promoter polymorphism. Allele frequencies and genotypes of short (S) and long (L) variants of 5-HTTLPR polymorphism were compared between patients and controls. Association between LL, SL, and SS genotypes, and the natural logarithm of the IELT in men with LPE was investigated. IELT measured by stopwatch, 5-HTTLPR polymorphism. In men with lifelong PE, the geometric mean, median, and natural mean IELTs were 21, 26, and 32 seconds, respectively. There were no significant differences in the 5-HTT polymorphism alleles and genotypes between 89 Dutch Caucasian men with LPE (S 47%, L 53%/LL 29%, SL 48%, SS 22%) and 92 Dutch Caucasian controls (S 48%, L 52%/LL 29%, SL 45%, SS 26%). In men with lifelong PE there was a statistically significant difference between LL, SL, and SS genotypes in their geometric mean IELT (P IELTs than the SS and SL genotypes. The 5-HTTLPR polymorphism is associated with significant effects on the latency to ejaculate in men with lifelong PE. Men with SS and SL genotypes have 100% and 90% longer ejaculation time, respectively than men with LL genotypes.

  7. PROXIMAL DISABILITY AND SPINAL DEFORMITY INDEX IN PATIENTS WITH PROXIMAL FEMUR FRACTURES

    Directory of Open Access Journals (Sweden)

    Sylvio Mistro Neto

    2015-12-01

    Full Text Available Objective : To evaluate the quality of life related to the spine in patients with proximal femoral fractures. Methods : Study conducted in a tertiary public hospital in patients with proximal femoral fractures caused by low-energy trauma, through the Oswestry Disability Index questionnaire to asses complaints related to the spine at the time of life prior to the femoral fracture. The thoracic and lumbar spine of patients were also evaluated applying the radiographic index described by Gennant (Spinal Deformity Index, which assesses the number and severity of fractures. Results : Seventeen subjects completed the study. All had some degree of vertebral fracture. Patients were classified in the categories of severe and very severe disability in the questionnaire about quality of life. It was found that the higher SDI, the better the quality of life. Conclusion : There is a strong association of disability related to the spine in patients with proximal femoral fracture, and this complaint must be systematically evaluated in patients with appendicular fracture.

  8. Initial outcome and efficacy of S3 proximal humerus locking plate in the treatment of proximal humerus fractures

    International Nuclear Information System (INIS)

    Zhang Zhiming; Zhu Xuesong; Bao Zhaohua; Yang Huilin

    2012-01-01

    Objective: to explore the initial outcome and efficacy of S 3 proximal humerus locking plate in the treatment of proximal humerus fractures. Methods: Twenty-two patients with proximal humerus fracture were treated with the S 3 proximal humerus locking plate. Most of the fractures were complex, two-part (n=4), three-part (n=11) and four-part (n=7) fractures according to the Neer classification of the proximal humerus fractures. Results: All patients were followed up for 3∼15 months. There were no complications related to the implant including loosening or breakage of the plate. Good and excellent results were documented in 17 patients fair results in 4 patients according the Neer scores of shoulder. Conclusion: New design concepts of S 3 proximal humerus plate provide the subchondral support and the internal fixation support. With the addition of the proper exercise of the shoulder joint, the outcomes would be satisfied. (authors)

  9. Additional protocols and regional cooperation on peaceful uses of nuclear energy in northeast Asia

    Energy Technology Data Exchange (ETDEWEB)

    Choe, Kwan Kyoo [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    2004-07-01

    The main object of this article is to clarify the relations between the implementation of the Protocols Additional to Safeguards Agreement (hereinafter referred to as the Additional Protocols) and the feasibility of the regional cooperation on peaceful uses of nuclear energy in Northeast Asia (NEA). The regionalism has a strong tendency to be based in advance on regional cooperation. The regionalism has three main structural elements in its definition: geographical proximity, cultural resemblance, and cooperative attitudes among all the countries concerned. The Additional Protocols allow the IAEA to access to more detailed information and nuclear activities of a State party. The aspect that the Additional Protocols could increase the nuclear transparency will result in ultimately promoting the confidence among the regional nations concerned.

  10. A Salmonella typhimurium-translocated Glycerophospholipid:Cholesterol Acyltransferase Promotes Virulence by Binding to the RhoA Protein Switch Regions

    Energy Technology Data Exchange (ETDEWEB)

    LaRock, Doris L.; Brzovic, Peter S.; Levin, Itay; Blanc, Marie-Pierre; Miller, Samuel I.

    2012-08-24

    Salmonella enterica serovar typhimurium translocates a glycerophospholipid: cholesterol acyltransferase (SseJ) into the host cytosol after its entry into mammalian cells. SseJ is recruited to the cytoplasmic face of the host cell phagosome membrane where it is activated upon binding the small GTPase, RhoA. SseJ is regulated similarly to cognate eukaryotic effectors, as only the GTP-bound form of RhoA family members stimulates enzymatic activity. Using NMR and biochemistry, this work demonstrates that SseJ competes effectively with Rhotekin, ROCK, and PKN1 in binding to a similar RhoA surface. The RhoA surface that binds SseJ includes the regulatory switch regions that control activation of mammalian effectors. These data were used to create RhoA mutants with altered SseJ binding and activation. This structure-function analysis supports a model in which SseJ activation occurs predominantly through binding to residues within switch region II. We further defined the nature of the interaction between SseJ and RhoA by constructing SseJ mutants in the RhoA binding surface. These data indicate that SseJ binding to RhoA is required for recruitment of SseJ to the endosomal network and for full Salmonella virulence for inbred susceptible mice, indicating that regulation of SseJ by small GTPases is an important virulence strategy of this bacterial pathogen. The dependence of a bacterial effector on regulation by a mammalian GTPase defines further how intimately host pathogen interactions have coevolved through similar and divergent evolutionary strategies.

  11. Health Promotion

    DEFF Research Database (Denmark)

    Povlsen, Lene; Borup, I.

    2015-01-01

    and Adolescent Health Promotion', Salutogenesis - from theory to practice' and Health, Stress and Coping'. More than half of all doctoral theses undertaken at NHV during these years had health promotion as their theme. As a derivative, the Nordic Health Promotion Research Network (NHPRN) was established in 2007......In 1953 when the Nordic School of Public Health was founded, the aim of public health programmes was disease prevention more than health promotion. This was not unusual, since at this time health usually was seen as the opposite of disease and illness. However, with the Ottawa Charter of 1986......, the World Health Organization made a crucial change to view health not as a goal in itself but as the means to a full life. In this way, health promotion became a first priority and fundamental action for the modern society. This insight eventually reached NHV and in 2002 - 50 years after the foundation...

  12. Small supernumerary marker chromosome derived from proximal p-arm of chromosome 2: identification by fluorescent in situ hybridization.

    Science.gov (United States)

    Lasan Trcić, Ruzica; Hitrec, Vlasta; Letica, Ljiljana; Cuk, Mario; Begović, Davor

    2003-08-01

    Conventional cytogenetics detected an interstitial deletion of proximal region of p-arm of chromosome 2 in a 6-month-old boy with a phenotype slightly resembling Down's syndrome. The deletion was inherited from the father, whose karyotype revealed a small ring-shaped marker chromosome, in addition to interstitial deletion. Fluorescence in situ hybridization identified the marker, which consisted of the proximal region of the p-arm of chromosome 2, including a part of its centromere. This case shows that molecular cytogenetic analysis can reveal the mechanism of the formation of the marker chromosome.

  13. Activation of the skeletal alpha-actin promoter during muscle regeneration.

    Science.gov (United States)

    Marsh, D R; Carson, J A; Stewart, L N; Booth, F W

    1998-11-01

    Little is known concerning promoter regulation of genes in regenerating skeletal muscles. In young rats, recovery of muscle mass and protein content is complete within 21 days. During the initial 5-10 days of regeneration, mRNA abundance for IGF-I, myogenin and MyoD have been shown to be dramatically increased. The skeletal alpha-actin promoter contains E box and serum response element (SRE) regulatory regions which are directly or indirectly activated by myogenin (or MyoD) and IGF-I proteins, respectively. We hypothesized that the skeletal alpha-actin promoter activity would increase during muscle regeneration, and that this induction would occur before muscle protein content returned to normal. Total protein content and the percentage content of skeletal alpha-actin protein was diminished at 4 and 8 days and re-accumulation had largely occurred by 16 days post-bupivacaine injection. Skeletal alpha-actin mRNA per whole muscle was decreased at day 8, and thereafter returned to control values. During regeneration at day 8, luciferase activity (a reporter of promoter activity) directed by -424 skeletal alpha-actin and -99 skeletal alpha-actin promoter constructs was increased by 700% and 250% respectively; however, at day 16, skeletal alpha-actin promoter activities were similar to control values. Thus, initial activation of the skeletal alpha-actin promoter is associated with regeneration of skeletal muscle, despite not being sustained during the later stages of regrowth. The proximal SRE of the skeletal alpha-actin promoter was not sufficient to confer a regeneration-induced promoter activation, despite increased serum response factor protein binding to this regulatory element in electrophoretic mobility shift assays. Skeletal alpha-actin promoter induction during regeneration is due to a combination of regulatory elements, at least including the SRE and E box.

  14. Proximity Operations and Docking Sensor Development

    Science.gov (United States)

    Howard, Richard T.; Bryan, Thomas C.; Brewster, Linda L.; Lee, James E.

    2009-01-01

    The Next Generation Advanced Video Guidance Sensor (NGAVGS) has been under development for the last three years as a long-range proximity operations and docking sensor for use in an Automated Rendezvous and Docking (AR&D) system. The first autonomous rendezvous and docking in the history of the U.S. Space Program was successfully accomplished by Orbital Express, using the Advanced Video Guidance Sensor (AVGS) as the primary docking sensor. That flight proved that the United States now has a mature and flight proven sensor technology for supporting Crew Exploration Vehicles (CEV) and Commercial Orbital Transport Systems (COTS) Automated Rendezvous and Docking (AR&D). NASA video sensors have worked well in the past: the AVGS used on the Demonstration of Autonomous Rendezvous Technology (DART) mission operated successfully in spot mode out to 2 km, and the first generation rendezvous and docking sensor, the Video Guidance Sensor (VGS), was developed and successfully flown on Space Shuttle flights in 1997 and 1998. 12 Parts obsolescence issues prevent the construction of more AVGS units, and the next generation sensor was updated to allow it to support the CEV and COTS programs. The flight proven AR&D sensor has been redesigned to update parts and add additional capabilities for CEV and COTS with the development of the Next Generation AVGS at the Marshall Space Flight Center. The obsolete imager and processor are being replaced with new radiation tolerant parts. In addition, new capabilities include greater sensor range, auto ranging capability, and real-time video output. This paper presents some sensor hardware trades, use of highly integrated laser components, and addresses the needs of future vehicles that may rendezvous and dock with the International Space Station (ISS) and other Constellation vehicles. It also discusses approaches for upgrading AVGS to address parts obsolescence, and concepts for minimizing the sensor footprint, weight, and power requirements

  15. Sensitivity of MLL-rearranged AML cells to all-trans retinoic acid is associated with the level of H3K4me2 in the RARα promoter region

    International Nuclear Information System (INIS)

    Sakamoto, K; Imamura, T; Yano, M; Yoshida, H; Fujiki, A; Hirashima, Y; Hosoi, H

    2014-01-01

    All-trans retinoic acid (ATRA) is well established as differentiation therapy for acute promyelocytic leukemia (APL) in which the PML–RARα (promyelocytic leukemia-retinoic acid receptor α) fusion protein causes blockade of the retinoic acid (RA) pathway; however, in types of acute myeloid leukemia (AML) other than APL, the mechanism of RA pathway inactivation is not fully understood. This study revealed the potential mechanism of high ATRA sensitivity of mixed-lineage leukemia (MLL)-AF9-positive AML compared with MLL-AF4/5q31-positive AML. Treatment with ATRA induced significant myeloid differentiation accompanied by upregulation of RARα, C/EBPα, C/EBPε and PU.1 in MLL-AF9-positive but not in MLL-AF4/5q31-positive cells. Combining ATRA with cytarabine had a synergistic antileukemic effect in MLL-AF9-positive cells in vitro. The level of dimethyl histone H3 lysine 4 (H3K4me2) in the RARα gene-promoter region, PU.1 upstream regulatory region (URE) and RUNX1+24/+25 intronic enhancer was higher in MLL-AF9-positive cells than in MLL-AF4-positive cells, and inhibiting lysine-specific demethylase 1, which acts as a histone demethylase inhibitor, reactivated ATRA sensitivity in MLL-AF4-positive cells. These findings suggest that the level of H3K4me2 in the RARα gene-promoter region, PU.1 URE and RUNX1 intronic enhancer is determined by the MLL-fusion partner. Our findings provide insight into the mechanisms of ATRA sensitivity in AML and novel treatment strategies for ATRA-resistant AML

  16. Proximity coupling in superconductor-graphene heterostructures

    Science.gov (United States)

    Lee, Gil-Ho; Lee, Hu-Jong

    2018-05-01

    This review discusses the electronic properties and the prospective research directions of superconductor-graphene heterostructures. The basic electronic properties of graphene are introduced to highlight the unique possibility of combining two seemingly unrelated physics, superconductivity and relativity. We then focus on graphene-based Josephson junctions, one of the most versatile superconducting quantum devices. The various theoretical methods that have been developed to describe graphene Josephson junctions are examined, together with their advantages and limitations, followed by a discussion on the advances in device fabrication and the relevant length scales. The phase-sensitive properties and phase-particle dynamics of graphene Josephson junctions are examined to provide an understanding of the underlying mechanisms of Josephson coupling via graphene. Thereafter, microscopic transport of correlated quasiparticles produced by Andreev reflections at superconducting interfaces and their phase-coherent behaviors are discussed. Quantum phase transitions studied with graphene as an electrostatically tunable 2D platform are reviewed. The interplay between proximity-induced superconductivity and the quantum-Hall phase is discussed as a possible route to study topological superconductivity and non-Abelian physics. Finally, a brief summary on the prospective future research directions is given.

  17. [Ophthalmologists in the proximity of Adolf Hitler].

    Science.gov (United States)

    Rohrbach, J M

    2012-10-01

    Adolf Hitler met or at least knew about 5 ophthalmologists. The chair of ophthalmology in Berlin, Walther Löhlein, personally examined Hitler's eyes at least two times. The chair of ophthalmology in Breslau, Walter Dieter, developed "air raid protection spectacles" with the aid of high representatives of the NS-system and probably Adolf Hitler himself. Heinrich Wilhelm Kranz became rector of the universities of Giessen and Frankfurt/Main. He was known as a very strict advocate of the NS-race hygiene. Werner Zabel made plans for Hitler's diet and tried to interfere with Hitler's medical treatment. Finally, Hellmuth Unger was an influential representative of the medical press and a famous writer. Three of his novels with medical topics were made into a film which Hitler probably saw. Hitler had, so to say, a small "ophthalmological proximity" which, however, did not play a significant role for himself or the NS-state. © Georg Thieme Verlag KG Stuttgart · New York.

  18. Semiconductor detectors with proximity signal readout

    International Nuclear Information System (INIS)

    Asztalos, Stephen J.

    2012-01-01

    Semiconductor-based radiation detectors are routinely used for the detection, imaging, and spectroscopy of x-rays, gamma rays, and charged particles for applications in the areas of nuclear and medical physics, astrophysics, environmental remediation, nuclear nonproliferation, and homeland security. Detectors used for imaging and particle tracking are more complex in that they typically must also measure the location of the radiation interaction in addition to the deposited energy. In such detectors, the position measurement is often achieved by dividing or segmenting the electrodes into many strips or pixels and then reading out the signals from all of the electrode segments. Fine electrode segmentation is problematic for many of the standard semiconductor detector technologies. Clearly there is a need for a semiconductor-based radiation detector technology that can achieve fine position resolution while maintaining the excellent energy resolution intrinsic to semiconductor detectors, can be fabricated through simple processes, does not require complex electrical interconnections to the detector, and can reduce the number of required channels of readout electronics. Proximity electrode signal readout (PESR), in which the electrodes are not in physical contact with the detector surface, satisfies this need

  19. Imaging of rectus femoris proximal tendinopathies

    International Nuclear Information System (INIS)

    Pesquer, Lionel; Poussange, Nicolas; Meyer, Philippe; Dallaudiere, Benjamin; Feldis, Matthieu; Sonnery-Cottet, Bertrand; Graveleau, Nicolas

    2016-01-01

    The rectus femoris is the most commonly injured muscle of the anterior thigh among athletes, especially soccer players. Although the injury pattern of the muscle belly is well documented, less is known about the anatomy and specific lesions of the proximal tendons. For each head, three distinctive patterns may be encountered according to the location of the injury, which can be at the enthesis, within the tendon, or at the musculotendinous junction. In children, injuries correspond most commonly to avulsion of the anteroinferior iliac spine from the direct head and can lead to subspine impingement. Calcific tendinitis and traumatic tears may be encountered in adults. Recent studies have shown that traumatic injuries of the indirect head may be underdiagnosed and that injuries of both heads may have a surgical issue. Finally, in the case of tears, functional outcome and treatment may vary if the rupture involves one or both tendons and if the tear is partial or complete. Thus, it is mandatory for the radiologist to know the different ultrasound and magnetic resonance imaging (MRI) patterns of these lesions in order to provide accurate diagnosis and treatment. The purpose of this article is to recall the anatomy of the two heads of rectus femoris, describe a reliable method of assessment with ultrasound and MRI and know the main injury patterns, through our own experience and literature review. (orig.)

  20. Proximal spinal muscular atrophy: current orthopedic perspective

    Directory of Open Access Journals (Sweden)

    Haaker G

    2013-11-01

    Full Text Available Gerrit Haaker, Albert Fujak Department of Orthopaedic Surgery, Friedrich-Alexander-Universität Erlangen-Nürnberg, Erlangen, Germany Abstract: Spinal muscular atrophy (SMA is a hereditary neuromuscular disease of lower motor neurons that is caused by a defective "survival motor neuron" (SMN protein that is mainly associated with proximal progressive muscle weakness and atrophy. Although SMA involves a wide range of disease severity and a high mortality and morbidity rate, recent advances in multidisciplinary supportive care have enhanced quality of life and life expectancy. Active research for possible treatment options has become possible since the disease-causing gene defect was identified in 1995. Nevertheless, a causal therapy is not available at present, and therapeutic management of SMA remains challenging; the prolonged survival is increasing, especially orthopedic, respiratory and nutritive problems. This review focuses on orthopedic management of the disease, with discussion of key aspects that include scoliosis, muscular contractures, hip joint disorders, fractures, technical devices, and a comparative approach of conservative and surgical treatment. Also emphasized are associated complications including respiratory involvement, perioperative care and anesthesia, nutrition problems, and rehabilitation. The SMA disease course can be greatly improved with adequate therapy with established orthopedic procedures in a multidisciplinary therapeutic approach. Keywords: spinal muscular atrophy, scoliosis, contractures, fractures, lung function, treatment, rehabilitation, surgery, ventilation, nutrition, perioperative management

  1. Imaging of rectus femoris proximal tendinopathies

    Energy Technology Data Exchange (ETDEWEB)

    Pesquer, Lionel; Poussange, Nicolas; Meyer, Philippe; Dallaudiere, Benjamin; Feldis, Matthieu [Clinique du Sport de Bordeaux, Centre d' Imagerie Osteo-articulaire, Merignac (France); Sonnery-Cottet, Bertrand [Groupe Ramsay Generale de Sante - Hopital Prive Jean Mermoz, Centre Orthopedique Santy, Lyon (France); Graveleau, Nicolas [Clinique du Sport de Bordeaux, Centre de Chirurgie Orthopedique et Sportive, Merignac (France)

    2016-07-15

    The rectus femoris is the most commonly injured muscle of the anterior thigh among athletes, especially soccer players. Although the injury pattern of the muscle belly is well documented, less is known about the anatomy and specific lesions of the proximal tendons. For each head, three distinctive patterns may be encountered according to the location of the injury, which can be at the enthesis, within the tendon, or at the musculotendinous junction. In children, injuries correspond most commonly to avulsion of the anteroinferior iliac spine from the direct head and can lead to subspine impingement. C