WorldWideScience

Sample records for providing radiation resistance

  1. Ways of providing radiation resistance of magnetic field semiconductor sensors

    CERN Document Server

    Bolshakova, I A; Holyaka, R; Matkovskii, A; Moroz, A

    2001-01-01

    Hall magnetic field sensors resistant to hard ionizing irradiation are being developed for operation under the radiation conditions of space and in charged particle accelerators. Radiation resistance of the sensors is first determined by the properties of semiconductor materials of sensitive elements; we have used microcrystals and thin layers of III-V semiconductors. Applying complex doping by rare-earth elements and isovalent impurities in certain proportions, we have obtained magnetic field sensors resistant to irradiation by fast neutrons and gamma-quanta. Tests of their radiation resistance were carried out at IBR-2 at the Joint Institute for Nuclear Research (Dubna). When exposed to neutrons with E=0.1-13 MeV and intensity of 10 sup 1 sup 0 n cm sup - sup 2 s sup - sup 1 , the main parameter of the sensors - their sensitivity to magnetic fields - changes by no more than 0.1% up to fluences of 10 sup 1 sup 4 n cm sup - sup 2. Further improvement of radiation resistance of sensor materials is expected by ...

  2. Radiation resistant modified polypropylene

    International Nuclear Information System (INIS)

    Bojarski, J.; Zimek, Z.

    1997-01-01

    Radiation technology for production of radiation resistant polypropylene for medical use has been presented. The method consists in radiation induced copolymerization of polypropylene with ethylene and addition of small amount of copolymer of polyethylene and vinyl acetate. The material of proposed composition has a very good mechanical properties and elevated radiation resistivity decided on possibility of radiosterilization of products made of this material and designed for medical use. 3 figs, 3 tabs

  3. Radiation resistant lining material

    International Nuclear Information System (INIS)

    Ouchi, Koki; Okagawa, Seigo; Tamaki, Hidehiro.

    1990-01-01

    Rigidity, viscoelasticity, flexibility, radiation resistance, leaching resistance, rust-proofness, endurance, etc. are required for the lining materials to wall surfaces and floor surfaces of facilities used under the effect of radiation rays and for the inner surface protection of vessels for radioactive wastes. The present invention provides radiation resistant lining material capable of satisfying such various requirements in a well-balanced manner. That is, the material contains (A) 100 parts by weight of rapidly curing cement, (B) 50 to 300 % by weight of aggregate, and (C) 80 to 120 parts by weight of polymer emulsion. As the specific example, the ingredient (A) is commercially available under the trade name of Jet Cement. The aggregate of the ingredient (B) has preferably from about 0.6 to 0.2 mm of size and is made of material, preferably, silicon or iron grains. As the ingredient (C), acrylic resin emulsion is preferred. As a result of example, these ingredient constitutions can satisfy each of the required performance described above. (I.S.)

  4. Biological improvement of radiation resistance

    Energy Technology Data Exchange (ETDEWEB)

    Chun, K J; Lee, Y K; Kim, J S; Kim, J K; Lee, S J

    2000-08-01

    To investigate the mechanisms of gene action related to the radiation resistance in microorganisms could be essentially helpful for the development of radiation protectants and hormeric effects of low dose radiation. This book described isolation of radiation-resistant microorganisms, induction of radiation-resistant and functionally improved mutants by gamma-ray radiation, cloning and analysis of the radiation resistance related genes and analysis of the expressed proteins of the radiation resistant related genes.

  5. Biological improvement of radiation resistance

    International Nuclear Information System (INIS)

    Chun, K. J.; Lee, Y. K.; Kim, J. S.; Kim, J. K.; Lee, S. J.

    2000-08-01

    To investigate the mechanisms of gene action related to the radiation resistance in microorganisms could be essentially helpful for the development of radiation protectants and hormeric effects of low dose radiation. This book described isolation of radiation-resistant microorganisms, induction of radiation-resistant and functionally improved mutants by gamma-ray radiation, cloning and analysis of the radiation resistance related genes and analysis of the expressed proteins of the radiation resistant related genes

  6. NEW RADIATION RESISTANT GREASES

    Energy Technology Data Exchange (ETDEWEB)

    DasGupta, Sharda; Slobodian, J. T.

    1962-11-20

    New radiation resistant greases were prepared from commercially available greases by carrying out radioinduced reactions with styrene. The radiation tolerances of the products were 250-1000 fold more than the starting materials and any product of similar properties now available. The various properties of the new products initially and after exposure to large radiation doses were in no case inferior to the original greases and in some respects improvements were observed. Radiation tolerance of commercial greases could be enhanced by the addition of polystyrene to form a physical mixture rather than copolymers. The reaction mechanisms involved at all stages were studied using infrared spectroscopic techniques. (P.C.H.)

  7. Enhanced radiation resistant fiber optics

    International Nuclear Information System (INIS)

    Lyons, P.B.; Looney, L.D.

    1993-01-01

    A process for producing an optical fiber having enhanced radiation resistance is provided, the process including maintaining an optical fiber within a hydrogen-containing atmosphere for sufficient time to yield a hydrogen-permeated optical fiber having an elevated internal hydrogen concentration, and irradiating the hydrogen-permeated optical fiber at a time while the optical fiber has an elevated internal hydrogen concentration with a source of ionizing radiation. The radiation source is typically a cobalt-60 source and the fiber is pre-irradiated with a dose level up to about 1000 kilorads of radiation. 4 figures

  8. Enhanced radiation resistant fiber optics

    Science.gov (United States)

    Lyons, P.B.; Looney, L.D.

    1993-11-30

    A process for producing an optical fiber having enhanced radiation resistance is provided, the process including maintaining an optical fiber within a hydrogen-containing atmosphere for sufficient time to yield a hydrogen-permeated optical fiber having an elevated internal hydrogen concentration, and irradiating the hydrogen-permeated optical fiber at a time while the optical fiber has an elevated internal hydrogen concentration with a source of ionizing radiation. The radiation source is typically a cobalt-60 source and the fiber is pre-irradiated with a dose level up to about 1000 kilorads of radiation. 4 figures.

  9. Radiation-Resistant Photon-Counting Detector Package Providing Sub-ps Stability for Laser Time Transfer in Space

    Science.gov (United States)

    Prochzaka, Ivan; Kodat, Jan; Blazej, Josef; Sun, Xiaoli (Editor)

    2015-01-01

    We are reporting on a design, construction and performance of photon-counting detector packages based on silicon avalanche photodiodes. These photon-counting devices have been optimized for extremely high stability of their detection delay. The detectors have been designed for future applications in fundamental metrology and optical time transfer in space. The detectors have been qualified for operation in space missions. The exceptional radiation tolerance of the detection chip itself and of all critical components of a detector package has been verified in a series of experiments.

  10. Radiation-resistant plastic insulators

    International Nuclear Information System (INIS)

    Sturm, B.J.; Parkinson, W.W.

    1975-01-01

    A high molecular weight organic composition useful as an electric insulator in radiation fields is provided and comprises normally a solid polymer of an organic compound having a specific resistance greater than 10 19 ohm-cm and containing phenyl groups and 1 to 7.5 weight percent of a high molecular weight organic phosphite. In one embodiment the composition comprises normally solid polystyrene having 7.5 weight percent tris-β-chloroethyl phosphite as an additive; the composition exhibited an increase in the post-irradiation resistivity of over an order of magnitude over the post-irradiation resistivity of pure polystyrene. (Patent Office Record)

  11. Radiation resistant ducted superconductive coil

    International Nuclear Information System (INIS)

    Schleich, A.

    1976-01-01

    The radiation-resistant ducted superconductive coil consists of a helically wound electrical conductor constituted by an electrically conductive core of superconductive material provided with a longitudinally extending cooling duct. The core is covered with a layer of inorganic insulating material and the duct is covered by an electrically conductive metallic gas-tight sheath. The metallic sheaths on adjacent turns of the coil are secured together. 2 Claims, 4 Drawing Figures

  12. Communication equipment radiation resistance ensurance

    International Nuclear Information System (INIS)

    Myrova, L.O.; Chelizhenko, A.Z.

    1983-01-01

    A review of works on radiation resistance of electronic equipment (epsilon epsilon) for 15 years is presented. The effect of ionizing radiation appearing as a result of nuclear explosions in nuclear facilities and in outerspace on epsilon epsilon has been considered. Types of radiation effects in epsilon epsilon, radiation effect on semiconductor devices and integrated circUits, types of epsilon epsilon failures, as well as the procass of radiation-resistant epsilon epsilon designing and selection of its main parameters have been described. The methods of epsilon epsilon flowsheet optimization, application of mathematical simulation and peculiarities of ensurance of epsilon epsilon radiation resistance of communication systems are considered. Peculiarities of designing of radiation-resistant quartz generators, secondary power supply sources and amplifiers are discussed

  13. Radiation resistance of elastomers

    International Nuclear Information System (INIS)

    Hourquebie, P.; Bigarre, J.; Forveille, J.L.; Raby, J.; Lazare, L.

    2002-01-01

    The COMOR group is a network of laboratories from both the CEA and the CNRS. This network is particularly involved in fundamental and applied studies on the ageing of polymers under irradiation. COMOR has studied the ageing of EPDM (ethylene-propylene-diene-monomer) because this elastomer is often used in nuclear environment (in cable coating for instance). In this study, we have prepared materials with different formulations and we have characterised their use-condition properties (dielectric and mechanical) before and after γ irradiation. The dielectric measurements are well adapted to study the oxidation and the crosslinking phenomena which appear during the irradiation ageing. We have shown that after a short time, the oxidation is limited by the diffusion of oxygen. A phenolic antioxidant is not able to protect the polymer against the oxidation. However, we used a concentration typical of a purely thermal stabilisation case (0,1%). On the other hand, a diamine type additive with a concentration of 1% showed efficient stabilisation. The mechanical properties of the regular EPDM are strongly affected by the irradiation but there is little difference with regard to radiation resistance between both types of raw materials. Nevertheless, the NORDEL IP 3725 stabilised with the amine has better initial mechanical properties whereas the NORDEL 2722 offers higher strength above 300 kGy. Our results emphasize the stake of a proper stabilisation of polymers with respect to ionising radiation. (authors)

  14. CERN selects Fujikura's radiation resistant fiber

    CERN Multimedia

    2007-01-01

    "Fujikura Europe Ltd. (search for Fujikura Europe) today announced that its radiation resistant singlemode optical fiber has been selected by CERN to provide communicaton links within the world's largest particle accelerator..."(2/3 page)

  15. Radiation-resistant asporogenic bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Yano, K [Tokyo Univ. (Japan). Faculty of Agriculture

    1975-09-01

    This paper reports the biological and ecological examinations on the radiation-resistant asporogenic bacteria (mainly concerning Micrococcus radiodurans). Radiation-resistant asporogenic bacteria were isolated from the irradiated areas of the natural world as well as from the general areas and from the Rn waters in the Misasa hot spring. The acquiring of the tolerance to radiation in bacteria was also examined. In addition, the future problems of microbiological treatment with irradiation were mentioned.

  16. Radiation-resistant asporogenic bacteria

    International Nuclear Information System (INIS)

    Yano, Keiji

    1975-01-01

    This paper reports the biological and ecological examinations on the radiation-resistant asporogenic bacteria (mainly concerning Micrococcus radiodurans). Radiation-resistant asporogenic bacteria were isolated from the irradiated areas of the natural world as well as from the general areas and from the Rn waters in the Misasa hot spring. The acquiring of the tolerance to radiation in bacteria was also examined. In addition, the future problems of microbiological treatment with irradiation were mentioned. (Tsukamoto, Y.)

  17. Radiation resistance of Rhizopus stolonifer

    International Nuclear Information System (INIS)

    Robbertse, P.J.; Du Toit, T.L.; Van der Merwe, L.J.; Koekemoer, M.L.; Eilers, I.M.I.

    1983-01-01

    A problem encountered with the irradiation of food is that certain micro-organisms are highly resistant to gamma rays. This includes the fungus, Rhizopus stolonifer, associated with most fruits. The Nuclear Development Corporation of South Africa (NUCOR) has found that a combination of radiation and mild heat treatment reduces the radiation dose necessary to kill 90% of R. stolonifer by approximately half. Treatment at 50 degrees Celsius for 10 minutes or at 55 degrees Celsius for five minutes is sufficient. The article discusses the mechanism of radiation resistance in R. stolonifer and the way in which heating affects this resistance

  18. Radiation-resistant camera tube

    International Nuclear Information System (INIS)

    Kuwahata, Takao; Manabe, Sohei; Makishima, Yasuhiro

    1982-01-01

    It was a long time ago that Toshiba launched on manufacturing black-and-white radiation-resistant camera tubes employing nonbrowning face-plate glass for ITV cameras used in nuclear power plants. Now in compliance with the increasing demand in nuclear power field, the Company is at grips with the development of radiation-resistant single color-camera tubes incorporating a color-stripe filter for color ITV cameras used under radiation environment. Herein represented are the results of experiments on characteristics of materials for single color-camera tubes and prospects for commercialization of the tubes. (author)

  19. Radiation-resistant control system

    International Nuclear Information System (INIS)

    Cable, T.C.; Jones, S.

    1995-01-01

    REMOTEC has developed a open-quotes radiation resistanceclose quotes control system under a U.S. Department of Energy Small Business Innovative Research (SBIR) contract with assistance from the University of Florida. The SBIR goal was to develop a radiation resistant mobile robot from the ANDROS family of hazardous duty mobile robots that REMOTEC manufactures. See Refs. 1 and 2 for additional SBIR results. The control system, as well as the entire ANDROS robot, was redesigned, where necessary, to withstand radiation doses in excess of 10 6 rad. Those components of the robot that could not be purchased as open-quotes radiation hardenedclose quotes were tested under standard operating conditions for determination of their open-quotes radiation resistance.close quotes The entire ANDROS robot was then assembled with these new components and tested to > 10 6 rad

  20. Resistive Memory Devices for Radiation Resistant Non-Volatile Memory

    Data.gov (United States)

    National Aeronautics and Space Administration — Ionizing radiation in space can damage electronic equipment, corrupting data and even disabling computers. Radiation resistant (rad hard) strategies must be employed...

  1. Final Report for Radiation Resistant Magnets II

    International Nuclear Information System (INIS)

    A. F. Zeller

    2005-01-01

    Report on techniques for the fabrication of radiation resistant magnets for the RIA Fragment Separator. The development of magnet designs capable of reasonable life times in high-radiation environments and having reasonable performance is of paramount importance for RIA as well as other high-intensity projects under consideration, such as the Neutrino Factory and FAIR project at GSI. Several approaches were evaluated for radiation resistant superconducting magnets. One approach was to simply use a more radiation resistant epoxy for the coil fabrication. Another approach for cryostable magnets, like the S800 Spectrograph dipole, is the use of all-inorganic materials. The final approach was the development of radiation resistant Cable-In-Conduit-Conductor (CICC) like that used in fusion magnets; though these are not radiation resistant because an organic insulator is used. Simulations have shown that the nuclear radiation heating of the first quadrupoles in the RIA Fragment Separator will be so large that cold mass minimization will be necessary with the magnet iron being at room temperature. Three different types of conductor for radiation resistant superconducting magnets have been built and successfully tested. The cyanate ester potted coils will work nicely for magnets where the lifetime dose is a factor of 20 less than the end of life of the superconductor and the rate of energy deposition is below the heat-removal limit of the coil. The all-inorganic cryostable coil and the metal oxide insulated CICC will provide conductor that will work up to the life of the superconductor and have the ability to remove large quantities of nuclear heating. Obviously, more work needs to be done on the CICC to increase the current density and to develop different insulations; and on the cyanate esters to increase the heat transfer

  2. Adriamycin resistance and radiation response

    International Nuclear Information System (INIS)

    Belli, J.A.; Harris, J.R.

    1979-01-01

    Mammalian cells (V79) in culture developed resistance to Adriamycin during continuous exposure to low levels of drug. This resistance was accompanied by change in x-ray survival properties which, in turn, depended upon the isolation of subpopulations from resistant sub lines. These changes in x-ray survival properties were characterized by reduced D/sub Q/ values and a decrease in the D/sub O/. However, these changes were not observed together in the same cell sub line. Adriamycin-resistant cells did not appear to be radiation damage repair deficient. Other phenotypic changes (cell morphology, DNA content and chromosome number) suggested mutational events coincident with the development of Adriamycin resistance

  3. Radiation resistance of Candida parapsilosis

    International Nuclear Information System (INIS)

    Kristensen, H.

    1982-01-01

    The radiation resistance of 30 strains classified as Candida parapsilosis was examined. The strains originated partly from environments where ionizing radiation was used for research or routine purposes, partly from environments with no known possibility for selection of strains with unusually high radiation resistance. D-6 values between 1.5 and 2.4 Megarads were found when the cells were irradiated in the dried state, a D-6 value being the dose necessary to reduce the initial number of colony-forming units with a factor of 10 6 . The majority of D-6 values were between 1.9 and 2.1 Megarads. D-6 values for the cells irradiated in liquid media were about 2/3 of tose in the dried state. No difference in resistance was revealed depending on the origin of the strains examined. For radiation sterilization of medical products the demonstrated resistance of Candida parapsilosis might be of importance of routine use of minimum doses below 2.5 Megarads were to be accepted. (author)

  4. CERN selects Fujikura's radiation resistant fiber

    CERN Multimedia

    2007-01-01

    "Fujikura recently announced that its radiation resistant single mode optical fiber has been selected by CERN, the European Laboratory for Particle Physics, to provide communication links within the world's largest particle accelerator - the Large Hadron Collider (LHC) - near Geneva, Switzerland." (1/2 page)

  5. CERN selects Fujikura's radiation resistant fibre

    CERN Multimedia

    2007-01-01

    "Fujikura today announced that its radiation resistant single mode optical fibre has been selected by CERN, the European Laboratory for Particle Physics, to provide communication links within the world's largest particle accelerator - the Large hadron Collider (LHC) - near Genevan, Switzerland. (1/2 page)

  6. Research of radiation-resistant microbial organisms

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dongho; Lim, Sangyong; Joe, Minho; Park, Haejoon; Song, Hyunpa; Im, Seunghun; Kim, Haram; Kim, Whajung; Choi, Jinsu; Park, Jongchun

    2012-01-15

    Many extremophiles including radiation-resistant bacteria Deinococcus radiodurans have special characteristics such as novel enzymes and physiological active substances different from known biological materials and are being in the spotlight of biotechnology science. In this research, basic technologies for the production of new genetic resources and microbial strains by a series of studies in radiation-resistant microbial organisms were investigated and developed. Mechanisms required for radiation-resistant in Deinococcus radiodurans were partly defined by analyzing the function of dinB, pprI, recG, DRA{sub 0}279, pprM, and two-component signal transduction systems. To apply genetic resource and functional materials from Deinococcus species, omics analysis in response to cadmium, construction of macroscopic biosensor, and characterization of carotenoids and chaperon protein were performed. Additionally, potential use of D. geothermalis in monosaccharide production from non-biodegradable plant materials was evaluated. Novel radiation resistant yeasts and bacteria were isolated and identified from environmental samples to obtain microbial and genomic resources. An optimal radiation mutant breeding method was set up for efficient and rapid isolation of target microbial mutants. Furthermore, an efficient ethanol producing mutant strain with high production yield and productivity was constructed using the breeding method in collaboration with Korea Research Institute of Bioscience and Biotechnology. Three Deinococcal bioindicators for radiation dosage confirmation after radiation sterilization process were developed. These results provide a comprehensive information for novel functional genetic elements, enzymes, and physiological active substances production or application. Eventually, industrial microbial cell factories based on radiation resistant microbial genomes can be developed and the technologies can be diffused to bioindustry continuously by this project.

  7. Research of radiation-resistant microbial organisms

    International Nuclear Information System (INIS)

    Kim, Dongho; Lim, Sangyong; Joe, Minho; Park, Haejoon; Song, Hyunpa; Im, Seunghun; Kim, Haram; Kim, Whajung; Choi, Jinsu; Park, Jongchun

    2012-01-01

    Many extremophiles including radiation-resistant bacteria Deinococcus radiodurans have special characteristics such as novel enzymes and physiological active substances different from known biological materials and are being in the spotlight of biotechnology science. In this research, basic technologies for the production of new genetic resources and microbial strains by a series of studies in radiation-resistant microbial organisms were investigated and developed. Mechanisms required for radiation-resistant in Deinococcus radiodurans were partly defined by analyzing the function of dinB, pprI, recG, DRA 0 279, pprM, and two-component signal transduction systems. To apply genetic resource and functional materials from Deinococcus species, omics analysis in response to cadmium, construction of macroscopic biosensor, and characterization of carotenoids and chaperon protein were performed. Additionally, potential use of D. geothermalis in monosaccharide production from non-biodegradable plant materials was evaluated. Novel radiation resistant yeasts and bacteria were isolated and identified from environmental samples to obtain microbial and genomic resources. An optimal radiation mutant breeding method was set up for efficient and rapid isolation of target microbial mutants. Furthermore, an efficient ethanol producing mutant strain with high production yield and productivity was constructed using the breeding method in collaboration with Korea Research Institute of Bioscience and Biotechnology. Three Deinococcal bioindicators for radiation dosage confirmation after radiation sterilization process were developed. These results provide a comprehensive information for novel functional genetic elements, enzymes, and physiological active substances production or application. Eventually, industrial microbial cell factories based on radiation resistant microbial genomes can be developed and the technologies can be diffused to bioindustry continuously by this project

  8. Fallout radiation protection provided by transportation vehicles

    Energy Technology Data Exchange (ETDEWEB)

    Burson, Z.G.

    1972-10-20

    Fallout radiation protection factors (PF's) were estimated for a variety of civilian transportation vehicles using measurements of the natural terrain radiation as a source. The PF values are below 2 in light vehicles, truck beds, or trailers; from 2.5 to 3 in the cabs of heavy trucks and in a railway guard car; and from 3.0 to 3.5 in the engineer's seat of heavy locomotives. This information can be useful in planning the possible movement of personnel from or through areas contaminated either by a wartime incident or a peacetime accident. The information may also be useful for studying the reduction of exposure to the natural terrestrial radiation environment provided by vehicles.

  9. Heat resistant/radiation resistant cable and incore structure test device for FBR type reactor

    International Nuclear Information System (INIS)

    Tanimoto, Hajime; Shiono, Takeo; Sato, Yoshimi; Ito, Kazumi; Sudo, Shigeaki; Saito, Shin-ichi; Mitsui, Hisayasu.

    1995-01-01

    A heat resistant/radiation resistant coaxial cable of the present invention comprises an insulation layer, an outer conductor and a protection cover in this order on an inner conductor, in which the insulation layer comprises thermoplastic polyimide. In the same manner, a heat resistant/radiation resistant power cable has an insulation layer comprising thermoplastic polyimide on a conductor, and is provided with a protection cover comprising braid of alamide fibers at the outer circumference of the insulation layer. An incore structure test device for an FBR type reactor comprises the heat resistant/radiation resistant coaxial cable and/or the power cable. The thermoplastic polyimide can be extrusion molded, and has excellent radiation resistant by the extrusion, as well as has high dielectric withstand voltage, good flexibility and electric characteristics at high temperature. The incore structure test device for the FBR type reactor of the present invention comprising such a cable has excellent reliability and durability. (T.M.)

  10. Intrinsic radiation resistance in human chondrosarcoma cells

    International Nuclear Information System (INIS)

    Moussavi-Harami, Farid; Mollano, Anthony; Martin, James A.; Ayoob, Andrew; Domann, Frederick E.; Gitelis, Steven; Buckwalter, Joseph A.

    2006-01-01

    Human chondrosarcomas rarely respond to radiation treatment, limiting the options for eradication of these tumors. The basis of radiation resistance in chondrosarcomas remains obscure. In normal cells radiation induces DNA damage that leads to growth arrest or death. However, cells that lack cell cycle control mechanisms needed for these responses show intrinsic radiation resistance. In previous work, we identified immortalized human chondrosarcoma cell lines that lacked p16 ink4a , one of the major tumor suppressor proteins that regulate the cell cycle. We hypothesized that the absence of p16 ink4a contributes to the intrinsic radiation resistance of chondrosarcomas and that restoring p16 ink4a expression would increase their radiation sensitivity. To test this we determined the effects of ectopic p16 ink4a expression on chondrosarcoma cell resistance to low-dose γ-irradiation (1-5 Gy). p16 ink4a expression significantly increased radiation sensitivity in clonogenic assays. Apoptosis did not increase significantly with radiation and was unaffected by p16 ink4a transduction of chondrosarcoma cells, indicating that mitotic catastrophe, rather than programmed cell death, was the predominant radiation effect. These results support the hypothesis that p16 ink4a plays a role in the radiation resistance of chondrosarcoma cell lines and suggests that restoring p16 expression will improve the radiation sensitivity of human chondrosarcomas

  11. Gravitational radiation resistance, radiation damping and field fluctuations

    International Nuclear Information System (INIS)

    Schaefer, G.

    1981-01-01

    Application is made of two different generalised fluctuation-dissipation theorems and their derivations to the calculation of the gravitational quadrupole radiation resistance using the radiation-reaction force given by Misner, Thorne and Wheeler (Gravitation (San Francisco: Freeman) ch 36,37 (1973)) and the usual tidal force on one hand and the tidal force and the free gravitational radiation field on the other hand. The quantum-mechanical version (including thermal generalisations) of the well known classical quadrupole radiation damping formula is obtained as a function of the radiation resistance. (author)

  12. Radiation resistance of polymer materials for space

    International Nuclear Information System (INIS)

    Miyauchi, Masahiko; Iwata, Minoru; Yokota, Rikio

    2011-01-01

    The thin film of thermoplastic polyimide with a new asymmetric structure is used in the solar sail 'IKAROS'. Here, the relation of its chemical structure to its thermodynamic properties and radiation resistance is introduced. (M.H.)

  13. Physiological and genetics studies of highly radiation-resistant bacteria

    International Nuclear Information System (INIS)

    Keller, L.C.

    1981-01-01

    The phenomenon of radiation resistance was studied using micrococci and Moraxella-Acinetobacter capable of surviving very high doses of gamma radiation which were isolated from foods. Physiological age, or growth phase, was found to be an important factor in making comparisons of radiation-resistance among different bacteria and their mutants. Radiation-resistant bacteria were highly resistant to the lethal effect of nitrosoguanidine used for mutagenesis. Studies of relative resistance of radiation-resistant bacteria, radiation-sensitive mutants, and nonradiation-resistant bacteria to killing by different chemical mutagens did not reveal a correlation between the traits of radiation resistance and mutagen resistance among different strains. Comparisons of plasmid profiles of radiation-resistant bacteria and selected radiation-sensitive mutants suggested the possibility that plasmids may carry genes involved in radiation resistance

  14. Physiologic mechanisms in radiation resistance

    International Nuclear Information System (INIS)

    Reichard, S.M.

    1976-01-01

    Some topics discussed are as follows: role of the reticuloendothelial system in the regeneration of the hematopoietic system; uptake of colloidal agents by liver and spleen cells following graded doses of x radiation; effects of x radiation on peritoneal macrophages of rats; stimulation of phagocytic activity of the reticuloendothelial system by estrogens, serum albumin, and bacterial endotoxins; and sequestration of particulate material within the reticuloendothelial organs following x irradiation

  15. Development of radiation resistant PEEK insulation cable

    International Nuclear Information System (INIS)

    Mio, Keigo; Ogiwara, Norio; Hikichi, Yusuke; Furukori, Hisayoshi; Arai, Hideyuki; Nishizawa, Daiji; Nishidono, Toshiro

    2009-04-01

    Material characterization and development has been carried out for cable insulation suitable for use in the J-PARC 3-GeV RCS radiation environment. In spite of its high cost, PEEK (polyether-ether-ketone) has emerged as the leading candidate satisfying requirements of being non-halogen based, highly incombustible and with radiation resistant at least 10 MGy, along with the usual mechanical characteristics such as good elongation at break, which are needed in a cable insulation. Gamma-ray irradiation tests have been done in order to study radiation resistance of PEEK cable. Further, mechanical, electrical and fire retardant characteristics of a complete cable such as would be used at the J-PARC RCS were investigated. As a result, PEEK cables were shown to be not degraded by radiation up to at least 10 MGy, and thus could be expected to operate stably under the 3-GeV RCS radiation environment. (author)

  16. Radiation resistance of plastic solid

    International Nuclear Information System (INIS)

    Moriyama, Noboru; Dojiri, Shigeru; Wadachi, Yoshiki

    1985-01-01

    The radiation from nucleides contained in solidified wates have some effects on the degradation of the solidification materials. This report deals with effects of such radiation on the mechanical strength of waste-plastics composites and on the generation of gasses. It is shown that the mechanical strength of polyethylene and polyester solids will not decrease at a total absorbed dose of 10 6 rad, a dose which a low-level waste composite is expected to receive during an infinite period of time. Rather, it increases in the case of polyethylene. The amount of gas generated from degraded polyethylene is about three times as large as that from polyester, namely, about 6 l per 200 l drum can at 10 6 rad. Hydrogen accounts for about 80 % of the total gas generated from polyethylene. On the other hand, the gas from polyester solid mainly contains hydrogen, carbon dioxide, carbon monoxide and methane, with a composition greatly dependent on the type of the waste contained. It is concluded from these results that plastic materials can serve satisfactorily as for as the effects of radiation on their mechanical strength and gas generation are concerned. A more important problem still remaining to be solved is the effects of radiation on the leaching of radioactive nuclides. (Nogami, K.)

  17. Predictors of radiation exposure to providers during percutaneous nephrolithotomy

    Directory of Open Access Journals (Sweden)

    David L Wenzler

    2017-01-01

    Conclusion: Increased stone burden, partial or staghorn calculi, surgery and fluoroscopy duration, and absence of preexisting access were associated with high provider radiation exposure. Radiation safety awareness is essential to minimize exposure and to protect the patient and all providers from potential radiation injury.

  18. Archway for Radiation and Micrometeorite Occurrence Resistance

    Science.gov (United States)

    Giersch, Louis R.

    2012-01-01

    The environmental conditions of the Moon require mitigation if a long-term human presence is to be achieved for extended periods of time. Radiation, micrometeoroid impacts, high-velocity debris, and thermal cycling represent threats to crew, equipment, and facilities. For decades, local regolith has been suggested as a candidate material to use in the construction of protective barriers. A thickness of roughly 3m is sufficient protection from both direct and secondary radiation from cosmic rays and solar protons; this thickness is sufficient to reduce radiation exposure even during solar flares. NASA has previously identified a need for innovations that will support lunar habitats using lightweight structures because the reduction of structural mass translates directly into additional up and down mass capability that would facilitate additional logistics capacity and increased science return for all mission phases. The development of non-pressurized primary structures that have synergy with the development of pressurized structures is also of interest. The use of indigenous or in situ materials is also a well-known and active area of research that could drastically improve the practicality of human exploration beyond low-Earth orbit. The Archway for Radiation and Micrometeorite Occurrence Resistance (ARMOR) concept is a new, multifunctional structure that acts as radiation shielding and micrometeorite impact shielding for long-duration lunar surface protection of humans and equipment. ARMOR uses a combination of native regolith and a deployed membrane jacket to yield a multifunctional structure. ARMOR is a robust and modular system that can be autonomously assembled on-site prior to the first human surface arrival. The system provides protection by holding a sufficiently thick (3 m) archshaped shell of local regolith around a central cavity. The regolith is held in shape by an arch-shaped jacket made of strong but deployable material. No regolith processing is

  19. Radiation resistance of ethylene-styrene copolymers

    International Nuclear Information System (INIS)

    Matsumoto, Kaoru; Ikeda, Masaaki; Ohki, Yoshimichi; Kusama, Yasuo; Harashige, Masahiro; Yazaki, Fumihiko.

    1988-01-01

    In this paper, the radiation resistance of ethylene-styrene copolymer, a polymeric resin developed newly by the authors, is reported. Resin examined were five kinds of ethylene-styrene copolymers: three random and two graft copolymers with different styrene contents. Low-density polyethylene was used as a reference. The samples were irradiated by 60 Co γ-rays to total absorbed doses up to 10 MGy. The mechanical properties of the smaples were examined. Infrared spectroscopy, differential scanning calorimetry and X-ray scattering techniques were used to examine the morphology of the samples. The random copolymers are soft and easy to extend, because benzene rings which exisist highly at random hinder the crystallization. As for the radiation resistance, they are highly resistant to γ-rays in the aspects of carbonyl group formation, gel formation, and elongation. Further, they show even better radiation resistance when proper additives were compounded in. The graft copolymers are hard to extend, because they consist of segregated polystyrene and polyethylene regions which are connected with each other. The tensile strength of irradiated graft copolymers does not decrease below that of unirradiated copolymers, up to a total dose of 10 MGy. As a consequence, it can be said that ethylene-styrene copolymers have good radiation resistance owing to the so-called 'sponge' effect of benzene rings. (author)

  20. Radiation therapy for resistant sternal hydatid disease

    International Nuclear Information System (INIS)

    Ulger, S.; Barut, H.; Tunc, M.; Aydinkarahaliloglu, E.; Aydin, E.; Karaoglanoglu, N.; Gokcek, A.

    2013-01-01

    Hydatid disease is a zoonotic infectious disease for which there are known treatment procedures and effective antibiotics; however, there are resistant cases that do not respond to medication or surgery. We report a case diagnosed as hydatid disease of the chest wall and treated with radiation therapy (RT) after medical and surgical therapy had failed. In conclusion, RT represents an alternative treatment modality in resistant cases. (orig.)

  1. On the honeybee resistance to gamma radiation

    International Nuclear Information System (INIS)

    Courtois, G.; Lecomte, J.

    1960-01-01

    The honeybee, when irradiated by gamma radiations from a cobalt-60 source can stand a 18000 r dose without any apparent harm. Noticeable harm is observed for 90000 r. while immediate death of 100% of the individuals is obtained with a 200000 r dose. The physiological condition of the honeybee plays an important role in its resistance to gamma radiation. Reprint of a paper published in Annales de l'abeille, IV, 1959, p. 285-290 [fr

  2. Bacterial and archaeal resistance to ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Confalonieri, F; Sommer, S, E-mail: fabrice.confalonieri@u-psud.fr, E-mail: suzanne.sommer@u-psud.fr [University Paris-Sud, CNRS UMR8621, Institut de Genetique et Microbiologie, Batiments 400-409, Universite Paris-Sud, 91405 Orsay (France)

    2011-01-01

    Organisms living in extreme environments must cope with large fluctuations of temperature, high levels of radiation and/or desiccation, conditions that can induce DNA damage ranging from base modifications to DNA double-strand breaks. The bacterium Deinococcus radiodurans is known for its resistance to extremely high doses of ionizing radiation and for its ability to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Recently, extreme ionizing radiation resistance was also generated by directed evolution of an apparently radiation-sensitive bacterial species, Escherichia coli. Radioresistant organisms are not only found among the Eubacteria but also among the Archaea that represent the third kingdom of life. They present a set of particular features that differentiate them from the Eubacteria and eukaryotes. Moreover, Archaea are often isolated from extreme environments where they live under severe conditions of temperature, pressure, pH, salts or toxic compounds that are lethal for the large majority of living organisms. Thus, Archaea offer the opportunity to understand how cells are able to cope with such harsh conditions. Among them, the halophilic archaeon Halobacterium sp and several Pyrococcus or Thermococcus species, such as Thermococcus gammatolerans, were also shown to display high level of radiation resistance. The dispersion, in the phylogenetic tree, of radioresistant prokaryotes suggests that they have independently acquired radioresistance. Different strategies were selected during evolution including several mechanisms of radiation byproduct detoxification and subtle cellular metabolism modifications to help cells recover from radiation-induced injuries, protection of proteins against oxidation, an efficient DNA repair tool box, an original pathway of DNA double-strand break repair, a condensed nucleoid that may prevent the dispersion of the DNA fragments and specific radiation-induced proteins involved in

  3. Design of online testing system of material radiation resistance

    International Nuclear Information System (INIS)

    Wan Junsheng; He Shengping; Gao Xinjun

    2014-01-01

    The capability of radiation resistance is important for some material used in some specifically engineering fields. It is the same principal applied in all existing test system that compares the performance parameter after radiation to evaluate material radiation resistance. A kind of new technique on test system of material radiation resistance is put forward in this paper. Experimentation shows that the online test system for material radiation resistance works well and has an extending application outlook. (authors)

  4. Radiation-resistant beamline components at LAMPF

    International Nuclear Information System (INIS)

    Macek, R.J.; Grisham, D.L.; Lambert, J.e.; Werbeck, R.

    1983-01-01

    A variety of highly radiation-resistant beamline components have been successfully developed at LAMPF primarily for use in the target cells and beam stop area of the intense proton beamline. Design features and operating experience are reviewed for magnets, instrumentation, targets, vacuum seals, vacuum windows, collimators, and beam stops

  5. A stunning resistance to radiations

    International Nuclear Information System (INIS)

    Etien, S.

    2010-01-01

    The Deinococus radiodurans bacteria (DRB) can survive extreme radiation doses as high as 100 times the doses that kill other bacteria. The number of DNA breaking due to irradiation is the same as in other bacteria but DRB benefits from a very efficient DNA repairing system. This system relies on the fact that DRB owns 4 to 10 identical copies of its genome and because of this high number of copies the repair process is very likely to find a no-damaged part of the DNA in one copy to reconstitute the DNA. It appears that this process does not involve specific enzymes but enzymes that are present in any other bacteria. The efficiency of the repairing process relies on two things: first, the circular shape of the genome that avoids the spreading in the cell of the DNA breaks, and secondly, the enzymes are protected from irradiation oxidation by a high concentration in manganese and iron. (A.C.)

  6. Effect of physiological age on radiation resistance of some bacteria that are highly radiation resistant

    International Nuclear Information System (INIS)

    Keller, L.C.; Maxcy, R.B.

    1984-01-01

    Physiological age-dependent variation in radiation resistance was studied for three bacteria that are highly radiation resistant: Micrococcus radiodurans, Micrococcus sp. isolate C-3, and Moraxella sp. isolate 4. Stationary-phase cultures of M. radiodurans and isolate C-3 were much more resistant to gamma radiation than were log-phase cultures. This pattern of relative resistance was reversed for isolate 4. Resistance of isolate 4 to UV light was also greater during log phase, although heat resistance and NaCl tolerance after heat stresses were greater during stationary phase. Radiation-induced injury of isolate 4 compared with injury of Escherichia coli B suggested that the injury process, as well as the lethal process, was affected by growth phase. The hypothesis that growth rate affects radiation resistance was tested, and results were interpreted in light of the probable confounding effect of methods used to alter growth rates of bacteria. These results indicate that dose-response experiments should be designed to measure survival during the most resistant growth phase of the organism under study. The timing is particularly important when extrapolations of survival results might be made to potential irradiation processes for foods. 17 references

  7. Radiation resistant characteristics of optical fibers

    International Nuclear Information System (INIS)

    Nakasuji, Masaaki; Tanaka, Gotaro; Watanabe, Minoru; Kyodo, Tomohisa; Mukunashi, Hiroaki

    1983-01-01

    It is required to develop the optical fibers with good radiation resistivity because the fibers cause the increase of transmission loss due to glass colouring when they are used under the presence of radiation such as γ-ray. Generally, it is known that SI (step index) fibers are more resistive to radiation than GI (graded index) fibers. However, since a wide band can not be obtained with SI fibers, the development of radiation resistive GI optical fibers is desirable. In this report, the production for trial of the GI fibers of fluorine-doped silica core, the examination of radiation effect on their optical transmission loss by exposing them to γ-ray, thermal and fast neutron beams and also of mechanical strength are described. The GI fibers of fluorine-doped silica core show better radiation resistivity than Ge-doped ones. The B- and F-doped GI fibers show small increase of loss due to γ-ray, but large increase of loss due to thermal neutron beam. This is supposed to be caused by the far greater neutron absorption cross-section of boron than that of other elements. Significant increase of loss was not recognized when 14 MeV fast neutrons (8.6 x 10 4 n/cm 2 .s) were applied by 1.8 x 10 9 n/cm 2 . It was found that ETFE-covered fiber cores generated fluorine-containing gas due to γ irradiation, and the strength was remarkably lowered, but the lowering of strength can be prevented by adding titanium-white to the covering material. (Wakatsuki, Y.)

  8. Sustainably Sourced, Thermally Resistant, Radiation Hard Biopolymer

    Science.gov (United States)

    Pugel, Diane

    2011-01-01

    This material represents a breakthrough in the production, manufacturing, and application of thermal protection system (TPS) materials and radiation shielding, as this represents the first effort to develop a non-metallic, non-ceramic, biomaterial-based, sustainable TPS with the capability to also act as radiation shielding. Until now, the standing philosophy for radiation shielding involved carrying the shielding at liftoff or utilizing onboard water sources. This shielding material could be grown onboard and applied as needed prior to different radiation landscapes (commonly seen during missions involving gravitational assists). The material is a bioplastic material. Bioplastics are any combination of a biopolymer and a plasticizer. In this case, the biopolymer is a starch-based material and a commonly accessible plasticizer. Starch molecules are composed of two major polymers: amylase and amylopectin. The biopolymer phenolic compounds are common to the ablative thermal protection system family of materials. With similar constituents come similar chemical ablation processes, with the potential to have comparable, if not better, ablation characteristics. It can also be used as a flame-resistant barrier for commercial applications in buildings, homes, cars, and heater firewall material. The biopolymer is observed to undergo chemical transformations (oxidative and structural degradation) at radiation doses that are 1,000 times the maximum dose of an unmanned mission (10-25 Mrad), indicating that it would be a viable candidate for robust radiation shielding. As a comparison, the total integrated radiation dose for a three-year manned mission to Mars is 0.1 krad, far below the radiation limit at which starch molecules degrade. For electron radiation, the biopolymer starches show minimal deterioration when exposed to energies greater than 180 keV. This flame-resistant, thermal-insulating material is non-hazardous and may be sustainably sourced. It poses no hazardous

  9. Radiation resistance of optical fibers, (10)

    International Nuclear Information System (INIS)

    Tsunoda, Tsunemi; Ara, Katsuyuki; Morimoto, Naoki; Sanada, Kazuo; Inada, Koichi.

    1991-01-01

    Optical fibers have many excellent characteristics such as the light weight of the material, insulation, the noninductivity of electromagnetic interference noise, the wide band of signal transmission, and small loss. Also in the field of atomic energy, the utilization of optical fibers is positively expanded, and the research on the method of application and so on has been advanced. However in optical fibers, there is the problem that color centers are formed at the relatively low level of radiation, and they are colored. Accordingly, for effectively utilizing optical fibers in radiation environment, it is indispensable to improve their radiation resistance. For the purpose of solving this problem, the authors have carried out the basic research on the effect that radiation exerts to optical fibers and the development of the optical fibers having excellent radiation resistance. For the purpose of expanding the range of application of GeO 2 -doped silica core fibers including GI type in radiation regions, the transmission characteristics of the fibers during irradiation were examined by using the Cl content as the parameter. Therefore, the results are reported. The fibers put to the test, the testing method and the results are described. (K.I.)

  10. Some resistance mechanisms to ultraviolet radiation

    International Nuclear Information System (INIS)

    Alcantara D, D.

    2002-12-01

    The cyclical exposure of bacterial cells to the ultraviolet light (UV) it has as consequence an increment in the resistance to the lethal effects of this type of radiation, increment that happens as a result of a selection process of favorable genetic mutations induced by the same UV light. With object to study the reproducibility of the genetic changes and the associate mechanisms to the resistance to UV in the bacteria Escherichia coli, was irradiated cyclically with UV light five different derived cultures of a single clone, being obtained five stumps with different resistance grades. The genetic mapping Hfr revealed that so much the mutation events like of selection that took place during the adaptation to the UV irradiation, happened of random manner, that is to say, each one of the resistant stumps it is the result of the unspecified selection of mutations arisen at random in different genes related with the repair and duplication of the DNA. (Author)

  11. arXiv Radiation resistant LGAD design

    CERN Document Server

    Ferrero, M.; Boscardin, M.; Cartiglia, N.; Dalla Betta, G.F.; Galloway, Z.; Mandurrino, M.; Mazza, S.; Paternoster, G.; Ficorella, F.; Pancheri, L.; Sadrozinski, H-F W.; Sola, V.; Staiano, A.; Seiden, A.; Zhao, Y.

    In this paper, we report on the radiation resistance of 50-micron thick LGAD detectors manufactured at the Fondazione Bruno Kessler employing several different doping combinations of the gain layer. LGAD detectors with gain layer doping of Boron, Boron low-diffusion, Gallium, Carbonated Boron and Carbonated Gallium have been designed and successfully produced. These sensors have been exposed to neutron fluences up to $\\phi_n \\sim 3 \\cdot 10^{16}\\; n/cm^2$ and to proton fluences up to $\\phi_p \\sim 9\\cdot10^{15}\\; p/cm^2$ to test their radiation resistance. The experimental results show that Gallium-doped LGADs are more heavily affected by initial acceptor removal than Boron-doped LGAD, while the presence of Carbon reduces initial acceptor removal both for Gallium and Boron doping. Boron low-diffusion shows a higher radiation resistance than that of standard Boron implant, indicating a dependence of the initial acceptor removal mechanism upon the implant width. This study also demonstrates that proton irradiati...

  12. Extreme Ionizing-Radiation-Resistant Bacterium

    Science.gov (United States)

    Vaishampayan, Parag A.; Venkateswaran, Kasthuri J.; Schwendner, Petra

    2013-01-01

    There is a growing concern that desiccation and extreme radiation-resistant, non-spore-forming microorganisms associated with spacecraft surfaces can withstand space environmental conditions and subsequent proliferation on another solar body. Such forward contamination would jeopardize future life detection or sample return technologies. The prime focus of NASA s planetary protection efforts is the development of strategies for inactivating resistance-bearing micro-organisms. Eradi cation techniques can be designed to target resistance-conferring microbial populations by first identifying and understanding their physiologic and biochemical capabilities that confers its elevated tolerance (as is being studied in Deinococcus phoenicis, as a result of this description). Furthermore, hospitals, food, and government agencies frequently use biological indicators to ensure the efficacy of a wide range of radiation-based sterilization processes. Due to their resistance to a variety of perturbations, the nonspore forming D. phoenicis may be a more appropriate biological indicator than those currently in use. The high flux of cosmic rays during space travel and onto the unshielded surface of Mars poses a significant hazard to the survival of microbial life. Thus, radiation-resistant microorganisms are of particular concern that can survive extreme radiation, desiccation, and low temperatures experienced during space travel. Spore-forming bacteria, a common inhabitant of spacecraft assembly facilities, are known to tolerate these extreme conditions. Since the Viking era, spores have been utilized to assess the degree and level of microbiological contamination on spacecraft and their associated spacecraft assembly facilities. Members of the non-sporeforming bacterial community such as Deinococcus radiodurans can survive acute exposures to ionizing radiation (5 kGy), ultraviolet light (1 kJ/m2), and desiccation (years). These resistive phenotypes of Deinococcus enhance the

  13. High Radiation Resistance IMM Solar Cell

    Science.gov (United States)

    Pan, Noren

    2015-01-01

    Due to high launch costs, weight reduction is a key driver for the development of new solar cell technologies suitable for space applications. This project is developing a unique triple-junction inverted metamorphic multijunction (IMM) technology that enables the manufacture of very lightweight, low-cost InGaAsP-based multijunction solar cells. This IMM technology consists of indium (In) and phosphorous (P) solar cell active materials, which are designed to improve the radiation-resistant properties of the triple-junction solar cell while maintaining high efficiency. The intrinsic radiation hardness of InP materials makes them of great interest for building solar cells suitable for deployment in harsh radiation environments, such as medium Earth orbit and missions to the outer planets. NASA Glenn's recently developed epitaxial lift-off (ELO) process also will be applied to this new structure, which will enable the fabrication of the IMM structure without the substrate.

  14. Predictors of radiation exposure to providers during percutaneous nephrolithotomy

    Science.gov (United States)

    Wenzler, David L.; Abbott, Joel E.; Su, Jeannie J.; Shi, William; Slater, Richard; Miller, Daniel; Siemens, Michelle J.; Sur, Roger L.

    2017-01-01

    Background: Limited studies have reported on radiation risks of increased ionizing radiation exposure to medical personnel in the urologic community. Fluoroscopy is readily used in many urologic surgical procedures. The aim of this study was to determine radiation exposure to all operating room personnel during percutaneous nephrolithotomy (PNL), commonly performed for large renal or complex stones. Materials and Methods: We prospectively collected personnel exposure data for all PNL cases at two academic institutions. This was collected using the Instadose™ dosimeter and reported both continuously and categorically as high and low dose using a 10 mrem dose threshold, the approximate amount of radiation received from one single chest X-ray. Predictors of increased radiation exposure were determined using multivariate analysis. Results: A total of 91 PNL cases in 66 patients were reviewed. Median surgery duration and fluoroscopy time were 142 (38–368) min and 263 (19–1809) sec, respectively. Median attending urologist, urology resident, anesthesia, and nurse radiation exposure per case was 4 (0–111), 4 (0–21), 0 (0–5), and 0 (0–5) mrem, respectively. On univariate analysis, stone area, partial or staghorn calculi, surgery duration, and fluoroscopy time were associated with high attending urologist and resident radiation exposure. Preexisting access that was utilized was negatively associated with resident radiation exposure. However, on multivariate analysis, only fluoroscopy duration remained significant for attending urologist radiation exposure. Conclusion: Increased stone burden, partial or staghorn calculi, surgery and fluoroscopy duration, and absence of preexisting access were associated with high provider radiation exposure. Radiation safety awareness is essential to minimize exposure and to protect the patient and all providers from potential radiation injury. PMID:28216931

  15. Radiation resistance of track etched membranes

    International Nuclear Information System (INIS)

    Buczkowski, M.; Sartowska, B.; Wawszczak, D.; Starosta, W.

    2001-01-01

    Track etched membranes (TEMs) obtained by irradiation of polymer films with heavy ions and subsequent etching of latent tracks can be applied in many fields and among others in biomedicine as well. It is important to know radiation resistance of TEMs because of wide use of radiation sterilization in the case of biomedical devices. Tensile properties of TEMs made of PET and PC films with the thickness of 10 μm after electron irradiation at different doses are known from literature. Nowadays TEMs are being manufactured from thicker (20 μm) PET and PC films as well as polyethylene naphthalate (PEN) films are proposed for TEMs. It seems to be important to get data about radiation resistance of new kinds of TEMs. Samples of polymer films made of PET and PEN with the thickness of 19-25 μm and TEMs made of such materials have been irradiated using 10 MeV electron beam with doses up to 990 kGy. Tensile properties and SEM photographs of the samples after irradiation are given in the paper

  16. Radiation resisting features of pure quartz fiber

    International Nuclear Information System (INIS)

    Fujii, Takashi; Nagasawa, Yoshiya; Hoshi, Hiroshi; Tomon, Ryoichi; Ooki, Yoshimichi; Yahagi, Kichinosuke

    1985-01-01

    The control of the generation of color centers is essential for optical fibers used in radiation environment. Even pure quartz which is the best radiation resisting material is not exceptional also elucidarion of the mechanism of the generation of color center is necessary for the development of optical fiber with higher radiation resisting feature. Previously, it was assumed that color centers are distributed uniformly throughout cores. Determination of the distribution of color centers was attempted. Cores were etched with HF after γ-ray irradiation, and the changes of intensity of ESR signals of NBOHC and E'-center were determined. NBOHC were not found in circumferential part, and concentrated in the central part. In other words the tendency of distribution is diametral. Thus, the distribution of precursor is supposed to be affected by certain external cause and the generation of NBOHC was depressed in circumferential area. The distribution of E'-center of high OH sample showed similar tendency and high in the center. Where as the distribution in low OH sample was uniform. The external cause is supposed to be hydrogen derived from silicone clad and silicone buffer. Two kind of precursor is suspected for the explanation of the difference of the E'-center in high OH sample and low OH sample. (Ishimitsu, A.)

  17. Ultraviolet radiation resistance in Halobacterium salinarium

    International Nuclear Information System (INIS)

    Kristoff, S.R.

    1985-01-01

    An obvious characteristic of wild type H. salinarium is its red pigmentation. A non-pigmented mutant was isolated to test the role of pigmentation in UV radiation resistance. Survival curves of UV-irradiated wild type and mutant cells show that pigmentation does not play a direct role in protecting DNA from UV damage. Pigmentation does play a role, however, in repairing UV damage. UV-irradiated wild type cells show more efficient recovery by photoreactivation with 405 nm light than do UV-irradiated non-pigmented mutants. High internal cation concentrations found in H. salinarium may also be partly responsible for the relative resistance of H. salinarium to UV radiation by causing the DNA to assume a conformation less conducive to the production of pyrimidine dimers. In vitro irradiation of DNA extracted from H. salinarium, dissolved in solutions of different ionic strengths, indicate that pyrimidine dimers may not form as readily in DNA which is in an environment with high salt concentration

  18. Radiation resistance of quartz core fibers, (6)

    International Nuclear Information System (INIS)

    Suzuki, Toshiya; Morisawa, Masaaki; Gozen, Toshikazu; Tanaka, Yukihiro; Shintani, Takeshi; Okamoto, Shin-ichi.

    1988-01-01

    Quatz optical fibers have been used for the communication channels for long distance and large capacity, in addition, their application to the communication system in radiation environment such as nuclear power plants and artificial statellites has been positively examined. In the case of the application to aircrafts and communication satellites, optical fibers are exposed to the temperature variation of wider range than the system on the ground. Particularly, the radiation resistance of optical fibers depends largely on temperature, and at low temperature, the increase of loss is remarkable, therefore, it is important to know the characteristics in low temperature radiation environment. This time, five kinds of the core materials were prepared, and gamma-ray was irradiated at -80degC to evaluate the characteristics of increasing loss and restoration. In this report, based on the results of these evaluation, the wavelength dependence, the effect of impurities in the cores and so on are described. The absorption loss increased remarkably in short wavelength. The increase of loss in high OH fibers became high particularly in the case of low optical power. The effect of Cl was especially conspicuous in the restoration characteristics. Chlorine-free core fibers have the excellent restoration characteristics independent of wavelength and optical power. (K.I.)

  19. Isolation and identification of radiation resistant yeasts from sea water

    International Nuclear Information System (INIS)

    Park, Jong Cheon; Jeong, Yong Uk; Kim, Du Hong; Jo, Eun A

    2011-12-01

    This study was conducted to isolate radiation-resistant yeasts from sea water for development of application technology of radiation-resistant microorganism. · Isolation of 656 yeasts from sea water and selection of 2 radiation-resistant yeasts (D 10 value >3) · Identification of isolated yeasts as Filobasidium elegans sharing 99% sequence similarity · Characterization of isolated yeast with ability to repair of the DNA damage and membrane integrity to irradiation

  20. Accuracy of marketing claims by providers of stereotactic radiation therapy.

    Science.gov (United States)

    Narang, Amol K; Lam, Edwin; Makary, Martin A; Deweese, Theodore L; Pawlik, Timothy M; Pronovost, Peter J; Herman, Joseph M

    2013-01-01

    Direct-to-consumer advertising by industry has been criticized for encouraging overuse of unproven therapies, but advertising by health care providers has not been as carefully scrutinized. Stereotactic radiation therapy is an emerging technology that has sparked controversy regarding the marketing campaigns of some manufacturers. Given that this technology is also being heavily advertised on the Web sites of health care providers, the accuracy of providers' marketing claims should be rigorously evaluated. We reviewed the Web sites of all U.S. hospitals and private practices that provide stereotactic radiation using two leading brands of stereotactic radiosurgery technology. Centers were identified by using data from the manufacturers. Centers without Web sites were excluded. The final study population consisted of 212 centers with online advertisements for stereotactic radiation. Web sites were evaluated for advertisements that were inconsistent with advertising guidelines provided by the American Medical Association. Most centers (76%) had individual pages dedicated to the marketing of their brand of stereotactic technology that frequently contained manufacturer-authored images (50%) or text (55%). Advertising for the treatment of tumors that have not been endorsed by professional societies was present on 66% of Web sites. Centers commonly claimed improved survival (22%), disease control (20%), quality of life (17%), and toxicity (43%) with stereotactic radiation. Although 40% of Web sites championed the center's regional expertise in delivering stereotactic treatments, only 15% of Web sites provided data to support their claims. Provider advertisements for stereotactic radiation were prominent and aggressive. Further investigation of provider advertising, its effects on quality of care, and potential oversight mechanisms is needed.

  1. Radiation resistance of microorganisms on unsterilized infusion sets

    DEFF Research Database (Denmark)

    Christensen, E. Ahrensburg; Kristensen, H.; Hoborn, J.

    1991-01-01

    Three different methods were used for detecting and isolating microorganisms with high radiation resistance from the microbial contamination on infusion sets prior to sterilization. By all three methods, microorganisms with a radiation resistance high enough to be a critical factor in a steriliza......Three different methods were used for detecting and isolating microorganisms with high radiation resistance from the microbial contamination on infusion sets prior to sterilization. By all three methods, microorganisms with a radiation resistance high enough to be a critical factor...

  2. Radiation resistant modified polypropylene; Polipropylen modyfikowany odporny radiacyjnie

    Energy Technology Data Exchange (ETDEWEB)

    Bojarski, J; Zimek, Z [Institute of Nuclear Chemistry and Technology, Warsaw (Poland)

    1997-10-01

    Radiation technology for production of radiation resistant polypropylene for medical use has been presented. The method consists in radiation induced copolymerization of polypropylene with ethylene and addition of small amount of copolymer of polyethylene and vinyl acetate. The material of proposed composition has a very good mechanical properties and elevated radiation resistivity decided on possibility of radiosterilization of products made of this material and designed for medical use. 3 figs, 3 tabs.

  3. Radiation resistance of organic azo dyes in aqueous solutions

    International Nuclear Information System (INIS)

    Khabarov, V.N.; Kozlov, L.L.

    1987-01-01

    The resistance to the action of the ionizing radiation of aqueous and aqueous-alcoholic solutions of organic mono- and diazo dyes was studied. The radiation chemical yield of decolorization of the dye, determined from the kinetic decolorization curves served as a quantitative criterion of the radiation resistance. The influence of pH, addition of ethanol, hydroquinone, thiourea, glucose and oxygen on the radiation resistance of the azo dyes was studied. An attempt was made to relate the efficiency of radiation decolorization to the chemical nature of the dye

  4. Radiation-resistant bacteria and their application to metal and radionuclides bioremediation

    International Nuclear Information System (INIS)

    Wang Jianlong

    2004-01-01

    Microorganisms have a number of applications in the nuclear industry, which would benefit from the use of radiation-resistant microorganisms. Environmentally isolated bacteria have shown to be resistant to gamma irradiation up to a dose of 30,000 Gy. It has also been reported that the presence of ionizing radiation may induce radio-resistance in bacteria. Recent demonstrations of the removal and immobilization of inorganic contaminants by microbial transformations, sorption and mineralization show the potential of both natural and engineered microorganisms as bioremedial tools. This review is to provide an overview of the application of radiation-resistant bacteria to decontamination of metal and radionuclide. (authors)

  5. Isolation of radiation-resistant bacteria without exposure to irradiation

    International Nuclear Information System (INIS)

    Sanders, S.W.; Maxcy, R.B.

    1979-01-01

    Resistance to desiccation was utilized in the selection of highly radiation-resistant asporogenous bacteria from nonirradiated sources. A bacterial suspension in phosphate buffer was dried in a thin film at 25 0 C and 33% relative humidity. Storage under these conditions for 15 days or more reduced the number of radiation-sensitive bacteria. Further selection for radiation-resistant bacteria was obtained by irradiation of bacteria on velveteen in the replication process, therby avoiding the toxic effect of irradiated media. The similarity of radiation resistance and identifying characteristics in irradiated and non-irradiated isolates should allay some concerns that highly radiation-resistance bacteria have been permanently altered by radiation selection

  6. Radiation resistivity of quartz core fiber, 3

    International Nuclear Information System (INIS)

    Gozen, Toshikazu; Suzuki, Toshiya; Hayashi, Tokuji; Tanaka, Hiroyuki; Okamoto, Shinichi.

    1985-01-01

    Radiation resistance characteristics were evaluated for a multi-mode quartz core fiber in low temperature region together with photobleaching effect depending on the incident light power and dependency on the wavelength of measuring rays. This report describes the results of the abovementioned items and the next step study of trial manufacturing of a pure-quartz single-mode fiber for the employment of longer wavelength rays and greater capacity in light transmission communication system. Quartz core fiber specimens were irradiated by 60 Co γ-ray source at -55 deg C to 80 deg C in a constant temperature bath and light transmission loss was determined under irradiation conditions. Low temperature characteristics were superior in an MRT (modified rod-in tube) pure quartz fiber prepared by the plasma method as compared to VAD quartz and Ge-GI fibers. The MRT fiber showed better quality than the Ge-GI fiber also in the photobleaching effect examination. As for the wavelength dependency, light transmission loss of the MRT fiber was less than that of the Ge-GI fiber. The MRT fiber also showed a superior quality in the wide range of irradiation temperatures. Based on the above-mentioned understandings, a pure-quartz single-mode fiber of both BF 3 -doped and F-doped cladding types were developed for longer wavelengths uses. The fibers could attain low light transmission loss of less than 1.0 dB/km at 1.30 μm of wavelength. At the standpoint of radiation resistivity, the BF 3 -doped fiber was found superior. (Takagi, S.)

  7. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  8. Elevated Rate of Genome Rearrangements in Radiation-Resistant Bacteria.

    Science.gov (United States)

    Repar, Jelena; Supek, Fran; Klanjscek, Tin; Warnecke, Tobias; Zahradka, Ksenija; Zahradka, Davor

    2017-04-01

    A number of bacterial, archaeal, and eukaryotic species are known for their resistance to ionizing radiation. One of the challenges these species face is a potent environmental source of DNA double-strand breaks, potential drivers of genome structure evolution. Efficient and accurate DNA double-strand break repair systems have been demonstrated in several unrelated radiation-resistant species and are putative adaptations to the DNA damaging environment. Such adaptations are expected to compensate for the genome-destabilizing effect of environmental DNA damage and may be expected to result in a more conserved gene order in radiation-resistant species. However, here we show that rates of genome rearrangements, measured as loss of gene order conservation with time, are higher in radiation-resistant species in multiple, phylogenetically independent groups of bacteria. Comparison of indicators of selection for genome organization between radiation-resistant and phylogenetically matched, nonresistant species argues against tolerance to disruption of genome structure as a strategy for radiation resistance. Interestingly, an important mechanism affecting genome rearrangements in prokaryotes, the symmetrical inversions around the origin of DNA replication, shapes genome structure of both radiation-resistant and nonresistant species. In conclusion, the opposing effects of environmental DNA damage and DNA repair result in elevated rates of genome rearrangements in radiation-resistant bacteria. Copyright © 2017 Repar et al.

  9. Adriamycin resistance, heat resistance and radiation response in Chinese hamster fibroblasts

    International Nuclear Information System (INIS)

    Wallner, K.; Li, G.

    1985-01-01

    Previous investigators have demonstrated synergistic interaction between hyperthermia and radiation or Adriamycin (ADR), using cell lines that are sensitive to heat or ADR alone. The authors investigated the effect of heat, radiation or ADR on Chinese hamster fibroblasts (HA-1), their heat resistant variants and their ADR resistant variants. Heat for ADR resistance did not confer cross resistance to radiation. Cells resistant to heat did show cross resistance to ADR. While cells selected for ADR resistance were not cross resistant to heat, they did not exhibit drug potentiation by hyperthermia, characteristic of ADR sensitive cells. Cytofluorometric measurement showed decreased ADR uptake in both heat and ADR resistant cells. The possibility of cross resistance between heat and ADR should be considered when designing combined modality trials

  10. Studies on the radiation resistances of bioburden for medical devices

    International Nuclear Information System (INIS)

    Sekiguchi, Masayuki; Tabei, Masae

    1997-01-01

    Radiation resistances of reference bacteria strains and the bioburden obtained from hypodermic needles were estimated with gamma- and electron- irradiators calibrated with NPL (National Physics Laboratory) alanine dosimeter. Radiation resistances of the TSB-bacteria suspension samples dried on glass test tubes showed about two times higher than those of the water-bacteria suspension dried on glass fiber paper or paper filter. Radiation resistances of the dried TSB-bacteria suspension samples irradiated by both gamma rays and electron beams were fluctuated. The overall increase ratio of radiation resistance was estimated by dividing D-values of TSB-bacteria suspension samples by that of water-bacteria suspension samples for individual bacteria. Then, the survival curve of hypodermic needle bioburden revised by the increase ratio was obtained, and which compared with that of standard distribution of radiation resistances of ISO(SDR). (author)

  11. Development of radiation resistant organic composites for cryogenic use

    International Nuclear Information System (INIS)

    Nishijima, S.

    1997-01-01

    The mechanism of the radiation induced degradation of the mechanical properties in composite materials have been studied and based on the mechanism the radiation resistant organic composites for fusion magnet have been developing. It was found that the degradation was brought by the change of the fracture mode from tensile (or flexural) to shear failure. Consequently the intrinsic parameter which control the degradation was concluded to be the interlaminar shear strength. To develop the radiation resistant composites, therefore, means to develop the composites showing the radiation resistant interlaminar shear strength. The mechanism was confirmed using three dimensional fabric reinforced plastics which do not have the interlaminar area. The roles of matrix in the composites were also revealed. The effects of dose quality and irradiated temperature on the radiation induced degradation were also discussed and the selection standards of the components for radiation resistant composites were proposed

  12. Genetic variation in resistance to ionizing radiation

    International Nuclear Information System (INIS)

    Ayala, F.J.

    1991-01-01

    We proposed an investigation of genetically-determined individual differences in sensitivity to ionizing radiation. The model organism is Drosophila melanogaster. The gene coding for Cu,Zn superoxide dismutase (SOD) is the target locus, but the effects of variation in other components of the genome that modulate SOD levels are also taken into account. SOD scavenges oxygen radicals generated during exposure to ionizing radiation. It has been shown to protect against ionizing radiation damage to DNA, viruses, bacteria, mammalian cells, whole mice, and Drosophila. Two alleles, S and F, are commonly found in natural populations of D. melanogaster; in addition we have isolated from a natural population ''null'' (CA1) mutant that yields only 3.5% of normal SOD activity. The S, F, and CA1 alleles provide an ideal model system to investigate SOD-dependent radioresistance, because each allele yields different levels of SOD, so that S > F >> CA1. The roles of SOD level in radioresistance are being investigated in a series of experiments that measure the somatic and germ-line effects of increasing doses of ionizing radiation. In addition, we have pursued an unexpected genetic event-namely the nearly simultaneous transformation of several lines homozygous for the SOD ''null'' allele into predominately S lines. Using specifically designed probes and DNA amplification by means of the Tag polymerase chain reaction (PCR) we have shown that (1) the null allele was still present in the transformed lines, but was being gradually replaced by the S allele as a consequence of natural selection; and (2) that the transformation was due to the spontaneous deletion of a 0.68 Kb truncated P-element, the insertion of which is characteristic of the CA1 null allele

  13. Synthesis and radiation resistance of fullerenes and fullerene derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Shilin, V. A., E-mail: shilin@pnpi.spb.ru; Lebedev, V. T.; Sedov, V. P.; Szhogina, A. A. [St. Petersburg Nuclear Physics Institute, National Research Centre “Kurchatov Institute” (Russian Federation)

    2016-07-15

    The parameters of an electric-arc facility for the synthesis of fullerenes and endohedral metallofullerenes are optimized. The resistance of C{sub 60} and C{sub 70} fullerenes and C{sub 60}(OH){sub 30} and C{sub 70}(OH){sub 30} fullerenols against neutron irradiation is studied. It is established that the radiation resistance of the fullerenes is higher than that of the fullerenols, but the radiation resistance of the Gd@C{sub 2n} endometallofullerenes is lower than that of the corresponding Gd@C{sub 2n}(OH){sub 38} fullerenols. The radiation resistance of mixtures of Me@C{sub 2n}(OH){sub 38} (Me = Gd, Tb, Sc, Fe, and Pr) endometallofullerenes with C{sub 60}(OH){sub 30} is determined. The factors affecting the radiation resistance of the fullerenes and fullerenols are discussed.

  14. Effect of radiation resistance additives for insulation materials

    International Nuclear Information System (INIS)

    Yamamoto, Yasuaki; Yagyu, Hideki; Seguchi, Tadao.

    1988-01-01

    For the electric wires and cables used in radiation environment such as nuclear power stations and fuel reprocessing facilities, the properties of excellent radiation resistance are required. For these insulators and sheath materials, ethylene propylene rubber, polyethylene and other polymers have been used, but it cannot be said that they always have good radiation resistance. However, it has been well known that radiation resistance can be improved with small amount of additives, and heat resistance and burning retarding property as well as radiation resistance are given to the insulators of wires and cables for nuclear facilities by mixing various additives. In this research, the measuring method for quantitatively determining the effect of Anti-rad (radiation resistant additive) was examined. Through the measurement of gel fraction, radical formation and decomposed gas generation, the effect of Anti-rad protecting polymers from radiation deterioration was examined from the viewpoint of chemical reaction. The experimental method and the results are reported. The radiation energy for cutting C-H coupling is polymers is dispersed by Anti-rad, and the probability of cutting is lowered. Anti-rad catches and extinguishes radicals that start oxidation reaction. (K.I.)

  15. Development of radiation-resisting high molecular-weight materials

    International Nuclear Information System (INIS)

    Nakagawa, Tsutomu

    1976-01-01

    The excellent radiation-resisting polyvinyl chloride developed at the opportunity of the research on the relationships between the protection of living body and the polymer-technological protection from radiation is reviewed. The report is divided into four main parts, namely 1) the change in the molecular arrangement of market-available, high molecular-weight materials by gamma-ray irradiation, 2) the protection of high molecular-weight materials from radiation, 3) the relationships between the biological radiation-protective substances and the change to radiation-resisting property of synthesized high molecular-weight substances, and 4) the development of the radiation-resisting high molecular-weight materials as metal-collecting agents. Attention is paid to the polyvinyl chloride having N-methyl-dithio-carbamate radical (PMD), synthesized by the author et. al., that has excellent radiation-resisting property. PMD has some possibility to form thiol- and amino-radicals necessary to protect living things from radiation. It is believed that the protection effects of N-methyl-dithio-carbamate radical are caused by the relatively stable S radical produced by the energy transfer. PMD film is suitable for the irradiation of foods, because it hardly changes the permeability of oxygen and carbon dioxide. PMD produces mercaptide or chelate. A new metal-collecting agent (PSDC) having reactivity with the metallic ions with radiation-resisting property was developed, which is derived from polyvinyl chloride and sodium N-methyl-N-carboxy-methyl-dithio-carbamate. (Iwakiri, K.)

  16. Tumourigenicity and radiation resistance of mesenchymal stem cells

    DEFF Research Database (Denmark)

    D'Andrea, Filippo Peder; Horsman, Michael Robert; Kassem, Moustapha

    2012-01-01

    Background. Cancer stem cells are believed to be more radiation resistant than differentiated tumour cells of the same origin. It is not known, however, whether normal nontransformed adult stem cells share the same radioresistance as their cancerous counterpart. Material and methods....... Nontumourigenic (TERT4) and tumourigenic (TRET20) cell lines, from an immortalised mesenchymal stem cell line, were grown in culture prior to irradiation and gene expression analysis. Radiation resistance was measured using a clonogenic assay. Differences in gene expression between the two cell lines, both under...... the intercellular matrix. These results also indicate that cancer stem cells are more radiation resistant than stem cells of the same origin....

  17. Increased radiation resistance in lithium-counterdoped silicon solar cells

    Science.gov (United States)

    Weinberg, I.; Swartz, C. K.; Mehta, S.

    1984-01-01

    Lithium-counterdoped n(+)p silicon solar cells are found to exhibit significantly increased radiation resistance to 1-MeV electron irradiation when compared to boron-doped n(+)p silicon solar cells. In addition to improved radiation resistance, considerable damage recovery by annealing is observed in the counterdoped cells at T less than or equal to 100 C. Deep level transient spectroscopy measurements are used to identify the defect whose removal results in the low-temperature aneal. It is suggested that the increased radiation resistance of the counterdoped cells is primarily due to interaction of the lithium with interstitial oxygen.

  18. Providing context: antimicrobial resistance from multiple environmental sources

    Science.gov (United States)

    Background: Animal agriculture has been identified as encouraging the spread of resistance due to the use of large quantities of antimicrobials for animal production purposes. When antimicrobial resistance (AMR) is reported in agricultural settings without comparison to other environments there is a...

  19. Effect of radiation decontamination on drug-resistant bacteria

    International Nuclear Information System (INIS)

    Ito, Hitoshi

    2006-01-01

    More than 80% of food poisoning bacteria such as Salmonella are reported as antibiotic-resistant to at least one type antibiotic, and more than 50% as resistant to two or more. For the decontamination of food poisoning bacteria in foods, radiation resistibility on drug-resistant bacteria were investigated compared with drug-sensitive bacteria. Possibility on induction of drug-resistant mutation by radiation treatment was also investigated. For these studies, type strains of Escherichia coli S2, Salmonella enteritidis YK-2 and Staphylococcus aureus H12 were used to induce drug-resistant strains with penicillin G. From the study of radiation sensitivity on the drug-resistant strain induced from E. coli S2, D 10 value was obtained to be 0.20 kGy compared with 0.25 kGy at parent strain. On S. enteritidis YK-2, D 10 value was obtained to be 0.14 kGy at drug-resistant strain compared with 0.16 kGy at parent strain. D 10 value was also obtained to be 0.15 kGy at drug-resistant strain compared with 0.21 kGy at parent strain of St. aureus H12. Many isolates of E. coli 157:H7 or other type of E. coli from meats such as beef were resistant to penicillin G, and looked to be no relationship on radiation resistivities between drug-resistant strains and sensitive strains. On the study of radiation sensitivity on E. coli S2 at plate agars containing antibiotics, higher survival fractions were obtained at higher doses compared with normal plate agar. The reason of higher survival fractions at higher doses on plate agar containing antibiotics should be recovery of high rate of injured cells by the relay of cell division, and drug-resistant strains by mutation are hardly induced by irradiation. (author)

  20. Radiation resistance and injury of Yersinia enterocolitica

    Energy Technology Data Exchange (ETDEWEB)

    El-Zawahry, Y.A.; Rowley, D.B.

    1979-01-01

    The D values of Yersinia enterocolitica strains IP134, IP107, and WA, irradiated at 25/sup 0/C in Trypticase soy broth, ranged from 9.7 to 11.8 krad. When irradiated in ground beef at 25 and -30/sup 0/C, the D value of strain IP107 and 19.5 and 38.8 krad, respectively. Cells suspended in Trypticase soy broth were more sensitive to storage at -20/sup 0/C than those mixed in ground beef. The percentages of inactivation and of injury (inability to form colonies in the presence of 3.0% NaCl) of cells stored in ground beef for 10 days at -20/sup 0/C were 70 and 23%, respectively. Prior irradiation did not alter the cell's sensitivity to storage at -20/sup 0/C, nor did storage at -20/sup 0/C alter the cell's resistance to irradiation at 25/sup 0/C. Added NaCl concentrations of up to 4.0% in Trypticase soy agar (TSA) (which contains 0.5% NaCl) had little effect on colony formation at 36/sup 0/C of unirradiated Y. enterocolitica. With added 4.0% NaCl, 79% of the cells formed colonies at 36/sup 0/C; with 5.0% NaCl added, no colonies were formed. Although 2.5% NaCl added to ground beef did not sensitize Y. enterocolitica cells to irradiation, when added to TSA it reduced the number of apparent radiation survivors. Cells uninjured by irradiation formed colonies on TSA when incubated at either 36 or 5/sup 0/C. More survivors of an exposure to 60 krad were capable of recovery and forming colonies on TSA when incubated at 36/sup 0/C for 1 day than at 5/sup 0/C for 14 days. This difference in count was considered a manifestation of injury to certain survivors of irradiation.

  1. Radiation resistance and injury of Yersinia enterocolitica

    International Nuclear Information System (INIS)

    El-Zawahry, Y.A.; Rowley, D.B.

    1979-01-01

    The D values of Yersinia enterocolitica strains IP134, IP107, and WA, irradiated at 25 0 C in Trypticase soy broth, ranged from 9.7 to 11.8 krad. When irradiated in ground beef at 25 and -30 0 C, the D value of strain IP107 and 19.5 and 38.8 krad, respectively. Cells suspended in Trypticase soy broth were more sensitive to storage at -20 0 C than those mixed in ground beef. The percentages of inactivation and of injury (inability to form colonies in the presence of 3.0% NaCl) of cells stored in ground beef for 10 days at -20 0 C were 70 and 23%, respectively. Prior irradiation did not alter the cell's sensitivity to storage at -20 0 C, nor did storage at -20 0 C alter the cell's resistance to irradiation at 25 0 C. Added NaCl concentrations of up to 4.0% in Trypticase soy agar (TSA) (which contains 0.5% NaCl) had little effect on colony formation at 36 0 C of unirradiated Y. enterocolitica. With added 4.0% NaCl, 79% of the cells formed colonies at 36 0 C; with 5.0% NaCl added, no colonies were formed. Although 2.5% NaCl added to ground beef did not sensitize Y. enterocolitica cells to irradiation, when added to TSA it reduced the number of apparent radiation survivors. Cells uninjured by irradiation formed colonies on TSA when incubated at either 36 or 5 0 C. More survivors of an exposure to 60 krad were capable of recovery and forming colonies on TSA when incubated at 36 0 C for 1 day than at 5 0 C for 14 days. This difference in count was considered a manifestation of injury to certain survivors of irradiation

  2. Elevated Rate of Genome Rearrangements in Radiation-Resistant Bacteria

    OpenAIRE

    Repar, Jelena; Supek, Fran; Klanjscek, Tin; Warnecke, Tobias; Zahradka, Ksenija; Zahradka, Davor

    2017-01-01

    A number of bacterial, archaeal, and eukaryotic species are known for their resistance to ionizing radiation. One of the challenges these species face is a potent environmental source of DNA double-strand breaks, potential drivers of genome structure evolution. Efficient and accurate DNA double-strand break repair systems have been demonstrated in several unrelated radiation-resistant species and are putative adaptations to the DNA damaging environment. Such adaptations are expected to compen...

  3. Gene Expression Analysis of Four Radiation-resistant Bacteria

    OpenAIRE

    Gao, Na; Ma, Bin-Guang; Zhang, Yu-Sheng; Song, Qin; Chen, Ling-Ling; Zhang, Hong-Yu

    2009-01-01

    To investigate the general radiation-resistant mechanisms of bacteria, bioinformatic method was employed to predict highly expressed genes for four radiation-resistant bacteria, i.e. Deinococcus geothermalis (D. geo), Deinococcus radiodurans (D. rad), Kineococcus radiotolerans (K. rad) and Rubrobacter xylanophilus (R. xyl). It is revealed that most of the three reference gene sets, i.e. ribosomal proteins, transcription factors and major chaperones, are generally highly expressed in the four ...

  4. Basic design of radiation-resistant LVDTs: Linear Variable Differential Transformer

    Energy Technology Data Exchange (ETDEWEB)

    Sohn, J. M.; Park, S. J.; Kang, Y. H. (and others)

    2008-02-15

    A LVDT(Linear Variable Differential Transformer) for measuring the pressure level was used to measure the pressure of a nuclear fuel rod during the neutron irradiation test in a research reactor. A LVDT for measuring the elongation was also used to measure the elongation of nuclear fuels, and the creep and fatigue of materials during a neutron irradiation test in a research reactor. In this report, the basic design of two radiation-resistant LVDTs for measuring the pressure level and elongation are described. These LVDTs are used a under radiation environment such as a research reactor. In the basic design step, we analyzed the domestic and foreign technical status for radiation-resistant LVDTs, made part and assembly drawings and established simple procedures for their assembling. Only a few companies in the world can produce radiation-resistant LVDTs. Not only these are extremely expensive, but the prices are continuously rising. Also, it takes a long time to procure a LVDT, as it can only be bought about by an order-production. The localization of radiation-resistant LVDTs is necessary in order to provide them quickly and at a low cost. These radiation-resistant LVDTs will be used at neutron irradiation devices such as instrumented fuel capsules, special purpose capsules and a fuel test loop in research reactors. We expect that the use of neutron irradiation tests will be revitalized by the localization of radiation-resistant LVDTs.

  5. Apparatus for sensing radiation and providing electrical readout

    International Nuclear Information System (INIS)

    Eichelberger, C.W.; Engeler, W.E.; Tiemann, J.J.

    1975-01-01

    An array of radiation sensing devices each including a pair of closely coupled conductor-insulator-semiconductor cells, one a row line connected cell and the other a column line connected cell, is provided on a common semiconductor substrate connected to ground. Read out of a device is accomplished by reducing the voltage on the row line of the device to cause stored charge to flow to the column connected cell of the device and thereafter reducing the voltage on the column line of the device to inject the charge stored therein into the substrate. Circuit means is provided in series relationship with the addressed column line to integrate the current flow in the column line due to the injected charge. In another embodiment the column conductor lines are arranged in a plurality of consecutively numbered sets, each set including the same number of consecutively numbered column lines. A plurality of charge integrating means are provided each connected between a respective column line of a set and ground for simultaneous read out of charges through the column lines of a set. Switch means are provided for connecting each set of column lines in turn for read out. A plurality of video signals equal in number to the number of sets are obtained. The video signals may be multiplexed to obtain a composite video signal. (auth)

  6. Development of flame retardant, radiation resistant insulating materials

    Energy Technology Data Exchange (ETDEWEB)

    Hagiwara, M.

    1984-01-01

    On the cables used for nuclear power stations, in particular those ranked as IE class, flame retardation test, simulated LOCA environment test, radiation resistance test and so on are imposed. The results of the evaluation of performance by these tests largely depend on the insulating materials mainly made of polymers. Ethylene propylene copolymer rubber has been widely used as cable insulator because of its electrical characteristics, workability, economy and relatively good radiation resistance, but it is combustible, therefore, in the practical use, it is necessary to make it fire resistant. The author et al. have advanced the research on the molecular design of new fire retarding materials, and successfully developed acenaphthylene bromide condensate, which is not only fire resistant but also effective for improving radiation resistance. The condition of flame retardant, radiation resistant auxiliary agents is explained, and there are additive type and reaction type in fire retarding materials. The synthesis of acenaphthylene bromide condensate and its effect of giving flame retardant and radiation resistant properties are reported. The characteristics of the cables insulated with the flame retardant ethylene propylene rubber containing acenaphthylene bromide condensate were tested, and the results are shown. (Kako, I.).

  7. Trial manufacture of flame retardant and radiation resistant cables

    Energy Technology Data Exchange (ETDEWEB)

    Oshima, Yunosuke; Hagiwara, Miyuki (Japan Atomic Energy Research Inst., Takasaki, Gunma. Takasaki Radiation Chemistry Research Establishment); Oda, Eisuke

    1983-04-01

    High radiation resistance as well as incombustibility is required for the wires and cables used for nuclear facilities such as nuclear power stations. In order to give such performance to general purpose insulation materials such as ethylene-propylene copolymerized rubber, acenaphthylene bromide condensation product was developed anew. Moreover, by the use of this agent, the new flame retardant and radiation resistant cables were manufactured for trial, which are not different from ordinary plastic rubber cables in the handling such as flexibility, and withstand the radiation nearly up to 1000 Mrad. The requirement for the agent giving flame retardant and radiation resistant properties is explained. The synthesis of acenaphthylene bromide and its condensation product and the effect of giving flame retardant and radiation resistant properties are described. The test resultd of the prevention of spread of flame, the endurance in LOCA-simulating environment, and radiation resistance for the cables manufactured for trial are reported. It was confirmed that the cables of this type are suitable to the use in which the maintenance of mechanical properties after radiation exposure is required.

  8. Oncogenes and radiation resistance - a review

    International Nuclear Information System (INIS)

    Dritschilo, A.

    1992-01-01

    Oncogenes exert their effects on the genetic programs of cells by regulating signal transduction pathways, resulting in multi-factorial genetic responses. By such actions, the genetic elements responsible for the cellular responses to ionizing radiation may be affected. Reports implicating the association of oncogene expression with modulation of the radiation response include the ras, raf, and myc genes. Experiments overexpressing H-ras and c-raf-1 using genetically engineered constructs result in enhanced post-radiation cellular survival. Conversely, inhibition of raf gene expression has resulted in relative radiation sensitization and delay of human squamous cell carcinoma tumor growth in nude mice. There appears to be a potential strategy for therapeutic intervention. The identification of genes that confer survival advantage following radiation exposure, and understanding their mechanisms of action, may permit a genetically based intervention for radiation sensitization. One such approach employs oligo-deoxynucleotides complementary to oncogene-encoded in RNA's (antisense DNA). (author)

  9. Radiation resistant passivation of silicon solar cells

    International Nuclear Information System (INIS)

    Swanson, R.M.; Gan, J.Y.; Gruenbaum, P.E.

    1991-01-01

    This patent describes a silicon solar cell having improved stability when exposed to concentrated solar radiation. It comprises a body of silicon material having a major surface for receiving radiation, a plurality of p and n conductivity regions in the body for collecting electrons and holes created by impinging radiation, and a passivation layer on the major surface including a first layer of silicon oxide in contact with the body and a polycrystalline silicon layer on the first layer of silicon oxide

  10. Apparatus for sensing radiation and providing electrical read out

    International Nuclear Information System (INIS)

    Michon, G.J.; Burke, H.K.

    1975-01-01

    In an array of radiation sensing devices each including a pair of closely coupled conductor-insulator-semiconductor cells on a common substrate, each of the devices is addressed in sequence for read out. Read out of a device is accomplished by reducing the amplitudes of the voltages on the cells of the device in sequence to inject charge stored in the cells into the substrate and by sensing such injected charge. The device is reset for the next cycle of operation by reestablishing voltages in sequence on the cells. Means are provided in the bulk of the substrate to collect injected charge to avoid recollection by the cells of the device of such charge which has not had sufficient time to recombine or diffuse in the substrate away from the vicinity of the cells. (auth)

  11. Resistance to BN myelogenous leukemia in rat radiation chimeras

    International Nuclear Information System (INIS)

    Singer, D.E.; Haynor, D.R.; Williams, R.M

    1980-01-01

    Lewis → LBNFl rat radiation chimeras showed marked resistance to transplanted BN myelogenous leukemia when compared to naive LBNFl, LBNFl → LBNFl, or BN → LBNFl. This occurred in the absence of overt graft versus host disease or of anti-BN response in mixed lymphocyte culture. Bone marrow specific antigens may serve as the target of the resistance mechanism. (author)

  12. Providing Radiation Protection Experts in the United Kingdom

    International Nuclear Information System (INIS)

    Partington, C.; Owen, D.

    2004-01-01

    The EEC Directive on Qualified Experts in Radiation Protection has been implemented in the United Kingdom by the Ionising Radiations Regulations 1999 (IRR99). These Regulations require Radiation Employers to appoint suitable Radiation Protection Advisers (RPA) who must be consulted in certain circumstances when starting work with, or using ionising radiations. Radiation Protection Advisers have to have a current certificate of competence and, to gain one of these, must have demonstrated their competence in one of two ways either by achieving a National Vocational Qualification in Radiation Protection Practice or by being Certificated by an Assessing Body. Assessing Bodies have to be recognised by the Health and Safety Executive, who undertake a rigorous assessment process to determine whether the proposed Assessing Body is fit to undertake RPA Assessments. By July 2003, only two such Assessing Bodies had been approved in the UK. These two Assessing Bodies are ? RPA 2000 a company established by the four leading Radiation Protection Professional Societies in the UK for assessing anyone in the UK as Radiation Protection Advisers, And ? BNFL established by BNFL to assess the competence of BNFL's own Radiation Protection Advisers. This paper will describe the standards against which Radiation Protection Advisers are assessed, the manner in which each of these two Assessing Bodies carry out the assessment process and their experience to date. The way in which Radiation Employers carry out the appointment process will also be described. Potential future developments of the Assessment Process and standards will also be discussed. (Author)

  13. Utilization of SRNL-developed radiation-resistant polymer in high radiation environments

    Energy Technology Data Exchange (ETDEWEB)

    Skibo, A. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2017-09-27

    The radiation-resistant polymer developed by the Savannah River National Laboratory is adaptable for multiple applications to enhance polymer endurance and effectiveness in radiation environments. SRNL offers to collaborate with TEPCO in evaluation, testing, and utilization of SRNL’s radiation-resistant polymer in the D&D of the Fukushima Daiichi NPS. Refinement of the scope and associated costs will be conducted in consultation with TECPO.

  14. Radiation resistance of a hemolytic micrococcus isolated from chicken meat

    International Nuclear Information System (INIS)

    Tan, S.T.

    1982-01-01

    The effects of environmental factors on a highly radiation-resistant hemolytic micrococcus isolated from chicken meat were studied. NaCl tolerance and gamma radiation resistance of the cells were growth phase-related. The cells were resistant to injury from drying or freezing/thawing. Under certain conditions, cells in the frozen state required approximately 5 Mrad to inactivate 90% of the population; 0.2 Mrad injured an equivalent proportion. Survival curve of the cells heated at 60 0 C showed a unique pattern which was in three distinct phases. Heat-stressed cells were much more sensitive to radiation inactivation than unheated cells. When suspended in fresh m-Plate Count Broth (PCB), the injured cells repaired without multiplication during incubation at 32 0 C. The repair process in this bacterium, however, was slower compared to thermally injured organisms studied by other workers. An improved replica-plating technique, was devised for isolation of radiation-sensitive mutants of pigmented bacteria. A simple method to demonstrate radiation-inducible radiation resistance in microbial cells was developed. The new method required neither washing/centrifugation nor procedures for cell enumeration. Mutagenesis treatment of radiation-resistant micrococcal bacterium with N-methyl-N'-nitro-N-nitrosoguanidine (NTG) followed by FPR and screening steps resulted in isolation of two radiation-sensitive mutants. The more sensitive mutant strain, designated as 702, was seven times as sensitive to gamma or UC radiation as the wild type. No apparent difference was observed between 702 and the wild type in (1) cell morphology, colonial morphology, and pigment production or (2) tolerance to NaCl, drying/storage, freezing/thawing, and heating. Sodium dodecyl sulfate treatment (for curing) of wild type did not result in isolation of a radiation-sensitive mutant

  15. Radiation-resistant composite for biological shield of personnel

    Science.gov (United States)

    Barabash, D. E.; Barabash, A. D.; Potapov, Yu B.; Panfilov, D. V.; Perekalskiy, O. E.

    2017-10-01

    This article presents the results of theoretical and practical justification for the use of polymer concrete based on nonisocyanate polyurethanes in biological shield structures. We have identified the impact of ratio: polymer - radiation-resistant filling compound on the durability and protection properties of polymer concrete. The article expounds regression dependence of the change of basic properties of the aforementioned polymer concrete on the absorbed radiation dose rate. Synergy effect in attenuation of radioactivity release in case of conjoint use of hydrogenous polymer base and radiation-resistant powder is also addressed herein.

  16. A Novel Radiation-Resistant Yeast, Filobasidium elegans RRY1

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Harinder; Kim, Ha Ram; Song, Hyun Pa; Lim, Sang Yong; Kim, Dong Ho [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)

    2012-05-15

    The tolerance to ionizing radiation stress is present among different classes and species of organisms. As listed by Rainey et al., ionizing radiation resistant organisms were isolated from a variety of different sources like processed/canned food items, paper industry, soil and water samples. Apart from extensively reported bacteria and Archea group, many fungal species like Aspergillus, Curvularia, Alternaria, Cryptococcus, and Ustilago maydis have been found to be resistant to ionizing radiation. However, different environmental sources are constantly been explored for novel radioresistant organisms, which can help in understanding the molecular mechanism behind these extreme stress responses. On the basis of this, present study was initiated to find novel radiation resistant yeast from sea water source

  17. Predictors of radiation exposure to providers during percutaneous nephrolithotomy

    OpenAIRE

    David L Wenzler; Joel E Abbott; Jeannie J Su; William Shi; Richard Slater; Daniel Miller; Michelle J Siemens; Roger L Sur

    2017-01-01

    Background: Limited studies have reported on radiation risks of increased ionizing radiation exposure to medical personnel in the urologic community. Fluoroscopy is readily used in many urologic surgical procedures. The aim of this study was to determine radiation exposure to all operating room personnel during percutaneous nephrolithotomy (PNL), commonly performed for large renal or complex stones. Materials and Methods: We prospectively collected personnel exposure data for all PNL cases at...

  18. Diversity of ionizing radiation-resistant bacteria obtained from the Taklimakan Desert.

    Science.gov (United States)

    Yu, Li Zhi-Han; Luo, Xue-Song; Liu, Ming; Huang, Qiaoyun

    2015-01-01

    So far, little is known about the diversity of the radiation-resistant microbes of the hyperarid Taklimakan Desert. In this study, ionizing radiation (IR)-resistant bacteria from two sites in Xinjiang were investigated. After exposing the arid (water content of 0.8 ± 0.3%) and non-arid (water content of 21.3 ± 0.9%) sediment samples to IR of 3000 Gy using a (60)Co source, a total of 52 γ-radiation-resistant bacteria were isolated from the desert sample. The 16S rRNA genes of all isolates were sequenced. The phylogenetic tree places these isolates into five groups: Cytophaga-Flavobacterium-Bacteroides, Proteobacteria, Deinococcus-Thermus, Firmicutes, and Actinobacteria. Interestingly, this is the first report of radiation-resistant bacteria belonging to the genera Knoellia, Lysobacter, Nocardioides, Paracoccus, Pontibacter, Rufibacter and Microvirga. The 16s rRNA genes of four isolates showed low sequence similarities to those of the published species. Phenotypic analysis showed that all bacteria in this study are able to produce catalase, suggesting that these bacteria possess reactive oxygen species (ROS)-scavenging enzymes. These radiation-resistant bacteria also displayed diverse metabolic properties. Moreover, their radiation resistances were found to differ. The diversity of the radiation-resistant bacteria in the desert provides further ecological support for the hypothesis that the ionizing-radiation resistance phenotype is a consequence of the evolution of ROS-scavenging systems that protect cells against oxidative damage caused by desiccation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Radiation resistant polymers and coatings for nuclear fuel reprocessing plants

    International Nuclear Information System (INIS)

    Kamachi Mudali, U.; Mallika, C.; Lawrence, Falix

    2014-01-01

    Polymer based materials are extensively used in the nuclear industry for the reprocessing of spent fuels in highly radioactive and corrosive environment. Hence, these polymer materials are susceptible to damage by ionizing radiation, resulting in the degradation in properties. Polymers containing aromatic molecules generally possess higher resistance to radiation degradation than the aliphatic polymers. For improving the radiation resistance of polymers various methods are reported in the literature. Among the aromatic polymers, polyetheretherketone (PEEK) has the radiation tolerance up to 10 Mega Grey (MGy). To explore the possibility of enhancing the radiation resistance of PEEK, a study was initiated to develop PEEK - ceramic composites and evaluate the effect of radiation on the properties of the composites. PEEK and PEEK - alumina (micron size) composites were irradiated in a gamma chamber using 60 Co source and the degradation in mechanical, structural, electrical and thermal properties, gel fraction, coefficient of friction and morphology were investigated. The degradation in the mechanical properties owing to radiation could be reduced by adding alumina filler to PEEK. Nano alumina filler was observed to be more effective in suppressing the damage caused by radiation on the polymer, when compared to micron alumina filler. For the protection of aluminium components in the manipulators and the rotors and stators of the motors of the centrifugal extractors employed in the plant from the attack by nitric acid vapour, PEEK coating based on liquid dispersion was developed, which has resistance to radiation, chemicals and wear. The effect of radiation and chemical vapour on the properties of the PEEK coating was estimated. The performance of the coating in the plant was evaluated and the coating was found to give adequate protection to the motors of centrifugal extractors against corrosion. (author)

  20. Research progress and application prospect of radiation-resistant prokaryotic microbe

    International Nuclear Information System (INIS)

    Wang Wei; Zhu Jing; Zhang Zhidong; Tang Qiyong; Chen Ming

    2013-01-01

    Radiation-resistant microbe is becoming the research hotspot because of its special life phenomenon and physiological mechanism. Radiation-resistant bacteria are one kind of the most studied radiation-resistant microbe. This article summarized some aspects of the research on radiation-resistant bacteria, including the radiation resistant bacteria resources, and discussed its potential application prospects in the environmental engineering, biotechnology, human health, military and space et al. (authors)

  1. Enhanced methanol production in plants provides broad spectrum insect resistance.

    Directory of Open Access Journals (Sweden)

    Sameer Dixit

    Full Text Available Plants naturally emit methanol as volatile organic compound. Methanol is toxic to insect pests; but the quantity produced by most of the plants is not enough to protect them against invading insect pests. In the present study, we demonstrated that the over-expression of pectin methylesterase, derived from Arabidopsis thaliana and Aspergillus niger, in transgenic tobacco plants enhances methanol production and resistance to polyphagous insect pests. Methanol content in the leaves of transgenic plants was measured using proton nuclear spectroscopy (1H NMR and spectra showed up to 16 fold higher methanol as compared to control wild type (WT plants. A maximum of 100 and 85% mortality in chewing insects Helicoverpa armigera and Spodoptera litura larvae was observed, respectively when fed on transgenic plants leaves. The surviving larvae showed less feeding, severe growth retardation and could not develop into pupae. In-planta bioassay on transgenic lines showed up to 99 and 75% reduction in the population multiplication of plant sap sucking pests Myzus persicae (aphid and Bemisia tabaci (whitefly, respectively. Most of the phenotypic characters of transgenic plants were similar to WT plants. Confocal microscopy showed no deformities in cellular integrity, structure and density of stomata and trichomes of transgenic plants compared to WT. Pollen germination and tube formation was also not affected in transgenic plants. Cell wall enzyme transcript levels were comparable with WT. This study demonstrated for the first time that methanol emission can be utilized for imparting broad range insect resistance in plants.

  2. Enhanced Methanol Production in Plants Provides Broad Spectrum Insect Resistance

    Science.gov (United States)

    Dixit, Sameer; Upadhyay, Santosh Kumar; Singh, Harpal; Sidhu, Om Prakash; Verma, Praveen Chandra; K, Chandrashekar

    2013-01-01

    Plants naturally emit methanol as volatile organic compound. Methanol is toxic to insect pests; but the quantity produced by most of the plants is not enough to protect them against invading insect pests. In the present study, we demonstrated that the over-expression of pectin methylesterase, derived from Arabidopsis thaliana and Aspergillus niger, in transgenic tobacco plants enhances methanol production and resistance to polyphagous insect pests. Methanol content in the leaves of transgenic plants was measured using proton nuclear spectroscopy (1H NMR) and spectra showed up to 16 fold higher methanol as compared to control wild type (WT) plants. A maximum of 100 and 85% mortality in chewing insects Helicoverpa armigera and Spodoptera litura larvae was observed, respectively when fed on transgenic plants leaves. The surviving larvae showed less feeding, severe growth retardation and could not develop into pupae. In-planta bioassay on transgenic lines showed up to 99 and 75% reduction in the population multiplication of plant sap sucking pests Myzus persicae (aphid) and Bemisia tabaci (whitefly), respectively. Most of the phenotypic characters of transgenic plants were similar to WT plants. Confocal microscopy showed no deformities in cellular integrity, structure and density of stomata and trichomes of transgenic plants compared to WT. Pollen germination and tube formation was also not affected in transgenic plants. Cell wall enzyme transcript levels were comparable with WT. This study demonstrated for the first time that methanol emission can be utilized for imparting broad range insect resistance in plants. PMID:24223989

  3. Tamper and radiation resistant instrumentation for safeguarding special nuclear materials

    International Nuclear Information System (INIS)

    Parsons, B.B.; Wells, J.L.

    1977-01-01

    A tamper-resistant liquid level/accountability instrumentation system for safeguards use has been developed and tested. The tests demonstrate the accuracy of liquid level measurement using TDR (Time Domain Reflectometry) techniques and the accuracy of differential pressure and temperature measurements utilizing a custom designed liquid level sensor probe. The calibrated liquid level, differential pressure, and temperature data provide sufficient information to accurately determine volume, density, and specific gravity. Test solutions used include ordinary tap water, diluted nitric acid in varying concentrations, and diluted uranium trioxide also in varying concentrations. System operations and preliminary test results conducted at the General Electric Midwest Fuel Recovery Plant and the National Bureau of Standards, respectively, suggest that the system will provide the safeguards inspector with an additional tool for real-time independent verification of normal operations and special nuclear materials accountancy data for chemical reprocessing plants. This paper discusses the system design concepts, including a brief description of the tamper and radiation resistant features, the preliminary test results, and the significance of the work

  4. Radiation curable resistant coatings and their preparation

    International Nuclear Information System (INIS)

    Brack, K.

    1976-01-01

    A prepolymer containing unsaturated hydrocarbon groups is prepared and mixed on a roller mill with one or more acrylic ester monomers and various additives to make a coating formulation of a desired viscosity. In general, low viscosity formulations are used for overprint varnishes, on paper or foil, or with pigments, for certain types of printing inks. Higher viscosity formulations are used to apply thick films on panels, tiles, or other bodies. Thin films are cured to hardness by brief exposure to ultraviolet light. Thicker films require more energetic radiation such as plasma arc and electron beam radiation. The prepolymers particularly useful for making such radiation curable coatings are the reaction products of polyether polyols and bis- or polyisocyanates and hydroxy alkenes or acrylic (or methacrylic) hydroxy esters, and, likewise, reactive polyamides modified with dicarboxy alkenes, their anhydrides or esters. A small amount of wax incorporated in the coating formulations results in coatings with release characteristics similar to those of PTFE coatings. 10 claims

  5. Insulating materials resistance in intense radiation beams

    International Nuclear Information System (INIS)

    Oproiu, Constantin; Martin, Diana; Scarlat, Florin; Timus, Dan; Brasoveanu, Mirela; Nemtanu, Monica

    2002-01-01

    The paper emphasizes the main changes of the mechanical and electrical properties of some organic insulating materials exposed to accelerated electron beams. These materials are liable to be used in nuclear plants and particle accelerators. The principal mechanical and electrical properties analyzed were: tensile strength, fracture strength, tearing on fracture, dielectric strength, electrical resistivity, dielectric constant and tangent angle of dielectric losses. (authors)

  6. Radiation-resistant micro-organisms isolated from textiles

    International Nuclear Information System (INIS)

    Kristensen, H.; Christensen, E.A.

    1981-01-01

    Towels from private homes and public offices and underwear contaminated by being used by employees at a public health laboratory were examined for occurrence of radiation-resistant bacteria and fungi. Three different methods were used for isolation of the most resistant organisms, one with multiplication of the microbial population prior to an irradiation used for selection, and two witout this multiplication and with the organisms placed on membrane filters or in situ on the textiles, respectively. A total of 44 different strains were isolated. Differences in the three methods used for selection of the most radiation-resistant microorganisms were not reflected in the results. 16 pigmentproducing Gram-positive cocci, tentatively classified as Micrococcus radiodurans, were the most radiation-resistant and were isolated in about half of the examinations. Other Gram-positive cocci, nonspore forming rods, some Nocardia and Candida parapsilosis strains and two Bacillus strains constituted the rest of the collection. With few exceptions dose-response curves for the strains were upward convex. D-6 values determined to be between 1.5 megarad for the most radiation sensitive, a Candida, and 5.7 megarad for the most resistant, tentatively classified as M. radiodurans. The D-6 values for the Bacillus strains were in both cases 1.8 megarad, consistent with a D-value of 0.3 megarad. The same resistance is reported to be the maximum resistance for B. pumilus, strain E601, commonly used as reference strain in the literature on radiation sterilization of medical devices and supplies. (author)

  7. Radiation-resistant micro-organisms isolated from textiles

    Energy Technology Data Exchange (ETDEWEB)

    Kristensen, H; Christensen, E A [Statens Seruminstitut, Copenhagen (Denmark)

    1981-01-01

    Towels from private homes and public offices and underwear contaminated by being used by employees at a public health laboratory were examined for occurrence of radiation-resistant bacteria and fungi. Three different methods were used for isolation of the most resistant organisms, one with multiplication of the microbial population prior to an irradiation used for selection, and two witout this multiplication and with the organisms placed on membrane filters or in situ on the textiles, respectively. A total of 44 different strains were isolated. Differences in the three methods used for selection of the most radiation-resistant microorganisms were not reflected in the results. 16 pigmentproducing Gram-positive cocci, tentatively classified as Micrococcus radiodurans, were the most radiation-resistant and were isolated in about half of the examinations. Other Gram-positive cocci, nonspore forming rods, some Nocardia and Candida parapsilosis strains and two Bacillus strains constituted the rest of the collection. With few exceptions dose-response curves for the strains were upward convex. D-6 values determined to be between 1.5 megarad for the most radiation sensitive, a Candida, and 5.7 megarad for the most resistant, tentatively classified as M. radiodurans. The D-6 values for the Bacillus strains were in both cases 1.8 megarad, consistent with a D-value of 0.3 megarad. The same resistance is reported to be the maximum resistance for B. pumilus, strain E601, commonly used as reference strain in the literature on radiation sterilization of medical devices and supplies.

  8. Metal-nanotube composites as radiation resistant materials

    Energy Technology Data Exchange (ETDEWEB)

    González, Rafael I.; Valencia, Felipe; Mella, José; Kiwi, Miguel, E-mail: m.kiwi.t@gmail.com [Departamento de Física, Facultad de Ciencias, CEDENNA, Universidad de Chile, Casilla 653, Santiago 7800024 (Chile); Duin, Adri C. T. van [Department of Mechanical and Nuclear Engineering, The Pennsylvania State University, University Park, Pennsylvania 16802 (United States); So, Kang Pyo; Li, Ju [Department of Nuclear Science and Engineering and Department of Materials Science and Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States); Bringa, Eduardo M. [CONICET and Facultad de Ciencias Exactas y Naturales, Universidad Nacional de Cuyo, Mendoza 5500 (Argentina)

    2016-07-18

    The improvement of radiation resistance in nanocomposite materials is investigated by means of classical reactive molecular dynamics simulations. In particular, we study the influence of carbon nanotubes (CNTs) in an Ni matrix on the trapping and possible outgassing of He. When CNTs are defect-free, He atoms diffuse alongside CNT walls and, although there is He accumulation at the metal-CNT interface, no He trespassing of the CNT wall is observed, which is consistent with the lack of permeability of a perfect graphene sheet. However, when vacancies are introduced to mimic radiation-induced defects, He atoms penetrate CNTs, which play the role of nano-chimneys, allowing He atoms to escape the damaged zone and reduce bubble formation in the matrix. Consequently, composites made of CNTs inside metals are likely to display improved radiation resistance, particularly when radiation damage is related to swelling and He-induced embrittlement.

  9. Metal-nanotube composites as radiation resistant materials

    International Nuclear Information System (INIS)

    González, Rafael I.; Valencia, Felipe; Mella, José; Kiwi, Miguel; Duin, Adri C. T. van; So, Kang Pyo; Li, Ju; Bringa, Eduardo M.

    2016-01-01

    The improvement of radiation resistance in nanocomposite materials is investigated by means of classical reactive molecular dynamics simulations. In particular, we study the influence of carbon nanotubes (CNTs) in an Ni matrix on the trapping and possible outgassing of He. When CNTs are defect-free, He atoms diffuse alongside CNT walls and, although there is He accumulation at the metal-CNT interface, no He trespassing of the CNT wall is observed, which is consistent with the lack of permeability of a perfect graphene sheet. However, when vacancies are introduced to mimic radiation-induced defects, He atoms penetrate CNTs, which play the role of nano-chimneys, allowing He atoms to escape the damaged zone and reduce bubble formation in the matrix. Consequently, composites made of CNTs inside metals are likely to display improved radiation resistance, particularly when radiation damage is related to swelling and He-induced embrittlement.

  10. Superior radiation-resistant nanoengineered austenitic 304L stainless steel for applications in extreme radiation environments.

    Science.gov (United States)

    Sun, C; Zheng, S; Wei, C C; Wu, Y; Shao, L; Yang, Y; Hartwig, K T; Maloy, S A; Zinkle, S J; Allen, T R; Wang, H; Zhang, X

    2015-01-15

    Nuclear energy provides more than 10% of electrical power internationally, and the increasing engagement of nuclear energy is essential to meet the rapid worldwide increase in energy demand. A paramount challenge in the development of advanced nuclear reactors is the discovery of advanced structural materials that can endure extreme environments, such as severe neutron irradiation damage at high temperatures. It has been known for decades that high dose radiation can introduce significant void swelling accompanied by precipitation in austenitic stainless steel (SS). Here we report, however, that through nanoengineering, ultra-fine grained (UFG) 304 L SS with an average grain size of ~100 nm, can withstand Fe ion irradiation at 500 °C to 80 displacements-per-atom (dpa) with moderate grain coarsening. Compared to coarse grained (CG) counterparts, swelling resistance of UFG SS is improved by nearly an order of magnitude and swelling rate is reduced by a factor of 5. M(23)C(6) precipitates, abundant in irradiated CG SS, are largely absent in UFG SS. This study provides a nanoengineering approach to design and discover radiation tolerant metallic materials for applications in extreme radiation environments.

  11. Data base of radiation-resistant dielectric and insulating materials

    International Nuclear Information System (INIS)

    Hama, Yoshimasa; Sunazuka, Hideo; Nashiyama, Isamu; Kakuta, Tsunemi.

    1987-01-01

    In the data base of radiation-resistant dielectric and insulating materials, the data format contains such items as to give the summary; the data sheet contains the data in concrete form of respective properties from the references; the sheet of references contains the references in the former two. In the above three, there are attached code No., data sheet No., reference No. and key words. In the three areas as radiation-resistant dielectric and insulating materials, i.e., organic materials, inorganic materials and optical fibers, the following are explained: data format, data sheet and objectives. (Mori, K.)

  12. Heat- and radiation-resistant scintillator for electron microscopes

    International Nuclear Information System (INIS)

    Kosov, A.V.; Petrov, S.A.; Puzyr', A.P.; Chetvergov, N.A.

    1987-01-01

    The use of a scintillator consisting of a single crystal of bismuth orthogermanate, which has high heat and radiation resistance, in REM-100, REM-200, and REM-100U electron microscopes is described. A study of the heat and radiation stabilities of single crystals of bismuth orthogermanate (Bi 4 Ge 3 O 12 ) has shown that they withstood multiple electron-beam heating redness (T ∼ 800 0 C) without changes in their properties

  13. Radiation resistivity of pure-silica core image guide

    International Nuclear Information System (INIS)

    Hayami, H.; Ishitani, T.; Kishihara, O.; Suzuki, K.

    1988-01-01

    Radiation resistivity of pure-silica core image guides were investigated in terms of incremental spectral loss and quality of pictures transmitted through the image guides. Radiation-induced spectral losses were measured so as to clarify the dependences of radiation resistivity on such parameters as core materials (OH and Cl contents), picture element dimensions, (core packing density and cladding thickness), number of picture elements and drawing conditions. As the results, an image guide with OH-and Cl-free pure-silica core, 30-45% in core packing density, and 1.8 ∼ 2.2 μm in cladding thickness showed the lowest loss. The parameters to design this image guide were almost the same as those to obtain a image guide with good picture quality. Radiation resistivity of the image guide was not dependent on drawing conditions and number of picture elements, indicating that the image guide has large allowable in production conditions and that reliable quality is constantly obtained in production. Radiation resistivity under high total doses was evaluated using the image guide with the lowest radiation-induced loss. Maximum usable lengths of the image guide for practical use under specific high total doses and maximum allowable total doses for the image guide in specific lengths were extrapolated. Picture quality in terms of radiation-induced degradation in color fidelity in the pictures transmitted through image guides was quantitatively evaluated in the chromaticity diagram based on the CIE standard colorimetric system and in the color specification charts according to three attributes of colors. The image guide with the least spectral incremental loss gives the least radiation-induced degradation in color fidelity in the pictures as well. (author)

  14. Radiation resistance of clinical Acinetobacter spp.: A need for concern

    International Nuclear Information System (INIS)

    Christensen, E.A.; Gerner-Smidt, P.; Kristensen, H.

    1991-01-01

    As part of an epidemiological investigation of hospital infections caused by Acinetobacter spp. the radiation resistance of 15 clinical isolates and four reference strains was assessed. The radiation resistance (in D-6 values, viz. the dose necessary for reducing the initial number of colony forming units by a factor of 10(6)) was, in general, higher in the isolates of A. radioresistens than in the isolates of the A. calcoaceticus-A. baumannii complex and of A. lwoffi. However, the least resistant isolates of A. radioresistens had a D-6 value equal to or lower than the most resistant isolates of the other groups. The lowest D-6 values found were for two of the reference strains. The highest D-6 value was 35 kGy. Three isolates of A. johnsonii could not survive long enough in a dried preparation to make an assessment of the D-6 values possible. The radiation resistance of the 15 clinical isolates in the present study was higher than the resistance found in a study of similar isolates in 1970

  15. Radiation resistance of clinical Acinetobacter spp. : A need for concern

    Energy Technology Data Exchange (ETDEWEB)

    Christensen, E.A.; Gerner-Smidt, P.; Kristensen, H. (Control Department, Statens Seruminstitut, Copenhagen (Denmark))

    1991-06-01

    As part of an epidemiological investigation of hospital infections caused by Acinetobacter spp. the radiation resistance of 15 clinical isolates and four reference strains was assessed. The radiation resistance (in D-6 values, viz. the dose necessary for reducing the initial number of colony forming units by a factor of 10(6)) was, in general, higher in the isolates of A. radioresistens than in the isolates of the A. calcoaceticus-A. baumannii complex and of A. lwoffi. However, the least resistant isolates of A. radioresistens had a D-6 value equal to or lower than the most resistant isolates of the other groups. The lowest D-6 values found were for two of the reference strains. The highest D-6 value was 35 kGy. Three isolates of A. johnsonii could not survive long enough in a dried preparation to make an assessment of the D-6 values possible. The radiation resistance of the 15 clinical isolates in the present study was higher than the resistance found in a study of similar isolates in 1970.

  16. Proceedings: Radiation Protection Technology Conference: Providence, RI, November 2001

    International Nuclear Information System (INIS)

    2002-01-01

    Health physics (HP) professionals within the nuclear industry are continually upgrading their respective programs with new methods and technologies. The move to shorter outages combined with a diminishing group of contract HP technicians and demanding emergent work makes such changes even more important. The EPRI Radiation Protection Technology Conference focused on a number of key health physics issues and developments

  17. Tumourigenicity and radiation resistance of mesenchymal stem cells.

    Science.gov (United States)

    D'Andrea, Filippo P; Horsman, Michael R; Kassem, Moustapha; Overgaard, Jens; Safwat, Akmal

    2012-05-01

    Cancer stem cells are believed to be more radiation resistant than differentiated tumour cells of the same origin. It is not known, however, whether normal nontransformed adult stem cells share the same radioresistance as their cancerous counterpart. Nontumourigenic (TERT4) and tumourigenic (TRET20) cell lines, from an immortalised mesenchymal stem cell line, were grown in culture prior to irradiation and gene expression analysis. Radiation resistance was measured using a clonogenic assay. Differences in gene expression between the two cell lines, both under nontreated and irradiated conditions, were assessed with microarrays (Affymetrix Human Exon 1.0 ST array). The cellular functions affected by the altered gene expressions were assessed through gene pathway mapping (Ingenuity Pathway Analysis). Based on the clonogenic assay the nontumourigenic cell line was found to be more sensitive to radiation than the tumourigenic cell line. Using the exon chips, 297 genes were found altered between untreated samples of the cell lines whereas only 16 genes responded to radiation treatment. Among the genes with altered expression between the untreated samples were PLAU, PLAUR, TIMP3, MMP1 and LOX. The pathway analysis based on the alteration between the untreated samples indicated cancer and connective tissue disorders. This study has shown possible common genetic events linking tumourigenicity and radiation response. The PLAU and PLAUR genes are involved in apoptosis evasion while the genes TIMP3, MMP1 and LOX are involved in regulation of the surrounding matrix. The first group may contribute to the difference in radiation resistance observed and the latter could be a major contributor to the tumourigenic capabilities by degrading the intercellular matrix. These results also indicate that cancer stem cells are more radiation resistant than stem cells of the same origin.

  18. Radiation resistant organic composites for superconducting fusion magnets

    International Nuclear Information System (INIS)

    Nishijima, S.; Okada, T.

    1993-01-01

    Organic composite materials (usually reinforced by glas fibers: GFRP) are to be used in fusion superconducting magnets as insulating and/or structural materials. The fusion superconducting magnets are operated under radiation environments and hence the radiation induced degradation of magnet components is ought to be estimated. Among the components the organic composite materials were evaluated to be the most radiation sensitive. Consequently the development of radiation resistant organic composite materials is thought one of the 'key' technologies for fusion superconducting magnets. The mechanism of radiation-induced degradation was studied and the degradation of interlaminar shear strength (ILSS) was found to be the intrinsic phenomenon which controlled the overall degradation of organic composite materials. The degradation of ILSS was studied changing matrix resin, reinforcement and type of fabrics. The possible combination of the organic composites for the fusion superconducting magnet will be discussed. (orig.)

  19. Radiation resistance of concrete of nuclear reactor vessel

    International Nuclear Information System (INIS)

    Belyakov, V.V.; Denisov, A.V.; Korenevskij, V.V.; Muzalevskij, L.P.; Dubrovskij, V.B.; Ivanov, D.A.; Nazarov, I.L.; Sashin, N.L.

    1992-01-01

    Results of calculational-experimental determination of radiation resistance for concrete bases on limestone gravel and quartz sand, which are the most perspective materials for manufacturing prestressed concrete of the VG-400 reactor vessel are considered. Material samples under investigation were irradiated in the channels of the IBR-2 research reactor for the purpose of the calcultional result verification

  20. Radiation resistivity of frozen insulin solutions and suspensions

    Energy Technology Data Exchange (ETDEWEB)

    Soboleva, N N; Ivanova, A I; Talrose, V L; Trofimov, V I; Fedotov, V P [AN SSSR, Moscow. Inst. Fizicheskoj Khimii; Research Institute for Biological Testing of Chemicals, Moscow (USSR); Institute of Experimental Endocrinology and Hormon Chemistry, Moscow (USSR))

    1981-10-01

    The effect of great increase in radiation resistance of insulin solutions and suspensions after irradiation at low temperatures in the frozen state was observed by absorption spectrophotometry, paper chromatography and biological analysis. The data obtained suggest irradiation of frozen insulin solutions and suspensions as a method for its sterilization.

  1. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

    2007-07-24

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  2. Development of application technology of radiation-resistant microorganism

    International Nuclear Information System (INIS)

    Kim, Dong Ho; Lim, Sang Yong; Joe, Min Ho; Jung, Jin Woo; Jung, Sun Wook; Song, Du Sup; Choi, Young Ji

    2009-02-01

    The scope of the project is divided into of three parts; (i) to define the survival strategy of radiation-resistant microbes, especially Deinococcus (ii) acquisition of gene resources encoding the novel protein and related with the production of functional materials (iii) development of control technology against radiation-resistant microbes. To this aim, first, the whole transcriptional response of the D. radiodurans strain haboring pprI mutation, which plays an important role in radiation resistance, was analyzed by cDNA microarray. The anti-oxidant activity of the major carotenoid of D. radiodurans, deinoxanthin, was analyzed and the strain was constructed, in which the gene necessary for bio- synthesis of deinoxanthin is deleted. The response to cadmium of D. radiodurans was also investigated through cDNA microarray analysis. Radiogenic therapy, one of the cancer treatments, is designed to use radiation-inducible gene for the treatment. To develop the gene-transfer vehicle for radiogenic therapy, we have investigated the virulence mechanism of Salmonella, which is tumor-targeting bacteria and studied the synergistic effect of some anti-cancer agents on radiation treatment for cancer. Finally, we confirmed that irradiation could decompose a fungus toxin, patulin, into various harmless by-products

  3. Development of application technology of radiation-resistant microorganism

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong Ho; Lim, Sang Yong; Joe, Min Ho; Jung, Jin Woo; Jung, Sun Wook; Song, Du Sup; Choi, Young Ji [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2009-02-15

    The scope of the project is divided into of three parts; (i) to define the survival strategy of radiation-resistant microbes, especially Deinococcus (ii) acquisition of gene resources encoding the novel protein and related with the production of functional materials (iii) development of control technology against radiation-resistant microbes. To this aim, first, the whole transcriptional response of the D. radiodurans strain haboring pprI mutation, which plays an important role in radiation resistance, was analyzed by cDNA microarray. The anti-oxidant activity of the major carotenoid of D. radiodurans, deinoxanthin, was analyzed and the strain was constructed, in which the gene necessary for bio- synthesis of deinoxanthin is deleted. The response to cadmium of D. radiodurans was also investigated through cDNA microarray analysis. Radiogenic therapy, one of the cancer treatments, is designed to use radiation-inducible gene for the treatment. To develop the gene-transfer vehicle for radiogenic therapy, we have investigated the virulence mechanism of Salmonella, which is tumor-targeting bacteria and studied the synergistic effect of some anti-cancer agents on radiation treatment for cancer. Finally, we confirmed that irradiation could decompose a fungus toxin, patulin, into various harmless by-products.

  4. Radiation induction of drug resistance in RIF-1 tumors and tumor cells

    International Nuclear Information System (INIS)

    Hopwood, L.E.; Moulder, J.E.

    1989-01-01

    The RIF-1 tumor cell line contains a small number of cells (1-20 per 10(6) cells) that are resistant to various single antineoplastic drugs, including 5-fluorouracil (5FU), methotrexate (MTX), and adriamycin (ADR). For 5FU the frequency of drug resistance is lower for tumor-derived cells than for cells from cell culture; for MTX the reverse is true, and for ADR there is no difference. In vitro irradiation at 5 Gy significantly increased the frequency of drug-resistant cells for 5FU, MTX, and ADR. In vivo irradiation at 3 Gy significantly increased the frequency of drug-resistant cells for 5FU and MTX, but not for ADR. The absolute risk for in vitro induction of MTX, 5FU, and ADR resistance, and for in vivo induction of 5FU resistance, was 1-3 per 10(6) cells per Gy; but the absolute risk for in vivo induction of MTX resistance was 54 per 10(6) cells per Gy. The frequency of drug-resistant cells among individual untreated tumors was highly variable; among individual irradiated tumors the frequency of drug-resistant cells was significantly less variable. These studies provide supporting data for models of the development of tumor drug resistance, and imply that some of the drug resistance seen when chemotherapy follows radiotherapy may be due to radiation-induced drug resistance

  5. Breast cancers radiation-resistance: key role of the cancer stem cells marker CD24

    International Nuclear Information System (INIS)

    Bensimon, Julie

    2013-01-01

    This work focuses on the characterization of radiation-resistant breast cancer cells, responsible for relapse after radiotherapy. The 'Cancer Stem Cells' (CSC) theory describes a radiation-resistant cellular sub-population, with enhanced capacity to induce tumors and proliferate. In this work, we show that only the CSC marker CD24-/low defines a radiation resistant cell population, able to transmit the 'memory' of irradiation, expressed as long term genomic instability in the progeny of irradiated cells. We show that CD24 is not only a marker, but is an actor of radiation-response. So, CD24 expression controls cell proliferation in vitro and in vivo, and ROS level before and after irradiation. As a result, CD24-/low cells display enhanced radiation-resistance and genomic stability. For the first time, our results attribute a role to CD24-/low CSCs in the transmission of genomic instability. Moreover, by providing informations on tumor intrinsic radiation-sensitivity, CD24- marker could help to design new radiotherapy protocols. (author)

  6. Radiation Resistance Test of Wireless Sensor Node and the Radiation Shielding Calculation

    Energy Technology Data Exchange (ETDEWEB)

    Li, Liqan; Sur, Bhaskar [Atomic Energy of Canada Limited, Ontario (Canada); Wang, Quan [University of Western Ontario, Ontario (Canada); Deng, Changjian [The University of Electronic Science and Technology, Chengdu (China); Chen, Dongyi; Jiang, Jin [Applied Physics Branch, Ontario (Korea, Republic of)

    2014-08-15

    A wireless sensor network (WSN) is being developed for nuclear power plants. Amongst others, ionizing radiation resistance is one essential requirement for WSN to be successful. This paper documents the work done in Chalk River Laboratories of Atomic Energy of Canada Limited (AECL) to test the resistance to neutron and gamma radiation of some WSN nodes. The recorded dose limit that the nodes can withstand before being damaged by the radiation is compared with the radiation environment inside a typical CANDU (CANada Deuterium Uranium) power plant reactor building. Shielding effects of polyethylene, cadmium and lead to neutron and gamma radiations are also analyzed using MCNP simulation. The shielding calculation can be a reference for the node case design when high dose rate or accidental condition (like Fukushima) is to be considered.

  7. Shielding ability of lead loaded radiation resistant gloves

    International Nuclear Information System (INIS)

    Kawano, Takao; Ebihara, Hiroshi

    1990-01-01

    The shielding ability of radiation resistant gloves were examined. The gloves are made of lead loaded (as PbO 2 ) polyvinyl chloride resin and are about 0.4 mm of thickness (70 mg/cm 2 ). Eleven test pieces were sampled from each of three gloves (total were thirty three) and the transmission rates for radiations (X-ray or γ-ray) through the test pieces were measured with radiation sources, 99m Tc, 57 Co, 133 Ba, 133 Xe and 241 Am. The differences of the transmission rate for radiations by the positions of the gloves were smaller than 15%, and the differences by three gloves were smaller than 5% in the case of 60 keV and 141 keV radiations. The average transmission rates for radiations in thirty three test pieces were about 40% for 30 keV radiation, about 90% for 80 keV and 140 keV radiations. The shielding characteristic of the gloves could be equivalent to about 0.026 mm thick lead plate. (author)

  8. Isolation of Radiation-Resistant Bacteria from Mars Analog Antarctic Dry Valleys by Preselection, and the Correlation between Radiation and Desiccation Resistance.

    Science.gov (United States)

    Musilova, Michaela; Wright, Gary; Ward, John M; Dartnell, Lewis R

    2015-12-01

    Extreme radiation-resistant microorganisms can survive doses of ionizing radiation far greater than are present in the natural environment. Radiation resistance is believed to be an incidental adaptation to desiccation resistance, as both hazards cause similar cellular damage. Desert soils are, therefore, promising targets to prospect for new radiation-resistant strains. This is the first study to isolate radiation-resistant microbes by using gamma-ray exposure preselection from the extreme cold desert of the Antarctic Dry Valleys (a martian surface analogue). Halomonads, identified by 16S rRNA gene sequencing, were the most numerous survivors of the highest irradiation exposures. They were studied here for the first time for both their desiccation and irradiation survival characteristics. In addition, the association between desiccation and radiation resistance has not been investigated quantitatively before for a broad diversity of microorganisms. Thus, a meta-analysis of scientific literature was conducted to gather a larger data set. A strong correlation was found between desiccation and radiation resistance, indicating that an increase in the desiccation resistance of 5 days corresponds to an increase in the room-temperature irradiation survival of 1 kGy. Irradiation at -79°C (representative of average martian surface temperatures) increases the microbial radiation resistance 9-fold. Consequently, the survival of the cold-, desiccation-, and radiation-resistant organisms isolated here has implications for the potential habitability of dormant or cryopreserved life on Mars. Extremophiles-Halomonas sp.-Antarctica-Mars-Ionizing radiation-Cosmic rays.

  9. Inactivation of the Radiation-Resistant Spoilage Bacterium Micrococcus radiodurans

    Science.gov (United States)

    Duggan, D. E.; Anderson, A. W.; Elliker, P. R.

    1963-01-01

    A simplified technique permitting the pipetting of raw puréed meats for quantitative bacteriological study is described for use in determining survival of these non-sporing bacteria, which are exceptionally resistant to radiation. Survival curves, using gamma radiation as the sterilizing agent, were determined in raw beef with four strains of Micrococcus radiodurans. Survival curves of the R1 strain in other meat substrates showed that survival was significantly greater in raw beef and raw chicken than in raw fish or in cooked beef. Resistance was lowest in the buffer. Cells grown in broth (an artificial growth medium) and resuspended in beef did not differ in resistance from cells that had been grown and irradiated in beef. Survival rate was statistically independent of the initial cell concentration, even though there appeared to be a correlation between lower death rate and lower initial cell concentrations. The initial viable count of this culture of the domesticated R1 strain in beef was reduced by a factor of about 10-5 by 3.0 megarad, and 4.0 megarad reduced the initial count by a factor of more than 10-9. Data suggest that M. radiodurans R1 is more resistant to radiation than spore-forming spoilage bacteria for which inactivation rates have been published. PMID:14063780

  10. Radiation resistance of wide-bandgap semiconductor power transistors

    Energy Technology Data Exchange (ETDEWEB)

    Hazdra, Pavel; Popelka, Stanislav [Department of Microelectronics, Czech Technical University in Prague (Czech Republic)

    2017-04-15

    Radiation resistance of state-of-the-art commercial wide-bandgap power transistors, 1700 V 4H-SiC power MOSFETs and 200 V GaN HEMTs, to the total ionization dose was investigated. Transistors were irradiated with 4.5 MeV electrons with doses up to 2000 kGy. Electrical characteristics and introduced defects were characterized by current-voltage (I-V), capacitance-voltage (C-V), and deep level transient spectroscopy (DLTS) measurements. Results show that already low doses of 4.5 MeV electrons (>1 kGy) cause a significant decrease in threshold voltage of SiC MOSFETs due to embedding of the positive charge into the gate oxide. On the other hand, other parameters like the ON-state resistance are nearly unchanged up to the dose of 20 kGy. At 200 kGy, the threshold voltage returns back close to its original value, however, the ON-state resistance increases and transconductance is lowered. This effect is caused by radiation defects introduced into the low-doped drift region which decrease electron concentration and mobility. GaN HEMTs exhibit significantly higher radiation resistance. They keep within the datasheet specification up to doses of 2000 kGy. Absence of dielectric layer beneath the gate and high concentration of carriers in the two dimensional electron gas channel are the reasons of higher radiation resistance of GaN HEMTs. Their degradation then occurs at much higher doses due to electron mobility degradation. (copyright 2016 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  11. Development of superior radiation resistant materials and cables. 2

    Energy Technology Data Exchange (ETDEWEB)

    Ikehara, Junichiro; Kanemitsuya, Kazuhiko; Ohara, Hideo; Araki, Syogo; Hamachi, Katsuhiko [Mitsubishi Cable Industries Ltd., Tokyo (Japan)

    1996-01-01

    Many nuclear power plants have been constructed in Japan and electric power generation is now highly dependent on this technology. Therefore, the needs for facilities that will enrich and reprocess nuclear fuel from nuclear power stations will be high. As there are areas with high levels of radiation, the cables which can be used in these environments are needed. We have developed a superior radiation-resistant cable which uses halogen flame-retardant materials. This radiation-resistant cable consists of Ethylene-propylene rubber (EPDM) insulation and Chlorosulfonated polyethylene (CSM) sheath can be safely used in areas with high levels of radiation. We developed this product to aid in disaster prevention. Non-halogen, flame-retardant EPDM is used for the insulation, and low-halogen, flame-retardant CSM and new non-halogen, flame-retardant materials are used for the sheath. These cables have superior flame-retardant properties and generate little smoke on corrosive gas. This products can hence reduce the danger of a secondary disaster in a fire. We expect that these cables will find application in areas with high levels of radiation. (author).

  12. Development of superior radiation resistant materials and cables. 2

    International Nuclear Information System (INIS)

    Ikehara, Junichiro; Kanemitsuya, Kazuhiko; Ohara, Hideo; Araki, Syogo; Hamachi, Katsuhiko

    1996-01-01

    Many nuclear power plants have been constructed in Japan and electric power generation is now highly dependent on this technology. Therefore, the needs for facilities that will enrich and reprocess nuclear fuel from nuclear power stations will be high. As there are areas with high levels of radiation, the cables which can be used in these environments are needed. We have developed a superior radiation-resistant cable which uses halogen flame-retardant materials. This radiation-resistant cable consists of Ethylene-propylene rubber (EPDM) insulation and Chlorosulfonated polyethylene (CSM) sheath can be safely used in areas with high levels of radiation. We developed this product to aid in disaster prevention. Non-halogen, flame-retardant EPDM is used for the insulation, and low-halogen, flame-retardant CSM and new non-halogen, flame-retardant materials are used for the sheath. These cables have superior flame-retardant properties and generate little smoke on corrosive gas. This products can hence reduce the danger of a secondary disaster in a fire. We expect that these cables will find application in areas with high levels of radiation. (author)

  13. Isolation of radiation resistant fungal strains from highly radioactive field

    International Nuclear Information System (INIS)

    Adam, Y.M.; Aziz, N.H.; Attaby, H.S.H.

    1995-01-01

    This study examined the radiation resistance of fungal flora isolated from the hot-lab around the radiation sources, cobalt 137 and radium 226 . The predominant mould species were: Aspergillus flavus, A. Niger, penicillium chrysogenum, cladosporium herbarum, fusarium oxysporum and alternaria citri. The D 10 values of F. Oxysporum; 2.00 KGy, A. Flavus; 1.40 KGy, P. chrysogenum; 1.15 KGy, and A. citri; 0.95 KGy, are about 1.67, 3.10, 1.92 and 1.36 folds as the D 1 0 values of the same isolates recovered from soil

  14. Human Genetic Marker for Resistance to Radiation and Chemicals

    International Nuclear Information System (INIS)

    Lieberman, Howard B.

    2001-01-01

    TO characterize the human HRDAD9 gene and evaluate its potential as a biomarker to predict susceptibility to the deleterious health effects potentially caused by exposure to radiations or chemicals present at DOE hazardous waste cleanup sites. HRAD9 is a human gene that is highly conserved throughout evolution. Related genes have been isolated from yeasts and mice, underscoring its biological significance. Most of our previous work involved characterization of the yeast gene cognate, wherein it was determined that the corresponding protein plays a significant role in promoting resistance of cells to radiations and chemicals, and in particular, controlling cell growth in response to DNA damage

  15. Radiation resistance of InP-related materials

    International Nuclear Information System (INIS)

    Yamaguchi, Masafumi; Takamoto, Tatsuya; Ikeda, Eiji; Kurita, Hiroshi; Ohmori, Masamichi; Ando, Koshi; Vargas-Aburto, C.

    1995-01-01

    Irradiation effects of 1-MeV electrons on InP-related materials such as InP, InGaP and InGaAsP have been examined in comparison with those of GaAs. Superior radiation-resistance of InP-related materials and their devices compared to GaAs has been found in terms of minority-carrier diffusion length and properties of devices such as solar cells and light-emitting devices. Moreover, minority-carrier injection-enhanced annealing of radiation-induced defects in InP-related materials has also been observed. (author)

  16. CERTIFICATION OF THE RADIATION RESISTANCE OF COIL INSULATION MATERIAL

    CERN Document Server

    Polinski, J; Bogdan, P

    2013-01-01

    The goal of the WP 7.2.1 sub-task of the EuCARD program has been to determine the Nb$_{3}$Sn based accelerator magnet coil electrical insulation resistance against irradiation, which will occur in future accelerators. The scope of the certification covers determination of mechanical, electrical and thermal properties changes due to irradiation. The report presents a selection of the insulation material candidates for future accelerator magnets as well as the definition of the radiation certification methodology with respect of radiation type, energy, doses and irradiation conditions. The test methods and results of the electrical and mechanical insulation materials properties degradation due to irradiation are presented. Thermal conductivity and Kapitza resistance at temperature range from 1.5 K to 2.0 K (superfluid helium conditions) are given.

  17. High resistance of some oligotrophic bacteria to ionizing radiation

    International Nuclear Information System (INIS)

    Nikitin, D.I.; Tashtemirova, M.A.; Pitryuk, I.A.; Sorokin, V.V.; Oranskaya, M.S.; Nikitin, L.E.

    1994-01-01

    The resistance of seven cultures of eutrophic and oligotrophic bacteria to gamma radiation (at doses up to 360 Gy) was investigated. The bacteria under study were divided into three groups according to their survival ability after irradiation. Methylobacterium organophilum and open-quotes Pedodermatophilus halotoleransclose quotes (LD 50 = 270 Gy) were highly tolerant. By their tolerance, these organisms approached Deinococcus radiodurans. Aquatic ring-shaped (toroidal) bacteria Flectobacillus major and open-quotes Arcocella aquaticaclose quotes (LD 5 = 173 and 210 Gy, respectively) were moderately tolerant. Eutrophic Pseudomonas fluorescens and Escherichia coli (LD 50 = 43 and 38 Gy, respectively) were the most sensitive. X-ray microanalysis showed that in tolerant bacteria the intracellular content of potassium increased and the content of calcium decreased after irradiation. No changes in the element composition of the eutrophic bacterium E. coli were detected. Possible mechanisms of the resistance of oligotrophic bacteria to gamma radiation are discussed

  18. Radiation resistance of amorphous silicon alloy solar cells

    International Nuclear Information System (INIS)

    Hanak, J.J.; Chen, E.; Myatt, A.; Woodyard, J.R.

    1987-01-01

    The radiation resistance of a-Si alloy solar cells when bombarded by high energy particles is reviewed. The results of investigations of high energy proton radiation resistance of a-Si alloy thin film photovoltaic cells are reported. Irradiations were carried out with 200 keV and 1.00 MeV protons with fluences ranging betweeen 1E11 and 1E15 cm-2. Defect generation and passivation mechanisms were studied using the AM1 conversion efficiency and isochronal anneals. It is concluded that the primary defect generation mechanism results from the knock-on of Si and Ge in the intrinsic layer of the cells. The defect passivation proceeds by the complex annealing of Si and Ge defects and not by the simple migration of hydrogen

  19. Destruction of radiation-resistant cell populations by hyperthermia

    International Nuclear Information System (INIS)

    Roettinger, E.M.; Gerweck, L.E.

    1979-01-01

    Animal experiments with local hyperthermia have shown that the radiauion dose necessary for the local control of 50% of the tumours examined was essentially reduced by heating to 42,5 0 C. In-vitro experients indicated selective destruction of relatively radiation-resistent cell populations by the combination of hyperthermie and reduced hydrogen ion concentration. Experiments with glioblastoma cells confirmed these results qualitatively, but showed quantitatively considerably lower sensitivity towards hyperthermia. (orig.) 891 MG/orig. 892 RDG [de

  20. Study of decontamination and radiation resistance properties of Indian paints

    International Nuclear Information System (INIS)

    Shah, S.M.; Gopinathan, E.; Bhagwath, A.M.

    1976-01-01

    A brief introduction to the study of contamination and radiation resistance properties of Indian paints used as coating for structural materials in the nuclear industry is given. The general composition of paints such as epoxy, vinyl, alkyd, phenolic, chlesimated rubber, etc. is given. Method of sample preparation, processing and actual evaluation of decontaminability are described. The results have been discussed in terms of decontamination factors. Some recommendations based on the performance of the paints studied are also included. (K.B.)

  1. Radiation resistant polypropylene blended with mobilizer,. antioxidants and nucleating agent

    Science.gov (United States)

    Shamshad, A.; Basfar, A. A.

    2000-03-01

    Post-irradiation storage of medical disposables prepared from isotactic polypropylene renders them brittle due to degradation. To avoid this, isotactic polypropylene [(is)PP] was blended with a mobilizer, dioctyl pthallate (DOP), three antioxidants (hindered amines and a secondary antioxidant) and benzoic acid to obtain radiation-resistant, thermally-stable and transparent material. Different formulations prepared were subjected to gamma radiation to doses of 25 and 50 kGy. Tests of breakage on bending after ageing in an oven at 70°C up to 12 months have shown that the addition of DOP and the antioxidants imparts improved radiation and thermal stability as compared to (is)PP alone or its blend with DOP. All the formulations irradiated or otherwise demonstrated excellent colour stability even after accelerated ageing at 70°C for prolonged periods.

  2. Resistance of Salmonella enteritidis variety typhimurium to gamma radiation

    International Nuclear Information System (INIS)

    Norberg, A.N.; Maliska, C.

    1988-01-01

    The use of ionizing radiations to kill microrganisms responsible for food deterioration, and toxinfections is an example of peaceful use of nuclear energy. Food toxinfections are, amongus, produced mostly by Salmonella enteritidis var. typhimurium. Due to the pauncity of information on the resistance to gamma radiation of Salmonella enteritidis var. typhimurium this paper has the aim to define the 60-Cobalt gamma radiation lethal dose to these bacteria, in experimentally contaminated milk by samples recovered from our geographycal area. One hundred nineteen samples of milk containing about 150.000 bacteria per ml were irradiated with doses ranging from 100 to 1.100 Gy. Two samples of surving bacteria were again irradiated by doses up to 2.500 Gy. The bacteria not previously irradiated were killed by doses of 1.100 Gy. It was concluded that the 60-Cobalt gamma radiation minimal lethal dose to Salmonella enteritidis var. typhimurium is 1.200 Gy. The surviving strains to smaller doses than 1.200 Gy when re-irradiated prompt the forthcoming of more radio-resistant germs. (author) [pt

  3. Radiation resistant quench protection diodes for the LHC

    International Nuclear Information System (INIS)

    Hagedorn, D.; Coull, L.

    1994-01-01

    The quench protection diodes for the proposed Large Hadron Collider at CERN will be located inside the He-II vessel of the short straight section of one half cell, where they could be exposed to a radiation dose of about 50 kGy and a total neutron fluence of about 10 15 n/cm 2 over 10 years at temperatures of about 2 K. To investigate the influence of irradiation on the electrical characteristics of the diodes, newly developed diodes of thin base region of the diffusion type and of the epitaxial type have been submitted to irradiation tests at liquid nitrogen temperature in a target area of the SPS accelerator at CERN. The degradation of the electrical characteristics of the diodes for a radiation dose up to about 20 kGy and neutron fluence of up to about 5 10 14 n/cm 2 and the effect of carrier injection and thermal annealing after irradiation have been measured. The test results show that only the thin base diodes of the epitaxial type are really radiation resistant. A compromise must be found between required blocking characteristics and radiation resistance. Annealing by carrier injection and occasional warm up to room temperature can extend the service life of irradiated diodes quite substantially

  4. Providing current radiation safety according to new version of 'Ukrytie' object regulation

    International Nuclear Information System (INIS)

    Borovoj, A.A.; Vysotskij, E.D.; Krinitsyn, A.P.; Bogatov, S.A.

    1999-01-01

    Main provisions are given of the 'Ukryttia' object's Regulation related to provision of radiation safety during the object's operation. The safety is provided due to the realization by the object's personnel of functions of global monitoring of current radiation conditions, as well as of the measures of operative or preventive suppression of radiation abnormalities sources

  5. Prediction of Ionizing Radiation Resistance in Bacteria Using a Multiple Instance Learning Model.

    Science.gov (United States)

    Aridhi, Sabeur; Sghaier, Haïtham; Zoghlami, Manel; Maddouri, Mondher; Nguifo, Engelbert Mephu

    2016-01-01

    Ionizing-radiation-resistant bacteria (IRRB) are important in biotechnology. In this context, in silico methods of phenotypic prediction and genotype-phenotype relationship discovery are limited. In this work, we analyzed basal DNA repair proteins of most known proteome sequences of IRRB and ionizing-radiation-sensitive bacteria (IRSB) in order to learn a classifier that correctly predicts this bacterial phenotype. We formulated the problem of predicting bacterial ionizing radiation resistance (IRR) as a multiple-instance learning (MIL) problem, and we proposed a novel approach for this purpose. We provide a MIL-based prediction system that classifies a bacterium to either IRRB or IRSB. The experimental results of the proposed system are satisfactory with 91.5% of successful predictions.

  6. Radiation resistivity of pure silica core image guides for industrial fiberscopes

    International Nuclear Information System (INIS)

    Okamoto, Shinichi; Ohnishi, Tokuhiro; Kanazawa, Tamotsu; Tsuji, Yukio; Hayami, Hiroyuki; Ishitani, Tadayoshi; Akutsu, Takeji; Suzuki, Koichi.

    1991-01-01

    Industrial fiberscopes incorporating pure silica core image guides have been extensively used for remote visual inspection in radiation fields including nuclear power plants, owing to their superior radiation resistivity. The authors have been intensively conducting R and D on improving radiation resistivity of pure silica core image guides. This paper reports the results of experiments to compare the effects of core materials on radiation resistivity and to investigate the dependence of radiation resistivity on total dose, does rate, and support pipe material. The results confirmed the superior radiation resistivity of the core material containing fluorine at any irradiation condition and indicated the existence of a critical dose rate at which radiation-induced deterioration was stabilized. No difference in radiation resistivity attributable to support layer material was observed. (author)

  7. Radiation damage resistance in mercuric iodide X-ray detectors

    Energy Technology Data Exchange (ETDEWEB)

    Patt, B E; Dolin, R C; Devore, T M; Markakis, J M [EG and G Energy Measurements, Inc., Goleta, CA (USA); Iwanczyk, J S; Dorri, N [Xsirius, Inc., Marina del Rey, CA (USA); Trombka, J [National Aeronautics and Space Administration, Greenbelt, MD (USA). Goddard Space Flight Center

    1990-12-20

    Mercuric iodide (HgI{sub 2}) radiation detectors show great potential as ambient-temperature solid-state detectors for X-rays, gamma rays and visible light, with parameters that are competitive with existing technologies. In a previous experiment, HgI{sub 2} detectors irradiated with 10 MeV protons/cm{sup 2} exhibited no damage. The 10 MeV protons represent only the low range of the spectrum of energies that are important. An experiment has been conducted at the Saturne accelerator facility at Saclay, France, to determine the susceptibility of these detectors to radiation damage by high-energy (1.5 GeV) protons. The detectors were irradiated to a fluence of 10{sup 8} protons/cm{sup 2}. This fluence is equivalent to the cosmic radiation expected in a one-year period in space. The resolution of the detectors was measured as a function of the integral dose. No degradation in the response of any of the detectors or spectrometers was seen. It is clear from this data that HgI{sub 2} has extremely high radiation-damage resistance, exceeding that of most other semiconductor materials used for radiation detectors. Based on the results shown to date, HgI{sub 2} detectors are suitable for applications in which they may be exposed to high integral dose levels. (orig.).

  8. Development of EPDM based thermoplastic elastomers for oil resistant applications: optimization of radiation grafting parameters

    International Nuclear Information System (INIS)

    Chaudhari, C.V.; Dubey, K.A.; Bhardwaj, Y.K.; Sabharwal, S.

    2008-01-01

    Full text: Ethylene-propylene diene terpolymer (EPDM) is currently among the most industrially useful elastomers because of its certain unique properties like excellent heat resistance, resistance towards ozone deterioration, high impact strength. However EPDM has a serious drawback of weak adhesion properties and tendency to swell in contact with paraffin oil and aromatic hydrocarbons. Blending EPDM with suitable polar elastomers or grafting polar polymer chains onto EPDM is an easy method to overcome this drawback. Radiation grafting of Acrylonitrile (ACN) on EPDM provides an easy and effective method of incorporating ACN uniformly on the EPDM backbone. Grafting of ACN on EPDM is expected to result grafted copolymer with better oil resistance, hardness and better compatibility with polar polymer matrices. In the present study radiation induced grafting of ACN onto EPDM rubber film was investigated by mutual radiation grafting technique. Effect of experimental variables viz. radiation dose, dose rate, types of solvents and monomer content on extent of grafting was studied. The solvent composition of Acetone:CCl 4 (20:80) was found to be the optimum mixture which resulted in highest degree of grafting. It was found that the degree of grafting increases with radiation dose, monomer content and decreases with dose rate

  9. Characterization of radiation-resistant vegetative bacteria in beef

    International Nuclear Information System (INIS)

    Welch, A.B.; Maxcy, R.B.

    1975-01-01

    Ground beef contains numerous microorganisms of various types. The commonly recognized bacteria are associated with current problems of spoilage. Irradiation, however, contributes a new factor through selective destruction of the microflora. The residual microorganisms surviving a nonsterilizing dose are predominantly gram-negative coccobacilli. Various classifications have been given, e.g., Moraxella, Acinetobacter, Achromobacter, etc. For a more detailed study of these radiation-resistant bacteria occurring in ground beef, an enrichment procedure was used for isolation. By means of morphological and biochemical tests, most of the isolates were found to be Moraxella, based on current classifications. The range of growth temperatures was from 2 to 50 C. These bacteria were relatively heat sensitive, e.g., D 10 of 5.4 min at 70 0 C or less. The radiation resistance ranged from D 10 values of 273 to 2,039 krad. Thus, some were more resistant than any presently recognized spores. A reference culture of Moraxella osloensis was irradiated under conditions comparable to the enrichment procedure used with the ground beef. The only apparent changes were in morphology and penicillin sensitivity. However, after a few subcultures these bacteria reverted to the characteristics of the parent strain. Thus, it is apparent that these isolates are a part of the normal flora of ground beef and not aberrant forms arising from the irradiation procedure. The significance, if any, of these bacteria is not presently recognized. (auth)

  10. Optical emission behavior and radiation resistance of epoxy resins

    International Nuclear Information System (INIS)

    Kawanishi, Shunichi; Udagawa, Akira; Hagiwara, Miyuki

    1987-11-01

    To make clear a mechanism of radiation resistance of epoxy resin systems, a role of energy trapping site induced in bisphenol A type epoxy resins cured with 4 kinds of aromatic amines (Φ N ) was studied in comparison with the case of aliphatic amine curing system through a measurement of optical emission. In the system of the epoxy resin cured with DETA, the optical emission from an excited state of bisphenol A unit of epoxy resin and a charge transfer complex was observed. On the other hand, the optical emission from Φ N was observed in the aromatic amine curing system. Their excitation spectrum consists of peaks of absorption spectrum of BA and those of Φ N , showing that the excited state of Φ N is formed through the excitation of both BA and Φ N . Therefore, the excited energy of BA transfers to the excited state of Φ N . Emission intensity of Φ N band was 20 ∼ 100 times as large as that of BA. These results indicate that the radiation energy is effectively released as an optical emission from excited state of Φ N in the epoxy resin when cured with aromatic amine. It can be concluded from the above results that aromatic amine hardeners contribute to enhancement of the radiation resistance of epoxy resin by acting as an energy transfer agent. (author)

  11. Radiation resistance characteristics of optical communication system for single mode

    International Nuclear Information System (INIS)

    Ohe, Masamoto; Chigusa, Yoshiki; Kyodo, Tomohisa; Tanaka, Gohtaro; Watanabe, Hajime; Okamoto, Shin-ichi; Yamamoto, Takao.

    1988-01-01

    Optical communication has been utilized also for nuclear power stations and fuel reporocessing plants. As the sufficient safety countermeasures are required there, the amount of information becomes enormous, therefore, optical communication, by which the required space is expected to be reduced, becomes more important. Also in the application to submarine cables, attention must be paid to the radiation resistance as there are the effects of potassium contained in large amount in seawater and uranium deposits in sea bottom. Therefore, the reliability of the components of optical communication systems against radiation becomes a problem. In this study, single mode optical fibers and transmission and receipt modules were selected, and high dose rate irradiation supposing the case of using in a cell and low dose rate, long time irradiation supposing the case of submarine cables were carried out to evaluate the radiation resistance characteristics. The fibers tested were SiO 2 core/F-SiO 2 clad type and GeO 2 -SiO 2 core/SiO 2 clad type. The characteristics of increasing loss in irradiation and restoration after irradiation of the former type were superior to those of the latter type. The output of a receipt module was normal during irradiation, and the output power of a transmission module decreases, but other problems did not arise. (K.I.)

  12. Radiation resistance of insulating materials for electric wires

    International Nuclear Information System (INIS)

    Kanemitsuya, Kazuhiko; Okuda, Tomoaki; Tachibana, Tadao; Yagi, Toshiaki; Seguchi, Tadao.

    1990-01-01

    In no halogen incombustible materials, smoke and poisonous gas generation at the time of burning is small, and corrosive gas rarely arises. Since no halogen electric wires and cables which use these material maintain safety for people and equipment in the case of fires, those are used for ships, tunnels, subways and so on. Also in nuclear power stations, the demand for no halogen cables becomes high although the condition of adoption is difficult. In this study, for the purpose of developing the no halogen cables for nuclear power stations, the basic data on the radiation resistance of no halogen incombustible materials were collected, and by using chemical analysis method, the radiation deterioration behavior was examined. The samples were those with base polymers of VLDPE, ULDPE, EEA, EMA and EVA. Gamma ray irradiation, tensile test, chemi-luminescence measurement, and the determination of gel fraction and swelling rate were carried out. The results are reported, In no halogen materials, when ethylene system copolymer is used as the base polymer instead of PE, the composition with good radiation resistance can be obtained, and by combining amine oxidation inhibitor, it is further improved. (K.I.)

  13. Development of new radiation resistant, fire-retardant cables

    International Nuclear Information System (INIS)

    Hagiwara, Ko; Morita, Yosuke; Udagawa, Takashi; Fujimura, Shun-ichi; Oda, Eisuke.

    1982-01-01

    For the cables for nuclear facilities, radiation resistance and fire-retardation are severely required. The authors took note of the fact that even in the existing cables for nuclear power plants, their mechanical properties are greatly degraded by the exposure to large dose (for example, 200 Mrad in PWR testing conditions), and attempted the improvement. They employed a new additive, bromated acenaphthylene condensate (con-BACN), which effectively gives radiation resistance and also is a good flame retarder, to be compounded to an insulation material, and examined the characteristics. In this paper, the features of con-BACN and the investigation of fire-retardant EPDM composition are described. As an initial composition, a small amount of zinc white, sulphur, stearic acid, noclac 224 (Ouchi-Shinko Chemicals, Co.), and antimony trioxide, 100 parts of tale and 45 parts of con-BACN were added to 100 parts of EPDM (propylene content 34 %, Japan Synthetic Rubber Co.). As the antiaging agent, it was decided to use phenol series No. 3 as a result of test. The fire-retardant EP rubber-composed cable was produced for trial, its insulation being fabricated, using a Furukawa's pressurized salt bath continuous vulcanizer. The tests of γ-irradiation, simulated LOCA and combustion were carried out, and the test results are reported. It was indicated that the cable resisted against high dose several times as much as 200 Mrad, and was suitable for the applications, in which the mechanical properties such as bending are required to be maintained after radiation exposure. It was also found that con-BACN was safe, and its properties of decomposition, concentration and acute toxicity were all very low. (Wakatsuki, Y.)

  14. Analysis of QTL for resistance to radiation in rice

    International Nuclear Information System (INIS)

    Zhao Fei; Zhou Yifeng; Ren Sanjuan; Fu Junjie; Zhuang Jieyun; Shen Shengquan

    2010-01-01

    The recombinant inbred line (RIL) population derived from rice variates Zhenshan 97B/Miyang 46 and their genetic linkage maps were used to map QTLs controlling resistant to radiation. The trait was measured by the relative germination rate (RGR) and the relative surviving plant rate (RSPR) after the seeds of each line treated with γ-rays irradiation at two 350 and 550 Gy. The results indicated that the lines treated with γ-irradiation showed different performance in resistance to radiation. Under the treatment of 350 Gy, two QTLs with additive effects were detected, of which qRR (g) 81 was only significant for relative germination rate, and it had the positive additive effects from the male parent, explaining 6.53% of the total phenotypic variations. The qRR(s)2-2 was another significant one for relative surviving plant rate, whose positive effects came from the female parent,explaining 12.81% of the total phenotypic variations. Similarly, 4 QTLs were detected under irradiation dose of 550 Gy, and qRR(g)1-2 and qRR(g)8-2 were detected for relative germination rate, with positive effects coming from female and male parent,respectively,explaining 14.38% of the total variations. qRR(s)5-2 and qRR(s)10 were detected for relative surviving plant rate, with positive effects coming from the male parent, explaining 19.65% of total variations. Under different irradiation dose, 9 pairs of double QTL epistasis effects could be identified in this population. The results suggested that the expression of QTL with resistance to radiation might have relation with the irradiation dose. (authors)

  15. Radiation Resistance and Gain of Homogeneous Ring Quasi-Array

    DEFF Research Database (Denmark)

    Knudsen, H. L.

    1954-01-01

    In a previous paper homogeneous ring quasi-arrays of tangential or radial dipoles were introduced, i.e. systems of dipoles arranged equidistantly along a circle, the dipoles being oriented in tangential or radial directions and carrying currents with the same amplitude, but with a phase that incr......In a previous paper homogeneous ring quasi-arrays of tangential or radial dipoles were introduced, i.e. systems of dipoles arranged equidistantly along a circle, the dipoles being oriented in tangential or radial directions and carrying currents with the same amplitude, but with a phase...... that increases uniformly along the circle. Such quasi-arrays are azimuthally omnidirectional, and the radiated field will be mainly horizontally polarized and concentrated around the plane of the circle. In this paper expressions are obtained for the radiation resistance and the gain of homogeneous ring quasi...

  16. Radiation resistance of electro-optic polymer-based modulators

    International Nuclear Information System (INIS)

    Taylor, Edward W.; Nichter, James E.; Nash, Fazio D.; Haas, Franz; Szep, Attila A.; Michalak, Richard J.; Flusche, Brian M.; Cook, Paul R.; McEwen, Tom A.; McKeon, Brian F.; Payson, Paul M.; Brost, George A.; Pirich, Andrew R.; Castaneda, Carlos; Tsap, Boris; Fetterman, Harold R.

    2005-01-01

    Mach-Zehnder interferometric electro-optic polymer modulators composed of highly nonlinear phenyltetraene bridge-type chromophores within an amorphous polycarbonate host matrix were investigated for their resistance to gamma rays and 25.6 MeV protons. No device failures were observed and the majority of irradiated modulators exhibited decreases in half-wave voltage and optical insertion losses compared to nonirradiated control samples undergoing aging processes. Irradiated device responses were attributed to scission, cross-linking, and free volume processes. The data suggests that strongly poled devices are less likely to de-pole under the influence of ionizing radiation

  17. Radiation resistance of solar cells for space application, 1

    International Nuclear Information System (INIS)

    Mitsui, Hiroshi; Tanaka, Ryuichi; Sunaga, Hiromi

    1989-07-01

    A 50-μm thick ultrathin silicon solar cell and a 280-μm thick high performance AlGaAs/GaAs solar cell with high radiation resistance have been recently developed by National Space Development Agency of Japan (NASDA). In order to study the radiation resistance of these cells, a joint research was carried out between Japan Atomic Energy Research Institute (JAERI) and NASDA from 1984 through 1987. In this research, the irradiation method of electron beams, the effects of the irradiation conditions on the deterioration of solar cells by electron beams, and the annealing effects of the radiation damage in solar cells were investigated. This paper is the first one of a series of reports of the joint research. In this paper, the space radiation environment which artificial satellites will encounter, the solar cells used, and the experimental methods are described. In addition to these, the results of the study on the irradiation procedure of electron beams are reported. In the study of the irradiation method of electron beams, three methods, that is, the fixed irradiation method, the moving irradiation method, and the spot irradiation method were examined. In the fixed irradiation method and moving one, stationary solar cells and solar cells moving by conveyer were irradiated by scanning electron beams, respectively. On the other hand, in the spot irradiation method, stationary solar cells were irradiated by non-scanning steady electron beams. It was concluded that the fixed irradiation method was the most proper method. In addition to this, in this study, some pieces of information were obtained with respect to the changes in the electrical characteristics of solar cells caused by the irradiation of electron beams. (author) 52 refs

  18. Cross-resistance to radiation in human squamous cell carcinoma cells with induced cisplatin resistance

    International Nuclear Information System (INIS)

    Komori, Keiichi

    1998-01-01

    Accumulated evidence indicates that drug resistance is induced in tumor cells treated with a variety of anti-cancer drugs and that there is a possibility of cross-resistance to ionizing radiation associated with induced drug resistance. Most in vitro studies have shown inconsistent results on cross-resistance probably because of different cell lines used and protocols for drug induction. In this study, TE3 human squamous cell carcinoma cell line was treated with a 4-day cycle of cisplatin (cis-diamminedichloroplatinum (II); CDDP) at a concentration yielding 10% cell survival. The treatment was repeated up to 3 cycles. After treatment, cells were tested for CDDP and X-ray sensitivity. One cycle of CDDP treatment induced CDDP resistance with a factor of 1.41 and 2 cycles of the treatment with a factor of 1.86. The resistance factor reached a plateau at 3 cycles of treatment. For analyzing the correlation of CDDP and X-ray resistance, 30 clones from both untreated and 3-cycle treated cells were isolated and analyzed for CDDP and X-ray sensitivity. The sensitivity was expressed as the concentration of drug or dose of X-ray required to reduce the cell survival to x% (Dx). The correlation coefficient of clones with 3-cycle treatment between CDDP and X-ray sensitivity increased gradually by increasing the end point of Dx from D 10 to D 90 , resulting in significant correlation at D 90 . The result suggested that there is a certain common repair-related mechanism affecting both CDDP and X-ray resistance in CDDP-treated cells. (author)

  19. Improvement of radiation resistance for polytetrafluoroethylene(PTFE) by radiation cross-linking

    International Nuclear Information System (INIS)

    Oshima, Akihiro; Tabata, Yoneho; Ikeda, Shigetoshi; Seguchi, Tadao.

    1996-01-01

    The crosslinked polytetrafluoroethylene(PTFE) was prepared by electron beams irradiation technique in the molten state at 340degC ± 3degC in inert gas atmosphere. The crosslinking density was changed by the irradiation dose. The radiation resistance of crosslinked PTFE was investigated on the mechanical properties after irradiation by γ-rays at room temperature under vacuum and in air. The dose at half value of elongation at break was about 1MGy for 500kGy-crosslinked PTFE, while the dose for non-crosslinked PTFE was only 3.5kGy. It was found that the radiation resistance of PTFE was extremely improved by crosslinking. (author)

  20. A novel radiation-induced p53 mutation is not implicated in radiation resistance via a dominant-negative effect.

    Directory of Open Access Journals (Sweden)

    Yunguang Sun

    Full Text Available Understanding the mutations that confer radiation resistance is crucial to developing mechanisms to subvert this resistance. Here we describe the creation of a radiation resistant cell line and characterization of a novel p53 mutation. Treatment with 20 Gy radiation was used to induce mutations in the H460 lung cancer cell line; radiation resistance was confirmed by clonogenic assay. Limited sequencing was performed on the resistant cells created and compared to the parent cell line, leading to the identification of a novel mutation (del at the end of the DNA binding domain of p53. Levels of p53, phospho-p53, p21, total caspase 3 and cleaved caspase 3 in radiation resistant cells and the radiation susceptible (parent line were compared, all of which were found to be similar. These patterns held true after analysis of p53 overexpression in H460 cells; however, H1299 cells transfected with mutant p53 did not express p21, whereas those given WT p53 produced a significant amount, as expected. A luciferase assay demonstrated the inability of mutant p53 to bind its consensus elements. An MTS assay using H460 and H1299 cells transfected with WT or mutant p53 showed that the novel mutation did not improve cell survival. In summary, functional characterization of a radiation-induced p53 mutation in the H460 lung cancer cell line does not implicate it in the development of radiation resistance.

  1. Radiation resistance of paralytic shellfish poison (PSP) toxins

    Energy Technology Data Exchange (ETDEWEB)

    San Juan, Edith M

    2000-04-01

    Radiation resistance of paralytic shellfish poison (PSP) toxins, obtained from Pyrodinium bahamense var. compressum in shellstocks of green mussels, was determined by subjecting the semi-purified toxin extract as well as the shellstocks of green mussels to high doses of ionizing radiation of 5, 10, 15 and 20 kGy. The concentration of the PSP toxins was determined by the Standard Mouse Bioassay (SMB) method. The radiation assistance of the toxins was determined by plotting the PSP toxin concentration versus applied dose in a semilog paper. The D{sub 10} value or decimal reduction dose was obtained from the straight line which is the dose required to reduce the toxicity level by 90%. The effects of irradiation on the quality of green mussels in terms of its physico-chemical, microbiological and sensory attributes were also conducted. The effect of irradiation on the fatty acid components of green mussels was determined by gas chromatography. Radiation resistance of the PSP toxins was determined to be lower in samples with initially high toxicity level as compared with samples with initially low toxicity level. The D{sub 10} values of samples with initially high PSP level were 28.5 kGy in shellstocks of green musssels and 17.5 kGy in the semi-purified toxin extract. When the PSP level was low initially, the D{sub 10} values were as high as 57.5 and 43.5 kGy in shellstocks of green mussels for the two trials, and 43.0 kGy in semi-purified toxin extract. The microbial load of the irradiated mussels was remarkably reduced. No differnce in color and odor characteristics were observed in the mussel samples subjected to varying doses of ionizing radiation. There was darkening in the color of mussel meat and its juice. The concentration of the fatty acid components in the fresh green mussels were considerably higher as compared with those present in the irradiated mussels, though some volatile fatty acids were detected as a result of irradiation. (Author)

  2. Radiation resistance of paralytic shellfish poison (PSP) toxins

    International Nuclear Information System (INIS)

    San Juan, Edith M.

    2000-04-01

    Radiation resistance of paralytic shellfish poison (PSP) toxins, obtained from Pyrodinium bahamense var. compressum in shellstocks of green mussels, was determined by subjecting the semi-purified toxin extract as well as the shellstocks of green mussels to high doses of ionizing radiation of 5, 10, 15 and 20 kGy. The concentration of the PSP toxins was determined by the Standard Mouse Bioassay (SMB) method. The radiation assistance of the toxins was determined by plotting the PSP toxin concentration versus applied dose in a semilog paper. The D 10 value or decimal reduction dose was obtained from the straight line which is the dose required to reduce the toxicity level by 90%. The effects of irradiation on the quality of green mussels in terms of its physico-chemical, microbiological and sensory attributes were also conducted. The effect of irradiation on the fatty acid components of green mussels was determined by gas chromatography. Radiation resistance of the PSP toxins was determined to be lower in samples with initially high toxicity level as compared with samples with initially low toxicity level. The D 10 values of samples with initially high PSP level were 28.5 kGy in shellstocks of green musssels and 17.5 kGy in the semi-purified toxin extract. When the PSP level was low initially, the D 10 values were as high as 57.5 and 43.5 kGy in shellstocks of green mussels for the two trials, and 43.0 kGy in semi-purified toxin extract. The microbial load of the irradiated mussels was remarkably reduced. No differnce in color and odor characteristics were observed in the mussel samples subjected to varying doses of ionizing radiation. There was darkening in the color of mussel meat and its juice. The concentration of the fatty acid components in the fresh green mussels were considerably higher as compared with those present in the irradiated mussels, though some volatile fatty acids were detected as a result of irradiation. (Author)

  3. Development of radiation resistant magnets for JHF/J-PARC project

    CERN Document Server

    Tanaka, K H; Takahashi, H; Agari, K; Toyoda, A; Sato, Y; Minakawa, M; Noumi, H; Yamanoi, Y; Ieiri, M; Katoh, Y; Yamada, Y; Suzuki, Y; Takasaki, M; Birumachi, T; Tsukuda, S; Saitoh, Y; Saitô, N; Yahata, K; Kato, K; Tanaka, H; 10.1109/TASC.2004.829681

    2004-01-01

    A series of the R&D works on the radiation resistant magnets for the Japan Hadron Facility (JHF) project has been continued at the High Energy Accelerator Research Organization (KEK). The JHF is a high- energy part of the Japanese high intensity Particle Accelerator Research Complex (J-PARC), which is Japanese next-generation high- intensity accelerator project. The main JHF accelerator is the 50 GeV proton synchrotron and will provide high intensity 15 mu A proton beam for various nuclear and particle physics experiments. This time, the actual sized completely-inorganic radiation-resistant quadrupole magnet, designed for the 50 GeV proton beam transportation, was manufactured successfully by using mineral insulation magnet cable (MIC). The assembling procedure and the test results are presented in this issue. (8 refs).

  4. Radiation resistance in a melphalan-resistant subline of a rat mammary carcinoma

    International Nuclear Information System (INIS)

    Lehnert, S.; Vestergaard, J.; Batist, G.; Aloui-Jamali, M.A.

    1994-01-01

    A subline of a rat mammary carcinoma (MATB 13762), selected for resistance to melphalan, is cross-resistant to other alkylating drugs, to unrelated drugs and to ionizing radiation. The difference in radioresponse between the sensitive wild-type cell line and the melphalan- and radiation-resistant line (MLN r ) is related to the size of the α component in the linear-quadratic model. Reduction of dose rate does not affect the response of MLN r cells but does increase survival for wild-type cells. MLN r cells have elevated levels of reduced glutathione (GSH) and overexpress redox enzymes glutathione-S-transferase and glutathione peroxidase. Modest depletion of GSH (to 50% of control) radiosensitizes MLN r cells but not wild-type cells. On the basis of the results of an excitation assay, growth delay and tumor control experiments, MATB MLN r tumors are also more radioresistant than wild-type cells when irradiated in situ. However, wild-type cells irradiated shortly after excision of the tumor are much more radioresistant than the same cells irradiated 24 h after excision or maintained in culture, and their response resembles that of MLN r cells irradiated under the same conditions. These results suggest that, in spite of some similarity between the in vivo and in vitro observations, intrinsic radioresistance is not the most important factor influencing the response of MLN r cells in vivo. 22 refs., 7 figs., 4 tabs

  5. Radiation Resistant Hybrid Lotus Effect Photoelectrocatalytic Self-Cleaning Anti-Contamination Coatings, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This project will develop radiation resistant hybrid Lotus Effect photoelectrocatalytic self-cleaning anti-contamination coatings for application to Lunar...

  6. Radiation induction of drug resistance in RIF-1: Correlation of tumor and cell culture results

    International Nuclear Information System (INIS)

    Moulder, J.E.; Hopwood, L.E.; Volk, D.M.; Davies, B.M.

    1991-01-01

    The RIF-1 tumor line contains cells that are resistant to various anti-neoplastic drugs, including 5-fluorouracil (5FU), methotrexate (MTX), adriamycin (ADR), and etoposide (VP16). The frequency of these drug-resistant cells is increased after irradiation. The frequency of drug-resistant cells and the magnitude of radiation-induced drug resistance are different in cell culture than in tumors. The dose-response and expression time relationships for radiation induction of drug resistance observed in RIF-1 tumors are unusual.We hypothesize that at high radiation doses in vivo, we are selecting for cells that are both drug resistant and radiation resistant due to microenvironmental factors, whereas at low radiation doses in vivo and all radiation doses in vitro, we are observing true mutants. These studies indicate that there can be significant differences in drug-resistance frequencies between tumors and their cell lines of origin, and that radiation induction of drug resistance depends significantly on whether the induction is done in tumors or in cell culture. These results imply that theories about the induction of drug resistance that are based on cell culture studies may be inapplicable to the induction of drug resistance in tumors

  7. Parent-healthcare provider interaction during peripheral vein cannulation with resistive preschool children.

    Science.gov (United States)

    Svendsen, Edel Jannecke; Moen, Anne; Pedersen, Reidar; Bjørk, Ida Torunn

    2016-03-01

    The aim of this study was to increase understanding of parent-healthcare provider interaction in situations where newly admitted preschool children resist peripheral vein cannulation. Parent-healthcare provider interaction represents an important context for understanding children's resistance to medical procedures. Knowledge about this interaction can provide a better understanding of how restraint is used and talked about. Symbolic interactionism informed the understanding of interaction. An exploratory, qualitative study was chosen because little is known about these interactions. During 2012-2013, 14 naturalistic peripheral vein cannulation -attempts with six newly hospitalized preschool children were video recorded. Eight parents/relatives, seven physicians and eight nurses participated in this study. The analytical foci of turn-taking and participant structure were used. The results comprised three patterns of interactions. The first pattern, 'parents supported the interaction initiated by healthcare providers', was a response to the children's expressed resistance and they performed firm restraint together. The second pattern, 'parents create distance in interaction with healthcare providers', appeared after failed attempts and had a short time span. Parents stopped following up on the healthcare providers' interaction and their restraint became less firm. In the third pattern, 'healthcare providers reorient in interaction', healthcare providers took over more of the restraint and either helped each other to continue the interaction or they stopped it. Knowledge about the identified patterns of interactions can help healthcare providers to better understand and thereby prepare both parents and themselves for situations with potential use of restraint. © 2015 John Wiley & Sons Ltd.

  8. Durability of certain configurations for providing skid resistance on concrete pavements.

    Science.gov (United States)

    1974-01-01

    The main objective of this study was to establish the factors that influence the durability of the surface configurations that are used or can be used to provide high and long lasting skid resistance for portland cement concrete pavements. In the dev...

  9. Gamma radiation shielding materials improved with burning resistance

    International Nuclear Information System (INIS)

    Nakamura, Michio; Nakamura, Ken-ichi; Yukawa, Katsunori.

    1985-01-01

    Purpose: To obtain gamma irradiation shielding materials excellent in workability and resistant to burning by using a two component type room temperature vulcanizing silicon rubber composition as the base material. Method: Silicon rubber comprising a diorganopolysiloxane polymer, an alkyl silicate as a crosslinker and a suitable sulfurdizing catalyst, for example, a carboxylate is mixed with iron powder and silicon oxide powder as reinforcing and flame retardant material and applied with molding. The iron powder and the silica rocks powder have grain size of 50 - 150 μm and 1 - 70 μm and charged by the amount of from 55 to 60 % by weight and from 20 to 25 % by weight respectively. The fluidizing property is impaired if the particle size of the silica rocks powder is less than 1 μm and, while on the other hand, no desired specific gravity of a predetermined value can be obtained for the molding product if the filled amount of the iron powder is less than 55 %. The oxygen index of the molding product is 45 to improve the burning resistance. The materials are excellent in the air-tightness, gamma radiation shielding performance, elasticity and workability required for the cable penetrations in a nuclear power plant and they generate noxious gases neither. (Kawakami, Y.)

  10. The radiation resistance of thermoset plastics: Pt. 1

    International Nuclear Information System (INIS)

    Gilfrich, H.-P.; Roesinger, S.; Wilski, H.

    1991-01-01

    Not much is known about the influence of ionising radiation on thermoset plastics. In particular the influence of the dose rate on the radiation resistance has not yet been investigated. To get more information about this subject we have irradiated a number of thermoset plastics of different chemical compositions in two ways: irradiation with electrons at a high dose rate and under exclusion of oxygen and irradiation at an extremely low dose rate in air with the γ-rays of a cobalt-60 source. The latter experiment lasting over a period of 10 years (and in some cases even 16 years). In this first part of our report we describe the experimental conditions as well as the results obtained using two phenolic plastics with different inorganic fillers. In no case did we find any improvement in the properties tested. The mechanical properties deteriorated at high doses, the effects being particularly noticeable in long term experiments. Both materials became more sensitive to the influence of heat and humidity. A relatively reliable extrapolation of the results to a working period of 50 years seems to be possible. (author)

  11. Autophagy contributes to resistance of tumor cells to ionizing radiation.

    Science.gov (United States)

    Chaachouay, Hassan; Ohneseit, Petra; Toulany, Mahmoud; Kehlbach, Rainer; Multhoff, Gabriele; Rodemann, H Peter

    2011-06-01

    Autophagy signaling is a novel important target to improve anticancer therapy. To study the role of autophagy on resistance of tumor cells to ionizing radiation (IR), breast cancer cell lines differing in their intrinsic radiosensitivity were used. Breast cancer cell lines MDA-MB-231 and HBL-100 were examined with respect to clonogenic cell survival and induction of autophagy after radiation exposure and pharmacological interference of the autophagic process. As marker for autophagy the appearance of LC3-I and LC3-II proteins was analyzed by SDS-PAGE and Western blotting. Formation of autophagic vacuoles was monitored by immunofluorescence staining of LC3. LC3-I and LC3-II formation differs markedly in radioresistant MDA-MB-231 versus radiosensitive HBL-100 cells. Western blot analyses of LC3-II/LC3-I ratio indicated marked induction of autophagy by IR in radioresistant MDA-MB-231 cells, but not in radiosensitive HBL-100 cells. Indirect immunofluorescence analysis of LC3-II positive vacuoles confirmed this differential effect. Pre-treatment with 3-methyladenine (3-MA) antagonized IR-induced autophagy. Likewise, pretreatment of radioresistant MDA-231 cells with autophagy inhibitors 3-MA or chloroquine (CQ) significantly reduced clonogenic survival of irradiated cells. Our data clearly indicate that radioresistant breast tumor cells show a strong post-irradiation induction of autophagy, which thus serves as a protective and pro-survival mechanism in radioresistance. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  12. DNA from radiation resistant human tumor cells transfers resistance to NIH/3T3 cells with varying degrees of penetrance

    International Nuclear Information System (INIS)

    Kasid, U.; Dritschilo, A.; Weichselbaum, R.

    1987-01-01

    Experimental evidence suggests that clinical radiation resistance may correlate with in vitro radiation survival parameters. Specifically, they isolated several cell lines from radioresistant head and neck carcinomas with D/sub 0/ values greater than 2 Gy. The authors co-transfected DNA from cell line SQ2OB (D/sub 0/ = 2.4 Gy) with the rhoSVNeO plasmid into NIH/3T3 cells (D/sub 0/ = 1.7 Gy). Antibiotic G418 resistant, transformed clones were isolated and confirmed by Southern blotting to contain human alu, as well as rhoSVNeO sequences. Screening for radiation resistance with 8Gy (Cs-137) revealed that 3 of 4 tested hybrid clones show a radiation survival intermediate between NIH/3T3 and SQ2OB. This suggests that radiation resistance is a dominant, transfectable phenotype of mammalian cells and can be expressed in more sensitive cells. Karyotyping of resistant hybrid clones shows the presence of double minute chromosomes. Secondary transfection results and experiments to clone the genetic factors responsible for radiation resistance are in progress and results will be reported

  13. Assessment of the radiation resistance of some aromatic polyesters

    International Nuclear Information System (INIS)

    Choi, E.J.; Hill, D.J.T.; Kim, K.Y.

    1998-01-01

    Full text: For many applications, polyesters have more useful properties than vinyl polymers, and they can be degraded to their monomer components and recycled. In addition, aromatic polyesters are known to display a resistance to high temperatures and high-energy ionizing radiation. Recently, we have reported the γ-radiolysis for some aromatic polyesters at low radiation dose; The G-values of radical formation at 77 K were determined to be in the range 0.38∼0.46 for the polyesters of bisphenol A with fluorine substitution at isopropylidene units and in the range 0.71∼1.18 for the polyesters of halogenated bisphenol A with decamethylene segments. While the radiation sensitivities of the latter polymers were dependent on the position and content of halogen substitution, those of the former polymers were slightly dependent on these factors as assessed by the G-values at 77 K. We also have studied the radiolysis of the commercial aromatic polyesters (UP) and polycarbonate (PC). UP has been found to be more radiation stable than PC with respect to the total yield of radicals formed. The G-values for radical formation at 77K was determined to be 0.31 and 0.5 for UP and PC, respectively. In this work, we have prepared poly(ethylene-, butylene- or decalene-terephthalate)s (PET, PBT or PDT) and poly(ethylene-, buthylene- or decalene-2,6-naphthalenedicarboxylate)s (PEN, PBN or PDN) by standard melt polymerization methods, and have examined their γ-radiolysis at 77 K or room temperature, and in vacuum or air, through the applications of ESR spectroscopy and thermal analysis. Inherent viscosities of the polyesters used for the radiation studies were in the range of 0.16∼0.69 dL/g. The values of G(R) indicates that PEN-related polymers have more radiation stable than PET-related polymers and the E, B and D order is one of decreasing stability as one might expect. The significant decrease in the G(R)-values of the polyester being in the range of 0.1∼0.41 at 77 K by

  14. Highly radiation-resistant vacuum impregnation resin systems for fusion magnet insulation

    International Nuclear Information System (INIS)

    Fabian, P.E.; Munshi, N.A.; Denis, R.J.

    2002-01-01

    Magnets built for fusion devices such as the newly proposed Fusion Ignition Research Experiment (FIRE) need to be highly reliable, especially in a high radiation environment. Insulation materials are often the weak link in the design of superconducting magnets due to their sensitivity to high radiation doses, embrittlement at cryogenic temperatures, and the limitations on their fabricability. An insulation system capable of being vacuum impregnated with desirable properties such as a long pot-life, high strength, and excellent electrical integrity and which also provides high resistance to radiation would greatly improve magnet performance and reduce the manufacturing costs. A new class of insulation materials has been developed utilizing cyanate ester chemistries combined with other known radiation-resistant resins, such as bismaleimides and polyimides. These materials have been shown to meet the demanding requirements of the next generation of devices, such as FIRE. Post-irradiation testing to levels that exceed those required for FIRE showed no degradation in mechanical properties. In addition, the cyanate ester-based systems showed excellent performance at cryogenic temperatures and possess a wide range of processing variables, which will enable cost-effective fabrication of new magnets. This paper details the processing parameters, mechanical properties at 76 K and 4 K, as well as post-irradiation testing to dose levels surpassing 10 8 Gy

  15. Development of new radiation resistant, fire-retardant cables. [Gamma radiation

    Energy Technology Data Exchange (ETDEWEB)

    Hagiwara, Ko; Morita, Yosuke; Udagawa, Takashi (Japan Atomic Energy Research Inst., Takasaki, Gunma. Takasaki Radiation Chemistry Research Establishment); Fujimura, Shun-ichi; Oda, Eisuke

    1982-12-01

    For the cables for nuclear facilities, radiation resistance and fire-retardation are severely required. The authors took note of the fact that even in the existing cables for nuclear power plants, their mechanical properties are greatly degraded by the exposure to large dose (for example, 200 Mrad in PWR testing conditions), and attempted the improvement. They employed a new additive, bromated acenaphthylene condensate (con-BACN), which effectively gives radiation resistance and also is a good flame retarder, to be compounded to an insulation material, and examined the characteristics. In this paper, the features of con-BACN and the investigation of fire-retardant EPDM composition are described. As an initial composition, a small amount of zinc white, sulphur, stearic acid, noclac 224 (Ouchi-Shinko Chemicals, Co.), and antimony trioxide, 100 parts of tale and 45 parts of con-BACN were added to 100 parts of EPDM (propylene content 34 %, Japan Synthetic Rubber Co.). As the antiaging agent, it was decided to use phenol series No. 3 as a result of test. The fire-retardant EP rubber-composed cable was produced for trial, its insulation being fabricated, using a Furukawa's pressurized salt bath continuous vulcanizer. The tests of ..gamma..-irradiation, simulated LOCA and combustion were carried out, and the test results are reported. It was indicated that the cable resisted against high dose several times as much as 200 Mrad, and was suitable for the applications, in which the mechanical properties such as bending are required to be maintained after radiation exposure. It was also found that con-BACN was safe, and its properties of decomposition, concentration and acute toxicity were all very low.

  16. Low level radiation: how does the linear without threshold model provide the safety of Canadian

    International Nuclear Information System (INIS)

    Anon.

    2010-01-01

    The linear without threshold model is a model of risk used worldwide by the most of health organisms of nuclear regulation in order to establish dose limits for workers and public. It is in the heart of the approach adopted by the Canadian commission of nuclear safety (C.C.S.N.) in matter of radiation protection. The linear without threshold model presumes reasonably it exists a direct link between radiation exposure and cancer rate. It does not exist scientific evidence that chronicle exposure to radiation doses under 100 milli sievert (mSv) leads harmful effects on health. Several scientific reports highlighted scientific evidences that seem indicate a low level of radiation is less harmful than the linear without threshold predicts. As the linear without threshold model presumes that any radiation exposure brings risks, the ALARA principle obliges the licensees to get the radiation exposure at the lowest reasonably achievable level, social and economical factors taken into account. ALARA principle constitutes a basic principle in the C.C.S.N. approach in matter of radiation protection; On the radiation protection plan, C.C.S.N. gets a careful approach that allows to provide health and safety of Canadian people and the protection of their environment. (N.C.)

  17. A compensatory mutation provides resistance to disparate HIV fusion inhibitor peptides and enhances membrane fusion.

    Directory of Open Access Journals (Sweden)

    Matthew P Wood

    Full Text Available Fusion inhibitors are a class of antiretroviral drugs used to prevent entry of HIV into host cells. Many of the fusion inhibitors being developed, including the drug enfuvirtide, are peptides designed to competitively inhibit the viral fusion protein gp41. With the emergence of drug resistance, there is an increased need for effective and unique alternatives within this class of antivirals. One such alternative is a class of cyclic, cationic, antimicrobial peptides known as θ-defensins, which are produced by many non-human primates and exhibit broad-spectrum antiviral and antibacterial activity. Currently, the θ-defensin analog RC-101 is being developed as a microbicide due to its specific antiviral activity, lack of toxicity to cells and tissues, and safety in animals. Understanding potential RC-101 resistance, and how resistance to other fusion inhibitors affects RC-101 susceptibility, is critical for future development. In previous studies, we identified a mutant, R5-tropic virus that had evolved partial resistance to RC-101 during in vitro selection. Here, we report that a secondary mutation in gp41 was found to restore replicative fitness, membrane fusion, and the rate of viral entry, which were compromised by an initial mutation providing partial RC-101 resistance. Interestingly, we show that RC-101 is effective against two enfuvirtide-resistant mutants, demonstrating the clinical importance of RC-101 as a unique fusion inhibitor. These findings both expand our understanding of HIV drug-resistance to diverse peptide fusion inhibitors and emphasize the significance of compensatory gp41 mutations.

  18. The identification of aluminium-resistance genes provides opportunities for enhancing crop production on acid soils.

    Science.gov (United States)

    Ryan, P R; Tyerman, S D; Sasaki, T; Furuichi, T; Yamamoto, Y; Zhang, W H; Delhaize, E

    2011-01-01

    Acid soils restrict plant production around the world. One of the major limitations to plant growth on acid soils is the prevalence of soluble aluminium (Al(3+)) ions which can inhibit root growth at micromolar concentrations. Species that show a natural resistance to Al(3+) toxicity perform better on acid soils. Our understanding of the physiology of Al(3+) resistance in important crop plants has increased greatly over the past 20 years, largely due to the application of genetics and molecular biology. Fourteen genes from seven different species are known to contribute to Al(3+) tolerance and resistance and several additional candidates have been identified. Some of these genes account for genotypic variation within species and others do not. One mechanism of resistance which has now been identified in a range of species relies on the efflux of organic anions such as malate and citrate from roots. The genes controlling this trait are members of the ALMT and MATE families which encode membrane proteins that facilitate organic anion efflux across the plasma membrane. Identification of these and other resistance genes provides opportunities for enhancing the Al(3+) resistance of plants by marker-assisted breeding and through biotechnology. Most attempts to enhance Al(3+) resistance in plants with genetic engineering have targeted genes that are induced by Al(3+) stress or that are likely to increase organic anion efflux. In the latter case, studies have either enhanced organic anion synthesis or increased organic anion transport across the plasma membrane. Recent developments in this area are summarized and the structure-function of the TaALMT1 protein from wheat is discussed.

  19. Estimation of interface resistivity in bonded Si for the development of high performance radiation detectors

    International Nuclear Information System (INIS)

    Kanno, Ikuo; Yamashita, Makoto; Nomiya, Seiichiro; Onabe, Hideaki

    2007-01-01

    For the development of high performance radiation detectors, direct bonding of Si wafers would be an useful method. Previously, p-n bonded Si were fabricated and they showed diode characteristics. The interface resistivity was, however, not investigated in detail. For the study of interface resistivity, n-type Si wafers with different resistivities were bonded. The resistivity of bonded Si wafers were measured and the interface resistivity was estimated by comparing with the results of model calculations. (author)

  20. The solar ultraviolet B radiation protection provided by shading devices with regard to its diffuse component.

    Science.gov (United States)

    Kudish, Avraham I; Harari, Marco; Evseev, Efim G

    2011-10-01

    The composition of the incident solar global ultraviolet B (UVB) radiation with regard to its beam and diffuse radiation fractions is highly relevant with regard to outdoor sun protection. This is especially true with respect to sun protection during leisure-time outdoor sun exposure at the shore and pools, where people tend to escape the sun under shade trees or different types of shading devices, e.g., umbrellas, overhangs, etc., believing they offer protection from the erythemal solar radiation. The degree of sun protection offered by such devices is directly related to the composition of the solar global UVB radiation, i.e., its beam and diffuse fractions. The composition of the incident solar global UVB radiation can be determined by measuring the global UVB (using Solar Light Co. Inc., Model 501A UV-Biometer) and either of its components. The beam component of the UVB radiation was determined by measuring the normal incidence beam radiation using a prototype, tracking instrument consisting of a Solar Light Co. Inc. Model 501A UV-Biometer mounted on an Eppley Solar Tracker Model St-1. The horizontal beam component of the global UVB radiation was calculated from the measured normal incidence using a simple geometric correlation and the diffuse component is determined as the difference between global and horizontal beam radiations. Horizontal and vertical surfaces positioned under a horizontal overhang/sunshade or an umbrella are not fully protected from exposure to solar global UVB radiation. They can receive a significant fraction of the UVB radiation, depending on their location beneath the shading device, the umbrella radius and the albedo (reflectance) of the surrounding ground surface in the case of a vertical surface. Shading devices such as an umbrella or horizontal overhang/shade provide relief from the solar global radiation and do block the solar global UVB radiation to some extent; nevertheless, a significant fraction of the solar global UVB

  1. Radiation-resistance of polyurethane pipes for cooling liquid in BES III

    International Nuclear Information System (INIS)

    Li Xunfeng; Zheng Lifang; Ji Quan; Wu Ping; Wang Li

    2009-01-01

    Gamma ray radiation and neutron radiation are predominant in the working conditions of BES III, and the radiation-resistance aging of polyurethane pipes is very important in this condition, as the pipes of cooling liquid for beam pipe and SCQ (superconducting quadrupole) vacuum pipe in BESIII. Polyester polyurethane pipes and polyether polyurethane pipes were irradiated by gamma ray and neutron. The radiation doses were as much as ten years' doses in BES. Pressure test, FTIR and thermal analysis were used to study the radiation-resistance of these two kinds of polyurethane pipes. The results show that the radiation-resistance and thermal stability of polyester polyurethane pipes are prior to those of polyether polyurethane pipes, and the pressure resistance of polyester polyurethane pipes is almost maintained after the irradiation by gamma ray and neutron, but the polyether polyurethane pipes can be aged and ruptured after the irradiation by neutron. (authors)

  2. Role of Mn2+ and Compatible Solutes in the Radiation Resistance of Thermophilic Bacteria and Archaea

    OpenAIRE

    Webb, Kimberly M.; DiRuggiero, Jocelyne

    2012-01-01

    Radiation-resistant bacteria have garnered a great deal of attention from scientists seeking to expose the mechanisms underlying their incredible survival abilities. Recent analyses showed that the resistance to ionizing radiation (IR) in the archaeon Halobacterium salinarum is dependent upon Mn-antioxidant complexes responsible for the scavenging of reactive oxygen species (ROS) generated by radiation. Here we examined the role of the compatible solutes trehalose, mannosylglycerate, and di-m...

  3. Radiation-resistance test on optical fiber for artificial satellite

    International Nuclear Information System (INIS)

    Morita, Yosuke; Seguchi, Tadao; Mori, Tatsuo; Miyaji, Yuji.

    1985-01-01

    Radiation resistance of a prototype optical fiber for use in artificial satellites is investigated under a long-term irradiation of gamma rays at relatively low dose rates. The optical fiber tested is composed of a pure silica core and an F-doped cladding. Various aspects of the relations between induced loss and irradiation time are observed and results obtained are discussed. It is generally accepted that a satellite and its equipment should be resistant to a total dose of about 1 x 10 6 rad. In the present test, accordingly, gamma ray irradiation is performed up to a total dose of 1 x 10 6 rad at a dose rate of 1 x 10 4 rad/h (for 100 h), 3 x 10 3 rad/h (333 h) and 1 x 10 3 rad/h (1000 h), and it is shown that the loss induced in this fiber at these dose rates is 23.6 - 27.2, 16.9 - 21.6 and 12.5 - 13.5 dB/km, respectively. On the other hand, it has been reported that the loss induced at the dose rate of 1 x 10 6 rad/h (1 h) is about 600 dB/km, which is much larger than the above values. From these results, the loss at a dose rate of 100 rad/h, which would be expected in a satellite, is estimated at about 10 dB/km. It is concluded that this prototype fiber has a sufficient capability for satellite use with respect to induced loss. (Nogami, K.)

  4. Transfer of innate resistance and susceptibility to Leishmania donovani infection in mouse radiation bone marrow chimaeras

    Energy Technology Data Exchange (ETDEWEB)

    Crocker, P.R.; Blackwell, J.M.; Bradley, D.J. (London School of Hygiene and Tropical Medicine (UK))

    1984-07-01

    Reciprocal radiation bone marrow chimaeras were made between H-2-compatible strains of mice innately resistant or susceptible to visceral leishmaniasis. In initial experiments, susceptibility but not resistance to Leishmania donovani could be transferred with donor bone marrow into irradiated recipients. In subsequent experiments it was possible to transfer both resistance and susceptibility. This was achieved either by selecting more radiosensitive mouse strains as susceptible recipients, or alternatively by increasing the irradiation dose for the susceptible recipients used in the initial experiments. Using the higher irradiation dose, successful transfer of resistance and susceptibility between congenic mice carrying the Lshsup(r) and Lshsup(s) alleles on the more radioresistant B10 genetic background provided firm evidence that the results obtained in this study were specifically related to expression of the Lsh gene. It is concluded that Lsh gene-controlled resistance and susceptibility to L. donovani is determined by bone marrow-derived cells. The cell type(s) involved is likely to be of the macrophage lineage.

  5. Transfer of innate resistance and susceptibility to Leishmania donovani infection in mouse radiation bone marrow chimaeras

    International Nuclear Information System (INIS)

    Crocker, P.R.; Blackwell, J.M.; Bradley, D.J.

    1984-01-01

    Reciprocal radiation bone marrow chimaeras mere made between H-2-compatible strains of mice innately resistant or susceptible to visceral leishmaniasis. In initial experiments, susceptibility but not resistance to Leishmania donovani could be transferred with donor bone marrow into irradiated recipients. In subsequent experiments it was possible to transfer both resistance and susceptibility. This was achieved either by selecting more radiosensitive mouse strains as susceptible recipients, or alternatively by increasing the irradiation dose for the susceptible recipients used in the initial experiments. Using the higher irradiation dose, successful transfer of resistance and susceptibility between congenic mice carrying the Lshsup(r) and Lshsup(s) alleles on the more radioresistant B10 genetic background provided firm evidence that the results obtained in this study were specifically related to expression of the Lsh gene. It is concluded that Lsh gene-controlled resistance and susceptibility to L. donovani is determined by bone marrow-derived cells. The cell type(s) involved is likely to be of the macrophage lineage. (author)

  6. Ultrastructural investigation on radiation resistant microbial isolates of bacillus coagulans

    International Nuclear Information System (INIS)

    Tawfik, Z.S.

    1992-01-01

    Radiation resistant strains of bacillus coagulans were isolated from environmental atmospheric surrounding industrial cobalt-60 irradiator. D 1 0 value of the studied isolate was found to be 3.3 KGy. Ultrastructure studies were performed on control isolates as well as on isolates exposed to challenging doses of 12, 15 and 25 KGy. These dose values were delivered at two different dose rate values 40 Gy/min and 300 Gy/min. Ultrastructure studies showed small differences due to dose rate effect. These differences were not sufficient to cause lethality changes. It was demonstrated that the growing effect of dose value is concentrated on cellular material rather than on cellular membrane damages. The severeness of cell damage, due to received dose increase, was also demonstrated. Results suggest that repeated sub culturing may lead to repair of cell damage when it is subjected to sub sterilizing doses. This fact is of special interest when the sterilizing dose might be splitted in more than one fraction at different latent periods

  7. Atomistic simulations of the radiation resistance of oxides

    International Nuclear Information System (INIS)

    Chartier, A.; Van Brutzel, L.; Crocombette, J.-P.

    2012-01-01

    Fluorite compounds such as urania and ceria, or related compounds such as pyrochlores and also spinels show different behaviors under irradiations, which ranges from perfect radiation resistance to crystalline phase change or even complete amorphization depending on their structure and/or their composition. Displacement cascades – dedicated to the understanding of the ballistic regime and performed by empirical potentials molecular dynamics simulations – have revealed that the remaining damages of the above mentioned oxides are reduced to point defects unlike what is observed in zircon and zirconolite, which directly amorphize during the cascade. The variable behavior of these point defects is the key of the various responses of these materials to irradiations. This behavior can be investigated by two specific molecular dynamics methodologies that will be reviewed here: (i) the method of point defects accumulation as a function of temperature that gives access to the dose effects and to the critical doses for amorphization; (ii) the study Frenkel pairs life-time – i.e. their time of recombination as function of temperature – that may be used as a tool to understand the results obtained in displacements cascades or to identify the microscopic mechanisms responsible for the amorphization/re-crystallization during the point defects accumulations.

  8. Radiation resistance of cable insulation and jacket materials for nuclear power plants

    International Nuclear Information System (INIS)

    Morita, Minoru; Kon, Shuji; Nishikawa, Ichiro

    1978-01-01

    The cables for use in nuclear power plants are required to satisfy the specific environmental resistance and excellent flame resistance as stipulated in IEEE Std. 383. The materials to be used to cables intended for this specific purpose of use must therefore be strictly tested so as to evaluate their flame resistance in addition to compliance with various environmental requirements, such as heat resistance, water-vapor resistance, and radiation resistance. This paper describes general information on radiation resistance and deterioration of various high-molecular materials, suggests the direction of efforts to be made to improve their properties including flame resistance of various rubber and plastic materials for cables to be used in nuclear power plants, and indicates the performance characteristics of such materials. (author)

  9. An oncofetal glycosaminoglycan modification provides therapeutic access to Cisplatin-resistant bladder cancer

    DEFF Research Database (Denmark)

    Seiler, Roland; Oo, Htoo Zarni; Tortora, Davide

    2017-01-01

    the malaria parasite Plasmodium falciparum, we can target these sugar chains, and our results showed a significant antitumor effect in cisplatin-resistant bladder cancer. This novel treatment paradigm provides therapeutic access to bladder cancers not responding to cisplatin.......BACKGROUND: Although cisplatin-based neoadjuvant chemotherapy (NAC) improves survival of unselected patients with muscle-invasive bladder cancer (MIBC), only a minority responds to therapy and chemoresistance remains a major challenge in this disease setting. OBJECTIVE: To investigate the clinical...... significance of oncofetal chondroitin sulfate (ofCS) glycosaminoglycan chains in cisplatin-resistant MIBC and to evaluate these as targets for second-line therapy. DESIGN, SETTING, AND PARTICIPANTS: An ofCS-binding recombinant VAR2CSA protein derived from the malaria parasite Plasmodium falciparum (rVAR2...

  10. Development of high voltage PEEK wire with radiation-resistance and cryogenic characteristics

    International Nuclear Information System (INIS)

    Fujita, T.; Hirata, T.; Araki, S.; Ohara, H.; Nishimura, H.

    1989-01-01

    High voltage electric wires insulated with highly-refined polyetheretherketone (PEEK) have been developed for the wiring in fusion reactors, where the wire is required to withstand high voltage under high vacuum up to 10 -5 Torr. The PEEK wires having the advantages of PEEK resin including superior radiation resistance and cryogenic characteristics are usable over a wide range of temperature and in radiation fields. The results of withstand voltage tests proved that the PEEK wires exceeding 0.8 mm in insulation thickness withstand such specified high voltage conditions as 24 kV for 1 minutes by 10 times and 6.6 kV for 110 hours. The results also revealed that the withstand voltage is improved by providing a jacket layer over the insulation and decreased by periodical voltage charge, by bending of the specimen and by water in the conductor. This paper deal with the withstand voltage test results under varied conditions of the PEEK wires. (author)

  11. An algorithm to provide UK global radiation for use with models

    International Nuclear Information System (INIS)

    Hamer, P.J.C.

    1999-01-01

    Decision support systems which include crop growth models require long-term average values of global radiation to simulate future expected growth. Global radiation is rarely available as there are relatively few meteorological stations with long-term records and so interpolation between sites is difficult. Global radiation data across a good geographical spread throughout the UK were obtained and sub-divided into ‘coastal’ and ‘inland’ sites. Monthly means of global radiation (S) were extracted and analysed in relation to irradiance in the absence of atmosphere (S o ) calculated from site latitude and the time of year. The ratio S/S o was fitted to the month of the year (t) and site latitude using a nonlinear fit function in which 90% of the variance was accounted for. An algorithm is presented which provides long-term daily values of global radiation from information on latitude, time of year and whether the site is inland or close to the coast. (author)

  12. Genetic study of resistance to inhibitory effects of UV radiation in rice (Oryza sativa)

    International Nuclear Information System (INIS)

    Sato, T.; Kang, H.S.; Kumagai, T.

    1994-01-01

    Genetic analysis of resistance to the inhibitory effects of UV radiation on growth of rice (Oryza sativa L.) cultivars was carried out. Some experimental plants were grown in visible radiation supplemented with UV radiation containing a large amount of UV-B and a small amount of UV-C in a phytotron, while others were grown without UV radiation. The degree of resistance to UV radiation was estimated in terms of the degree of reduction caused by supplemental UV radiation in the fresh weight of the aboveground plant parts and the chlorophyll content per unit fresh weight. Fresh weight and chlorophyll content in F 2 plants generated by reciprocally crossing cv. Sasanishiki, a cultivar more resistant to UV radiation, and Norin 1, a cultivar less resistant to such radiation exhibited a normal frequency distribution. The heritabilities of these two properties in F 2 plants were low under conditions of non-supplemental UV radiation. Under elevated UV radiation, the F 2 population shifted to the lower range of fresh weight and chlorophyll content, and the means were close to those of Norin 1. The heritabilities of these two properties were the same in the reciprocal crosses, indicating that maternal inheritance was not involved. Inheritance of chlorophyll content per unit fresh weight was further determined in F 3 lines generated by self-fertilizing F 2 plants of Sasanishiki and Norin 1. The results showed that the F 3 population was segregated into three genotypes, namely, resistant homozygotes, segregated heterozygotes and sensitive homozygotes, with a ratio of 1:65:16. It was thus evident that the resistance to the inhibitory effect of elevated UV radiation in these rice plants was controlled by recessive polygenes. (author)

  13. NVENTIONS IN THE NANOTECHNOLOGICAL AREA PROVIDE INCREASED RESISTANCE OF CONSTRUCTION MATERIALS AND PRODUCTS TO OPERATIONAL LOAD

    Directory of Open Access Journals (Sweden)

    VLASOV Vladimir Alexeevich

    2013-12-01

    Full Text Available The invention «Dispersion of Carbon Nanotubes (RU 2494961» can be used in production of modifying additives for construction materials. Dispersion of carbon nanotubes contains, mass %: carbon nanotubes 1–20; surface active agent – sodium chloride of sulfonated derived naphthalene 1–20; fumed silica 5–15; water – the rest. Dispersion can additionally contain ethylene glycol as antifreeze. Dispersion is steady in storage, it is soluble in water, provides increased strength of construction materials. Invention «Building Structures Reinforcement Composition (RU 2493337» can beused in construction to reinforce concrete, brick and masonry structures. Composition contains glass or basalt roving taken in quantity 90÷100 parts by weight, soaked in polymer binder based on epoxy taken in quantity 0,001÷1,5 parts by weight. This invention provides high resistance to operational load.

  14. Radiation exposure during CT-guided biopsies: recent CT machines provide markedly lower doses.

    Science.gov (United States)

    Guberina, Nika; Forsting, Michael; Ringelstein, Adrian; Suntharalingam, Saravanabavaan; Nassenstein, Kai; Theysohn, Jens; Wetter, Axel

    2018-03-28

    To examine radiation dose levels of CT-guided interventional procedures of chest, abdomen, spine and extremities on different CT-scanner generations at a large multicentre institute. 1,219 CT-guided interventional biopsies of different organ regions ((A) abdomen (n=516), (B) chest (n=528), (C) spine (n=134) and (D) extremities (n=41)) on different CT-scanners ((I) SOMATOM-Definition-AS+, (II) Volume-Zoom, (III) Emotion6) were included from 2013-2016. Important CT-parameters and standard dose-descriptors were retrospectively examined. Additionally, effective dose and organ doses were calculated using Monte-Carlo simulation, following ICRP103. Overall, radiation doses for CT interventions are highly dependent on CT-scanner generation: the newer the CT scanner, the lower the radiation dose imparted to patients. Mean effective doses for each of four procedures on available scanners are: (A) (I) 9.3mSv versus (II) 13.9mSv (B) (I) 7.3mSv versus (III) 11.4mSv (C) (I) 6.3mSv versus (II) 7.4mSv (D) (I) 4.3mSv versus (II) 10.8mSv. Standard dose descriptors [standard deviation (SD); CT dose index vol (CTDI vol ); dose-length product (DLP body ); size-specific dose estimate (SSDE)] were also compared. Effective dose, organ doses and SSDE for various CT-guided interventional biopsies on different CT-scanner generations following recommendations of the ICRP103 are provided. New CT-scanner generations involve markedly lower radiation doses versus older devices. • Effective dose, organ dose and SSDE are provided for CT-guided interventional examinations. • These data allow identifying organs at risk of higher radiation dose. • Detailed knowledge of radiation dose may contribute to a better individual risk-stratification. • New CT-scanner generations involve markedly lower radiation doses compared to older devices.

  15. Experimental shielding evaluation of the radiation protection provided by the structurally significant components of residential structures.

    Science.gov (United States)

    Dickson, E D; Hamby, D M

    2014-03-01

    The human health and environmental effects following a postulated accidental release of radioactive material to the environment have been a public and regulatory concern since the early development of nuclear technology. These postulated releases have been researched extensively to better understand the potential risks for accident mitigation and emergency planning purposes. The objective of this investigation is to provide an updated technical basis for contemporary building shielding factors for the US housing stock. Building shielding factors quantify the protection from ionising radiation provided by a certain building type. Much of the current data used to determine the quality of shielding around nuclear facilities and urban environments is based on simplistic point-kernel calculations for 1950s era suburbia and is no longer applicable to the densely populated urban environments realised today. To analyse a building's radiation shielding properties, the ideal approach would be to subject a variety of building types to various radioactive sources and measure the radiation levels in and around the building. While this is not entirely practicable, this research analyses the shielding effectiveness of ten structurally significant US housing-stock models (walls and roofs) important for shielding against ionising radiation. The experimental data are used to benchmark computational models to calculate the shielding effectiveness of various building configurations under investigation from two types of realistic environmental source terms. Various combinations of these ten shielding models can be used to develop full-scale computational housing-unit models for building shielding factor calculations representing 69.6 million housing units (61.3%) in the United States. Results produced in this investigation provide a comparison between theory and experiment behind building shielding factor methodology.

  16. Experimental shielding evaluation of the radiation protection provided by the structurally significant components of residential structures

    International Nuclear Information System (INIS)

    Dickson, E D; Hamby, D M

    2014-01-01

    The human health and environmental effects following a postulated accidental release of radioactive material to the environment have been a public and regulatory concern since the early development of nuclear technology. These postulated releases have been researched extensively to better understand the potential risks for accident mitigation and emergency planning purposes. The objective of this investigation is to provide an updated technical basis for contemporary building shielding factors for the US housing stock. Building shielding factors quantify the protection from ionising radiation provided by a certain building type. Much of the current data used to determine the quality of shielding around nuclear facilities and urban environments is based on simplistic point-kernel calculations for 1950s era suburbia and is no longer applicable to the densely populated urban environments realised today. To analyse a building’s radiation shielding properties, the ideal approach would be to subject a variety of building types to various radioactive sources and measure the radiation levels in and around the building. While this is not entirely practicable, this research analyses the shielding effectiveness of ten structurally significant US housing-stock models (walls and roofs) important for shielding against ionising radiation. The experimental data are used to benchmark computational models to calculate the shielding effectiveness of various building configurations under investigation from two types of realistic environmental source terms. Various combinations of these ten shielding models can be used to develop full-scale computational housing-unit models for building shielding factor calculations representing 69.6 million housing units (61.3%) in the United States. Results produced in this investigation provide a comparison between theory and experiment behind building shielding factor methodology. (paper)

  17. Method for providing uranium articles with a corrosion resistant anodized coating

    International Nuclear Information System (INIS)

    Waldrop, F.B.; Washington, C.A.

    1982-01-01

    Uranium articles are provided with anodized oxide coatings in an aqueous solution of an electrolyte selected from the group consisting of potassium phosphate, potassium hydroxide, ammonium hydroxide, and a mixture of potassium tetraborate and boric acid. The uranium articles are anodized at a temperature greater than about 75 degrees C. With a current flow of less than about 0.036 A/cm2 of surface area while the Ph of the solution is maintained in a range of about 2 to 11.5. The Ph values of the aqueous solution and the low current density utilized during the electrolysis prevent excessive dissolution of the uranium and porosity in the film or watering. The relatively high temperature of the electrolyte bath inhibits hydration and the attendant deleterious pitting so as to enhance corrosion resistance of the anodized coating

  18. A NUMERICAL TREATMENT OF ANISOTROPIC RADIATION FIELDS COUPLED WITH RELATIVISTIC RESISTIVE MAGNETOFLUIDS

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Hiroyuki R. [Center for Computational Astrophysics, National Astronomical Observatory of Japan, Mitaka, Tokyo 181-8588 (Japan); Ohsuga, Ken [Division of Theoretical Astronomy, National Astronomical Observatory of Japan, Mitaka, Tokyo 181-8588 (Japan)

    2013-08-01

    We develop a numerical scheme for solving fully special relativistic, resistive radiation magnetohydrodynamics. Our code guarantees conservation of total mass, momentum, and energy. The radiation energy density and the radiation flux are consistently updated using the M-1 closure method, which can resolve an anisotropic radiation field, in contrast to the Eddington approximation, as well as the flux-limited diffusion approximation. For the resistive part, we adopt a simple form of Ohm's law. The advection terms are explicitly solved with an approximate Riemann solver, mainly the Harten-Lax-van Leer scheme; the HLLC and HLLD schemes are also solved for some tests. The source terms, which describe the gas-radiation interaction and the magnetic energy dissipation, are implicitly integrated, relaxing the Courant-Friedrichs-Lewy condition even in an optically thick regime or a large magnetic Reynolds number regime. Although we need to invert 4 Multiplication-Sign 4 matrices (for the gas-radiation interaction) and 3 Multiplication-Sign 3 matrices (for the magnetic energy dissipation) at each grid point for implicit integration, they are obtained analytically without preventing massive parallel computing. We show that our code gives reasonable outcomes in numerical tests for ideal magnetohydrodynamics, propagating radiation, and radiation hydrodynamics. We also applied our resistive code to the relativistic Petschek-type magnetic reconnection, revealing the reduction of the reconnection rate via radiation drag.

  19. A NUMERICAL TREATMENT OF ANISOTROPIC RADIATION FIELDS COUPLED WITH RELATIVISTIC RESISTIVE MAGNETOFLUIDS

    International Nuclear Information System (INIS)

    Takahashi, Hiroyuki R.; Ohsuga, Ken

    2013-01-01

    We develop a numerical scheme for solving fully special relativistic, resistive radiation magnetohydrodynamics. Our code guarantees conservation of total mass, momentum, and energy. The radiation energy density and the radiation flux are consistently updated using the M-1 closure method, which can resolve an anisotropic radiation field, in contrast to the Eddington approximation, as well as the flux-limited diffusion approximation. For the resistive part, we adopt a simple form of Ohm's law. The advection terms are explicitly solved with an approximate Riemann solver, mainly the Harten-Lax-van Leer scheme; the HLLC and HLLD schemes are also solved for some tests. The source terms, which describe the gas-radiation interaction and the magnetic energy dissipation, are implicitly integrated, relaxing the Courant-Friedrichs-Lewy condition even in an optically thick regime or a large magnetic Reynolds number regime. Although we need to invert 4 × 4 matrices (for the gas-radiation interaction) and 3 × 3 matrices (for the magnetic energy dissipation) at each grid point for implicit integration, they are obtained analytically without preventing massive parallel computing. We show that our code gives reasonable outcomes in numerical tests for ideal magnetohydrodynamics, propagating radiation, and radiation hydrodynamics. We also applied our resistive code to the relativistic Petschek-type magnetic reconnection, revealing the reduction of the reconnection rate via radiation drag

  20. Radiation resistance and molecular structure of poly(arylene ether sulphone)s

    International Nuclear Information System (INIS)

    Hill, D.J.T.; Lewis, D.A.; O'Donnell, J.H.; Pomery, P.J.; Hedrick, J.L.; McGrath, J.E.

    1991-01-01

    The radiation resistance of a series of aromatic polysulfones comprising alternating units of diphenyl sulfone and various aromatic diols has been investigated by measuring volatile products, soluble fractions and electron spin resonance (ESR) spectra. The yields of radicals at 77 K observed by ESR and of SO 2 at 423 K have indicated that biphenol gives enhanced resistance to γ radiation, and tetramethyl bisphenol-A decreased resistance, relative to bisphenol-A, bisphenol-S and hydroquinone. The protective effect of biphenol was confirmed by lower scission and crosslinking yields determined from the soluble fractions after high doses. (author)

  1. Induced resistance to hydrogen peroxide, UV and gamma radiation in bacillus species

    International Nuclear Information System (INIS)

    Bashandy, A.S.

    2005-01-01

    The catalase activity produced in four bacillus spp.(bacillus cereus, B. laterosporus, B. pumilus and B. subtilis (Escherichia coli was used for comparison) was measured and the sensitivity of these bacteria to hydrogen peroxide was tested. Bacillus spp. had higher resistance to hydrogen peroxide than E. coil. cultures of bacillus spp . When pretreated with sublethal level of hydrogen peroxide, became relatively resistant to the lethal effects of hydrogen than untreated control cultures. These pretreated cells were also resistant to lethality mediated by UV light and gamma radiation. The obtained results suggest that bacillus spp. Possess inducible defense mechanism (s) against the deleterious effects of oxidants and /or ionizing radiation

  2. Radiation response of drug-resistant variants of a human breast cancer cell line

    International Nuclear Information System (INIS)

    Lehnert, S.; Greene, D.; Batist, G.

    1989-01-01

    The radiation response of drug-resistant variants of the human tumor breast cancer cell line MCF-7 has been investigated. Two sublines, one resistant to adriamycin (ADRR) and the other to melphalan (MLNR), have been selected by exposure to stepwise increasing concentrations of the respective drugs. ADRR cells are 200-fold resistant to adriamycin and cross-resistant to a number of other drugs and are characterized by the presence of elevated levels of selenium-dependent glutathione peroxidase and glutathione-S-transferase. MLNR cells are fourfold resistant to melphalan and cross-resistant to some other drugs. The only mechanism of drug resistance established for MLNR cells to date is an enhancement of DNA excision repair processes. While the spectrum of drug resistance and the underlying mechanisms differ for the two sublines, their response to radiation is qualitatively similar. Radiation survival curves for ADRR and MLNR cells differ from that for wild-type cells in a complex manner with, for the linear-quadratic model, a decrease in the size of alpha and an increase in the size of beta. There is a concomitant decrease in the size of the alpha/beta ratio which is greater for ADRR cells than for MLNR cells. Analysis of results using the multitarget model gave values of D0 of 1.48, 1.43, and 1.67 Gy for MCF-7 cells are not a consequence of cell kinetic differences between these sublines. Results of split-dose experiments indicated that for both drug-resistant sublines the extent of sublethal damage repair reflected the width of the shoulder on the single-dose survival curve. For MCF-7 cells in the stationary phase of growth, the drug-resistant sublines did not show cross-resistance to radiation; however, delayed subculture following irradiation of stationary-phase cultures increased survival to a greater extent for ADRR and MLNR cells than for wild-type cells

  3. Investigating mechanical behavior and radiation resistant of fuel rods clad in nuclear power plant

    International Nuclear Information System (INIS)

    Sedgh Kerdar, A.

    1999-01-01

    The important factors for selection of material for use in nuclear reactors is similar to those for other engineering applications. There are however other parameters which are of importance when materials are going to be used in high radiation environments. These parameters are compatibility in intense nuclear radiation field, high resistance against corrosion and other characteristics such as thermal conductivity, machinability and suitable welding properties. This factors discussed in chapter one. In additions to the materials used as fuel, moderator, controls, etc., which have clear and stringent nuclear requirements, other materials may be necessary in a reactor to provide structural strength and other desired properties. For a materials used in a reactor core, the single most important property is its capacity for neutron absorption. Other properties, such as temperature and radiation stability, mechanical strength, corrosion resistance, etc., also receive much attention in selecting material for a specific application. Obviously, far more can be said about each of the potential metals than is possible in chapter two. We shall limit our attention to those metals of current nuclear interest, i.e., aluminium, beryllium magnesium, zirconium, austenitic stainless steels, nickel base alloys, and in factory metals (Nb and Mo). Interactions between matter and different radiations like Neutrons, protons, Gamma , Beta and Alpha rays in nuclear reactors induced important changes in properties of materials.There are five mechanism responsible for radiation induced changes in solids: ionization, vacancy formation, interstitial formation, creation of impurities caused by nuclear reactions and displacements spikes under the local thermal environment. Due to presence of many electrons in metals ionization does not play a major role in metals only the other four mechanisms are relevant to metals and their alloys. Generally speaking formation of many vacancies and

  4. Genetic resistance in experimental autoimmune encephalomyelitis. I. Analysis of the mechanism of LeR resistance using radiation chimeras

    International Nuclear Information System (INIS)

    Pelfrey, C.M.; Waxman, F.J.; Whitacre, C.C.

    1989-01-01

    Experimental autoimmune encephalomyelitis (EAE) is a cell-mediated autoimmune disease of the central nervous system that has been extensively studied in the rat. The Lewis rat is highly susceptible to the induction of EAE, while the Lewis resistant (LeR) rat is known to be resistant. In this paper, we demonstrate that the LeR rat, which was derived from the Lewis strain by inbreeding of fully resistant animals, is histocompatible with the Lewis strain. Radiation chimeras, a tool for distinguishing between immunologic and nonimmunologic resistance mechanisms, were utilized to analyze the cellular mechanisms involved in genetic resistance to EAE. By transplanting bone marrow cells from LeR rats into irradiated Lewis recipients, Lewis rats were rendered resistant to EAE induction. Likewise, transplanting Lewis bone marrow cells into irradiated LeR recipients rendered LeR rats susceptible. Mixed lymphoid cell chimeras using bone marrow, spleen, and thymus cells in Lewis recipient rats revealed individual lymphoid cell types and cell interactions that significantly affected the incidence and severity of EAE. Our results suggest that LeR resistance is mediated by hematopoietic/immune cells, and that cells located in the spleen appear to play a critical role in the resistance/susceptibility to EAE induction. Depletion of splenic adherent cells did not change the patterns of EAE resistance. In vivo cell mixing studies suggested the presence of a suppressor cell population in the LeR spleen preparations which exerted an inhibitory effect on Lewis autoimmune responses. Thus, the mechanism of LeR resistance appears to be different from that in other EAE-resistant animals

  5. Power reactor services provided by the Penn State Radiation Science and Engineering Center

    International Nuclear Information System (INIS)

    Voth, M.H.; Jester, W.A.

    1993-01-01

    The power reactor industry emerged from extensive research and development performed at nonpower reactors (NPRs). As the industry matures, NPRs continue to support and enhance power reactor technology. With the closure of many government and private industry NPRS, there is an increasing call for the 33 universities with operating research reactors to provide the needed services. The Penn State Radiation Science and Engineering Center (RSEC) includes a 1-MW pool-type pulsing TRIGA reactor, a neutron beam laboratory with real-time neutron radiography equipment, hot cells with master-slave manipulators for remote handling of radioactive materials, a gamma-ray irradiation pool, a low-level radiation monitoring laboratory, and extensive equipment for radiation monitoring, dosimetry, and material properties determination. While equipment is heavily utilized in the instructional and academic research programs, significant time remains available for service work. Cost recovery for service work generates income for personnel, equipment maintenance, and facility improvements. With decreasing federal and state funding for educational programs, it is increasingly important that facilities be fully utilized to generate supplementary revenue. The following are examples of such work performed at the RSEC

  6. Correlation of electromagnetic radiation emitted from coal or rock to supporting resistance

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Hui-lin; Wang, En-yuan; Song, Xiao-yan; Zhang, Hong-jie; Li, Zhong-hui [China University of Mining & Technology, Xuzhou (China). School of Safety Engineering

    2009-05-15

    More accurate forecasting of rock burst might be possible from observations of electromagnetic radiation emitted in the mine. We analyzed experimental observations and field data from the Muchengjian coal mine to study the relationship between electromagnetic radiation signal intensity and stress during the fracturing of coal, or rock, and samples under load. The results show that the signal intensity is positively correlated with stress. In addition, we investigated the change in the electromagnetic radiation intensity, the supporting resistance in a real coal mine environment, and the coal or rock stress in the mining area. The data analysis indicates that: (1) electromagnetic radiation intensity can accurately reflect the distribution of stress in the mining area; and, (2) there is a correlation between electromagnetic radiation intensity and supporting resistance. The research has some practical guiding significance for rock burst forecasting and for the prevention of accidents in coal mines. 9 refs., 6 figs.

  7. Acquired Tumor Cell Radiation Resistance at the Treatment Site Is Mediated Through Radiation-Orchestrated Intercellular Communication

    Energy Technology Data Exchange (ETDEWEB)

    Aravindan, Natarajan, E-mail: naravind@ouhsc.edu [Department of Radiation Oncology, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma (United States); Aravindan, Sheeja; Pandian, Vijayabaskar; Khan, Faizan H.; Ramraj, Satish Kumar; Natt, Praveen [Department of Radiation Oncology, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma (United States); Natarajan, Mohan [Department of Pathology, The University of Texas Health Science Center at San Antonio, San Antonio, Texas (United States)

    2014-03-01

    Purpose: Radiation resistance induced in cancer cells that survive after radiation therapy (RT) could be associated with increased radiation protection, limiting the therapeutic benefit of radiation. Herein we investigated the sequential mechanistic molecular orchestration involved in radiation-induced radiation protection in tumor cells. Results: Radiation, both in the low-dose irradiation (LDIR) range (10, 50, or 100 cGy) or at a higher, challenge dose IR (CDIR), 4 Gy, induced dose-dependent and sustained NFκB-DNA binding activity. However, a robust and consistent increase was seen in CDIR-induced NFκB activity, decreased DNA fragmentation, apoptosis, and cytotoxicity and attenuation of CDIR-inhibited clonal expansion when the cells were primed with LDIR prior to challenge dose. Furthermore, NFκB manipulation studies with small interfering RNA (siRNA) silencing or p50/p65 overexpression unveiled the influence of LDIR-activated NFκB in regulating CDIR-induced DNA fragmentation and apoptosis. LDIR significantly increased the transactivation/translation of the radiation-responsive factors tumor necrosis factor-α (TNF-α), interleukin-1α (IL-1α), cMYC, and SOD2. Coculture experiments exhibit LDIR-influenced radiation protection and increases in cellular expression, secretion, and activation of radiation-responsive molecules in bystander cells. Individual gene-silencing approach with siRNAs coupled with coculture studies showed the influence of LDIR-modulated TNF-α, IL-1α, cMYC, and SOD2 in induced radiation protection in bystander cells. NFκB inhibition/overexpression studies coupled with coculture experiments demonstrated that TNF-α, IL-1α, cMYC, and SOD2 are selectively regulated by LDIR-induced NFκB. Conclusions: Together, these data strongly suggest that scattered LDIR-induced NFκB-dependent TNF-α, IL-1α, cMYC, and SOD2 mediate radiation protection to the subsequent challenge dose in tumor cells.

  8. Molecular Imaging Biomarkers of Resistance to Radiation Therapy for Spontaneous Nasal Tumors in Canines

    Energy Technology Data Exchange (ETDEWEB)

    Bradshaw, Tyler J. [Department of Medical Physics, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States); Bowen, Stephen R. [Departments of Radiation Oncology and Radiology, University of Washington, Seattle, Washington (United States); Deveau, Michael A. [Department of Small Animal Clinical Sciences, Texas A& M University, College Station, Texas (United States); Kubicek, Lyndsay [Angell Animal Medical Center, Boston, Massachusetts (United States); White, Pamela [Department of Surgical Sciences, School of Veterinary Medicine, University of Wisconsin-Madison, Madison, Wisconsin (United States); Bentzen, Søren M. [Division of Biostatistics and Bioinformatics, University of Maryland Greenebaum Cancer Center, and Department of Epidemiology and Public Health, University of Maryland School of Medicine, Baltimore, Maryland (United States); Chappell, Richard J. [Department of Biostatistics and Medical Informatics, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States); Forrest, Lisa J. [Department of Surgical Sciences, School of Veterinary Medicine, University of Wisconsin-Madison, Madison, Wisconsin (United States); Jeraj, Robert, E-mail: rjeraj@wisc.edu [Department of Medical Physics, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States); Department of Human Oncology, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin (United States)

    2015-03-15

    Purpose: Imaging biomarkers of resistance to radiation therapy can inform and guide treatment management. Most studies have so far focused on assessing a single imaging biomarker. The goal of this study was to explore a number of different molecular imaging biomarkers as surrogates of resistance to radiation therapy. Methods and Materials: Twenty-two canine patients with spontaneous sinonasal tumors were treated with accelerated hypofractionated radiation therapy, receiving either 10 fractions of 4.2 Gy each or 10 fractions of 5.0 Gy each to the gross tumor volume. Patients underwent fluorodeoxyglucose (FDG)-, fluorothymidine (FLT)-, and Cu(II)-diacetyl-bis(N4-methylthiosemicarbazone) (Cu-ATSM)-labeled positron emission tomography/computed tomography (PET/CT) imaging before therapy and FLT and Cu-ATSM PET/CT imaging during therapy. In addition to conventional maximum and mean standardized uptake values (SUV{sub max}; SUV{sub mean}) measurements, imaging metrics providing response and spatiotemporal information were extracted for each patient. Progression-free survival was assessed according to response evaluation criteria in solid tumor. The prognostic value of each imaging biomarker was evaluated using univariable Cox proportional hazards regression. Multivariable analysis was also performed but was restricted to 2 predictor variables due to the limited number of patients. The best bivariable model was selected according to pseudo-R{sup 2}. Results: The following variables were significantly associated with poor clinical outcome following radiation therapy according to univariable analysis: tumor volume (P=.011), midtreatment FLT SUV{sub mean} (P=.018), and midtreatment FLT SUV{sub max} (P=.006). Large decreases in FLT SUV{sub mean} from pretreatment to midtreatment were associated with worse clinical outcome (P=.013). In the bivariable model, the best 2-variable combination for predicting poor outcome was high midtreatment FLT SUV{sub max} (P=.022) in

  9. Molecular Imaging Biomarkers of Resistance to Radiation Therapy for Spontaneous Nasal Tumors in Canines

    International Nuclear Information System (INIS)

    Bradshaw, Tyler J.; Bowen, Stephen R.; Deveau, Michael A.; Kubicek, Lyndsay; White, Pamela; Bentzen, Søren M.; Chappell, Richard J.; Forrest, Lisa J.; Jeraj, Robert

    2015-01-01

    Purpose: Imaging biomarkers of resistance to radiation therapy can inform and guide treatment management. Most studies have so far focused on assessing a single imaging biomarker. The goal of this study was to explore a number of different molecular imaging biomarkers as surrogates of resistance to radiation therapy. Methods and Materials: Twenty-two canine patients with spontaneous sinonasal tumors were treated with accelerated hypofractionated radiation therapy, receiving either 10 fractions of 4.2 Gy each or 10 fractions of 5.0 Gy each to the gross tumor volume. Patients underwent fluorodeoxyglucose (FDG)-, fluorothymidine (FLT)-, and Cu(II)-diacetyl-bis(N4-methylthiosemicarbazone) (Cu-ATSM)-labeled positron emission tomography/computed tomography (PET/CT) imaging before therapy and FLT and Cu-ATSM PET/CT imaging during therapy. In addition to conventional maximum and mean standardized uptake values (SUV max ; SUV mean ) measurements, imaging metrics providing response and spatiotemporal information were extracted for each patient. Progression-free survival was assessed according to response evaluation criteria in solid tumor. The prognostic value of each imaging biomarker was evaluated using univariable Cox proportional hazards regression. Multivariable analysis was also performed but was restricted to 2 predictor variables due to the limited number of patients. The best bivariable model was selected according to pseudo-R 2 . Results: The following variables were significantly associated with poor clinical outcome following radiation therapy according to univariable analysis: tumor volume (P=.011), midtreatment FLT SUV mean (P=.018), and midtreatment FLT SUV max (P=.006). Large decreases in FLT SUV mean from pretreatment to midtreatment were associated with worse clinical outcome (P=.013). In the bivariable model, the best 2-variable combination for predicting poor outcome was high midtreatment FLT SUV max (P=.022) in combination with large FLT response from

  10. Influence of preliminary radiation-oxidizing treatment on the corrosion resistance of zirconium in conditions of action of ionizing radiation

    International Nuclear Information System (INIS)

    Garibov, A. A.; Aliyev, A. G.; Agayev, T. N.; Velibekova, G. Z.

    2004-01-01

    Today mainly water-cooled nuclear reactors predominate in atomic energetics. For safe work of nuclear reactors detection of accumulation process of explosives, formed during radiation and temperature influence on heat-carriers in contact with materials of nuclear reactors in normal and emergency regimes of work is of great importance. The main sources of molecular hydrogen formation in normal and emergency regimes are the processes of liquid and vaporous water in vapo metallic reaction [1-5]. At the result of these processes molecular hydrogen concentration in heat-carrier composition always exceeds theoretically expected concentration. One of the main ways to solve the problem of water-cooled reactors safety is detection of possibilities to raise material resistance of fuel elements and heat carrier to joint action of ionizing radiation and temperature. The second way is inhibition of radiation-catalytic activity of construction materials' surface during the process of water decomposition. It's been established, that one of the ways to raise resistance of zirconium materials to the influence of ionizing radiation is formation of thin oxide film on the surface of metals. In the given work the influence of preliminary oxidizing treatment of zirconium surface on its radiation-catalytic activity during the process of water decomposition. With this aim zirconium is exposed to preliminary influence of gamma-quantum in contact with hydrogen peroxide at different meanings of absorbed radiation dose

  11. How the nature of the chemical bond governs resistance to amorphization by radiation damage

    International Nuclear Information System (INIS)

    Trachenko, Kostya; Artacho, Emilio; Dove, Martin T.; Pruneda, J.M.

    2005-01-01

    We discuss what defines a material's resistance to amorphization by radiation damage. We propose that resistance is generally governed by the competition between the short-range covalent and long-range ionic forces, and we quantify this picture using quantum-mechanical calculations. We calculate the Voronoi deformation density charges and Mulliken overlap populations of 36 materials, representative of different families, including complex oxides. We find that the computed numbers generally follow the trends of experimental resistance in several distinct families of materials: the increase (decrease) of the short-range covalent component in material's total force field decreases (increases) its resistance

  12. Collection of radiation resistant characteristics reports for instruments and materials in high dose rate environment

    International Nuclear Information System (INIS)

    Kusano, Joichi

    2008-03-01

    This document presents the collected official reports of radiation irradiation study for the candidate materials to be used in high dose rate environment as J-PARC facility. The effect of radiation damage by loss-beam or secondary particle beam of the accelerators influences the performance and the reliability of various instruments. The knowledge on the radiation resistivity of the materials is important to estimate the life of the equipments, the maintenance interval and dose evaluation for the personnel at the maintenance period. The radiation damage consists with mechanical property, electrical property and gas-evolution property. (author)

  13. Conductive core of radiation-resistant high-pressure electric bushing, especially for nuclear technology

    Energy Technology Data Exchange (ETDEWEB)

    Zajic, V

    1981-09-01

    A radiation-resistant high-pressure electric bushing was developed featuring a conductive core consisting of a hollow moulding. At the point of attachment to the bushing insulator the core moulding is widened, thus forming a ring support of a diameter larger by at least 10% than the diameter of the conductive core cylindrical section. On the outer side of the pressure body the core cavity is narrowed and tightly closed with the conductor. On the side facing the medium of higher pressure, the conductive core is provided with a thread. Core manufacture and connection of the conductor to the bushing is very simple. The bushing can be used for an environment with pressures exceeding 10 MPa.

  14. Conductive core of radiation-resistant high-pressure electric bushing, especially for nuclear technology

    International Nuclear Information System (INIS)

    Zajic, V.

    1981-01-01

    A radiation-resistant high-pressure electric bushing was developed featuring a conductive core consisting of a hollow moulding. At the point of attachment to the bushing insulator the core moulding is widened, thus forming a ring support of a diameter larger by at least 10% than the diameter of the conductive core cylindrical section. On the outer side of the pressure body the core cavity is narrowed and tightly closed with the conductor. On the side facing the medium of higher pressure, the conductive core is provided with a thread. Core manufacture and connection of the conductor to the bushing is very simple. The bushing can be used for an environment with pressures exceeding 10 MPa. (J.B.)

  15. Role of Mn2+ and Compatible Solutes in the Radiation Resistance of Thermophilic Bacteria and Archaea

    Directory of Open Access Journals (Sweden)

    Kimberly M. Webb

    2012-01-01

    Full Text Available Radiation-resistant bacteria have garnered a great deal of attention from scientists seeking to expose the mechanisms underlying their incredible survival abilities. Recent analyses showed that the resistance to ionizing radiation (IR in the archaeon Halobacterium salinarum is dependent upon Mn-antioxidant complexes responsible for the scavenging of reactive oxygen species (ROS generated by radiation. Here we examined the role of the compatible solutes trehalose, mannosylglycerate, and di-myo-inositol phosphate in the radiation resistance of aerobic and anaerobic thermophiles. We found that the IR resistance of the thermophilic bacteria Rubrobacter xylanophilus and Rubrobacter radiotolerans was highly correlated to the accumulation of high intracellular concentration of trehalose in association with Mn, supporting the model of Mn2+-dependent ROS scavenging in the aerobes. In contrast, the hyperthermophilic archaea Thermococcus gammatolerans and Pyrococcus furiosus did not contain significant amounts of intracellular Mn, and we found no significant antioxidant activity from mannosylglycerate and di-myo-inositol phosphate in vitro. We therefore propose that the low levels of IR-generated ROS under anaerobic conditions combined with highly constitutively expressed detoxification systems in these anaerobes are key to their radiation resistance and circumvent the need for the accumulation of Mn-antioxidant complexes in the cell.

  16. Role of Mn2+ and compatible solutes in the radiation resistance of thermophilic bacteria and archaea.

    Science.gov (United States)

    Webb, Kimberly M; DiRuggiero, Jocelyne

    2012-01-01

    Radiation-resistant bacteria have garnered a great deal of attention from scientists seeking to expose the mechanisms underlying their incredible survival abilities. Recent analyses showed that the resistance to ionizing radiation (IR) in the archaeon Halobacterium salinarum is dependent upon Mn-antioxidant complexes responsible for the scavenging of reactive oxygen species (ROS) generated by radiation. Here we examined the role of the compatible solutes trehalose, mannosylglycerate, and di-myo-inositol phosphate in the radiation resistance of aerobic and anaerobic thermophiles. We found that the IR resistance of the thermophilic bacteria Rubrobacter xylanophilus and Rubrobacter radiotolerans was highly correlated to the accumulation of high intracellular concentration of trehalose in association with Mn, supporting the model of Mn(2+)-dependent ROS scavenging in the aerobes. In contrast, the hyperthermophilic archaea Thermococcus gammatolerans and Pyrococcus furiosus did not contain significant amounts of intracellular Mn, and we found no significant antioxidant activity from mannosylglycerate and di-myo-inositol phosphate in vitro. We therefore propose that the low levels of IR-generated ROS under anaerobic conditions combined with highly constitutively expressed detoxification systems in these anaerobes are key to their radiation resistance and circumvent the need for the accumulation of Mn-antioxidant complexes in the cell.

  17. Radiation-resistant vegetative bacteria in a proposed system of radappertization of meats

    International Nuclear Information System (INIS)

    Maxcy, R.B.; Rowley, D.B.

    1978-01-01

    After irradiation in the frozen state with 1 Mrad fresh minced pork or chicken contained approximately 10-100 colony-forming units of highly radiation resistant asporogenous bacteria per gram. Some of these had greater radiation resistance than Clostridium botulinum spores. Much of the radiation resistance was apparent as a shoulder in the death curve, which was markedly reduced by heating prior or subsequent to irradiation. Nature of the meat, such as variation in fat content (5-44%), had no significant effect on the radiation resistance of bacteria therein. Even though these bacteria were isolated from meat, it was not a favourable microenvironment for their growth. The water activity was too low. Heat sensitivity of isolates indicated the pre-irradiation enzyme inactivation treatment required for radappertization of meats would destroy or injure most vegetative cells. Thus, the combined process of heat, irradiation, and unfavourable microenvironment would ensure that these radiation resistant cells would not be a problem in radappertized meats. (author)

  18. Resistance to Change among Veteran Teachers: Providing Voice for More Effective Engagement

    Science.gov (United States)

    Snyder, Richard R.

    2017-01-01

    Effective implementation of change remains a crucial concern for educational leaders in the 21st Century. One of the factors affecting effective implementation of reform is resistance to change. Veteran teachers in particular present unique challenges, and stereotypically the greatest resistance, for effective implementation of change. This study…

  19. Experimental study on radiation resistant properties of seismic isolation elements

    International Nuclear Information System (INIS)

    Yoneda, G.; Nojima, O.; Aizawa, S.; Uchiyama, Y.; Ikenaga, M.; Yoshizawa, T.

    1991-01-01

    Recently, studies on the application of a seismic isolation system to a reactor building and or the equipment of a nuclear power plant has been carried out. This study aims at investigating the influence which is exerted upon the mechanical properties of the seismic isolation elements by radiation. The authors conducted irradiation tests, using γ rays, on natural rubber bearings (NRB), lead rubber bearings (LRB), high damping rubber bearings (HRB), and the viscous fluid used in viscous dampers. The maximum radiation intensity was 5 x 10 7 R (Roentgen). The comparison between the mechanical properties of each seismic isolation element before and after the irradiation test are reported in the following. (author)

  20. Development of a programming model for radiation-resistant software

    International Nuclear Information System (INIS)

    Eichhorn, G.; Piercey, R.B.

    1984-01-01

    The adverse effects of ionizing radiation on microelectronic systems include cumulative dosage effects, single-event upsets (SEU's) and latch-up. Most frequent, especially when the radiation environment includes heavy ions, are SEU's. Unfortunately SEU's are difficult to detect since they can be read (in RAM or ROM) as valid addresses. They can however be handled in software by proper techniques. The authors refer to their method as MRS - Maximally Redundant Software. The MRS programming model which the authors are developing uses multiply redundant boot blocks, majority voting, periodic refresh, and error recovery techniques to minimize the deleterious effects of SEU's. 1 figure

  1. Combination therapeutics of Nilotinib and radiation in acute lymphoblastic leukemia as an effective method against drug-resistance.

    Directory of Open Access Journals (Sweden)

    Kamran Kaveh

    2017-07-01

    Full Text Available Philadelphia chromosome-positive (Ph+ acute lymphoblastic leukemia (ALL is characterized by a very poor prognosis and a high likelihood of acquired chemo-resistance. Although tyrosine kinase inhibitor (TKI therapy has improved clinical outcome, most ALL patients relapse following treatment with TKI due to the development of resistance. We developed an in vitro model of Nilotinib-resistant Ph+ leukemia cells to investigate whether low dose radiation (LDR in combination with TKI therapy overcome chemo-resistance. Additionally, we developed a mathematical model, parameterized by cell viability experiments under Nilotinib treatment and LDR, to explain the cellular response to combination therapy. The addition of LDR significantly reduced drug resistance both in vitro and in computational model. Decreased expression level of phosphorylated AKT suggests that the combination treatment plays an important role in overcoming resistance through the AKT pathway. Model-predicted cellular responses to the combined therapy provide good agreement with experimental results. Augmentation of LDR and Nilotinib therapy seems to be beneficial to control Ph+ leukemia resistance and the quantitative model can determine optimal dosing schedule to enhance the effectiveness of the combination therapy.

  2. Influence of mutations in some structural genes of heat-shock proteins on radiation resistance of Escherichia coli

    International Nuclear Information System (INIS)

    Verbenko, V.N.; Kuznetsova, L.V.; Bikineeva, E.G.; Kalinin, V.L.

    1992-01-01

    Lethal effects of γ-irradiation were studied in Escherichia coli strains with normal repair genotype and in radiation-resistant Gam r strains, both carrying additional mutations in the structural genes dnaK, grpE, groES or groEL. The null mutation ΔdnaK52::Cm r enhanced radiation sensitivity of wild-type cells and abolished the effect of heat induced rediation-resistance (ETIRR) and elevated radiation resistance of the Gam r strains

  3. On the honeybee resistance to gamma radiation; Sur la resistance au rayonnement gamma de l'abeille ouvriere

    Energy Technology Data Exchange (ETDEWEB)

    Courtois, G.; Lecomte, J. [Commissariat a l' energie atomique et aux energies alternatives - CEA, Section des Applications des Radioelements, Centre d' Etudes Nucleaires, Saclay, Station de Recherches Apicoles, Bures-sur-Yvette (France)

    1960-07-01

    The honeybee, when irradiated by gamma radiations from a cobalt-60 source can stand a 18000 r dose without any apparent harm. Noticeable harm is observed for 90000 r. while immediate death of 100% of the individuals is obtained with a 200000 r dose. The physiological condition of the honeybee plays an important role in its resistance to gamma radiation. Reprint of a paper published in Annales de l'abeille, IV, 1959, p. 285-290 [French] L'Abeille butineuse irradiee par le rayonnement gamma issu d'une source de Cobalt 60 supporte sans dommages apparents une dose de 18000 r. Des dommages tres appreciables sont observes pour 90000 r. Une dose de 200000 r entraine la mort immediate de 100% des individus. L'etat physiologique de l'Abeille joue un role important dans la resistance au rayonnement gamma. Reproduction d'un article publie dans Annales de l'abeille, IV, 1959, p. 285-290.

  4. Nuclear radiation detectors using high resistivity neutron transmutation doped silicon

    International Nuclear Information System (INIS)

    Gessner, T.; Irmer, K.

    1983-01-01

    A method for the production of semiconductor detectors based on high resistivity n-type silicon is described. The n-type silicon is produced by neutron irradiation of p-type silicon. The detectors are produced by planar technique. They are suitable for the spectrometry of alpha particles and for the pulse count measurement of beta particles at room temperature. (author)

  5. Radiation crosslinked block copolymer blends with improved impact resistance

    International Nuclear Information System (INIS)

    Saunders, F.L.; Pelletier, R.R.

    1976-01-01

    Polymer blends having high impact resistance after mechanical working are produced by blending together a non-elastomeric monovinylidene aromatic polymer such as polystyrene with an elastomeric copolymer, such as a block copolymer of styrene and butadiene, in the form of crosslinked, colloidal size particles

  6. Characteristic of resistant ionization-radiation and its relationship with polysaccharide contents in spirulina

    International Nuclear Information System (INIS)

    Wang Zhiping; Xu Bujin

    2001-01-01

    The anti-radiation capacities of intact filaments, no-sheath filaments and cells of 4 kinds of Spiralina strains (Ss-V, Sp-F, Sp-Z and Sp-D) treated by "6"0Co γ-rays were studied. The relationship between polysaccharide contents and anti-radiation capacity of 4 strains were also detected. The results showed that Spirulina is highly resistant toγ-radiation, however there were significant differences with various strains. The order of anti-radiation capacity is Ss-V > Sp-F > Sp-Z > Sp-D. Moreover, the anti-radiation capacity were remarkably related with polysaccharide contents in the 4 strains. This showed that polysaccharide is very important for raising and maintain-ing super anti-radiation capacity in Spiralina. (authors)

  7. Evaluation of Radiation Response and Gold Nanoparticle Enhancement in Drug-Resistant Pancreatic Cancer Cells

    Science.gov (United States)

    Abourabia, Assya

    Pancreatic cancer is a major cause of cancer-related death worldwide after lung cancer and colorectal cancer Pancreatic treatment modalities consist of surgery, chemotherapy, and radiation therapy or combination of these therapies. These modalities are good to some extents but they do have some limitations. For example, during the chemotherapy, tumor cells can develop some escape mechanisms and become chemoresistant to protect themselves against the chemo drugs and pass on theses escape mechanisms to their offspring, despite the treatment given. Cancer Cells can become chemoresistant by many mechanisms, for example, decreased drug influx mechanisms, decreased of drug transport molecules, decreased drug activation, altered drug metabolism that diminishes the capacity of cytotoxic drugs, and enhanced repair of DNA damage. Given that some of these chemoresistance mechanisms may impact sensitivity to radiation. Therefore, there is a strong need for a new alternative treatment option to amplify the therapeutic efficacy of radiotherapy and eventually increase the overall efficacy of cancer treatment. Nano-radiation therapy is an emerging and promising modality aims to enhance the therapeutic efficacy of radiotherapy through the use of radiosensitizing nanoparticles. The primary goal of using GNP-enhanced radiation is that GNPs are potent radiosensitizer agents that sensitize the tumor cells to radiation, and these agents promote generation of the free radicals produced by Photo- and Auger- electrons emission at the molecular level which can enhance the effectiveness of radiation-induced cancer cell death. The main aim of this research is to analyze and compare the response to radiation of pancreatic cancer cells, PANC-1, and PANC-1 cells that are resistant to oxaliplatin, PANC-1/OR, and investigate the radiation dose enhancement effect attributable to GNP when irradiating the cells with low-energy (220 kVp) beam at various doses. Based on evidence from the existing

  8. Radiation sensitivity of Salmonella isolates relative to resistance to ampicillin, chloramphenicol or gentamicin

    Science.gov (United States)

    Niemira, Brendan A.; Lonczynski, Kelly A.; Sommers, Christopher H.

    2006-09-01

    Antibiotic resistance of inoculated bacteria is a commonly used selective marker. Bacteria resistant to the antibiotic nalidixic acid have been shown to have an increased sensitivity to irradiation. The purpose of this research was to screen a collection of Salmonella isolates for antibiotic resistance and determine the association, if any, of antibiotic resistance with radiation sensitivity. Twenty-four clinical isolates of Salmonella were screened for native resistance to multiple concentrations of ampicillin (Amp), chloramphenicol (Chl), or gentamicin (Gm). Test concentrations were chosen based on established clinical minimum inhibitory concentration (MIC) levels, and isolates were classified as either sensitive or resistant based on their ability to grow at or above the MIC. Salmonella cultures were grown overnight at (37 °C) in antibiotic-amended tryptic soy broth (TSB). Native resistance to Gm was observed with each of the 24 isolates (100%). Eight isolates (33%) were shown to be resistant to Amp, while seven isolates (29%) were shown to be resistant to Chl. In separate experiments, Salmonella cultures were grown overnight (37 °C) in TSB, centrifuged, and the cell pellets were re-suspended in phosphate buffer. The samples were then gamma irradiated at doses up to 1.0 kGy. The D10 values (the ionizing radiation dose required to reduce the viable number of microorganisms by 90%) were determined for the 24 isolates and they ranged from 0.181 to 0.359 kGy. No correlation was found between the D10 value of the isolate and its sensitivity or resistance to each of the three antibiotics. Resistance to Amp or Chl is suggested as appropriate resistance marker for Salmonella test strains to be used in studies of irradiation.

  9. Radiation sensitivity of Salmonella isolates relative to resistance to ampicillin, chloramphenicol or gentamicin

    International Nuclear Information System (INIS)

    Niemira, Brendan A.; Lonczynski, Kelly A.; Sommers, Christopher H.

    2006-01-01

    Antibiotic resistance of inoculated bacteria is a commonly used selective marker. Bacteria resistant to the antibiotic nalidixic acid have been shown to have an increased sensitivity to irradiation. The purpose of this research was to screen a collection of Salmonella isolates for antibiotic resistance and determine the association, if any, of antibiotic resistance with radiation sensitivity. Twenty-four clinical isolates of Salmonella were screened for native resistance to multiple concentrations of ampicillin (Amp), chloramphenicol (Chl), or gentamicin (Gm). Test concentrations were chosen based on established clinical minimum inhibitory concentration (MIC) levels, and isolates were classified as either sensitive or resistant based on their ability to grow at or above the MIC. Salmonella cultures were grown overnight at (37 o C) in antibiotic-amended tryptic soy broth (TSB). Native resistance to Gm was observed with each of the 24 isolates (100%). Eight isolates (33%) were shown to be resistant to Amp, while seven isolates (29%) were shown to be resistant to Chl. In separate experiments, Salmonella cultures were grown overnight (37 o C) in TSB, centrifuged, and the cell pellets were re-suspended in phosphate buffer. The samples were then gamma irradiated at doses up to 1.0 kGy. The D 10 values (the ionizing radiation dose required to reduce the viable number of microorganisms by 90%) were determined for the 24 isolates and they ranged from 0.181 to 0.359 kGy. No correlation was found between the D 10 value of the isolate and its sensitivity or resistance to each of the three antibiotics. Resistance to Amp or Chl is suggested as appropriate resistance marker for Salmonella test strains to be used in studies of irradiation

  10. INFLUENCE OF INCUBATION TIME, GAMMA RAYS AND ELECTRON BEAM ON RADIATION RESISTANCE OF SOME SELECTED PATHOGENS

    International Nuclear Information System (INIS)

    EL-HIFNAWI, H.N.; EL-TABLAWY, S.Y.

    2009-01-01

    The effect of different growth phases on the radiation resistance, antibiotic susceptibility and pathogenicity of certain selected pathogens (Escherichia coli, Candida albicans and Staphylococcus aureus) was studied in mice. The obtained results showed that Escherichia coli was slightly more resistant to gamma radiation in 18 h than 24 h or 48 h but it was relatively more resistant to electron beam in 24 h and 48 h than 18 h. Candida albicans showed radiation resistance nearly the same in all incubation times in the case of gamma radiation while for electron beam, its radiation resistance was slightly more in 24 h and 48 h than in 18 h. On the other hand, Staphylococcus aureus recorded much more resistance to gamma radiation in the 48 h than in 24 h or 18 h whereas in the case of electron beam, it was slightly more resistant in 18 h than in 24 h and 48 h.The antibiotic susceptibility of Escherichia coli reported that the exposure to gamma radiation at 3 kGy and electron beam at 6 kGy increase the susceptibility to the nalidixic acid and nitrofurantoin. When Candida albicans was exposed to 3 kGy gamma radiation and 6 kGy electron beam, the same sensitivity to nystatin was observed in comparison with the unexposed one while the sensitivity of Staphylococcus aureus to some antibiotics (amoxicillin, nitrofurantoin and tetracycline) was decreased after exposure to gamma radiation at 0.75 and 2 kGy and electron beam at 6 kGy, but for other antibiotics (trimethoprim/ sulfamethoxazole), the sensitivity was increased at 6 kGy electron beam.The lethality percent recorded after the oral ingestion of the mice with the unexposed Escherichia coli and Candida albicans were 25% and 100%, respectively, and for 6 kGy exposure to electron beam was 0% . The cotaneous disease and abscesses caused by the intradermal injection of the mice with unexposed Staphylococcus aureus was 75% and for 6 kGy exposure to electron beam was 25%.

  11. Radiation-hard ceramic Resistive Plate Chambers for forward TOF and T0 systems

    Energy Technology Data Exchange (ETDEWEB)

    Akindinov, A., E-mail: Alexander.Akindinov@cern.ch [Institute for Theoretical and Experimental Physics, Moscow (Russian Federation); Dreyer, J.; Fan, X.; Kämpfer, B. [Helmholtz-Zentrum Dresden-Rossendorf, Dresden (Germany); Kiselev, S. [Institute for Theoretical and Experimental Physics, Moscow (Russian Federation); Kotte, R.; Garcia, A. Laso [Helmholtz-Zentrum Dresden-Rossendorf, Dresden (Germany); Malkevich, D. [Institute for Theoretical and Experimental Physics, Moscow (Russian Federation); Naumann, L. [Helmholtz-Zentrum Dresden-Rossendorf, Dresden (Germany); Nedosekin, A.; Plotnikov, V. [Institute for Theoretical and Experimental Physics, Moscow (Russian Federation); Stach, D. [Helmholtz-Zentrum Dresden-Rossendorf, Dresden (Germany); Sultanov, R.; Voloshin, K. [Institute for Theoretical and Experimental Physics, Moscow (Russian Federation)

    2017-02-11

    Resistive Plate Chambers with ceramic electrodes are the main candidates for a use in precise multi-channel timing systems operating in high-radiation conditions. We report the latest R&D results on these detectors aimed to meet the requirements of the forward T0 counter at the CBM experiment. RPC design, gas mixture, limits on the bulk resistivity of ceramic electrodes, efficiency, time resolution, counting rate capabilities and ageing test results are presented.

  12. Materials That Enhance Efficiency and Radiation Resistance of Solar Cells

    Science.gov (United States)

    Sun, Xiadong; Wang, Haorong

    2012-01-01

    A thin layer (approximately 10 microns) of a novel "transparent" fluorescent material is applied to existing solar cells or modules to effectively block and convert UV light, or other lower solar response waveband of solar radiation, to visible or IR light that can be more efficiently used by solar cells for additional photocurrent. Meanwhile, the layer of fluorescent coating material remains fully "transparent" to the visible and IR waveband of solar radiation, resulting in a net gain of solar cell efficiency. This innovation alters the effective solar spectral power distribution to which an existing cell gets exposed, and matches the maximum photovoltaic (PV) response of existing cells. By shifting a low PV response waveband (e.g., UV) of solar radiation to a high PV response waveband (e.g. Vis-Near IR) with novel fluorescent materials that are transparent to other solar-cell sensitive wavebands, electrical output from solar cells will be enhanced. This approach enhances the efficiency of solar cells by converting UV and high-energy particles in space that would otherwise be wasted to visible/IR light. This innovation is a generic technique that can be readily implemented to significantly increase efficiencies of both space and terrestrial solar cells, without incurring much cost, thus bringing a broad base of economical, social, and environmental benefits. The key to this approach is that the "fluorescent" material must be very efficient, and cannot block or attenuate the "desirable" and unconverted" waveband of solar radiation (e.g. Vis-NIR) from reaching the cells. Some nano-phosphors and novel organometallic complex materials have been identified that enhance the energy efficiency on some state-of-the-art commercial silicon and thin-film-based solar cells by over 6%.

  13. Pregnant x-ray technologist: providing adequate radiation safety for the fetus

    International Nuclear Information System (INIS)

    Caprio, M.L. Jr.

    1980-01-01

    The human embryo-fetus is highly radiosensitive and must be protected from excessive exposure to ionizing radiation. The maximum permissible dose equivalent for the developing embryo-fetus is set at 0.5 rem per year - the MPD level for members of the general public. Methods by which supervisory personnel can limit the fetal dose incurred by the occupational exposure of the mother are presented. It is recommended that supervisory personnel attempt to limit occupational exposure to the current non-occupational MPD levels for all x-ray technologists, thereby, insuring that the fetal dose limits are not surpassed and providing an added safety factor for personnel by keeping exposures as low as reasonably achievable

  14. Heavy irradiation effects in radiation-resistant optical fibers

    Energy Technology Data Exchange (ETDEWEB)

    Shikama, Tatsuo [Tohoku Univ., Oarai, Ibaraki (Japan). Oarai Branch, Inst. for Materials Research

    1998-07-01

    Development of a system for optical measurements in a nuclear reactor has been progressing to investigate dynamic changes in a material caused by heavy irradiation. In such system, transfer of optical signals to out-pile measuring systems is being attempted by the use of optical fibers. In this report, the characteristics of optical fibers in the heavy irradiation field were summarized. It has been known that amorphous silica might produce radiolysis and structural defects by the exposure to ionizing radiation. The effects of heavy irradiation on molten silica were extremely complicated. A large intensity of visible light absorption occurred from an early time during start-up of the reactor. The absorption range was limited below 700 nm for the radiation associating fast neutron and the absorption was mostly attributed to non-bridging oxygen hole center. The depletion of optical transferring capacity under the radiation might be related to the internal stress. Therefore, it seems desirable to use optical fibers in the conditions without leading too much stress. (M.N.)

  15. Evolution of radiation resistant hollow fibers membranes for nuclear

    International Nuclear Information System (INIS)

    Neelam Kumari; Raut, D.R.; Bhardwaj, Y.K.; Mohapatra, P.K.

    2014-01-01

    We have evaluated hollow fiber supported liquid membrane (HFSLM) technique for the separation of actinides, fission products and other valuables from the nuclear waste solutions. In this technique, ligand responsible for separation of metal ion is held in tiny pores of membrane. Any drastic change as a consequence of irradiation, like change in pore size, change in hydrophobicity of polymeric material can be fatal for separation process as it may lead dislodging of carrier ligands from the pores. It was therefore needed to study the irradiation stability of hollow fibers. We have earlier showed that polypropylene fibers were stable up to 500 radiation dose and we therefore need to look into other options. In the present work, hollow fiber membranes made from polyether ether ketone (PEEK), polysulphone (PS). Polymers were evaluated for their radiation stability after exposing to varying absorbed dose of gamma radiation. The hollow fibers were irradiated to 100 KGy, 200 KGy, 500 KGy and 1000 KGy and its changes in hydrophobicity were measured using contact angle measurement studies

  16. Genetic Engineering of a Radiation-Resistant Bacterium for Biodegradation of Mixed Wastes. Final Report

    International Nuclear Information System (INIS)

    Lidstrom, Mary E.

    2003-01-01

    Aqueous mixed low level wastes (MLLW) containing radionuclides, solvents, and/or heavy metals represent a serious current and future problem for DOE environmental management and cleanup. In order to provide low-cost treatment alternatives under mild conditions for such contained wastes, we have proposed to use the radiation-resistant bacterium, Deinococcus radiodurans. This project has focused on developing D. radiodurans strains for dual purpose processes: cometabolic treatment of haloorganics and other solvents and removal of heavy metals from waste streams in an above-ground reactor system. The characteristics of effective treatment strains that must be attained are: (a) high biodegradative and metal binding activity; (b) stable treatment characteristics in the absence of selection and in the presence of physiological stress; (c) survival and activity under harsh chemical conditions, including radiation. The result of this project has been a suite of strains with high biodegradative capabilities that are candidates for pilot stage treatment systems. In addition, we have determined how to create conditions to precipitate heavy metals on the surface of the bacterium, as the first step towards creating dual-use treatment strains for contained mixed wastes of importance to the DOE. Finally, we have analyzed stress response in this bacterium, to create the foundation for developing treatment processes that maximize degradation while optimizing survival under high stress conditions

  17. Effects of low dose gamma radiation on the early growth of red pepper and the resistance to subsquent high dose of radiation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, J. S.; Baek, M. H.; Kim, D. H.; Lee, Y. K. [KAERI, Taejon (Korea, Republic of); Lee, Y. B. [Chungnam National Univ., Taejon (Korea, Republic of)

    2001-05-01

    Red pepper (capsicum annuum L. cv. Jokwang and cv. Johong) seeds were irradiated with the dose of 0{approx}50 Gy to investigated the effect of the low dose gamma radiation on the early growth and resistance to subsequent high dose of radiation. The effect of the low dose gamma radiation on the early growth and resistance to subsequenct high dose of radiation were enhanced in Johong cultivar but not in Jokwang cultivar. Germination rate and early growth of Johong cultivar were noticeably increased at 4 Gy-, 8 Gy- and 20 Gy irradiation group. Resistance to subsequent high dose of radiation of Johong cultivar were increased at almost all of the low dose irradiation group. Especially it was highest at 4 Gy irradiation group. The carotenoid contents and enzyme activity on the resistance to subsequent high dose of radiation of Johong cultivar were increased at the 4 Gy and 8 Gy irradiation group.

  18. Pediatric providers and radiology examinations. Knowledge and comfort levels regarding ionizing radiation and potential complications of imaging

    Energy Technology Data Exchange (ETDEWEB)

    Wildman-Tobriner, Benjamin; Maxfield, Charles M. [Duke University Hospital, Department of Radiology, Durham, NC (United States); Parente, Victoria M. [Duke University Hospital, Department of Pediatrics, Durham, NC (United States)

    2017-12-15

    Pediatric providers should understand the basic risks of the diagnostic imaging tests they order and comfortably discuss those risks with parents. Appreciating providers' level of understanding is important to guide discussions and enhance relationships between radiologists and pediatric referrers. To assess pediatric provider knowledge of diagnostic imaging modalities that use ionizing radiation and to understand provider concerns about risks of imaging. A 6-question survey was sent via email to 390 pediatric providers (faculty, trainees and midlevel providers) from a single academic institution. A knowledge-based question asked providers to identify which radiology modalities use ionizing radiation. Subjective questions asked providers about discussions with parents, consultations with radiologists, and complications of imaging studies. One hundred sixty-nine pediatric providers (43.3% response rate) completed the survey. Greater than 90% of responding providers correctly identified computed tomography (CT), fluoroscopy and radiography as modalities that use ionizing radiation, and ultrasound and magnetic resonance imaging (MRI) as modalities that do not. Fewer (66.9% correct, P<0.001) knew that nuclear medicine utilizes ionizing radiation. A majority of providers (82.2%) believed that discussions with radiologists regarding ionizing radiation were helpful, but 39.6% said they rarely had time to do so. Providers were more concerned with complications of sedation and cost than they were with radiation-induced cancer, renal failure or anaphylaxis. Providers at our academic referral center have a high level of basic knowledge regarding modalities that use ionizing radiation, but they are less aware of ionizing radiation use in nuclear medicine studies. They find discussions with radiologists helpful and are concerned about complications of sedation and cost. (orig.)

  19. Pediatric providers and radiology examinations: knowledge and comfort levels regarding ionizing radiation and potential complications of imaging.

    Science.gov (United States)

    Wildman-Tobriner, Benjamin; Parente, Victoria M; Maxfield, Charles M

    2017-12-01

    Pediatric providers should understand the basic risks of the diagnostic imaging tests they order and comfortably discuss those risks with parents. Appreciating providers' level of understanding is important to guide discussions and enhance relationships between radiologists and pediatric referrers. To assess pediatric provider knowledge of diagnostic imaging modalities that use ionizing radiation and to understand provider concerns about risks of imaging. A 6-question survey was sent via email to 390 pediatric providers (faculty, trainees and midlevel providers) from a single academic institution. A knowledge-based question asked providers to identify which radiology modalities use ionizing radiation. Subjective questions asked providers about discussions with parents, consultations with radiologists, and complications of imaging studies. One hundred sixty-nine pediatric providers (43.3% response rate) completed the survey. Greater than 90% of responding providers correctly identified computed tomography (CT), fluoroscopy and radiography as modalities that use ionizing radiation, and ultrasound and magnetic resonance imaging (MRI) as modalities that do not. Fewer (66.9% correct, Pionizing radiation. A majority of providers (82.2%) believed that discussions with radiologists regarding ionizing radiation were helpful, but 39.6% said they rarely had time to do so. Providers were more concerned with complications of sedation and cost than they were with radiation-induced cancer, renal failure or anaphylaxis. Providers at our academic referral center have a high level of basic knowledge regarding modalities that use ionizing radiation, but they are less aware of ionizing radiation use in nuclear medicine studies. They find discussions with radiologists helpful and are concerned about complications of sedation and cost.

  20. Assessment of Gamma Radiation Resistance of Spores Isolated from the Spacecraft Assembly Facility During MSL Assembly

    Science.gov (United States)

    Chopra, Arsh; Ramirez, Gustavo A.; Vaishampayan, Parag A.; Venkateswaran, Kasthuri J.

    2011-01-01

    Spore forming bacteria, a common inhabitant of spacecraft assembly facilities, are known to tolerate extreme environmental conditions such as radiation, desiccation, and high temperatures. Since the Viking era (early 1970's), spores have been utilized to assess the degree and level of microbiological contamination on spacecraft and their associated spacecraft assembly facilities. There is a growing concern that desiccation and extreme radiation resistant spore forming microorganisms associated with spacecraft surfaces can withstand space environmental conditions and subsequently proliferate on another solar body. Such forward contamination would certainly jeopardize future life detection or sample return technologies. It is important to recognize that different classes of organisms are critical while calculating the probability of contamination, and methods must be devised to estimate their abundances. Microorganisms can be categorized based on radiation sensitivity as Type A, B, C, and D. Type C represents spores resistant to radiation (10% or greater survival above 0.8 Mrad gamma radiation). To address these questions we have purified 96 spore formers, isolated during planetary protection efforts of Mars Science Laboratory assembly for gamma radiation resistance. The spores purified and stored will be used to generate data that can be used further to model and predict the probability of forward contamination.

  1. Resistance of Feather-Associated Bacteria to Intermediate Levels of Ionizing Radiation near Chernobyl.

    Science.gov (United States)

    Ruiz-González, Mario Xavier; Czirják, Gábor Árpád; Genevaux, Pierre; Møller, Anders Pape; Mousseau, Timothy Alexander; Heeb, Philipp

    2016-03-15

    Ionizing radiation has been shown to produce negative effects on organisms, although little is known about its ecological and evolutionary effects. As a study model, we isolated bacteria associated with feathers from barn swallows Hirundo rustica from three study areas around Chernobyl differing in background ionizing radiation levels and one control study site in Denmark. Each bacterial community was exposed to four different γ radiation doses ranging from 0.46 to 3.96 kGy to test whether chronic exposure to radiation had selected for resistant bacterial strains. Experimental radiation duration had an increasingly overall negative effect on the survival of all bacterial communities. After exposure to γ radiation, bacteria isolated from the site with intermediate background radiation levels survived better and produced more colonies than the bacterial communities from other study sites with higher or lower background radiation levels. Long-term effects of radiation in natural populations might be an important selective pressure on traits of bacteria that facilitate survival in certain environments. Our findings indicate the importance of further studies to understand the proximate mechanisms acting to buffer the negative effects of ionizing radiation in natural populations.

  2. Some physiological and morphological aspects of radiation-resistant bacteria and a new method for their isolation from food

    International Nuclear Information System (INIS)

    Sanders, S.W.

    1978-01-01

    A study was undertaken to help clarify the taxonomic positions and mechanisms of radiation resistance of radiation-resistant asporogenous bacteria found in foods. Determinations of DNA base compositions of highly resistant Moroxella-Acinetobacter (M-A) strains indicated that they were atypical, having percent guanine plus cytosine contents exceeding the values for true Moraxella or Acinetobacter spp. By direct observation of dividing cells, the resistant M-A were found to undergo multiple-plane division. Electron micrographs revealed unusually thick cell walls in the M-A as compared with gram-negative bacteria, indicating a possible role of the cell wall in radiation resistance. Resistance to desiccation was utilized in the selection of highly radiation-resistant bacteria from non-irradiated sources. Bacteria from a food or other source were suspended in dilute phosphate buffer and dried in a thin film at 25 C and 33% relative humidity. Storage under these conditions for 15 days or more reduced the numbers of radiation-sensitive bacteria. Further selection of the most radiation-resistant bacteria was obtained by irradiation of bacteria on velveteen in the replication process, thereby allowing the isolation of highly resistant bacteria that had not been irradiated. The similarity of radiation-resistance and identifying characteristics between irradiated and non-irradiated isolates indicated that highly radiation-resistant bacteria are not altered by radiation selection. Irradiated Plate Count Agar and Tryptic Soy Agar were found to be very toxic to radiation-resistant bacteria. This phenomenon may be important in food irradiation, where the ability to survive and grow in a product may depend partly on the sensitivity to bacteriocidal products formed during irradiation

  3. Studies on the flame and radiation resistant modification of wires and cables for nuclear power generation plants

    International Nuclear Information System (INIS)

    Hagiwara, Miyuki; Morita, Yosuke; Udagawa, Akira; Oda, Eisuke; Fujimura, Shunichi.

    1982-08-01

    For the use in the light-water nuclear power generation plants, wires and cables are required to keep high flame retardancy and superior resistivity against heat and radiation throughout the whole period of service. They are expected, further, to fulfill their functions even under LOCA conditions. The present work aimed to provide new technology to give flame and radiation resistancy to insulating materials for the cables which are used under the above requirements. For the improvement of flame retardancy and the elongation of life time, polymerizable flame retardants were examined their applicability to ethylene-propylene-diene rubber. Various polymerizable flame retardants were first synthesized, and their performance was analyzed, especially, as to the relationship between molecular structure and their effectiveness. As a guiding principle for developing of a high performance flame and radiation resistant reagent, it was suggested that the back born of the reagent molecule should be constructed by carbon-carbon bond including fused aromatic rings and groups which can undergo polymerization by radical initiators. After careful consideration and detailed experimental work, condensed bromoacenaphthylene (con-BACN) was shown to have an effectiveness enough for the present purpose. Its satisfactory performance was also shown by making cables of a practical size using con-BACN, and by carrying out various performance tests based substantially on IEEE standards. (author)

  4. The radiation resistance of thermoset plastics: Pt. 2

    International Nuclear Information System (INIS)

    Gilfrich, H.-P.; Roesinger, S.; Wilski, H.

    1991-01-01

    Two thermoset phenolic plastics filled with organic fillers (wood flour and cotton fabric shreds) were irradiated at high dose rates (under exclusion of air) and with extremely low dose rates in air. The mechanical and electrical properties are compared with each other and with the results obtained from previous investigations involving inorganic filled thermosets. As expected, the organic filled plastics were found to be more sensitive to irradiation than the inorganic filled counterparts. Radiation induced changes previously observed with the inorganic filled thermosets can now be explained by the small amounts of organic admixtures which they contain. (author)

  5. A possible radiation-resistant solar cell geometry using superlattices

    Science.gov (United States)

    Goradia, C.; Clark, R.; Brinker, D.

    1985-01-01

    A solar cell structure is proposed which uses a GaAs nipi doping superlattice. An important feature of this structure is that photogenerated minority carriers are very quickly collected in a time shorter than bulk lifetime in the fairly heavily doped n and p layers and these carriers are then transported parallel to the superlattice layers to selective ohmic contacts. Assuming that these already-separated carriers have very long recombination lifetimes, due to their across an indirect bandgap in real space, it is argued that the proposed structure may exhibit superior radiation tolerance along with reasonably high beginning-of-life efficiency.

  6. Carbon glass-ceramics and their radiation resistance

    International Nuclear Information System (INIS)

    Virgil'ev, Yu. S.

    1995-01-01

    Structural carbon materials (SCMs) hold great promise for use in numerous plasma-facing components of fusion reactors. One possible candidate for this use is carbon glass-ceramic. Therefore, it is not surprising that there is considerable interest in studying its properties and their variations upon exposure to different radiations, such as neutrons, high-energy electrons, and light ions (H + , D + , and He + ). Here, the authors summarize data accumulated to date on the structure and properties of commercial carbon glass-ceramics and their behavior under irradiation with neutrons, electrons, and some ions

  7. Diffuse Reflectance Spectroscopy (DRS) of radiation-induced re-oxygenation in sensitive and resistant head and neck tumor xenografts

    Science.gov (United States)

    Dadgar, Sina; Rodríguez Troncoso, Joel; Rajaram, Narasimhan

    2018-02-01

    Currently, anatomical assessment of tumor volume performed several weeks after completion of treatment is the clinical standard to determine whether a cancer patient has responded to a treatment. However, functional changes within the tumor could potentially provide information regarding treatment resistance or response much earlier than anatomical changes. We have used diffuse reflectance spectroscopy to assess the short and long-term re-oxygenation kinetics of a human head and neck squamous cell carcinoma xenografts in response to radiation therapy. First, we injected UM-SCC-22B cell line into the flank of 50 mice to grow xenografts. Once the tumor volume reached 200 mm3 (designated as Day 1), the mice were distributed into radiation and control groups. Members of radiation group underwent a clinical dose of radiation of 2 Gy/day on Days 1, 4, 7, and 10 for a cumulative dose of 8 Gy. DRS spectra of these tumors were collected for 14 days during and after therapy, and the collected spectra of each tumor were converted to its optical properties using a lookup table-base inverse model. We found statistically significant differences in tumor growth rate between two groups which is in indication of the sensitivity of this cell line to radiation. We further acquired significantly different contents of hemoglobin and scattering magnitude and size in two groups. The scattering has previously been associated with necrosis. We furthermore found significantly different time-dependent changes in vascular oxygenation and tumor hemoglobin concentration in post-radiation days.

  8. Gamma radiation-a possible tool to provide quarantine security against Khapra beetle, Trogoderma granarium everts (Coleoptera: dermestidae)

    International Nuclear Information System (INIS)

    Gautam, R.D.; Garg, A.K.; Viji, C.P.

    2005-01-01

    Khapra beetle, Trogoderma granarium everts is apparently native to India. Current quarantine regulations for the US recognize 25 countries as harboring endemic populations of khapra beetle: Afghanistan, Algeria, Bangladesh, Burkina Faso, Cyprus, Egypt, India, Iran, Iraq, Israel, Libya, Mali, Mauritania, Morocco, Myanmar, Niger, Nigeria, Pakistan, Saudi Arabia, Senegal, Sri Lanka, Sudan, Syria, Tunisia and Turkey. The beetle has developed resistance to many insecticides particularly to phosphine alone and malathion. Fumigation with methyl bromide provides good control in a variety of commodities, however, its production and importation has been restricted since it is an ozone depleting substance. Further, for effective treatment of storage facilities and ships require use of high concentrations, which has raised concerns among the public. Potential alternatives to the use of methyl bromide may need to be tested for effectiveness against this beetle prior to implementation. In view of this, studies were undertaken to record the effectiveness of different doses of gamma radiation (40-100, 250, 500, 750 and 1000 Gy) for the control of this important pest in grain storage. (author)

  9. Variations in Medicare Reimbursement in Radiation Oncology: An Analysis of the Medicare Provider Utilization and Payment Data Set

    International Nuclear Information System (INIS)

    Vu, Charles C.; Lanni, Thomas B.; Robertson, John M.

    2016-01-01

    Purpose: The purposes of this study were to summarize recently published data on Medicare reimbursement to individual radiation oncologists and to identify the causes of variation in Medicare reimbursement in radiation oncology. Methods and Materials: The Medicare Provider Utilization and Payment Data: Physician and Other Supplier Public Use File (POSPUF), which details nearly all services provided by radiation oncologists in 2012, was used for this study. The data were filtered and analyzed by physician and by billing code. Statistical analysis was performed to identify differences in reimbursements based on sex, rurality, billing of technical services, or location in a certificate of need (CON) state. Results: There were 4135 radiation oncologists who received a total of $1,499,625,803 in payments from Medicare in 2012. Seventy-five percent of radiation oncologists were male. The median reimbursement was $146,453. The code with the highest total reimbursement was 77418 (radiation treatment delivery intensity modulated radiation therapy [IMRT]). The most commonly billed evaluation and management (E/M) code for new visits was 99205 (49%). The most commonly billed E/M code for established visits was 99213 (54%). Forty percent of providers billed none of their new office visits using 99205 (the highest E/M billing code), whereas 34% of providers billed all of their new office visits using 99205. For the 1510 radiation oncologists (37%) who billed technical services, median Medicare reimbursement was $606,008, compared with $93,921 for all other radiation oncologists (P<.001). On multivariate analysis, technical services billing (P<.001), male sex (P<.001), and rural location (P=.007) were predictive of higher Medicare reimbursement. Conclusions: The billing of technical services, with their high capital and labor overhead requirements, limits any comparison in reimbursement between individual radiation oncologists or between radiation oncologists and other

  10. Variations in Medicare Reimbursement in Radiation Oncology: An Analysis of the Medicare Provider Utilization and Payment Data Set.

    Science.gov (United States)

    Vu, Charles C; Lanni, Thomas B; Robertson, John M

    2016-04-01

    The purposes of this study were to summarize recently published data on Medicare reimbursement to individual radiation oncologists and to identify the causes of variation in Medicare reimbursement in radiation oncology. The Medicare Provider Utilization and Payment Data: Physician and Other Supplier Public Use File (POSPUF), which details nearly all services provided by radiation oncologists in 2012, was used for this study. The data were filtered and analyzed by physician and by billing code. Statistical analysis was performed to identify differences in reimbursements based on sex, rurality, billing of technical services, or location in a certificate of need (CON) state. There were 4135 radiation oncologists who received a total of $1,499,625,803 in payments from Medicare in 2012. Seventy-five percent of radiation oncologists were male. The median reimbursement was $146,453. The code with the highest total reimbursement was 77418 (radiation treatment delivery intensity modulated radiation therapy [IMRT]). The most commonly billed evaluation and management (E/M) code for new visits was 99205 (49%). The most commonly billed E/M code for established visits was 99213 (54%). Forty percent of providers billed none of their new office visits using 99205 (the highest E/M billing code), whereas 34% of providers billed all of their new office visits using 99205. For the 1510 radiation oncologists (37%) who billed technical services, median Medicare reimbursement was $606,008, compared with $93,921 for all other radiation oncologists (Preimbursement. The billing of technical services, with their high capital and labor overhead requirements, limits any comparison in reimbursement between individual radiation oncologists or between radiation oncologists and other specialists. Male sex and rural practice location are independent predictors of higher total Medicare reimbursements. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Variations in Medicare Reimbursement in Radiation Oncology: An Analysis of the Medicare Provider Utilization and Payment Data Set

    Energy Technology Data Exchange (ETDEWEB)

    Vu, Charles C.; Lanni, Thomas B.; Robertson, John M., E-mail: JRobertson@beaumont.edu

    2016-04-01

    Purpose: The purposes of this study were to summarize recently published data on Medicare reimbursement to individual radiation oncologists and to identify the causes of variation in Medicare reimbursement in radiation oncology. Methods and Materials: The Medicare Provider Utilization and Payment Data: Physician and Other Supplier Public Use File (POSPUF), which details nearly all services provided by radiation oncologists in 2012, was used for this study. The data were filtered and analyzed by physician and by billing code. Statistical analysis was performed to identify differences in reimbursements based on sex, rurality, billing of technical services, or location in a certificate of need (CON) state. Results: There were 4135 radiation oncologists who received a total of $1,499,625,803 in payments from Medicare in 2012. Seventy-five percent of radiation oncologists were male. The median reimbursement was $146,453. The code with the highest total reimbursement was 77418 (radiation treatment delivery intensity modulated radiation therapy [IMRT]). The most commonly billed evaluation and management (E/M) code for new visits was 99205 (49%). The most commonly billed E/M code for established visits was 99213 (54%). Forty percent of providers billed none of their new office visits using 99205 (the highest E/M billing code), whereas 34% of providers billed all of their new office visits using 99205. For the 1510 radiation oncologists (37%) who billed technical services, median Medicare reimbursement was $606,008, compared with $93,921 for all other radiation oncologists (P<.001). On multivariate analysis, technical services billing (P<.001), male sex (P<.001), and rural location (P=.007) were predictive of higher Medicare reimbursement. Conclusions: The billing of technical services, with their high capital and labor overhead requirements, limits any comparison in reimbursement between individual radiation oncologists or between radiation oncologists and other

  12. A stochastic simulation model for reliable PV system sizing providing for solar radiation fluctuations

    International Nuclear Information System (INIS)

    Kaplani, E.; Kaplanis, S.

    2012-01-01

    Highlights: ► Solar radiation data for European cities follow the Extreme Value or Weibull distribution. ► Simulation model for the sizing of SAPV systems based on energy balance and stochastic analysis. ► Simulation of PV Generator-Loads-Battery Storage System performance for all months. ► Minimum peak power and battery capacity required for reliable SAPV sizing for various European cities. ► Peak power and battery capacity reduced by more than 30% for operation 95% success rate. -- Abstract: The large fluctuations observed in the daily solar radiation profiles affect highly the reliability of the PV system sizing. Increasing the reliability of the PV system requires higher installed peak power (P m ) and larger battery storage capacity (C L ). This leads to increased costs, and makes PV technology less competitive. This research paper presents a new stochastic simulation model for stand-alone PV systems, developed to determine the minimum installed P m and C L for the PV system to be energy independent. The stochastic simulation model developed, makes use of knowledge acquired from an in-depth statistical analysis of the solar radiation data for the site, and simulates the energy delivered, the excess energy burnt, the load profiles and the state of charge of the battery system for the month the sizing is applied, and the PV system performance for the entire year. The simulation model provides the user with values for the autonomy factor d, simulating PV performance in order to determine the minimum P m and C L depending on the requirements of the application, i.e. operation with critical or non-critical loads. The model makes use of NASA’s Surface meteorology and Solar Energy database for the years 1990–2004 for various cities in Europe with a different climate. The results obtained with this new methodology indicate a substantial reduction in installed peak power and battery capacity, both for critical and non-critical operation, when compared to

  13. Microparticles shed from multidrug resistant breast cancer cells provide a parallel survival pathway through immune evasion.

    Science.gov (United States)

    Jaiswal, Ritu; Johnson, Michael S; Pokharel, Deep; Krishnan, S Rajeev; Bebawy, Mary

    2017-02-06

    Breast cancer is the most frequently diagnosed cancer in women. Resident macrophages at distant sites provide a highly responsive and immunologically dynamic innate immune response against foreign infiltrates. Despite extensive characterization of the role of macrophages and other immune cells in malignant tissues, there is very little known about the mechanisms which facilitate metastatic breast cancer spread to distant sites of immunological integrity. The mechanisms by which a key healthy defense mechanism fails to protect distant sites from infiltration by metastatic cells in cancer patients remain undefined. Breast tumors, typical of many tumor types, shed membrane vesicles called microparticles (MPs), ranging in size from 0.1-1 μm in diameter. MPs serve as vectors in the intercellular transfer of functional proteins and nucleic acids and in drug sequestration. In addition, MPs are also emerging to be important players in the evasion of cancer cell immune surveillance. A comparative analysis of effects of MPs isolated from human breast cancer cells and non-malignant human brain endothelial cells were examined on THP-1 derived macrophages in vitro. MP-mediated effects on cell phenotype and functionality was assessed by cytokine analysis, cell chemotaxis and phagocytosis, immunolabelling, flow cytometry and confocal imaging. Student's t-test or a one-way analysis of variance (ANOVA) was used for comparison and statistical analysis. In this paper we report on the discovery of a new cellular basis for immune evasion, which is mediated by breast cancer derived MPs. MPs shed from multidrug resistant (MDR) cells were shown to selectively polarize macrophage cells to a functionally incapacitated state and facilitate their engulfment by foreign cells. We propose this mechanism may serve to physically disrupt the inherent immune response prior to cancer cell colonization whilst releasing mediators required for the recruitment of distant immune cells. These findings

  14. Three Canted Radiator Panels to Provide Adequate Cooling for Instruments on Slewing Spacecraft in LEO

    Science.gov (United States)

    Choi, Michael K.

    2012-01-01

    Certain free-flying spacecraft in low Earth orbit (LEO) or payloads on the International Space Station (ISS) are required to slew to point the telescopes at targets. Instrument detectors and electronics require cooling. Traditionally a planar thermal radiator is used. The temperature of such a radiator varies significantly when the spacecraft slews because its view factors to space vary significantly. Also for payloads on the ISS, solar impingement on the radiator is possible. These thermal adversities could lead to inadequate cooling for the instrument. This paper presents a novel thermal design concept that utilizes three canted radiator panels to mitigate this problem. It increases the overall radiator view factor to cold space and reduces the overall solar or albedo flux absorbed per unit area of the radiator.

  15. Identifying the Proteins that Mediate the Ionizing Radiation Resistance of Deinococcus Radiodurans R1

    Energy Technology Data Exchange (ETDEWEB)

    Battista, John R

    2010-02-22

    The primary objectives of this proposal was to define the subset of proteins required for the ionizing radiation (IR) resistance of Deinococcus radiodurans R1, characterize the activities of those proteins, and apply what was learned to problems of interest to the Department of Energy.

  16. Radiation resistance of polymer materials. Degradation evaluation by accelerated testing for application condition

    International Nuclear Information System (INIS)

    Seguchi, Tadao; Tamura, Kiyotoshi; Sorimachi, Masami

    2010-02-01

    This paper presents re-evaluated radiation resistance property data of polymer materials, which had been tested in past times in TAKASAKI Quantum Beam Science Directorate, for the future study of ageing evaluation of low voltage electric cable insulation materials used in light-water nuclear reactors. The radiation resistance of 25 types of plastics and rubbers materials applied in practical environments was evaluated by the accelerated testing of gamma-ray irradiation under oxygen pressure, and was compared with the radiation resistance determined from the traditional testing by irradiation with a high dose rate in air. The polymer materials were formulated to be similar or equivalent to practical materials, and the most of formulation (chemical compounds and quantities) were described. For all materials, the tensile properties (elongation at break, ultimate strength, 100% or 200% modulus), electric resistivity, gel-fraction, and density were measured after irradiation in oxidation conditions and irradiation in air with a high dose rate (non-oxidation conditions). The data of relations between each properties and total dose at various conditions were compiled, and the relations among the changes of mechanical properties, electrical properties, and radiation induced chemical reactions were discussed. (author)

  17. Radiation-resistant optical sensors and cameras; Strahlungsresistente optische Sensoren und Kameras

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, G. [Imaging and Sensing Technology, Bonn (Germany)

    2008-02-15

    Introducing video technology, i.e. 'TV', specifically in the nuclear field was considered at an early stage. Possibilities to view spaces in nuclear facilities by means of radiation-resistant optical sensors or cameras are presented. These systems are to enable operators to monitor and control visually the processes occurring within such spaces. Camera systems are used, e.g., for remote surveillance of critical components in nuclear power plants and nuclear facilities, and thus contribute also to plant safety. A different application of optical systems resistant to radiation is in the visual inspection of, e.g., reactor pressure vessels and in tracing small parts inside a reactor. Camera systems are also employed in remote disassembly of radioactively contaminated old plants. Unfortunately, the niche market of radiation-resistant camera systems hardly gives rise to the expectation of research funds becoming available for the development of new radiation-resistant optical systems for picture taking and viewing. Current efforts are devoted mainly to improvements of image evaluation and image quality. Other items on the agendas of manufacturers are the reduction in camera size, which is limited by the size of picture tubes, and the increased use of commercial CCD cameras together with adequate shieldings or improved lenses. Consideration is also being given to the use of periphery equipment and to data transmission by LAN, WAN, or Internet links to remote locations. (orig.)

  18. Genetic analysis of resistance to radiation lymphomagenesis with recombinant inbred strains of mice

    International Nuclear Information System (INIS)

    Okumoto, M.; Nishikawa, R.; Imai, S.; Hilgers, J.

    1990-01-01

    Induction of lymphomas by radiation in mice is controlled by genetic factors. We analyzed the genetic control of radiation lymphomagenesis using the CXS series of recombinant inbred strains derived from two progenitor strains: one highly susceptible to radiation induction of lymphoma [BALB/cHeA (C)] and one extremely resistant [STS/A (S)]. The best concordances between strain distribution patterns of genetic markers and resistance (or susceptibility) to radiation lymphomagenesis were observed in a region with the b and Ifa genes on chromosome 4. This indicates that one major locus controls the incidence of radiogenic lymphomas in mice. We designated this locus as the Lyr (lymphoma resistance) locus. Backcrosses of (CXS)F1 to the two progenitor strains showed an intermediate incidence of lymphomas between their parental mice and did not significantly differ from (CXS)F1 mice. This and previous observations that (CXS)F1 mice also showed an intermediate incidence, differing from both progenitor strains, indicate that more genes are involved in the resistance (or susceptibility) to lymphoma induced by irradiation

  19. Effect that radiation exerts to insulation breakdown of heat resistant polymer materials

    International Nuclear Information System (INIS)

    Fujita, Shigetaka; Baba, Makoto; Noto, Fumitoshi; Ruike, Mitsuo.

    1990-01-01

    Artificial satellites are always exposed to cosmic rays which contain the radiations which do not reach the ground, therefore, the radiation resistance of the polymer insulators for cables and others used in such environment becomes a problem. Also the polymer insulator materials used for nuclear facilities require excellent radiation resistance. It is important to examine the effect that radiation exerts to electric insulation characteristics from the viewpoint of material development. In this paper, the insulation breakdown characteristics of heat resistant polymer films and the mini-cables made for trial of heat resistant polymer materials in the case without irradiation and in the case of gamma ray irradiation, and the results of the structural analysis are reported. The specimens tested, the experimental method and the results are described. The insulation breakdown strength of PFA and FEP films lowered from 0.15-0.2 MGy, but that of PEEK film did not change up to 5 MGy. It was found that fluorine group resins were apt to deteriorate by oxidation as dose increased. (K.I.)

  20. On possibility to make a new type of calorimeter: radiation resistant and fast

    International Nuclear Information System (INIS)

    Derevshchikov, A.A.; Khodyrev, V.Yu.; Kryshkin, V.I.; Rakhmatov, V.E.; Ronzhin, A.I.

    1990-01-01

    It is proposed to use electron multipliers, which directly detect low energy shower particles as an active element in sandwich calorimeters. The approach pffers fast and radiation resistant calorimetry. Test of the method is presented with the use of a microchannel plate. 4 refs.; 4 figs

  1. Dual responsive promoters to target therapeutic gene expression to radiation-resistant hypoxic tumor cells

    International Nuclear Information System (INIS)

    Chadderton, Naomi; Cowen, Rachel L.; Sheppard, Freda C.D.; Robinson, Suzanne; Greco, Olga; Scott, Simon D.; Stratford, Ian J.; Patterson, Adam V.; Williams, Kaye J.

    2005-01-01

    Purpose: Tumor hypoxia is unequivocally linked to poor radiotherapy outcome. This study aimed to identify enhancer sequences that respond maximally to a combination of radiation and hypoxia for use in genetic radiotherapy approaches. Methods and materials: The influence of radiation (5 Gy) and hypoxia (1% O 2 ) on reporter-gene expression driven by hypoxia (HRE) and radiation (Egr-1) responsive elements was evaluated in tumor cells grown as monolayers or multicellular spheroids. Hypoxia-inducible factor-1α (HIF-1α) and HIF-2α protein expression was monitored in parallel. Results: Of the sequences tested, an HRE from the phosphoglycerate kinase-1 gene (PGK-18[5+]) was maximally induced in response to hypoxia plus radiation in all 5 cell lines tested. The additional radiation treatment afforded a significant increase in the induction of PGK-18[5+] compared with hypoxia alone in 3 cell lines. HIF-1α/2α were induced by radiation but combined hypoxia/radiation treatment did not yield a further increase. The dual responsive nature of HREs was maintained when spheroids were irradiated after delivery of HRE constructs in a replication-deficient adenovirus. Conclusions: Hypoxia-responsive enhancer element sequences are dually responsive to combined radiation and hypoxic treatment. Their use in genetic radiotherapy in vivo could maximize expression in the most radio-resistant population at the time of radiation and also exploit microenvironmental changes after radiotherapy to yield additional switch-on

  2. Radiation-Resistant Micrococcus luteus SC1204 and Its Proteomics Change Upon Gamma Irradiation.

    Science.gov (United States)

    Deng, Wuyuan; Yang, Yang; Gao, Peng; Chen, Hao; Wen, Wenting; Sun, Qun

    2016-06-01

    To explore the radiation-resistance mechanisms in bacteria, a radiation-resistant strain SC1204 was isolated from the surrounding area of a (60)Co-γ radiation facility. SC1204 could survive up to 8 kGy dose of gamma irradiation and was identified as Micrococcus luteus by phylogenetic analysis of 16S rRNA gene sequences. Its proteomic changes under 2-kGy irradiation were examined by two-dimensional electrophoresis followed by MALDI-TOF-TOF/MS analysis. The results showed that at least 24 proteins displayed significant changes (p < 0.05) at expression level under the radiation stress, among which 22 were successfully identified and classified into the major functional categories of metabolism, energy production and conservation, translation, ribosomal structure, and biogenesis. Among these proteins, leucyl aminopeptidase involved in synthesis of glutathione was the most abundant induced protein during postirradiation recovery, indicating that anti-oxidation protection was the most important line of defense in SC1204 against radiation. The next abundant protein was phosphoribosyl aminoimidazole carboxamide formyltransferase/IMP cyclohydrolase (AICAR Tfase/IMPCH), the key enzyme in the biosynthetic pathway of purine that is anti-radiation compound. Other proteins changing significantly (p < 0.05) after radiation exposure included urocanate hydratase, dihydrolipoyl dehydrogenase, succinyl-CoA synthetase subunit alpha, phosphoglycerate kinase, cell division protein FtsZ, elongation factor Ts and Tu, translation elongation factor Tu and G, 30S ribosomal protein S1, histidyl-tRNA synthetase, and arginyl-tRNA synthetase, which were considered to be the key proteins in urocanate metabolism, tricarboxylic acid cycle, glycolysis, cell division process, and synthesis process of proteins. Therefore, these proteins may also play important roles in radiation resistance in M. luteus.

  3. Radiation stability of low-temperature resistance thermometers

    International Nuclear Information System (INIS)

    Neklyudov, I.M.; Petrusenko, Yu.T.; Sleptsov, A.N.; Logvinenko, S.P.; Mikhina, G.F.; Rossoshanskij, O.A.

    1989-01-01

    The effect of low temperature (∼ 5 and 11 K) irradiation with E=30 MeV electrons and the subsequent annealing at 180 and 300 K on gauge dependences R(T) of resistance thermometers (RT) on the basis of p-GaAs, Ni and In is investigated. For GaAs-RT the dependence of electroresistance R(4.2 K) on the irradiation fluence is shown to be non monotonic. The annealing at 180 and 300 K does not restore GaAs-RT thermometric characteristics but it leads to their further degradation. The annealing of Ni and In irradiated RT's at T>180 K leads to total restoring of their electrophysical properties. 16 refs.; 5 figs.; 1 tab

  4. A general purpose fiber optic link with radiation resistance

    International Nuclear Information System (INIS)

    Beadle, E.R.

    1995-01-01

    In some applications it is necessary to send wide-band analog data, with good fidelity, between two stations separated by several hundred feet. This is particularly true for instrumentation in an accelerator environment, where the sensing equipment can be inside the tunnel, and the processing equipment outside. Aside from the distortion and loss introduced by low cost coaxial cables, this case is further complicated by the possibility of pick-up from environmental noise, and the possible radiation damage of the transmitting electronics. Fiber optics is be a viable alternative to the standard coaxial driver, particularly where video bandwidths are concerned. This paper discusses basic design, trade-offs, and performance of one such link developed primarily for the AGS-to-RHIC (ATR) Transfer line profile monitors

  5. Radiation resistance of lactobacilli isolated from radurized meat relative to growth and environment

    International Nuclear Information System (INIS)

    Hastings, J.W.; Holzapfel, W.H.; Niemand, J.G.

    1986-01-01

    Of 113 lactobacilli isolated from radurized (5 kGy) minced meat, 7 Lactobacillus sake strains, 1 L. curvatus strain, and 1 L. farciminis strain were used for radiation resistance studies in a semisynthetic substrate (i.e., modified MRS broth). Five reference Lactobacillus spp. one Staphylococcus aureus strain, and one Salmonella typhimurium strain were used for comparative purposes. All L. sake isolates exhibited the phenomenon of being more resistant to gamma-irradiation in the exponential (log) phase than in the stationary phase of their growth cycles by a factor of 28%. Four reference strains also exhibited this phenomenon, with L. sake (DSM 20017) showing a 68% increase in resistance in the log phase over the stationary phase. This phenomenon was not common to all bacteria tested and is not common to all strains with high radiation resistance. Four L. sake isolates and three reference strains were used in radiation sensitivity testing in a natural food system (i.e., meat). The bacteria were irradiated in minced meat and packaged under four different conditions (air, vacuum, CO 2 , and N 2 ). Organisms exhibited the highest death rate (lowest D 10 values [doses required to reduce the logarithm of the bacterial population by 1] under CO 2 packaging conditions, but resistance to irradiation was increased under N 2 . The D 10 values of the isolates were generally greater than those of the reference strains. The D 10 values were also higher (approximately two times) in meat than in a semisynthetic growth medium

  6. Radiation-resistant acquired immunity of vaccinated mice to Schistosoma mansoni

    International Nuclear Information System (INIS)

    Aitken, R.; Coulson, P.S.; Dixon, B.; Wilson, R.A.

    1987-01-01

    Vaccination of mice with attenuated cercariae of Schistosoma mansoni induces specific acquired resistance to challenge infection. This resistance is immunologically-mediated, possibly via a delayed-type hypersensitivity. Studies of parasite migration have shown that the protective mechanism operates most effectively in the lungs of vaccinated mice. We have probed the mechanism by exposing mice to 500 rads of gamma radiation before challenge infection. Our results show that the effector mechanism operative against challenge larvae is resistant to radiation. In contrast, classical immune responses are markedly suppressed by the same treatment. While leukocyte populations in the blood fall dramatically after irradiation, numbers of cells recoverable by bronchoalveolar lavage are unaffected. We suggest that vaccination with attenuated cercariae establishes populations of sensitized cells in the lungs which trigger the mechanism of resistance when challenge schistosomula migrate through pulmonary capillary beds. Although the cells may be partially disabled by irradiation, they remain responsive to worm antigens and thereby capable of initiating the elimination mechanism. This hypothesis would explain the radiation resistance of vaccine-induced immunity to S. mansoni

  7. Resistance to radiation, recombination, repair of DNA and chromosome organisation

    International Nuclear Information System (INIS)

    Fletcher, H.L.

    1981-01-01

    The model advanced here proposes that death is caused by destructive lesions, mainly double-strand breaks, in all the inter-repairable copies so close together that recombination repair cannot function. Death is related to the exponential of dose where r is the number of copies of the genome. A graph of ln(-ln survival) against ln dose is used to produce a linear dose-survival relationship, the slope of which gives the number of inter-repairable copies of the genome (= number of hits per lethal event). In Ustilago maydis it seems that unless all the chromatids are broken within a few thousand base pairs all ds breaks are repaired. The size of this critical target is similar to the size of a gene. Meiotic pairing in fungi starts outside the genes, and it is therefore suggested that specific pairing sites between genes define the ends of the targets. The model also describes the radiation-induced death of Micrococcus radiodurans and Sacchromyces cerevisiae. Cultured mammalian cells also show a linear ln(-ln survival)/ln dose relationship with a slope of 1.5 showing that both 1st and 2nd order killing occured. Sublethal radiation induces recombination in heterozygous diploid U. maydis proportional to the square of the dose. Sister-chromatid repair is preferred. Polyploid yeast can only use pairs of chromosomes for repair, showing that chromosome pairing is required for recombination repair, and mitotic pairing is restricted to bivalents in the same way that meiotic pairing is. (orig./AJ)

  8. Resistance to radiation, recombination, repair of DNA and chromosome organisation

    Energy Technology Data Exchange (ETDEWEB)

    Fletcher, H L [East Anglia Univ., Norwich (UK). School of Biological Sciences

    1981-01-01

    The model advanced here proposes that death is caused by destructive lesions, mainly double-strand breaks, in all the inter-repairable copies so close together that recombination repair cannot function. Death is related to the exponential of dose where r is the number of copies of the genome. A graph of ln(-ln survival) against ln dose is used to produce a linear dose-survival relationship, the slope of which gives the number of inter-repairable copies of the genome (= number of hits per lethal event). In Ustilago maydis it seems that unless all the chromatids are broken within a few thousand base pairs all ds breaks are repaired. The size of this critical target is similar to the size of a gene. Meiotic pairing in fungi starts outside the genes, and it is therefore suggested that specific pairing sites between genes define the ends of the targets. The model also describes the radiation-induced death of Micrococcus radiodurans and Sacchromyces cerevisiae. Cultured mammalian cells also show a linear ln(-ln survival)/ln dose relationship with a slope of 1.5 showing that both 1st and 2nd order killing occured. Sublethal radiation induces recombination in heterozygous diploid U. maydis proportional to the square of the dose. Sister-chromatid repair is preferred. Polyploid yeast can only use pairs of chromosomes for repair, showing that chromosome pairing is required for recombination repair, and mitotic pairing is restricted to bivalents in the same way that meiotic pairing is.

  9. Identification of a New Antimicrobial Resistance Gene Provides Fresh Insights Into Pleuromutilin Resistance in Brachyspira hyodysenteriae, Aetiological Agent of Swine Dysentery

    Directory of Open Access Journals (Sweden)

    Roderick M. Card

    2018-06-01

    that tva(A contributed to development of tiamulin resistance in vivo in a manner consistent with that seen experimentally in vitro. The in vitro studies further showed that tva(A broadened the mutant selection window and raised the mutant prevention concentration above reported in vivo antibiotic concentrations obtained when administered at certain doses. We show how the identification and characterisation of tva(A, a new marker for pleuromutilin resistance, provides evidence to inform treatment regimes and reduce the development of resistance to this class of highly important antimicrobial agents.

  10. Role of manganese in the resistance of Micrococcus radiodurans to ionizing radiation

    International Nuclear Information System (INIS)

    Wierowski, J.V.

    1980-01-01

    Micrococcus radiodurans possesses a very high level of intracellular manganese compared to other organisms. This manganese content has previously been shown to participate in the exceptional ulraviolet radiation resistance of M. radiodurans. This study was undertaken to determine the role of manganese in the ionizing radiation resistant of M. radiodurans. The results indicate that manganese is essential for DNA degradation to occur during irradiation. Manganese has also proven essential for the second phase of post-irradiation thymine base damage removal. These factors work together to increase the rate of recovery from radiation damage, which is reflected in a larger Dq, D 37 and exponential portion of the survival curve of high Mn-grown cells

  11. Endogenous superoxide dismutase and catalase activities and radiation resistance in mouse cell lines

    International Nuclear Information System (INIS)

    Davy, C.A.; Tesfay, Z.; Jones, J.; Rosenberg, R.C.; McCarthy, C.; Ostrand-Rosenberg, S.

    1988-01-01

    The relationship between the endogenous cytoplasmic levels of the enzymes superoxide dismutase and catalase and the inhibition of cell proliferation by γ-radiation has been studied in 11 mouse cell lines. The resistance of these mouse cell lines to radiation was found to vary by over 25-fold. No correlation was found between the cytoplasmic level of CuZn-superoxide dismutase or catalase and the resistance to radiation as measured by extrapolation number (EN), quasi-threshold dose (Dsub(q)), or Dsub(o). None of the cell lines had detectable cytoplasmic Mn-superoxide dismutase. The apparent Ksub(i) of potassium cyanide for mouse CuZn-superoxide dismutase was determined (Ksub(i) = 6.5 μmol dm -3 ). (author)

  12. Experiment of radiation-resistant materials for nuclear powers generating station

    International Nuclear Information System (INIS)

    Choe, J.H.; Lee, C.K.; Kong, Y.K.; Chang, H.S.

    1981-01-01

    The properties of polyethylene materials exhibit good insulation and radiation resistance, but exhibit poor flame resistance. Flame retardant properties of the polyethylene were improved by the radiation induced grafting, coating or cross-linking. When the various flame retardants were fixed onto polyethylene, the amount of fixation in grafting or coating was increased with the increase of radiation dosages. In the case of grafting, it is necessary for high grafting yield that the polyethylene films were swelled before irradiation with γ-rays or electron beams. It is the suitable method for the fixation of flame retardant that polyethylene samples were blended with various flame retardants at 125 0 C and then blended polymers were crosslinked by the electron beams at room temperature

  13. A study on measurement of radiation resistance of Pyronema domesticum sclerotia

    International Nuclear Information System (INIS)

    Aoshuang, Y.; Ailian, W.; Ying, Z.

    2000-01-01

    Measurements of radiation resistance have been carried out using two strains of Pyronema domesticum which were isolated from Chinese cotton swab gauze. A 'sand-washing' technique was developed to overcome the difficulties when harvesting sclerotia spores from cultured plates and preparing spore suspensions for further use. Three types of microbial preparations, spore suspension, inoculated cotton and spore dot, were exposed to gamma radiation. A dose-survival curve method and a fraction positive method were employed to determine radiation resistance. D 10 values derived from this study are within the range of 2.0-3.0 kGy. Concerns associated with the current study indicate that further work is needed. (author)

  14. Use of gamma radiation for inducing rust resistance in soybean

    International Nuclear Information System (INIS)

    Smutkupt, Sumit; Wongpiyasatid, Arunee; Lamseejan, Siranut; Naritoom, Kruik

    1982-01-01

    Experiments on induced mutations for rust resistance in 11 soybean cultivars were started in the rainy season of 1979. M 1 seeds were grown at Farm Suwan, Pak Chong, Nakorn Rajchasima Province. Six plods from each of 4,438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked. In addition, 270 good M 1 plants were selected and threshed singly. M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both of M 3 -bulk and M 3 -single plants together with M 2 -bulk plants derived from remnant M 2 seeds were screened for rust resistance in the rainy season of 1980. The IWGSR rust rating system was used. Based on the slow growth of rust reaction on the plant (323,333) compared with the average IWGSR rust rating notation of the rates (343) in the same row, 121 plants were selected. Among them, six were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Seeds of each selection harvested. Only 88 lines of M 4 and M 5 were available for further rust evaluation in the rainy season of 1981. The results were as follows: At 77 days after planting, 82 selected lines were rated 333, 323 in comparison with 87 out of 137 rows of control S.J.1, S.J.2, S.J.4 and T.K.5 were rated 343. At 86 days after planting, most of the selections reached the diseased level 343. However, six lines which were derived from G8586 were still rated 333. In addition, a plant with slow growth of rust (323) from Taichung N No. 81-1-032 was selected. The six selected lines having characteristics of slow growth of rust reaction on the plants will be further tested. The high yielding selections among 82 selected lines having low percentage of shrivelled seeds will be used for further yield evaluation in the rainy season of 1982

  15. A genomic island provides Acidithiobacillus ferrooxidans ATCC 53993 additional copper resistance: a possible competitive advantage.

    Science.gov (United States)

    Orellana, Luis H; Jerez, Carlos A

    2011-11-01

    There is great interest in understanding how extremophilic biomining bacteria adapt to exceptionally high copper concentrations in their environment. Acidithiobacillus ferrooxidans ATCC 53993 genome possesses the same copper resistance determinants as strain ATCC 23270. However, the former strain contains in its genome a 160-kb genomic island (GI), which is absent in ATCC 23270. This GI contains, amongst other genes, several genes coding for an additional putative copper ATPase and a Cus system. A. ferrooxidans ATCC 53993 showed a much higher resistance to CuSO(4) (>100 mM) than that of strain ATCC 23270 (<25 mM). When a similar number of bacteria from each strain were mixed and allowed to grow in the absence of copper, their respective final numbers remained approximately equal. However, in the presence of copper, there was a clear overgrowth of strain ATCC 53993 compared to ATCC 23270. This behavior is most likely explained by the presence of the additional copper-resistance genes in the GI of strain ATCC 53993. As determined by qRT-PCR, it was demonstrated that these genes are upregulated when A. ferrooxidans ATCC 53993 is grown in the presence of copper and were shown to be functional when expressed in copper-sensitive Escherichia coli mutants. Thus, the reason for resistance to copper of two strains of the same acidophilic microorganism could be determined by slight differences in their genomes, which may not only lead to changes in their capacities to adapt to their environment, but may also help to select the more fit microorganisms for industrial biomining operations. © Springer-Verlag 2011

  16. Development of guidance and methodical documents for providing the decommissioning of radiation-hazardous objects

    International Nuclear Information System (INIS)

    Ermakov, A.

    2015-01-01

    Federal Center for Nuclear and Radiation Safety (JSC FCNRS) developed and approbated guidance and methodical documents for providing the facility to radiologically safe status in the course of Building B decommissioning activity at JSC VNIINM (A.A. Bochvar High-Technology Scientific Research Institute for Inorganic Materials). The scope of application of the documents developed is as follows: - preliminary segregation of radwaste into streams during its collection and preparation for removal from facilities/sites under decommissioning; - express assessment of specific activity (activity) of radwaste generated in the course of dismantling and decontamination activities; - radiological survey of premises and building structures following completion of dismantling and decontamination activities; - SRW processing (compaction, reduction in size), packaging, characterisation and containerisation in order to reduce risks of spread of radioactive contamination. Documents that have been developed can be used both at nuclear facilities/ sites similar to the JSC VNIINM Building B in terms of work stages and types of waste to be generated, and other facilities/ sites taking into consideration their peculiarities. (author)

  17. High temperature creep strength of Advanced Radiation Resistant Oxide Dispersion Strengthened Steels

    Energy Technology Data Exchange (ETDEWEB)

    Noh, Sanghoon; Kim, Tae Kyu [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2014-05-15

    Austenitic stainless steel may be one of the candidates because of good strength and corrosion resistance at the high temperatures, however irradiation swelling well occurred to 120dpa at high temperatures and this leads the decrease of the mechanical properties and dimensional stability. Compared to this, ferritic/martensitic steel is a good solution because of excellent thermal conductivity and good swelling resistance. Unfortunately, the available temperature range of ferritic/martensitic steel is limited up to 650 .deg. C. ODS steel is the most promising structural material because of excellent creep and irradiation resistance by uniformly distributed nano-oxide particles with a high density which is extremely stable at the high temperature in ferritic/martensitic matrix. In this study, high temperature strength of advanced radiation resistance ODS steel was investigated for the core structural material of next generation nuclear systems. ODS martensitic steel was designed to have high homogeneity, productivity and reproducibility. Mechanical alloying, hot isostactic pressing and hot rolling processes were employed to fabricate the ODS steels, and creep rupture test as well as tensile test were examined to investigate the behavior at high temperatures. ODS steels were fabricated by a mechanical alloying and hot consolidation processes. Mechanical properties at high temperatures were investigated. The creep resistance of advanced radiation resistant ODS steels was more superior than those of ferritic/ martensitic steel, austenitic stainless steel and even a conventional ODS steel.

  18. Concomitant changes in radiation resistance and trehalose levels during life stages of Drosophila melanogaster suggest radio-protective function of trehalose.

    Science.gov (United States)

    Paithankar, Jagdish Gopal; Raghu, Shamprasad Varija; Patil, Rajashekhar K

    2018-04-20

    During development, various life stages of Drosophila melanogaster (D. melanogaster) show different levels of resistance to gamma irradiation, with the early pupal stage being the most radiation sensitive. This provides us an opportunity to explore the biochemical basis of such variations. The present study was carried out to understand the mechanisms underlying radiation resistance during life stages of D. melanogaster. Homogenates from all the life stages of D. melanogaster were prepared at stipulated age. These homogenates were used for the determination of (1) enzymatic antioxidants: superoxide dismutase (SOD), catalase, D. melanogaster glutathione peroxidase (DmGPx), and glutathione S-transferase (GST); (2) reducing non-enzymatic antioxidants: total antioxidant capacity (TAC), reduced glutathione (GSH) and non-reducing non-enzymatic antioxidant trehalose; and (3) levels of protein carbonyl (PC) content. Age-dependent changes in radiation resistance and associated biochemical changes were also studied in young (2 d) and old (20 and 30 d) flies. TAC and GSH were found high in the early pupal stage, whereas catalase and DmGPx were found to increase in the early pupal stage. The non-feeding third instar (NFTI) larvae were found to have high levels of SOD and GST, besides NFTI larvae showed high levels of trehalose. A remarkable decrease was observed in radiation resistance and trehalose levels during the early pupal stage. The PC level was the highest during early pupal stage and was the lowest in NFTI larvae. Older flies showed high level of PC compared with young flies. In vitro increments in trehalose concentration correspond to reduced formation of PCs, suggesting a protective role of trehalose against free radicals. A strong correlation between levels of trehalose and PC formation suggests amelioration of proteome damage due to ionizing radiation (IR). Stages with high trehalose levels showed protected proteome and high radiation resistance, suggesting a

  19. Radiation resistance of some microorganisms isolated from irradiated herbs

    International Nuclear Information System (INIS)

    El-Bazza, Z.E.; Shihab, A.; Farrag, H.A.; El-Sayed, Z.G.; Mahmoud, M.I.

    1997-01-01

    Three types of Egyptian medicinal herbs, sweet marjoram, spearmint and thyme were used in this study. The tested herbs were exposed to gamma radiation doses ranging from 1.0 to 10,0 kGy. The sublethal doses of radioresistant molds ranged from 1.0 to 2.0 kGy and the sublethal doses of radioresistant bacteria ranged from 7.0 to 8.0 kGy. The radioresistant molds isolated from sweet marjoram and spearmint herbs were identified as Aspergillus, whereas that isolated from thyme was identified as Aspergillus ochraceus. The radioresistant bacteria isolated from sweet marjoram, spearmint and thyme were identified as Bacillus megaterium, B.pantothenticus and B. brevis, respectively. All the radioresistant molds exhibited an exponential response. The D 15 v alue of Asp. ochraceus was 0.33 kGy, while that of Asp. niger were 0.45 and 0.5 kGy, respectively. All the bacterial species exhibited non-exponential response. The D 10 -values for B.megaterium, B. pantothenticus and B. brevis were found to be 2.58, 3.0 and 1.63 kGy, respectively

  20. Studies of antibiotic resistant mutants of Bacteroides fragilis obtained by Cs-137 ionizing radiation

    International Nuclear Information System (INIS)

    Azghani, A.O.

    1986-01-01

    The genus Bacteroides is an obligate anaerobic bacillus normally found in the upper respiratory tract, the colon, and the genitourinary system. The project reported here was undertaken because of the high frequency of hospital infections attributed to B. fragilis, and the increased resistance of the bacteria to commonly used antibiotics. Cs-137 gamma irradiation was used to induce antibiotic resistant mutants in B. fragilis in the presence of Escherichia coli B/r membrane fragments, employed as reducing agent. Based on a dose-survival curve, an effective radiation dose of 1.54 x 10 4 R (3.99 C/Kg) was used to induce mutations to rifampicin and tetracycline resistance in the test organism. The antibiotic resistant mutants of B. fragilis were utilized to reveal the mechanism by which this group of organisms becomes resistant to select chemotherapeutic agents. Studies on tetracycline resistant mutants of B. fragilis isolated after irradiation, suggest that the resistance to this antibiotic is associated with the outer membrane permeability. The difference in inhibitory action of rifampicin on RNA polymerase activity, from rifampicin sensitive and resistant strains of B. fragilis, reveals that this enzyme is a possible suitable target for inhibition of bacterial growth in anaerobes by rifampicin

  1. Radiation-resistant requirements analysis of device and control component for advanced spent fuel management process

    Energy Technology Data Exchange (ETDEWEB)

    Song, Tai Gil; Park, G. Y.; Kim, S. Y.; Lee, J. Y.; Kim, S. H.; Yoon, J. S. [Korea Atomic Energy Research Institute, Taejeon (Korea)

    2002-02-01

    It is known that high levels of radiation can cause significant damage by altering the properties of materials. A practical understanding of the effects of radiation - how radiation affects various types of materials and components - is required to design equipment to operate reliably in a gamma radiation environment. When designing equipment to operate in a high gamma radiation environment, such as will be present in a nuclear spent fuel handling facility, several important steps should be followed. In order to active test of the advanced spent fuel management process, the radiation-resistant analysis of the device and control component for active test which is concerned about the radiation environment is conducted. Also the system design process is analysis and reviewed. In the foreign literature, 'threshold' values are generally reported. the threshold values are normally the dose required to begin degradation in a particular material property. The radiation effect analysis for the device of vol-oxidation and metalization, which are main device for the advanced spent fuel management process, is performed by the SCALE 4.4 code. 5 refs., 4 figs., 13 tabs. (Author)

  2. Nucleocapsid Gene-Mediated Transgenic Resistance Provides Protection Against Tomato spotted wilt virus Epidemics in the Field.

    Science.gov (United States)

    Herrero, S; Culbreath, A K; Csinos, A S; Pappu, H R; Rufty, R C; Daub, M E

    2000-02-01

    ABSTRACT Transformation of plants with the nucleocapsid (N) gene of Tomato spotted wilt tospovirus (TSWV) provides resistance to disease development; however, information is lacking on the response of plants to natural inoculum in the field. Three tobacco cultivars were transformed with the N gene of a dahlia isolate of TSWV (TSWV-D), and plants were evaluated over several generations in the greenhouse. The resistant phenotype was more frequently observed in 'Burley 21' than in 'KY-14' or 'K-326', but highly resistant 'Burley 21' transgenic lines were resistant to only 44% of the heterologous TSWV isolates tested. Advanced generation (R(3) and R(4)) transgenic resistant lines of 'Burley 21' and a 'K-326' F(1) hybrid containing the N genes of two TSWV isolates were evaluated in the field near Tifton, GA, where TSWV is endemic. Disease development was monitored by symptom expression and enzyme-linked immunosorbent assay (ELISA) analysis. Whereas incidence of TSWV infection in 'Burley 21' susceptible controls was 20% in 1996 and 62% in 1997, the mean incidence in transgenic lines was reduced to 4 and 31%, respectively. Three transgenic 'Burley 21' lines were identified that had significantly lower incidence of disease than susceptible controls over the two years of the study. In addition, the rate of disease increase at the onset of the 1997 epidemic was reduced for all the 'Burley 21' transgenic lines compared with the susceptible controls. The 'K-326' F(1) hybrid was as susceptible as the 'K-326' nontransformed control. ELISA analysis demonstrated that symptomless plants from the most resistant 'Burley 21' transgenic lines accumulated detectable nucleocapsid protein, whereas symptomless plants from more susceptible lines did not. We conclude that transgenic resistance to TSWV is effective in reducing incidence of the disease in the field, and that accumulation of transgene protein may be important in broad-spectrum resistance.

  3. Sensitivity to ionizing radiation and chemotherapeutic agents in gemcitabine-resistant human tumor cell lines

    International Nuclear Information System (INIS)

    Bree, Chris van; Kreder, Natasja Castro; Loves, Willem J.P.; Franken, Nicolaas A.P.; Peters, Godefridus J.; Haveman, Jaap

    2002-01-01

    Purpose: To determine cross-resistance to anti-tumor treatments in 2',2'difluorodeoxycytidine (dFdC, gemcitabine)-resistant human tumor cells. Methods and Materials: Human lung carcinoma cells SW-1573 (SWp) were made resistant to dFdC (SWg). Sensitivity to cisplatin (cDDP), paclitaxel, 5-fluorouracil (5-FU), methotrexate (MTX), cytarabine (ara-C), and dFdC was measured by a proliferation assay. Radiosensitivity and radioenhancement by dFdC of this cell panel and the human ovarian carcinoma cell line A2780 and its dFdC-resistant variant AG6000 were determined by clonogenic assay. Bivariate flowcytometry was performed to study cell cycle changes. Results: In the SWg, a complete deoxycytidine kinase (dCK) deficiency was found on mRNA and protein level. This was accompanied by a 10-fold decrease in dCK activity which resulted in the >1000-fold resistance to dFdC. Sensitivity to other anti-tumor drugs was not altered, except for ara-C (>100-fold resistance). Radiosensitivity was not altered in the dFdC-resistant cell lines SWg and AG6000. High concentrations (50-100 μM dFdC) induced radioenhancement in the dFdC-resistant cell lines similar to the radioenhancement obtained at lower concentrations (10 nM dFdC) in the parental lines. An early S-phase arrest was found in all cell lines after dFdC treatment where radioenhancement was achieved. Conclusions: In the dFdC-resistant lung tumor cell line SWg, the deficiency in dCK is related to the resistance to dFdC and ara-C. No cross-resistance was observed to other anti-tumor drugs used for the treatment in lung cancer. Sensitivity to ionizing radiation was not altered in two different dFdC-resistant cell lines. Resistance to dFdC does not eliminate the ability of dFdC to sensitize cells to radiation

  4. Hypersensitivity to contact inhibition provides a clue to cancer resistance of naked mole-rat.

    Science.gov (United States)

    Seluanov, Andrei; Hine, Christopher; Azpurua, Jorge; Feigenson, Marina; Bozzella, Michael; Mao, Zhiyong; Catania, Kenneth C; Gorbunova, Vera

    2009-11-17

    The naked mole-rat is the longest living rodent with a maximum lifespan exceeding 28 years. In addition to its longevity, naked mole-rats have an extraordinary resistance to cancer as tumors have never been observed in these rodents. Furthermore, we show that a combination of activated Ras and SV40 LT fails to induce robust anchorage-independent growth in naked mole-rat cells, while it readily transforms mouse fibroblasts. The mechanisms responsible for the cancer resistance of naked mole-rats were unknown. Here we show that naked mole-rat fibroblasts display hypersensitivity to contact inhibition, a phenomenon we termed "early contact inhibition." Contact inhibition is a key anticancer mechanism that arrests cell division when cells reach a high density. In cell culture, naked mole-rat fibroblasts arrest at a much lower density than those from a mouse. We demonstrate that early contact inhibition requires the activity of p53 and pRb tumor suppressor pathways. Inactivation of both p53 and pRb attenuates early contact inhibition. Contact inhibition in human and mouse is triggered by the induction of p27(Kip1). In contrast, early contact inhibition in naked mole-rat is associated with the induction of p16(Ink4a). Furthermore, we show that the roles of p16(Ink4a) and p27(Kip1) in the control of contact inhibition became temporally separated in this species: the early contact inhibition is controlled by p16(Ink4a), and regular contact inhibition is controlled by p27(Kip1). We propose that the additional layer of protection conferred by two-tiered contact inhibition contributes to the remarkable tumor resistance of the naked mole-rat.

  5. Some resistance mechanisms to ultraviolet radiation; Algunos mecanismos de resistencia a radiacion ultravioleta

    Energy Technology Data Exchange (ETDEWEB)

    Alcantara D, D. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2002-12-15

    The cyclical exposure of bacterial cells to the ultraviolet light (UV) it has as consequence an increment in the resistance to the lethal effects of this type of radiation, increment that happens as a result of a selection process of favorable genetic mutations induced by the same UV light. With object to study the reproducibility of the genetic changes and the associate mechanisms to the resistance to UV in the bacteria Escherichia coli, was irradiated cyclically with UV light five different derived cultures of a single clone, being obtained five stumps with different resistance grades. The genetic mapping Hfr revealed that so much the mutation events like of selection that took place during the adaptation to the UV irradiation, happened of random manner, that is to say, each one of the resistant stumps it is the result of the unspecified selection of mutations arisen at random in different genes related with the repair and duplication of the DNA. (Author)

  6. Electrical resistance behavior with gamma radiation dose in bulk carbon nanostrutured samples

    International Nuclear Information System (INIS)

    Lage, J.; Leyva, A.; Pinnera, I.; Desdin, L. F.; Abreu, Y.; Cruz, C. M.; Leyva, D.; Toledo, C.

    2013-01-01

    The aim of this paper is to study the effects of 60 Co gamma radiation on the electrical resistance and V-I characteristic of bulk carbon nano structured samples obtained by electric arc discharge in water method. Images of pristine samples obtained with scanning electron, and the results in graphical form of the electrical characterization of irradiated samples are presented in the text. It was observed that the electrical resistance vs. dose behavior shows an initial increment reaching the maximum at approximately 135 kGy, followed by a drop of the resistance values. These behaviors are associated with the progressive generation of radiation induced defects in the sample, whose number increases to reach saturation at 135 kGy. From this dose, defects could lead to cross-links between different nano structures present in the sample conducting to a gradually drop in electrical resistance. The measured V-I curves show that, increasing exposure to the 60 Co gamma radiation, the electrical properties of the studied samples transit from a semiconductor towards a predominantly metallic behavior. These results were compared with those obtained for a sample of graphite powder irradiated under the same conditions. (Author)

  7. Radiation resistance of pyrocarbon-boned fuel and absorbing elements for HTGR

    International Nuclear Information System (INIS)

    Gurin, V.A.; Konotop, Yu.F.; Odejchuk, N.P.; Shirochenkov, S.D.; Yakovlev, V.K.; Aksenov, N.A.; Kuprienko, V.A.; Lebedev, I.G.; Samsonov, B.V.

    1990-01-01

    In choosing the reactor type, problems of nuclear and radiation safety are outstanding. The analysis of the design and experiments show that HTGR type reactors helium cooled satisfy all the safety requirements. It has been planned in the Soviet Union to construct two HTGR plants, VGR-50 and VG-400. Later it was decided to construct an experimental plant with a low power high temperature reactor (VGM). Spherical uranium-graphite fuel elements with coated fuel particles are supposed to be used in HTGR core. A unique technology for producing spherical pyrocarbon-bound fuel and absorbing elements of monolithic type has been developed. Extended tests were done to to investigate fuel elements behaviour: radiation resistance of coated fuel particles with different types of fuel; influence of the coated fuel particles design on gaseous fission products release; influence of non-sphericity on coated fuel particle performance; dependence of gaseous fission products release from fuel elements on the thickness of fuel-free cans; confining role of pyrocarbon as a factor capable of diminishing the rate of fission products release; radiation resistance of spherical fuel elements during burnup; radiation resistance of spherical absorbing elements to fast neutron fluence and boron burnup

  8. Expression of a cystatin transgene in eggplant provides resistance to root-knot nematode, Meloidogyne incognita

    Directory of Open Access Journals (Sweden)

    Pradeep Kumar Papolu

    2016-07-01

    Full Text Available Root-knot nematodes (RKN cause substantial yield decline in eggplant and sustainable management options to minimize crop damage due to nematodes are still limited. A number of genetic engineering strategies have been developed to disrupt the successful plant-nematode interactions. Among them, delivery of proteinase inhibitors from the plant to perturb nematode development and reproduction is arguably the most effective strategy. In the present study, transgenic eggplant expressing a modified rice cystatin (OC-IΔD86 gene under the control of the root-specific promoter, TUB-1, was generated to evaluate the genetically modified nematode resistance. Five putative transformants were selected through PCR and genomic Southern blot analysis. Expression of the cystatin transgene was confirmed in all the events using western blotting, ELISA and qPCR assay. Upon challenge inoculation, all the transgenic events exhibited a detrimental effect on RKN development and reproduction. The best transgenic line (a single copy event showed 78.3% inhibition in reproductive success of RKN. Our results suggest that cystatins can play an important role for improving nematode resistance in eggplant and their deployment in gene pyramiding strategies with other proteinase inhibitors could ultimately enhance crop yield.

  9. 'REACTS'. A pragmatic approach for providing medical care and physician education for radiation emergencies

    International Nuclear Information System (INIS)

    Lushbaugh, C.C.; Andrews, G.A.; Huebner, K.F.; Cloutier, R.J.; Beck, W.L.; Berger, J.D.

    1976-01-01

    Because serious radiation incidents have been rare, few medical personnel (notably only some in France, Russia, Belgium, Canada, Yugoslavia, Japan, Great Britain and the United States) have first-hand experience in radiation-accident management. The generation of physicians who participated in those accidents now needs to pass on the bits of knowledge that were gleaned from them. These case histories are difficult for the local, non-radiology physician to obtain when he is called upon to help formulate the medical-emergency response plan required everywhere for licensing power reactors. The Radiation Emergency Assistance Center and Training Site (REACTS) in Oak Ridge, Tennessee, supported by the US Energy Research and Development Administration, is designed to meet these medical and educational needs. REACTS, located in the Oak Ridge Hospital of the Methodist Church, is not involved in the hospital's daily community functions except insofar as REACTS is the radiation emergency arm of the area's major disaster plan. Its dual mission is training physicians, nurses, and paramedical emergency personnel in radiation-accident management, and treating irradiated and contaminated persons. Its training activities are carried out by the Special Training Division of Oak Ridge Associated Universities. Formal courses in radiation medicine and health physics and practical laboratory experience are now conducted twice a year for physicians. They will be expanded in the future to include training of paramedical personnel. Follow-up studies of radiation-accident survivors are carried out in REACTS to ensure the preservation of valuable human data and radiation-accident experiences. This unique facility and its staff are dedicated to meet the needs of the far-flung public and private medical domains in the United States for nuclear-production energy

  10. Sunlight-exposed biofilm microbial communities are naturally resistant to chernobyl ionizing-radiation levels.

    Science.gov (United States)

    Ragon, Marie; Restoux, Gwendal; Moreira, David; Møller, Anders Pape; López-García, Purificación

    2011-01-01

    The Chernobyl accident represents a long-term experiment on the effects of exposure to ionizing radiation at the ecosystem level. Though studies of these effects on plants and animals are abundant, the study of how Chernobyl radiation levels affect prokaryotic and eukaryotic microbial communities is practically non-existent, except for a few reports on human pathogens or soil microorganisms. Environments enduring extreme desiccation and UV radiation, such as sunlight exposed biofilms could in principle select for organisms highly resistant to ionizing radiation as well. To test this hypothesis, we explored the diversity of microorganisms belonging to the three domains of life by cultivation-independent approaches in biofilms developing on concrete walls or pillars in the Chernobyl area exposed to different levels of radiation, and we compared them with a similar biofilm from a non-irradiated site in Northern Ireland. Actinobacteria, Alphaproteobacteria, Bacteroidetes, Acidobacteria and Deinococcales were the most consistently detected bacterial groups, whereas green algae (Chlorophyta) and ascomycete fungi (Ascomycota) dominated within the eukaryotes. Close relatives to the most radio-resistant organisms known, including Rubrobacter species, Deinococcales and melanized ascomycete fungi were always detected. The diversity of bacteria and eukaryotes found in the most highly irradiated samples was comparable to that of less irradiated Chernobyl sites and Northern Ireland. However, the study of mutation frequencies in non-coding ITS regions versus SSU rRNA genes in members of a same actinobacterial operational taxonomic unit (OTU) present in Chernobyl samples and Northern Ireland showed a positive correlation between increased radiation and mutation rates. Our results show that biofilm microbial communities in the most irradiated samples are comparable to non-irradiated samples in terms of general diversity patterns, despite increased mutation levels at the single

  11. Do clinical examination gloves provide adequate electrical insulation for safe hands-on defibrillation? I: Resistive properties of nitrile gloves.

    Science.gov (United States)

    Deakin, Charles D; Lee-Shrewsbury, Victoria; Hogg, Kitwani; Petley, Graham W

    2013-07-01

    Uninterrupted chest compressions are a key factor in determining resuscitation success. Interruptions to chest compression are often associated with defibrillation, particularly the need to stand clear from the patient during defibrillation. It has been suggested that clinical examination gloves may provide adequate electrical resistance to enable safe hands-on defibrillation in order to minimise interruptions. We therefore examined whether commonly used nitrile clinical examination gloves provide adequate resistance to current flow to enable safe hands-on defibrillation. Clinical examination gloves (Kimberly Clark KC300 Sterling nitrile) worn by members of hospital cardiac arrest teams were collected immediately following termination of resuscitation. To determine the level of protection afforded by visually intact gloves, electrical resistance across the glove was measured by applying a DC voltage across the glove and measuring subsequent resistance. Forty new unused gloves (control) were compared with 28 clinical (non-CPR) gloves and 128 clinical (CPR) gloves. One glove in each group had a visible tear and was excluded from analysis. Control gloves had a minimum resistance of 120 kΩ (median 190 kΩ) compared with 60 kΩ in clinical gloves (both CPR (median 140 kΩ) and non-CPR groups (median 160 kΩ)). Nitrile clinical examination gloves do not provide adequate electrical insulation for the rescuer to safely undertake 'hands-on' defibrillation and when exposed to the physical forces of external chest compression, even greater resistive degradation occurs. Further work is required to identify gloves suitable for safe use for 'hands-on' defibrillation. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  12. Phenotypical and biochemical characterisation of resistance for parasitic weed (Orobanche foetida Poir.) in radiation-mutagenised mutants of chickpea.

    Science.gov (United States)

    Brahmi, Ines; Mabrouk, Yassine; Brun, Guillaume; Delavault, Philippe; Belhadj, Omrane; Simier, Philippe

    2016-12-01

    Some radiation-mutagenised chickpea mutants potentially resistant to the broomrape, Orobanche foetida Poir., were selected through field trials. The objectives of this work were to confirm resistance under artificial infestation, in pots and mini-rhizotron systems, and to determine the developmental stages of broomrape affected by resistance and the relevant resistance mechanisms induced by radiation mutagenesis. Among 30 mutants tested for resistance to O. foetida, five shared strong resistance in both pot experiments and mini-rhizotron systems. Resistance was not complete, but the few individuals that escaped resistance displayed high disorders of shoot development. Results demonstrated a 2-3-fold decrease in stimulatory activity of root exudates towards broomrape seed germination in resistant mutants in comparison with non-irradiated control plants and susceptible mutants. Resistance was associated with an induction of broomrape necrosis early during infection. When infested, most of the resistant mutants shared enhanced levels of soluble phenolic contents, phenylalanine ammonia lyase activity, guaiacol peroxidase activity and polyphenol oxidase activity, in addition to glutathione and notably ascorbate peroxidase gene expression in roots. Results confirmed enhanced resistance in chickpea radiation-mutagenised mutants, and demonstrated that resistance is based on alteration of root exudation, presumed cell-wall reinforcement and change in root oxidative status in response to infection. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  13. Handling technique of spore-forming bacteria in radiation sterilization. 2. Determination of numbers and radiation resistance of spores

    International Nuclear Information System (INIS)

    Koshikawa, Tomihiko

    1994-01-01

    Stepwise ten-fold dilution of bacterial solution is required in the determination of bacterial spores. For this, the selection of diluted solution is important according to the purpose of experiment. First, the preparation of suspension of bacterial spores and selection of diluted solution are presented. Then, a method for determining the number of bacterial spores in materials is outlined in terms of dilution methods of bacterial solution (shaking and homogenization) and application method of diluted solution to the plating medium. Finally, a method for determining radiation resistance of spore-forming bacteria is explained according to the measurement conditions (suspension of bacterial spores and filters applied with bacterial spores). (N.K.)

  14. Handling technique of spore-forming bacteria in radiation sterilization. 2. Determination of numbers and radiation resistance of spores

    Energy Technology Data Exchange (ETDEWEB)

    Koshikawa, Tomihiko [Japan Radioisotope Association, Shiga (Japan). Koka Laboratory

    1994-12-01

    Stepwise ten-fold dilution of bacterial solution is required in the determination of bacterial spores. For this, the selection of diluted solution is important according to the purpose of experiment. First, the preparation of suspension of bacterial spores and selection of diluted solution are presented. Then, a method for determining the number of bacterial spores in materials is outlined in terms of dilution methods of bacterial solution (shaking and homogenization) and application method of diluted solution to the plating medium. Finally, a method for determining radiation resistance of spore-forming bacteria is explained according to the measurement conditions (suspension of bacterial spores and filters applied with bacterial spores). (N.K.).

  15. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  16. In vitro induction of variability through radiation for late blight resistance and heat tolerance in potato

    International Nuclear Information System (INIS)

    Gosal, S.S.; Das, A.; Gopal, J.; Minocha, J.L.; Chopra, H.R.; Dhaliwal, H.S.

    2001-01-01

    In vitro cultured shoots of potato, cvs. 'Kufri Jyoti' and 'Kufri Chandramukhi', were irradiated with 20 and 40 Gy gamma rays. Microtubers, obtained from MIV3 shoots multiplied in vitro, were planted in pots. The resulting plants were screened for resistance to late blight, using detached leaf method. In 'Kufri Chandramukhi', 42% plants and in 'Kufri Jyoti' 36% plants, obtained from 40 Gy treatment, showed resistance to late blight. The frequency of resistant plants was lower from 20 Gy treatment. The progenies of putatively resistant plants were grown in field, and inoculated with sporangial inoculum of late blight fungus. The field grown progeny segregated for disease resistance, and approximately 56% plants showed resistance. During the next propagation, the frequency of resistant plants increased to 72%. For developing heat tolerance, microtubers obtained from 20 and 40 Gy treatments and in vitro multiplied M 1 V 3 shoots were cultured at high temperature of 28C. In both varieties, the number of the microtubers per plant was highly reduced and the resulting microtubers had distorted shape but showed better germination (62%), even in early sowing at relatively higher temperature. Of the two radiation doses, the higher dose of 40 Gy gave better results in both the varieties. Heat tolerance was also assessed from chlorophyll persistence. The progenies from putative heat-tolerant plants were tested in field by planting at higher temperature in two subsequent generations. The heat tolerant plants segregated in each generation, but the frequency of heat-tolerant plants increased. (author)

  17. Increasing the radiation resistance of single-crystal silicon epitaxial layers

    Directory of Open Access Journals (Sweden)

    Kurmashev Sh. D.

    2014-12-01

    Full Text Available The authors investigate the possibility of increasing the radiation resistance of silicon epitaxial layers by creating radiation defects sinks in the form of dislocation networks of the density of 109—1012 m–2. Such networks are created before the epitaxial layer is applied on the front surface of the silicon substrate by its preliminary oxidation and subsequent etching of the oxide layer. The substrates were silicon wafers KEF-4.5 and KDB-10 with a diameter of about 40 mm, grown by the Czochralski method. Irradiation of the samples was carried out using electron linear accelerator "Electronics" (ЭЛУ-4. Energy of the particles was 2,3—3,0 MeV, radiation dose 1015—1020 m–2, electron beam current 2 mA/m2. It is shown that in structures containing dislocation networks, irradiation results in reduction of the reverse currents by 5—8 times and of the density of defects by 5—10 times, while the mobility of the charge carriers is increased by 1,2 times. Wafer yield for operation under radiation exposure, when the semiconductor structures are formed in the optimal mode, is increased by 7—10% compared to the structures without dislocation networks. The results obtained can be used in manufacturing technology for radiation-resistant integrated circuits (bipolar, CMOS, BiCMOS, etc..

  18. Radiation resistant electrical bushing for high pressures and temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Zajic, V; Banyr, J

    1980-11-15

    The bushing described is characterized by a hollow with a joining member provided inside of at least one of the bushing's electrically conductive core soldered or embedded into a bore in the insulator. Thus, the concentration is limited of the material of the electrically conductive core in the area of the soldered or embedded joint of the support of the electrically conductive core and the insulator, and the resulting force effect is reduced of the difference in thermal dilatations of the materials of the electrically conductive core and the insulator.

  19. Radiation resistant electrical bushing for high pressures and temperatures

    International Nuclear Information System (INIS)

    Zajic, V.; Banyr, J.

    1980-01-01

    The bushing described is characterized by a hollow with a joining member provided inside of at least one of the bushing's electrically conductive core soldered or embedded into a bore in the insulator. Thus, the concentration is limited of the material of the electrically conductive core in the area of the soldered or embedded joint of the support of the electrically conductive core and the insulator, and the resulting force effect is reduced of the difference in thermal dilatations of the materials of the electrically conductive core and the insulator. (J.B.)

  20. Development of bunchy top virus resistant banana cv lakatan in vitro culture and radiation technology

    International Nuclear Information System (INIS)

    Estrella, J.D.; Caymo, L.S.; Dizon, T.O.; Dela Cruz, F. Jr; Damasco, O.P.

    2002-01-01

    Bunchy to virus (BTV) is the most destructive virus disease of banana in the Philippines. Incorporation of resistance to this virus disease by conventional hybridization is not possible due to male and female sterility of most commercial banana cultivars. In vitro culture coupled with radiation technology can be used to develop BTV resistance in banana cv. Lakatan. The sensitivity of banana shot tip explants to gamma irradiation was determined by subjecting the shoot tips to varying doses (5, 10, 20, 25, 30, 40, 60, 80 and 100 Gy) of irradiation. The LD sub 50 for banana shoot tips determined by 50% reduction in growth and shoot proliferation, was observed to around 20-25 Gy. Bulk irradiation of shoot tip explants was conducted using 20-25 Gy. Irradiated cultures were multiplied for 3-5 cycles and plants regenerated were potted out and screened for BTV resistance. A total of 3,447 irradiated plants regenerated from the radiosensitivity experiment (1,847 plants) and bulk irradiation of 20/25 Gy (1,600 plants) were screened for BTV resistance in the greenhouse using artificial BTV inoculation using the aphid vector Pentalonia nigronervosa. One hundred eighteen plants or 3.4% (118/3,447) of the artificially irradiated plants showed seedling resistance after 4-7 months of evaluation. These plants were planted in the field and were subjected to natural BTV infection. To date, 85 (out of the 118) putative seedling resistant plants continuously expressed BTV resistance in the field after more than 10 months of evaluation. The absence of BTV infection in 39 putative resistant plants was confirmed by ELISA test. Suckers from selected putative resistance plants will be collected, propagated and evaluated for the second cycle stability of BTV resistance and detailed characterization of important horticultural traits

  1. Resistance Patterns Associated with HCV NS5A Inhibitors Provide Limited Insight into Drug Binding

    Directory of Open Access Journals (Sweden)

    Moheshwarnath Issur

    2014-11-01

    Full Text Available Direct-acting antivirals (DAAs have significantly improved the treatment of infection with the hepatitis C virus. A promising class of novel antiviral agents targets the HCV NS5A protein. The high potency and broad genotypic coverage are favorable properties. NS5A inhibitors are currently assessed in advanced clinical trials in combination with viral polymerase inhibitors and/or viral protease inhibitors. However, the clinical use of NS5A inhibitors is also associated with new challenges. HCV variants with decreased susceptibility to these drugs can emerge and compromise therapy. In this review, we discuss resistance patterns in NS5A with focus prevalence and implications for inhibitor binding.

  2. Evaluation of the radiation resistance of high-density polyethylene

    International Nuclear Information System (INIS)

    Dougherty, D.R.; Adams, J.W.; Barletta, R.R.

    1984-03-01

    Mechanical tests following gamma irradiation and creep tests during irradiation have been conducted on high-density polyethylene (HDPE) to provide data to help assess the adequacy of this material for use in high integrity containers (HICs). Two types of HDPE, a highly cross-linked rotationally molded material and a non-cross-linked blow molded material, were used in these tests. Gamma-ray irradiations were performed at several dose rates in environments of air, Barnwell and Hanford backfill soils, and ion-exchange resins. The results of tensile and bend tests on these materials following irradiation are presented along with results on creep during irradiation. 8 references, 9 figures, 2 tables

  3. Supplementary Material for: Mycobacterium tuberculosis whole genome sequencing and protein structure modelling provides insights into anti-tuberculosis drug resistance

    KAUST Repository

    Phelan, Jody

    2016-01-01

    Abstract Background Combating the spread of drug resistant tuberculosis is a global health priority. Whole genome association studies are being applied to identify genetic determinants of resistance to anti-tuberculosis drugs. Protein structure and interaction modelling are used to understand the functional effects of putative mutations and provide insight into the molecular mechanisms leading to resistance. Methods To investigate the potential utility of these approaches, we analysed the genomes of 144 Mycobacterium tuberculosis clinical isolates from The Special Programme for Research and Training in Tropical Diseases (TDR) collection sourced from 20 countries in four continents. A genome-wide approach was applied to 127 isolates to identify polymorphisms associated with minimum inhibitory concentrations for first-line anti-tuberculosis drugs. In addition, the effect of identified candidate mutations on protein stability and interactions was assessed quantitatively with well-established computational methods. Results The analysis revealed that mutations in the genes rpoB (rifampicin), katG (isoniazid), inhA-promoter (isoniazid), rpsL (streptomycin) and embB (ethambutol) were responsible for the majority of resistance observed. A subset of the mutations identified in rpoB and katG were predicted to affect protein stability. Further, a strong direct correlation was observed between the minimum inhibitory concentration values and the distance of the mutated residues in the three-dimensional structures of rpoB and katG to their respective drugs binding sites. Conclusions Using the TDR resource, we demonstrate the usefulness of whole genome association and convergent evolution approaches to detect known and potentially novel mutations associated with drug resistance. Further, protein structural modelling could provide a means of predicting the impact of polymorphisms on drug efficacy in the absence of phenotypic data. These approaches could ultimately lead to novel

  4. Mycobacterium tuberculosis whole genome sequencing and protein structure modelling provides insights into anti-tuberculosis drug resistance

    KAUST Repository

    Phelan, Jody

    2016-03-23

    Background Combating the spread of drug resistant tuberculosis is a global health priority. Whole genome association studies are being applied to identify genetic determinants of resistance to anti-tuberculosis drugs. Protein structure and interaction modelling are used to understand the functional effects of putative mutations and provide insight into the molecular mechanisms leading to resistance. Methods To investigate the potential utility of these approaches, we analysed the genomes of 144 Mycobacterium tuberculosis clinical isolates from The Special Programme for Research and Training in Tropical Diseases (TDR) collection sourced from 20 countries in four continents. A genome-wide approach was applied to 127 isolates to identify polymorphisms associated with minimum inhibitory concentrations for first-line anti-tuberculosis drugs. In addition, the effect of identified candidate mutations on protein stability and interactions was assessed quantitatively with well-established computational methods. Results The analysis revealed that mutations in the genes rpoB (rifampicin), katG (isoniazid), inhA-promoter (isoniazid), rpsL (streptomycin) and embB (ethambutol) were responsible for the majority of resistance observed. A subset of the mutations identified in rpoB and katG were predicted to affect protein stability. Further, a strong direct correlation was observed between the minimum inhibitory concentration values and the distance of the mutated residues in the three-dimensional structures of rpoB and katG to their respective drugs binding sites. Conclusions Using the TDR resource, we demonstrate the usefulness of whole genome association and convergent evolution approaches to detect known and potentially novel mutations associated with drug resistance. Further, protein structural modelling could provide a means of predicting the impact of polymorphisms on drug efficacy in the absence of phenotypic data. These approaches could ultimately lead to novel resistance

  5. Genome Analysis of the First Extensively Drug-Resistant (XDR Mycobacterium tuberculosis in Malaysia Provides Insights into the Genetic Basis of Its Biology and Drug Resistance.

    Directory of Open Access Journals (Sweden)

    Chee Sian Kuan

    Full Text Available The outbreak of extensively drug-resistant tuberculosis (XDR-TB has become an increasing problem in many TB-burdened countries. The underlying drug resistance mechanisms, including the genetic variation favored by selective pressure in the resistant population, are partially understood. Recently, the first case of XDR-TB was reported in Malaysia. However, the detailed genotype family and mechanisms of the formation of multiple drugs resistance are unknown. We sequenced the whole genome of the UM 1072388579 strain with a 2-kb insert-size library and combined with that from previously sequenced 500-bp-insert paired-end reads to produce an improved sequence with maximal sequencing coverage across the genome. In silico spoligotyping and phylogenetic analyses demonstrated that UM 1072388579 strain belongs to an ancestral-like, non-Beijing clade of East Asia lineage. This is supported by the presence of a number of lineage-specific markers, including fadD28, embA, nuoD and pks7. Polymorphism analysis showed that the drug-susceptibility profile is correlated with the pattern of resistance mutations. Mutations in drug-efflux pumps and the cell wall biogenesis pathway such as mmpL, pks and fadD genes may play an important role in survival and adaptation of this strain to its surrounding environment. In this work, fifty-seven putative promoter SNPs were identified. Among them, we identified a novel SNP located at -4 T allele of TetR/acrR promoter as an informative marker to recognize strains of East Asian lineage. Our work indicates that the UM 1072388579 harbors both classical and uncommon SNPs that allow it to escape from inhibition by many antibiotics. This study provides a strong foundation to dissect the biology and underlying resistance mechanisms of the first reported XDR M. tuberculosis in Malaysia.

  6. Mutants of Escherichia coli K-12 with enhanced resistance to ionizing radiation

    International Nuclear Information System (INIS)

    Verbenko, V.N.; Akhmedov, A.T.; Kalinin, V.L.

    1986-01-01

    By means of one-dimensional electrophoresis, it is shown that in radiation-resistant Gam 444 ad Gam 445 mutants of Escherichia coli K-12 high-molecular weight heat shock proteins are hyperproduced at 32-37 deg C and are induced more intensively during heat shock (in comparison to the parental) wild-tupe strain AB parallel 57). When the missense htp R15 mutation of the positive regulatory htpR gene for heat shock proteins was introduced by transduction into genome of the Gam 444 mutant, its enhanced radiation-resistance disappeared but could not be restored upon introduction of pKV3 plasmid bearing the htpR, gene. These data show that heat shock Protens are participating in the enhanced radioresistance of Gam mutants

  7. Irradiation test of component for radiation-resistant small sized motor

    International Nuclear Information System (INIS)

    Nakamichi, M.; Ishitsuka, E.; Shimakawa, S.; Kan, S.

    2009-01-01

    A small-sized motor with a resistance to radiation was developed. This motor has been able to operate at a gamma-ray dose of a value 700 times as high as the specification of a commercial motor. The present work describes results of post-irradiation examinations (PIEs) to evaluate effects of neutron irradiation on the lifetime of some major components of the motor such as a bearing, a magnet and a fixation agent for a field coil wire. It became clear from the results of PIEs that the radiation-resistance dose of the motor using a Sm-Co magnet will be expected to be one order of magnitude higher than that of the motor using a Nb-Fe-B magnet.

  8. Effect of nano-oxide particle size on radiation resistance of iron–chromium alloys

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Weizong; Li, Lulu [Department of Materials Science and Engineering, North Carolina State University, Raleigh, NC 27695 (United States); Valdez, James A. [Materials Science and Technology Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Saber, Mostafa [Department of Mechanical and Materials Engineering, Portland State University, Portland, OR 97201 (United States); Zhu, Yuntian, E-mail: ytzhu@ncsu.edu [Department of Materials Science and Engineering, North Carolina State University, Raleigh, NC 27695 (United States); Koch, Carl C.; Scattergood, Ronald O. [Department of Materials Science and Engineering, North Carolina State University, Raleigh, NC 27695 (United States)

    2016-02-15

    Radiation resistance of Fe–14Cr alloys under 200 keV He irradiation at 500 °C was systematically investigated with varying sizes of nano oxide Zr, Hf and Cr particles. It is found that these nano oxide particles acted as effective sites for He bubble formation. By statistically analyzing 700–1500 He bubbles at the depth of about 150–700 nm from a series of HRTEM images for each sample, we established the variation of average He bubble size, He bubble density, and swelling percentage along the depth, and found them to be consistent with the He concentration profile calculated from the SIRM program. Oxide particles with sizes less than 3.5–4 nm are found most effective for enhancing radiation resistance in the studied alloy systems.

  9. Simulation of Radiation Heat Transfer in a VAR Furnace Using an Electrical Resistance Network

    Science.gov (United States)

    Ballantyne, A. Stewart

    The use of electrical resistance networks to simulate heat transfer is a well known analytical technique that greatly simplifies the solution of radiation heat transfer problems. In a VAR furnace, radiative heat transfer occurs between the ingot, electrode, and crucible wall; and the arc when the latter is present during melting. To explore the relative heat exchange between these elements, a resistive network model was developed to simulate the heat exchange between the electrode, ingot, and crucible with and without the presence of an arc. This model was then combined with an ingot model to simulate the VAR process and permit a comparison between calculated and observed results during steady state melting. Results from simulations of a variety of alloys of different sizes have demonstrated the validity of the model. Subsequent simulations demonstrate the application of the model to the optimization of both steady state and hot top melt practices, and raises questions concerning heat flux assumptions at the ingot top surface.

  10. The activity at the state organs of Russia in the field for providing radiation safety

    International Nuclear Information System (INIS)

    Panfilov, A.P.

    1994-01-01

    The principles of reliable, efficient radiation safety of enterprises, research institute and organizations of Minatom of Russian Federation, environmental protection and some other problems have been discussed in this report. It consists of three parts. The first contents the information of the governmental and industrial safety systems on the territory of Russian Federation. The second part comprises the findings distinguishing the safety of the NPPs and the enterprises of nuclear industry. Some problems of the actual researches and application developments including the development of new international nuclear safety standards based on recommendations of International Committee of Radiation Protection have been written in third part. (author)

  11. Alkali activated slag mortars provide high resistance to chloride-induced corrosion of steel

    Science.gov (United States)

    Criado, Maria; Provis, John L.

    2018-06-01

    The pore solutions of alkali-activated slag cements and Portland-based cements are very different in terms of their chemical and redox characteristics, particularly due to the high alkalinity and high sulfide content of alkali-activated slag cement. Therefore, differences in corrosion mechanisms of steel elements embedded in these cements could be expected, with important implications for the durability of reinforced concrete elements. This study assesses the corrosion behaviour of steel embedded in alkali-activated blast furnace slag (BFS) mortars exposed to alkaline solution, alkaline chloride-rich solution, water, and standard laboratory conditions, using electrochemical techniques. White Portland cement (WPC) mortars and blended cement mortars (white Portland cement and blast furnace slag) were also tested for comparative purposes. The steel elements embedded in immersed alkali-activated slag mortars presented very negative redox potentials and high apparent corrosion current values; the presence of sulfide reduced the redox potential, and the oxidation of the reduced sulfur-containing species within the cement itself gave an electrochemical signal that classical electrochemical tests for reinforced concrete durability would interpret as being due to steel corrosion processes. However, the actual observed resistance to chloride-induced corrosion was very high, as measured by extraction and characterisation of the steel at the end of a 9-month exposure period, whereas the steel embedded in white Portland cement mortars was significantly damaged under the same conditions.

  12. Microbial cells can cooperate to resist high-level chronic ionizing radiation

    OpenAIRE

    Shuryak, Igor; Matrosova, Vera Y.; Gaidamakova, Elena K.; Tkavc, Rok; Grichenko, Olga; Klimenkova, Polina; Volpe, Robert P.; Daly, Michael J.

    2017-01-01

    Understanding chronic ionizing radiation (CIR) effects is of utmost importance to protecting human health and the environment. Diverse bacteria and fungi inhabiting extremely radioactive waste and disaster sites (e.g. Hanford, Chernobyl, Fukushima) represent new targets of CIR research. We show that many microorganisms can grow under intense gamma-CIR dose rates of 13–126 Gy/h, with fungi identified as a particularly CIR-resistant group of eukaryotes: among 145 phylogenetically diverse strain...

  13. Prostate radiation in non-metastatic castrate refractory prostate cancer provides an interesting insight into biology of prostate cancer

    Directory of Open Access Journals (Sweden)

    Pascoe Abigail C

    2012-03-01

    Full Text Available Abstract Background The natural history of non-metastatic castrate refractory prostate cancer is unknown and treatment options are limited. We present a retrospective review of 13 patients with locally advanced or high risk prostate cancer, initially treated with hormone monotherapy and then treated with prostate radiation after becoming castration refractory. Findings Median PSA response following prostate radiation was 67.4%. Median time to biochemical progression following radiotherapy was 15 months and to detection of metastatic disease was 18.5 months. Median survival from castration resistance (to date of death or November 2011 was 60 months, with median survival from RT 42 months. Conclusion Prostate radiation appears to be beneficial even in patients with potential micrometastatic disease, which supports the hypothesis that the primary tumour is important in the progression of prostate cancer. These results are an interesting addition to the literature on the biology of prostate cancer especially as this data is unlikely to be available in the future due to combined prostate radiation and androgen deprivation therapy now being the standard of care.

  14. Radiation Effects of n-type, Low Resistivity, Spiral Silicon Drift Detector Hybrid Systems

    International Nuclear Information System (INIS)

    Chen, W.; De Geronimo, G.; Carini, G.A.; Gaskin, J.A.; Keister, J.W.; Li, S.; Li, Z.; Ramsey, B.D.; Siddons, D.P.; Smith, G.C.; Verbitskaya, E.

    2011-01-01

    We have developed a new thin-window, n-type, low-resistivity, spiral silicon drift detector (SDD) array - to be used as an extraterrestrial X-ray spectrometer (in varying environments) for NASA. To achieve low-energy response, a thin SDD entrance window was produced using a previously developed method. These thin-window devices were also produced on lower resistivity, thinner, n-type, silicon material, effectively ensuring their radiation hardness in anticipation of operation in potentially harsh radiation environments (such as found around the Jupiter system). Using the Indiana University Cyclotron Facility beam line RERS1, we irradiated a set of suitable diodes up to 5 Mrad and the latest iteration of our ASICs up to 12 Mrad. Then we irradiated two hybrid detectors consisting of newly, such-produced in-house (BNL) SDD chips bonded with ASICs with doses of 0.25 Mrad and 1 Mrad. Also we irradiated another hybrid detector consisting of previously produced (by KETEK) on n-type, high-resistivity SDD chip bonded with BNL's ASICs with a dose of 1 Mrad. The measurement results of radiated diodes (up to 5 Mrad), ASICs (up to 12 Mrad) and hybrid detectors (up to 1 Mrad) are presented here.

  15. Use of radiation for improving vines regarding their resistance to mildew

    International Nuclear Information System (INIS)

    Coutinho, M.P.

    1977-01-01

    Vines (Vitis vinifera) resistant to mildew (Plasmopara viticola) offer real advantages in Europe, and the problems of producing such vines were studied for a long time. At first conventional techniques were used, obtaining plants with high yield and with resistance persisting under widely differing ecological conditions; moreover, pathogenically different biotypes of Plasmopara have never been found. However, various factors - such as the quantitative nature of this resistance, which is controlled by a polygenic system, certain genetic correlations between resistance and poor quality of the grapes and the lack of resistance sources in V. vinifera - suggested that mutagenesis should be included among the methods used for the improvement of vines. Hence shoots and, more particularly, seeds have been undergoing irradiation with X-rays and neutrons since 1966. The exposure of seeds to low radiation doses (about 1000rad), particularly of X-rays, has in most varieties produced a very welcome increase in the germination percentage. Seedlings from irradiated seeds are selected mainly on the basis of the characteristics of the infection spots which develop on the leaves. In V. vinifera, resistance to mildew is reflected not in necroses but in small and usually not very sporulated spots. Using these criteria, the author has already selected - after natural infections and inoculations - plants representing approximately 0.001-0.0025% of the total number of plants screened. Tables illustrate the selection procedure up to 1976

  16. Functional genetic research for radiation and drug resistant adenocarcinoma and its application

    Energy Technology Data Exchange (ETDEWEB)

    Kim, In Gyu; Kim, Kug Chan; Jung, Il Lae; Chul, Shin Byung; Kook, Park Hyo; Lee, Hee Min

    2012-01-15

    The work scope of 'Functional genetic research for radiation and drug resistant adenocarcinoma and its application' had contained the research about effect of transgelin(SM22a), neurotensin, metallothionein-1G transgelin-2 genes on the cell death triggered ionizing radiation, cisplatin, MMS, luteolin and H{sub 2}O{sub 2}(toxic agents), which are highly expressed in radiation-induced mutant cells. In this study, to elucidate the role of these proteins in the ionizing radiation (toxic chemicals)-induced cell death, we utilized sensed (or antisense, small interference RNA) cells, which overexpress (or down-regulate) RNAs associated with these proteins biosynthesis, and investigated the effects of these genes on the cytotoxicity caused by ionizing radiation, H{sub 2}O{sub 2} and toxic chemicals. We also investigated the functions of downstream target genes of transgelin such as IGF-1Rβ/PI3K/AKT pathway and transgelin/metallothioneine in A-549 and HepG2 cells because such target genes are able to potentiate the cell-killing or cell protecting effects against radiation.

  17. Functional genetic research for radiation and drug resistant adenocarcinoma and its application

    International Nuclear Information System (INIS)

    Kim, In Gyu; Kim, Kug Chan; Jung, Il Lae; Chul, Shin Byung; Kook, Park Hyo; Lee, Hee Min

    2012-01-01

    The work scope of 'Functional genetic research for radiation and drug resistant adenocarcinoma and its application' had contained the research about effect of transgelin(SM22a), neurotensin, metallothionein-1G transgelin-2 genes on the cell death triggered ionizing radiation, cisplatin, MMS, luteolin and H 2 O 2 (toxic agents), which are highly expressed in radiation-induced mutant cells. In this study, to elucidate the role of these proteins in the ionizing radiation (toxic chemicals)-induced cell death, we utilized sensed (or antisense, small interference RNA) cells, which overexpress (or down-regulate) RNAs associated with these proteins biosynthesis, and investigated the effects of these genes on the cytotoxicity caused by ionizing radiation, H 2 O 2 and toxic chemicals. We also investigated the functions of downstream target genes of transgelin such as IGF-1Rβ/PI3K/AKT pathway and transgelin/metallothioneine in A-549 and HepG2 cells because such target genes are able to potentiate the cell-killing or cell protecting effects against radiation

  18. Nutritional Supplement of Hatchery Eggshell Membrane Improves Poultry Performance and Provides Resistance against Endotoxin Stress.

    Directory of Open Access Journals (Sweden)

    S K Makkar

    resistance of chickens to endotoxin.

  19. Nutritional Supplement of Hatchery Eggshell Membrane Improves Poultry Performance and Provides Resistance against Endotoxin Stress.

    Science.gov (United States)

    Makkar, S K; Rath, N C; Packialakshmi, B; Zhou, Z Y; Huff, G R; Donoghue, A M

    2016-01-01

    Eggshells are significant part of hatchery waste which consist of calcium carbonate crust, membranes, and proteins and peptides of embryonic origins along with other entrapped contaminants including microbes. We hypothesized that using this product as a nutritional additive in poultry diet may confer better immunity to the chickens in the paradigm of mammalian milk that enhances immunity. Therefore, we investigated the effect of hatchery eggshell membranes (HESM) as a short term feed supplement on growth performance and immunity of chickens under bacterial lipopolysaccharide (LPS) challenged condition. Three studies were conducted to find the effect of HESM supplement on post hatch chickens. In the first study, the chickens were fed either a control diet or diets containing 0.5% whey protein or HESM as supplement and evaluated at 5 weeks of age using growth, hematology, clinical chemistry, plasma immunoglobulins, and corticosterone as variables. The second and third studies were done to compare the effects of LPS on control and HESM fed birds at 5 weeks of age following at 4 and 24 h of treatment where the HESM was also sterilized with ethanol to deplete bacterial factors. HESM supplement caused weight gain in 2 experiments and decreased blood corticosterone concentrations. While LPS caused a significant loss in body weight at 24 h following its administration, the HESM supplemented birds showed significantly less body weight loss compared with the control fed birds. The WBC, heterophil/lymphocyte ratio, and the levels of IgG were low in chickens fed diets with HESM supplement compared with control diet group. LPS challenge increased the expression of pro-inflammatory cytokine gene IL-6 but the HESM fed birds showed its effect curtailed, also, which also, favored the up-regulation of anti-inflammatory genes compared with control diet fed chickens. Post hatch supplementation of HESM appears to improve performance, modulate immunity, and increase resistance of

  20. Analysis of the experience of providing radiation protection of population and environment within the international collaboration network

    International Nuclear Information System (INIS)

    Sergei Aleksanin; Eugene Zheleznyakov; Regina Fedortseva

    2007-01-01

    Complete text of publication follows. The All-Russian Center of Emergency and Radiation Medicine (ARCERM) in St. Petersburg is a specialized radiation health institution and World Health Organization (WHO) collaborating center within the Radiation Emergency Medical Preparedness and Assistance Network (REMPAN), which primary objectives are: - To promote medical preparedness for radiation accidents and radio-nuclear threats among WHO Member States; - To provide medical and public health advice, assistance and coordination of medical management at international and regional levels in the case of a nuclear accident or radiological emergency; - To assist in follow-up studies and rehabilitation. ARCERM serves as a national focal point for advice and possible medical care in cases of radiation injuries in humans as well as assists WHO to prepare relevant documents and guidelines, provides training in radiation medicine, distributes relevant information to the medical community and the public and carries out scientific investigations on radiation effects on humans. The Center is prepared to undertake actions on medical management of possible radiation emergencies both on national and international level as a member of REMPAN network. The assistance provided by ARCERM may also include providing radiation medicine and other appropriate specialists, scientific services and expertise, equipment and medical services for diagnosis, prognosis, medical treatment and medical follow-up of persons affected by radiation. In case of radiation accident the Center has standard operating procedures at country level. It includes the system of warning and data collection, setting up special wards for receiving radiation victims, radioactivity control station, primary deactivation and treatment as well as providing personal protection for staff. WHO, as well as other co-operating international organizations, are notified and provided with relevant information through the International Atomic

  1. Patterning characteristics of a chemically-amplified negative resist in synchrotron radiation lithography

    International Nuclear Information System (INIS)

    Deguchi, Kimiyoshi; Miyoshi, Kazunori; Ishii, Tetsuyoshi; Matsuda, Tadahito

    1992-01-01

    To explore the applicability of synchrotron radiation X-ray lithography for fabricating sub-quartermicron devices, we investigate the patterning characteristics of the chemically-amplified negative resist SAL601-ER7. Since these characteristics depend strongly on the conditions of the chemical amplification process, the effects of post-exposure baking and developing conditions on sensitivity and resolution are examined. The resolution-limiting factors are investigated, revealing that pattern collapse during the development process and fog caused by Fresnel diffraction, photo-electron scattering, and acid diffusion in the resist determine the resolution and the maximum aspect ratio of the lines and spaces pattern. Using the model of a swaying beam supported at one end, it is shown that pattern collapse depends on the resist pattern's flexural stiffness. Patterning stability, which depends on the delay time between exposure and baking, is also discussed. (author)

  2. Structural Component Fabrication and Characterization of Advanced Radiation Resistant ODS Steel for Next Generation Nuclear Systems

    International Nuclear Information System (INIS)

    Noh, Sang Hoon; Kim, Young Chun; Jin, Hyun Ju; Choi, Byoung Kwon; Kang, Suk Hoon; Kim, Tae Kyu

    2016-01-01

    In a sodium-cooled fast reactor (SFR), the coolant outlet temperature and peak temperature of the fuel cladding tube will be about 545 .deg. C and 700 .deg. C with 250 dpa of a very high neutron dose rate. To realize this system, it is necessary to develop an advanced structural material having high creep and irradiation resistance at high temperatures. Austenitic stainless steel may be one of the candidates because of good strength and corrosion resistance at the high temperatures, however irradiation swelling severely occurred to 120dpa at high temperatures and this eventually leads to a decrease of the mechanical properties and dimensional stability. Advanced radiation resistant ODS steel (ARROS) has been newly developed for the in-core structural components in SFR, which has very attractive microstructures to achieve both superior creep and radiation resistances at high temperatures [4]. Nevertheless, the use of ARROS as a structural material essentially requires the fabrication technology development for component parts such as sheet, plate and tube. In this study, plates and tubes were tentatively fabricated with a newly developed alloy, ARROS. Microstructures as well as mechanical properties were also investigated to determine the optimized condition of the fabrication processes.

  3. Study on the Hot Extrusion Process of Advanced Radiation Resistant Oxide Dispersion Strengthened Steel Tubes

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Byoungkwon; Noh, Sanghoon; Kim, Kibaik; Kang, Suk Hoon; Chun, Youngbum; Kim, Tae Kyu [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2014-05-15

    Ferritic/martensitic steel has a better thermal conductivity and swelling resistance than austenitic stainless steel. Unfortunately, the available temperature range of ferritic/martensitic steel is limited at up to 650 .deg. C. Oxide dispersion strengthened (ODS) steels have been developed as the most prospective core structural materials for next generation nuclear systems because of their excellent high strength and irradiation resistance. The material performances of this new alloy are attributed to the existence of uniformly distributed nano-oxide particles with a high density, which is extremely stable at high temperature in a ferritic/martensitic matrix. This microstructure can be very attractive in achieving superior mechanical properties at high temperatures, and thus, these favorable microstructures should be obtained through the controls of the fabrication process parameters during the mechanical alloying and hot consolidation procedures. In this study, a hot extrusion process for advanced radiation resistant ODS steel tube was investigated. ODS martensitic steel was designed to have high homogeneity, productivity, and reproducibility. Mechanical alloying and hot consolidation processes were employed to fabricate the ODS steels. A microstructure observation and creep rupture test were examined to investigate the effects of the optimized fabrication conditions. Advanced radiation resistant ODS steel has been designed to have homogeneity, productivity, and reproducibility. For these characteristics, modified mechanical alloying and hot consolidation processes were developed. Microstructure observation revealed that the ODS steel has uniformly distributed fine-grain nano-oxide particles. The fabrication process for the tubing is also being propelled in earnest.

  4. Study on the Hot Extrusion Process of Advanced Radiation Resistant Oxide Dispersion Strengthened Steel Tubes

    International Nuclear Information System (INIS)

    Choi, Byoungkwon; Noh, Sanghoon; Kim, Kibaik; Kang, Suk Hoon; Chun, Youngbum; Kim, Tae Kyu

    2014-01-01

    Ferritic/martensitic steel has a better thermal conductivity and swelling resistance than austenitic stainless steel. Unfortunately, the available temperature range of ferritic/martensitic steel is limited at up to 650 .deg. C. Oxide dispersion strengthened (ODS) steels have been developed as the most prospective core structural materials for next generation nuclear systems because of their excellent high strength and irradiation resistance. The material performances of this new alloy are attributed to the existence of uniformly distributed nano-oxide particles with a high density, which is extremely stable at high temperature in a ferritic/martensitic matrix. This microstructure can be very attractive in achieving superior mechanical properties at high temperatures, and thus, these favorable microstructures should be obtained through the controls of the fabrication process parameters during the mechanical alloying and hot consolidation procedures. In this study, a hot extrusion process for advanced radiation resistant ODS steel tube was investigated. ODS martensitic steel was designed to have high homogeneity, productivity, and reproducibility. Mechanical alloying and hot consolidation processes were employed to fabricate the ODS steels. A microstructure observation and creep rupture test were examined to investigate the effects of the optimized fabrication conditions. Advanced radiation resistant ODS steel has been designed to have homogeneity, productivity, and reproducibility. For these characteristics, modified mechanical alloying and hot consolidation processes were developed. Microstructure observation revealed that the ODS steel has uniformly distributed fine-grain nano-oxide particles. The fabrication process for the tubing is also being propelled in earnest

  5. Radiation resistant low bandgap InGaAsP solar cell for multi-junction solar cells

    International Nuclear Information System (INIS)

    Khan, Aurangzeb; Yamaguchi, Masafumi; Dharmaras, Nathaji; Yamada, Takashi; Tanabe, Tatsuya; Takagishi, Shigenori; Itoh, Hisayoshi; Ohshima, Takeshi

    2001-01-01

    We have explored the superior radiation tolerance of metal organic chemical vapor deposition (MOCVD) grown, low bandgap, (0.95eV) InGaAsP solar cells as compared to GaAs-on-Ge cells, after 1 MeV electron irradiation. The minority carrier injection due to forward bias and light illumination under low concentration ratio, can lead to enhanced recovery of radiation damage in InGaAsP n + -p junction solar cells. An injection anneal activation energy (0.58eV) of the defects involved in damage/recovery of the InGaAsP solar cells has been estimated from the resultant recovery of the solar cell properties following minority carrier injection. The results suggest that low bandgap radiation resistant InGaAsP (0.95eV) lattice matched to InP substrates provide an alternative to use as bottom cells in multi-junction solar cells instead of less radiation ressitant conventional GaAs based solar cells for space applications. (author)

  6. Resistance to ionizing radiations of materials installed at the CERN accelerators

    International Nuclear Information System (INIS)

    Schoenbacher, H.

    1982-01-01

    All materials installed in high energy accelerators along the lines of primary and secondary beams are exposed to ionizing radiation. This can in certain cases cause a degradation of the properties of these materials and consequently affect the good function of the installation. The author has taken at CERN large number of samples of materials in order to determine their radioresistance. Generally the organic materials and the electronic components are more sensitive to ionizing radiation. The author presents the results of these studies which concern the isolations of the cables (polyethylene, polyvinyl chloride, caoutchouc ethylene propylene, etc.), the isolations for the magnets on the base of epoxy resins, as well as other thermoresistant and thermoplastic products. The author equally presents a choice of materials and components which are used at CERN and which are resistant to radiations above an integral dose of 10 7 -10 8 Gy. (orig.)

  7. Radiation resistance of the carbon fiber reinforced composite material with PEEK as the matrix resin

    International Nuclear Information System (INIS)

    Sasuga, Tsuneo; Seguchi, Tadao; Sakai, Hideo; Nakakura, Toshiyuki; Masutani, Masahiro.

    1987-01-01

    In the fast breeder reactor etc. the structural materials are exposed to various environment, i.e., repeated high and low temperature, stress, etc. Irradiation effect (electron radiation) in the mechanical characteristic at low and high temperature has been studied in the PEEK-CF, polyarylether · ether · ketone - carbon fiber composite. Following are the results. (1) Radiation resistance of PEEK-CF is higher than that of PEEK-PES-CF, PEEK - polyethersulfone surface treated CF composite. In PEEK-PES-CF, PES is deteriorated by irradiation so the adhesive power lowers. (2) In the unirradiated PEEK-CF, its mechanical characteristic decreases beyond 140 deg C. With increase of the radiation dose, however, the characteristic rises. (3) Mechanical characteristic of PEEK-CF thus little drops by the heat treatment after the irradiation. (Mori, K.)

  8. Induction of radiation resistance and radio-protective mechanism. On the reactive oxygen and free radical

    International Nuclear Information System (INIS)

    Yukawa, Osami

    2003-01-01

    Radical scavenging system for reactive oxygen species (ROS) leading to radio-protection is reviewed on findings in animals, tissues and cells. Protection against oxygen toxicity in evolution can be seen in anaerobes' superoxide dismutase (SOD) over 3500 million years ago. ROS is generated endogenously and also by radiation. However, the intracellular sites of the generated ROS are different depending on its cause. The protection is done through enzymes like SOD, peroxidase, catalase, glutathione-related enzymes and through substances like GSH, α-tocopherol, ascorbic acid etc. Induction of ROS scavenging substances related with radio-resistance includes the responses to the low dose radiation (5-50 cGy) in those enzymes described above; to middle to high dose radiation (1-30 Gy) in a similar and in other unknown mechanisms; to exposure of ROS like H 2 O 2 at low concentration; and to antioxidant treatment. The cross-resistance between radiation and drugs suggests necessity of this induction. (N.I.)

  9. The Politics of Resistance to Workplace Cultural Diversity Education for Health Service Providers: An Australian Study

    Science.gov (United States)

    Johnstone, Megan-Jane; Kanitsaki, Olga

    2008-01-01

    This qualitative study has as its focus an exploration of health service providers' perceptions and experiences of the processes and implications of delivering workplace cultural diversity education for staff. Data were obtained from conducting in-depth individual and focus group interviews with a purposeful sample of 137 healthcare professionals,…

  10. Radiation response of human lung cancer cells with inherent and acquired resistance to cisplatin

    International Nuclear Information System (INIS)

    Twentyman, P.R.; Wright, K.A.; Rhodes, T.

    1991-01-01

    We have derived sublines of three human lung cancer cell lines with acquired resistance to cisplatin. The cisplatin resistant sublines of NCI-H69 (small cell), COR-L23 (large cell), and MOR (adenocarcinoma) show 5.3 fold, 3.1 fold, and 3.8 fold resistance, respectively, determined in a 6-day MTT assay. Although the parent lines show a wide range of glutathione content per cell, the sublines each show similar values to their corresponding parent line. Radiation response curves have been obtained using a soft agar clonogenic assay. Values obtained for the parent lines (95% CL in parentheses) were: NCI-H69: Do = 0.99 Gy (0.87-1.16), n = 2.9 (1.6-5.2), GSH = 14 ng/10(4) cells; COR-L23: Do = 1.23 Gy (1.05-1.49), n = 1.3 (0.7-2.2), GSH = 47 ng/10(4) cells; MOR: Do = 1.66 Gy (1.48-1.88), n = 3.0 (1.9-4.8), GSH = 86 ng/10(4) cells. The cisplatin resistant variants of NCI-H69 and COR-L23 showed 31% and 63% increases, respectively, in Do compared to their parent lines, whereas no change in radiation response was seen in MOR. In this panel of lines, therefore, although there is a correlation between glutathione content and radiosensitivity of the parent cell lines, acquired resistance to cisplatin is not accompanied by increased glutathione content. However, two of the three cisplatin resistant lines do show a significantly reduced radiosensitivity

  11. Susceptibility to radiation-induced mammary carcinoma in genetically resistant Copenhagen rats

    International Nuclear Information System (INIS)

    Kamiya, Kenji; Nitta, Yumiko; Gould, M.N.

    2000-01-01

    The objective of this experiment was to compare the cellular basis of mammary cancer induction by a chemical carcinogen with induction by ionizing radiation in three strains of rats (inbred that have different genetic susceptibilities: COP rats, F344 rats, and WF rats). Rats were given a single intraperitoneal injection of 50 mg MNU/kg body weight as a mammary-tumor-inducing chemical carcinogen and were irradiated with a 3.0 Gy dose of 60 Co gamma rays at a dose rate of 26.58±1.19 cGy/min. The rats were inspected weekly, and they were killed and necropsied whenever palpable tumors were detected or they became moribund. The histopathological and immunohistochemical characteristics of the mammary tumors were investigated. A transplantation experiment using selected primary mammary tumors that developed in COP rats exposed to gamma rays was also performed to investigate the transplantability of mammary tumors induced by ionizing radiation. The sensitivity of the WF and F344 rats and the resistance of the COP rats to mammary carcinoma induction by the chemical carcinogen MNU was confirmed. In contrast to the chemical carcinogens, no difference in susceptibility to radiation induction of mammary carcinomas was detected among the three strains of rats, and immunohistochemical examination indicated that the radiation-induced carcinomas consisted of more highly differentiated cells than the MNU-induced cancers. The results of the experiment appear to support the hypothesis that differentiated mammary gland tissue is more resistant to chemical carcinogens than to cancer induction by radiation. The authors conclude that radiation-induced cancers in rats may develop via different pathways or from different cell populations than chemically induced cancers. (K.H.)

  12. Susceptibility to radiation-induced mammary carcinoma in genetically resistant Copenhagen rats

    Energy Technology Data Exchange (ETDEWEB)

    Kamiya, Kenji; Nitta, Yumiko [Hiroshima Univ. (Japan). Research Inst. for Radiation Biology and Medicine; Gould, M.N.

    2000-07-01

    The objective of this experiment was to compare the cellular basis of mammary cancer induction by a chemical carcinogen with induction by ionizing radiation in three strains of rats (inbred that have different genetic susceptibilities: COP rats, F344 rats, and WF rats). Rats were given a single intraperitoneal injection of 50 mg MNU/kg body weight as a mammary-tumor-inducing chemical carcinogen and were irradiated with a 3.0 Gy dose of {sup 60} Co gamma rays at a dose rate of 26.58{+-}1.19 cGy/min. The rats were inspected weekly, and they were killed and necropsied whenever palpable tumors were detected or they became moribund. The histopathological and immunohistochemical characteristics of the mammary tumors were investigated. A transplantation experiment using selected primary mammary tumors that developed in COP rats exposed to gamma rays was also performed to investigate the transplantability of mammary tumors induced by ionizing radiation. The sensitivity of the WF and F344 rats and the resistance of the COP rats to mammary carcinoma induction by the chemical carcinogen MNU was confirmed. In contrast to the chemical carcinogens, no difference in susceptibility to radiation induction of mammary carcinomas was detected among the three strains of rats, and immunohistochemical examination indicated that the radiation-induced carcinomas consisted of more highly differentiated cells than the MNU-induced cancers. The results of the experiment appear to support the hypothesis that differentiated mammary gland tissue is more resistant to chemical carcinogens than to cancer induction by radiation. The authors conclude that radiation-induced cancers in rats may develop via different pathways or from different cell populations than chemically induced cancers. (K.H.)

  13. Simulations of CYP51A from Aspergillus fumigatus in a model bilayer provide insights into triazole drug resistance.

    Science.gov (United States)

    Nash, Anthony; Rhodes, Johanna

    2018-04-01

    Azole antifungal drugs target CYP51A in Aspergillus fumigatus by binding with the active site of the protein, blocking ergosterol biosynthesis. Resistance to azole antifungal drugs is now common, with a leucine to histidine amino acid substitution at position 98 the most frequent, predominantly conferring resistance to itraconazole, although cross-resistance has been reported in conjunction with other mutations. In this study, we create a homology model of CYP51A using a recently published crystal structure of the paralog protein CYP51B. The derived structures, wild type, and L98H mutant are positioned within a lipid membrane bilayer and subjected to molecular dynamics simulations in order improve the accuracy of both models. The structural analysis from our simulations suggests a decrease in active site surface from the formation of hydrogen bonds between the histidine substitution and neighboring polar side chains, potentially preventing the binding of azole drugs. This study yields a biologically relevant structure and set of dynamics of the A. fumigatus Lanosterol 14 alpha-demethylase enzyme and provides further insight into azole antifungal drug resistance.

  14. RAD18 mediates resistance to ionizing radiation in human glioma cells

    International Nuclear Information System (INIS)

    Xie, Chen; Wang, Hongwei; Cheng, Hongbin; Li, Jianhua; Wang, Zhi; Yue, Wu

    2014-01-01

    Highlights: • RAD18 is an important mediator of the IR-induced resistance in glioma cell lines. • RAD18 overexpression confers resistance to IR-mediated apoptosis. • The elevated expression of RAD18 is associated with recurrent GBM who underwent IR therapy. - Abstract: Radioresistance remains a major challenge in the treatment of glioblastoma multiforme (GBM). RAD18 a central regulator of translesion DNA synthesis (TLS), has been shown to play an important role in regulating genomic stability and DNA damage response. In the present study, we investigate the relationship between RAD18 and resistance to ionizing radiation (IR) and examined the expression levels of RAD18 in primary and recurrent GBM specimens. Our results showed that RAD18 is an important mediator of the IR-induced resistance in GBM. The expression level of RAD18 in glioma cells correlates with their resistance to IR. Ectopic expression of RAD18 in RAD18-low A172 glioma cells confers significant resistance to IR treatment. Conversely, depletion of endogenous RAD18 in RAD18-high glioma cells sensitized these cells to IR treatment. Moreover, RAD18 overexpression confers resistance to IR-mediated apoptosis in RAD18-low A172 glioma cells, whereas cells deficient in RAD18 exhibit increased apoptosis induced by IR. Furthermore, knockdown of RAD18 in RAD18-high glioma cells disrupts HR-mediated repair, resulting in increased accumulation of DSB. In addition, clinical data indicated that RAD18 was significantly higher in recurrent GBM samples that were exposed to IR compared with the corresponding primary GBM samples. Collectively, our findings reveal that RAD18 may serve as a key mediator of the IR response and may function as a potential target for circumventing IR resistance in human GBM

  15. Heat-shock induction of ionizing radiation resistance in Saccharomyces cerevisiae, and the correlation with stationary growth phase

    International Nuclear Information System (INIS)

    Mitchel, R.E.J.; Morrison, D.P.

    1982-01-01

    Radiation resistance and thermal resistance vary as a function of culture temperature in logarithmically growing Saccharomyces cerevisiae and are related to the optimum temperature for growth. Radiation resistance and thermal resistance were also induced when cells grown at low temperatures were subjected to a heat shock at or above the optimum growth temperature. Exposure to ionizing radiation followed by a short incubation at low temperature also induced resistance to killing by heat. Heat-shocked cells are induced to a level of thermal and radioresistance much greater than the characteristic resistance level of cells grown continuously at the shock temperature. This high level of resistance, which resembles that of stationary-phase cells, decays to the characteristic log-phase level within one doubling of cell number after the heat shock. Both induction of resistance and decay of that induction require protein synthesis. It is postulated that induction of resistance by heat shock or ionizing radiation is a response of the cells to stress and represents a preparation to enter stationary phase

  16. Theory of the high base resistivity n(+)pp(+) silicon solar cell and its application to radiation damage effects

    Science.gov (United States)

    Goradia, C.; Weinberg, I.

    1985-01-01

    Particulate radiation in space is a principal source of silicon solar cell degradation, and an investigation of cell radiation damage at higher base resistivities appears to have implication toward increasing solar cell and, therefore, useful satellite lifetimes in the space environment. However, contrary to expectations, it has been found that for cells with resistivities of 84 and 1250 ohm cm, the radiation resistance decreases as cell base resistivity increases. An analytical solar-cell computer model was developed with the objective to determine the reasons for this unexpected behavior. The present paper has the aim to describe the analytical model and its use in interpreting the behavior, under irradiation, of high-resistivity solar cells. Attention is given to boundary conditions at the space-charge region edges, cell currents, cell voltages, the generation of the theoretical I-V characteristic, experimental results, and computer calculations.

  17. Assessment of the role of oxygen and mitochondria in heat shock induction of radiation and thermal resistance in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Mitchel, R.E.J.; Morrison, D.P.

    1983-01-01

    In response to a heat shock, the yeast Saccharomyces cerevisiae undergoes a large increase in its resistance to heat and, by the induction of its recombinational DNA repair capacity, a corresponding increase in resistance to radiation. Yeast which lack mitochondrial DNA, mitochondria-controlled protein synthetic apparatus, aerobic respiration, and electron transport (rho 0 strain) were used to assess the role of O 2 , mitochondria, and oxidative processes controlled by mitochondria in the induction of these resistances. We have found that rho 0 yeast grown and heat shocked in either the presence or absence of O 2 are capable of developing both radiation and heat resistance. We conclude that neither the stress signal nor its cellular consequences of induced heat and radiation resistance are directly dependent on O 2 , mitochondrial DNA, or mitochondria-controlled protein synthetic or oxidative processes

  18. Transcription and activity of antioxidant proteins after ionization irradiation of radiation-resistant and radiation-sensitive mice

    International Nuclear Information System (INIS)

    Hardmeier, R.

    1998-03-01

    The involvernent of antioxidant proteins catalase (CAT), superoxide dismutase (SOD), glutathione peroxidase (GSH px), and thioredoxin (TRX) in radiobiological processes has been described at the enzyme activity level. We were interested in examining the transcription of these proteins in a mammalian system following ionizing irradiation. In order to answer the question whether radiation effects in sensitive mice (Balb/c) (RS) showed differences at the transcriptional level from radiation effects in resistant mice (C3H) (RR). We exposed the whole body of these strains to X/rays doses of 2, 4, and 6 Gy and sacrificed the animals 5, 15, and 30 minutes after irradiation. The mRNA was isolated from liver and hybrized with probes for antioxidant enzymes and thioredoxin, β-actin was used as a housekeeping gene control. Antioxidant enzyme activities were determined by standard assays. Parameters for aromatic hydroxylation (o-Tyr) and lipid peroxidation (MDA) were determined by HPLC methods. Antioxidant transcription was unchanged in contrast to antioxidant activities. SOD and CAT activities were elevated within 15 minutes in RR animals but not in RS at all radiation doses. Glutathione peroxidase activity was not different between RR and RS mice, and was only moderately elevated after irradiation. No significant differences were found between RR and RS animals at the oxidation level, although a radiation dose-dependent increase of oxidation products was detected in both groups. Quantification of thioredoxin mRNA revealed that RR mice transcribed this protein at a significantly higher level at an earlier time point (5 minutes) than did RS mice. This delay may well be responsible for the radioresistance although no quantitative differences were found. As unchanged transcription of antioxidant enzymes could not have been responsible for the increased antioxidant enzyme activities, preformed antioxidant enzymes may have been released by irradiation. This would be in agreement

  19. A study on the improvement of radiation-induced oxidation resistance for polypropylene and PVC materials

    International Nuclear Information System (INIS)

    Park, K. Z.; Jeong, K. S.; Cho, S. H.; Cho, Y. H.; Seok, H. C.

    2002-01-01

    The object of this project is to improve the stability and the economics by reducing the radiation-induced oxidation as a factor of degradation of polymer materials used under the radiation environment. In order to attain the objective of this study and to check the effect of diamond-like carbon (DLC) coating on the anti-oxidation reaction, polymer specimens such as Polyproplyene, PVC coating DLC thin layer were exposed to high level gamma radiation, and their irradiation effects were investigated. A plasma-enhanced chemical vapor deposition method was adopted in fabricating a DLC thin film on the polymer specimens, which were irradiated with the non-DLC film deposited specimens under the gamma radiation emitted from Co-60 source from 1 x 10 5 to 1 x 10 8 rads exposure. According to the characterization of irradiated specimens from the elapsed time of minimum 4 hours to a maximum of 105 days after the irradiation, the DLC deposition on the polymer surface was revealed to contribute to the improvement on the resistance of the radiation-induced oxidation in this study

  20. Radiation resistant PIDECα cell using photon intermediate direct energy conversion and a 210Po source.

    Science.gov (United States)

    Weaver, Charles L; Schott, Robert J; Prelas, Mark A; Wisniewski, Denis A; Rothenberger, Jason B; Lukosi, Eric D; Oh, Kyuhak

    2018-02-01

    Radiation damage is a significant concern with both alphavoltaic and betavoltaic cells because their performance degrades, especially with high-energy - (>200keV) beta and alpha particles. Indirect excitation methods, such as the Photon Intermediate Direct Energy Conversion (PIDEC) framework, can protect the transducer from radiation. A nuclear battery using a 90 Sr beta source was constructed by the author's research group, which demonstrated the radiation resistance of a PIDEC cell driven by beta particles (PIDECβ cell). Use of alpha sources to drive nuclear batteries would appear to be much more attractive than beta sources due to higher potential power density. However, they are also subject to higher rates of radiation damage. This paper describes the successful incorporation of alpha particles into the PIDEC framework using the alpha emitter 210 Po to form a PIDECα cell. The PIDECα cell transducer was exposed to alpha particles for over one year without experiencing adverse effects from radiation damage. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Radiation inactivation method provides evidence that membrane-bound mitochondrial creatine kinase is an oligomer

    International Nuclear Information System (INIS)

    Quemeneur, E.; Eichenberger, D.; Goldschmidt, D.; Vial, C.; Beauregard, G.; Potier, M.

    1988-01-01

    Lyophilized suspensions of rabbit heart mitochondria have been irradiated with varying doses of gamma rays. Mitochondrial creatine kinase activity was inactivated exponentially with a radiation inactivation size of 352 or 377 kDa depending upon the initial medium. These values are in good agreement with the molecular mass previously deduced from by permeation experiments: 357 kDa. This is the first direct evidence showing that the native form of mitochondrial creatine kinase is associated to the inner membrane as an oligomer, very likely an octamer

  2. WNT activation by lithium abrogates TP53 mutation associated radiation resistance in medulloblastoma.

    Science.gov (United States)

    Zhukova, Nataliya; Ramaswamy, Vijay; Remke, Marc; Martin, Dianna C; Castelo-Branco, Pedro; Zhang, Cindy H; Fraser, Michael; Tse, Ken; Poon, Raymond; Shih, David J H; Baskin, Berivan; Ray, Peter N; Bouffet, Eric; Dirks, Peter; von Bueren, Andre O; Pfaff, Elke; Korshunov, Andrey; Jones, David T W; Northcott, Paul A; Kool, Marcel; Pugh, Trevor J; Pomeroy, Scott L; Cho, Yoon-Jae; Pietsch, Torsten; Gessi, Marco; Rutkowski, Stefan; Bognár, Laszlo; Cho, Byung-Kyu; Eberhart, Charles G; Conter, Cecile Faure; Fouladi, Maryam; French, Pim J; Grajkowska, Wieslawa A; Gupta, Nalin; Hauser, Peter; Jabado, Nada; Vasiljevic, Alexandre; Jung, Shin; Kim, Seung-Ki; Klekner, Almos; Kumabe, Toshihiro; Lach, Boleslaw; Leonard, Jeffrey R; Liau, Linda M; Massimi, Luca; Pollack, Ian F; Ra, Young Shin; Rubin, Joshua B; Van Meir, Erwin G; Wang, Kyu-Chang; Weiss, William A; Zitterbart, Karel; Bristow, Robert G; Alman, Benjamin; Hawkins, Cynthia E; Malkin, David; Clifford, Steven C; Pfister, Stefan M; Taylor, Michael D; Tabori, Uri

    2014-12-24

    TP53 mutations confer subgroup specific poor survival for children with medulloblastoma. We hypothesized that WNT activation which is associated with improved survival for such children abrogates TP53 related radioresistance and can be used to sensitize TP53 mutant tumors for radiation. We examined the subgroup-specific role of TP53 mutations in a cohort of 314 patients treated with radiation. TP53 wild-type or mutant human medulloblastoma cell-lines and normal neural stem cells were used to test radioresistance of TP53 mutations and the radiosensitizing effect of WNT activation on tumors and the developing brain. Children with WNT/TP53 mutant medulloblastoma had higher 5-year survival than those with SHH/TP53 mutant tumours (100% and 36.6%±8.7%, respectively (p<0.001)). Introduction of TP53 mutation into medulloblastoma cells induced radioresistance (survival fractions at 2Gy (SF2) of 89%±2% vs. 57.4%±1.8% (p<0.01)). In contrast, β-catenin mutation sensitized TP53 mutant cells to radiation (p<0.05). Lithium, an activator of the WNT pathway, sensitized TP53 mutant medulloblastoma to radiation (SF2 of 43.5%±1.5% in lithium treated cells vs. 56.6±3% (p<0.01)) accompanied by increased number of γH2AX foci. Normal neural stem cells were protected from lithium induced radiation damage (SF2 of 33%±8% for lithium treated cells vs. 27%±3% for untreated controls (p=0.05). Poor survival of patients with TP53 mutant medulloblastoma may be related to radiation resistance. Since constitutive activation of the WNT pathway by lithium sensitizes TP53 mutant medulloblastoma cells and protect normal neural stem cells from radiation, this oral drug may represent an attractive novel therapy for high-risk medulloblastomas.

  3. Sunlight-exposed biofilm microbial communities are naturally resistant to chernobyl ionizing-radiation levels.

    Directory of Open Access Journals (Sweden)

    Marie Ragon

    Full Text Available BACKGROUND: The Chernobyl accident represents a long-term experiment on the effects of exposure to ionizing radiation at the ecosystem level. Though studies of these effects on plants and animals are abundant, the study of how Chernobyl radiation levels affect prokaryotic and eukaryotic microbial communities is practically non-existent, except for a few reports on human pathogens or soil microorganisms. Environments enduring extreme desiccation and UV radiation, such as sunlight exposed biofilms could in principle select for organisms highly resistant to ionizing radiation as well. METHODOLOGY/PRINCIPAL FINDINGS: To test this hypothesis, we explored the diversity of microorganisms belonging to the three domains of life by cultivation-independent approaches in biofilms developing on concrete walls or pillars in the Chernobyl area exposed to different levels of radiation, and we compared them with a similar biofilm from a non-irradiated site in Northern Ireland. Actinobacteria, Alphaproteobacteria, Bacteroidetes, Acidobacteria and Deinococcales were the most consistently detected bacterial groups, whereas green algae (Chlorophyta and ascomycete fungi (Ascomycota dominated within the eukaryotes. Close relatives to the most radio-resistant organisms known, including Rubrobacter species, Deinococcales and melanized ascomycete fungi were always detected. The diversity of bacteria and eukaryotes found in the most highly irradiated samples was comparable to that of less irradiated Chernobyl sites and Northern Ireland. However, the study of mutation frequencies in non-coding ITS regions versus SSU rRNA genes in members of a same actinobacterial operational taxonomic unit (OTU present in Chernobyl samples and Northern Ireland showed a positive correlation between increased radiation and mutation rates. CONCLUSIONS/SIGNIFICANCE: Our results show that biofilm microbial communities in the most irradiated samples are comparable to non-irradiated samples in

  4. Sunlight-Exposed Biofilm Microbial Communities Are Naturally Resistant to Chernobyl Ionizing-Radiation Levels

    Science.gov (United States)

    Ragon, Marie; Restoux, Gwendal; Moreira, David; Møller, Anders Pape; López-García, Purificación

    2011-01-01

    Background The Chernobyl accident represents a long-term experiment on the effects of exposure to ionizing radiation at the ecosystem level. Though studies of these effects on plants and animals are abundant, the study of how Chernobyl radiation levels affect prokaryotic and eukaryotic microbial communities is practically non-existent, except for a few reports on human pathogens or soil microorganisms. Environments enduring extreme desiccation and UV radiation, such as sunlight exposed biofilms could in principle select for organisms highly resistant to ionizing radiation as well. Methodology/Principal Findings To test this hypothesis, we explored the diversity of microorganisms belonging to the three domains of life by cultivation-independent approaches in biofilms developing on concrete walls or pillars in the Chernobyl area exposed to different levels of radiation, and we compared them with a similar biofilm from a non-irradiated site in Northern Ireland. Actinobacteria, Alphaproteobacteria, Bacteroidetes, Acidobacteria and Deinococcales were the most consistently detected bacterial groups, whereas green algae (Chlorophyta) and ascomycete fungi (Ascomycota) dominated within the eukaryotes. Close relatives to the most radio-resistant organisms known, including Rubrobacter species, Deinococcales and melanized ascomycete fungi were always detected. The diversity of bacteria and eukaryotes found in the most highly irradiated samples was comparable to that of less irradiated Chernobyl sites and Northern Ireland. However, the study of mutation frequencies in non-coding ITS regions versus SSU rRNA genes in members of a same actinobacterial operational taxonomic unit (OTU) present in Chernobyl samples and Northern Ireland showed a positive correlation between increased radiation and mutation rates. Conclusions/Significance Our results show that biofilm microbial communities in the most irradiated samples are comparable to non-irradiated samples in terms of general

  5. Study of surface properties of ATLAS12 strip sensors and their radiation resistance

    Energy Technology Data Exchange (ETDEWEB)

    Mikestikova, M., E-mail: mikestik@fzu.cz [Academy of Sciences of the Czech Republic, Institute of Physics, Na Slovance 2, 18221 Prague 8 (Czech Republic); Allport, P.P.; Baca, M.; Broughton, J.; Chisholm, A.; Nikolopoulos, K.; Pyatt, S.; Thomas, J.P.; Wilson, J.A. [School of Physics and Astronomy, University of Birmingham, Birmingham B15 2TT (United Kingdom); Kierstead, J.; Kuczewski, P.; Lynn, D. [Brookhaven National Laboratory, Physics Department and Instrumentation Division, Upton, NY 11973-5000 (United States); Hommels, L.B.A. [Cavendish Laboratory, University of Cambridge, JJ Thomson Avenue, Cambridge CB3 0HE (United Kingdom); Ullan, M. [Centro Nacional de Microelectronica (IMB-CNM, CSIC), Campus UAB-Bellaterra, 08193 Barcelona (Spain); Bloch, I.; Gregor, I.M.; Tackmann, K. [DESY, Notkestrasse 85, 22607 Hamburg (Germany); Hauser, M.; Jakobs, K.; Kuehn, S. [Physikalisches Institut, Universität Freiburg, Hermann-Herder-Str. 3, D-79104 Freiburg (Germany); and others

    2016-09-21

    A radiation hard n{sup +}-in-p micro-strip sensor for the use in the Upgrade of the strip tracker of the ATLAS experiment at the High Luminosity Large Hadron Collider (HL-LHC) has been developed by the “ATLAS ITk Strip Sensor collaboration” and produced by Hamamatsu Photonics. Surface properties of different types of end-cap and barrel miniature sensors of the latest sensor design ATLAS12 have been studied before and after irradiation. The tested barrel sensors vary in “punch-through protection” (PTP) structure, and the end-cap sensors, whose stereo-strips differ in fan geometry, in strip pitch and in edge strip ganging options. Sensors have been irradiated with proton fluences of up to 1×10{sup 16} n{sub eq}/cm{sup 2}, by reactor neutron fluence of 1×10{sup 15} n{sub eq}/cm{sup 2} and by gamma rays from {sup 60}Co up to dose of 1 MGy. The main goal of the present study is to characterize the leakage current for micro-discharge breakdown voltage estimation, the inter-strip resistance and capacitance, the bias resistance and the effectiveness of PTP structures as a function of bias voltage and fluence. It has been verified that the ATLAS12 sensors have high breakdown voltage well above the operational voltage which implies that different geometries of sensors do not influence their stability. The inter-strip isolation is a strong function of irradiation fluence, however the sensor performance is acceptable in the expected range for HL-LHC. New gated PTP structure exhibits low PTP onset voltage and sharp cut-off of effective resistance even at the highest tested radiation fluence. The inter-strip capacitance complies with the technical specification required before irradiation and no radiation-induced degradation was observed. A summary of ATLAS12 sensors tests is presented including a comparison of results from different irradiation sites. The measured characteristics are compared with the previous prototype of the sensor design, ATLAS07. - Highlights:

  6. Elimination of Listeria monocytogenes in sausage meat by combination treatment: Radiation and radiation-resistant bacteriocins

    International Nuclear Information System (INIS)

    Turgis, Mélanie; Stotz, Viviane; Dupont, Claude; Salmieri, Stéphane; Khan, Ruhul A.; Lacroix, Monique

    2012-01-01

    Two new bacteria were isolated from human feces and were designated MT 104 and MT 162. They were able to produce bacteriocins that are active against five strains of Listeria monocytogenes. Bacteriocins produced by these isolated strains had 100% and 82.35% residual activity when they were treated by gamma radiation at doses of 4 and 40 kGy, respectively. A reduction of 1.0, 1.5 and 3 log CFU/g of L. monocytogenes was observed in sausage meat when treated with bacteriocins from MT 104, MT 162, and nisin, respectively. For synergic effect, the D 10 value in presence of the bacteriocins produced by MT 104 showed a 1.08 fold increased relative sensitivity of L. monocytogenes as compared to control after 5 days. The highest synergic effect was observed in presence of nisin which led to 1.61 fold increased relative sensitivity. Combined treatments with nisin and γ-irradiation showed a synergic antimicrobial effect in meat after 24 h and 5 days of storage. A synergic effect was observed only after 5 days at 4 °C for the bacteriocin from MT 104, as compared to the bacteriocin produced by MT 162 that had only an additive antimicrobial effect in all conditions.

  7. Elimination of Listeria monocytogenes in sausage meat by combination treatment: Radiation and radiation-resistant bacteriocins

    Science.gov (United States)

    Turgis, Mélanie; Stotz, Viviane; Dupont, Claude; Salmieri, Stéphane; Khan, Ruhul A.; Lacroix, Monique

    2012-08-01

    Two new bacteria were isolated from human feces and were designated MT 104 and MT 162. They were able to produce bacteriocins that are active against five strains of Listeria monocytogenes. Bacteriocins produced by these isolated strains had 100% and 82.35% residual activity when they were treated by gamma radiation at doses of 4 and 40 kGy, respectively. A reduction of 1.0, 1.5 and 3 log CFU/g of L. monocytogenes was observed in sausage meat when treated with bacteriocins from MT 104, MT 162, and nisin, respectively. For synergic effect, the D10 value in presence of the bacteriocins produced by MT 104 showed a 1.08 fold increased relative sensitivity of L. monocytogenes as compared to control after 5 days. The highest synergic effect was observed in presence of nisin which led to 1.61 fold increased relative sensitivity. Combined treatments with nisin and γ-irradiation showed a synergic antimicrobial effect in meat after 24 h and 5 days of storage. A synergic effect was observed only after 5 days at 4 °C for the bacteriocin from MT 104, as compared to the bacteriocin produced by MT 162 that had only an additive antimicrobial effect in all conditions.

  8. Application of living radical polymerization to the synthesis of resist polymers for radiation lithography

    International Nuclear Information System (INIS)

    Shimizu, Takashi; Ichikawa, Tsuneki

    2005-01-01

    Poly(styrene) and poly(methyl acrylate) with benzyl ester of carboxylic acid at the center of the polymer skeletons were synthesized by living radical polymerization for developing a new type of radiation resist with high resistivity to plasma etching and high sensitivity and spatial resolution to ionizing radiations. The initiators were benzyl esters with two functional groups for living radical polymerization on the benzyl and the carboxylic sides. Introduction of benzyl ester to the polymer skeletons changed the polymers from cross-link type to scission type upon γ-irradiation. Irradiation of the polymers resulted in the binary change of the molecular weight, due to dissociative capture of secondary electrons by the benzyl ester, as M n R 1 COOCH(C 6 H 5 )R 2 M n +e - ->M n R 1 COO - + · CH(C 6 H 5 )R 2 M n . The generated polymer fragments were not decomposed by further irradiation, which suggests that the synthesized polymers have high resistivity to plasma etching

  9. Application of living radical polymerization to the synthesis of resist polymers for radiation lithography

    Energy Technology Data Exchange (ETDEWEB)

    Shimizu, Takashi [Nitto Denko Co. LTD., Shimohozumi 1-1-2, Ibaraki, Osaka 567-8680 (Japan); Ichikawa, Tsuneki [Division of Materials Chemistry, Graduate school of Engineering, Hokkaido University, Sapporo 060-8628 (Japan)]. E-mail: ichikawa@eng.hokudai.ac.jp

    2005-07-01

    Poly(styrene) and poly(methyl acrylate) with benzyl ester of carboxylic acid at the center of the polymer skeletons were synthesized by living radical polymerization for developing a new type of radiation resist with high resistivity to plasma etching and high sensitivity and spatial resolution to ionizing radiations. The initiators were benzyl esters with two functional groups for living radical polymerization on the benzyl and the carboxylic sides. Introduction of benzyl ester to the polymer skeletons changed the polymers from cross-link type to scission type upon {gamma}-irradiation. Irradiation of the polymers resulted in the binary change of the molecular weight, due to dissociative capture of secondary electrons by the benzyl ester, as M{sub n}R{sub 1}COOCH(C{sub 6}H{sub 5})R{sub 2}M{sub n}+e{sup -}->M{sub n}R{sub 1}COO{sup -}+{sup {center_dot}}CH(C{sub 6}H{sub 5})R{sub 2}M{sub n}. The generated polymer fragments were not decomposed by further irradiation, which suggests that the synthesized polymers have high resistivity to plasma etching.

  10. Toward advanced gamma rays radiation resistance and shielding efficiency with phthalonitrile resins and composites

    Science.gov (United States)

    Derradji, Mehdi; Zegaoui, Abdeldjalil; Xu, Yi-Le; Wang, An-ran; Dayo, Abdul Qadeer; Wang, Jun; Liu, Wen-bin; Liu, Yu-Guang; Khiari, Karim

    2018-04-01

    The phthalonitrile resins have claimed the leading place in the field of high performance polymers thanks to their combination of outstanding properties. The present work explores for the first time the gamma rays radiation resistance and shielding efficiency of the phthalonitrile resins and its related tungsten-reinforced nanocomposites. The primary goal of this research is to define the basic behavior of the phthalonitrile resins under highly ionizing gamma rays. The obtained results confirmed that the neat phthalonitrile resins can resist absorbed doses as high as 200 kGy. Meanwhile, the remarkable shielding efficiency of the phthalonitrile polymers was confirmed to be easily improved by preparing lead-free nanocomposites. In fact, the gamma rays screening ratio reached the exceptional value of 42% for the nanocomposites of 50 wt% of nano-tungsten loading. Thus, this study confirms that the remarkable performances of the phthalonitrile resins are not limited to the thermal and mechanical properties and can be extended to the gamma rays radiation and shielding resistances.

  11. Resistance of human erythrocytes containing elevated levels of vitamin E to radiation-induced hemolysis

    International Nuclear Information System (INIS)

    Brown, M.A.

    1983-01-01

    Human erythrocytes were isolated from the blood of healthy donors and then incubated in the presence of suspensions of alpha-tocopherol for 30 min at 37 degrees C. Unabsorbed tocopherol was removed by centrifugation using several washes of isotonic phosphate-buffered saline. Washed erythrocytes were resuspended to 0.05%. Hct and exposed to hemolyzing doses of 60 Co gamma radiation, and hemolysis was monitored continuously by light scattering at 700 nm in a recording spectrophotometer. The extent of hemolysis with time was sigmoid and data analysis was carried out on the time taken for 50% hemolysis to occur (t50%). The vitamin E content of erythrocytes was significantly elevated by the incubation procedure and resulted in the cells exhibiting a significantly increased resistance to hemolysis as reflected by the extended t50% values. Oral supplementation of 500 IU of vitamin E per day to eight normal human subjects for a period of 16 days also resulted in their washed erythrocytes exhibiting a significant increase in resistance to radiation-induced hemolysis. When comparing vitamin E incubated cells with control cells, both the dose-reducing factor (DRF) and the time for 50% hemolysis quotient (Qt50%) were observed to increase with increasing radiation dose

  12. Irradiation tests of radiation resistance optical fibers for fusion diagnostic application

    Science.gov (United States)

    Kakuta, Tsunemi; Shikama, Tatsuo; Nishitani, Takeo; Yamamoto, Shin; Nagata, Shinji; Tsuchiya, Bun; Toh, Kentaro; Hori, Junichi

    2002-11-01

    To promote development of radiation-resistant core optical fibers, the ITER-EDA (International Thermonuclear Experimental Reactor-Engineering Design Activity) recommended carrying out international round-robin irradiation tests of optical fibers to establish a reliable database for their applications in the ITER plasma diagnostics. Ten developed optical fibers were irradiation-tested in a Co-60 gamma cell, a Japan Materials Testing Reactor (JMTR). Also, some of them were irradiation tested in a fast neutron irradiation facility of FNS (Fast Neutron Source), especially to study temperature dependence of neutron-associated irradiation effects. Included were several Japanese fluorine doped fibers and one Japanese standard fiber (purified and undoped silica core), as well as seven Russian fibers. Some of Russian fibers were drawn by Japanese manufactures from Russian made pre-form rods to study effects of manufacturing processes to radiation resistant properties. The present paper will describe behaviors of growth of radiation-induced optical transmission loss in the wavelength range of 350-1750nm. Results indicate that role of displacement damages by fast neutrons are very important in introducing permanent optical transmission loss. Spectra of optical transmission loss in visible range will depend on irradiation temperatures and material parameters of optical fibers.

  13. Dento-oral care in patients with head and neck radiation therapy. Questionnaire to institutions provided with radiotherapy units

    International Nuclear Information System (INIS)

    Ashikagaya, Misa; Fuzisawa, Yuko; Kato, Tokunori; Hayashi, Takafumi; Nakayama, Hitoshi; Nakamura, Motoyasu

    1995-01-01

    We sent a questionnaire to 465 institutions provided with radiotherapy units in order to search for the radiotherapists' understanding of and concern about dento-oral care in patients with head and neck radiation therapy and subsequent occurrence of radiation side effects in the oral-maxillofacial region. An analysis of 292 responses showed that in 183 (62.7%) institutions radiotherapist had experience of dental consultation of these patients for dento-oral care to the dental facility and in 109 (37.3%) they hadn't. In dental consultation, the symptomatic care for toothache etc. were more often requested than the preventive care for radiation side effects. Of 6 items of the preventive care, periodical oral examination, oral hygiene instruction and treatment for radiation caries were less frequently requested. It is concluded that radiotherapists are not fully aware of the importance of dento-oral care including the preventive care in patients with radiation therapy in the head and neck region. (author)

  14. Medical advice for citizens in the Erzgebirge provided by the Information Centre of the Federal Office for Radiation Protection

    International Nuclear Information System (INIS)

    Laude, G.; Meyer, W.

    1995-01-01

    In the Erzgebirge region of Saxony, long-term uranium mining and the existence of waste tips from medieval silver mining have resulted in elevated subsoil radioactivity. Jointly with the Federal Office for Radiation Protection, the Robert Koch Institute, being one of the successors to the Federal Health Office, has offered consultations on problems of radiation and environmental medicine in Schlema, Erzgebirge, since 1990. It has been the objective of this activity, to provide expert information on radiation and environmental exposure levels in that region and possible risk for human health and thus to reduce exaggerated apprehensions about existing radiation hazards. 242 out of a total of 3547 persons who appeared during consultation hours offered by the Federal Office for Radiation Protection asked for medical consultation. The most frequently stated reasons for taking advantage of the consultations offered included questions associated with the influence of radioactivity on human health, requests for checking on occupational exposure and decisions made in the framework of expert opinions, requests for radon measurements in homes and other buildings as well as interpretation of levels measured under medical aspects. Recently, there has been an increasing number of requests for clinical examination for assessment of the health status of the persons concerned. Furthermore, queries referred to general problems of environemental medicine and of genetics and to consequences of the Chernobyl reactor accident. (orig.) [de

  15. The involvement of topoisomerases and DNA polymerase I in the mechanism of induced thermal and radiation resistance in yeast

    International Nuclear Information System (INIS)

    Boreham, D.R.; Trivedi, A.; Weinberger, P.; Mitchel, R.E.

    1990-01-01

    Either an ionizing radiation exposure or a heat shock is capable of inducing both thermal tolerance and radiation resistance in yeast. Yeast mutants, deficient in topoisomerase I, in topoisomerase II, or in DNA polymerase I, were used to investigate the mechanism of these inducible resistances. The absence of either or both topoisomerase activities did not prevent induction of either heat or radiation resistance. However, if both topoisomerase I and II activities were absent, the sensitivity of yeast to become thermally tolerant (in response to a heat stress) was markedly increased. The absence of only topoisomerase I activity (top1) resulted in the constitutive expression of increased radiation resistance equivalent to that induced by a heat shock in wild-type cells, and the topoisomerase I-deficient cells were not further inducible by heat. This heat-inducible component of radiation resistance (or its equivalent constitutive expression in top1 cells) was, in turn, only a portion of the full response inducible by radiation. The absence of polymerase I activity had no detectable effect on either response. Our results indicate that the actual systems that confer resistance to heat or radiation are independent of either topoisomerase activity or DNA polymerase function, but suggest that topoisomerases may have a regulatory role during the signaling of these mechanisms. The results of our experiments imply that maintenance of correct DNA topology prevents induction of the heat-shock response, and that heat-shock induction of a component of the full radiation resistance in yeast may be the consequence of topoisomerase I inactivation

  16. Radiation shielding provided by residential houses in Japan in reactor accidents accompanied with atmospheric release

    International Nuclear Information System (INIS)

    Yamaguchi, Yasuhiro; Minami, Kentaro

    1991-01-01

    The present report describes the radiation shielding effect of houses in Japan against the radioactive cloud resulting from a major reactor accident accompanied with atmospheric release. The shielding factor of houses, the ratio of indoor exposure rate to outdoor one, has been studied for the semi-infinite and finite clouds which contain γ-emitting radionuclides released from a reactor facility. The shielding factor of houses against γ-rays from the radioactive cloud decreases gradually with release delay time and keeps a minimum during the period from 50 to 1000 hours after reactor shutdown while 133 Xe predominates in the cloud. Radioiodines mixed in the cloud raise slightly the shielding factor, and the factor depends little on the shape of the cloud. A set of shielding factors for the use of emergency planning was consequently proposed as 0.4 for simple ferroconcrete residential house and 0.9 for other ordinary ones. (author)

  17. Complete genome sequence analysis of the fish pathogen Flavobacterium columnare provides insights into antibiotic resistance and pathogenicity related genes.

    Science.gov (United States)

    Zhang, Yulei; Zhao, Lijuan; Chen, Wenjie; Huang, Yunmao; Yang, Ling; Sarathbabu, V; Wu, Zaohe; Li, Jun; Nie, Pin; Lin, Li

    2017-10-01

    We analyzed here the complete genome sequences of a highly virulent Flavobacterium columnare Pf1 strain isolated in our laboratory. The complete genome consists of a 3,171,081 bp circular DNA with 2784 predicted protein-coding genes. Among these, 286 genes were predicted as antibiotic resistance genes, including 32 RND-type efflux pump related genes which were associated with the export of aminoglycosides, indicating inducible aminoglycosides resistances in F. columnare. On the other hand, 328 genes were predicted as pathogenicity related genes which could be classified as virulence factors, gliding motility proteins, adhesins, and many putative secreted proteases. These genes were probably involved in the colonization, invasion and destruction of fish tissues during the infection of F. columnare. Apparently, our obtained complete genome sequences provide the basis for the explanation of the interactions between the F. columnare and the infected fish. The predicted antibiotic resistance and pathogenicity related genes will shed a new light on the development of more efficient preventional strategies against the infection of F. columnare, which is a major worldwide fish pathogen. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Heterologous expression of MlcE in Saccharomyces cerevisiae provides resistance to natural and semi-synthetic statins

    Directory of Open Access Journals (Sweden)

    Ana Ley

    2015-12-01

    Full Text Available Statins are inhibitors of 3-hydroxy-3-methylglutaryl coenzyme A reductase, the key enzyme in cholesterol biosynthesis. Their extensive use in treatment and prevention of cardiovascular diseases placed statins among the best selling drugs. Construction of Saccharomyces cerevisiae cell factory for the production of high concentrations of natural statins will require establishment of a non-destructive self-resistance mechanism to overcome the undesirable growth inhibition effects of statins. To establish active export of statins from yeast, and thereby detoxification, we integrated a putative efflux pump-encoding gene mlcE from the mevastatin-producing Penicillium citrinum into the S. cerevisiae genome. The resulting strain showed increased resistance to both natural statins (mevastatin and lovastatin and semi-synthetic statin (simvastatin when compared to the wild type strain. Expression of RFP-tagged mlcE showed that MlcE is localized to the yeast plasma and vacuolar membranes. We provide a possible engineering strategy for improvement of future yeast based production of natural and semi-synthetic statins. Keywords: Polyketide, Statins, Saccharomyces cerevisiae, Transport, Cell factory, Resistance

  19. Modulation of DNA methylation levels sensitizes doxorubicin-resistant breast adenocarcinoma cells to radiation-induced apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Luzhna, Lidia [Department of Biological Sciences, University of Lethbridge, AB, Canada T1K 3M4 (Canada); Kovalchuk, Olga, E-mail: olga.kovalchuk@uleth.ca [Department of Biological Sciences, University of Lethbridge, AB, Canada T1K 3M4 (Canada)

    2010-02-05

    Chemoresistant tumors often fail to respond to other cytotoxic treatments such as radiation therapy. The mechanisms of chemo- and radiotherapy cross resistance are not fully understood and are believed to be epigenetic in nature. We hypothesize that MCF-7 cells and their doxorubicin-resistant variant MCF-7/DOX cells may exhibit different responses to ionizing radiation due to their dissimilar epigenetic status. Similar to previous studies, we found that MCF-7/DOX cells harbor much lower levels of global DNA methylation than MCF-7 cells. Furthermore, we found that MCF-7/DOX cells had lower background apoptosis levels and were less responsive to radiation than MCF-7 cells. Decreased radiation responsiveness correlated to significant global DNA hypomethylation in MCF-7/DOX cells. Here, for the first time, we show that the radiation resistance of MCF-7/DOX cells can be reversed by an epigenetic treatment - the application of methyl-donor SAM. SAM-mediated reversal of DNA methylation led to elevated radiation sensitivity in MCF-7/DOX cells. Contrarily, application of SAM on the radiation sensitive and higher methylated MCF-7 cells resulted in a decrease in their radiation responsiveness. This data suggests that a fine balance of DNA methylation is needed to insure proper radiation and drug responsiveness.

  20. Study of surface properties of ATLAS12 strip sensors and their radiation resistance

    Science.gov (United States)

    Mikestikova, M.; Allport, P. P.; Baca, M.; Broughton, J.; Chisholm, A.; Nikolopoulos, K.; Pyatt, S.; Thomas, J. P.; Wilson, J. A.; Kierstead, J.; Kuczewski, P.; Lynn, D.; Hommels, L. B. A.; Ullan, M.; Bloch, I.; Gregor, I. M.; Tackmann, K.; Hauser, M.; Jakobs, K.; Kuehn, S.; Mahboubi, K.; Mori, R.; Parzefall, U.; Clark, A.; Ferrere, D.; Sevilla, S. Gonzalez; Ashby, J.; Blue, A.; Bates, R.; Buttar, C.; Doherty, F.; McMullen, T.; McEwan, F.; O'Shea, V.; Kamada, S.; Yamamura, K.; Ikegami, Y.; Nakamura, K.; Takubo, Y.; Unno, Y.; Takashima, R.; Chilingarov, A.; Fox, H.; Affolder, A. A.; Casse, G.; Dervan, P.; Forshaw, D.; Greenall, A.; Wonsak, S.; Wormald, M.; Cindro, V.; Kramberger, G.; Mandić, I.; Mikuž, M.; Gorelov, I.; Hoeferkamp, M.; Palni, P.; Seidel, S.; Taylor, A.; Toms, K.; Wang, R.; Hessey, N. P.; Valencic, N.; Hanagaki, K.; Dolezal, Z.; Kodys, P.; Bohm, J.; Stastny, J.; Bevan, A.; Beck, G.; Milke, C.; Domingo, M.; Fadeyev, V.; Galloway, Z.; Hibbard-Lubow, D.; Liang, Z.; Sadrozinski, H. F.-W.; Seiden, A.; To, K.; French, R.; Hodgson, P.; Marin-Reyes, H.; Parker, K.; Jinnouchi, O.; Hara, K.; Sato, K.; Hagihara, M.; Iwabuchi, S.; Bernabeu, J.; Civera, J. V.; Garcia, C.; Lacasta, C.; Marti i Garcia, S.; Rodriguez, D.; Santoyo, D.; Solaz, C.; Soldevila, U.

    2016-09-01

    A radiation hard n+-in-p micro-strip sensor for the use in the Upgrade of the strip tracker of the ATLAS experiment at the High Luminosity Large Hadron Collider (HL-LHC) has been developed by the "ATLAS ITk Strip Sensor collaboration" and produced by Hamamatsu Photonics. Surface properties of different types of end-cap and barrel miniature sensors of the latest sensor design ATLAS12 have been studied before and after irradiation. The tested barrel sensors vary in "punch-through protection" (PTP) structure, and the end-cap sensors, whose stereo-strips differ in fan geometry, in strip pitch and in edge strip ganging options. Sensors have been irradiated with proton fluences of up to 1×1016 neq/cm2, by reactor neutron fluence of 1×1015 neq/cm2 and by gamma rays from 60Co up to dose of 1 MGy. The main goal of the present study is to characterize the leakage current for micro-discharge breakdown voltage estimation, the inter-strip resistance and capacitance, the bias resistance and the effectiveness of PTP structures as a function of bias voltage and fluence. It has been verified that the ATLAS12 sensors have high breakdown voltage well above the operational voltage which implies that different geometries of sensors do not influence their stability. The inter-strip isolation is a strong function of irradiation fluence, however the sensor performance is acceptable in the expected range for HL-LHC. New gated PTP structure exhibits low PTP onset voltage and sharp cut-off of effective resistance even at the highest tested radiation fluence. The inter-strip capacitance complies with the technical specification required before irradiation and no radiation-induced degradation was observed. A summary of ATLAS12 sensors tests is presented including a comparison of results from different irradiation sites. The measured characteristics are compared with the previous prototype of the sensor design, ATLAS07.

  1. Isolation and characterization of a radiation resistant thermophilic bacterium from radon hot spring

    International Nuclear Information System (INIS)

    Liang Xinle; Yang Long; Zhang Hong; Zhang Lei

    2011-01-01

    A radiation resistant and thermophilic bacterium strain R4-33 was isolated from radon hot spring water samples, pretreated with 60 Co γ-rays and UV irradiation. Tests on morphological, physiological and biochemical characters, fatty acid compositions, (G + C) mol% contents, and 16S rDNA sequencing were conducted. The results showed that strain R4-33 was of rod-shape, Gram-negative, atrichous, and endospore-forming. The optimum growth temperature and pH were 60 ℃ and 7.5, respectively. The strain utilized glucose, maltose and trehalose as carbon sources, and hydrolyzed casein and starch. Its catalase positive. The strain was sensitive to penicillin, neomycin, erythromycin, vancomycin, streptomycin, gentamycin, amikacin and ampicillin. The major cellular fatty acids were C 14:1 (48.8%) and C 15:1 (15.2%). The (G + C) mol% content of DNA was 58.2%. Phylogenetic tree based on 16S rDNA sequence showed R4-33 shared highly similarity to those of species in genus Anoxybacillus, especially to that of Anoxybacillus gonensis (99.5%). Based on the above, the strain R4-33 was proposed to the evolution branch of Anoxybacillus and designated as Anoxybacillu sp. R4-33. The UV and γ-radiation tests showed that the strain R4-33 had an ability of resistance to UV of 396 J/m 2 and 60 Co γ-rays irradiation of 14.0 kGy, indicating that the strain was a radiation resistant and thermophilic bacterium. (authors)

  2. Projection of needs for gamma radiation sources and other radioisotopes and assessment of alternatives for providing radiation sources

    Energy Technology Data Exchange (ETDEWEB)

    Ross, W.A.; Jensen, G.A.; Clark, L.L.; Eakin, D.E.; Jarrett, J.H.; Katayama, Y.B.; McKee, R.W.; Morgan, L.G.; Nealey, S.M.; Platt, A.M.; Tingey, G.L.

    1989-06-01

    Pacific Northwest Laboratory reviewed the projected uses and demands for a variety of nuclear byproducts. Because the major large-scale near-term demand is for gamma irradiation sources, this report concentrates on the needs for gamma sources and evaluates the options for providing the needed material. Projections of possible growth in the irradiation treatment industry indicate that there will be a need for 180 to 320 MCi of /sup 60/Co (including /sup 137/Cs equivalent) in service in the year 2000. The largest current and projected use of gamma irradiation is for the sterilization of medical devices and disposable medical supplies. Currently, 40% of US disposable medical products are treated by irradiation, and within 10 years it is expected that 90% will be treated in this manner. Irradiation treatment of food for destruction of pathogens or parasites, disinfestation, or extension of allowable storage periods is estimated to require an active inventory of 75 MCi of /sup 60/Co-equivalent gamma source in about a decade. 90 refs., 7 figs., 25 tabs.

  3. Projection of needs for gamma radiation sources and other radioisotopes and assessment of alternatives for providing radiation sources

    International Nuclear Information System (INIS)

    Ross, W.A.; Jensen, G.A.; Clark, L.L.

    1989-06-01

    Pacific Northwest Laboratory reviewed the projected uses and demands for a variety of nuclear byproducts. Because the major large-scale near-term demand is for gamma irradiation sources, this report concentrates on the needs for gamma sources and evaluates the options for providing the needed material. Projections of possible growth in the irradiation treatment industry indicate that there will be a need for 180 to 320 MCi of 60 Co (including 137 Cs equivalent) in service in the year 2000. The largest current and projected use of gamma irradiation is for the sterilization of medical devices and disposable medical supplies. Currently, 40% of US disposable medical products are treated by irradiation, and within 10 years it is expected that 90% will be treated in this manner. Irradiation treatment of food for destruction of pathogens or parasites, disinfestation, or extension of allowable storage periods is estimated to require an active inventory of 75 MCi of 60 Co-equivalent gamma source in about a decade. 90 refs., 7 figs., 25 tabs

  4. The effect of cellular carotenoid levels in micrococcus luteus on resistance to gamma radiation

    International Nuclear Information System (INIS)

    Al-Wandawi, K. H.

    2000-01-01

    In the present study, a biological system was developed to link the cellular carotenoid levels to Gamma radiation resistance in bacteria for the frst time. thus, in a non-photosynrhetic bacterium, in Micrococcus Luteus an inverse relationship was found between the increase in diphenylamine (DPA) concentration (5.25 μg/ml culture) and the polar cellular carotenoid pigments (C-45 and C-50 carotenoids and their glucosides). It was also found that irradiation of cells with different carotenoid concentrations with doses of γ-radiation in the range of (0.2500 gray) under oxic, air and hypoxic conditions showed that carotenoid pigments offer no significant protection as they usually do in case of visible light. (author).15 refs., 5 figs., 3 tabs

  5. Improvement of radiation resistance of polypropylene by blending with polyethylene and polystyrene

    International Nuclear Information System (INIS)

    Al Aji, Z.

    2001-01-01

    The use of polypropylene in production of medical component and packaging materials makes it an interesting material for applied research. Since the use of ethylene oxide for sterilization of medical components will be forbidden in the next future because of its carcinogens effect. Therefore, another alternative sterilization methods are required. The use of Gamma radiation is already established for sterilization of some medical components, this technique causes change in the physical mechanical properties of polypropylene, which makes the addition of stabilizers necessary. In this work, blends of domestically used polymers, polypropylene, linear low-density polyethylene, and polystyrene/butadiene were prepared in order to improve the radiation resistance of polypropylene; naphthalene was also used as an additive

  6. Heat enhancement of radiation resistivity of evaporated CsI, KI and KBr photocathodes

    CERN Document Server

    Tremsin, A S

    2000-01-01

    The photoemissive stability of as-deposited and heat-treated CsI, KI and KBr evaporated thin films under UV radiation is examined in this paper. After the deposition, some photocathodes were annealed for several hours at 90 deg. C in vacuum and their performance was then compared to the performance of non-heated samples. We observed that the post-evaporation thermal treatment not only increases the photoyield of CsI and KI photocathodes in the spectral range of 115-190 nm, but also reduces CsI, KI and KBr photocurrent degradation that occurs after UV irradiation. KBr evaporated layers appeared to be more radiation-resistant than CsI and KI layers. Post-deposition heat treatment did not result in any significant variation of KBr UV sensitivity.

  7. Molecular exploration of the highly radiation resistant cyanobacterium Arthrospira sp. PCC 8005

    Science.gov (United States)

    Badri, Hanène; Leys, Natalie; Wattiez, Ruddy

    Arthrospira (Spirulina) is a photosynthetic cyanobacterium able to use sunlight to release oxygen from water and remove carbon dioxide and nitrate from water. In addition, it is suited for human consumption (edible). For these traits, the cyanobacterium Arthrospira sp. PCC 8005 was selected by the European Space Agency (ESA) as part of the life support system MELiSSA for recycling oxygen, water, and food during future long-haul space missions. However, during such extended missions, Arthrospira sp. PCC 8005 will be exposed to continuous artificial illumination and harmful cosmic radiation. The aim of this study was to investigate how Arthrospira will react and behave when exposed to such stress environment. The cyanobacterium Arthrospira sp. PCC 8005 was exposed to high gamma rays doses in order to unravel in details the response of this bacterium following such stress. Test results showed that after acute exposure to high doses of 60Co gamma radiation upto 3200 Gy, Arthrospira filaments were still able to restart photosynthesis and proliferate normally. Doses above 3200 Gy, did have a detrimental effect on the cells, and delayed post-irradiation proliferation. The photosystem activity, measured as the PSII quantum yield immediately after irradiation, decreased significantly at radiation doses above 3200 Gy. Likewise through pigment content analysis a significant decrease in phycocyanin was observed following exposure to 3200 Gy. The high tolerance of this bacterium to 60Co gamma rays (i.e. ca. 1000x more resistant than human cells for example) raised our interest to investigate in details the cellular and molecular mechanisms behind this amazing resistance. Optimised DNA, RNA and protein extraction methods and a new microarray chip specific for Arthrospira sp. PCC 8005 were developed to identify the global cellular and molecular response following exposure to 3200 Gy and 5000 Gy A total of 15,29 % and 30,18 % genes were found differentially expressed in RNA

  8. Gamma-Ray Dosimetry System Using Radiation-Resistant Optical Fibers and a Luminescent Material

    International Nuclear Information System (INIS)

    Toh, K.; Nakamura, T.; Yamagishi, H.; Sakasai, K.; Soyama, K.; Shikama, T.; Nagata, S.

    2013-06-01

    Gamma-ray dosimetry system using radiation-resistant optical fibers and a luminescent material was developed for use in a damaged Fukushima Dai-ichi nuclear power plant. The system was designed to be compact and unnecessary of an external supply of electricity to a radiation sensor head with a contaminated working environment and restricted through-holes to a measurement point in the damaged reactor. The system can detect a gamma-ray dose rate at a measurement point using a couple of optical fibers and a luminescent material with a coincidence method. This system demonstrated a linear response with respect to the gamma-ray dose rate from 0.5 mGy/h to 0.1 Gy/h and the system had a capability to measure the dose rate of more than 10 2 Gy/h. (authors)

  9. The origin of polarized blackbody radiation from resistively heated multiwalled carbon nanotubes

    International Nuclear Information System (INIS)

    Aliev, Ali E.; Kuznetsov, Alexander A.

    2008-01-01

    We observed very pronounced polarization of light emitted by highly aligned free-standing multiwall carbon nanotube (MWNT) sheet in axial direction which is turned to the perpendicular polarization when a number of layers are increased. The radiation spectrum of resistively heated MWNT sheet closely follows to the Plank's blackbody radiation distribution. The obtained polarization features can be described by a classical dielectric cylindrical shell model, taking into consideration the contribution of delocalized π-electrons (π surface plasmons). In absorption (emission) the optical transverse polarizability, which is much smaller than longitudinal one, is substantially suppressed by depolarization effect due to screening by induced charges. This phenomenon suggests very simple and precise method to estimate the alignment of nanotubes in bundles or large assemblies

  10. Conceptual design of a versatile radiation tolerant integrated signal conditioning circuit for resistive sensors

    Energy Technology Data Exchange (ETDEWEB)

    Leroux, P. [Katholieke Hogeschool Kempen, Kleinhoefstraat 4, B-2440 Geel (Belgium); Katholieke Universiteit Leuven, Dept. ESAT-MICAS, Kasteelpark Arenberg 10, B-3001 Heverlee (Belgium); SCK-CEN, Belgian Nuclear Research Centre, Boeretang 200, B-2400 Mol (Belgium); Sterckx, J. [Katholieke Hogeschool Kempen, Kleinhoefstraat 4, B-2440 Geel (Belgium); Van Uffelen, M.; Damiani, C. [Fusion 4 Energy, Ed. B3, c/Josep, no 2, Torres Diagonal Litoral, 08019 Barcelona (Spain)

    2011-07-01

    This paper presents the design of a radiation tolerant configurable discrete time CMOS signal conditioning circuit for use with resistive sensors like strain gauge pressure sensors. The circuit is intended to be used for remote handling in harsh environments in the International Thermonuclear Experimental fusion Reactor (ITER). The design features a 5 V differential preamplifier using a Correlated Double Sampling (CDS) architecture at a sample rate of 20 kHz and a 24 V discrete time post amplifier. The gain is digitally controllable between 27 and 400 in the preamplifier and between 1 and 8 in the post amplifier. The nominal input referred noise voltage is only 8.5 {mu}V while consuming only 1 mW. The circuit has a simulated radiation tolerance of more than 1 MGy. (authors)

  11. Nicotinamide and other benzamide analogs as agents for overcoming hypoxic cell radiation resistance in tumours

    International Nuclear Information System (INIS)

    Horsman, M.

    1996-01-01

    Oxygen deficient hypoxic cells, which are resistant to sparsely ionising radiation, have now been identified in most animal and some human solid tumours and will influence the response of those tumours to radiation treatment. This hypoxia can be either chronic, arising from an oxygen diffusion limitation, or acute, resulting from transient stoppages in microregional blood flow. Extensive experimental studies, especially in the last decade, have shown that nicotinamide and structurally related analogs can effectively sensitize murine tumours to both single and fractionated radiation treatments and that they do so in preference to the effects seen in mouse normal tissues. The earliest studies suggested that this enhancement of radiation damage was the result of an inhibition of the repair mechanisms. However, recent studies in mouse tumours have shown that these drugs prevent transient cessations in blood flow, thus inhibiting the development of acute hypoxia. This novel discovery led to the suggestion that the potential role of these agents as radiosensitizers would be when combined with treatments that overcame chronic hypoxia. The combined nicotinamide with hyperthermia proved that the enhancement of radiation damage by both agents together was greater than that seen with each agent alone. Similar results were later seen for nicotinamide combined with a perfluorochemical emulsion, carbogen breathing, and pentoxifylline, and in all these studies the effects in tumours were always greater than those seen in appropriate normal tissues. Of all the analogs, it is nicotinamide itself which has been the most extensively studied as a radiosensitizer in vivo and the one that shows the greatest effect in animal tumours. It is also an agent that has been well established clinically, with daily doses of up to 6 g, associated with a low incidence of side effects. This human dose is equivalent to 100-200 mg/kg in mice and such doses will maximally sensitize murine tumours to

  12. Effect of fractionated radiation on multidrug resistance in human ovarian cancer

    International Nuclear Information System (INIS)

    Kong Dejuan; Liu Xiaodong; Liang Bing; Jia Lili; Ma Shumei

    2012-01-01

    Objective: To investigate the effect of different subtypes of fractionated doses on multidrug resistance in ovarian cancer cells. Methods: The human ovarian cancer cell lines SKOV3 and its drug-resistant subtype SKVCR were divided into four groups i.e., sham-irradiated, single dose (10 Gy), fractionated dose (2 Gy × 5) and multi-fractionated dose (1 Gy × 2 × 5). Cell sensitivity to vincristine (VCR), etoposide (VP-16), pirarubicin (THP) and cisplatin (DDP) was measured by MTT assay. Western blot was applied to detect the expression of P-gp after irradiation. Results: The doubling time of SKVCR was about 1.8-fold of that of SKOV3 cells. P-gp was expressed in SKVCR but not in SKOV3. IC 50 values of SKVCR were higher than those of SKOV3. To SKOV3 cells, single dose irradiation decreased cell sensitivity to THP and DDP and fractionated irradiation decreased cell sensitivity to VCR, THP and VP-16. Multi-fractionated irradiation decreased cell sensitivity to VP-16. In SKVCR cells, all these irradiation treatments increased cell sensitivity to VCR and VP-16 but not to DDP. In addition, single and fractionated irradiation decreased P-gp expression in SKVCR cells. Conclusions: Single, fractionated and multi-fractionated radiation induced chemotherapy resistance in SKOV3 cells, while reversed drug resistance to VCR and VP-16 in SKVCR cells. (authors)

  13. CMOS pixel sensors on high resistive substrate for high-rate, high-radiation environments

    Energy Technology Data Exchange (ETDEWEB)

    Hirono, Toko, E-mail: thirono@uni-bonn.de [Physikalisches Institute der Universität Bonn, Bonn (Germany); Barbero, Marlon; Breugnon, Patrick; Godiot, Stephanie [CPPM, Aix-Marseille Universite, CNRS/IN2P3, Marseille (France); Gonella, Laura; Hemperek, Tomasz; Hügging, Fabian; Krüger, Hans [Physikalisches Institute der Universität Bonn, Bonn (Germany); Liu, Jian; Pangaud, Patrick [CPPM, Aix-Marseille Universite, CNRS/IN2P3, Marseille (France); Peric, Ivan [IPE, Karlsruher Institut für Technologie, Karlsruhe (Germany); Pohl, David-Leon [Physikalisches Institute der Universität Bonn, Bonn (Germany); Rozanov, Alexandre [CPPM, Aix-Marseille Universite, CNRS/IN2P3, Marseille (France); Rymaszewski, Piotr [Physikalisches Institute der Universität Bonn, Bonn (Germany); Wang, Anqing [CPPM, Aix-Marseille Universite, CNRS/IN2P3, Marseille (France); Wermes, Norbert [Physikalisches Institute der Universität Bonn, Bonn (Germany)

    2016-09-21

    A depleted CMOS active pixel sensor (DMAPS) has been developed on a substrate with high resistivity in a high voltage process. High radiation tolerance and high time resolution can be expected because of the charge collection by drift. A prototype of DMAPS was fabricated in a 150 nm process by LFoundry. Two variants of the pixel layout were tested, and the measured depletion depths of the variants are 166 μm and 80 μm. We report the results obtained with the prototype fabricated in this technology.

  14. Effects of sulekang capsule in enhancement of resistance to radiation and regulating immunological function in mice

    International Nuclear Information System (INIS)

    Zhao Naikun; Zhou Ouliang; Du Weixia

    1990-01-01

    The effects of Sulekang capsule in enhancing the resistance to radiation and regulating the immunological function in mice were described. The results show that Sulekang capsule may lengthen the survival time (p 60 Co gamma rays. The experimental results of ANAE reaction show that the activety of T cells of normal or exposed mice may be enhanced by Sulekang capsule, which can control the decrease of both ANAE-positive cells and T cells in exposed mice. So it may enhance the immunological function on exposed animals

  15. Cytoplasmic superoxide dismutase and catalase activity and resistance to radiation lethality in murine tumor cells

    International Nuclear Information System (INIS)

    Davy, C.A.; Tesfay, Z.; Jones, J.; Rosenberg, R.C.; McCarthy, C.; Rosenberg, S.O.

    1986-01-01

    Reduced species of molecular oxygen are produced by the interaction of ionizing radiation with aqueous solutions containing molecular oxygen. The enzymes catalase and superoxide dismutase (SOD) are thought to function in vivo as scavengers of metabolically produced peroxide and superoxide respectively. SOD has been shown to protect against the lethal effects of ionizing radiation in vitro and in vivo. The authors have investigated the relationship between the cytosolic SOD catalase content and the sensitivity to radiation lethality of a number of murine cell lines (402AX, EL-4, MB-2T3, MB-4, MEL, P-815, SAI, SP-2, and SV-3T3). K/sub i/(CN - ) for murine Cu-Zn-SOD was determined to be 6.8 x 10 -6 M. No cytosolic Mn-SOD activity was found in any of the cell lines studied. No correlation was found between the cytosolic Cu-Zn-SOD or cytosolic catalase activity and the resistance to radiation lethality or the murine cell lines studied

  16. Effect of aromatic compounds on radiation resistance of polymers studied by optical emission

    International Nuclear Information System (INIS)

    Kawanishi, Shunichi; Hagiwara, Miyuki

    1987-10-01

    To clarify the effects of condensed bromoacenaphthylene (con-BACN) as a newly developed flame retardant on the radiation resistance of ethylene-propylene-diene-terpolymer (EPDM), optical emission behavior of aromatic compounds, acenaphthylene and acenaphthene as model compound of con-BACN was studied. The energy absorbed in polymer matrix is transferred to the aromatic molecules very fast within 1 ns, and introduces excited states of aromatic compound. The fluorescence from naphthalene units of the additives with peak at 337 and 350 nm (named AT emission band) was observed in EPDM containing acenaphthene or acenaphthylene. When aromatic peroxide was used as a crosslinking agent, another emission band (Xn band) was observed at 400 nm. It was found that these emission bands play a role in trapping sites in which a part of radiation energy release in the form of fluorescence. The energy level of the excited state was correlated to the radiation stability measured with coloration and oxidation reaction of the polymer. Furthermore, acenaphthylene having a reactive vinyl bond forms excimer emission band Ex whose level is lower than those of AT and Xn bands, and therefore, enhances radiation stability of matrix polymer by giving effective routes for energy release. (author)

  17. Some aspects of radiation resistance of wide-gap metal oxides

    International Nuclear Information System (INIS)

    Lushchik, Aleksandr; Feldbach, Eduard; Galajev, Semjon; Kaerner, Tiit; Liblik, Peeter; Lushchik, Cheslav; Maaroos, Aarne; Nagirnyi, Vitali; Vasil'chenko, Evgeni

    2007-01-01

    Wide-gap oxides drastically differ in radiation resistance against nonimpact mechanisms of defect creation depending on the ratio between the values of the energy gap E g and the formation energy of a pair of Frenkel defects (FD) E FD . Materials with E g >E FD are radiation-sensitive even at a low excitation density, while the efficiency of FD creation in the materials with E g FD is noticeable only under a high excitation density or in the presence of impurity centers serving as the promoters of radiation damage due to the nonimpact mechanisms. Novel experimental results on the FD creation in the bulk of MgO single crystals (E g FD ) irradiated by swift uranium ions at 300 K and 5 keV electrons at 6 K are presented. The prospects of luminescent protection against radiation damage as well as of the decrease of the luminescence efficiency due to the suppression of nonradiative recombination of electrons and holes (both relaxed and nonrelaxed) by doping the material with a sufficient amount of luminescent impurity ions are considered on the example of spectral transformers for plasma display panels

  18. Clinical and histological study of radiation-resistant cancer of the larynx

    Energy Technology Data Exchange (ETDEWEB)

    Maeda, K [Osaka Univ. (Japan). Faculty of Medicine

    1979-02-01

    In its early stage, cancer of the larynx is treated mainly by irradiation. A clinical and histological study of the radiation-resistant cancer of the larynx is reported. From 1958 to 1976, 1190 patients with squamous cell carcinoma of the larynx were treated at the Department of Otolaryngology, Osaka University Hospital. Among them, 597 patients (50.2%) were treated by radiation therapy. In 180 patients who had developed local recurrence after initial irradiation, partial or total laryngectomies were performed and 5-year crude survival rates were 71.3%. Gross examination of the specimens and histological studies were performed on these cases, as well as microangiography. The majority of recurrent glottic cancers were located at the anterior commissure and had some subglottic extention. In the supraglottic cancers, marked invasion to the pre-epiglottic space, perichondritis, and edema of the arytenoids were observed. These findings suggested that the unsuccessful radiation therapy was due to the diagnostic failure of the tumor extention. Fixation of the affected vocal cords and ulcer formation were also observed. Histologically, cancer cells invaded deeply the surrounding tissues as scattered cancer nests with marked hypoxic stromal reaction. This study suggests that radiation therapy should be the initial but non-repetitive treatment of choice for earlystage laryngeal cancers.

  19. Improved ozone resistance of styrene-butadiene rubber cured by a combination of sulfur and ionizing radiation

    International Nuclear Information System (INIS)

    Basfar, A.A.; Silverman, Joseph

    1995-01-01

    Fourier Transform Infrared (FTIR) studies performed in this work indicate that high ozone resistance of Styrene-Butadiene Rubber (SBR) formulations cured by a combination of sulfur and ionizing radiation is associated with unusually high vinyl concentration. On the other hand, sulfur cured SBR formulations with low vinyl concentration have poor ozone resistance. Curing with peroxides which involves chemistry similar to that of radiation curing, also leads to high vinyl concentration (relative to sulfur curing) and high ozone resistance. Increasing the absorbed dose in sulfur-radiation cured samples decreased the high vinyl content to a point where the ozone resistance declined greatly. Carbon black was shown to reduce the absorption of both the transvinylene and the vinyl unsaturation groups, but not to the same extent in all formulations. Also, the carbon black seems to play a greater role in the absorption of the unsaturation as sulfur increases. (Author)

  20. Improved ozone resistance of styrene-butadiene rubber cured by a combination of sulfur and ionizing radiation

    International Nuclear Information System (INIS)

    Basfar, A.A.; Silverman, J.

    1995-01-01

    Fourier Transform (FTIR) studies performed in this work indicate that high ozone resistance of Styrene-Butadiene Rubber (SBR) formulations cured by a combination of sulfur and ionizing radiation is associated with unusually high vinyl concentration. On the other hand, sulfur cured SBR formulations with low vinyl concentration have poor ozone resistance. Curing with peroxides which involves chemistry similar to that of radiation curing, also leads to high vinyl concentration (relative to sulfur curing) and high ozone resistance. Increasing the absorbed dose in sulfur-radiation cured samples decreased the high vinyl content to a point where the ozone resistance declined greatly. Carbon black was shown to reduce the absorption of both the transvinylene and the vinyl unsaturation groups, but not to the same extent in all formulations. Also, the carbon black seems to play a greater role in the absorption of the unsaturation as sulfur increases. (Author)

  1. Comparison Study On Sunlight Or Gamma Radiation Aging Resistance Of Poly (Vinyl Pyrrolidone) Aqueous Solution With PVP Nanogel

    International Nuclear Information System (INIS)

    Doan Binh; Pham Thu Hong; Nguyen Nguyet Dieu; Nguyen Thanh Duoc

    2011-01-01

    Comparison study on sunlight or gamma-radiation aging resistance of poly (vinyl pyrrolidone) (PVP) aqueous solution with PVP nanogel at 0.5% was carried out. Sunlight or gamma- radiation aging resistance of PVP aqueous solution and nanogel was evaluated on the basis of their intrinsic viscosity, UV-VIS absorbance, weight averaged molecular weight (M w ). The PVP aqueous solution and nanogel exposed to sunlight in the storage duration of 3 months and to gamma radiation at absorbed doses of 0, 15, 30, 50 kGy were used for this study. Furthermore, the stability of PVP nanogel and of PVP aqueous solution was also studied on the change of their intrinsic viscosity, UV-VIS absorbance, weight averaged molecular weight, particle size distribution and coil size. The experimental results were shown that the aging resistance of PVP nanogel was higher than that of PVP aqueous solution when exposed to gamma radiation or sunlight. (author)

  2. UV light-induced survival response in a highly radiation-resistant isolate of the Moraxella-acinetobacter group

    International Nuclear Information System (INIS)

    Keller, L.C.; Thompson, T.L.; Maxcy, R.B.

    1982-01-01

    A highly radiation-resistant member of the Moraxella-Acinetobacter group, isolate 4, obtained from meat, was studied to determine the effect of preexposure to UV radiation on subsequent UV light resistance. Cultures that were preexposed to UV light and incubated for a short time in plate count broth exhibited increased survival of a UV light challenge dose. This response was inhibited in the presence of chloramphenicol. Frequencies of mutation to streptomycin, trimethoprim, and sulfanilamide resistance remained the same after the induction of this survival response and were not altered by treatment with mutagens, with the exception of mutation to streptomycin resistance after γ-irradiation or nitrosoguanidine or methyl methane sulfonate treatment. The results indicated that isolate 4 has a UV light-inducible UV light resistance mechanism which is not associated with increased mutagenesis. The characteristics of the radiation resistance response in this organism are similar to those of certain other common food contaminants. Therefore, considered as part of the total microflora of meat, isolate 4 and the other radiation-resistant Moraxella-Acinetobacter isolates should not pose unique problems in a proposed radappertizaton process

  3. Radiation-resistance assessment of IR fibres for ITER thermography diagnostic system

    International Nuclear Information System (INIS)

    Brichard, B.; Ierschot, S. van; Ooms, H.; Berghmans, F.; Reichle, R.; Pocheau, C.; Decreton, M.

    2006-01-01

    The actively cooled target plates in the divertor of ITER will be subjected to high thermal fluxes (∼ 10 MW/m 2 ). These target plates are compound structures of an armour material at the surface - either carbon fibre reinforced carbon (CFC) or tungsten - and a water cooled CuCrZr structure inside or below. The thermal limit of the interface between the two materials must not exceed 550 o C. Therefore, the temperature must be carefully monitored to prevent structural damages of the divertor plates. Non contact measurements of the temperature offer the advantage to avoid weakening of the cooling plate structure which is already quite complex to manufacture. Infrared thermography of the target surface is therefore considered as a possible solution. Recently a diagnostic concept for spectrally resolved ITER divertor thermography using optical fibres has been proposed by CEA-Cadarache. However, the divertor region will have to face high-radiation flux and the radiation-resistance of InfraRed (IR)-fibres must be evaluated. In collaboration with CEA-Cadarache, an irradiation program has been started at SCK-CEN (Mol, Belgium) with the aim to measure the radiation-induced absorption of different IR fibre candidates operating in the 1-5 μm range. We selected various commercially available IR technologies: ZrF 4 , Hollow-Waveguide, Sapphire and Chalcogenide. For wavelengths below 2 μm we also tested low-OH silica fibres. We carried out a gamma irradiation at a maximum dose-rate of 0.42 Gy/s up to a total dose of about 5000 Gy. We showed that the optical transmission of ZrF 4 fibres strongly decreased under gamma radiation, primarily for wavelengths below 2 μm. In this type of fibre typical optical losses can reach 50 % at 5000 Gy around 3 μm. Nevertheless, the optical transmission can be significantly recovered by performing a thermal annealing treatment at a temperature of 100 o C. We also irradiated a Silver-coated hollow waveguide fibre at the same dose-rate but up

  4. Fruit Flies Provide New Insights in Low-Radiation Background Biology at the INFN Underground Gran Sasso National Laboratory (LNGS).

    Science.gov (United States)

    Morciano, Patrizia; Cipressa, Francesca; Porrazzo, Antonella; Esposito, Giuseppe; Tabocchini, Maria Antonella; Cenci, Giovanni

    2018-06-04

    Deep underground laboratories (DULs) were originally created to host particle, astroparticle or nuclear physics experiments requiring a low-background environment with vastly reduced levels of cosmic-ray particle interference. More recently, the range of science projects requiring an underground experiment site has greatly expanded, thus leading to the recognition of DULs as truly multidisciplinary science sites that host important studies in several fields, including geology, geophysics, climate and environmental sciences, technology/instrumentation development and biology. So far, underground biology experiments are ongoing or planned in a few of the currently operating DULs. Among these DULs is the Gran Sasso National Laboratory (LNGS), where the majority of radiobiological data have been collected. Here we provide a summary of the current scenario of DULs around the world, as well as the specific features of the LNGS and a summary of the results we obtained so far, together with other findings collected in different underground laboratories. In particular, we focus on the recent results from our studies of Drosophila melanogaster, which provide the first evidence of the influence of the radiation environment on life span, fertility and response to genotoxic stress at the organism level. Given the increasing interest in this field and the establishment of new projects, it is possible that in the near future more DULs will serve as sites of radiobiology experiments, thus providing further relevant biological information at extremely low-dose-rate radiation. Underground experiments can be nicely complemented with above-ground studies at increasing dose rate. A systematic study performed in different exposure scenarios provides a potential opportunity to address important radiation protection questions, such as the dose/dose-rate relationship for cancer and non-cancer risk, the possible existence of dose/dose-rate threshold(s) for different biological systems and

  5. Europium- and lithium-doped yttrium oxide nanocrystals that provide a linear emissive response with X-ray radiation exposure†

    Science.gov (United States)

    Stanton, Ian N.; Belley, Matthew D.; Nguyen, Giao; Rodrigues, Anna; Li, Yifan; Kirsch, David G.; Yoshizumi, Terry T.

    2015-01-01

    device recorded scintillation intensities that tracked linearly with total radiation exposure, highlighting its capability to provide alternately accurate dosimetry measurements for both diagnostic imaging (80 kVp) and radiation therapy treatment (225 kVp). PMID:24696056

  6. Mechanisms of UVB-resistance in rice: Cultivar differences in the sensitivity to UVB radiation in rice

    International Nuclear Information System (INIS)

    Hidema, J.

    2001-01-01

    In a study on the sensitivity to UVB radiation of rice cultivars of 5 Asian rice ecotypes, results showed that the rice cultivars widely varied in UVB sensitivity; among the Japanese rice cultivars, Sasanishiki was more resistant to UVB, while Norin 1 was less resistant; UV-sensitive Norin 1 was deficient in photorepair of cyclobutane pyrimidine dimers (UV-induced DNA damage), and the sensitivity to UVB radiation significantly correlated with deficient CPD photorepair; and that this deficiency in Norin 1 resulted from a functionally altered photolyase. The results suggest that photorepair capacity is a principal factor in determining UVB sensitivity in rice. The effects of supplemental UVB radiation on the growth and yield of Japanese rice cultivars under field conditions were also studied in Japan since 1993. The results indicate that supplemental UVB radiation had inhibitory effects on the growth and yield of rice. Furthermore, grain size was smaller with supplemental UVB radiation

  7. Effect of solar radiation on multidrug resistant E. coli strains and antibiotic mixture photodegradation in wastewater polluted stream

    International Nuclear Information System (INIS)

    Rizzo, L.; Fiorentino, A.; Anselmo, A.

    2012-01-01

    The effect of solar radiation on the inactivation of multidrug resistant Escherichia coli (MDR) strains selected from an urban wastewater treatment plant (UWWTP) effluent and the change of their resistance to a mixture of three antibiotics (evaluated in terms of minimum inhibit concentration (MIC)) in wastewater polluted stream were investigated. The solar photodegradation of the mixture of the three target antibiotics (amoxicillin (AMX), ciprofloxacin (CPX), and sulfamethoxazole (SMZ)) was also evaluated. Additionally, since UWWTP effluents are possible sources of antibiotics and antibiotic resistant bacteria, the disinfection by conventional chlorination process of the UWWTP effluent inoculated with MDR strains was investigated too. Solar radiation poorly affected the inactivation of the two selected antibiotic resistant E. coli strains (40 and 60% after 180 min irradiation). Moreover, solar radiation did not affect strain resistance to AMX (MIC > 256 μg/mL) and SMZ (MIC > 1024 μg/mL), but affected resistance of the lower resistance strain to CPX (MIC decreased by 33% but only after 180 min of irradiation). Chlorination of wastewater sample strongly decreased the number of the two selected antibiotic resistant E. coli strains (99.667 and 99.999%), after 60 min of contact time at 2.0 mg/L initial chlorine concentration, but the resistance of survived colonies to antibiotics was unchanged. Finally, the solar photodegradation rate of the antibiotic mixture (1 mg/L initial concentration respectively) resulted in the following order (half-life time): CPX (t 1/2 = 24 min) 1/2 = 99 min) 1/2 = 577 min). Accordingly, the risk of the development of resistance to SMZ in surface water is significantly higher compared to CPX and AMX. - Highlights: ► Solar radiation did not affect E. coli strain resistance to AMX and SMZ. ► Solar radiation affected the resistance of one E. coli strain to CPX. ► MIC for CPX decreased by 33% after 180 min of solar irradiation.

  8. Effect of solar radiation on multidrug resistant E. coli strains and antibiotic mixture photodegradation in wastewater polluted stream

    Energy Technology Data Exchange (ETDEWEB)

    Rizzo, L., E-mail: l.rizzo@unisa.it [Department of Civil Engineering, University of Salerno, via Ponte don Melillo, 1-84084 Fisciano (Italy); Fiorentino, A. [Department of Civil Engineering, University of Salerno, via Ponte don Melillo, 1-84084 Fisciano (Italy); Anselmo, A. [Pluriacque, via Alento, 84060 Prignano Cilento (Italy)

    2012-06-15

    The effect of solar radiation on the inactivation of multidrug resistant Escherichia coli (MDR) strains selected from an urban wastewater treatment plant (UWWTP) effluent and the change of their resistance to a mixture of three antibiotics (evaluated in terms of minimum inhibit concentration (MIC)) in wastewater polluted stream were investigated. The solar photodegradation of the mixture of the three target antibiotics (amoxicillin (AMX), ciprofloxacin (CPX), and sulfamethoxazole (SMZ)) was also evaluated. Additionally, since UWWTP effluents are possible sources of antibiotics and antibiotic resistant bacteria, the disinfection by conventional chlorination process of the UWWTP effluent inoculated with MDR strains was investigated too. Solar radiation poorly affected the inactivation of the two selected antibiotic resistant E. coli strains (40 and 60% after 180 min irradiation). Moreover, solar radiation did not affect strain resistance to AMX (MIC > 256 {mu}g/mL) and SMZ (MIC > 1024 {mu}g/mL), but affected resistance of the lower resistance strain to CPX (MIC decreased by 33% but only after 180 min of irradiation). Chlorination of wastewater sample strongly decreased the number of the two selected antibiotic resistant E. coli strains (99.667 and 99.999%), after 60 min of contact time at 2.0 mg/L initial chlorine concentration, but the resistance of survived colonies to antibiotics was unchanged. Finally, the solar photodegradation rate of the antibiotic mixture (1 mg/L initial concentration respectively) resulted in the following order (half-life time): CPX (t{sub 1/2} = 24 min) < AMX (t{sub 1/2} = 99 min) < SMZ (t{sub 1/2} = 577 min). Accordingly, the risk of the development of resistance to SMZ in surface water is significantly higher compared to CPX and AMX. - Highlights: Black-Right-Pointing-Pointer Solar radiation did not affect E. coli strain resistance to AMX and SMZ. Black-Right-Pointing-Pointer Solar radiation affected the resistance of one E. coli strain

  9. Proliferation Resistance and Safeguards by Design: The Safeguardability Assessment Tool Provided by the INPRO Collaborative Project ''INPRO'' (Proliferation Resistance and Safeguardability Assessment)

    International Nuclear Information System (INIS)

    Haas, E.; Chang, H.-L.; Phillips, J.R.; Listner, C.

    2015-01-01

    Since the INPRO Collaborative Project on Proliferation Resistance and Safeguardability Assessment Tools (PROSA) was launched in 2011, Member State experts have worked with the INPRO Section and the IAEA Department of Safeguards to develop a revised methodology for self-assessment of sustainability in the area of proliferation resistance of a nuclear energy system (NES). With the common understanding that there is ''no proliferation resistance without safeguards'' the revised approach emphasizes the evaluation of a new 'User Requirement' for ''safeguardability'', that combines metrics of effective and efficient implementation of IAEA Safeguards including ''Safeguards-by-Design'' principles. The assessment with safeguardability as the key issue has been devised as a linear process evaluating the NES against a ''Basic Principle'' in the area of proliferation resistance, answering fundamental questions related to safeguards: 1) Do a State's legal commitments, policies and practices provide credible assurance of the exclusively peaceful use of the NES, including a legal basis for verification activities by the IAEA? 2) Does design and operation of the NES facilitate the effective and efficient implementation of IAEA safeguards? To answer those questions, a questionnaire approach has been developed that clearly identifies gaps and weaknesses. Gaps include prospects for improvements and needs for research and development. In this context, the PROSA approach assesses the safeguardability of a NES using a layered ''Evaluation Questionnaire'' that defines Evaluation Parameters (EP), EP-related questions, Illustrative Tests and Screening Questions to present and structure the evidence of findings. An integral part of the assessment process is Safeguards-by-Design, the identification of potential diversion, misuse and concealment strategies (coarse diversion path

  10. Benefits of a Pharmacology Antimalarial Reference Standard and Proficiency Testing Program Provided by the Worldwide Antimalarial Resistance Network (WWARN)

    Science.gov (United States)

    Lourens, Chris; Lindegardh, Niklas; Barnes, Karen I.; Guerin, Philippe J.; Sibley, Carol H.; White, Nicholas J.

    2014-01-01

    Comprehensive assessment of antimalarial drug resistance should include measurements of antimalarial blood or plasma concentrations in clinical trials and in individual assessments of treatment failure so that true resistance can be differentiated from inadequate drug exposure. Pharmacometric modeling is necessary to assess pharmacokinetic-pharmacodynamic relationships in different populations to optimize dosing. To accomplish both effectively and to allow comparison of data from different laboratories, it is essential that drug concentration measurement is accurate. Proficiency testing (PT) of laboratory procedures is necessary for verification of assay results. Within the Worldwide Antimalarial Resistance Network (WWARN), the goal of the quality assurance/quality control (QA/QC) program is to facilitate and sustain high-quality antimalarial assays. The QA/QC program consists of an international PT program for pharmacology laboratories and a reference material (RM) program for the provision of antimalarial drug standards, metabolites, and internal standards for laboratory use. The RM program currently distributes accurately weighed quantities of antimalarial drug standards, metabolites, and internal standards to 44 pharmacology, in vitro, and drug quality testing laboratories. The pharmacology PT program has sent samples to eight laboratories in four rounds of testing. WWARN technical experts have provided advice for correcting identified problems to improve performance of subsequent analysis and ultimately improved the quality of data. Many participants have demonstrated substantial improvements over subsequent rounds of PT. The WWARN QA/QC program has improved the quality and value of antimalarial drug measurement in laboratories globally. It is a model that has potential to be applied to strengthening laboratories more widely and improving the therapeutics of other infectious diseases. PMID:24777099

  11. Development of radiation resistant structural materials utilizing fission research reactors in Japan (Role of research reactors)

    International Nuclear Information System (INIS)

    Shikama, T.; Tanigawa, H.; Nozawa, T.; Muroga, T.; Aoyama, T.; Kawamura, H.; Ishihara, M.; Ito, C.; Kaneda, S.; Mimura, S.

    2009-01-01

    Structural materials for next-generation nuclear power systems should have a good radiation resistance, where the expected accumulation dose will largely exceed 10 dpa. Among several candidate materials, materials of five categories, 1. Austenitic steels, including high nickel alloys, 2. Low activation ferritic martensitic steels, 3. ODS steels (austenitic and ferritic), 4. Vanadium based alloys, 5. Silicon carbide composites (SiC/SiCf). All have been most extensively studied in Japan, in collaboration among industries, national institutes such as Japan Atomic Energy Agency (JAEA), National Institute for Fusion Science (NIFS) and National Institute for Materials Science (NIMS), and universities. The high nickel base alloys were studied for their low swelling behaviors mainly by the NIMS and the austenitic steels are studied for their reliable engineering data base and their reliable performance in irradiation environments mainly by the JAEA, mainly for their application in the near-term projects such as the ITER and the Sodium Cooled Fast Reactors. The most extensive studies are now concentrated on the Low Activation Ferritic Marsensitic steels and ODS steels, for their application in a demonstration fusion reactor and prototype sodium cooled fast reactors. Fundamental studies on radiation effects are carried out, mainly utilizing Japan Materials Testing Rector (JMTR) with its flexible irradiation ability, up to a few dpa. For higher dpa irradiation, a fast test reactor, JOYO is utilized up to several 10s dpa. Some international collaborations such as Japan/USA and Japan/France are effective to utilize reactors abroad, such as High Flux Isotope Reactor (HFIR) of Oak Ridge National Laboratory, and sodium cooled high flux fast reactors in France. Silicon carbide based composites are extensively studied by university groups led by Kyoto University and the JAEA. For their performance in heavy irradiation environments, the Japan/USA collaboration plays an important role

  12. The effect of ultraviolet radiation on water-logging resistance in ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-12-01

    Dec 1, 2009 ... similar defense systems to reduce cellular damages and a phenomenon ... UV-B radiation (280 - 320 nm) was provided by UV-B Lamps. (Beijing Normal .... of the experiment, water-logging led to a decrease of. SOD activity ...

  13. Europium- and lithium-doped yttrium oxide nanocrystals that provide a linear emissive response with X-ray radiation exposure

    Science.gov (United States)

    Stanton, Ian N.; Belley, Matthew D.; Nguyen, Giao; Rodrigues, Anna; Li, Yifan; Kirsch, David G.; Yoshizumi, Terry T.; Therien, Michael J.

    2014-04-01

    scintillation intensities that tracked linearly with total radiation exposure, highlighting its capability to provide alternately accurate dosimetry measurements for both diagnostic imaging (80 kVp) and radiation therapy treatment (225 kVp).Eu- and Li-doped yttrium oxide nanocrystals [Y2-xO3 Eux, Liy], in which Eu and Li dopant ion concentrations were systematically varied, were developed and characterized (TEM, XRD, Raman spectroscopic, UV-excited lifetime, and ICP-AES data) in order to define the most emissive compositions under specific X-ray excitation conditions. These optimized [Y2-xO3 Eux, Liy] compositions display scintillation responses that: (i) correlate linearly with incident radiation exposure at X-ray energies spanning from 40-220 kVp, and (ii) manifest no evidence of scintillation intensity saturation at the highest evaluated radiation exposures [up to 4 Roentgen per second]. For the most emissive nanoscale scintillator composition, [Y1.9O3; Eu0.1, Li0.16], excitation energies of 40, 120, and 220 kVp were chosen to probe the dependence of the integrated emission intensity upon X-ray exposure-rate in energy regimes having different mass-attenuation coefficients and where either the photoelectric or the Compton effect governs the scintillation mechanism. These experiments demonstrate for the first time for that for comparable radiation exposures, when the scintillation mechanism is governed by the photoelectric effect and a comparably larger mass-attenuation coefficient (120 kVp excitation), greater integrated emission intensities are recorded relative to excitation energies where the Compton effect regulates scintillation (220 kVp) in nanoscale [Y2-xO3 Eux] crystals. Nanoscale [Y1.9O3; Eu0.1, Li0.16] (70 +/- 20 nm) was further exploited as a detector material in a prototype fiber-optic radiation sensor. The scintillation intensity from the [Y1.9O3; Eu0.1, Li0.16]-modified, 400 μm sized optical fiber tip, recorded using a CCD-photodetector and integrated over the

  14. Up-regulation of DNA-dependent protein kinase correlates with radiation resistance in oral squamous cell carcinoma

    International Nuclear Information System (INIS)

    Shintani, Satoru; Mihara, Mariko; Li, Chunnan; Nakahara Yuuji; Hino, Satoshi; Nakashiro, Koh-ichi; Hamakawa, Hiroyuki

    2003-01-01

    DNA-PK is a nuclear protein with serine/threonine kinase activity and forms a complex consisting of the DNA-PKcs and a heterodimer of Ku70 and Ku80 proteins. Recent laboratory experiments have demonstrated that the DNA-PK complex formation is one of the major pathways by which mammalian cells respond to DNA double-strand breaks induced by ionizing radiation. In this study, we evaluated the relationship between expression levels of DNA-PKcs, Ku70 and Ku80 proteins and radiation sensitivity in oral squamous cell carcinoma (OSCC) cell lines and in OSCC patients treated with preoperative radiation therapy. The OSCC cell lines greatly differed in their response to irradiation, as assessed by a standard colony formation assay. However, the expression levels of the DNA-PK complex proteins were all similar, and there was no association between the magnitude of their expression and the tumor radiation sensitivity. Expression of DNA-PK complex proteins increased after radiation treatment, and the increased values correlated with the tumor radiation resistance. Expression of DNA-PKcs and Ku70 after irradiation was increased in the surviving cells of OSCC tissues irradiated preoperatively. These results suggest that up-regulation of DNA-PK complex protein, especially DNA-PKcs, after radiation treatment correlates to radiation resistance. DNA-PKcs might be a molecular target for a novel radiation sensitization therapy of OSCC. (author)

  15. Human genetic marker for resistance to radiations and chemicals. 1998 annual progress report

    International Nuclear Information System (INIS)

    Lieberman, H.B.

    1998-01-01

    'The broad objective of the project is to understand the molecular basis for the response of cells to radiations and chemicals, with the pragmatic goal of being able to identify human subpopulations that are exceptionally sensitive to DNA damaging agents. The project focuses on HRAD9, a human orthologue of the fission yeast Schizosaccharomyces pombe gene rad9. S. pombe rad9::ura4+ mutant cells are highly sensitive to ionizing radiation, UV and many chemicals, such as the DNA synthesis inhibitor hydroxyurea. They also lack the ability to delay cycling transiently in S phase or in G2 following a block in DNA replication or after incurring DNA damage, respectively -i.e., they lack checkpoint controls. The attempt by mutant cells to progress through mitosis in the absence of fully intact DNA accounts at least in part for their sensitivity to DNA damaging agents. Cells bearing rad9::ura4+ also aberrantly regulate UVDE, an enzyme that participates in a secondary DNA excision repair pathway. The key role played by S. pombe rad9 in promoting resistance to chemicals and radiations suggests that the evolutionarily conserved human cognate also has important functions in mammals. The first set of aims in this proposal centers on characterizing the structure and expression of HRAD9, to assess structure/function relationships and potentially link protein activity to a specific tissue. The next set of aims focuses on determining the role of HRAD9 in radio/chemoresponsiveness and cancer.'

  16. Supplementary Material for: Mycobacterium tuberculosis whole genome sequencing and protein structure modelling provides insights into anti-tuberculosis drug resistance

    KAUST Repository

    Phelan, Jody; Coll, Francesc; McNerney, Ruth; Ascher, David; Pires, Douglas; Furnham, Nick; Coeck, Nele; Hill-Cawthorne, Grant; Nair, Mridul; Mallard, Kim; Ramsay, Andrew; Campino, Susana; Hibberd, Martin; Pain, Arnab; Rigouts, Leen; Clark, Taane

    2016-01-01

    Abstract Background Combating the spread of drug resistant tuberculosis is a global health priority. Whole genome association studies are being applied to identify genetic determinants of resistance to anti-tuberculosis drugs. Protein structure

  17. SU-C-303-01: Activation-Induced Cytidine Deaminase Confers Cancer Resistance to Radiation Therapy

    International Nuclear Information System (INIS)

    Yi, S; La Count, S; Liu, J; Bai, X; Lu, L

    2015-01-01

    Purpose: To study the role of activation-induced cytidine deaminase (AID) in malignant cell resistance to radiation therapy. Methods: We first developed several small devices that could be used to adopt radiation beams from clinical high dose rate brachy therapy (HDR) or linac-based megavoltage machines to perform pre-clinical cell and mouse experiments. Then we used these devices to deliver radiation to AID-positive and AID-silenced cancer cells or tumors formed by these cells in mice. Cells and mice bearing tumors received the same dose under the same experimental conditions. For cells, we observed the apoptosis and the cell survival rate over time. For mice bearing tumors, we measured and recorded the tumor sizes every other day for 4 weeks. Results: For cell experiments, we found that the AID-positive cells underwent much less apoptosis compared with AID-silenced cells upon radiation. And for mouse experiments, we found that AID-positive tumors grew significantly faster than the AID-silenced tumors despite of receiving the same doses of radiation. Conclusion: Our study suggests that AID may confer cancer resistance to radiation therapy, and AID may be a significant biomarker predicting cancer resistance to radiation therapy for certain cancer types

  18. The Survival and Resistance of Halobacterium salinarum NRC-1, Halococcus hamelinensis, and Halococcus morrhuae to Simulated Outer Space Solar Radiation.

    Science.gov (United States)

    Leuko, S; Domingos, C; Parpart, A; Reitz, G; Rettberg, P

    2015-11-01

    Solar radiation is among the most prominent stress factors organisms face during space travel and possibly on other planets. Our analysis of three different halophilic archaea, namely Halobacterium salinarum NRC-1, Halococcus morrhuae, and Halococcus hamelinensis, which were exposed to simulated solar radiation in either dried or liquid state, showed tremendous differences in tolerance and survivability. We found that Hcc. hamelinensis is not able to withstand high fluences of simulated solar radiation compared to the other tested organisms. These results can be correlated to significant differences in genomic integrity following exposure, as visualized by random amplified polymorphic DNA (RAPD)-PCR. In contrast to the other two tested strains, Hcc. hamelinensis accumulates compatible solutes such as trehalose for osmoprotection. The addition of 100 mM trehalose to the growth medium of Hcc. hamelinensis improved its survivability following exposure. Exposure of cells in liquid at different temperatures suggests that Hbt. salinarum NRC-1 is actively repairing cellular and DNA damage during exposure, whereas Hcc. morrhuae exhibits no difference in survival. For Hcc. morrhuae, the high resistance against simulated solar radiation may be explained with the formation of cell clusters. Our experiments showed that these clusters shield cells on the inside against simulated solar radiation, which results in better survival rates at higher fluences when compared to Hbt. salinarum NRC-1 and Hcc. hamelinensis. Overall, this study shows that some halophilic archaea are highly resistant to simulated solar radiation and that they are of high astrobiological significance. Halophiles-Solar radiation-Stress resistance-Survival.

  19. BAD knockout provides metabolic seizure resistance in a genetic model of epilepsy with sudden unexplained death in epilepsy.

    Science.gov (United States)

    Foley, Jeannine; Burnham, Veronica; Tedoldi, Meghan; Danial, Nika N; Yellen, Gary

    2018-01-01

    Metabolic alteration, either through the ketogenic diet (KD) or by genetic alteration of the BAD protein, can produce seizure protection in acute chemoconvulsant models of epilepsy. To assess the seizure-protective role of knocking out (KO) the Bad gene in a chronic epilepsy model, we used the Kcna1 -/- model of epilepsy, which displays progressively increased seizure severity and recapitulates the early death seen in sudden unexplained death in epilepsy (SUDEP). Beginning on postnatal day 24 (P24), we continuously video monitored Kcna1 -/- and Kcna1 -/- Bad -/- double knockout mice to assess survival and seizure severity. We found that Kcna1 -/- Bad -/- mice outlived Kcna1 -/- mice by approximately 2 weeks. Kcna1 -/- Bad -/- mice also spent significantly less time in seizure than Kcna1 -/- mice on P24 and the day of death, showing that BadKO provides seizure resistance in a genetic model of chronic epilepsy. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

  20. Homozygous mutations in the Fhit gene results in resistance to ionizing radiation and inhibition of apoptosis

    International Nuclear Information System (INIS)

    Turner, B.C.; Potoczek, M.B.; Ottey, M.; Croce, C.M.; Huebner, K.

    2001-01-01

    radiation compared to parental mammalian cells expressing wild-type Fhit protein. Finally, we demonstrated that breast tumors from breast cancer patients with local breast tumor recurrences following breast conserving therapy more often lacked immunhistochemical detection of Fhit protein compared to tumors from breast cancer patients without local breast cancer recurrence (p=0.02). Interestingly, the adjacent benign regions of these sections contained similar levels of Fhit protein expression suggesting that a somatic alteration is critical in the clinical resistance to ionizing radiation observed in these patients. Apoptotic pathways regulating the aberrant response to DNA damage-induced apoptosis in Fhit knock-out cells are currently being studied. Conclusion: Mouse epithelial cells containing homozygous Fhit mutations are resistant to single fraction low and high dose ionizing radiation with decreased levels of radiation-induced apoptotic cell death. Breast tumors from women with local breast cancer recurrence following breast conserving therapy have low levels of Fhit protein. These findings may have important biologic and treatment implications including those for cancer patients with tumors having mutations in Fhit and suggest that treatment with ionizing radiation in these patients may not result in optimal responses

  1. Provider perspectives on drug-resistant tuberculosis and human immunodeficiency virus care in South Africa: a qualitative case study.

    Science.gov (United States)

    Daftary, A; Padayatchi, N

    2016-11-01

    To examine influences on health care workers' (HCWs') capacity to deliver health care for multi- and/or extensively drug-resistant tuberculosis (MDR/XDR-TB) and human immunodeficiency virus (HIV) infection in South Africa. Qualitative data were collected via group and individual interviews with a purposive sample of 17 HCWs at a centralised, tertiary TB facility and analysed using grounded theory. Four themes were identified: 1) personal infection control practices among HCWs may be weakened by a workplace culture comprising low motivation, disparate risk perceptions and practices across workforce hierarchies, physical discomfort, and problems managing patients with treatment-induced hearing loss. 2) Patient-provider interactions are likely stronger among nurses, and in HIV vs. MDR/XDR-TB service delivery, due to greater attention to patient empowerment and support. Stigma associated with MDR/XDR-TB, considered worse than HIV, may be perpetuated within non-specialised facilities less familiar with MDR/XDR-TB. 3) HCWs who struggle with the daily tedium of MDR/XDR-TB treatment supervision are becoming increasingly supportive of treatment literacy and self-administration. 4) Effective integration of HIV and MDR/XDR-TB services may be impeded by administrative restrictions, workplace norms and provider mindsets. Comprehensive, decentralised management of MDR/XDR-TB and HIV coinfection requires the creation of patient-provider trust and treatment literacy in MDR/XDR-TB programmes, and defying workplace norms that could provoke nosocomial TB exposure and fragmented service provision.

  2. Internet-based ICRP resource for healthcare providers on the risks and benefits of medical imaging that uses ionising radiation.

    Science.gov (United States)

    Demeter, S; Applegate, K E; Perez, M

    2016-06-01

    The purpose of the International Commission on Radiological Protection (ICRP) Committee 3 Working Party was to update the 2001 web-based module 'Radiation and your patient: a guide for medical practitioners' from ICRP. The key elements of this task were: to clearly identify the target audience (such as healthcare providers with an emphasis on primary care); to review other reputable sources of information; and to succinctly publish the contribution made by ICRP to the various topics. A 'question-and-answer' format addressing practical topics was adopted. These topics included benefits and risks of imaging using ionising radiation in common medical situations, as well as pertaining to specific populations such as pregnant, breast-feeding, and paediatric patients. In general, the benefits of medical imaging and related procedures far outweigh the potential risks associated with ionising radiation exposure. However, it is still important to ensure that the examinations are clinically justified, that the procedure is optimised to deliver the lowest dose commensurate with the medical purpose, and that consideration is given to diagnostic reference levels for particular classes of examinations. © The International Society for Prosthetics and Orthotics.

  3. Genomic analysis of globally diverse Mycobacterium tuberculosis strains provides insights into emergence and spread of multidrug resistance

    Science.gov (United States)

    Manson, Abigail L.; Cohen, Keira A.; Abeel, Thomas; Desjardins, Christopher A.; Armstrong, Derek T.; Barry, Clifton E.; Brand, Jeannette; Chapman, Sinéad B.; Cho, Sang-Nae; Gabrielian, Andrei; Gomez, James; Jodals, Andreea M.; Joloba, Moses; Jureen, Pontus; Lee, Jong Seok; Malinga, Lesibana; Maiga, Mamoudou; Nordenberg, Dale; Noroc, Ecaterina; Romancenco, Elena; Salazar, Alex; Ssengooba, Willy; Velayati, A. A.; Winglee, Kathryn; Zalutskaya, Aksana; Via, Laura E.; Cassell, Gail H.; Dorman, Susan E.; Ellner, Jerrold; Farnia, Parissa; Galagan, James E.; Rosenthal, Alex; Crudu, Valeriu; Homorodean, Daniela; Hsueh, Po-Ren; Narayanan, Sujatha; Pym, Alexander S.; Skrahina, Alena; Swaminathan, Soumya; Van der Walt, Martie; Alland, David; Bishai, William R.; Cohen, Ted; Hoffner, Sven; Birren, Bruce W.; Earl, Ashlee M.

    2017-01-01

    Multidrug-resistant tuberculosis (MDR-TB), caused by drug resistant strains of Mycobacterium tuberculosis, is an increasingly serious problem worldwide. In this study, we examined a dataset of 5,310 M. tuberculosis whole genome sequences from five continents. Despite great diversity with respect to geographic point of isolation, genetic background and drug resistance, patterns of drug resistance emergence were conserved globally. We have identified harbinger mutations that often precede MDR. In particular, the katG S315T mutation, conferring resistance to isoniazid, overwhelmingly arose before rifampicin resistance across all lineages, geographic regions, and time periods. Molecular diagnostics that include markers for rifampicin resistance alone will be insufficient to identify pre-MDR strains. Incorporating knowledge of pre-MDR polymorphisms, particularly katG S315, into molecular diagnostics will enable targeted treatment of patients with pre-MDR-TB to prevent further development of MDR-TB. PMID:28092681

  4. Radiation enhanced copper clustering processes in Fe-Cu alloys during electron and ion irradiations as measured by electrical resistivity

    International Nuclear Information System (INIS)

    Ishino, S.; Chimi, Y.; Bagiyono; Tobita, T.; Ishikawa, N.; Suzuki, M.; Iwase, A.

    2003-01-01

    To study the mechanism of radiation-enhanced clustering of copper atoms in Fe-Cu alloys, in situ electrical resistivity measurements are performed during irradiation with 100 MeV carbon ions and with 2 MeV electrons at 300 K. Two kinds of highly pure Fe-Cu alloys with Cu content of 0.02 and 0.6 wt% are used. The results are summarized as follows: - Although there is a steep initial resistivity increase below about 10 μdpa, the resistivity steadily decreases after this initial transient in Fe-0.6wt%Cu alloy, while in Fe-0.02wt%Cu alloy, the resistivity either decreases slowly or stays almost constant. The rate of change in resistivity depends on copper concentration. - The rate of change in resistivity per dpa is larger for electron irradiation than for ion irradiation. - Change in dose rate from 10 -8 to 10 -9 dpa/s slightly enhances the rate of resistivity change per dpa. The decrease in resistivity with dose is considered to be due to clustering or precipitation of copper atoms. The initial abrupt increase in resistivity is too large to be accounted for by initial introduction of point defects before copper clustering. Tentatively the phenomenon is explained as due to the formation of embryos of copper precipitates with a large strain field around them. Quantitative evaluation of the results using resistivity contribution of a unit concentration of Frenkel pairs and that of copper atoms gives an important conclusion that more than one copper atom are removed from solid solution by one Frenkel pair. The clustering efficiency is surprisingly high in the present case compared with the ordinary radiation-induced or radiation-enhanced precipitation processes

  5. Effect of solar radiation on multidrug resistant E. coli strains and antibiotic mixture photodegradation in wastewater polluted stream.

    Science.gov (United States)

    Rizzo, L; Fiorentino, A; Anselmo, A

    2012-06-15

    The effect of solar radiation on the inactivation of multidrug resistant Escherichia coli (MDR) strains selected from an urban wastewater treatment plant (UWWTP) effluent and the change of their resistance to a mixture of three antibiotics (evaluated in terms of minimum inhibit concentration (MIC)) in wastewater polluted stream were investigated. The solar photodegradation of the mixture of the three target antibiotics (amoxicillin (AMX), ciprofloxacin (CPX), and sulfamethoxazole (SMZ)) was also evaluated. Additionally, since UWWTP effluents are possible sources of antibiotics and antibiotic resistant bacteria, the disinfection by conventional chlorination process of the UWWTP effluent inoculated with MDR strains was investigated too. Solar radiation poorly affected the inactivation of the two selected antibiotic resistant E. coli strains (40 and 60% after 180 min irradiation). Moreover, solar radiation did not affect strain resistance to AMX (MIC>256 μg/mL) and SMZ (MIC>1024 μg/mL), but affected resistance of the lower resistance strain to CPX (MIC decreased by 33% but only after 180 min of irradiation). Chlorination of wastewater sample strongly decreased the number of the two selected antibiotic resistant E. coli strains (99.667 and 99.999%), after 60 min of contact time at 2.0 mg/L initial chlorine concentration, but the resistance of survived colonies to antibiotics was unchanged. Finally, the solar photodegradation rate of the antibiotic mixture (1mg/L initial concentration respectively) resulted in the following order (half-life time): CPX (t(1/2)=24 min)risk of the development of resistance to SMZ in surface water is significantly higher compared to CPX and AMX. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Development of the radiation-resistant strain of Moraxella osloensis and effect of penicillin G on its growth

    International Nuclear Information System (INIS)

    Lim, Sangyong; Yun, Hyejeong; Joe, Minho; Kim, Dongho

    2009-01-01

    A series of repeated exposures to γ-radiation with intervening outgrowth of survivors was used to develop radioresistant cultures of Moraxella osloensis that have been recognized as potential pathogenic microorganism. The D 10 value of the radiation-resistant strain, 5.903±0.006 kGy, was increased by four-fold compared to the parent wild-type strain, 1.637±0.004 kGy. Since most strains of M. osloensis are sensitive to penicillin, we have surveyed the sensitivity of radiation-resistant strain to this antibiotic. When the optical density was monitored after the addition of penicillin G, the radioresistant strain appeared to be more resistant to only a low concentration of penicillin G (0.5 U/ml) than the parent strain. Interestingly, however, there was no apparent difference in the number of viable cells between both strains. Scanning electron microscope data showed that the resistance cells were generally larger than the parent cells, suggesting that this increase in size may cause a higher optical density of radioresistant cells. In conclusion, radiation mutation does not affect the penicillin resistance of M. osloensis.

  7. Development of the radiation-resistant strain of Moraxella osloensis and effect of penicillin G on its growth

    Science.gov (United States)

    Lim, Sangyong; Yun, Hyejeong; Joe, Minho; Kim, Dongho

    2009-07-01

    A series of repeated exposures to γ-radiation with intervening outgrowth of survivors was used to develop radioresistant cultures of Moraxella osloensis that have been recognized as potential pathogenic microorganism. The D10 value of the radiation-resistant strain, 5.903±0.006 kGy, was increased by four-fold compared to the parent wild-type strain, 1.637±0.004 kGy. Since most strains of M. osloensis are sensitive to penicillin, we have surveyed the sensitivity of radiation-resistant strain to this antibiotic. When the optical density was monitored after the addition of penicillin G, the radioresistant strain appeared to be more resistant to only a low concentration of penicillin G (0.5 U/ml) than the parent strain. Interestingly, however, there was no apparent difference in the number of viable cells between both strains. Scanning electron microscope data showed that the resistance cells were generally larger than the parent cells, suggesting that this increase in size may cause a higher optical density of radioresistant cells. In conclusion, radiation mutation does not affect the penicillin resistance of M. osloensis.

  8. Development of the radiation-resistant strain of Moraxella osloensis and effect of penicillin G on its growth

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Sangyong; Yun, Hyejeong; Joe, Minho [Radiation Research Division for Biotechnology, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Kim, Dongho [Radiation Research Division for Biotechnology, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of)], E-mail: fungikim@kaeri.re.kr

    2009-07-15

    A series of repeated exposures to {gamma}-radiation with intervening outgrowth of survivors was used to develop radioresistant cultures of Moraxella osloensis that have been recognized as potential pathogenic microorganism. The D{sub 10} value of the radiation-resistant strain, 5.903{+-}0.006 kGy, was increased by four-fold compared to the parent wild-type strain, 1.637{+-}0.004 kGy. Since most strains of M. osloensis are sensitive to penicillin, we have surveyed the sensitivity of radiation-resistant strain to this antibiotic. When the optical density was monitored after the addition of penicillin G, the radioresistant strain appeared to be more resistant to only a low concentration of penicillin G (0.5 U/ml) than the parent strain. Interestingly, however, there was no apparent difference in the number of viable cells between both strains. Scanning electron microscope data showed that the resistance cells were generally larger than the parent cells, suggesting that this increase in size may cause a higher optical density of radioresistant cells. In conclusion, radiation mutation does not affect the penicillin resistance of M. osloensis.

  9. Multiplicity of genome equivalents in the radiation-resistant bacterium Micrococcus radiodurans.

    Science.gov (United States)

    Hansen, M T

    1978-01-01

    The complexity of the genome of Micrococcus radiodurans was determined to be (2.0 +/- 0.3) X 10(9) daltons by DNA renaturation kinetics. The number of genome equivalents of DNA per cell was calculated from the complexity and the content of DNA. A lower limit of four genome equivalents per cell was approached with decreasing growth rate. Thus, no haploid stage appeared to be realized in this organism. The replication time was estimated from the kinetics and amount of residual DNA synthesis after inhibiting initiation of new rounds of replication. From this, the redundancy of terminal genetic markers was calculated to vary with growth rate from four to approximately eight copies per cell. All genetic material, including the least abundant, is thus multiply represented in each cell. The potential significance of the maintenance in each cell of multiple gene copies is discussed in relation to the extreme radiation resistance of M. radiodurans. PMID:649572

  10. Recent progress and tests of radiation resistant impregnation materials for Nb3Sn coils

    Science.gov (United States)

    Bossert, R.; Krave, S.; Ambrosio, G.; Andreev, N.; Chlachidze, G.; Nobrega, A.; Novitski, I.; Yu, M.; Zlobin, A. V.

    2014-01-01

    Fermilab is collaborating with Lawrence Berkeley National Laboratory (LBNL) and Brookhaven National Laboratory (BNL) (US-LARP collaboration) to develop a large-aperture Nb3Sn superconducting quadrupole for the Large Hadron Collider (LHC) luminosity upgrade. An important component of this work is the development of materials that are sufficiently radiation resistant for use in critical areas of the upgrade. This paper describes recent progress in characterization of materials, including the baseline CTD101K epoxy, cyanate ester blends, and Matrimid 5292, a bismaleimide-based system. Structural properties of "ten stacks" of cable impregnated with these materials are tested at room and cryogenic temperatures and compared to the baseline CT-101K. Experience with potting 1 and 2 meter long coils with Matrimid 5292 are described. Test results of a single 1-m coil impregnated with Matrimid 5292 are reported and compared to similar coils impregnated with the traditional epoxy.

  11. Cyanobacteria: photosynthetic factories combining biodiversity, radiation resistance, and genetics to facilitate drug discovery.

    Science.gov (United States)

    Cassier-Chauvat, Corinne; Dive, Vincent; Chauvat, Franck

    2017-02-01

    Cyanobacteria are ancient, abundant, and widely diverse photosynthetic prokaryotes, which are viewed as promising cell factories for the ecologically responsible production of chemicals. Natural cyanobacteria synthesize a vast array of biologically active (secondary) metabolites with great potential for human health, while a few genetic models can be engineered for the (low level) production of biofuels. Recently, genome sequencing and mining has revealed that natural cyanobacteria have the capacity to produce many more secondary metabolites than have been characterized. The corresponding panoply of enzymes (polyketide synthases and non-ribosomal peptide synthases) of interest for synthetic biology can still be increased through gene manipulations with the tools available for the few genetically manipulable strains. In this review, we propose to exploit the metabolic diversity and radiation resistance of cyanobacteria, and when required the genetics of model strains, for the production and radioactive ( 14 C) labeling of bioactive products, in order to facilitate the screening for new drugs.

  12. ETS Gene Fusions as Predictive Biomarkers of Resistance to Radiation Therapy for Prostate Cancer

    Science.gov (United States)

    2016-05-01

    phenotype  in   preclinical  models  of  prostate  cancer,  2)  to  explore  the  mechanism  of  interaction  between   ERG  (the  predominant  ETS...established  this  axis  as  a  potential  therapeutic   target.         15. SUBJECT  TERMS Prostate cancer, ETS gene fusions, ERG , radiation resistance, DNA...interaction  between   ERG   (the   predominant   ETS   gene   fusion   product)   and   the   DNA   repair   protein   DNA-­PK,   and   3)   to

  13. Radiation-resistant composite scintillators based on GSO and GPS grains

    Energy Technology Data Exchange (ETDEWEB)

    Boyarintsev, A.Yu. [Institute for Scintillation Materials, National Academy of Sciences of Ukraine, 60 Nauki Avenue, 61001 Kharkiv (Ukraine); Galunov, N.Z. [Institute for Scintillation Materials, National Academy of Sciences of Ukraine, 60 Nauki Avenue, 61001 Kharkiv (Ukraine); V.N. Karasin Kharkov National University, 4 Svobody Sq., 61022 Kharkiv (Ukraine); Gerasymov, Ia.V.; Karavaeva, N.L. [Institute for Scintillation Materials, National Academy of Sciences of Ukraine, 60 Nauki Avenue, 61001 Kharkiv (Ukraine); Krech, A.V., E-mail: AntonKrech@gmail.com [Institute for Scintillation Materials, National Academy of Sciences of Ukraine, 60 Nauki Avenue, 61001 Kharkiv (Ukraine); Levchuk, L.G.; Popov, V.F. [National Science Center, Kharkov Institute of Physics and Technology, 1 Akademicheskaya Str., 61108 Kharkiv (Ukraine); Sidletskiy, O.Ts. [Institute for Scintillation Materials, National Academy of Sciences of Ukraine, 60 Nauki Avenue, 61001 Kharkiv (Ukraine); Sorokin, P.V. [National Science Center, Kharkov Institute of Physics and Technology, 1 Akademicheskaya Str., 61108 Kharkiv (Ukraine); Tarasenko, O.A. [Institute for Scintillation Materials, National Academy of Sciences of Ukraine, 60 Nauki Avenue, 61001 Kharkiv (Ukraine)

    2017-01-01

    The effect of irradiation on the scintillation light output, optical transmittance, and luminescent spectra of composite scintillators based on grains of single crystals Gd{sub 2}SiO{sub 5}:Ce (GSO) and Gd{sub 2}Si{sub 2}O{sub 7}:Ce (GPS) is studied. The dielectric gel Sylgard-184 is the base and the binder for the grains inside the composite scintillator. The paper presents and analyzes the results obtained for the scintillators exposed by 10 MeV electrons from the linear electron accelerator at room temperature. The exposure doses D≤250 Mrad. The dose rate is 0.2 or 1500 Mrad/h. The study has shown that the composite scintillators based on the grains of GSO and GPS are radiation-resistant over the range of the irradiation.

  14. High conversion efficiency and high radiation resistance InP solar cells

    International Nuclear Information System (INIS)

    Yamamoto, Akio; Itoh, Yoshio; Yamaguchi, Masafumi

    1987-01-01

    The fabrication of homojunction InP solar cells has been studied using impurity thermal diffusion, organometallic vapor phase epitaxy (OMVPE) and liquid phase epitaxy (LPE), and is discussed in this paper. Conversion efficiencies exceeding 20 % (AM1.5) are attained. These are the most efficient results ever reported for InP cells, and are comparable to those for GaAs cells. Electron and γ-ray irradiation studies have also been conducted for fabricated InP cells. The InP cells were found to have higher radiation resistance than GaAs cells. Through these studies, it has been demonstrated that the InP cells have excellent potential for space application. (author)

  15. Recent progress and tests of radiation resistant impregnation materials for Nb3Sn coils

    International Nuclear Information System (INIS)

    Bossert, R.; Krave, S.; Ambrosio, G.; Andreev, N.; Chlachidze, G.; Nobrega, A.; Novitski, I.; Yu, M.; Zlobin, A. V.

    2014-01-01

    Fermilab is collaborating with Lawrence Berkeley National Laboratory (LBNL) and Brookhaven National Laboratory (BNL) (US-LARP collaboration) to develop a large-aperture Nb 3 Sn superconducting quadrupole for the Large Hadron Collider (LHC) luminosity upgrade. An important component of this work is the development of materials that are sufficiently radiation resistant for use in critical areas of the upgrade. This paper describes recent progress in characterization of materials, including the baseline CTD101K epoxy, cyanate ester blends, and Matrimid 5292, a bismaleimide-based system. Structural properties of “ten stacks” of cable impregnated with these materials are tested at room and cryogenic temperatures and compared to the baseline CT-101K. Experience with potting 1 and 2 meter long coils with Matrimid 5292 are described. Test results of a single 1-m coil impregnated with Matrimid 5292 are reported and compared to similar coils impregnated with the traditional epoxy

  16. Evaluation of resistance of diamond-like carbon coating to the corpuscular radiation in outer space conditions

    Science.gov (United States)

    Tomilova, Elizaveta; Bashkov, Valeriy; Mikhalev, Pavel; Fedorchenko, Alexander; Volkova, Yana

    2015-02-01

    The purpose of this work was to research the resistance of thin coatings to the effects of corpuscular radiation, as well as evaluation speed etching of diamond-like films with different content of diamond phase. There were two samples of monocrystalline silicon with DLC coating. To evaluate the resistance, two groups of grooves were etched on each sample. The depth was then measured to calculate a relative etching ratio of DLC coating. The resistance was determined to be four times that of silicon.

  17. Irradiation tests of a small-sized motor with radiation resistance

    International Nuclear Information System (INIS)

    Nakamichi, M.; Ishitsuka, E.; Shimakawa, S.; Kan, S.

    2007-01-01

    In the Test Blanket Module (TBM) of the International Thermonuclear Experimental Reactor (ITER), tritium production and release behavior will be studied using neutrons from fusion reactions, as the blanket development for a demonstration (DEMO) reactor. For development of the TBM, in-pile functional tests are planned, including an integrated irradiation experiment of a fusion blanket mock-up for pulsed operation simulating the ITER operation mode, using the Japan Materials Testing Reactor (JMTR) of Japan Atomic Energy Agency (JAEA).Due to be installed in an irradiation rig, a small-sized motor has to be developed for rotating a neutron absorber with a window to realize the simulated pulse operation. Since degradation of materials of the motor may be caused by radiation damage due to neutron and gamma-ray irradiation, it is important to examine the soundness of the motor materials under the neutron and gamma irradiation.In the present study, a small-sized motor with increased radiation resistance was developed as follows. A design of a commercial alternate current (AC) servomotor was adopted in the base structure, and some components of the motor were replaced by those made of radiation-proof materials, through elimination of organic materials. Polyester-coated wire for field coil and epoxy for fixed resin were replaced by polyimide-coated wire and polysiloxane filled with MgO and Al 2 O 3 , respectively. Furthermore, inorganic lubricant (Mo-based coating of 4 micro meter in thickness) was treated on the surface of a gear, instead of organic (polyphenylether) oil.Radiation-induced degradation of the components of the developed small-sized motor was examined using JMTR and the Japan Research Reactor No.4 (JRR-4) of JAEA. The motor was operating normally up to a gamma-ray dose of 7 x 10 8 Gy, a fast neutron (E>1 MeV) fluence of 2 x 10 21 m -2 and a thermal neutron (E 22 m -2 . The irradiated gamma-ray dose for this motor is about 700 times as high as the operation

  18. Radiation resistant, decontaminable and sealing jointing compounds for application in nuclear facilities

    International Nuclear Information System (INIS)

    Kunze, S.

    1991-09-01

    The sealing jointing compounds applied in practice and already examined for decontaminability will be presented here. Solvent-free sealing compounds, emulsifiable in water, with low molecular epoxy resins as binders, quite a number of curing versions, and little hygroscopic filler mixtures adapted in grain size have been tested with a view to ceramic tile jointing in nuclear facilities. The sealing compounds were examined before and after exposure to gamma irradiation (300 KGy energy dose) for decontaminability, color, gloss and resistance to decontaminants. Out of fourteeen compounds exhaustively investigated ten are very well decontaminable and four well decontaminable. After exposure to radiation no or only minor changes in color and gloss, respectively, were observed. Visible changes such as cracking, bubbles, etc. were not found and the resistance to decontaminants was neither affected. It has even been possible to replace in the well decontaminable sealing compounds developed until now part of the epoxy resin binder with elasticizing components such as Thiokol which is very important as a base material for sealing compounds in the construction industry, but difficult to decontaminate. (orig.) [de

  19. Ionizing-radiation resistance in the desiccation-tolerant cyanobacterium Chroococcidiopsis

    Science.gov (United States)

    Billi, D.; Friedmann, E. I.; Hofer, K. G.; Caiola, M. G.; Ocampo-Friedmann, R.

    2000-01-01

    The effect of X-ray irradiation on cell survival, induction, and repair of DNA damage was studied by using 10 Chroococcidiopsis strains isolated from desert and hypersaline environments. After exposure to 2.5 kGy, the percentages of survival for the strains ranged from 80 to 35%. In the four most resistant strains, the levels of survival were reduced by 1 or 2 orders of magnitude after irradiation with 5 kGy; viable cells were recovered after exposure to 15 kGy but not after exposure to 20 kGy. The severe DNA damage evident after exposure to 2.5 kGy was repaired within 3 h, and the severe DNA damage evident after exposure to 5 kGy was repaired within 24 h. The increase in trichloroacetic acid-precipitable radioactivity in the culture supernatant after irradiation with 2.5 kGy might have been due to cell lysis and/or an excision process involved in DNA repair. The radiation resistance of Chroococcidiopsis strains may reflect the ability of these cyanobacteria to survive prolonged desiccation through efficient repair of the DNA damage that accumulates during dehydration.

  20. FtsZ from radiation resistant bacterium Deinococcus radiodurans is different from its characterized homologues

    International Nuclear Information System (INIS)

    Mehta, Kruti P.; Misra, H.S.

    2012-01-01

    Polymerization/depolymerization dynamics of FtsZ and its GTPase activity are interdependent and the regulation of these processes determines the growth rate in a bacterium. Deinococcus radiodurans R1 that is best known for its extraordinary radiation resistance and efficient DNA double strand break repair is a comparatively slow growing bacterium and its growth gets arrested in response to gamma radiation. Mechanisms of cell division and its regulation under gamma stressed growth condition would be worth investigating. Genome of this bacterium encodes at least all the known components of divisome. Recombinant FtsZ of D. radiodurans (drFtsZ) preferred Mg 2+ for its GTPase activity. Relatively a very low GTPase activity was observed in presence of Mn 2+ , Co 2+ and Ni 2+ while release of inorganic phosphate could not be detected in presence of other divalent ions including Ca 2+ . GTPase activity of drFtsZ was lower than E. coli but higher than Mycobacterium and it required both Mg 2+ and GTP for its polymerization. Its GTPase activity did not increase with increasing concentration of Mg 2+ and correlates with the bundling of protofilaments. Results obtained from transmission electron microscopy and sedimentation analysis supported the reciprocal correlation of polymerization/depolymerization with the levels of GTPase activity. Dynamic light scattering in presence of 5mM or higher concentration of Mg 2+ and Mn 2 showed a characteristic cyclic change in light scattering without addition of extra metal ion or GTP

  1. The improvement for fire retardant and radiation resistance characteristics of chloroprene rubber

    Energy Technology Data Exchange (ETDEWEB)

    Kim, K. Y.; Lee, C.; Kim, P. J.; Kim, J. H

    2004-04-01

    In the report, in order to improve the fire retardancy better Chloroprene Rubber (CR) after adding each fixed amount of inorganic metallic hydroxide, and then compared and assessed fire retardancy with electrical properties and mechanical properties we intended to choose the most excellent additives. Also according to Co{sup 60} {gamma}-ray irradiation, we compared electrical, echanical and fire retardant characteristics to analyse to have the additives of inorganic filler effect on CR's antirad characteristic. In result, CR containing inorganic additive, advanced considerably fire retardant characteristics, but seems to be tended to declined electrical and mechanical characteristics on the whole. In syntherically comparison, the specimen viewed the most excellent characteristics is CR containing Magnesium hydroxide. As to Co{sup 60} {gamma}-ray irradiated Chloroprene rubber containing inorganic additives, fire retardant characteristic are improved, but electrical and mechanical properties are deteriorated as a function of radiation dose. Comparing before irradiation and after irradiation, the best inorganic filler into CR consider Magnesium hydroxide. In this report, in case of adding 30 phr of inorganic filler to CR we observed fire retardancy and radiation resistance characteristics change in according to the kinds of additives, but the research for choosing the optimum amount of additives is considered to progress from now on as adjusting the amount of additives presented excellent characteristics.

  2. Characterization and radiation response of a heat-resistant variant of V79 cells

    International Nuclear Information System (INIS)

    Campbell, S.D.; Kruuv, J.; Lepock, J.R.

    1983-01-01

    A thermoresistant variant of the established cell line V79-S171-W1 was isolated after treatment with nitrosoguanidine and repeated heat treatments at 42.6 to 43 degrees C, and showed an enhanced ability to survive at 42.6, 43.5, and 44.5 degrees C. The rates of inactivation of the normal and heat-resistant lines differed by approximately a factor of 2 over this temperature range. This level of thermoresistance was stable for the first 80 doublings, but was lost by 120 doublings. This may have been due to a reversion to the normal V79 line since there was no continuous selection pressure and the thermoresistant variant, which was designated at HR7, had a longer average doubling time. Transient thermotolerance was induced in both the V79 and HR7 cells by a 10-min exposure to 44.5 degrees C. After 3 hr incubation at 37 degrees C, both cell lines had an identical sensitivity to further exposure to 44.5 degrees C. Thus the long-term thermoresistance of the HR7 cells may be due to a permanent induction of a low level of thermotolerance. The (ionizing) radiation survival curves and the ability to repair sublethal radiation damage were identical for the thermoresistant variant and the parent cell line

  3. High NOTCH activity induces radiation resistance in non small cell lung cancer

    International Nuclear Information System (INIS)

    Theys, Jan; Yahyanejad, Sanaz; Habets, Roger; Span, Paul; Dubois, Ludwig; Paesmans, Kim; Kattenbeld, Bo; Cleutjens, Jack; Groot, Arjan J.; Schuurbiers, Olga C.J.; Lambin, Philippe; Bussink, Jan; Vooijs, Marc

    2013-01-01

    Background and purpose: Patients with advanced NSCLC have survival rates <15%. The NOTCH pathway plays an important role during lung development and physiology but is often deregulated in lung cancer, making it a potential therapeutic target. We investigated NOTCH signaling in NSCLC and hypothesized that high NOTCH activity contributes to radiation resistance. Materials and methods: NOTCH signaling in NSCLC patient samples was investigated using quantitative RT-PCR. H460 NSCLC cells with either high or blocked NOTCH activity were generated and their radiation sensitivity monitored using clonogenic assays. In vivo, xenograft tumors were irradiated and response assessed using growth delay. Microenvironmental parameters were analyzed by immunohistochemistry. Results: Patients with high NOTCH activity in tumors showed significantly worse disease-free survival. In vitro, NOTCH activity did not affect the proliferation or intrinsic radiosensitivity of NSCLC cells. In contrast, xenografts with blocked NOTCH activity grew slower than wild type tumors. Tumors with high NOTCH activity grew significantly faster, were more hypoxic and showed a radioresistant phenotype. Conclusions: We demonstrate an important role for NOTCH in tumor growth and correlate high NOTCH activity with poor prognosis and radioresistance. Blocking NOTCH activity in NSCLC might be a promising intervention to improve outcome after radiotherapy

  4. X- and gamma-ray N+PP+ silicon detectors with high radiation resistance

    International Nuclear Information System (INIS)

    Petris, M.; Ruscu, R.; Moraru, R.; Cimpoca, V.

    1998-01-01

    We have investigated the use of p-type silicon detectors as starting material for X-and gamma-ray detectors because of several potential benefits it would bring: 1. high purity p-type silicon grown by the float-zone process exhibits better radial dopant uniformity than n-type float-zone silicon; 2. it is free of radiation damage due to the neutron transmutation doping process and behaves better in a radiation field because mainly acceptor like centers are created through the exposure and the bulk material type inversion does not occur as in the n-type silicon. But the p-type silicon, in combination with a passivating layer of silicon dioxide, leads to a more complex detector layout since the positive charge in the oxide causes an inversion in the surface layer under the silicon dioxide. Consequently, it would be expected that N + P diodes have a higher leakage current than P + N ones. All these facts have been demonstrated experimentally. These features set stringent requirements for the technology of p-type silicon detectors. Our work presents two new geometries and an improved technology for p-type high resistivity material to obtain low noise radiation detectors. Test structures were characterized before and after the gamma exposure with a cumulative dose in the range 10 4 - 5 x 10 6 rad ( 60 Co). Results indicate that proposed structures and their technology enable the development of reliable N + PP + silicon detectors. For some samples (0.8 - 12 mm 2 ), extremely low reverse currents were obtained and, in combination with a low noise charge preamplifier, the splitting of 241 Am X-ray lines was possible and also the Mn Kα line (5.9 keV) was extracted from the noise with a 1.9 keV FWHM at the room temperature. An experimental model of a nuclear probe based on these diodes was designed for X-ray detection applications. (authors)

  5. Radiation sources providing increased UVA/UVB ratios induce photoprotection dependent on the UVA dose in hairless mice.

    Science.gov (United States)

    Reeve, Vivienne E; Domanski, Diane; Slater, Michael

    2006-01-01

    In studies involving mice in which doses of UVA (320-400 nm) and UVB (290-320 nm) radiation were administered alone or combined sequentially, we observed a protective effect of UVA against UVB-induced erythema/edema and systemic suppression of contact hypersensitivity. The UVA immunoprotection was mediated by the induction of the stress enzyme heme oxygenase-1 (HO-1) in the skin, protection of the cutaneous Th1 cytokines interferon-gamma (IFN-gamma) and IL-12 and inhibition of the UVB-induced expression of the Th2 cytokine IL-10. In this study, we seek evidence for an immunological waveband interaction when UVA and UVB are administered concurrently to hairless mice as occurs during sunlight exposure in humans. A series of spectra providing varying ratios of UVA/UVB were developed, with the UVA ratio increased to approximately 3.5 times the UVA component in solar simulated UV (SSUV). We report that progressively increasing the UVA component of the radiation while maintaining a constant UVB dose resulted in a reduction of both the erythema/edema reaction and the degree of systemic immunosuppression, as measured as contact hypersensitivity. The UVA-enhanced immunoprotection was abrogated in mice treated with a specific HO enzyme inhibitor. UVA-enhanced radiation also upregulated the expression of cutaneous IFN-gamma and IL-12 and inhibited expression of both IL-6 and IL-10, compared with the activity of SSUV. The results were consistent with the previously characterized mechanisms of photoprotection by the UVA waveband alone and suggest that the UVA component of solar UV may have beneficial properties for humans.

  6. Dichromatic and monochromatic laser radiation effects on antibiotic resistance, biofilm formation, and division rate of Pantoea agglomerans

    Science.gov (United States)

    Thomé, A. M. C.; Souza, B. P.; Mendes, J. P. M.; Cardoso, A. F. R.; Soares, L. C.; Trajano, E. T. L.; Fonseca, A. S.

    2018-06-01

    Since infection is a common cause of delayed wound healing, it is important to understand the effect of low-level laser therapy (LLLT) in bacterial mechanisms. In this study we evaluated the effects of LLLT on antibiotic resistance, division rate, and biofilm formation of Pantoea agglomerans. P. agglomerans samples were isolated from human pressure injuries in humans and cultures were exposed to low-level monochromatic and simultaneous dichromatic laser radiation to study the susceptibility of an antimicrobial to ampicillin and piperacillin  +  tazobactam, quantification of areas of bacterial colonies, and biofilm formation of bacterial cells. Fluence, wavelength, and emission mode were used in the therapeutic protocols for wound healing. The data showed no changes in the areas of the colonies, but dichromatic laser radiation decreased biofilm formation, while a monochromatic red laser at low dose increased biofilm formation and infrared at high dose decreased antibiotic resistance to ampicillin. LLLT modulates antibiotic resistance and biofilm formation of P. agglomerans, but these depend on the laser irradiation parameters, since dichromatic laser radiation induces biological effects that differ from those induced by monochromatic laser radiation. Thus, simultaneous dichromatic low-level red and infrared lasers could be a new option for the treatment of infected wounds, reducing biofilm formation, without altering antibiotic resistance and the division rate of P. agglomerans cultures.

  7. Radiation resistance and comparative performance of ITO/InP and n/p InP homojunction solar cells

    International Nuclear Information System (INIS)

    Weinberg, I.; Swartz, C.K.; Hart, R.E. Jr.; Coutts, T.J.

    1988-09-01

    The radiation resistance of ITO/InP cells processed by DC magnetron sputtering is compared to that of standard n/p InP and GaAs homojunction cells. After 20 MeV proton irradiations, it is found that the radiation resistance of the present ITO/InP cell is comparable to that of the n/p homojunction InP cell and that both InP cell types have radiation resistance significantly greater than GaAs. The relatively lower radiation resistance, observed at higher fluence, for the InP cell with the deepest junction depth, is attributed to losses in the cells emitter region. Diode parameters obtained from I sub sc - V sub oc plots, data from surface Raman spectroscopy, and determinations of surface conductivity types are used to investigate the configuration of the ITO/InP cells. It is concluded that thesee latter cells are n/p homojunctions, the n-region consisting of a disordered layer at the oxide semiconductor

  8. Olympic weightlifting and plyometric training with children provides similar or greater performance improvements than traditional resistance training.

    Science.gov (United States)

    Chaouachi, Anis; Hammami, Raouf; Kaabi, Sofiene; Chamari, Karim; Drinkwater, Eric J; Behm, David G

    2014-06-01

    A number of organizations recommend that advanced resistance training (RT) techniques can be implemented with children. The objective of this study was to evaluate the effectiveness of Olympic-style weightlifting (OWL), plyometrics, and traditional RT programs with children. Sixty-three children (10-12 years) were randomly allocated to a 12-week control OWL, plyometric, or traditional RT program. Pre- and post-training tests included body mass index (BMI), sum of skinfolds, countermovement jump (CMJ), horizontal jump, balance, 5- and 20-m sprint times, isokinetic force and power at 60 and 300° · s(-1). Magnitude-based inferences were used to analyze the likelihood of an effect having a standardized (Cohen's) effect size exceeding 0.20. All interventions were generally superior to the control group. Olympic weightlifting was >80% likely to provide substantially better improvements than plyometric training for CMJ, horizontal jump, and 5- and 20-m sprint times, whereas >75% likely to substantially exceed traditional RT for balance and isokinetic power at 300° · s(-1). Plyometric training was >78% likely to elicit substantially better training adaptations than traditional RT for balance, isokinetic force at 60 and 300° · s(-1), isokinetic power at 300° · s(-1), and 5- and 20-m sprints. Traditional RT only exceeded plyometric training for BMI and isokinetic power at 60° · s(-1). Hence, OWL and plyometrics can provide similar or greater performance adaptations for children. It is recommended that any of the 3 training modalities can be implemented under professional supervision with proper training progressions to enhance training adaptations in children.

  9. Irradiation behavior of developed radiation resistance optical-fibers and observed optical radiation from their SiO2 cores under reactor irradiation

    International Nuclear Information System (INIS)

    Shikama, Tatsuo; Narui, Minoru; Kayano, Hideo; Kakuta, Tsunemi; Sagawa, Tsutomu; Sanada, Kazuo; Shamoto, Naoki; Uramoto, Toshimasa.

    1994-01-01

    Two kinds of optical fibers were irradiated in a fission reactor, JMTR(Japan Materials Testing Reactor), up to a 1.55x10 19 n/cm 2 fast neutron fluence and a 3.3x10 9 Gy ionizing dose at 370K. Optical transmission spectra were measured in the wavelength range of 450-1750nm, in-situ. Growth of strong optical absorption bands were observed in the range of wavelength shorter than 750nm. In the meantime, the fibers showed good radiation-resistance in the range of wavelength longer than 750nm. Optical radiations were observed from SiO 2 optical fibers under irradiation. A major part of the observed optical radiations is thought to be composed of broad optical radiation in the whole wavelength range studied in the present experiment. This broad optical radiation will be generated by the process of so-called Cerenkov radiation. Also, a sharp optical radiation peak was found at 1270nm on a F-doped fiber. This peak is thought to relate with doped Fluorine ions and ionizing gamma-ray irradiation. (author)

  10. Radiation Tolerance of Controlled Fusion Welds in High Temperature Oxidation Resistant FeCrAl Alloys

    Energy Technology Data Exchange (ETDEWEB)

    Gussev, Maxim N. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Field, Kevin G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2017-08-01

    High temperature oxidation resistant iron-chromium-aluminum (FeCrAl) alloys are candidate alloys for nuclear applications due to their exceptional performance during off-normal conditions such as a loss-of-coolant accident (LOCA) compared to currently deployed zirconium-based claddings [1]. A series of studies have been completed to determine the weldability of the FeCrAl alloy class and investigate the weldment performance in the as-received (non-irradiated) state [2,3]. These initial studies have shown the general effects of composition and microstructure on the weldability of FeCrAl alloys. Given this, limited details on the radiation tolerance of FeCrAl alloys and their weldments exist. Here, the highest priority candidate FeCrAl alloys and their weldments have been investigated after irradiation to enable a better understanding of FeCrAl alloy weldment performance within a high-intensity neutron field. The alloys examined include C35M (Fe-13%Cr-5% Al) and variants with aluminum (+2%) or titanium carbide (+1%) additions. Two different sub-sized tensile geometries, SS-J type and SS-2E (or SS-mini), were neutron irradiated in the High Flux Isotope Reactor to 1.8-1.9 displacements per atom (dpa) in the temperature range of 195°C to 559°C. Post irradiation examination of the candidate alloys was completed and included uniaxial tensile tests coupled with digital image correlation (DIC), scanning electron microscopy-electron back scattered diffraction analysis (SEM-EBSD), and SEM-based fractography. In addition to weldment testing, non-welded parent material was examined as a direct comparison between welded and non-welded specimen performance. Both welded and non-welded specimens showed a high degree of radiation-induced hardening near irradiation temperatures of 200°C, moderate radiation-induced hardening near temperatures of 360°C, and almost no radiation-induced hardening at elevated temperatures near 550°C. Additionally, low-temperature irradiations showed

  11. Providing guidance for genomics-based cancer treatment decisions: insights from stakeholder engagement for post-prostatectomy radiation therapy.

    Science.gov (United States)

    Abe, James; Lobo, Jennifer M; Trifiletti, Daniel M; Showalter, Timothy N

    2017-08-24

    Despite the emergence of genomics-based risk prediction tools in oncology, there is not yet an established framework for communication of test results to cancer patients to support shared decision-making. We report findings from a stakeholder engagement program that aimed to develop a framework for using Markov models with individualized model inputs, including genomics-based estimates of cancer recurrence probability, to generate personalized decision aids for prostate cancer patients faced with radiation therapy treatment decisions after prostatectomy. We engaged a total of 22 stakeholders, including: prostate cancer patients, urological surgeons, radiation oncologists, genomic testing industry representatives, and biomedical informatics faculty. Slides were at each meeting to provide background information regarding the analytical framework. Participants were invited to provide feedback during the meeting, including revising the overall project aims. Stakeholder meeting content was reviewed and summarized by stakeholder group and by theme. The majority of stakeholder suggestions focused on aspects of decision aid design and formatting. Stakeholders were enthusiastic about the potential value of using decision analysis modeling with personalized model inputs for cancer recurrence risk, as well as competing risks from age and comorbidities, to generate a patient-centered tool to assist decision-making. Stakeholders did not view privacy considerations as a major barrier to the proposed decision aid program. A common theme was that decision aids should be portable across multiple platforms (electronic and paper), should allow for interaction by the user to adjust model inputs iteratively, and available to patients both before and during consult appointments. Emphasis was placed on the challenge of explaining the model's composite result of quality-adjusted life years. A range of stakeholders provided valuable insights regarding the design of a personalized decision

  12. Resistance of lichens to simulated galactic cosmic radiation: limits of survival capacity and biosignature detection

    Science.gov (United States)

    de la Torre Noetzel, Rosa; Miller, Ana Z.; Cubero, Beatriz; Raguse, Marina; Meessen, Joachim

    2016-04-01

    Space constitutes an extremely harmful environment for survival of terrestrial organisms. Amongst extremophiles on Earth, lichens are one of the most resistant organisms to harsh terrestrial environments, as well as some species of microorganisms, such as bacteria (Moeller et al., 2010), criptoendolithic cyanobacteria and lithic fungi (de los Ríos et al. 2004). To study the survival capacity of lichens to the harmful radiation environment of space, we have selected the lichen Circinaria gyrosa, an astrobiological model defined by its high capacity of resistance to space conditions (De la Torre et al. 2010) and to a simulated Mars environment (Sanchez et al., 2012). Samples were irradiated with four types of space-relevant ionizing radiation in the STARLIFE campaign: helium and iron ion doses (up to 2,000 Gy), X-ray doses (up to 5,000 Gy) and ultra-high γ-ray doses (from 6 to 113 kGy). Results on resistance of C. gyrosa to space-relevant ionizing radiation and its post-irradiation viability were obtained by: (i) chlorophyll a fluorescence of photosystem II (PS II); (ii) epifluorescence microscopy; (iii) confocal laser-scanning microscopy (CLSM), and (iv) field emission scanning electron microscopy (FESEM). Results of photosynthetic activity and epifluorescence showed no significant changes on the viability of C. gyrosa with increasing doses of helium and iron ions as well as X-rays. In contrast, γ-irradiation elicited significant dose-correlated effects as revealed by all applied techniques. Relevant is the presence of whewellite-like crystals, detected by FESEM on C. gyrosa thalli after high irradiation doses, which has been also identified in previous Mars simulation studies (Böttcher et al., 2014). These studies contribute to the better understanding of the adaptability of extremophile organisms to harsh environments, as well as to estimate the habitability of a planet's surface, like Mars; they will be important for planning experiments on the search of life

  13. Electron-hole pairs generated in ZrO2 nanoparticle resist upon exposure to extreme ultraviolet radiation

    Science.gov (United States)

    Kozawa, Takahiro; Santillan, Julius Joseph; Itani, Toshiro

    2018-02-01

    Metal oxide nanoparticle resists have attracted much attention as the next-generation resist used for the high-volume production of semiconductor devices. However, the sensitization mechanism of the metal oxide nanoparticle resists is unknown. Understanding the sensitization mechanism is important for the efficient development of resist materials. In this study, the energy deposition in a zirconium oxide (ZrO2) nanoparticle resist was investigated. The numbers of electron-hole pairs generated in a ZrO2 core and an methacrylic acid (MAA) ligand shell upon exposure to 1 mJ cm-2 (exposure dose) extreme ultraviolet (EUV) radiations were theoretically estimated to be 0.16 at most and 0.04-0.17 cm2 mJ-1, respectively. By comparing the calculated distribution of electron-hole pairs with the line-and-space patterns of the ZrO2 nanoparticle resist fabricated by an EUV exposure tool, the number of electron-hole pairs required for the solubility change of the resist films was estimated to be 1.3-2.2 per NP. NP denotes a nanoparticle consisting of a metal oxide core with a ligand shell. In the material design of metal oxide nanoparticle resists, it is important to efficiently use the electron-hole pairs generated in the metal oxide core for the chemical change of ligand molecules.

  14. Oropharyngeal candidiasis and resistance to antifungal drugs in patients receiving radiation for head and neck cancer

    Directory of Open Access Journals (Sweden)

    Maryam Rad DMD, MSc

    2012-04-01

    Full Text Available BACKGROUND: Oropharyngeal candidiasis is a common infection in patient receiving radiotherapy for head and neckcancer. Accurate and rapid identification of candida species is very important in clinical laboratory, because theincidence of candidiasis continues to rise after radiotherapy. The genus Candida has about 154 species that showdifferent level of resistance to antifungal drugs and have high degree of phenotypic similarity. The aim of this study wasto investigate oral yeast colonization and infection and resistance to antifungal drugs in these patients.METHODS: Thirty patients receiving a 6-week course of radiation therapy for treatment of head and neck cancer at theOncology Unit in Shafa Hospital, in 2008, were enrolled in the study. Specimens from patients were cultured weeklyfor Candida. All isolates were plated on CHROM agar and RPMI-based medium. They were subcultured and submittedfor antifungal susceptibility testing (nystatin, fluconazole, clotrimazole and ketoconazole and molecular typing.RESULTS: Infection (clinical and microbiological evidence occurred in 50% of the patients and Candida colonization(only microbiological evidence occurred in 70% of subjects in the first week. Candida albicans alone was isolated in94.9% of patient visits with positive cultures. Candida tropicalis was isolated from 5.1% of patient visits with positivecultures. All isolates were susceptible to nystatin, but did not respond to the other antifungal drugsCONCLUSIONS: The irradiation-induced changes of the intraoral environment such as xerostomia lead to increasedintraoral colonization by Candida species. All yeast isolates were susceptible to nystatin. Thus prophylactic therapywith nystatin should be considered for these patients.

  15. Hymenobacter swuensis sp. nov., a gamma-radiation-resistant bacteria isolated from mountain soil.

    Science.gov (United States)

    Lee, Jae-Jin; Srinivasan, Sathiyaraj; Lim, Sangyong; Joe, Minho; Lee, Sang Hee; Kwon, Shin Ae; Kwon, Yoon Jung; Lee, Jin; Choi, Jin Ju; Lee, Hye Min; Auh, Young Kyung; Kim, Myung Kyum

    2014-03-01

    Gram stain-negative and non-motile bacteria, designated as DY53(T) and DY43, were isolated from mountain soil in South Korea prior exposure with 5 kGy gamma radiation. Phylogenetic analysis based on 16S rRNA gene sequence revealed that the strains belonged to the family Cytophagaceae in the class Cytophagia. 16S rRNA gene sequence similarity of strains DY53(T) and DY43 was 100 %. The highest degrees of sequence similarities of strains DY53(T) and DY43 were found with Hymenobacter perfusus A1-12(T) (98.8 %), Hymenobacter rigui WPCB131(T) (98.5 %), H. yonginensis HMD1010(T) (97.9 %), H. xinjiangensis X2-1g(T) (96.6 %), and H. gelipurpurascens Txg1(T) (96.5 %). The DNA G+C content of the novel strains DY53(T) and DY43 were 59.5 mol%. Chemotaxonomic data revealed that strains possessed major fatty acids such as C₁₅:₀ iso, C₁₅:₀ anteiso, C₁₆:₁ ω5c, summed feature 3 (16:1 ω7c/ω6c), summed feature 4 (17:1 anteiso B/iso I) and C₁₇:₀ iso, and major polar lipid was phosphatidylethanolamine. The novel strains showed resistance to gamma radiation, with a D10 value (i.e., the dose required to reduce the bacterial population by tenfold) in excess of 5 kGy. Based on these data, strains DY53(T) and DY43 should be classified as representing a novel species, for which the name Hymenobacter swuensis sp. nov. is proposed, with the type strain DY53(T) (=KCTC 32018(T) = JCM 18582(T)) and DY43 (=KCTC 32010).

  16. DNA damage response in a radiation resistant bacterium Deinococcus radiodurans: a paradigm shift

    International Nuclear Information System (INIS)

    Misra, H.S.

    2015-01-01

    Deinococcusradiodurans is best known for its extraordinary resistance to gamma radiation with its D 10 12kGy, and several other DNA damaging agents including desiccation to less than 5% humidity and chemical xenotoxicants. An efficient DNA double strand break (DSB) repair and its ability to protect biomolecules from oxidative damage are a few mechanisms attributed to these phenotypes in this bacterium. Although it regulates its proteome and transcriptome in response to DNA damage for its growth and survival, it lacks LexA mediated classical SOS response mechanism. Since LexA mediated damages response mechanism is highly and perhaps only, characterized DNA damage response processes in prokaryotes, this bacterium keeps us guessing how it responds to extreme doses of DNA damage. Interestingly, this bacterium encodes a large number of eukaryotic type serine threonine/tyrosine protein kinases (eST/YPK), phosphatases and response regulators and roles of eST/YPKs in cellular response to DNA damage and cell cycle regulations are well established in eukaryotes. Here, we characterized an antioxidant and DNA damage inducible eST/YPK (RqkA) and established its role in extraordinary radioresistance and DSB repair in this bacterium. We identified native phosphoprotein substrates for this kinase and demonstrated the involvement of some of these proteins phosphorylation in the regulation of DSB repair and growth under radiation stress. Findings suggesting the possible existence of eST/YPK mediated DNA damage response mechanism as an alternate to classical SOS response in this prokaryote would be discussed. (author)

  17. Methicillin-Resistant Staphylococcus aureus (MRSA Detection from the Hands of Jatinangor Community Health Center’s Health Care Providers

    Directory of Open Access Journals (Sweden)

    Jeevanisha Patmanathan

    2015-06-01

    Full Text Available Background: Methicillin-resistant Staphylococcus aureus is a bacterium that is resistance towards β-lactam antibiotics, and it seems to be one of the leading causes of nosocomial infections. Hands of the health care workers are said to be the main source for the nosocomial transmission. Thus, the study aims to determine methicillin-resistant S. aureus from the hands of Jatinangor Community Health Center’s health care workers. Methods: Samples were taken from the hands of 30 Jatinangor Community Health Center’s staffs, including medical and paramedical; from October 2012 to November 2012. Then, these samples underwent further laboratory examinations, starting from culture, identification and susceptibility test towards cefoxitin, in identifying methicillin-resistant S. aureus. Results: Out of the 30 samples taken, 6 samples (20% were positive for S. aureus isolates. In which, 4 (13.33% of the samples were positive for methicillin-resistant S. aureus. Conclusions: Since, health care workers are the main people in contact with patients and maintaining proper hand hygiene makes a huge difference; hand hygiene should be given adequate attention for the benefit of all.

  18. Composite plasma electrolytic oxidation to improve the thermal radiation performance and corrosion resistance on an Al substrate

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Donghyun [Department of Materials Science and Engineering, Pusan National University, Busan 46241 (Korea, Republic of); Sung, Dahye [Department of Materials Science and Engineering, Pusan National University, Busan 46241 (Korea, Republic of); Korea Institute of Industrial Technology (KITECH), Busan 46742 (Korea, Republic of); Lee, Junghoon [Department of Mechanical Engineering, Stevens Institute of Technology, Hoboken, NJ 07030 (United States); Kim, Yonghwan [Korea Institute of Industrial Technology (KITECH), Busan 46742 (Korea, Republic of); Chung, Wonsub, E-mail: wschung1@pusan.ac.kr [Department of Materials Science and Engineering, Pusan National University, Busan 46241 (Korea, Republic of)

    2015-12-01

    Highlights: • Composite plasma electrolytic oxidation was performed using dispersed CuO particles in convectional PEO electrolyte. • Thermal radiation performance and corrosion resistance were examined by FT-IR spectroscopy and electrochemical methods, respectively. • Deposited copper oxide on the surface of the Al substrate was enhanced the corrosion resistance and the emissivity compared with the conventional PEO. - Abstract: A composite plasma electrolytic oxidation (PEO) was performed for enhancing the thermal radiation performance and corrosion resistance on an Al alloy by dispersing cupric oxide (CuO) particles in a conventional PEO electrolyte. Cu-based oxides (CuO and Cu{sub 2}O) formed by composite PEO increased the emissivity of the substrate to 0.892, and made the surface being dark color, similar to a black body, i.e., an ideal radiator. In addition, the corrosion resistance was analyzed using potentio-dynamic polarization and electrochemical impedance spectroscopy tests in 3.5 wt.% NaCl aqueous solution. An optimum condition of 10 ampere per square decimeter (ASD) current density and 30 min processing time produced appropriate surface morphologies and coating thicknesses, as well as dense Cu- and Al-based oxides that constituted the coating layers.

  19. Effects of gamma ray irradiation on the radiation resistance, dielectric and mechanical properties of polyvinylchloride containing plasticizer and stabilizer

    International Nuclear Information System (INIS)

    Kim, B.H.; Lee, J.I.; Kang, D.Y.

    1977-01-01

    To investigate the properties of radiation resistance together with dielectric and mechanical relaxation behaviors of polyvinylchloride exposed to several different doses under the gamma ray of cobalt-60 source, experiments were carried out using the specimens prepared by mixing dibutyl-tin-dilaurate and dibutyl-tin-dimaleate as stabilizers with or without adding dioctylphthalate as a plasticizer. The origin of the absorption band at 1540-1640 cm -1 on infrared spectrum seemed to be RCOO - ion obtained from the ionization of the stabilizer, and this peak could be useful as a measure of radiation resistance on polyvinylchloride. Addition of increasing plasticizer to polyvinylchloride exhibited increasing radiation resistance and the reason for the result might be attributable to aromatic resonance adsorption of radiation energy by the dioctylphthalate. On dose dependent dielectric characteristics, nonplastized specimen showed peak at about 10 Mrad and that the peak disappeared on the plastification of specimens. Such phenomena might be explainable in considering the statistical distribution of scissored chain molecular segments as well as the plastification process of the plasticizer to polyvinylchloride chain molecules. (author)

  20. Study of resistance of D. radiodurans to the combined action of ionizing radiation with an electric or magnetic fields exogenous

    International Nuclear Information System (INIS)

    Prado, Georgia Reis

    2011-01-01

    The key goal in radiotherapy is to maximize damages in a tumor while minimizing them in nearby health tissues. Several strategies have been worked out toward the enhancement of cellular radiosensitivity, as the use of exogenous fields. It is studied in this work the resistance of Deinococcus radiodurans to the combined action of conventional and non conventional radiations, with external agents (electric and magnetic fields). D. radiodurans is a bacterium having an extraordinary ability to cope with lethal and mutagenic agents harmful to the DNA, particularly ionizing radiations as gammas and UV. Given its high radioresistance and fast growing, D. radiodurans has been used as solid tumors simulators. Peculiarities associated with radioresistance at the exponential and stationary phases were delineated from growing curves. By measuring survival curves information on radiosensitivity was obtained. In gamma irradiation D. radiodurans exhibited repairing shoulders of 2 and 8 kGy at the exponential and stationary phases, respectively. When gamma irradiations were combined with expositions to the electric field the repairing shoulders were reduced to 1 and 4 kGy at the exponential and stationary phases, respectively. Radioresistance was similar in both growing phases when the number of cells were approximately equalized in these two processes. On the other hand, when gamma irradiations were combined with expositions to the magnetic field the repairing shoulders were reduced to 4 and 6 kGy at the exponential and stationary phases, respectively. In irradiations with electron beams the repairing shoulder at the exponential phase was totally depleted, while at the stationary phase it was only 1 kGy. The findings of this work revealed new and important information on the radioresistance of D. radiodurans, while providing hints to the improvement of radiotherapy protocols in association with exogenous physical agents. (author)

  1. Microsatellite polymorphism within pfcrt provides evidence of continuing evolution of chloroquine-resistant alleles in Papua New Guinea

    Directory of Open Access Journals (Sweden)

    Sharma Yagya D

    2007-03-01

    Full Text Available Abstract Background Polymorphism in the pfcrt gene underlies Plasmodium falciparum chloroquine resistance (CQR, as sensitive strains consistently carry lysine (K, while CQR strains carry threonine (T at the codon 76. Previous studies have shown that microsatellite (MS haplotype variation can be used to study the evolution of CQR polymorphism and to characterize intra- and inter-population dispersal of CQR in Papua New Guinea (PNG. Methods Here, following identification of new polymorphic MS in introns 2 and 3 within the pfcrt gene (msint2 and msint3, respectively, locus-by-locus and haplotype heterozygosity (H analyses were performed to determine the distribution of this intronic polymorphism among pfcrt chloroquine-sensitive and CQR alleles. Results For MS flanking the pfcrt CQR allele, H ranged from 0.07 (B5M77, -18 kb to 0.094 (9B12, +2 kb suggesting that CQ selection pressure was responsible for strong homogenisation of this gene locus. In a survey of 206 pfcrt-SVMNT allele-containing field samples from malaria-endemic regions of PNG, H for msint2 was 0.201. This observation suggests that pfcrt msint2 exhibits a higher level of diversity than what is expected from the analyses of pfcrt flanking MS. Further analyses showed that one of the three haplotypes present in the early 1980's samples has become the predominant haplotype (frequency = 0.901 in CQR parasite populations collected after 1995 from three PNG sites, when CQR had spread throughout malaria-endemic regions of PNG. Apparent localized diversification of pfcrt haplotypes at each site was also observed among samples collected after 1995, where minor CQR-associated haplotypes were found to be unique to each site. Conclusion In this study, a higher level of diversity at MS loci within the pfcrt gene was observed when compared with the level of diversity at pfcrt flanking MS. While pfcrt (K76T and its immediate flanking region indicate homogenisation in PNG CQR parasite populations

  2. New insight on the high radiation resistance of UO{sub 2} against fission fragments

    Energy Technology Data Exchange (ETDEWEB)

    Szenes, G., E-mail: szenesgyorgy@caesar.elte.hu

    2016-12-15

    Track radii are derived for semiconductors from a temperature distribution Θ(r) in which the width of the distribution is the only materials parameter. Analysis of track data for GeS, InP, GaAs and GaN show that the projectile velocity has no effect on track radii in semiconductors. Due to the missing velocity effect, the threshold for track formation, S{sub et} = 20 keV/nm is high in semiconducting UO{sub 2} in the whole range of projectile velocities. This is the origin of the high radiation resistance for fission fragments. Consequences for the simulation experiments with insulating CeO{sub 2} are discussed. It is verified that sputtering is described accurately by the Arrhenius equation for various materials including UO{sub 2}. The ion-induced surface potential has a strong effect on the activation energy. - Highlights: • Uniform features of track formation are demonstrated. • Semiconductors are more stable than insulators against fission fragments. • Melting point and width of the thermal spike control the track size. • High threshold for tracks S{sub et} = 20 keV/nm for fission fragments in semiconducting UO{sub 2}. • An Arrhenius equation describes the inelastic sputtering in UO{sub 2} and other solids.

  3. Radiation Resistance of the U(Al, Si)3 Alloy: Ion-Induced Disordering

    Science.gov (United States)

    Yaniv, Gili; Horak, Pavel; Vacik, Jiri; Mykytenko, Natalia; Rafailov, Gennady; Dahan, Itzchak; Fuks, David; Kiv, Arik

    2018-01-01

    During the exploitation of nuclear reactors, various U-Al based ternary intermetallides are formed in the fuel-cladding interaction layer. Structure and physical properties of these intermetallides determine the radiation resistance of cladding and, ultimately, the reliability and lifetime of the nuclear reactor. In current research, U(Al, Si)3 composition was studied as a potential constituent of an interaction layer. Phase content of the alloy of an interest was ordered U(Al, Si)3, structure of which was reported earlier, and pure Al (constituting less than 20 vol % of the alloy). This alloy was investigated prior and after the irradiation performed by Ar ions at 30 keV. The irradiation was performed on the transmission electron microscopy (TEM, JEOL, Japan) samples, characterized before and after the irradiation process. Irradiation induced disorder accompanied by stress relief. Furthermore, it was found that there is a dose threshold for disordering of the crystalline matter in the irradiated region. Irradiation at doses equal or higher than this threshold resulted in almost solely disordered phase. Using the program “Stopping and Range of Ions in Matter” (SRIM), the parameters of penetration of Ar ions into the irradiated samples were estimated. Based on these estimations, the dose threshold for ion-induced disordering of the studied material was assessed. PMID:29393870

  4. Raf oncogene is associated with a radiation-resistant human laryngeal cancer

    International Nuclear Information System (INIS)

    Kasid, U.; Pfeifer, A.; Weichselbaum, R.R.; Dritschilo, A.; Mark, G.E.

    1987-01-01

    In order to identify the genetic factors associated with the radiation-resistant human laryngeal carcinoma cell line (SQ-20B), tumor cell DNA was transfected into NIH/3T3 cells. A high incidence (six out of six) of raf sequences was found in transfected NIH/3T3 clones and the tumorigenic potential of SQ-20B DNA could be linked to genomic fragments that represent most of the kinase domain of human c-raf-1. An apparently unaltered 3.5-kilobase pair (kb) human c-raf transcript was identified in SQ-20B cells but was not observed in the transfected NIH/3T3 cell clones. Two new transcripts (4.2 kb and 2.6 kb) were found in tumorigenic clones; the large transcript was missing in a very poorly tumorigenic clone. Cytogenetic analysis indicated that the normal autosomes of chromosome 3 were absent in SQ-20B karyotypes and had formed apparently stable marker chromosomes. Unlike the recipient NIH/3T3 cell line, 30% of the transformed clone-1 metaphases had minute and double-minute chromosomes representative of amplified DNA sequences. The frequency of the c-raf-1 identification by NIH/3T3 transfection of SQ-20B DNA suggests the presence of some genetic abnormality within this locus

  5. Effect of coexisting organic substances on radiation resistance of Bacillus pumilus spores suspended in water

    International Nuclear Information System (INIS)

    Kigawa, Akiko; Tateishi, Tsuneo; Iso, Katsuaki; Kimura, Toshio; Mamuro, Tetsuo

    1987-01-01

    D values of B. pumilus spores suspended in water have been shown to increase in the presence of some coexisting organic substances. For elucidation of a mechanism or mechanisms involved in such a phenomenon, D-values of B.p. spores were examined by suspending them in aqueous solutions containing various concentrations of ethanol, glycerin, inulin and PVA. All these substances showed abrupt changes in D value at a narrow concentration range of 1 - 10 weight ppm. Solutions containing these substances at their lower limit concentrations and upper limit were prepared, sealed in incubator bottles leaving no air layer and irradiated at 0.7 Mrad with γ-rays. Winkler's method was used for the determination of oxygen concentrations in these solutions. The initial concentration of dissolved oxygen was 8.2 ppm. After irradiation, 3 - 5 ppm of oxygen remained in those solutions containing the lower limit (1 ppm), whereas only less than 0.5 ppm in those containing the upper limits, 2.5 ppm of ethanol, 5 ppm of PVA and 10 ppm each of glycerin and inulin. Therefore, the observed effect of coexisting organic substances on radiation resistance of B. pumilus can be explained by the so-called ''oxygen effect''. (author)

  6. A study on the improvement of radiation resistance for polymer materials

    International Nuclear Information System (INIS)

    Park, K. J.; Cho, S. H.

    1999-01-01

    DLC (Diamond-like carbon) thin film-deposited polycarbonate specimens were irradiated by high level gamma-ray and made observation of their irradiation effects. In order to do that, diamond-like carbon thin films were deposited on polycarbonate specimens by plasma-enhanced chemical vapor deposition, and then those specimens were irradiated in the high level irradiation facility in KAERI at the same dose rate of 10 6 rad. Relative concentration of free radicals generated during irradiation of the DLC-deposited and undeposited specimens was determined by the analysis of EPR (electron paramagnetic resonance) spectrum at the elapsed time of 4 hours and 2 months after irradiation of those specimens. As a result of the analysis, it was found that the radical concentration in the DLC-undeposited specimen at the elapsed time of 2 months reduced rapidly in 4 % compared with that at the elapsed time of 4 hours, whereas the concentration in the DLC-deposited specimens decreased slowly in the vicinity of 60 %. Consequently, DLC thin film-deposited polycarbonate specimens resulted in the increase of radiation-oxidation resistance

  7. Toxicity of radiation-resistant strains of Bacillus thuringiensis (Berl.) to larval Plutella xylostella (L.)

    International Nuclear Information System (INIS)

    Jangi, M.S.; Ibrahim, Hasan

    1983-01-01

    A total of 24 isolates of Bacillus thuringiensis (Berliner), resistant to a γ-radiation dose of 100 krad, were screened for their toxicity to larval silkworms, Bombyxmori(L.), and 15 of them were subsequently tested for their toxicity to larval diamond-back moth, Plutella xylostella(L.). The LC 50 's of these isolates to B. mori ranged from 1.6 X 10 5 to 6.0 X 10 3 spores/mL or from 5.9 to 0.3 μg cellular protein/mL. The irradiation treatment produced isolates which were significantly more toxic to P. xylostella (LC 50 4 spores/mL or 3.7 μg cellular protein/mL) and/ or less toxic to B. mori (LC 50 > 2.3 X 10 4 spores/mL or 1.0 μg cellular protein/mL) than the parent commercial strain

  8. An NAD+-dependent transcriptional program governs self-renewal and radiation resistance in glioblastoma.

    Science.gov (United States)

    Gujar, Amit D; Le, Son; Mao, Diane D; Dadey, David Y A; Turski, Alice; Sasaki, Yo; Aum, Diane; Luo, Jingqin; Dahiya, Sonika; Yuan, Liya; Rich, Keith M; Milbrandt, Jeffrey; Hallahan, Dennis E; Yano, Hiroko; Tran, David D; Kim, Albert H

    2016-12-20

    Accumulating evidence suggests cancer cells exhibit a dependency on metabolic pathways regulated by nicotinamide adenine dinucleotide (NAD + ). Nevertheless, how the regulation of this metabolic cofactor interfaces with signal transduction networks remains poorly understood in glioblastoma. Here, we report nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting step in NAD + synthesis, is highly expressed in glioblastoma tumors and patient-derived glioblastoma stem-like cells (GSCs). High NAMPT expression in tumors correlates with decreased patient survival. Pharmacological and genetic inhibition of NAMPT decreased NAD + levels and GSC self-renewal capacity, and NAMPT knockdown inhibited the in vivo tumorigenicity of GSCs. Regulatory network analysis of RNA sequencing data using GSCs treated with NAMPT inhibitor identified transcription factor E2F2 as the center of a transcriptional hub in the NAD + -dependent network. Accordingly, we demonstrate E2F2 is required for GSC self-renewal. Downstream, E2F2 drives the transcription of members of the inhibitor of differentiation (ID) helix-loop-helix gene family. Finally, we find NAMPT mediates GSC radiation resistance. The identification of a NAMPT-E2F2-ID axis establishes a link between NAD + metabolism and a self-renewal transcriptional program in glioblastoma, with therapeutic implications for this formidable cancer.

  9. Toxicity of radiation-resistant strains of Bacillus thuringiensis (Berl. ) to larval Plutella xylostella (L. )

    Energy Technology Data Exchange (ETDEWEB)

    Jangi, M.S.; Ibrahim, H. (Faculty of Health Sciences, Universiti Kebangsaan, Malysia, Bangi, Selangor)

    1983-05-01

    A total of 24 isolates of Bacillus thuringiensis (Berliner), resistant to a ..gamma..-radiation dose of 100 krad, were screened for their toxicity to larval silkworms, Bombyxmori(L.), and 15 of them were subsequently tested for their toxicity to larval diamond-back moth, Plutella xylostella(L.). The LC/sub 50/'s of these isolates to B. mori ranged from 1.6 X 10/sup 5/ to 6.0 X 10/sup 3/ spores/mL or from 5.9 to 0.3 ..mu..g cellular protein/mL. The irradiation treatment produced isolates which were significantly more toxic to P. xylostella (LC/sub 50/ < 8.1 X 10/sup 4/ spores/mL or 3.7 ..mu..g cellular protein/mL) and/ or less toxic to B. mori (LC/sub 50/ > 2.3 X 10/sup 4/ spores/mL or 1.0 ..mu..g cellular protein/mL) than the parent commercial strain.

  10. Gel-based proteomic approach to unravel the extreme radiation resistance of deinococcus radiodurans

    International Nuclear Information System (INIS)

    Basu, Bhakti; Apte, Shree Kumar

    2013-01-01

    The extremophile, Deinococcus radiodurans, is endowed with an extraordinary DNA repair ability and oxidative stress alleviation mechanisms that render it virtually resistant to all types of DNA damaging stressors such as ionizing radiations, UV or years of desiccation. Following DNA damage, the microbe reassembles its complete genome from multiple DNA fragments with impeccable fidelity. The deinococcal genome encodes functional homologues of both prokaryotic and eukaryotic DNA repair pathways, such as RecFOR mediated homologous recombination (HR), nucleotide/base excision repair (NER/BER), strand annealing (SA) and non-homologous end joining (NHEJ), but lacks homologues for universal prokaryotic DNA repair pathways such as RecBCD mediated HR, photo-reactivation and SOS response. It also harbors multiple enzymatic and non-enzymatic oxidative stress defense mechanisms. Proteomic approaches were employed to study the response of D. radiodurans to LD50 dose of gamma irradiation during the post-irradiation growth arrest phase by two dimensional protein electrophoresis coupled with mass spectrometry to reveal kinetics and dynamics of DNA repair, oxidative stress alleviation and resynthesis of damaged proteins, preceding growth recovery

  11. Radio resistibility of micro-organism and sterilization by ionizing radiation

    International Nuclear Information System (INIS)

    Tran Que; Tran Tich Canh; Hoang Hung Tien; Le Xuan Tham; Le Thi Dinh

    2000-01-01

    Pasteur ella pestis is a radiosensitive bacterium. The irradiation of P. pestis by gamma rays for the investigation of radiation sterilization with dose rate of 261 rads/s calculated the values of D 10 = 5.668 Krads and D q = 4.044 Krads. The responsive curve of dose-survival effect had a simple phase, shoulder and none detail effect. The survival frequencies of P. pestis after doses 30 Krads fixed 3.45x10 -5 . Using the survival P. pestis isolated from the first exposure for the second exposure and third exposure showed that the survival frequencies after 3 times were stable with 3.45x10 -5 ± 0.87x10 -5 . The survival frequency of P. pestis at dose 30 Krads was clearly high after 4th exposing time. The small colony isolated after 4th exposing time was a resistant line to gamma rays. This line also was dispersed by specific phage. The responsive curve of dose-survival effects had a simple phase, shoulder and none detail effect. (author)

  12. Development of radiation-resistant magnet coils for high-intensity beam lines

    Science.gov (United States)

    Tanaka, K. H.; Yamanoi, Y.; Noumi, H.; Takasaki, M.; Saitoh, Y.; Kato, K.; Yokoi, T.; Tsukada, S.; Tanno, H.

    1994-07-01

    In connection with the Japanese Hadron Facility (JHF) project, the development of new types of radiation-resistant magnet coils has been continued at KEK. One major program is the design and production of a mineral insulation cable (MIC) with a larger maximum current. We have already developed a 2000A-class MIC having a square-cross-section hollow conductor. A sample magnet coil was fabricated with this MIC. Tests of its stability and reliability are under progress. We are now planning to develop a 3000A-class MIC. The other program is R/D work on a completely inorganic wrapping insulation material which can be used like the usual type glass-fiber tape pre-impregnated with epoxy-resin. After tests of the mechanical strength and electric insulation of many combinations of tapes and bonds, we found a pure (99%) alumina-fiber tape pre-impregnated with inorganic cement that is suitable for a magnet coil insulator after thermal curing.

  13. Production of a nuclear radiation resistant and mechanically tough electrically insulating material

    International Nuclear Information System (INIS)

    Brechna, H.

    1975-01-01

    According to the invention, an electrically insulating material of high mechanical strength and resistance to nuclear radiation may be made of a hardenable plastic material coated on an inorganic supporting tissue. The synthetic resin serving as binder - duroplasts, e.g. epoxide resins, polyester resins or silicon resins - is heated, mixed with a catalyst, a wetting agent and a filler (and, if required, with 0.5-1.5 weight % thixotropic material) and coated, under reduced pressure (o.4 to 0.6 mm Hg), on the supporting tissue whose surface is cleaned before this by heating. It is then hardened. Hardening may also take place directly on the electric conductor to be insulated. One obtains a bubble-free wire coating. The inorganic supporting material is glas fibre tissue, also in combination with mica, while Al 2 O 3 , zirconium, zirconia, magnesium oxide, mica and silica (grain size 10-20 μ). The invention is illustrated by a number of examples. (UWI) [de

  14. Methodical assessment of all non-ionizing radiation sources that can provide a relevant contribution to public exposure. Final report

    International Nuclear Information System (INIS)

    Bornkessel, Christian; Schubert, Markus; Wuschek, Matthias; Brueggemeyer, Hauke; Weiskopf, Daniela

    2011-01-01

    The aim of the research project was to systematically identify artificial sources on non-ionizing radiation (electric, magnetic or electromagnetic fields in a frequency range from 0 Hz to 300 GHz, as well optical radiation in a wavelength range from 100 nm to 1 mm), that have relevant contribution to public exposure. The report includes the following chapters: (1) Concept for the relevance assessment for non-ionizing radiation sources; (2) concept for the systematic identification of sources from establishes technologies; (3) concept for the systematic identification of sources from new or foreseeable technologies; (4)overview of relevant radiation sources.

  15. Radiation-resistant photostructure for Schottky diode based on Cr/In2Hg3Te6

    Directory of Open Access Journals (Sweden)

    Ashcheulov A. A.

    2016-05-01

    Full Text Available Ge, Si, InGaAs, GaInAsP photodiodes are used as optical radiation receivers and function in a spectral range of transparency of quartz fiberglass. For the optical systems operated in the increased radioactivity the photodetectors' application on In2Hg3Te6 crystal base characterized by a photosensitivity in the spectral range of 0,5-1,6 mm and also by increased radiation resistance to alpha, beta and gamma radiation is most acceptable. Schottky photodiode structure was designed on the base of this semiconductor formed by a modified floating zone recrystallization technique where the sedimentation effect was leveled. It consists of n-In2Hg3Te6 substrate and deposited by cathode sputtering Cr barrier layer of thickness within a range 10-11 nm choice of Cr is determined by its optimal optical, electric and adhesive features in high quality radiation-resistant photodiode structures manufacturing. Indium and nichrome are used as ohmic contacts. The barrier structures have the contact area of 1,13 mm2 with photo response of 0,6-1,6 mm at the maximal sensitivity 0,43 A/W on the wavelength l,55 mm. Reverse dark current of these structures do not exceed 4 mA at the bias of 1 V (T=295 K, and the potential barrier height is equal to 0,41 eV. The tests of radiation resistance of these structures demonstrated their ability to function at doses of 2⋅108 rem without evident parameters changes. This allows using them in practical aims in the conditions of high radiation.

  16. Design and characterization of radiation resistant integrated circuits for the LHC particle detectors using deep sub-micron CMOS technologies

    International Nuclear Information System (INIS)

    Anelli, Giovanni Maria

    2000-01-01

    The electronic circuits associated with the particle detectors of the CERN Large Hadron Collider (LHC) have to work in a highly radioactive environment. This work proposes a methodology allowing the design of radiation resistant integrated circuits using the commercial sub-micron CMOS technology. This method uses the intrinsic radiation resistance of ultra-thin grid oxides, the technology of enclosed layout transistors (ELT), and the protection rings to avoid the radio-induced creation of leakage currents. In order to check the radiation tolerance level, several test structures have been designed and tested with different radiation sources. These tests have permitted to study the physical phenomena responsible for the damages induced by the radiations and the possible remedies. Then, the particular characteristics of ELT transistors and their influence on the design of complex integrated circuits has been explored. The modeling of the W/L ratio, the asymmetries (for instance in the output conductance) and the performance of ELT couplings have never been studied yet. The noise performance of the 0.25 μ CMOS technology, used in the design of several integrated circuits of the LHC detectors, has been characterized before and after irradiation. Finally, two integrated circuits designed using the proposed method are presented. The first one is an analogic memory and the other is a circuit used for the reading of the signals of one of the LHC detectors. Both circuits were irradiated and have endured very high doses practically without any sign of performance degradation. (J.S.)

  17. Radiation

    International Nuclear Information System (INIS)

    2013-01-01

    The chapter one presents the composition of matter and atomic theory; matter structure; transitions; origin of radiation; radioactivity; nuclear radiation; interactions in decay processes; radiation produced by the interaction of radiation with matter

  18. Transgenic Wheat Expressing a Barley UDP-Glucosyltransferase Detoxifies Deoxynivalenol and Provides High Levels of Resistance to Fusarium graminearum.

    Science.gov (United States)

    Li, Xin; Shin, Sanghyun; Heinen, Shane; Dill-Macky, Ruth; Berthiller, Franz; Nersesian, Natalya; Clemente, Thomas; McCormick, Susan; Muehlbauer, Gary J

    2015-11-01

    Fusarium head blight (FHB), mainly caused by Fusarium graminearum, is a devastating disease of wheat that results in economic losses worldwide. During infection, F. graminearum produces trichothecene mycotoxins, including deoxynivalenol (DON), that increase fungal virulence and reduce grain quality. Transgenic wheat expressing a barley UDP-glucosyltransferase (HvUGT13248) were developed and evaluated for FHB resistance, DON accumulation, and the ability to metabolize DON to the less toxic DON-3-O-glucoside (D3G). Point-inoculation tests in the greenhouse showed that transgenic wheat carrying HvUGT13248 exhibited significantly higher resistance to disease spread in the spike (type II resistance) compared with nontransformed controls. Two transgenic events displayed complete suppression of disease spread in the spikes. Expression of HvUGT13248 in transgenic wheat rapidly and efficiently conjugated DON to D3G, suggesting that the enzymatic rate of DON detoxification translates to type II resistance. Under field conditions, FHB severity was variable; nonetheless, transgenic events showed significantly less-severe disease phenotypes compared with the nontransformed controls. In addition, a seedling assay demonstrated that the transformed plants had a higher tolerance to DON-inhibited root growth than nontransformed plants. These results demonstrate the utility of detoxifying DON as a FHB control strategy in wheat.

  19. Resistance to infection with Eimeria vermiformis in mouse radiation chimeras is determined by donor bone-marrow cells

    International Nuclear Information System (INIS)

    Joysey, H.S.; Wakelin, D.; Rose, M.E.

    1988-01-01

    The course of infection with Eimeria vermiformis was determined in BALB/b, BALB/c, and C57BL/10ScSn (B10) mice and in radiation chimeras prepared from the H-2-compatible BALB/b and B10 mice. The BALB strains, irrespective of H-2 haplotype, were resistant, the B10 mice were susceptible, and in the chimeras infection was characterized by the genotype of the donated bone-marrow cells and not by the phenotype of the recipient. Thus, the genetic control of relative resistance or susceptibility to infection with this parasite is expressed through bone-marrow-derived cells

  20. Update on scribe–cleave–passivate (SCP) slim edge technology for silicon sensors: Automated processing and radiation resistance

    Energy Technology Data Exchange (ETDEWEB)

    Fadeyev, V., E-mail: fadeyev@ucsc.edu [Santa Cruz Institute for Particle Physics, University of California, Santa Cruz, CA 95064 (United States); Ely, S.; Galloway, Z.; Ngo, J.; Parker, C.; Sadrozinski, H.F.-W. [Santa Cruz Institute for Particle Physics, University of California, Santa Cruz, CA 95064 (United States); Christophersen, M.; Phlips, B.F. [U.S. Naval Research Laboratory, Code 7654, 4555 Overlook Avenue, Southwest Washington, DC 20375 (United States); Pellegrini, G.; Rafi, J.M.; Quirion, D. [Instituto de Microelectrónica de Barcelona, IMB-CNM-CSIC, Bellaterra, Barcelona (Spain); Dalla Betta, G.-F. [INFN and University of Trento, Via Sommarive, 14, 38123 Povo di Trento (Italy); Boscardin, M. [Fondazione Bruno Kessler, Via Sommarive, 18, 38123 Povo di Trento (Italy); Casse, G. [Department of Physics, University of Liverpool, O. Lodge Laboratory, Oxford Street, Liverpool L69 7ZE (United Kingdom); Gorelov, I.; Hoeferkamp, M.; Metcalfe, J.; Seidel, S. [Department of Physics and Astronomy, University of New Mexico, MSC 07 4220, 1919 Lomas Boulevard NE, Albuquerque, NM 87131 (United States); Gaubas, E.; Ceponis, T. [Institute of Applied Research, Vilnius University, Sauletekio 9, LT-10222 Vilnius (Lithuania); and others

    2014-11-21

    We pursue scribe–cleave–passivate (SCP) technology for making “slim edge” sensors. The goal is to reduce the inactive region at the periphery of the devices while maintaining their performance. In this paper we report on two aspects of the current efforts. The first one involves fabrication options for mass production. We describe the automated cleaving tests and a simplified version of SCP post-processing of n-type devices. Another aspect is the radiation resistance of the passivation. We report on the radiation tests of n- and p-type devices with protons and neutrons.

  1. Epoxy-borax-coal tar composition for a radiation protective, burn resistant drum liner and centrifugal casting method

    International Nuclear Information System (INIS)

    Boyer, N.W.; Taylor, R.S.

    1980-01-01

    A boron containing burn resistant, low level radiation protection material useful, for example, as a liner for radioactive waste disposal and storage, a component for neutron absorber, and a shield for a neutron source. The material is basically composed of borax in the range of 25-50%, coal tar in the range of 25-37.5%, with the remainder being an epoxy resin mix. A preferred composition is 50% borax, 25% coal tar and 25% epoxy resin. The material is not susceptible to burning and is about 1/5 the cost of existing radiation protection material utilized in similar applications

  2. Photodiode array for position-sensitive detection using high X-ray flux provided by synchrotron radiation

    Science.gov (United States)

    Jucha, A.; Bonin, D.; Dartyge, E.; Flank, A. M.; Fontaine, A.; Raoux, D.

    1984-09-01

    Synchrotron radiation provides a high intensity source over a large range of wavelengths. This is the prominent quality that has laid the foundations of the EXAFS development (Extended X-ray Absorption Fine Structure). EXAFS data can be collected in different ways. A full scan requires 5 to 10 min, compared to the one-day data collection of a conventional Bremsstrahlung X-ray tube. Recently, by using the new photodiode array (R 1024 SFX) manufactured by Reticon, it has been possible to reduce the data collection time to less than 100 ms. The key elements of this new EXAFS method are a dispersive optics combined with a position sensitive detector able to work under very high flux conditions. The total aperture of 2500 μm × 25 μm for each pixel is well suited to spectroscopic applications. Besides its high dynamic range (> 10 4) and its linearity, the rapidity of the readout allows a flux of 10 9-10 10 photons/s over the 1024 sensing elements.

  3. Study of the resistance mechanisms to ultraviolet radiation in Escherichia Coli. II. General characteristics of the mutants resistant to ultraviolet radiation of Escherichia Coli PQ30

    International Nuclear Information System (INIS)

    Alcantara D, D.

    1995-12-01

    Inside this second work the results are shown on the preliminary characterization of the 5 populations of Escherichia coli that its were subjected to the light UV, by means of 80 irradiation- growth cycles, the dose of which it was duplicated each 10 cycles. The course that the resistance to UV to those 5 populations continued along the process, that covers some 165 generations, and the level reached at the end by each one of them suggests the presence of different resistance mechanisms to the UV light. (Author)

  4. Ionizing Radiation Potentiates High Fat Diet-Induced Insulin Resistance and Reprograms Skeletal Muscle and Adipose Progenitor Cells

    DEFF Research Database (Denmark)

    Nylander, Vibe; Ingerslev, Lars R; Andersen, Emil

    2016-01-01

    Exposure to ionizing radiation increases the risk of chronic metabolic disorders such as insulin resistance and type 2 diabetes later in life. We hypothesized that irradiation reprograms the epigenome of metabolic progenitor cells, which could account for impaired metabolism after cancer treatment...... mice. Mice subjected to total body irradiation showed alterations in glucose metabolism and, when challenged with HFD, marked hyperinsulinemia. Insulin signaling was chronically disrupted in skeletal muscle and adipose progenitor cells collected from irradiated mice and differentiated in culture...

  5. Magnetic Measuring Instrumentation with Radiation-Resistant Hall Sensors for Fusion Reactors: Experience of Testing at JET

    Czech Academy of Sciences Publication Activity Database

    Bolshakova, I.; Quercia, A.; Coccorese, V.; Murari, A.; Holyaka, R.; Ďuran, Ivan; Viererbl, L.; Konopleva, R.; Yerashok, V.

    2012-01-01

    Roč. 59, č. 4 (2012), s. 1224-1231 ISSN 0018-9499. [International Conference on Advancements in Nuclear Instrumentation, Measurement Methods and their Applications. Ghent, 06.06.2011-09.06.2011] R&D Projects: GA ČR GAP205/10/2055 Institutional research plan: CEZ:AV0Z20430508 Keywords : plasma * tokamak * JET * Hall probes * radiation resistance Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.219, year: 2012

  6. Resistance Exercise and Inflammation in Breast Cancer Patients Undergoing Adjuvant Radiation Therapy: Mediation Analysis From a Randomized, Controlled Intervention Trial

    International Nuclear Information System (INIS)

    Schmidt, Martina E.; Meynköhn, Anna; Habermann, Nina; Wiskemann, Joachim; Oelmann, Jan; Hof, Holger; Wessels, Sabine; Klassen, Oliver; Debus, Jürgen; Potthoff, Karin; Steindorf, Karen; Ulrich, Cornelia M.

    2016-01-01

    Purpose: To explore the mediating role of inflammatory parameters in the development of fatigue, pain, and potentially related depressive symptoms during radiation therapy for breast cancer and its mitigation by resistance exercise. Methods and Materials: Breast cancer patients scheduled for adjuvant radiation therapy were randomized to 12-week progressive resistance exercise training (EX) or a relaxation control group. Interleukin-6 (IL-6) and interleukin-1 receptor antagonist (IL-1ra) were measured in serum samples collected before, at the end, and 6 weeks after radiation therapy from 103 chemotherapy-naïve participants. Fatigue was assessed with the multidimensional Fatigue Assessment Questionnaire, pain with the European Organization for Research and Treatment of Cancer QLQ-C30, and depressive symptoms with the Center for Epidemiologic Studies Depression Scale. Analysis of covariance models, partial correlations, Freedman-Schatzkin tests, and R"2 effect-size measures for mediation were calculated. Results: The analysis of covariance models revealed a significant intervention effect on IL-6 (P=.010) and the IL-6/IL-1ra ratio (P=.018), characterized by a marked increase during radiation therapy among controls, but no significant change in EX. Interleukin-1 receptor antagonist did not change significantly in either group (P=.88). Increased IL-6 and IL-6/IL-1ra levels at the end of radiation therapy were significantly associated with increased physical fatigue and pain 6 weeks after radiation. We observed significant partial mediation by IL-6 and IL-6/IL-1ra of the effect of resistance exercise on physical fatigue (Freedman-Schatzkin P=.023 and P<.001) and pain (both P<.001). Hereby IL-6 and IL-6/IL-1ra mediated between 15% and 24% of the variance of physical fatigue and pain explained by the intervention. Conclusions: This randomized, controlled trial showed a significantly increased proinflammatory cytokine level after adjuvant radiation therapy in breast

  7. Resistance Exercise and Inflammation in Breast Cancer Patients Undergoing Adjuvant Radiation Therapy: Mediation Analysis From a Randomized, Controlled Intervention Trial

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, Martina E., E-mail: m.schmidt@dkfz.de [Division of Preventive Oncology, National Center for Tumor Diseases and German Cancer Research Center, Heidelberg (Germany); Meynköhn, Anna; Habermann, Nina [Division of Preventive Oncology, National Center for Tumor Diseases and German Cancer Research Center, Heidelberg (Germany); Wiskemann, Joachim [Division of Medical Oncology, National Center for Tumor Diseases and University Hospital, Heidelberg (Germany); Oelmann, Jan; Hof, Holger; Wessels, Sabine [Department of Radiation Oncology, National Center for Tumor Diseases and University Hospital, Heidelberg (Germany); Klassen, Oliver [Division of Preventive Oncology, National Center for Tumor Diseases and German Cancer Research Center, Heidelberg (Germany); Debus, Jürgen; Potthoff, Karin [Department of Radiation Oncology, National Center for Tumor Diseases and University Hospital, Heidelberg (Germany); Steindorf, Karen; Ulrich, Cornelia M. [Division of Preventive Oncology, National Center for Tumor Diseases and German Cancer Research Center, Heidelberg (Germany)

    2016-02-01

    Purpose: To explore the mediating role of inflammatory parameters in the development of fatigue, pain, and potentially related depressive symptoms during radiation therapy for breast cancer and its mitigation by resistance exercise. Methods and Materials: Breast cancer patients scheduled for adjuvant radiation therapy were randomized to 12-week progressive resistance exercise training (EX) or a relaxation control group. Interleukin-6 (IL-6) and interleukin-1 receptor antagonist (IL-1ra) were measured in serum samples collected before, at the end, and 6 weeks after radiation therapy from 103 chemotherapy-naïve participants. Fatigue was assessed with the multidimensional Fatigue Assessment Questionnaire, pain with the European Organization for Research and Treatment of Cancer QLQ-C30, and depressive symptoms with the Center for Epidemiologic Studies Depression Scale. Analysis of covariance models, partial correlations, Freedman-Schatzkin tests, and R{sup 2} effect-size measures for mediation were calculated. Results: The analysis of covariance models revealed a significant intervention effect on IL-6 (P=.010) and the IL-6/IL-1ra ratio (P=.018), characterized by a marked increase during radiation therapy among controls, but no significant change in EX. Interleukin-1 receptor antagonist did not change significantly in either group (P=.88). Increased IL-6 and IL-6/IL-1ra levels at the end of radiation therapy were significantly associated with increased physical fatigue and pain 6 weeks after radiation. We observed significant partial mediation by IL-6 and IL-6/IL-1ra of the effect of resistance exercise on physical fatigue (Freedman-Schatzkin P=.023 and P<.001) and pain (both P<.001). Hereby IL-6 and IL-6/IL-1ra mediated between 15% and 24% of the variance of physical fatigue and pain explained by the intervention. Conclusions: This randomized, controlled trial showed a significantly increased proinflammatory cytokine level after adjuvant radiation therapy in breast

  8. Co-expression of CD147 and GLUT-1 indicates radiation resistance and poor prognosis in cervical squamous cell carcinoma.

    Science.gov (United States)

    Huang, Xin-Qiong; Chen, Xiang; Xie, Xiao-Xue; Zhou, Qin; Li, Kai; Li, Shan; Shen, Liang-Fang; Su, Juan

    2014-01-01

    The aim of this study was to investigate the association of CD147 and GLUT-1, which play important roles in glycolysis in response to radiotherapy and clinical outcomes in patients with locally advanced cervical squamous cell carcinoma (LACSCC). The records of 132 female patients who received primary radiation therapy to treat LACSCC at FIGO stages IB-IVA were retrospectively reviewed. Forty-seven patients with PFS (progression-free survival) of less than 36 months were regarded as radiation-resistant. Eighty-five patients with PFS longer than 36 months were regarded as radiation-sensitive. Using pretreatment paraffin-embedded tissues, we evaluated CD147 and GLUT-1 expression by immunohistochemistry. Overexpression of CD147, GLUT-1, and CD147 and GLUT-1 combined were 44.7%, 52.9% and 36.5%, respectively, in the radiation-sensitive group, and 91.5%, 89.4% and 83.0%, respectively, in the radiation-resistant group. The 5-year progress free survival (PFS) rates in the CD147-low, CD147-high, GLUT-1-low, GLUT-1-high, CD147- and/or GLUT-1-low and CD147- and GLUT-1- dual high expression groups were 66.79%, 87.10%, 52.78%, 85.82%, 55.94%, 82.90% and 50.82%, respectively. CD147 and GLUT-1 co-expression, FIGO stage and tumor diameter were independent poor prognostic factors for patients with LACSCC in multivariate Cox regression analysis. Patients with high expression of CD147 alone, GLUT-1 alone or co-expression of CD147 and GLUT-1 showed greater resistance to radiotherapy and a shorter PFS than those with low expression. In particular, co-expression of CD147 and GLUT-1 can be considered as a negative independent prognostic factor.

  9. Radiation resistance in mice increased following chronic application of Li/sub 2/CO/sub 3/

    Energy Technology Data Exchange (ETDEWEB)

    Vacek, A.; Sikulova, J.; Bartonickova, A. (Ceskoslovenska Akademie Ved, Brno. Biofysikalni Ustav)

    1982-01-01

    In experiments on strain H mice the increased radiation resistance of mice was analysed after three weeks' feeding with a diet including Li given as lithium carbonicum. The concentration of Li in the serum during the first three days of feeding was increased to 0.5 mmol/l and remained at that level to the end of feeding. The application of Li increased the overall number of stem cells in the spleen by 80 per cent compared with the control group. D/sub 0/ of the line of dependence of the number of endogenous colonies on radiation dose increased following Li application by 1.2 Gy compared with controls. The proliferation activity of haemopoietic stem cells observed 90 min after injection of hydroxyurea was, after 21 days feeding with a mixture containing Li, increased by 200 per cent. The results support the idea that the increased radiation resistance of mice following feeding with Li salts before irradiation may be due to the increased content and resistance of the haemopoietic stem cells, as well as activation of granulopoiesis.

  10. Preparation and characteristics of a flexible neutron and γ-ray shielding and radiation-resistant material reinforced by benzophenone

    Directory of Open Access Journals (Sweden)

    Pin Gong

    2018-04-01

    Full Text Available With a highly functional methyl vinyl silicone rubber (VMQ matrix and filler materials of B4C, PbO, and benzophenone (BP and through powder surface modification, silicone rubber mixing, and vulcanized molding, a flexible radiation shielding and resistant composite was prepared in the study. The dispersion property of the powder in the matrix filler was improved by powder surface modification. BP was added into the matrix to enhance the radiation resistance performance of the composites. After irradiation, the tensile strength, elongation, and tear strength of the composites decreased, while the Shore hardness of the composites and the crosslinking density of the VMQ matrix increased. Moreover, the composites with BP showed better mechanical properties and smaller crosslinking density than those without BP after irradiation. The initial degradation temperatures of the composites containing BP before and after irradiation were 323.6°C and 335.3°C, respectively. The transmission of neutrons for a 2-mm thick sample was only 0.12 for an Am–Be neutron source. The transmission of γ-rays with energies of 0.662, 1.173, and 1.332 MeV for 2-cm thick samples were 0.7, 0.782, and 0.795, respectively. Keywords: Flexible Composite, Neutron Shielding, Radiation Resistance, γ-ray Shielding

  11. Radiation resistances and decontamination of common pathogenic bacteria contaminated in white scar oyster (Crassostrea belcheri) in Thailand

    International Nuclear Information System (INIS)

    Thupila, Nunticha; Ratana-arporn, Pattama; Wilaipun, Pongtep

    2011-01-01

    In Thailand, white scar oyster (Crassostrea belcheri) was ranked for premium quality, being most expensive and of high demand. This oyster is often eaten raw, hence it may pose health hazards to consumers when contaminated with food-borne pathogens. As limited alternative methods are available to sterilize the oyster while preserving the raw characteristic, irradiation may be considered as an effective method for decontamination. In this study, the radiation resistance of pathogenic bacteria commonly contaminating the oyster and the optimum irradiation doses for sterilization of the most radiation resistant bacteria were investigated. The radiation decimal reduction doses (D 10 ) of Salmonella Weltevreden DMST 33380, Vibrio parahaemolyticus ATCC 17802 and Vibrio vulnificus DMST 5852 were determined in broth culture and inoculated oyster homogenate. The D 10 values of S. Weltevreden, V. parahaemolyticus and V. vulnificus in broth culture were 0.154, 0.132 and 0.059 kGy, while those of inoculated oyster homogenate were 0.330, 0.159 and 0.140 kGy, respectively. It was found that among the pathogens tested, S. Weltevreden was proved to be the most resistant species. An irradiation dose of 1.5 kGy reduced the counts of 10 5 CFU/g S. Weltevreden inoculated in oyster meat to an undetectable level. The present study indicated that a low-dose irradiation can improve the microbial quality of oyster and further reduce the risks from the food-borne pathogens without adversely affecting the sensory attributes.

  12. Development of high radiation-resistant glass fiber reinforced plastics with cyanate-based resin for superconducting magnet systems

    Energy Technology Data Exchange (ETDEWEB)

    Idesaki, Akira, E-mail: idesaki.akira@qst.go.jp [Quantum Beam Science Directorate, Japan Atomic Energy Agency, Watanuki 1233, Takasaki, Gunma 370-1292 (Japan); Nakamoto, Tatsushi [Cryogenic Science Center, High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan); Yoshida, Makoto [Institute of Particle and Nuclear Studies, High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan); Shimada, Akihiko [Quantum Beam Science Directorate, Japan Atomic Energy Agency, Watanuki 1233, Takasaki, Gunma 370-1292 (Japan); Iio, Masami; Sasaki, Kenichi; Sugano, Michinaka [Cryogenic Science Center, High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan); Makida, Yasuhiro [Institute of Particle and Nuclear Studies, High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan); Ogitsu, Toru [Cryogenic Science Center, High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan)

    2016-11-15

    Highlights: • GFRPs for superconducting magnet systems were developed. • Cyanate-based resins were used for GFRPs as matrices. • Radiation resistance was evaluated based on gas evolution and mechanical properties. • GFRP with bismaleimide-triazine resin exhibited excellent radiation resistance. - Abstract: Glass fiber reinforced plastics (GFRPs) with cyanate ester resin/epoxy resin, bismaleimide resin/epoxy resin, and bismaleimide-triazine resin as matrices were developed for the superconducting magnet systems used in high intensity accelerators. The radiation resistance of these GFRPs was evaluated based on their gas evolution and changes in their mechanical properties after gamma-ray irradiation with dose of 100 MGy in vacuum at ambient temperature. After irradiation, a small amount of gas was evolved from all of the GFRPs, and a slight decrease in mechanical properties was observed compared with the conventional epoxy resin-GFRP, G10. Among the GFRPs, the smallest amount of gas (6 × 10{sup −5} mol/g) was evolved from the GFRP with the bismaleimide-triazine resin, which also retained more than 88% of its flexural strength after 100 MGy irradiation; this GFRP is thus considered the most promising material for superconducting magnet systems.

  13. The effect of morphology and surface composition on radiation resistance of heterogeneous material CdS-PbS

    Energy Technology Data Exchange (ETDEWEB)

    Malyar, I. V., E-mail: imalyar@yandex.ru; Stetsyura, S. V., E-mail: stetsyurasv@info.sgu.ru [Chernyshevsky Saratov State University (Russian Federation)

    2011-07-15

    As a result of a complex study of the heterophase photosensitive material CdS-PbS by the methods of scanning electron microscopy and Auger spectrometry, it has been found that the radiation resistance of this material depends on the morphology and phase composition at its surface. It is shown that, as the temperature of annealing is increased, aggregations with predominant content of PbS grow; simultaneously, the composition of these aggregations varies as a consequence of the reaction of substitution of sulfur atoms with oxygen atoms. The latter of the aforementioned processes brings about a decrease in the radiation resistance of the heterophase photosensitive material CdS-PbS, which is accounted for by a decrease in the gettering due to appearance of an intermediate oxidized layer between PbS and CdS. An increase in the sizes and number of spherical aggregations at the surface, which consist of crystallites with predominant content of PbS, brings about an increase in the radiation resistance.

  14. Radiation resistances and decontamination of common pathogenic bacteria contaminated in white scar oyster ( Crassostrea belcheri) in Thailand

    Science.gov (United States)

    Thupila, Nunticha; Ratana-arporn, Pattama; Wilaipun, Pongtep

    2011-07-01

    In Thailand, white scar oyster ( Crassostrea belcheri) was ranked for premium quality, being most expensive and of high demand. This oyster is often eaten raw, hence it may pose health hazards to consumers when contaminated with food-borne pathogens. As limited alternative methods are available to sterilize the oyster while preserving the raw characteristic, irradiation may be considered as an effective method for decontamination. In this study, the radiation resistance of pathogenic bacteria commonly contaminating the oyster and the optimum irradiation doses for sterilization of the most radiation resistant bacteria were investigated. The radiation decimal reduction doses ( D10) of Salmonella Weltevreden DMST 33380, Vibrio parahaemolyticus ATCC 17802 and Vibrio vulnificus DMST 5852 were determined in broth culture and inoculated oyster homogenate. The D10 values of S. Weltevreden, V. parahaemolyticus and V. vulnificus in broth culture were 0.154, 0.132 and 0.059 kGy, while those of inoculated oyster homogenate were 0.330, 0.159 and 0.140 kGy, respectively. It was found that among the pathogens tested, S. Weltevreden was proved to be the most resistant species. An irradiation dose of 1.5 kGy reduced the counts of 10 5 CFU/g S. Weltevreden inoculated in oyster meat to an undetectable level. The present study indicated that a low-dose irradiation can improve the microbial quality of oyster and further reduce the risks from the food-borne pathogens without adversely affecting the sensory attributes.

  15. Tumor-specific apoptotic gene targeting overcomes radiation resistance in esophageal adenocarcinoma

    International Nuclear Information System (INIS)

    Chang, Joe Y.; Zhang Xiaochun; Komaki, Ritsuko; Cheung, Rex; Fang Bingliang

    2006-01-01

    Purpose: To overcome radiation resistance in esophageal adenocarcinoma by tumor-specific apoptotic gene targeting using tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). Methods and Materials: Adenoviral vector Ad/TRAIL-F/RGD with a tumor-specific human telomerase reverse transcription promoter was used to transfer TRAIL gene to human esophageal adenocarcinoma and normal human lung fibroblastic cells (NHLF). Activation of apoptosis was analyzed by Western blot, fluorescent activated cell sorting, and terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate labeling (TUNEL) assay. A human esophageal adenocarcinoma mouse model was treated with intratumoral injections of Ad/TRAIL-F/RGD plus local radiotherapy. Results: The combination of Ad/TRAIL-F/RGD and radiotherapy increased the cell-killing effect in all esophageal adenocarcinoma cell lines but not in NHLF cells. This combination also significantly reduced clonogenic formation (p < 0.05) and increased sub-G1 deoxyribonucleic acid accumulation in cancer cells (p < 0.05). Activation of apoptosis by Ad/TRAIL-F/RGD plus radiotherapy was demonstrated by activation of caspase-9, caspase-8, and caspase-3 and cleaved poly (adenosine diphosphate-ribose) polymerase in vitro and TUNEL assay in vivo. Combined Ad/TRAIL-F/RGD and radiotherapy dramatically inhibited tumor growth and prolonged mean survival in the esophageal adenocarcinoma model to 31.6 days from 16.7 days for radiotherapy alone and 21.5 days for Ad/TRAIL-F/RGD alone (p < 0.05). Conclusions: The combination of tumor-specific TRAIL gene targeting and radiotherapy enhances the effect of suppressing esophageal adenocarcinoma growth and prolonging survival

  16. Electrical resistivity of carbon black-filled high-density polyethylene (HDPE) composite containing radiation crosslinked HDPE particles

    International Nuclear Information System (INIS)

    <