WorldWideScience

Sample records for providing genetic evidence

  1. Genetic data provide evidence for wind-mediated transmission of highly pathogenic avian influenza.

    Science.gov (United States)

    Ypma, Rolf J F; Jonges, Marcel; Bataille, Arnaud; Stegeman, Arjan; Koch, Guus; van Boven, Michiel; Koopmans, Marion; van Ballegooijen, W Marijn; Wallinga, Jacco

    2013-03-01

    Outbreaks of highly pathogenic avian influenza in poultry can cause severe economic damage and represent a public health threat. Development of efficient containment measures requires an understanding of how these influenza viruses are transmitted between farms. However, the actual mechanisms of interfarm transmission are largely unknown. Dispersal of infectious material by wind has been suggested, but never demonstrated, as a possible cause of transmission between farms. Here we provide statistical evidence that the direction of spread of avian influenza A(H7N7) is correlated with the direction of wind at date of infection. Using detailed genetic and epidemiological data, we found the direction of spread by reconstructing the transmission tree for a large outbreak in the Netherlands in 2003. We conservatively estimate the contribution of a possible wind-mediated mechanism to the total amount of spread during this outbreak to be around 18%.

  2. Autosomal STRs provide genetic evidence for the hypothesis that Tai people originate from southern China.

    Directory of Open Access Journals (Sweden)

    Hao Sun

    Full Text Available Tai people are widely distributed in Thailand, Laos and southwestern China and are a large population of Southeast Asia. Although most anthropologists and historians agree that modern Tai people are from southwestern China and northern Thailand, the place from which they historically migrated remains controversial. Three popular hypotheses have been proposed: northern origin hypothesis, southern origin hypothesis or an indigenous origin. We compared the genetic relationships between the Tai in China and their "siblings" to test different hypotheses by analyzing 10 autosomal microsatellites. The genetic data of 916 samples from 19 populations were analyzed in this survey. The autosomal STR data from 15 of the 19 populations came from our previous study (Lin et al., 2010. 194 samples from four additional populations were genotyped in this study: Han (Yunnan, Dai (Dehong, Dai (Yuxi and Mongolian. The results of genetic distance comparisons, genetic structure analyses and admixture analyses all indicate that populations from northern origin hypothesis have large genetic distances and are clearly differentiated from the Tai. The simulation-based ABC analysis also indicates this. The posterior probability of the northern origin hypothesis is just 0.04 [95%CI: (0.01-0.06]. Conversely, genetic relationships were very close between the Tai and populations from southern origin or an indigenous origin hypothesis. Simulation-based ABC analyses were also used to distinguish the southern origin hypothesis from the indigenous origin hypothesis. The results indicate that the posterior probability of the southern origin hypothesis [0.640, 95%CI: (0.524-0.757] is greater than that of the indigenous origin hypothesis [0.324, 95%CI: (0.211-0.438]. Therefore, we propose that the genetic evidence does not support the hypothesis of northern origin. Our genetic data indicate that the southern origin hypothesis has higher probability than the other two hypotheses

  3. Cytoplasmic-genetic male sterility gene provides direct evidence for some hybrid rice recently evolving into weedy rice

    Science.gov (United States)

    Zhang, Jingxu; Lu, Zuomei; Dai, Weimin; Song, Xiaoling; Peng, Yufa; Valverde, Bernal E.; Qiang, Sheng

    2015-01-01

    Weedy rice infests paddy fields worldwide at an alarmingly increasing rate. There is substantial evidence indicating that many weedy rice forms originated from or are closely related to cultivated rice. There is suspicion that the outbreak of weedy rice in China may be related to widely grown hybrid rice due to its heterosis and the diversity of its progeny, but this notion remains unsupported by direct evidence. We screened weedy rice accessions by both genetic and molecular marker tests for the cytoplasmic male sterility (CMS) genes (Wild abortive, WA, and Boro type, BT) most widely used in the production of indica and japonica three-line hybrid rice as a diagnostic trait of direct parenthood. Sixteen weedy rice accessions of the 358 tested (4.5%) contained the CMS-WA gene; none contained the CMS-BT gene. These 16 accessions represent weedy rices recently evolved from maternal hybrid rice derivatives, given the primarily maternal inheritance of this trait. Our results provide key direct evidence that hybrid rice can be involved in the evolution of some weedy rice accessions, but is not a primary factor in the recent outbreak of weedy rice in China. PMID:26012494

  4. Cytoplasmic-genetic male sterility gene provides direct evidence for some hybrid rice recently evolving into weedy rice.

    Science.gov (United States)

    Zhang, Jingxu; Lu, Zuomei; Dai, Weimin; Song, Xiaoling; Peng, Yufa; Valverde, Bernal E; Qiang, Sheng

    2015-05-27

    Weedy rice infests paddy fields worldwide at an alarmingly increasing rate. There is substantial evidence indicating that many weedy rice forms originated from or are closely related to cultivated rice. There is suspicion that the outbreak of weedy rice in China may be related to widely grown hybrid rice due to its heterosis and the diversity of its progeny, but this notion remains unsupported by direct evidence. We screened weedy rice accessions by both genetic and molecular marker tests for the cytoplasmic male sterility (CMS) genes (Wild abortive, WA, and Boro type, BT) most widely used in the production of indica and japonica three-line hybrid rice as a diagnostic trait of direct parenthood. Sixteen weedy rice accessions of the 358 tested (4.5%) contained the CMS-WA gene; none contained the CMS-BT gene. These 16 accessions represent weedy rices recently evolved from maternal hybrid rice derivatives, given the primarily maternal inheritance of this trait. Our results provide key direct evidence that hybrid rice can be involved in the evolution of some weedy rice accessions, but is not a primary factor in the recent outbreak of weedy rice in China.

  5. An X chromosome association scan of the Norfolk Island genetic isolate provides evidence for a novel migraine susceptibility locus at Xq12.

    Directory of Open Access Journals (Sweden)

    Bridget H Maher

    Full Text Available Migraine is a common and debilitating neurovascular disorder with a complex envirogenomic aetiology. Numerous studies have demonstrated a preponderance of women affected with migraine and previous pedigree linkage studies in our laboratory have identified susceptibility loci on chromosome Xq24-Xq28. In this study we have used the genetic isolate of Norfolk Island to further analyse the X chromosome for migraine susceptibility loci.An association approach was employed to analyse 14,124 SNPs spanning the entire X chromosome. Genotype data from 288 individuals comprising a large core-pedigree, of which 76 were affected with migraine, were analysed. Although no SNP reached chromosome-wide significance (empirical α = 1 × 10(-5 ranking by P-value revealed two primary clusters of SNPs in the top 25. A 10 SNP cluster represents a novel migraine susceptibility locus at Xq12 whilst a 11 SNP cluster represents a previously identified migraine susceptibility locus at Xq27. The strongest association at Xq12 was seen for rs599958 (OR = 1.75, P = 8.92 × 10(-4, whilst at Xq27 the strongest association was for rs6525667 (OR = 1.53, P = 1.65 × 10(-4. Further analysis of SNPs at these loci was performed in 5,122 migraineurs from the Women's Genome Health Study and provided additional evidence for association at the novel Xq12 locus (P<0.05.Overall, this study provides evidence for a novel migraine susceptibility locus on Xq12. The strongest effect SNP (rs102834, joint P = 1.63 × 10(-5 is located within the 5'UTR of the HEPH gene, which is involved in iron homeostasis in the brain and may represent a novel pathway for involvement in migraine pathogenesis.

  6. Nucleotide variation in the mitochondrial genome provides evidence for dual routes of postglacial recolonization and genetic recombination in the northeastern brook trout (Salvelinus fontinalis).

    Science.gov (United States)

    Pilgrim, B L; Perry, R C; Barron, J L; Marshall, H D

    2012-09-26

    Levels and patterns of mitochondrial DNA (mtDNA) variation were examined to investigate the population structure and possible routes of postglacial recolonization of the world's northernmost native populations of brook trout (Salvelinus fontinalis), which are found in Labrador, Canada. We analyzed the sequence diversity of a 1960-bp portion of the mitochondrial genome (NADH dehydrogenase 1 gene and part of cytochrome oxidase 1) of 126 fish from 32 lakes distributed throughout seven regions of northeastern Canada. These populations were found to have low levels of mtDNA diversity, a characteristic trait of populations at northern extremes, with significant structuring at the level of the watershed. Upon comparison of northeastern brook trout sequences to the publicly available brook trout whole mitochondrial genome (GenBank AF154850), we infer that the GenBank sequence is from a fish whose mtDNA has recombined with that of Arctic charr (S. alpinus). The haplotype distribution provides evidence of two different postglacial founding groups contributing to present-day brook trout populations in the northernmost part of their range; the evolution of the majority of the haplotypes coincides with the timing of glacier retreat from Labrador. Our results exemplify the strong influence that historical processes such as glaciations have had on shaping the current genetic structure of northern species such as the brook trout.

  7. A High-Density Genetic Map of Wild Emmer Wheat from the Karaca Dağ Region Provides New Evidence on the Structure and Evolution of Wheat Chromosomes

    Directory of Open Access Journals (Sweden)

    Chad Jorgensen

    2017-10-01

    Full Text Available Wild emmer (Triticum turgidum ssp. dicoccoides is a progenitor of all cultivated wheat grown today. It has been hypothesized that emmer was domesticated in the Karaca Dağ region in southeastern Turkey. A total of 445 recombinant inbred lines of T. turgidum ssp. durum cv. ‘Langdon’ x wild emmer accession PI 428082 from this region was developed and genotyped with the Illumina 90K single nucleotide polymorphism Infinium assay. A genetic map comprising 2,650 segregating markers was constructed. The order of the segregating markers and an additional 8,264 co-segregating markers in the Aegilops tauschii reference genome sequence was used to compare synteny of the tetraploid wheat with the Brachypodium distachyon, rice, and sorghum. These comparisons revealed the presence of 15 structural chromosome rearrangements, in addition to the already known 4A-5A-7B rearrangements. The most common type was an intra-chromosomal translocation in which the translocated segment was short and was translocated only a short distance along the chromosome. A large reciprocal translocation, one small non-reciprocal translocation, and three large and one small paracentric inversions were also discovered. The use of inversions for a phylogeny reconstruction in the Triticum–Aegilops alliance was illustrated. The genetic map was inconsistent with the current model of evolution of the rearranged chromosomes 4A-5A-7B. Genetic diversity in the rearranged chromosome 4A showed that the rearrangements might have been contemporary with wild emmer speciation. A selective sweep was found in the centromeric region of chromosome 4A in Karaca Dağ wild emmer but not in 4A of T. aestivum. The absence of diversity from a large portion of chromosome 4A of wild emmer, believed to be ancestral to all domesticated wheat, is puzzling.

  8. Genome-Wide Analysis Provides Evidence on the Genetic Relatedness of the Emergent Xylella fastidiosa Genotype in Italy to Isolates from Central America.

    Science.gov (United States)

    Giampetruzzi, Annalisa; Saponari, Maria; Loconsole, Giuliana; Boscia, Donato; Savino, Vito Nicola; Almeida, Rodrigo P P; Zicca, Stefania; Landa, Blanca B; Chacón-Diaz, Carlos; Saldarelli, Pasquale

    2017-07-01

    Xylella fastidiosa is a plant-pathogenic bacterium recently introduced in Europe that is causing decline in olive trees in the South of Italy. Genetic studies have consistently shown that the bacterial genotype recovered from infected olive trees belongs to the sequence type ST53 within subspecies pauca. This genotype, ST53, has also been reported to occur in Costa Rica. The ancestry of ST53 was recently clarified, showing it contains alleles that are monophyletic with those of subsp. pauca in South America. To more robustly determine the phylogenetic placement of ST53 within X. fastidiosa, we performed a comparative analysis based on single nucleotide polymorphisms (SNPs) and the study of the pan-genome of the 27 currently public available whole genome sequences of X. fastidiosa. The resulting maximum-parsimony and maximum likelihood trees constructed using the SNPs and the pan-genome analysis are consistent with previously described X. fastidiosa taxonomy, distinguishing the subsp. fastidiosa, multiplex, pauca, sandyi, and morus. Within the subsp. pauca, the Italian and three Costa Rican isolates, all belonging to ST53, formed a compact phylotype in a clade divergent from the South American pauca isolates, also distinct from the recently described coffee isolate CFBP8072 imported into Europe from Ecuador. These findings were also supported by the gene characterization of a conjugative plasmid shared by all the four ST53 isolates. Furthermore, isolates of the ST53 clade possess an exclusive locus encoding a putative ATP-binding protein belonging to the family of histidine kinase-like ATPase gene, which is not present in isolates from the subspecies multiplex, sandyi, and pauca, but was detected in ST21 isolates of the subspecies fastidiosa from Costa Rica. The clustering and distinctiveness of the ST53 isolates supports the hypothesis of their common origin, and the limited genetic diversity among these isolates suggests this is an emerging clade within subsp

  9. Deciphering the genomes of 16 Acanthamoeba species does not provide evidence of integration of known giant virus-associated mobile genetic elements.

    Science.gov (United States)

    Chelkha, Nisrine; Colson, Philippe; Levasseur, Anthony; La Scola, Bernard

    2018-06-02

    Giant viruses infect protozoa, especially amoebae of the genus Acanthamoeba. These viruses possess genetic elements named Mobilome. So far, this mobilome comprises provirophages which are integrated into the genome of their hosts, transpovirons, and Maverick/Polintons. Virophages replicate inside virus factories within Acanthamoeba and can decrease the infectivity of giant viruses. The virophage infecting CroV was found to be integrated in the host of CroV, Cafeteria roenbergensis, thus protecting C. roenbergensis by reduction of CroV multiplication. Because of this unique property, assessment of the mechanisms of replication of virophages and their relationship with giant viruses is a key element of this investigation. This work aimed at evaluating the presence and the dynamic of these mobile elements in sixteen Acanthamoeba genomes. No significant traces of the integration of genomes or sequences from known virophages were identified in all the available Acanthamoeba genomes. These results brought us to hypothesize that the interactions between mimiviruses and their virophages might occur through different mechanisms, or at low frequency. An additional explanation could be that our knowledge of the diversity of virophages is still very limited. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Genetic Analysis of Microglandular Adenosis and Acinic Cell Carcinomas of the Breast Provides Evidence for the Existence of a Low-grade Triple-Negative Breast Neoplasia Family

    Science.gov (United States)

    Geyer, Felipe C; Berman, Samuel H.; Marchiò, Caterina; Burke, Kathleen A; Guerini-Rocco, Elena; Piscuoglio, Salvatore; Ng, Charlotte K Y; Pareja, Fresia; Wen, Hannah Y; Hodi, Zoltan; Schnitt, Stuart J; Rakha, Emad A; Ellis, Ian O; Norton, Larry; Weigelt, Britta; Reis-Filho, Jorge S

    2016-01-01

    Acinic cell carcinoma is an indolent form of invasive breast cancer, whereas microglandular adenosis has been shown to be a neoplastic proliferation. Both entities display a triple-negative phenotype, and may give rise to and display somatic genomic alterations typical of high-grade triple-negative breast cancers. Here we report on a comparison of previously published data on eight carcinoma-associated microglandular adenosis and eight acinic cell carcinomas subjected to targeted massively parallel sequencing targeting all exons of 236 genes recurrently mutated in breast cancer and/or DNA repair-related. Somatic mutations, insertions/deletions and copy number alterations were detected using state-of-the-art bioinformatic algorithms. All cases were of triple-negative phenotype. A median of 4.5 (1–13) and 4.0 (1–7) non-synonymous somatic mutations per carcinoma-associated microglandular adenosis and acinic cell carcinoma were identified, respectively. TP53 was the sole highly recurrently mutated gene (75% in microglandular adenosis versus 88% in acinic cell carcinomas), and TP53 mutations were consistently coupled with loss of heterozygosity of the wild-type allele. Additional somatic mutations shared by both groups included those in BRCA1, PIK3CA and INPP4B. Recurrent (n=2) somatic mutations restricted to microglandular adenosis or acinic cell carcinomas included those affecting PTEN and MED12, or ERBB4, respectively. No significant differences in the repertoire of somatic mutations were detected between microglandular adenosis and acinic cell carcinomas, and between this group of lesions and 77 triple-negative carcinomas from The Cancer Genome Atlas. Microglandular adenosis and acinic cell carcinomas, however, were genetically distinct from estrogen receptor-positive and/or HER2-positive breast cancers from The Cancer Genome Atlas. Our findings support the contention that microglandular adenosis and acinic cell carcinoma are part of the same spectrum of lesions

  11. Can lip prints provide biologic evidence?

    Science.gov (United States)

    Sharma, Preeti; Sharma, Neeraj; Wadhwan, Vijay; Aggarwal, Pooja

    2016-01-01

    Lip prints are unique and can be used in personal identification. Very few studies are available which establish them as biological evidence in the court of law. Thus, the objective of this study was to attempt to isolate DNA and obtain full short tandem repeat (STR) loci of the individual from the lip prints on different surfaces. Twelve lip prints were procured on different surfaces such as tissue paper, cotton cloth, ceramic tile, and glass surface. Latent lip prints were developed using fingerprint black powder. Lipstick-coated lip prints were also collected on the same supporting items. DNA was isolated, quantified, and amplified using Identifiler™ kit to type 15 STR loci. Ample quantity of DNA was extracted from all the lip print impressions and 15 loci were successfully located in seven samples. Fourteen loci were successfully typed in 3 lip impressions while 13 loci were typed in 2 samples. This study emphasizes the relevance of lip prints at the scene of crime. Extraction of DNA followed by typing of STR loci establishes the lip prints as biological evidence too. Tissue papers, napkins, cups, and glasses may have imprints of the suspect's lips. Thus, the full genetic profile is extremely useful for the forensic team.

  12. Primary care providers' lived experiences of genetics in practice.

    Science.gov (United States)

    Harding, Brittany; Webber, Colleen; Ruhland, Lucia; Dalgarno, Nancy; Armour, Christine M; Birtwhistle, Richard; Brown, Glenn; Carroll, June C; Flavin, Michael; Phillips, Susan; MacKenzie, Jennifer J

    2018-04-26

    To effectively translate genetic advances into practice, engagement of primary care providers (PCPs) is essential. Using a qualitative, phenomenological methodology, we analyzed key informant interviews and focus groups designed to explore perspectives of urban and rural PCPs. PCPs endorsed a responsibility to integrate genetics into their practices and expected advances in genetic medicine to expand. However, PCPs reported limited knowledge and difficulties accessing resources, experts, and continuing education. Rural practitioners' additional concerns included cost, distance, and poor patient engagement. PCPs' perspectives are crucial to develop relevant educational and systems-based interventions to further expand genetic medicine in primary care.

  13. Genetic Evidence for Modifying Oceanic Boundaries Relative to Fiji.

    Science.gov (United States)

    Shipley, Gerhard P; Taylor, Diana A; N'Yeurt, Antoine D R; Tyagi, Anand; Tiwari, Geetanjali; Redd, Alan J

    2016-07-01

    We present the most comprehensive genetic characterization to date of five Fijian island populations: Viti Levu, Vanua Levu, Kadavu, the Lau Islands, and Rotuma, including nonrecombinant Y (NRY) chromosome and mitochondrial DNA (mtDNA) haplotypes and haplogroups. As a whole, Fijians are genetically intermediate between Melanesians and Polynesians, but the individual Fijian island populations exhibit significant genetic structure reflecting different settlement experiences in which the Rotumans and the Lau Islanders were more influenced by Polynesians, and the other Fijian island populations were more influenced by Melanesians. In particular, Rotuman and Lau Islander NRY chromosomal and mtDNA haplogroup frequencies and Rotuman mtDNA hypervariable segment 1 region haplotypes more closely resemble those of Polynesians, while genetic markers of the other populations more closely resemble those of the Near Oceanic Melanesians. Our findings provide genetic evidence supportive of modifying regional boundaries relative to Fiji, as has been suggested by others based on a variety of nongenetic evidence. Specifically, for the traditional Melanesia/Polynesia/Micronesia scheme, our findings support moving the Melanesia-Polynesia boundary to include Rotuma and the Lau Islands in Polynesia. For the newer Near/Remote Oceania scheme, our findings support keeping Rotuma and the Lau Islands in Remote Oceania and locating the other Fijian island populations in an intermediate or "Central Oceania" region to better reflect the great diversity of Oceania.

  14. Genetic evidence for patrilocal mating behavior among Neandertal groups

    DEFF Research Database (Denmark)

    Lalueza-Fox, Carles; Rosas, Antonio; Estalrrich, Almudena

    2011-01-01

    The remains of 12 Neandertal individuals have been found at the El Sidrón site (Asturias, Spain), consisting of six adults, three adolescents, two juveniles, and one infant. Archaeological, paleontological, and geological evidence indicates that these individuals represent all or part of a contem...... of the three adult females carried different mtDNA lineages. These findings provide evidence to indicate that Neandertal groups not only were small and characterized by low genetic diversity but also were likely to have practiced patrilocal mating behavior....

  15. Genetics of Schizophrenia: Historical Insights and Prevailing Evidence.

    Science.gov (United States)

    van de Leemput, J; Hess, J L; Glatt, S J; Tsuang, M T

    2016-01-01

    Schizophrenia's (SZ's) heritability and familial transmission have been known for several decades; however, despite the clear evidence for a genetic component, it has been very difficult to pinpoint specific causative genes. Even so genetic studies have taught us a lot, even in the pregenomic era, about the molecular underpinnings and disease-relevant pathways. Recurring themes emerged revealing the involvement of neurodevelopmental processes, glutamate regulation, and immune system differential activation in SZ etiology. The recent emergence of epigenetic studies aimed at shedding light on the biological mechanisms underlying SZ has provided another layer of information in the investigation of gene and environment interactions. However, this epigenetic insight also brings forth another layer of complexity to the (epi)genomic landscape such as interactions between genetic variants, epigenetic marks-including cross-talk between DNA methylation and histone modification processes-, gene expression regulation, and environmental influences. In this review, we seek to synthesize perspectives, including limitations and obstacles yet to overcome, from genetic and epigenetic literature on SZ through a qualitative review of risk factors and prevailing hypotheses. Encouraged by the findings of both genetic and epigenetic studies to date, as well as the continued development of new technologies to collect and interpret large-scale studies, we are left with a positive outlook for the future of elucidating the molecular genetic mechanisms underlying SZ and other complex neuropsychiatric disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Evidence for a genetic etiology of early-onset delinquency.

    Science.gov (United States)

    Taylor, J; Iacono, W G; McGue, M

    2000-11-01

    Age at onset of antisocial behavior discriminates persistent and transitory offenders. The authors proposed that early-onset delinquency has an underlying genetic influence that manifests in problems related to inhibition, whereas late-onset delinquency is more environmentally mediated. To test these notions, they selected 36 early starters, 86 late starters, and 25 nondelinquent controls from a large sample of 11-year-old twins and compared them on several measures related to inhibition and a peer group measure. As expected, early starters had more psychological, behavioral, and emotional problems related to inhibition than late starters and controls. A longitudinal analysis indicated an increase an antisocial behavior among peers of late starters shortly before their delinquency onset. Family history data and a twin analysis provided evidence of greater genetic influence on early-onset than late-onset delinquency.

  17. Current Evidence and Insights about Genetics in Thoracic Aorta Disease

    Science.gov (United States)

    Muneretto, Claudio

    2013-01-01

    Thoracic aortic aneurysms have been historically considered to be caused by etiologic factors similar to those implied in abdominal aortic aneurysms. However, during the past decade, there has been increasing evidence that almost 20% of thoracic aortic aneurysms may be associated with a genetic disease, often within a syndromic or familial disorder. Moreover, the presence of congenital anomalies, such as bicuspid aortic valve, may have a unique common genetic underlying cause. Finally, also sporadic forms have been found to be potentially associated with genetic disorders, as highlighted by the analysis of rare variants and expression of specific microRNAs. We therefore sought to perform a comprehensive review of the role of genetic causes in the development of thoracic aortic aneurysms, by analyzing in detail the current evidence of genetic alterations in syndromes such as Marfan, Loeys-Dietz, and Ehler-Danlos, familial or sporadic forms, or forms associated with bicuspid aortic valve. PMID:24453931

  18. Evidence that pairing with genetically similar mates is maladaptive in a monogamous bird

    Science.gov (United States)

    Mulard, Hervé; Danchin, E.; Talbot, S.L.; Ramey, A.M.; Hatch, Shyla A.; White, J.F.; Helfenstein, F.; Wagner, R.H.

    2009-01-01

    Background. Evidence of multiple genetic criteria of mate choice is accumulating in numerous taxa. In many species, females have been shown to pair with genetically dissimilar mates or with extra-pair partners that are more genetically compatible than their social mates, thereby increasing their offsprings' heterozygosity which often correlates with offspring fitness. While most studies have focused on genetically promiscuous species, few studies have addressed genetically monogamous species, in which mate choice tends to be mutual. Results. Here, we used microsatellite markers to assess individual global heterozygosity and genetic similarity of pairs in a socially and genetically monogamous seabird, the black-legged kittiwake Rissa tridactyla. We found that pairs were more genetically dissimilar than expected by chance. We also identified fitness costs of breeding with genetically similar partners: (i) genetic similarity of pairs was negatively correlated with the number of chicks hatched, and (ii) offspring heterozygosity was positively correlated with growth rate and survival. Conclusion. These findings provide evidence that breeders in a genetically monogamous species may avoid the fitness costs of reproducing with a genetically similar mate. In such species that lack the opportunity to obtain extra-pair fertilizations, mate choice may therefore be under high selective pressure. ?? 2009 Mulard et al; licensee BioMed Central Ltd.

  19. Evidence that pairing with genetically similar mates is maladaptive in a monogamous bird

    Directory of Open Access Journals (Sweden)

    Ramey Andrew M

    2009-06-01

    Full Text Available Abstract Background Evidence of multiple genetic criteria of mate choice is accumulating in numerous taxa. In many species, females have been shown to pair with genetically dissimilar mates or with extra-pair partners that are more genetically compatible than their social mates, thereby increasing their offsprings' heterozygosity which often correlates with offspring fitness. While most studies have focused on genetically promiscuous species, few studies have addressed genetically monogamous species, in which mate choice tends to be mutual. Results Here, we used microsatellite markers to assess individual global heterozygosity and genetic similarity of pairs in a socially and genetically monogamous seabird, the black-legged kittiwake Rissa tridactyla. We found that pairs were more genetically dissimilar than expected by chance. We also identified fitness costs of breeding with genetically similar partners: (i genetic similarity of pairs was negatively correlated with the number of chicks hatched, and (ii offspring heterozygosity was positively correlated with growth rate and survival. Conclusion These findings provide evidence that breeders in a genetically monogamous species may avoid the fitness costs of reproducing with a genetically similar mate. In such species that lack the opportunity to obtain extra-pair fertilizations, mate choice may therefore be under high selective pressure.

  20. The PERSIAN Cohort: Providing the Evidence Needed for Healthcare Reform.

    Science.gov (United States)

    Eghtesad, Sareh; Mohammadi, Zahra; Shayanrad, Amaneh; Faramarzi, Elnaz; Joukar, Farahnaz; Hamzeh, Behrooz; Farjam, Mojtaba; Zare Sakhvidi, Mohammad Javad; Miri-Monjar, Mohammadreza; Moosazadeh, Mahmood; Hakimi, Hamid; Rahimi Kazerooni, Salar; Cheraghian, Bahman; Ahmadi, Ali; Nejatizadeh, Azim; Mohebbi, Iraj; Pourfarzi, Farhad; Roozafzai, Farzin; Motamed-Gorji, Nazgol; Montazeri, Seyed Ali; Masoudi, Sahar; Amin-Esmaeili, Masoumeh; Danaie, Navid; Mirhafez, Seyed Reza; Hashemi, Hasan; Poustchi, Hossein; Malekzadeh, Reza

    2017-11-01

    In the past, communicable diseases caused the highest mortality in Iran. Improvements in socioeconomic status and living standards including access to safe drinking water, along with the inception of Health Houses in the 1980s, have changed disease patterns, decreasing the spread of and deaths from infectious and communicable diseases. The incidence and prevalence of non-communicable diseases (NCD), however, have now increased in Iran, accounting for nearly 80% of deaths and disabilities. Without interventions, NCD are predicted to impose a substantial human and economic burden in the next 2 decades. However, Iran's health system is not equipped with the necessary policies to combat this growth and must refocus and reform. Therefore, in the year 2013, the Ministry of Health and Medical Education funded a well-designed nationwide cohort study-Prospective Epidemiological Research Studies in IrAN (PERSIAN)-in order to assess the burden of NCD and investigate the risk factors associated with them in the different ethnicities and geographical areas of Iran. The PERSIAN Cohort, which aims to include 200000 participants, has 4 components: Adult (main), Birth, Youth and Elderly, which are being carried out in 22 different regions of Iran. Having an enormous dataset along with a biobank of blood, urine, hair and nail samples, the PERSIAN Cohort will serve as an important infrastructure for future implementation research and will provide the evidence needed for new healthcare policies in order to better control, manage and prevent NCD. Copyright © 2017 The Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

  1. Genetics of Ustilago violacea. XXXII. Genetic evidence for transposable elements.

    Science.gov (United States)

    Garber, E D; Ruddat, M

    1994-12-01

    Crosses between Ustilago violacea mutant strains with different color phenotypes that were derived from the 1.A1 and 2.A2 laboratory strains yielded, as expected, bisectored teliospore colonies with the parental colors as well as the a-1 and the a-2 mating-types. Generally, wild teliospore collections usually produced sporidia of both mating-types, providing two-mating-type (TMT) strains. Occasionally, however, sporidia with only one mating-type allele, a-1 or a-2, were obtained from teliospores, providing one-mating-type (OMT) strains. Crosses between OMT and laboratory strains with different color phenotypes gave (1) bisectored teliospore colonies with the parental colors or colonies with a parental color and a nonparental color and (2) nonsectored colonies with the nonparental color or with the parental color. The frequencies for the occurrence of non-parental color ranged from 41% to 93%, depending on the strain. The yield of teliospore colonies was usually reduced for these crosses. In many of these teliospore colonies, morphologically-altered sporidia (MAS phenotype) were observed. The morphology and the size of the sporidia with the MAS phenotype differed from those of teliospore colonies of the crosses between the laboratory strains. In addition, these sporidia did not form conjugants. A cross involving the TMT strains C449 yielded the MAS phenotype as well as a high incidence of tetrad colonies with a nonparental color. The high degree of instability of the parental color phenotypes, and the high frequency of the appearance of nonparental color phenotypes as well as the appearance of the MAS phenotype, are in accord with the presence of active and inactive transposable elements in the OMT strains, TMT strains, and laboratory strains.

  2. New technologies provide insights into genetic basis of psychiatric disorders and explain their co-morbidity.

    Science.gov (United States)

    Rudan, Igor

    2010-06-01

    The completion of Human Genome Project and the "HapMap" project was followed by translational activities from companies within the private sector. This led to the introduction of genome-wide scans based on hundreds of thousands of single nucleotide polymorphysms (SNP). These scans were based on common genetic variants in human populations. This new and powerful technology was then applied to the existing DNA-based datasets with information on psychiatric disorders. As a result, an unprecedented amount of novel scientific insights related to the underlying biology and genetics of psychiatric disorders was obtained. The dominant design of these studies, so called "genome-wide association studies" (GWAS), used statistical methods which minimized the risk of false positive reports and provided much greater power to detect genotype-phenotype associations. All findings were entirely data-driven rather than hypothesis-driven, which often made it difficult for researchers to understand or interpret the findings. Interestingly, this work in genetics is indicating how non-specific some genes are for psychiatric disorders, having associations in common for schizophrenia, bipolar disorder and autism. This suggests that the earlier stages of psychiatric disorders may be multi-valent and that early detection, coupled with a clearer understanding of the environmental factors, may allow prevention. At the present time, the rich "harvest" from GWAS still has very limited power to predict the variation in psychiatric disease status at individual level, typically explaining less than 5% of the total risk variance. The most recent studies of common genetic variation implicated the role of major histocompatibility complex in schizophrenia and other disorders. They also provided molecular evidence for a substantial polygenic component to the risk of psychiatric diseases, involving thousands of common alleles of very small effect. The studies of structural genetic variation, such as copy

  3. Whole-Genome Scans Provide Evidence of Adaptive Evolution in Malawian Plasmodium falciparum Isolates

    DEFF Research Database (Denmark)

    Ocholla, Harold; Preston, Mark D; Mipando, Mwapatsa

    2014-01-01

    BACKGROUND:  Selection by host immunity and antimalarial drugs has driven extensive adaptive evolution in Plasmodium falciparum and continues to produce ever-changing landscapes of genetic variation. METHODS:  We performed whole-genome sequencing of 69 P. falciparum isolates from Malawi and used......, an area of high malaria transmission. Allele frequency-based tests provided evidence of recent population growth in Malawi and detected potential targets of host immunity and candidate vaccine antigens. Comparison of the sequence variation between isolates from Malawi and those from 5 geographically...... dispersed countries (Kenya, Burkina Faso, Mali, Cambodia, and Thailand) detected population genetic differences between Africa and Asia, within Southeast Asia, and within Africa. Haplotype-based tests of selection to sequence data from all 6 populations identified signals of directional selection at known...

  4. Review: domestic animal forensic genetics - biological evidence, genetic markers, analytical approaches and challenges.

    Science.gov (United States)

    Kanthaswamy, S

    2015-10-01

    This review highlights the importance of domestic animal genetic evidence sources, genetic testing, markers and analytical approaches as well as the challenges this field is facing in view of the de facto 'gold standard' human DNA identification. Because of the genetic similarity between humans and domestic animals, genetic analysis of domestic animal hair, saliva, urine, blood and other biological material has generated vital investigative leads that have been admitted into a variety of court proceedings, including criminal and civil litigation. Information on validated short tandem repeat, single nucleotide polymorphism and mitochondrial DNA markers and public access to genetic databases for forensic DNA analysis is becoming readily available. Although the fundamental aspects of animal forensic genetic testing may be reliable and acceptable, animal forensic testing still lacks the standardized testing protocols that human genetic profiling requires, probably because of the absence of monetary support from government agencies and the difficulty in promoting cooperation among competing laboratories. Moreover, there is a lack in consensus about how to best present the results and expert opinion to comply with court standards and bear judicial scrutiny. This has been the single most persistent challenge ever since the earliest use of domestic animal forensic genetic testing in a criminal case in the mid-1990s. Crime laboratory accreditation ensures that genetic test results have the courts' confidence. Because accreditation requires significant commitments of effort, time and resources, the vast majority of animal forensic genetic laboratories are not accredited nor are their analysts certified forensic examiners. The relevance of domestic animal forensic genetics in the criminal justice system is undeniable. However, further improvements are needed in a wide range of supporting resources, including standardized quality assurance and control protocols for sample

  5. Evidence for nonallelic genetic heterogeneity in autosomal recessive retinitis pigmentosa

    NARCIS (Netherlands)

    Bleeker-Wagemakers, L. M.; Gal, A.; Kumar-Singh, R.; van den Born, L. I.; Li, Y.; Schwinger, E.; Sandkuijl, L. A.; Bergen, A. A.; Kenna, P.; Humphries, P.

    1992-01-01

    Recent evidence suggesting the involvement of mutant rhodopsin proteins in the pathogenesis of autosomal recessive retinitis pigmentosa has prompted us to investigate whether this form of the disease shows non-allelic genetic heterogeneity, as has previously been shown to be the case in autosomal

  6. Genetic and biochemical evidences reveal novel insights into the ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences; Volume 41; Issue 4. Genetic and biochemical evidences reveal novel insights into the mechanism underlying Saccharomyces cerevisiae Sae2-mediated abrogation of DNA replication stress. INDRAJEET GHODKE K MUNIYAPPA. ARTICLE Volume 41 Issue 4 December 2016 pp ...

  7. Genetic evidence for hybrid trait speciation in heliconius butterflies.

    Directory of Open Access Journals (Sweden)

    Camilo Salazar

    2010-04-01

    Full Text Available Homoploid hybrid speciation is the formation of a new hybrid species without change in chromosome number. So far, there has been a lack of direct molecular evidence for hybridization generating novel traits directly involved in animal speciation. Heliconius butterflies exhibit bright aposematic color patterns that also act as cues in assortative mating. Heliconius heurippa has been proposed as a hybrid species, and its color pattern can be recreated by introgression of the H. m. melpomene red band into the genetic background of the yellow banded H. cydno cordula. This hybrid color pattern is also involved in mate choice and leads to reproductive isolation between H. heurippa and its close relatives. Here, we provide molecular evidence for adaptive introgression by sequencing genes across the Heliconius red band locus and comparing them to unlinked wing patterning genes in H. melpomene, H. cydno, and H. heurippa. 670 SNPs distributed among 29 unlinked coding genes (25,847bp showed H. heurippa was related to H. c. cordula or the three species were intermixed. In contrast, among 344 SNPs distributed among 13 genes in the red band region (18,629bp, most showed H. heurippa related with H. c. cordula, but a block of around 6,5kb located in the 3' of a putative kinesin gene grouped H. heurippa with H. m. melpomene, supporting the hybrid introgression hypothesis. Genealogical reconstruction showed that this introgression occurred after divergence of the parental species, perhaps around 0.43Mya. Expression of the kinesin gene is spatially restricted to the distal region of the forewing, suggesting a mechanism for pattern regulation. This gene therefore constitutes the first molecular evidence for adaptive introgression during hybrid speciation and is the first clear candidate for a Heliconius wing patterning locus.

  8. Psychiatric genetic testing: Attitudes and intentions among future users and providers

    DEFF Research Database (Denmark)

    Laegsgaard, Mett Marri; Mors, Ole

    2008-01-01

    as a guide in this field, but the optimal utilization of genetic testing has also been recognized to depend on knowledge of the potential consumers' attitudes. To provide knowledge to inform the public debate on mental illness and genetics, and the future conducting of psychiatric genetic testing....... Psychiatric and somatic genetic testing attracted the same amounts of accept. General attitudes toward access to psychiatric genetic testing and information revealed substantial support for bioethical principles of autonomy and privacy. However, questions describing more specific situations revealed......Psychiatric genetic research may eventually render possible psychiatric genetic testing. Whereas all genetic knowledge has certain characteristics raising ethical, legal, and social issues, psychiatric genetic knowledge adds more controversial issues. Ethical principles have been proposed...

  9. Levels of Evidence: Cancer Genetics Studies (PDQ®)—Health Professional Version

    Science.gov (United States)

    Levels of Evidence for Cancer Genetics Studies addresses the process and challenges of developing evidence-based summaries. Get information about how to weigh the strength of the evidence from cancer genetics studies in this summary for clinicians.

  10. Evidence for genetic association of RORB with bipolar disorder

    Directory of Open Access Journals (Sweden)

    Mick Eric

    2009-11-01

    Full Text Available Abstract Background Bipolar disorder, particularly in children, is characterized by rapid cycling and switching, making circadian clock genes plausible molecular underpinnings for bipolar disorder. We previously reported work establishing mice lacking the clock gene D-box binding protein (DBP as a stress-reactive genetic animal model of bipolar disorder. Microarray studies revealed that expression of two closely related clock genes, RAR-related orphan receptors alpha (RORA and beta (RORB, was altered in these mice. These retinoid-related receptors are involved in a number of pathways including neurogenesis, stress response, and modulation of circadian rhythms. Here we report association studies between bipolar disorder and single-nucleotide polymorphisms (SNPs in RORA and RORB. Methods We genotyped 355 RORA and RORB SNPs in a pediatric cohort consisting of a family-based sample of 153 trios and an independent, non-overlapping case-control sample of 152 cases and 140 controls. Bipolar disorder in children and adolescents is characterized by increased stress reactivity and frequent episodes of shorter duration; thus our cohort provides a potentially enriched sample for identifying genes involved in cycling and switching. Results We report that four intronic RORB SNPs showed positive associations with the pediatric bipolar phenotype that survived Bonferroni correction for multiple comparisons in the case-control sample. Three RORB haplotype blocks implicating an additional 11 SNPs were also associated with the disease in the case-control sample. However, these significant associations were not replicated in the sample of trios. There was no evidence for association between pediatric bipolar disorder and any RORA SNPs or haplotype blocks after multiple-test correction. In addition, we found no strong evidence for association between the age-at-onset of bipolar disorder with any RORA or RORB SNPs. Conclusion Our findings suggest that clock genes in

  11. Tourette's Disorder: Genetic Update, Neurological Correlates, and Evidence-Based Interventions

    Science.gov (United States)

    Phelps, LeAdelle

    2008-01-01

    This article provides an update of the search for genetic markers related to Tourette's Disorder. The probable neurophysiology of the disorder is reviewed. Frequently prescribed medications are related to the probable biological bases of the disorder. Behavioral interventions and assessment tools are examined. It is concluded that evidence based…

  12. Extensive genetic diversity, unique population structure and evidence of genetic exchange in the sexually transmitted parasite Trichomonas vaginalis.

    Directory of Open Access Journals (Sweden)

    Melissa D Conrad

    Full Text Available Trichomonas vaginalis is the causative agent of human trichomoniasis, the most common non-viral sexually transmitted infection world-wide. Despite its prevalence, little is known about the genetic diversity and population structure of this haploid parasite due to the lack of appropriate tools. The development of a panel of microsatellite makers and SNPs from mining the parasite's genome sequence has paved the way to a global analysis of the genetic structure of the pathogen and association with clinical phenotypes.Here we utilize a panel of T. vaginalis-specific genetic markers to genotype 235 isolates from Mexico, Chile, India, Australia, Papua New Guinea, Italy, Africa and the United States, including 19 clinical isolates recently collected from 270 women attending New York City sexually transmitted disease clinics. Using population genetic analysis, we show that T. vaginalis is a genetically diverse parasite with a unique population structure consisting of two types present in equal proportions world-wide. Parasites belonging to the two types (type 1 and type 2 differ significantly in the rate at which they harbor the T. vaginalis virus, a dsRNA virus implicated in parasite pathogenesis, and in their sensitivity to the widely-used drug, metronidazole. We also uncover evidence of genetic exchange, indicating a sexual life-cycle of the parasite despite an absence of morphologically-distinct sexual stages.Our study represents the first robust and comprehensive evaluation of global T. vaginalis genetic diversity and population structure. Our identification of a unique two-type structure, and the clinically relevant phenotypes associated with them, provides a new dimension for understanding T. vaginalis pathogenesis. In addition, our demonstration of the possibility of genetic exchange in the parasite has important implications for genetic research and control of the disease.

  13. Extensive genetic diversity, unique population structure and evidence of genetic exchange in the sexually transmitted parasite Trichomonas vaginalis.

    Science.gov (United States)

    Conrad, Melissa D; Gorman, Andrew W; Schillinger, Julia A; Fiori, Pier Luigi; Arroyo, Rossana; Malla, Nancy; Dubey, Mohan Lal; Gonzalez, Jorge; Blank, Susan; Secor, William E; Carlton, Jane M

    2012-01-01

    Trichomonas vaginalis is the causative agent of human trichomoniasis, the most common non-viral sexually transmitted infection world-wide. Despite its prevalence, little is known about the genetic diversity and population structure of this haploid parasite due to the lack of appropriate tools. The development of a panel of microsatellite makers and SNPs from mining the parasite's genome sequence has paved the way to a global analysis of the genetic structure of the pathogen and association with clinical phenotypes. Here we utilize a panel of T. vaginalis-specific genetic markers to genotype 235 isolates from Mexico, Chile, India, Australia, Papua New Guinea, Italy, Africa and the United States, including 19 clinical isolates recently collected from 270 women attending New York City sexually transmitted disease clinics. Using population genetic analysis, we show that T. vaginalis is a genetically diverse parasite with a unique population structure consisting of two types present in equal proportions world-wide. Parasites belonging to the two types (type 1 and type 2) differ significantly in the rate at which they harbor the T. vaginalis virus, a dsRNA virus implicated in parasite pathogenesis, and in their sensitivity to the widely-used drug, metronidazole. We also uncover evidence of genetic exchange, indicating a sexual life-cycle of the parasite despite an absence of morphologically-distinct sexual stages. Our study represents the first robust and comprehensive evaluation of global T. vaginalis genetic diversity and population structure. Our identification of a unique two-type structure, and the clinically relevant phenotypes associated with them, provides a new dimension for understanding T. vaginalis pathogenesis. In addition, our demonstration of the possibility of genetic exchange in the parasite has important implications for genetic research and control of the disease.

  14. Phylogenomics provides strong evidence for relationships of butterflies and moths.

    Science.gov (United States)

    Kawahara, Akito Y; Breinholt, Jesse W

    2014-08-07

    Butterflies and moths constitute some of the most popular and charismatic insects. Lepidoptera include approximately 160 000 described species, many of which are important model organisms. Previous studies on the evolution of Lepidoptera did not confidently place butterflies, and many relationships among superfamilies in the megadiverse clade Ditrysia remain largely uncertain. We generated a molecular dataset with 46 taxa, combining 33 new transcriptomes with 13 available genomes, transcriptomes and expressed sequence tags (ESTs). Using HaMStR with a Lepidoptera-specific core-orthologue set of single copy loci, we identified 2696 genes for inclusion into the phylogenomic analysis. Nucleotides and amino acids of the all-gene, all-taxon dataset yielded nearly identical, well-supported trees. Monophyly of butterflies (Papilionoidea) was strongly supported, and the group included skippers (Hesperiidae) and the enigmatic butterfly-moths (Hedylidae). Butterflies were placed sister to the remaining obtectomeran Lepidoptera, and the latter was grouped with greater than or equal to 87% bootstrap support. Establishing confident relationships among the four most diverse macroheteroceran superfamilies was previously challenging, but we recovered 100% bootstrap support for the following relationships: ((Geometroidea, Noctuoidea), (Bombycoidea, Lasiocampoidea)). We present the first robust, transcriptome-based tree of Lepidoptera that strongly contradicts historical placement of butterflies, and provide an evolutionary framework for genomic, developmental and ecological studies on this diverse insect order. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  15. Genetic evidence for a Paleolithic human population expansion in Africa

    Science.gov (United States)

    Reich, David E.; Goldstein, David B.

    1998-01-01

    Human populations have undergone dramatic expansions in size, but other than the growth associated with agriculture, the dates and magnitudes of those expansions have never been resolved. Here, we introduce two new statistical tests for population expansion, which use variation at a number of unlinked genetic markers to study the demographic histories of natural populations. By analyzing genetic variation in various aboriginal populations from throughout the world, we show highly significant evidence for a major human population expansion in Africa, but no evidence of expansion outside of Africa. The inferred African expansion is estimated to have occurred between 49,000 and 640,000 years ago, certainly before the Neolithic expansions, and probably before the splitting of African and non-African populations. In showing a significant difference between African and non-African populations, our analysis supports the unique role of Africa in human evolutionary history, as has been suggested by most other genetic work. In addition, the missing signal in non-African populations may be the result of a population bottleneck associated with the emergence of these populations from Africa, as postulated in the “Out of Africa” model of modern human origins. PMID:9653150

  16. Do public nursing home care providers deliver higher quality than private providers? Evidence from Sweden.

    Science.gov (United States)

    Winblad, Ulrika; Blomqvist, Paula; Karlsson, Andreas

    2017-07-14

    Swedish nursing home care has undergone a transformation, where the previous virtual public monopoly on providing such services has been replaced by a system of mixed provision. This has led to a rapidly growing share of private actors, the majority of which are large, for-profit firms. In the wake of this development, concerns have been voiced regarding the implications for care quality. In this article, we investigate the relationship between ownership and care quality in nursing homes for the elderly by comparing quality levels between public, for-profit, and non-profit nursing home care providers. We also look at a special category of for-profit providers; private equity companies. The source of data is a national survey conducted by the Swedish National Board of Health and Welfare in 2011 at 2710 nursing homes. Data from 14 quality indicators are analyzed, including structure and process measures such as staff levels, staff competence, resident participation, and screening for pressure ulcers, nutrition status, and risk of falling. The main statistical method employed is multiple OLS regression analysis. We differentiate in the analysis between structural and processual quality measures. The results indicate that public nursing homes have higher quality than privately operated homes with regard to two structural quality measures: staffing levels and individual accommodation. Privately operated nursing homes, on the other hand, tend to score higher on process-based quality indicators such as medication review and screening for falls and malnutrition. No significant differences were found between different ownership categories of privately operated nursing homes. Ownership does appear to be related to quality outcomes in Swedish nursing home care, but the results are mixed and inconclusive. That staffing levels, which has been regarded as a key quality indicator in previous research, are higher in publicly operated homes than private is consistent with earlier

  17. A systems genetics approach provides a bridge from discovered genetic variants to biological pathways in rheumatoid arthritis.

    Directory of Open Access Journals (Sweden)

    Hirofumi Nakaoka

    Full Text Available Genome-wide association studies (GWAS have yielded novel genetic loci underlying common diseases. We propose a systems genetics approach to utilize these discoveries for better understanding of the genetic architecture of rheumatoid arthritis (RA. Current evidence of genetic associations with RA was sought through PubMed and the NHGRI GWAS catalog. The associations of 15 single nucleotide polymorphisms and HLA-DRB1 alleles were confirmed in 1,287 cases and 1,500 controls of Japanese subjects. Among these, HLA-DRB1 alleles and eight SNPs showed significant associations and all but one of the variants had the same direction of effect as identified in the previous studies, indicating that the genetic risk factors underlying RA are shared across populations. By receiver operating characteristic curve analysis, the area under the curve (AUC for the genetic risk score based on the selected variants was 68.4%. For seropositive RA patients only, the AUC improved to 70.9%, indicating good but suboptimal predictive ability. A simulation study shows that more than 200 additional loci with similar effect size as recent GWAS findings or 20 rare variants with intermediate effects are needed to achieve AUC = 80.0%. We performed the random walk with restart (RWR algorithm to prioritize genes for future mapping studies. The performance of the algorithm was confirmed by leave-one-out cross-validation. The RWR algorithm pointed to ZAP70 in the first rank, in which mutation causes RA-like autoimmune arthritis in mice. By applying the hierarchical clustering method to a subnetwork comprising RA-associated genes and top-ranked genes by the RWR, we found three functional modules relevant to RA etiology: "leukocyte activation and differentiation", "pattern-recognition receptor signaling pathway", and "chemokines and their receptors".These results suggest that the systems genetics approach is useful to find directions of future mapping strategies to illuminate

  18. Technology assessment and resource allocation for predictive genetic testing: A study of the perspectives of Canadian genetic health care providers

    Directory of Open Access Journals (Sweden)

    Einsiedel Edna

    2009-06-01

    Full Text Available Abstract Background With a growing number of genetic tests becoming available to the health and consumer markets, genetic health care providers in Canada are faced with the challenge of developing robust decision rules or guidelines to allocate a finite number of public resources. The objective of this study was to gain Canadian genetic health providers' perspectives on factors and criteria that influence and shape resource allocation decisions for publically funded predictive genetic testing in Canada. Methods The authors conducted semi-structured interviews with 16 senior lab directors and clinicians at publically funded Canadian predictive genetic testing facilities. Participants were drawn from British Columbia, Alberta, Manitoba, Ontario, Quebec and Nova Scotia. Given the community sampled was identified as being relatively small and challenging to access, purposive sampling coupled with snowball sampling methodologies were utilized. Results Surveyed lab directors and clinicians indicated that predictive genetic tests were funded provincially by one of two predominant funding models, but they themselves played a significant role in how these funds were allocated for specific tests and services. They also rated and identified several factors that influenced allocation decisions and patients' decisions regarding testing. Lastly, participants provided recommendations regarding changes to existing allocation models and showed support for a national evaluation process for predictive testing. Conclusion Our findings suggest that largely local and relatively ad hoc decision making processes are being made in relation to resource allocations for predictive genetic tests and that a more coordinated and, potentially, national approach to allocation decisions in this context may be appropriate.

  19. Multiple genetic interaction experiments provide complementary information useful for gene function prediction.

    Directory of Open Access Journals (Sweden)

    Magali Michaut

    Full Text Available Genetic interactions help map biological processes and their functional relationships. A genetic interaction is defined as a deviation from the expected phenotype when combining multiple genetic mutations. In Saccharomyces cerevisiae, most genetic interactions are measured under a single phenotype - growth rate in standard laboratory conditions. Recently genetic interactions have been collected under different phenotypic readouts and experimental conditions. How different are these networks and what can we learn from their differences? We conducted a systematic analysis of quantitative genetic interaction networks in yeast performed under different experimental conditions. We find that networks obtained using different phenotypic readouts, in different conditions and from different laboratories overlap less than expected and provide significant unique information. To exploit this information, we develop a novel method to combine individual genetic interaction data sets and show that the resulting network improves gene function prediction performance, demonstrating that individual networks provide complementary information. Our results support the notion that using diverse phenotypic readouts and experimental conditions will substantially increase the amount of gene function information produced by genetic interaction screens.

  20. Providers' Attitudes Toward Evidence-Based Practices: Is it Just About Providers, or do Practices Matter, Too?

    Science.gov (United States)

    Reding, Michael E. J.; Chorpita, Bruce F.; Lau, Anna S.; Innes-Gomberg, Debbie

    2014-01-01

    Evidence-based practice (EBP) attitudes were measured in a sample of Los Angeles County mental health service providers. Three types of data were collected: provider demographic characteristics, attitudes toward EBP in general, and attitudes toward specific EBPs being implemented in the county. Providers could reliably rate characteristics of specific EBPs, and these ratings differed across interventions. Preliminary implementation data indicate that appealing features of an EBP relate to the degree to which providers use it. These findings suggest that assessing EBP-specific attitudes is feasible and may offer implementation-relevant information beyond that gained solely from providers' general attitudes toward EBP. PMID:24166077

  1. Genetic evidence linking lung cancer and COPD: a new perspective

    Directory of Open Access Journals (Sweden)

    Crapo JD

    2011-07-01

    Full Text Available Robert P Young1,4, Raewyn J Hopkins1, Gregory D Gamble1, Carol Etzel2, Randa El-Zein2, James D Crapo31Department of Medicine and School of Biological Sciences, University of Auckland, Auckland, New Zealand; 2Department of Epidemiology, UT MD Anderson Cancer Center, Houston, TX, USA; 3National Jewish Health, Denver, CO, USA; 4Synergenz Biosciences Ltd, Auckland, New ZealandAbstract: Epidemiological studies indicate that tobacco smoke exposure accounts for nearly 90% of cases of chronic obstructive pulmonary disease (COPD and lung cancer. However, genetic factors may explain why 10%–30% of smokers develop these complications. This perspective reviews the evidence suggesting that COPD is closely linked to susceptibility to lung cancer and outlines the potential relevance of this observation. Epidemiological studies show that COPD is the single most important risk factor for lung cancer among smokers and predates lung cancer in up to 80% of cases. Genome-wide association studies of lung cancer, lung function, and COPD have identified a number of overlapping “susceptibility” loci. With stringent phenotyping, it has recently been shown that several of these overlapping loci are independently associated with both COPD and lung cancer. These loci implicate genes underlying pulmonary inflammation and apoptotic processes mediated by the bronchial epithelium, and link COPD with lung cancer at a molecular genetic level. It is currently possible to derive risk models for lung cancer that incorporate lung cancer-specific genetic variants, recently identified “COPD-related” genetic variants, and clinical variables. Early studies suggest that single nucleotide polymorphism-based risk stratification of smokers might help better target novel prevention and early diagnostic strategies in lung cancer.Keywords: lung cancer, chronic obstructive pulmonary disease, association study, single nucleotide polymorphism, risk model

  2. Evidence for Genetic Overlap Between Schizophrenia and Age at First Birth in Women

    DEFF Research Database (Denmark)

    Mehta, Divya; Tropf, Felix C; Gratten, Jacob

    2016-01-01

    IMPORTANCE: A recently published study of national data by McGrath et al in 2014 showed increased risk of schizophrenia (SCZ) in offspring associated with both early and delayed parental age, consistent with a U-shaped relationship. However, it remains unclear if the risk to the child is due......), reflecting the published relationship between maternal age and SCZ risk in offspring by McGrath et al in 2014. CONCLUSIONS AND RELEVANCE: This study provides evidence for a significant overlap between genetic factors associated with risk of SCZ and genetic factors associated with AFB. It has been reported...

  3. Understanding the cognitive and genetic underpinnings of procrastination: Evidence for shared genetic influences with goal management and executive function abilities.

    Science.gov (United States)

    Gustavson, Daniel E; Miyake, Akira; Hewitt, John K; Friedman, Naomi P

    2015-12-01

    Previous research has suggested that individual differences in procrastination are tied to everyday goal-management abilities, but little research has been conducted on specific cognitive abilities that may underlie tendencies for procrastination, such as executive functions (EFs). In this study, we used behavioral genetics methodology to investigate 2 hypotheses about the relationships between procrastination and EF ability: (a) that procrastination is negatively correlated with general EF ability, and (b) that this relationship is due to the genetic components of procrastination that are most related to other everyday goal-management abilities. The results confirmed both of these hypotheses. Procrastination was related to worse general EF ability at both the phenotypic and genetic levels, and this relationship was due to the component of procrastination shared with self-report measures of everyday goal-management failures. These results were observed even after controlling for potential self-report biases stemming from the urge to respond in a socially desirable manner. Together, these findings provide strong evidence for growing theories of procrastination emphasizing the importance of goal-related cognitive abilities and further highlight important genetic influences that underlie procrastination. (c) 2015 APA, all rights reserved).

  4. The role and impact of personal faith and religion among genetic service providers.

    Science.gov (United States)

    Geller, Gail; Micco, Ellyn; Silver, Rachel J; Kolodner, Ken; Bernhardt, Barbara A

    2009-02-15

    This paper describes the impact of genetic service providers' personal faith and religious values on their experiences interacting with colleagues and patients. We surveyed 480 clinical geneticists (MDs), genetic counselors (GCs), and genetic nurses randomly selected from their professional associations, and then interviewed a sample of survey respondents. Outcomes included religiosity, coping with distress through spiritual beliefs, and personal value conflicts (PVCs). Two hundred fourteen providers completed the survey out of an estimated 348 eligible (61% response rate). Importance attributed to regular attendance at religious services ranged from 39% (not at all important) to 27% (very important). Reliance on religion and spiritual beliefs as a source of comfort ranged from 48% (never) to 33% (sometimes or often). Religiosity varied by discipline with 58% of nurses thinking regular attendance at religious services was moderately or very important as compared to 47% of GCs and 30% of MDs (P = 0.006). Ten percent of respondents had difficulty reconciling their own faith with being a genetics professional, 14% felt the need to hide their own faith from their colleagues or patients, 7% thought their professional stance was not consistent with their personal values, and 4% felt ostracized by the genetics community because of their personal beliefs. The experience of such PVCs was positively correlated with religiosity (r = 0.35; P religion among genetics professionals. (c) 2009 Wiley-Liss, Inc.

  5. Gene × Environment Interactions in Schizophrenia: Evidence from Genetic Mouse Models

    Directory of Open Access Journals (Sweden)

    Paula Moran

    2016-01-01

    Full Text Available The study of gene × environment, as well as epistatic interactions in schizophrenia, has provided important insight into the complex etiopathologic basis of schizophrenia. It has also increased our understanding of the role of susceptibility genes in the disorder and is an important consideration as we seek to translate genetic advances into novel antipsychotic treatment targets. This review summarises data arising from research involving the modelling of gene × environment interactions in schizophrenia using preclinical genetic models. Evidence for synergistic effects on the expression of schizophrenia-relevant endophenotypes will be discussed. It is proposed that valid and multifactorial preclinical models are important tools for identifying critical areas, as well as underlying mechanisms, of convergence of genetic and environmental risk factors, and their interaction in schizophrenia.

  6. Gene × Environment Interactions in Schizophrenia: Evidence from Genetic Mouse Models.

    Science.gov (United States)

    Moran, Paula; Stokes, Jennifer; Marr, Julia; Bock, Gavin; Desbonnet, Lieve; Waddington, John; O'Tuathaigh, Colm

    2016-01-01

    The study of gene × environment, as well as epistatic interactions in schizophrenia, has provided important insight into the complex etiopathologic basis of schizophrenia. It has also increased our understanding of the role of susceptibility genes in the disorder and is an important consideration as we seek to translate genetic advances into novel antipsychotic treatment targets. This review summarises data arising from research involving the modelling of gene × environment interactions in schizophrenia using preclinical genetic models. Evidence for synergistic effects on the expression of schizophrenia-relevant endophenotypes will be discussed. It is proposed that valid and multifactorial preclinical models are important tools for identifying critical areas, as well as underlying mechanisms, of convergence of genetic and environmental risk factors, and their interaction in schizophrenia.

  7. Gene × Environment Interactions in Schizophrenia: Evidence from Genetic Mouse Models

    Science.gov (United States)

    Marr, Julia; Bock, Gavin; Desbonnet, Lieve; Waddington, John

    2016-01-01

    The study of gene × environment, as well as epistatic interactions in schizophrenia, has provided important insight into the complex etiopathologic basis of schizophrenia. It has also increased our understanding of the role of susceptibility genes in the disorder and is an important consideration as we seek to translate genetic advances into novel antipsychotic treatment targets. This review summarises data arising from research involving the modelling of gene × environment interactions in schizophrenia using preclinical genetic models. Evidence for synergistic effects on the expression of schizophrenia-relevant endophenotypes will be discussed. It is proposed that valid and multifactorial preclinical models are important tools for identifying critical areas, as well as underlying mechanisms, of convergence of genetic and environmental risk factors, and their interaction in schizophrenia. PMID:27725886

  8. Genetic evidence of population structuring in the neotropical freshwater fish Brycon hilarii (Valenciennes, 1850

    Directory of Open Access Journals (Sweden)

    A Sanches

    Full Text Available Brycon hilarii is a migratory fish widely distributed throughout the Paraguay River Basin. It is appreciated in sport fishing and for its superior meat quality. It is also the main species for tourist attraction in the Bonito region (State of Mato Grosso do Sul, Brazil. Considering the lack of information on the genetic structure of the fish of this species, the aim of the present study was to detect the genetic variability of Brycon hilarii through RAPD markers. A total of eighty specimens collected in different seasons at four sites of the Miranda River sub-basin (Paraguay River Basin, Brazil were used for analysis. The results of genetic similarity, Shannon diversity, and AMOVA revealed differences between the sampling sites. Through AMOVA, differences between populations were more evident among the animals collected during the non-reproductive season, corresponding to a time of less movement of these fish. A population structuring model in which B. hilarii appears organized into genetically differentiated reproductive units that coexist and co-migrate through the studied system was suggested, contrasting the currently accepted idea that freshwater migratory fish form large panmictic populations in a determined hydrographic system. Despite the lack of a complete picture regarding the distribution of B. hilarii in the studied region, this initial idea on its population genetic structure could be an important contribution to providing aid for management and conservation programs of these fish.

  9. Genetic background of Prop1(df) mutants provides remarkable protection against hypothyroidism-induced hearing impairment.

    Science.gov (United States)

    Fang, Qing; Giordimaina, Alicia M; Dolan, David F; Camper, Sally A; Mustapha, Mirna

    2012-04-01

    Hypothyroidism is a cause of genetic and environmentally induced deafness. The sensitivity of cochlear development and function to thyroid hormone (TH) mandates understanding TH action in this sensory organ. Prop1(df) and Pou1f1(dw) mutant mice carry mutations in different pituitary transcription factors, each resulting in pituitary thyrotropin deficiency. Despite the same lack of detectable serum TH, these mutants have very different hearing abilities: Prop1(df) mutants are mildly affected, while Pou1f1(dw) mutants are completely deaf. Genetic studies show that this difference is attributable to the genetic backgrounds. Using embryo transfer, we discovered that factors intrinsic to the fetus are the major contributor to this difference, not maternal effects. We analyzed Prop1(df) mutants to identify processes in cochlear development that are disrupted in other hypothyroid animal models but protected in Prop1(df) mutants by the genetic background. The development of outer hair cell (OHC) function is delayed, but Prestin and KCNQ4 immunostaining appear normal in mature Prop1(df) mutants. The endocochlear potential and KCNJ10 immunostaining in the stria vascularis are indistinguishable from wild type, and no differences in neurofilament or synaptophysin staining are evident in Prop1(df) mutants. The synaptic vesicle protein otoferlin normally shifts expression from OHC to IHC as temporary afferent fibers beneath the OHC regress postnatally. Prop1(df) mutants exhibit persistent, abnormal expression of otoferlin in apical OHC, suggesting delayed maturation of synaptic function. Thus, the genetic background of Prop1(df) mutants is remarkably protective for most functions affected in other hypothyroid mice. The Prop1(df) mutant is an attractive model for identifying the genes that protect against deafness.

  10. Evidence for shared genetic risk between ADHD symptoms and reduced mathematics ability: a twin study.

    Science.gov (United States)

    Greven, Corina U; Kovas, Yulia; Willcutt, Erik G; Petrill, Stephen A; Plomin, Robert

    2014-01-01

    Attention-deficit/hyperactivity disorder (ADHD) symptoms and mathematics ability are associated, but little is known about the genetic and environmental influences underlying this association. Data came from more than 6,000 twelve-year-old twin pairs from the UK population-representative Twins Early Development Study. Parents rated each twin's behaviour using a DSM-IV-based 18-item questionnaire of inattentive and hyperactive-impulsive ADHD symptoms. Mathematics tests based on the UK National Curriculum were completed by each twin. The twins also completed standardised tests of reading and general cognitive ability. Multivariate twin model fitting was applied. Inattentive and hyperactive-impulsive ADHD symptoms were highly heritable (67% and 73% respectively). Mathematics ability was moderately heritable (46%). Mathematics ability and inattentiveness showed a significantly greater phenotypic correlation (r(p) = -.26) and genetic correlation (r(A) = -.41) than mathematics ability and hyperactivity-impulsivity (r(p) = -.18; r(A) = -.22). The genetic correlation between inattentiveness and mathematics ability was largely independent from hyperactivity-impulsivity, and was only partially accounted for by genetic influences related to reading and general cognitive ability. Results revealed the novel finding that mathematics ability shows significantly stronger phenotypic and genetic associations with inattentiveness than with hyperactivity-impulsivity. Genetic associations between inattentiveness and mathematics ability could only partially be accounted for by hyperactivity-impulsivity, reading and general cognitive ability. Results suggest that mathematics ability is associated with ADHD symptoms largely because it shares genetic risk factors with inattentiveness, and provide further evidence for considering inattentiveness and hyperactivity-impulsivity separately. DNA markers for ADHD symptoms (especially inattentiveness) may also be candidate risk factors for

  11. The genetics of music accomplishment: evidence for gene-environment correlation and interaction.

    Science.gov (United States)

    Hambrick, David Z; Tucker-Drob, Elliot M

    2015-02-01

    Theories of skilled performance that emphasize training history, such as K. Anders Ericsson and colleagues' deliberate-practice theory, have received a great deal of recent attention in both the scientific literature and the popular press. Twin studies, however, have demonstrated evidence for moderate-to-strong genetic influences on skilled performance. Focusing on musical accomplishment in a sample of over 800 pairs of twins, we found evidence for gene-environment correlation, in the form of a genetic effect on music practice. However, only about one quarter of the genetic effect on music accomplishment was explained by this genetic effect on music practice, suggesting that genetically influenced factors other than practice contribute to individual differences in music accomplishment. We also found evidence for gene-environment interaction, such that genetic effects on music accomplishment were most pronounced among those engaging in music practice, suggesting that genetic potentials for skilled performance are most fully expressed and fostered by practice.

  12. Preliminary evidence for genetic overlap between body mass index and striatal reward response.

    Science.gov (United States)

    Lancaster, T M; Ihssen, I; Brindley, L M; Linden, D E

    2018-01-10

    The reward-processing network is implicated in the aetiology of obesity. Several lines of evidence suggest obesity-linked genetic risk loci (such as DRD2 and FTO) may influence individual variation in body mass index (BMI) through neuropsychological processes reflected in alterations in activation of the striatum during reward processing. However, no study has tested the broader hypotheses that (a) the relationship between BMI and reward-related brain activation (measured through the blood oxygenation-dependent (BOLD) signal) may be observed in a large population study and (b) the overall genetic architecture of these phenotypes overlap, an assumption critical for the progression of imaging genetic studies in obesity research. Using data from the Human Connectome Project (N = 1055 healthy, young individuals: average BMI = 26.4), we first establish a phenotypic relationship between BMI and ventral striatal (VS) BOLD during the processing of rewarding (monetary) stimuli (β = 0.44, P = 0.013), accounting for potential confounds. BMI and VS BOLD were both significantly influenced by additive genetic factors (H2r = 0.57; 0.12, respectively). Further decomposition of this variance suggested that the relationship was driven by shared genetic (ρ g  = 0.47, P = 0.011), but not environmental (ρ E  = -0.07, P = 0.29) factors. To validate the assumption of genetic pleiotropy between BMI and VS BOLD, we further show that polygenic risk for higher BMI is also associated with increased VS BOLD response to appetitive stimuli (calorically high food images), in an independent sample (N = 81; P FWE-ROI  < 0.005). Together, these observations suggest that the genetic factors link risk to obesity to alterations within key nodes of the brain's reward circuity. These observations provide a basis for future work exploring the mechanistic role of genetic loci that confer risk for obesity using the imaging genetics approach.

  13. Organizational Culture and Climate and Mental Health Provider Attitudes Toward Evidence-Based Practice

    OpenAIRE

    Aarons, Gregory A.; Sawitzky, Angelina C.

    2006-01-01

    Mental health provider attitudes toward adopting evidence-based practice (EBP) are associated with organizational context and provider individual differences. Organizational culture and climate are contextual factors that can affect staff acceptance of innovation. This study examined the association of organizational culture and climate with attitudes toward adopting EBP. Participants were 301 public sector mental health service providers from 49 programs providing mental health services for ...

  14. Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease

    NARCIS (Netherlands)

    van der Harst, Pim; Verweij, Niek

    2018-01-01

    Rationale: Coronary artery disease (CAD) is a complex phenotype driven by genetic and environmental factors. Ninety-seven genetic risk loci have been identified to date, but the identification of additional susceptibility loci might be important to enhance our understanding of the genetic

  15. Pathway analysis of GWAS provides new insights into genetic susceptibility to 3 inflammatory diseases.

    Directory of Open Access Journals (Sweden)

    Hariklia Eleftherohorinou

    2009-11-01

    Full Text Available Although the introduction of genome-wide association studies (GWAS have greatly increased the number of genes associated with common diseases, only a small proportion of the predicted genetic contribution has so far been elucidated. Studying the cumulative variation of polymorphisms in multiple genes acting in functional pathways may provide a complementary approach to the more common single SNP association approach in understanding genetic determinants of common disease. We developed a novel pathway-based method to assess the combined contribution of multiple genetic variants acting within canonical biological pathways and applied it to data from 14,000 UK individuals with 7 common diseases. We tested inflammatory pathways for association with Crohn's disease (CD, rheumatoid arthritis (RA and type 1 diabetes (T1D with 4 non-inflammatory diseases as controls. Using a variable selection algorithm, we identified variants responsible for the pathway association and evaluated their use for disease prediction using a 10 fold cross-validation framework in order to calculate out-of-sample area under the Receiver Operating Curve (AUC. The generalisability of these predictive models was tested on an independent birth cohort from Northern Finland. Multiple canonical inflammatory pathways showed highly significant associations (p 10(-3-10(-20 with CD, T1D and RA. Variable selection identified on average a set of 205 SNPs (149 genes for T1D, 350 SNPs (189 genes for RA and 493 SNPs (277 genes for CD. The pattern of polymorphisms at these SNPS were found to be highly predictive of T1D (91% AUC and RA (85% AUC, and weakly predictive of CD (60% AUC. The predictive ability of the T1D model (without any parameter refitting had good predictive ability (79% AUC in the Finnish cohort. Our analysis suggests that genetic contribution to common inflammatory diseases operates through multiple genes interacting in functional pathways.

  16. Morphological and genetic evidence for early Holocene cattle management in northeastern China

    DEFF Research Database (Denmark)

    Zhang, Hucai; Paijmans, Johanna L. A.; Chang, Fengqin

    2013-01-01

    The domestication of cattle is generally accepted to have taken place in two independent centres: around 10,500 years ago in the Near East, giving rise to modern taurine cattle, and two millennia later in southern Asia, giving rise to zebu cattle. Here we provide firmly dated morphological...... and genetic evidence for early Holocene management of taurine cattle in northeastern China. We describe conjoining mandibles from this region that show evidence of oral stereotypy, dated to the early Holocene by two independent (14)C dates. Using Illumina high-throughput sequencing coupled with DNA...... hybridization capture, we characterize 15,406 bp of the mitogenome with on average 16.7-fold coverage. Phylogenetic analyses reveal a hitherto unknown mitochondrial haplogroup that falls outside the known taurine diversity. Our data suggest that the first attempts to manage cattle in northern China predate...

  17. Genetic Variance in Homophobia: Evidence from Self- and Peer Reports.

    Science.gov (United States)

    Zapko-Willmes, Alexandra; Kandler, Christian

    2018-01-01

    The present twin study combined self- and peer assessments of twins' general homophobia targeting gay men in order to replicate previous behavior genetic findings across different rater perspectives and to disentangle self-rater-specific variance from common variance in self- and peer-reported homophobia (i.e., rater-consistent variance). We hypothesized rater-consistent variance in homophobia to be attributable to genetic and nonshared environmental effects, and self-rater-specific variance to be partially accounted for by genetic influences. A sample of 869 twins and 1329 peer raters completed a seven item scale containing cognitive, affective, and discriminatory homophobic tendencies. After correction for age and sex differences, we found most of the genetic contributions (62%) and significant nonshared environmental contributions (16%) to individual differences in self-reports on homophobia to be also reflected in peer-reported homophobia. A significant genetic component, however, was self-report-specific (38%), suggesting that self-assessments alone produce inflated heritability estimates to some degree. Different explanations are discussed.

  18. Assessing the evidence for shared genetic risks across psychiatric disorders and traits.

    Science.gov (United States)

    Martin, Joanna; Taylor, Mark J; Lichtenstein, Paul

    2017-12-04

    Genetic influences play a significant role in risk for psychiatric disorders, prompting numerous endeavors to further understand their underlying genetic architecture. In this paper, we summarize and review evidence from traditional twin studies and more recent genome-wide molecular genetic analyses regarding two important issues that have proven particularly informative for psychiatric genetic research. First, emerging results are beginning to suggest that genetic risk factors for some (but not all) clinically diagnosed psychiatric disorders or extreme manifestations of psychiatric traits in the population share genetic risks with quantitative variation in milder traits of the same disorder throughout the general population. Second, there is now evidence for substantial sharing of genetic risks across different psychiatric disorders. This extends to the level of characteristic traits throughout the population, with which some clinical disorders also share genetic risks. In this review, we summarize and evaluate the evidence for these two issues, for a range of psychiatric disorders. We then critically appraise putative interpretations regarding the potential meaning of genetic correlation across psychiatric phenotypes. We highlight several new methods and studies which are already using these insights into the genetic architecture of psychiatric disorders to gain additional understanding regarding the underlying biology of these disorders. We conclude by outlining opportunities for future research in this area.

  19. Impact of behavioral genetic evidence on the adjudication of criminal behavior.

    Science.gov (United States)

    Appelbaum, Paul S; Scurich, Nicholas

    2014-01-01

    Recent advances in behavioral genetics suggest a modest relationship among certain gene variants, early childhood experiences, and criminal behavior. Although scientific research examining this link is still at an early stage, genetic data are already being introduced in criminal trials. However, the extent to which such evidence is likely to affect jurors' decisions has not been explored. In the present study, a representative sample of the U.S. population (n = 250) received a vignette describing an apparently impulsive homicide, accompanied by one of four explanations of the defendant's impulsivity: childhood abuse, genetic predisposition, childhood abuse and genetic predisposition, or simple impulsive behavior. The participants were asked to identify the crime that the defendant had committed and to select an appropriate sentence range. Evidence of genetic predisposition did not affect the crime of which the defendant was convicted or the sentence. However, participants who received the abuse or genetic + abuse explanation imposed longer prison sentences. Paradoxically, the genetic and genetic + abuse conditions engendered the greatest fear of the defendant. These findings should allay concerns that genetic evidence in criminal adjudications will be overly persuasive to jurors, but should raise questions about the impact of genetic attributions on perceptions of dangerousness.

  20. Effects of Behavioral Genetic Evidence on Perceptions of Criminal Responsibility and Appropriate Punishment

    Science.gov (United States)

    Appelbaum, Paul S.; Scurich, Nicholas; Raad, Raymond

    2015-01-01

    Demonstrations of a link between genetic variants and criminal behavior have stimulated increasing use of genetic evidence to reduce perceptions of defendants’ responsibility for criminal behavior and to mitigate punishment. However, because only limited data exist regarding the impact of such evidence on decision makers and the public at large, we recruited a representative sample of the U.S. adult population (n=960) for a web-based survey. Participants were presented with descriptions of three legal cases and were asked to: determine the length of incarceration for a convicted murderer; adjudicate an insanity defense; and decide whether a defendant should receive the death penalty. A fully crossed, between-participants, factorial design was used, varying the type of evidence (none, genetic, neuroimaging, both), heinousness of the crime, and past criminal record, with sentence or verdict as the primary outcome. Also assessed were participants’ apprehension of the defendant, belief in free will, political ideology, and genetic knowledge. Across all three cases, genetic evidence had no significant effects on outcomes. Neuroimaging data showed an inconsistent effect in one of the two cases in which it was introduced. In contrast, heinousness of the offense and past criminal record were strongly related to participants’ decisions. Moreover, participants’ beliefs about the controllability of criminal behavior and political orientations were significantly associated with their choices. Our findings suggest that neither hopes that genetic evidence will modify judgments of culpability and punishment nor fears about the impact of genetic evidence on decision makers are likely to come to fruition. PMID:26240516

  1. Effects of Behavioral Genetic Evidence on Perceptions of Criminal Responsibility and Appropriate Punishment.

    Science.gov (United States)

    Appelbaum, Paul S; Scurich, Nicholas; Raad, Raymond

    2015-05-01

    Demonstrations of a link between genetic variants and criminal behavior have stimulated increasing use of genetic evidence to reduce perceptions of defendants' responsibility for criminal behavior and to mitigate punishment. However, because only limited data exist regarding the impact of such evidence on decision makers and the public at large, we recruited a representative sample of the U.S. adult population (n=960) for a web-based survey. Participants were presented with descriptions of three legal cases and were asked to: determine the length of incarceration for a convicted murderer; adjudicate an insanity defense; and decide whether a defendant should receive the death penalty. A fully crossed, between-participants, factorial design was used, varying the type of evidence (none, genetic, neuroimaging, both), heinousness of the crime, and past criminal record, with sentence or verdict as the primary outcome. Also assessed were participants' apprehension of the defendant, belief in free will, political ideology, and genetic knowledge. Across all three cases, genetic evidence had no significant effects on outcomes. Neuroimaging data showed an inconsistent effect in one of the two cases in which it was introduced. In contrast, heinousness of the offense and past criminal record were strongly related to participants' decisions. Moreover, participants' beliefs about the controllability of criminal behavior and political orientations were significantly associated with their choices. Our findings suggest that neither hopes that genetic evidence will modify judgments of culpability and punishment nor fears about the impact of genetic evidence on decision makers are likely to come to fruition.

  2. Evidence for Within-Host Genetic Recombination among the Human Pegiviral Strains in HIV Infected Subjects.

    Science.gov (United States)

    Wu, Haoming; Padhi, Abinash; Xu, Junqiang; Gong, Xiaoyan; Tien, Po

    2016-01-01

    The non-pathogenic Human Pegivirus (HPgV, formerly GBV-C/HGV), the most prevalent RNA virus worldwide, is known to be associated with reduced morbidity and mortality in HIV-infected individuals. Although previous studies documented its ubiquity and important role in HIV-infected individuals, little is known about the underlying genetic mechanisms that maintain high genetic diversity of HPgV within the HIV-infected individuals. To assess the within-host genetic diversity of HPgV and forces that maintain such diversity within the co-infected hosts, we performed phylogenetic analyses taking into account 229 HPgV partial E1-E2 clonal sequences representing 15 male and 8 female co-infected HIV patients from Hubei province of central China. Our results revealed the presence of eleven strongly supported clades. While nine clades belonged to genotype 3, two clades belonged to genotype 2. Additionally, four clades that belonged to genotype 3 exhibited inter-clade recombination events. The presence of clonal sequences representing multiple clades within the HIV-infected individual provided the evidence of co-circulation of HPgV strains across the region. Of the 23 patients, six patients (i.e., five males and one female) were detected to have HPgV recombinant sequences. Our results also revealed that while male patients shared the viral strains with other patients, viral strains from the female patients had restricted dispersal. Taken together, the present study revealed that multiple infections with divergent HPgV viral strains may have caused within-host genetic recombination, predominantly in male patients, and therefore, could be the major driver in shaping genetic diversity of HPgV.

  3. Genetic evidence for monogamy in the dwarf seahorse, Hippocampus zosterae.

    Science.gov (United States)

    Rose, Emily; Small, Clayton M; Saucedo, Hector A; Harper, Cristin; Jones, Adam G

    2014-01-01

    Syngnathid fishes (pipefishes, seahorses, and seadragons) exhibit a wide array of mating systems ranging from monogamy with long-term pair bonds to more promiscuous mating systems, such as polyandry and polygynandry. Some seahorses, including the dwarf seahorse Hippocampus zosterae, have been found to be socially monogamous. Although several seahorse species have also been shown to be genetically monogamous, parentage analysis has not yet been applied to the dwarf seahorse. We developed 8 novel microsatellites for the dwarf seahorse to conduct genetic parentage analysis to confirm that this species is indeed monogamous. Using 4 selected loci and a total of 16 pregnant male seahorses, with 8 collected in Florida and 8 sampled in Texas, we genotyped all of the offspring within each male's brood to determine the maternal contributions to each brood. We found a maximum of 4 alleles per locus segregating within each pregnant male's brood, a pattern consistent with each brood having exactly 1 mother and 1 father. These results support previous laboratory-based behavioral studies and indicate that the dwarf seahorse, H. zosterae, is genetically monogamous. © The American Genetic Association 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Availability and accessibility of evidence-based information resources provided by medical libraries in Australia.

    Science.gov (United States)

    Ritchie, A; Sowter, B

    2000-01-01

    This article reports on the results of an exploratory survey of the availability and accessibility of evidence-based information resources provided by medical libraries in Australia. Although barriers impede access to evidence-based information for hospital clinicians, the survey revealed that Medline and Cinahl are available in over 90% of facilities. In most cases they are widely accessible via internal networks and the Internet. The Cochrane Library is available in 69% of cases. The Internet is widely accessible and most libraries provide access to some full-text, electronic journals. Strategies for overcoming restrictions and integrating information resources with clinical workflow are being pursued. State, regional and national public and private consortia are developing agreements utilising on-line technology. These could produce cost savings and more equitable access to a greater range of evidence-based resources.

  5. Population genetic structure in a Robertsonian race of house mice: evidence from microsatellite polymorphism

    NARCIS (Netherlands)

    Dallas, J.F.; Bonhomme, F.; Boursot, P.; Britton-Davidian, J.; Bauchau, V.

    1998-01-01

    Genetic evidence was assessed for inbreeding and population subdivision in a Robertsonian fusion (Rb) race of the western European form of house mouse, Mus musculus domesticus, in central Belgium. Inbreeding, and the factors responsible for subdivision (genetic drift and extinction-recolonization)

  6. First evidence of intraclonal genetic exchange in trypanosomatids using two Leishmania infantum fluorescent transgenic clones.

    Directory of Open Access Journals (Sweden)

    Estefanía Calvo-Álvarez

    2014-09-01

    Full Text Available The mode of reproduction in Leishmania spp has been argued to be essentially clonal. However, recent data (genetic analysis of populations and co-infections in sand flies have proposed the existence of a non-obligate sexual cycle in the extracellular stage of the parasite within the sand fly vector. In this article we propose the existence of intraclonal genetic exchange in the natural vector of Leishmania infantum.We have developed transgenic L. infantum lines expressing drug resistance markers linked to green and red fluorescent reporters. We hypothesized whether those cells with identical genotype can recognize each other and mate. Both types of markers were successfully exchanged within the sand fly midgut of the natural vector Phlebotomus perniciosus when individuals from these species were fed with a mixture of parental clones. Using the yellow phenotype and drug resistance markers, we provide evidence for genetic exchange in L. infantum. The hybrid progeny appeared to be triploid based on DNA content analysis. The hybrid clone analyzed was stable throughout the complete parasite life cycle. The progress of infections by the hybrid clone in BALB/c mice caused a reduction in parasite loads in both spleen and liver, and provided weight values similar to those obtained with uninfected mice. Spleen arginase activity was also significantly reduced relative to parental strains.A L. infantum hybrid lineage was obtained from intraclonal genetic exchange within the midgut of the natural vector, suggesting the ability of this parasite to recognize the same genotype and mate. The yellow hybrid progeny is stable throughout the whole parasite life cycle but with a slower virulence, which correlates well with the lower arginase activity detected both in vitro and in vivo infections.

  7. Measuring Provider Attitudes Toward Evidence-Based Practice: Consideration of Organizational Context and Individual Differences

    OpenAIRE

    Aarons, Gregory A.

    2005-01-01

    Mental health provider attitudes toward adoption of innovation in general, and toward evidence-based practice (EBP) in particular, are important in considering how best to disseminate and implement EBPs. This article first explores the role of attitudes in acceptance of innovation and proposes a model of organizational and individual factors that may affect or be affected by attitudes toward adoption of EBP. Next, a recently developed measure of mental health provider attitudes toward adoptio...

  8. Resequencing data provide no evidence for a human bottleneck in Africa during the penultimate glacial period.

    Science.gov (United States)

    Sjödin, Per; E Sjöstrand, Agnès; Jakobsson, Mattias; Blum, Michael G B

    2012-07-01

    Based on the accumulation of genetic, climatic, and fossil evidence, a central theory in paleoanthropology stipulates that a demographic bottleneck coincided with the origin of our species Homo Sapiens. This theory proposes that anatomically modern humans--which were only present in Africa at the time--experienced a drastic bottleneck during the penultimate glacial age (130-190 kya) when a cold and dry climate prevailed. Two scenarios have been proposed to describe the bottleneck, which involve either a fragmentation of the range occupied by humans or the survival of one small group of humans. Here, we analyze DNA sequence data from 61 nuclear loci sequenced in three African populations using Approximate Bayesian Computation and numerical simulations. In contrast to the bottleneck theory, we show that a simple model without any bottleneck during the penultimate ice age has the greatest statistical support compared with bottleneck models. Although the proposed bottleneck is ancient, occurring at least 130 kya, we can discard the possibility that it did not leave detectable footprints in the DNA sequence data except if the bottleneck involves a less than a 3-fold reduction in population size. Finally, we confirm that a simple model without a bottleneck is able to reproduce the main features of the observed patterns of genetic variation. We conclude that models of Pleistocene refugium for modern human origins now require substantial revision.

  9. Genetic Evidence Highlights Potential Impacts of By-Catch to Cetaceans

    Science.gov (United States)

    Mendez, Martin; Rosenbaum, Howard C.; Wells, Randall S.; Stamper, Andrew; Bordino, Pablo

    2010-01-01

    Incidental entanglement in fishing gear is arguably the most serious threat to many populations of small cetaceans, judging by the alarming number of captured animals. However, other aspects of this threat, such as the potential capture of mother-offspring pairs or reproductive pairs, could be equally or even more significant but have rarely been evaluated. Using a combination of demographic and genetic data we provide evidence that i) Franciscana dolphin pairs that are potentially reproductive and mother-offspring pairs form temporal bonds, and ii) are entangled simultaneously. Our results highlight potential demographic and genetic impacts of by-catch to cetacean populations: the joint entanglement of mother-offspring or reproductive pairs, compared to random individuals, might exacerbate the demographic consequences of by-catch, and the loss of groups of relatives means that significant components of genetic diversity could be lost together. Given the social nature of many odontocetes (toothed cetaceans), we suggest that these potential impacts could be rather general to the group and therefore by-catch could be more detrimental than previously considered. PMID:21179542

  10. Noninvasive genetics provides insights into the population size and genetic diversity of an Amur tiger population in China.

    Science.gov (United States)

    Wang, Dan; Hu, Yibo; Ma, Tianxiao; Nie, Yonggang; Xie, Yan; Wei, Fuwen

    2016-01-01

    Understanding population size and genetic diversity is critical for effective conservation of endangered species. The Amur tiger (Panthera tigris altaica) is the largest felid and a flagship species for wildlife conservation. Due to habitat loss and human activities, available habitat and population size are continuously shrinking. However, little is known about the true population size and genetic diversity of wild tiger populations in China. In this study, we collected 55 fecal samples and 1 hair sample to investigate the population size and genetic diversity of wild Amur tigers in Hunchun National Nature Reserve, Jilin Province, China. From the samples, we determined that 23 fecal samples and 1 hair sample were from 7 Amur tigers: 2 males, 4 females and 1 individual of unknown sex. Interestingly, 2 fecal samples that were presumed to be from tigers were from Amur leopards, highlighting the significant advantages of noninvasive genetics over traditional methods in studying rare and elusive animals. Analyses from this sample suggested that the genetic diversity of wild Amur tigers is much lower than that of Bengal tigers, consistent with previous findings. Furthermore, the genetic diversity of this Hunchun population in China was lower than that of the adjoining subpopulation in southwest Primorye Russia, likely due to sampling bias. Considering the small population size and relatively low genetic diversity, it is urgent to protect this endangered local subpopulation in China. © 2015 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

  11. Indirect evidence for genetic differentiation in vulnerability to embolism in Pinus halepensis

    Directory of Open Access Journals (Sweden)

    Rakefet eDavid-Schwartz

    2016-06-01

    Full Text Available Climate change is increasing mean temperatures and in the eastern Mediterranean is expected to decrease annual precipitation. The resulting increase in aridity may be too rapid for adaptation of tree species unless their gene pool already possesses variation in drought resistance. Vulnerability to embolism, estimated by the pressure inducing 50% loss of xylem hydraulic conductivity (P50, is strongly associated with drought stress resistance in trees. Yet, previous studies on various tree species reported low intraspecific genetic variation for this trait, and therefore limited adaptive capacities to increasing aridity. Here we quantified differences in hydraulic efficiency (xylem hydraulic conductance and safety (resistance to embolism in four contrasting provenances of Pinus halepensis (Aleppo pine in a provenance trial, which is indirect evidence for genetic differences. Results obtained with three techniques (bench dehydration, centrifugation and X-ray micro-CT evidenced significant differentiation with similar ranking between provenances. Inter-provenance variation in P50 correlated with pit anatomical properties (torus overlap and pit aperture size. These results suggest that adaptation of P. halepensis to xeric habitats has been accompanied by modifications of bordered pit function driven by variation in pit aperture. This study thus provides evidence that appropriate exploitation of provenance differences will allow continued forestry with P. halepensis in future climates of the Eastern Mediterranean.

  12. Evidence for weak genetic recombination at the PTP2 locus of Nosema ceranae.

    Science.gov (United States)

    Gómez-Moracho, Tamara; Bartolomé, Carolina; Martín-Hernández, Raquel; Higes, Mariano; Maside, Xulio

    2015-04-01

    The microsporidian Nosema ceranae is an emergent pathogen that threatens the health of honeybees and other pollinators all over the world. Its recent rapid spread across a wide variety of host species and environments demonstrated an enhanced ability of adaptation, which seems to contradict the lack of evidence for genetic recombination and the absence of a sexual stage in its life cycle. Here we retrieved fresh data of the patterns of genetic variation at the PTP2 locus in naturally infected Apis mellifera colonies, by means of single genome amplification. This technique, designed to prevent the formation of chimeric haplotypes during polymerase chain reaction (PCR), provides more reliable estimates of the diversity levels and haplotype structure than standard PCR-cloning methods. Our results are consistent with low but significant rates of recombination in the history of the haplotypes detected: estimates of the population recombination rate are of the order of 30 and support recent evidence for unexpectedly high levels of variation of the parasites within honeybee colonies. These observations suggest the existence of a diploid stage at some point in the life cycle of this parasite and are relevant for our understanding of the dynamics of its expanding population. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  13. Genetic Evidence for Recent Population Mixture in India

    OpenAIRE

    Moorjani, Priya; Thangaraj, Kumarasamy; Patterson, Nick; Lipson, Mark; Loh, Po-Ru; Govindaraj, Periyasamy; Berger, Bonnie; Reich, David; Singh, Lalji

    2013-01-01

    Most Indian groups descend from a mixture of two genetically divergent populations: Ancestral North Indians (ANI) related to Central Asians, Middle Easterners, Caucasians, and Europeans; and Ancestral South Indians (ASI) not closely related to groups outside the subcontinent. The date of mixture is unknown but has implications for understanding Indian history. We report genome-wide data from 73 groups from the Indian subcontinent and analyze linkage disequilibrium to estimate ANI-ASI mixture ...

  14. Genetic evidence of subaortic stenosis in the Newfoundland dog.

    Science.gov (United States)

    Reist-Marti, S B; Dolf, G; Leeb, T; Kottmann, S; Kietzmann, S; Butenhoff, K; Rieder, S

    2012-06-09

    Subaortic stenosis (SAS) is a cardiac disorder with a narrowing of the descending aorta below the left ventricular outflow tract of the heart. It occurs in several species and breeds. The Newfoundland is one of the dog breeds where it is more common and usually leads to death at early adulthood. It is still discussed to which extent SAS has a genetic background and what its mode of inheritance could be. Extensive pedigree data comprising more than 230,000 Newfoundland dogs from the European and North American population reaching back to the 19th century including 6023 dogs with a SAS diagnosis were analysed for genetic factors influencing SAS affection. The incidence and prevalence of SAS in the analysed Newfoundland population sample were much higher than those reported in previous studies on smaller population samples. Assuming that some SAS-affected dogs remained undiscovered or were not reported, these figures may even be underestimated. SAS-affected Newfoundland dogs were more often inbred and closer related to each other than unaffected dogs, which is an indicator for a genetic background of SAS. The sex had no significant impact on SAS affectedness, pointing at an autosomal inheritance. The only simple mode of inheritance that fitted the data well was autosomal codominant with lethal homozygosity and a penetrance of 1/3 in the heterozygotes.

  15. Appearance traits in fish farming: progress from classical genetics to genomics, providing insight into current and potential genetic improvement

    Directory of Open Access Journals (Sweden)

    Nelson eColihueque

    2014-08-01

    Full Text Available Appearance traits in fish, those external body characteristics that influence consumer acceptance at point of sale, have come to the forefront of commercial fish farming, as culture profitability is closely linked to management of these traits. Appearance traits comprise mainly body shape and skin pigmentation. Analysis of the genetic basis of these traits in different fish reveals significant genetic variation within populations, indicating potential for their genetic improvement. Work into ascertaining the minor or major genes underlying appearance traits for commercial fish is emerging, with substantial progress in model fish in terms of identifying genes that control body shape and skin colors. In this review, we describe research progress to date, especially with regard to commercial fish, and discuss genomic findings in model fish in order to better address the genetic basis of the traits. Given that appearance traits are important in commercial fish, the genomic information related to this issue promises to accelerate the selection process in coming years.

  16. Appearance traits in fish farming: progress from classical genetics to genomics, providing insight into current and potential genetic improvement

    Science.gov (United States)

    Colihueque, Nelson; Araneda, Cristian

    2014-01-01

    Appearance traits in fish, those external body characteristics that influence consumer acceptance at point of sale, have come to the forefront of commercial fish farming, as culture profitability is closely linked to management of these traits. Appearance traits comprise mainly body shape and skin pigmentation. Analysis of the genetic basis of these traits in different fish reveals significant genetic variation within populations, indicating potential for their genetic improvement. Work into ascertaining the minor or major genes underlying appearance traits for commercial fish is emerging, with substantial progress in model fish in terms of identifying genes that control body shape and skin colors. In this review, we describe research progress to date, especially with regard to commercial fish, and discuss genomic findings in model fish in order to better address the genetic basis of the traits. Given that appearance traits are important in commercial fish, the genomic information related to this issue promises to accelerate the selection process in coming years. PMID:25140172

  17. Genetic education and nongenetic health professionals: educational providers and curricula in Europe

    NARCIS (Netherlands)

    Challen, K.; Harris, H.J.; Julian-Reynier, C.; Kate, L.P. ten; Kristoffersson, U.; Nippert, I.; Schmidtke, J.; Benjamin, C.; Harris, R

    2005-01-01

    PURPOSE: Advances in and diffusion of genetic technology mean that nongeneticist health professionals have an increasing need to develop and maintain genetic competencies. This has been recognized by patient support groups and the European Commission. As the first phase of the GenEd (Genetic

  18. Asset management using genetic algorithm: Evidence from Tehran Stock Exchange

    Directory of Open Access Journals (Sweden)

    Abbas Sarijaloo

    2014-02-01

    Full Text Available This paper presents an empirical investigation to study the effect of market management using Markowitz theorem. The study uses the information of 50 best performers on Tehran Stock Exchange over the period 2006-2009 and, using Markowitz theorem, the efficient asset allocation are determined and the result are analyzed. The proposed model of this paper has been solved using genetic algorithm. The results indicate that Tehran Stock Exchange has managed to perform much better than average world market in most years of studies especially on year 2009. The results of our investigation have also indicated that one could reach outstanding results using GA and forming efficient portfolio.

  19. Are Private Providers more Productive and Efficient than Public Providers of International Education? Evidence from New Zealand

    Directory of Open Access Journals (Sweden)

    Dayal TALUKDER

    2011-10-01

    Full Text Available This study has investigated the productivity growth and efficiency of private and public providers of international education in New Zealand. It has used secondary data to calculate the DEA-based Malmquist productivity index for measuring Total Factor Productivity (TFP-growth and efficiency of both public and private providers of international education during 1999-2010. The study has found that private providers experienced a larger TFP-growth than that of public providers during 1999-2004. However, they experienced a sharp decline in TFP-growth since 2005 through to 2010 and experienced a much smaller TFP-growth than that of public providers during this period. Conversely, public providers experienced a positive TFP-growth during 1999-2004 but they experienced a negative TFP-growth since 2005 through to 2010. Considering efficiency, both private and public providers experienced almost a constant Technical Efficiency Change (TEC having a same level of efficiency of one. Both private and public providers exhibited a constant return to scale during 1999-2010. This study argues that on an average, private providers are more productive than public providers of international education. However, they are not more efficient than public providers as both types of providers exhibited a constant return to scale during 1999-2010. This study also argues that TFP-growth of New Zealand’s international education was determined by Technological Change (TC, not by TEC during this period.

  20. A rapid evidence-based service by librarians provided information to answer primary care clinical questions.

    Science.gov (United States)

    McGowan, Jessie; Hogg, William; Rader, Tamara; Salzwedel, Doug; Worster, Danielle; Cogo, Elise; Rowan, Margo

    2010-03-01

    A librarian consultation service was offered to 88 primary care clinicians during office hours. This included a streamlined evidence-based process to answer questions in fewer than 20 min. This included a contact centre accessed through a Web-based platform and using hand-held devices and computers with Web access. Librarians were given technical training in evidence-based medicine, including how to summarise evidence. To describe the process and lessons learned from developing and operating a rapid response librarian consultation service for primary care clinicians. Evaluation included librarian interviews and a clinician exit satisfaction survey. Clinicians were positive about its impact on their clinical practice and decision making. The project revealed some important 'lessons learned' in the clinical use of hand-held devices, knowledge translation and training for clinicians and librarians. The Just-in-Time Librarian Consultation Service showed that it was possible to provide evidence-based answers to clinical questions in 15 min or less. The project overcame a number of barriers using innovative solutions. There are many opportunities to build on this experience for future joint projects of librarians and healthcare providers.

  1. Organizational Culture and Climate and Mental Health Provider Attitudes Toward Evidence-Based Practice.

    Science.gov (United States)

    Aarons, Gregory A; Sawitzky, Angelina C

    2006-02-01

    Mental health provider attitudes toward adopting evidence-based practice (EBP) are associated with organizational context and provider individual differences. Organizational culture and climate are contextual factors that can affect staff acceptance of innovation. This study examined the association of organizational culture and climate with attitudes toward adopting EBP. Participants were 301 public sector mental health service providers from 49 programs providing mental health services for youths and families. Correlation analyses and multilevel hierarchical regressions, controlling for effects of provider characteristics, showed that constructive culture was associated with more positive attitudes toward adoption of EBP and poor organizational climates with perceived divergence of usual practice and EBP. Behavioral health organizations may benefit from consideration of how culture and climate affect staff attitudes toward change in practice.

  2. Genetic evidence of multiple loci in dystocia - difficult labour

    Directory of Open Access Journals (Sweden)

    Westgren Magnus

    2010-06-01

    Full Text Available Abstract Background Dystocia, difficult labour, is a common but also complex problem during childbirth. It can be attributed to either weak contractions of the uterus, a large infant, reduced capacity of the pelvis or combinations of these. Previous studies have indicated that there is a genetic component in the susceptibility of experiencing dystocia. The purpose of this study was to identify susceptibility genes in dystocia. Methods A total of 104 women in 47 families were included where at least two sisters had undergone caesarean section at a gestational length of 286 days or more at their first delivery. Study of medical records and a telephone interview was performed to identify subjects with dystocia. Whole-genome scanning using Affymetrix genotyping-arrays and non-parametric linkage (NPL analysis was made in 39 women exhibiting the phenotype of dystocia from 19 families. In 68 women re-sequencing was performed of candidate genes showing suggestive linkage: oxytocin (OXT on chromosome 20 and oxytocin-receptor (OXTR on chromosome 3. Results We found a trend towards linkage with suggestive NPL-score (3.15 on chromosome 12p12. Suggestive linkage peaks were observed on chromosomes 3, 4, 6, 10, 20. Re-sequencing of OXT and OXTR did not reveal any causal variants. Conclusions Dystocia is likely to have a genetic component with variations in multiple genes affecting the patient outcome. We found 6 loci that could be re-evaluated in larger patient cohorts.

  3. Genetic evidence of multiple loci in dystocia - difficult labour

    Science.gov (United States)

    2010-01-01

    Background Dystocia, difficult labour, is a common but also complex problem during childbirth. It can be attributed to either weak contractions of the uterus, a large infant, reduced capacity of the pelvis or combinations of these. Previous studies have indicated that there is a genetic component in the susceptibility of experiencing dystocia. The purpose of this study was to identify susceptibility genes in dystocia. Methods A total of 104 women in 47 families were included where at least two sisters had undergone caesarean section at a gestational length of 286 days or more at their first delivery. Study of medical records and a telephone interview was performed to identify subjects with dystocia. Whole-genome scanning using Affymetrix genotyping-arrays and non-parametric linkage (NPL) analysis was made in 39 women exhibiting the phenotype of dystocia from 19 families. In 68 women re-sequencing was performed of candidate genes showing suggestive linkage: oxytocin (OXT) on chromosome 20 and oxytocin-receptor (OXTR) on chromosome 3. Results We found a trend towards linkage with suggestive NPL-score (3.15) on chromosome 12p12. Suggestive linkage peaks were observed on chromosomes 3, 4, 6, 10, 20. Re-sequencing of OXT and OXTR did not reveal any causal variants. Conclusions Dystocia is likely to have a genetic component with variations in multiple genes affecting the patient outcome. We found 6 loci that could be re-evaluated in larger patient cohorts. PMID:20587075

  4. Evolving perspectives on genetic discrimination in health insurance among health care providers.

    Science.gov (United States)

    Huizenga, Carin R; Lowstuter, Katrina; Banks, Kimberly C; Lagos, Veronica I; Vandergon, Virginia O; Weitzel, Jeffrey N

    2010-06-01

    Previous studies have documented that concerns about genetic discrimination (GD) may influence access to and participation in medically necessary care. We sought to characterize how GD issues influence current cancer genetics professional (CGP) practice, determine if their attitudes regarding GD have changed over time, and compare their knowledge and attitudes regarding laws prohibiting GD to a contemporary cohort of non-genetics clinicians. Members of the National Society of Genetic Counselors Familial Cancer Special Interest Group were invited to complete a 39 item online survey, adapted from previously published instruments. The resulting data were compared to a survey of CGPs published in 2000 and to a contemporary cohort of non-genetics clinicians (n = 1,181). There were 153 qualified respondents. Compared to the historical CGP cohort (n = 163), a significantly greater proportion said they would bill insurance for the cost of genetic testing for themselves (P genetics clinicians (P genetics clinicians. Better knowledge of GD and protective legislation, may facilitate non-genetics clinician utilization of genetics and personalized medicine.

  5. Novel canine circovirus strains from Thailand: Evidence for genetic recombination.

    Science.gov (United States)

    Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E

    2018-05-14

    Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.

  6. Genetic evidence on the origins of Indian caste populations.

    Science.gov (United States)

    Bamshad, M; Kivisild, T; Watkins, W S; Dixon, M E; Ricker, C E; Rao, B B; Naidu, J M; Prasad, B V; Reddy, P G; Rasanayagam, A; Papiha, S S; Villems, R; Redd, A J; Hammer, M F; Nguyen, S V; Carroll, M L; Batzer, M A; Jorde, L B

    2001-06-01

    The origins and affinities of the approximately 1 billion people living on the subcontinent of India have long been contested. This is owing, in part, to the many different waves of immigrants that have influenced the genetic structure of India. In the most recent of these waves, Indo-European-speaking people from West Eurasia entered India from the Northwest and diffused throughout the subcontinent. They purportedly admixed with or displaced indigenous Dravidic-speaking populations. Subsequently they may have established the Hindu caste system and placed themselves primarily in castes of higher rank. To explore the impact of West Eurasians on contemporary Indian caste populations, we compared mtDNA (400 bp of hypervariable region 1 and 14 restriction site polymorphisms) and Y-chromosome (20 biallelic polymorphisms and 5 short tandem repeats) variation in approximately 265 males from eight castes of different rank to approximately 750 Africans, Asians, Europeans, and other Indians. For maternally inherited mtDNA, each caste is most similar to Asians. However, 20%-30% of Indian mtDNA haplotypes belong to West Eurasian haplogroups, and the frequency of these haplotypes is proportional to caste rank, the highest frequency of West Eurasian haplotypes being found in the upper castes. In contrast, for paternally inherited Y-chromosome variation each caste is more similar to Europeans than to Asians. Moreover, the affinity to Europeans is proportionate to caste rank, the upper castes being most similar to Europeans, particularly East Europeans. These findings are consistent with greater West Eurasian male admixture with castes of higher rank. Nevertheless, the mitochondrial genome and the Y chromosome each represents only a single haploid locus and is more susceptible to large stochastic variation, bottlenecks, and selective sweeps. Thus, to increase the power of our analysis, we assayed 40 independent, biparentally inherited autosomal loci (1 LINE-1 and 39 Alu elements

  7. The analysis of APOL1 genetic variation and haplotype diversity provided by 1000 Genomes project.

    Science.gov (United States)

    Peng, Ting; Wang, Li; Li, Guisen

    2017-08-11

    The APOL1 gene variants has been shown to be associated with an increased risk of multiple kinds of diseases, particularly in African Americans, but not in Caucasians and Asians. In this study, we explored the single nucleotide polymorphism (SNP) and haplotype diversity of APOL1 gene in different races provided by 1000 Genomes project. Variants of APOL1 gene in 1000 Genome Project were obtained and SNPs located in the regulatory region or coding region were selected for genetic variation analysis. Total 2504 individuals from 26 populations were classified as four groups that included Africa, Europe, Asia and Admixed populations. Tag SNPs were selected to evaluate the haplotype diversities in the four populations by HaploStats software. APOL1 gene was surrounded by some of the most polymorphic genes in the human genome, variation of APOL1 gene was common, with up to 613 SNP (1000 Genome Project reported) and 99 of them (16.2%) with MAF ≥ 1%. There were 79 SNPs in the URR and 92 SNPs in 3'UTR. Total 12 SNPs in URR and 24 SNPs in 3'UTR were considered as common variants with MAF ≥ 1%. It is worth noting that URR-1 was presents lower frequencies in European populations, while other three haplotypes taken an opposite pattern; 3'UTR presents several high-frequency variation sites in a short segment, and the differences of its haplotypes among different population were significant (P < 0.01), UTR-1 and UTR-5 presented much higher frequency in African population, while UTR-2, UTR-3 and UTR-4 were much lower. APOL1 coding region showed that two SNP of G1 with higher frequency are actually pull down the haplotype H-1 frequency when considering all populations pooled together, and the diversity among the four populations be widen by the G1 two mutation (P 1  = 3.33E-4 vs P 2  = 3.61E-30). The distributions of APOL1 gene variants and haplotypes were significantly different among the different populations, in either regulatory or coding regions. It could provide

  8. Feedback to providers improves evidence-based implantable cardioverter-defibrillator programming and reduces shocks.

    Science.gov (United States)

    Silver, Marc T; Sterns, Laurence D; Piccini, Jonathan P; Joung, Boyoung; Ching, Chi-Keong; Pickett, Robert A; Rabinovich, Rafael; Liu, Shufeng; Peterson, Brett J; Lexcen, Daniel R

    2015-03-01

    Implantable cardioverter-defibrillator (ICD) shocks are associated with increased anxiety, health care utilization, and potentially mortality. The purpose of the Shock-Less Study was to determine if providing feedback reports to physicians on their adherence to evidence-based shock reduction programming could improve their programming behavior and reduce shocks. Shock-Less enrolled primary prevention (PP) and secondary prevention (SP) ICD patients between 2009 and 2012 at 118 study centers worldwide and followed patients longitudinally after their ICD implant. Center-specific therapy programming reports (TPRs) were delivered to each center 9 to 12 months after their first enrollment. The reports detailed adherence to evidence-based programming targets: number of intervals to detect ventricular fibrillation (VF NID), longest treatment interval (LTI), supraventricular tachycardia (SVT) discriminators (Wavelet, PR Logic), SVT limit, Lead Integrity Alert (LIA), and antitachycardia pacing (ATP). Clinicians programmed ICDs at their discretion. The primary outcome measure was the change in utilization of evidence-based shock reduction programming before (phase I, n = 2694 patients) and after initiation of the TPR (phase II, n = 1438 patients). Patients implanted after feedback reports (phase II) were up to 20% more likely to have their ICDs programmed in line with evidence-based shock reduction programming (eg, VF NID in PP patients 30/40 in 33.5% vs 18.6%, P programming feedback reports improves adherence to evidence-based shock reduction programming and is associated with lower risk of ICD shocks. Copyright © 2015 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  9. Narcissism predicts impulsive buying: phenotypic and genetic evidence

    Science.gov (United States)

    Cai, Huajian; Shi, Yuanyuan; Fang, Xiang; Luo, Yu L. L.

    2015-01-01

    Impulsive buying makes billions of dollars for retail businesses every year, particularly in an era of thriving e-commerce. Narcissism, characterized by impulsivity and materialism, may serve as a potential antecedent to impulsive buying. To test this hypothesis, two studies examined the relationship between narcissism and impulsive buying. In Study 1, we surveyed an online sample and found that while adaptive narcissism was not correlated with impulsive buying, maladaptive narcissism was significantly predictive of the impulsive buying tendency. By investigating 304 twin pairs, Study 2 showed that global narcissism and its two components, adaptive and maladaptive narcissism, as well as the impulsive buying tendency were heritable. The study found, moreover, that the connections between global narcissism and impulsive buying, and between maladaptive narcissism and impulsive buying were genetically based. These findings not only establish a link between narcissism and impulsive buying but also help to identify the origins of the link. The present studies deepen our understanding of narcissism, impulsive buying, and their interrelationship. PMID:26217251

  10. Narcissism predicts impulsive buying: phenotypic and genetic evidence.

    Science.gov (United States)

    Cai, Huajian; Shi, Yuanyuan; Fang, Xiang; Luo, Yu L L

    2015-01-01

    Impulsive buying makes billions of dollars for retail businesses every year, particularly in an era of thriving e-commerce. Narcissism, characterized by impulsivity and materialism, may serve as a potential antecedent to impulsive buying. To test this hypothesis, two studies examined the relationship between narcissism and impulsive buying. In Study 1, we surveyed an online sample and found that while adaptive narcissism was not correlated with impulsive buying, maladaptive narcissism was significantly predictive of the impulsive buying tendency. By investigating 304 twin pairs, Study 2 showed that global narcissism and its two components, adaptive and maladaptive narcissism, as well as the impulsive buying tendency were heritable. The study found, moreover, that the connections between global narcissism and impulsive buying, and between maladaptive narcissism and impulsive buying were genetically based. These findings not only establish a link between narcissism and impulsive buying but also help to identify the origins of the link. The present studies deepen our understanding of narcissism, impulsive buying, and their interrelationship.

  11. Evidence of genetic susceptibility to infectious mononucleosis: a twin study.

    Science.gov (United States)

    Hwang, A E; Hamilton, A S; Cockburn, M G; Ambinder, R; Zadnick, J; Brown, E E; Mack, T M; Cozen, W

    2012-11-01

    Infectious mononucleosis is a clinical manifestation of primary Epstein-Barr virus infection. It is unknown whether genetic factors contribute to risk. To assess heritability, we compared disease concordance in monozygotic to dizygotic twin pairs from the population-based California Twin Program and assessed the risk to initially unaffected co-twins. One member of 611 and both members of 58 twin pairs reported a history of infectious mononucleosis. Pairwise concordance in monozygotic and dizygotic pairs was respectively 12·1% [standard error (s.e.)=1·9%] and 6·1% (s.e.=1·2%). The relative risk (hazard ratio) of monozygotic compared to dizygotic unaffected co-twins of cases was 1·9 [95% confidence interval (CI) 1·1-3·4, P=0·03], over the follow-up period. When the analysis was restricted to same-sex twin pairs, that estimate was 2·5 (95% CI 1·2-5·3, P=0·02). The results are compatible with a heritable contribution to the risk of infectious mononucleosis.

  12. Iridoschisis: high frequency ultrasound imaging. Evidence for a genetic defect?

    Science.gov (United States)

    Danias, J; Aslanides, I M; Eichenbaum, J W; Silverman, R H; Reinstein, D Z; Coleman, D J

    1996-01-01

    AIMS: To elucidate changes in the anatomy of the anterior chamber associated with iridoschisis, a rare form of iris atrophy, and their potential contribution to angle closure glaucoma. METHODS: Both eyes of a 71-year-old woman with bilateral iridoschisis and fibrous dysplasia and her asymptomatic 50-year-old daughter were scanned with a very high frequency (50 MHz) ultrasound system. RESULTS: The symptomatic patient exhibited diffuse changes in the iris stoma with an intact posterior iris pigmented layer in both eyes. These changes were clinically compatible with the lack of iris transillumination defects. Additionally, iris bowing with a resultant narrowing of the angle occurred. The asymptomatic daughter showed discrete, but less severe iris stromal changes. CONCLUSION: This is the first detailed study of high frequency ultrasonic imaging of the iris in iridoschisis. The observed structural changes suggest angle narrowing by forward bowing of the anterior iris stroma may be a mechanism of IOP elevation in this condition. The ultrasonic detection of iris changes in the asymptomatic daughter of the symptomatic patient and the association of iridoschisis with fibrous dysplasia suggest a possible genetic component in the pathogenesis of this condition. Images PMID:9059271

  13. Narcissism predicts impulsive buying: phenotypic and genetic evidence

    Directory of Open Access Journals (Sweden)

    Huajian eCai

    2015-07-01

    Full Text Available Impulsive buying makes billions of dollars for retail businesses every year, particularly in an era of thriving e-commerce. Narcissism, characterized by impulsivity and materialism, may serve as a potential antecedent to impulsive buying. To test this hypothesis, two studies examined the relationship between narcissism and impulsive buying. In study 1, we surveyed narcissism and the impulsive buying tendency among an online sample and found that while adaptive narcissism was not correlated with impulsive buying, maladaptive narcissism was significantly predictive of the impulsive buying tendency. By investigating narcissism and the impulsive buying tendency in 304 twin pairs, study 2 showed that global narcissism and its two components, adaptive and maladaptive narcissism, as well as the impulsive buying tendency were heritable. The study found, moreover, that the connections between global narcissism and impulsive buying, and between maladaptive narcissism and impulsive buying were genetically based. These findings not only establish a link between narcissism and impulsive buying but also help to identify the origins of the link. The present studies deepen our understanding of narcissism, impulsive buying, and their interrelationship.

  14. Utilisation of evidence-based practices by ASD early intervention service providers.

    Science.gov (United States)

    Paynter, Jessica M; Ferguson, Sarah; Fordyce, Kathryn; Joosten, Annette; Paku, Sofia; Stephens, Miranda; Trembath, David; Keen, Deb

    2017-02-01

    A number of autism intervention practices have been demonstrated to be effective. However, the use of unsupported practices persists in community early intervention settings. Recent research has suggested that personal, professional and workplace factors may influence intervention choices. The aim of this research was to investigate knowledge and use of strategies, organisational culture, individual attitudes, sources of information and considerations informing intervention choices by early intervention providers. An online survey was completed by 72 early intervention providers from four organisations across Australia. Providers reported high levels of trust and access of information from internal professional development, therapists and external professional development. A range of considerations including child factors, family values and research were rated as important in informing intervention choices. Participants reported greater knowledge and use of evidence-based and emerging practices than unsupported. Levels of use were linked to levels of knowledge, as well as some organisational and attitudinal factors. Areas for future research and implications are discussed.

  15. Training medical providers in evidence-based approaches to suicide prevention.

    Science.gov (United States)

    DeHay, Tamara; Ross, Sarah; McFaul, Mimi

    2015-01-01

    Suicide is a significant issue in the United States and worldwide, and its prevention is a public health imperative. Primary care practices are an important setting for suicide prevention, as primary care providers have more frequent contact with patients at risk for suicide than any other type of health-care provider. The Western Interstate Commission for Higher Education, in partnership with the Suicide Prevention Resource Center, has developed a Suicide Prevention Toolkit and an associated training curriculum. These resources support the education of primary care providers in evidence-based strategies for identifying and treating patients at risk for suicide. The application of this curriculum to post-graduate medical training is presented here. © The Author(s) 2015.

  16. Genetic evidence for natural selection in humans in the contemporary United States.

    Science.gov (United States)

    Beauchamp, Jonathan P

    2016-07-12

    Recent findings from molecular genetics now make it possible to test directly for natural selection by analyzing whether genetic variants associated with various phenotypes have been under selection. I leverage these findings to construct polygenic scores that use individuals' genotypes to predict their body mass index, educational attainment (EA), glucose concentration, height, schizophrenia, total cholesterol, and (in females) age at menarche. I then examine associations between these scores and fitness to test whether natural selection has been occurring. My study sample includes individuals of European ancestry born between 1931 and 1953 who participated in the Health and Retirement Study, a representative study of the US population. My results imply that natural selection has been slowly favoring lower EA in both females and males, and are suggestive that natural selection may have favored a higher age at menarche in females. For EA, my estimates imply a rate of selection of about -1.5 mo of education per generation (which pales in comparison with the increases in EA observed in contemporary times). Although they cannot be projected over more than one generation, my results provide additional evidence that humans are still evolving-albeit slowly, especially compared with the rapid changes that have occurred over the past few generations due to cultural and environmental factors.

  17. Evidence of genetic heterogeneity in Alberta Hutterites with Usher syndrome type I.

    Science.gov (United States)

    Zhou, Qi; Lenger, Chaeli; Smith, Richard; Kimberling, William J; Ye, Ming; Lehmann, Ordan; MacDonald, Ian

    2012-01-01

    To identify the genetic defect in a Hutterite population from northern Alberta with Usher syndrome type I. Complete ophthalmic examinations were conducted on two boys and two girls from two related Hutterite families diagnosed with Usher syndrome type I. DNA from patients and their parents was first evaluated for a mutation in exon 10 of the protocadherin-related 15 (PCDH15) gene (c.1471delG), previously reported in southern Alberta Hutterite patients with Usher syndrome (USH1F). Single nucleotide polymorphic linkage analysis was then used to confirm another locus, and DNA was analyzed with the Usher Chip v4.0 platform. Severe hearing impairment, unintelligible speech, and retinitis pigmentosa with varying degrees of visual acuity and visual field loss established a clinical diagnosis of Usher syndrome type I. The patients did not carry the exon 10 mutation in the PCDH15 gene; however, with microarray analysis, a previously reported mutation (c.52C>T; p.Q18X) in the myosin VIIA (MYO7A) gene was found in the homozygous state in the affected siblings. The finding of a MYO7A mutation in two related Hutterite families from northern Alberta provides evidence of genetic heterogeneity in Hutterites affected by Usher syndrome type I.

  18. Impact of Behavioral Genetic Evidence on the Adjudication of Criminal Behavior

    OpenAIRE

    Appelbaum, Paul S.; Scurich, Nicholas

    2014-01-01

    Recent advances in behavioral genetics suggest a modest relationship among certain gene variants, early childhood experiences, and criminal behavior. Although scientific research examining this link is still at an early stage, genetic data are already being introduced in criminal trials. However, the extent to which such evidence is likely to affect jurors’ decisions has not previously been explored. In the present study, a representative sample of the U.S. population (n=250) received a vigne...

  19. Does a ban on informal health providers save lives? Evidence from Malawi

    Science.gov (United States)

    Godlonton, Susan; Okeke, Edward N.

    2015-01-01

    Informal health providers ranging from drug vendors to traditional healers account for a large fraction of health care provision in developing countries. They are, however, largely unlicensed and unregulated leading to concern that they provide ineffective and, in some cases, even harmful care. A new and controversial policy tool that has been proposed to alter household health seeking behavior is an outright ban on these informal providers. The theoretical effects of such a ban are ambiguous. In this paper, we study the effect of a ban on informal (traditional) birth attendants imposed by the Malawi government in 2007. To measure the effect of the ban, we use a difference-in-difference strategy exploiting variation across time and space in the intensity of exposure to the ban. Our most conservative estimates suggest that the ban decreased use of traditional attendants by about 15 percentage points. Approximately three quarters of this decline can be attributed to an increase in use of the formal sector and the remainder is accounted for by an increase in relative/friend-attended births. Despite the rather large shift from the informal to the formal sector, we do not find any evidence of a statistically significant reduction in newborn mortality on average. The results are robust to a triple difference specification using young children as a control group. We examine several explanations for this result and find evidence consistent with quality of formal care acting as a constraint on improvements in newborn health. PMID:26681821

  20. Little Evidence Exists To Support The Expectation That Providers Would Consolidate To Enter New Payment Models.

    Science.gov (United States)

    Neprash, Hannah T; Chernew, Michael E; McWilliams, J Michael

    2017-02-01

    Provider consolidation has been associated with higher health care prices and spending. The prevailing wisdom is that payment reform will accelerate consolidation, especially between physicians and hospitals and among physician groups, as providers position themselves to bear financial risk for the full continuum of patient care. Drawing on data from a number of sources from 2008 onward, we examined the relationship between Medicare's accountable care organization (ACO) programs and provider consolidation. We found that consolidation was under way in the period 2008-10, before the Affordable Care Act (ACA) established the ACO programs. While the number of hospital mergers and the size of specialty-oriented physician groups increased after the ACA was passed, we found minimal evidence that consolidation was associated with ACO penetration at the market level or with physicians' participation in ACOs within markets. We conclude that payment reform has been associated with little acceleration in consolidation in addition to trends already under way, but there is evidence of potential defensive consolidation in response to new payment models. Project HOPE—The People-to-People Health Foundation, Inc.

  1. Delusional disorder: molecular genetic evidence for dopamine psychosis.

    Science.gov (United States)

    Morimoto, Kiyoshi; Miyatake, Ryosuke; Nakamura, Mitsuo; Watanabe, Takemi; Hirao, Toru; Suwaki, Hiroshi

    2002-06-01

    Since delusional disorder is characterized by mono-symptomatic paranoid symptoms, it can be a good clinical model for investigating the dopaminergic mechanism responsible for paranoid symptoms. We examined neuroleptic responses, plasma homovanillic acid (pHVA) and genes of the dopamine receptor (DR) and its synthesizing enzyme (tyrosine hydroxylase: TH) in patients with delusional disorder and compared them with those of schizophrenic patients and healthy controls. (1) A relatively small dose of haloperidol was more effective for delusional disorder than for schizophrenia. (2) The pretreatment level of pHVA was higher in patients with persecution-type, but not in those with jealousy-type delusional disorder, compared with age- and sex-matched controls. This increased pHVA level was decreased eight weeks after successful haloperidol treatment. (3) The genotype frequency of the DRD2 gene Ser311Cys was significantly higher in patients with persecution-type delusional disorder (21%), compared with schizophrenic patients (6%) or controls (6%). (4) Patients homozygous for the DRD3 gene Ser9Ser had higher pretreatment levels of pHVA than those heterozygous for Ser9Gly. (v) A significant positive correlation was found between the polymorphic (TCAT)(n) repeat in the first intron of the TH gene and pretreatment levels of pHVA in delusional disorder. We suggest that delusional disorder, especially the persecution-type, includes a "dopamine psychosis," and that polymorphism of the DRD2, DRD3 and/or TH gene is part of the genetic basis underlying the hyperdopaminergic state that produces paranoid symptoms. Further studies on a large sample size are required.

  2. Genetic structure of populations of whale sharks among ocean basins and evidence for their historic rise and recent decline

    KAUST Repository

    Vignaud, Thomas M.; Maynard, Jeffrey Allen; Leblois, Raphaë l; Meekan, Mark G.; Vá zquez-Juá rez, Ricardo; Ramí rez-Mací as, Dení ; Pierce, Simon J.; Rowat, David; Berumen, Michael L.; Beeravolu, Champak R.; Baksay, Sandra; Planes, Serge

    2014-01-01

    This study presents genetic evidence that whale sharks, Rhincodon typus, are comprised of at least two populations that rarely mix and is the first to document a population expansion. Relatively high genetic structure is found when comparing sharks

  3. Spontaneous chromosome aberrations in cancer cells. Evidence of existence of hidden genetic lesions in genetic structures

    International Nuclear Information System (INIS)

    Poryadkova-Luchnik, N.A.; Kuz'mina, E.G.

    1996-01-01

    Chromosome aberrations spontaneously observed in cancer cells were quantitively studied under the effect of non-mutagenic (suboptimal temperature, low content of propilgallate and caffeine) and mutagenic (ionizing radiation) factors. Human larynx cancer cells during several years or gamma-irradiation were used to carry out experiments. The experiments linked with cloning of the initial population and investigation into chromosome aberrations in 22 clones demonstrated persuasively the occurrence of latent genetic lesions in cancer cells

  4. Evidence of two genetic clusters of manatees with low genetic diversity in Mexico and implications for their conservation

    Science.gov (United States)

    Nourisson, C.; Morales-Vela, B.; Padilla-Saldivar, J.; Tucker, K.P.; Clark, A.; Olivera-Gomez, L. D.; Bonde, R.; McGuire, P.

    2011-01-01

    The Antillean manatee (Trichechus manatus manatus) occupies the tropical coastal waters of the Greater Antilles and Caribbean, extending from Mexico along Central and South America to Brazil. Historically, manatees were abundant in Mexico, but hunting during the pre-Columbian period, the Spanish colonization and throughout the history of Mexico, has resulted in the significantly reduced population occupying Mexico today. The genetic structure, using microsatellites, shows the presence of two populations in Mexico: the Gulf of Mexico (GMx) and Chetumal Bay (ChB) on the Caribbean coast, with a zone of admixture in between. Both populations show low genetic diversity (GMx: NA=2.69; HE=0.41 and ChB: NA=3.0; HE=0.46). The lower genetic diversity found in the GMx, the largest manatee population in Mexico, is probably due to a combination of a founder effect, as this is the northern range of the sub-species of T. m. manatus, and a bottleneck event. The greater genetic diversity observed along the Caribbean coast, which also has the smallest estimated number of individuals, is possibly due to manatees that come from the GMx and Belize. There is evidence to support limited or unidirectional gene flow between these two important areas. The analyses presented here also suggest minimal evidence of a handful of individual migrants possibly between Florida and Mexico. To address management issues we suggest considering two distinct genetic populations in Mexico, one along the Caribbean coast and one in the riverine systems connected to the GMx. ?? 2011 Springer Science+Business Media B.V.

  5. Evidence of two genetic clusters of manatees with low genetic diversity in Mexico and implications for their conservation.

    Science.gov (United States)

    Nourisson, Coralie; Morales-Vela, Benjamín; Padilla-Saldívar, Janneth; Tucker, Kimberly Pause; Clark, Annmarie; Olivera-Gómez, Leon David; Bonde, Robert; McGuire, Peter

    2011-07-01

    The Antillean manatee (Trichechus manatus manatus) occupies the tropical coastal waters of the Greater Antilles and Caribbean, extending from Mexico along Central and South America to Brazil. Historically, manatees were abundant in Mexico, but hunting during the pre-Columbian period, the Spanish colonization and throughout the history of Mexico, has resulted in the significantly reduced population occupying Mexico today. The genetic structure, using microsatellites, shows the presence of two populations in Mexico: the Gulf of Mexico (GMx) and Chetumal Bay (ChB) on the Caribbean coast, with a zone of admixture in between. Both populations show low genetic diversity (GMx: N(A) = 2.69; H(E) = 0.41 and ChB: N(A) = 3.0; H(E) = 0.46). The lower genetic diversity found in the GMx, the largest manatee population in Mexico, is probably due to a combination of a founder effect, as this is the northern range of the sub-species of T. m. manatus, and a bottleneck event. The greater genetic diversity observed along the Caribbean coast, which also has the smallest estimated number of individuals, is possibly due to manatees that come from the GMx and Belize. There is evidence to support limited or unidirectional gene flow between these two important areas. The analyses presented here also suggest minimal evidence of a handful of individual migrants possibly between Florida and Mexico. To address management issues we suggest considering two distinct genetic populations in Mexico, one along the Caribbean coast and one in the riverine systems connected to the GMx.

  6. Evidence of two genetic clusters of manatees with low genetic diversity in Mexico and implications for their conservation

    Science.gov (United States)

    Nourisson, Coralie; Morales-Vela, Benjamin; Padilla-Saldivar, Janneth; Tucker, Kimberly Pause; Clark, Ann Marie; Olivera-Gomez, Leon David; Bonde, Robert; McGuire, Peter

    2011-01-01

    The Antillean manatee (Trichechus manatus manatus) occupies the tropical coastal waters of the Greater Antilles and Caribbean, extending from Mexico along Central and South America to Brazil. Historically, manatees were abundant in Mexico, but hunting during the pre-Columbian period, the Spanish colonization and throughout the history of Mexico, has resulted in the significantly reduced population occupying Mexico today. The genetic structure, using microsatellites, shows the presence of two populations in Mexico: the Gulf of Mexico (GMx) and Chetumal Bay (ChB) on the Caribbean coast, with a zone of admixture in between. Both populations show low genetic diversity (GMx: NA = 2.69; HE = 0.41 and ChB: NA = 3.0; HE = 0.46). The lower genetic diversity found in the GMx, the largest manatee population in Mexico, is probably due to a combination of a founder effect, as this is the northern range of the sub-species of T. m. manatus, and a bottleneck event. The greater genetic diversity observed along the Caribbean coast, which also has the smallest estimated number of individuals, is possibly due to manatees that come from the GMx and Belize. There is evidence to support limited or unidirectional gene flow between these two important areas. The analyses presented here also suggest minimal evidence of a handful of individual migrants possibly between Florida and Mexico. To address management issues we suggest considering two distinct genetic populations in Mexico, one along the Caribbean coast and one in the riverine systems connected to the GMx.

  7. Online genetic counseling from the providers' perspective : counselors' evaluations and a time and cost analysis

    NARCIS (Netherlands)

    Otten, Ellen; Birnie, Erwin; Ranchor, Adelita V.; van Langen, Irene M.

    Telemedicine applications are increasingly being introduced in patient care in various disciplines, including clinical genetics, mainly to increase access to care and to reduce time and costs for patients and professionals. Most telegenetics reports describe applications in large geographical areas,

  8. Population genetics provides an efficient tool to quantify fragmentation impact in forest ecosystems

    Directory of Open Access Journals (Sweden)

    2005-01-01

    Full Text Available A method in population genetics (Dutech et al., Am. J. Bot. 92 (2, 252-261, February 2005 is described and discussed as an interesting tool for investigating the effects of fragmentation in forest ecosystems.

  9. Skin pigmentation provides evidence of convergent melanism in extinct marine reptiles.

    Science.gov (United States)

    Lindgren, Johan; Sjövall, Peter; Carney, Ryan M; Uvdal, Per; Gren, Johan A; Dyke, Gareth; Schultz, Bo Pagh; Shawkey, Matthew D; Barnes, Kenneth R; Polcyn, Michael J

    2014-02-27

    Throughout the animal kingdom, adaptive colouration serves critical functions ranging from inconspicuous camouflage to ostentatious sexual display, and can provide important information about the environment and biology of a particular organism. The most ubiquitous and abundant pigment, melanin, also has a diverse range of non-visual roles, including thermoregulation in ectotherms. However, little is known about the functional evolution of this important biochrome through deep time, owing to our limited ability to unambiguously identify traces of it in the fossil record. Here we present direct chemical evidence of pigmentation in fossilized skin, from three distantly related marine reptiles: a leatherback turtle, a mosasaur and an ichthyosaur. We demonstrate that dark traces of soft tissue in these fossils are dominated by molecularly preserved eumelanin, in intimate association with fossilized melanosomes. In addition, we suggest that contrary to the countershading of many pelagic animals, at least some ichthyosaurs were uniformly dark-coloured in life. Our analyses expand current knowledge of pigmentation in fossil integument beyond that of feathers, allowing for the reconstruction of colour over much greater ranges of extinct taxa and anatomy. In turn, our results provide evidence of convergent melanism in three disparate lineages of secondarily aquatic tetrapods. Based on extant marine analogues, we propose that the benefits of thermoregulation and/or crypsis are likely to have contributed to this melanisation, with the former having implications for the ability of each group to exploit cold environments.

  10. Magnetic resonance imaging provides evidence of glymphatic drainage from human brain to cervical lymph nodes.

    Science.gov (United States)

    Eide, Per Kristian; Vatnehol, Svein Are Sirirud; Emblem, Kyrre Eeg; Ringstad, Geir

    2018-05-08

    Pre-clinical research in rodents provides evidence that the central nervous system (CNS) has functional lymphatic vessels. In-vivo observations in humans, however, are not demonstrated. We here show data on CNS lymphatic drainage to cervical lymph nodes in-vivo by magnetic resonance imaging (MRI) enhanced with an intrathecal contrast agent as a cerebrospinal fluid (CSF) tracer. Standardized MRI of the intracranial compartment and the neck were acquired before and up to 24-48 hours following intrathecal contrast agent administration in 19 individuals. Contrast enhancement was radiologically confirmed by signal changes in CSF nearby inferior frontal gyrus, brain parenchyma of inferior frontal gyrus, parahippocampal gyrus, thalamus and pons, and parenchyma of cervical lymph node, and with sagittal sinus and neck muscle serving as reference tissue for cranial and neck MRI acquisitions, respectively. Time series of changes in signal intensity shows that contrast enhancement within CSF precedes glymphatic enhancement and peaks at 4-6 hours following intrathecal injection. Cervical lymph node enhancement coincides in time with peak glymphatic enhancement, with peak after 24 hours. Our findings provide in-vivo evidence of CSF tracer drainage to cervical lymph nodes in humans. The time course of lymph node enhancement coincided with brain glymphatic enhancement rather than with CSF enhancement.

  11. Review: fetal programming of polycystic ovary syndrome by androgen excess: evidence from experimental, clinical, and genetic association studies.

    Science.gov (United States)

    Xita, Nectaria; Tsatsoulis, Agathocles

    2006-05-01

    Polycystic ovary syndrome (PCOS) is a common endocrine disorder of premenopausal women, characterized by hyperandrogenism, polycystic ovaries, and chronic anovulation along with insulin resistance and abdominal obesity as frequent metabolic traits. Although PCOS manifests clinically during adolescence, emerging data suggest that the natural history of PCOS may originate in intrauterine life. Evidence from experimental, clinical, and genetic research supporting the hypothesis for the fetal origins of PCOS has been analyzed. Female primates, exposed in utero to androgen excess, exhibit the phenotypic features of PCOS during adult life. Clinical observations also support a potential fetal origin of PCOS. Women with fetal androgen excess disorders, including congenital 21-hydroxylase deficiency and congenital adrenal virilizing tumors, develop features characteristic of PCOS during adulthood despite the normalization of androgen excess after birth. The potential mechanisms of fetal androgen excess leading to a PCOS phenotype in humans are not clearly understood. However, maternal and/or fetal hyperandrogenism can provide a plausible mechanism for fetal programing of PCOS, and this, in part, may be genetically determined. Thus, genetic association studies have indicated that common polymorphic variants of genes determining androgen activity or genes that influence the availability of androgens to target tissues are associated with PCOS and increased androgen levels. These genomic variants may provide the genetic link to prenatal androgenization in human PCOS. Prenatal androgenization of the female fetus induced by genetic and environmental factors, or the interaction of both, may program differentiating target tissues toward the development of PCOS phenotype in adult life.

  12. Interpreting genetics in the context of eating disorders: evidence of disease, not diversity.

    Science.gov (United States)

    Easter, Michele

    2014-07-01

    How is genetic involvement interpreted for disorders whose medicalisation is contested? Framing psychiatric and behavioural disorders in terms of genetics is expected to make them seem more medical. Yet a genetic aetiology can also be used to frame behaviour as acceptable human variation, rather than a medical problem (for example, sexual orientation). I analyse responses to the idea that there is a genetic component in anorexia and bulimia nervosa (AN or BN) via semi-structured interviews with a sample of 50 women diagnosed with an eating disorder (25 had recovered). All but three volunteered that genetics would medicalise AN or BN by (i) making eating disorders seem more like 'real diseases'; implying that these disorders need (ii) professional treatment or (iii) a biologically based treatment. The results also indicate there are several counter-logics by which genetic framing could support non-medical definitions of AN or BN. I argue that genetic framing reduces perceived individual responsibility, which can support definitions of behaviour as either a reflection of disease (which entails intervention) or a reflection of normal human diversity (which does not). In the context of public scepticism as to the 'reality' of AN or BN, genetic involvement was taken as evidence of disease in ongoing negotiations about the medical and moral status of people with eating disorders. © 2013 The Author. Sociology of Health & Illness © 2013 Foundation for the Sociology of Health & Illness/John Wiley & Sons Ltd.

  13. Genetic evidence for the association between the early growth response 3 (EGR3 gene and schizophrenia.

    Directory of Open Access Journals (Sweden)

    Rui Zhang

    Full Text Available Recently, two genome scan meta-analysis studies have found strong evidence for the association of loci on chromosome 8p with schizophrenia. The early growth response 3 (EGR3 gene located in chromosome 8p21.3 was also found to be involved in the etiology of schizophrenia. However, subsequent studies failed to replicate this finding. To investigate the genetic role of EGR3 in Chinese patients, we genotyped four SNPs (average interval ∼2.3 kb in the chromosome region of EGR3 in 470 Chinese schizophrenia patients and 480 healthy control subjects. The SNP rs35201266 (located in intron 1 of EGR3 showed significant differences between cases and controls in both genotype frequency distribution (P = 0.016 and allele frequency distribution (P = 0.009. Analysis of the haplotype rs35201266-rs3750192 provided significant evidence for association with schizophrenia (P = 0.0012; a significant difference was found for the common haplotype AG (P = 0.0005. Furthermore, significant associations were also found in several other two-, and three-SNP tests of haplotype analyses. The meta-analysis revealed a statistically significant association between rs35201266 and schizophrenia (P = 0.0001. In summary, our study supports the association of EGR3 with schizophrenia in our Han Chinese sample, and further functional exploration of the EGR3 gene will contribute to the molecular basis for the complex network underlying schizophrenia pathogenesis.

  14. Coordinated vigilance provides evidence for direct reciprocity in coral reef fishes.

    Science.gov (United States)

    Brandl, Simon J; Bellwood, David R

    2015-09-25

    Reciprocity is frequently assumed to require complex cognitive abilities. Therefore, it has been argued that reciprocity may be restricted to animals that can meet these demands. Here, we provide evidence for the potential presence of direct reciprocity in teleost fishes. We demonstrate that in pairs of coral reef rabbitfishes (f. Siganidae), one fish frequently assumes an upright vigilance position in the water column, while the partner forages in small crevices in the reef substratum. Both behaviours are strongly coordinated and partners regularly alternate their positions, resulting in a balanced distribution of foraging activity. Compared to solitary individuals, fishes in pairs exhibit longer vigilance bouts, suggesting that the help provided to the partner is costly. In turn, fishes in pairs take more consecutive bites and penetrate deeper into crevices than solitary individuals, suggesting that the safety provided by a vigilant partner may outweigh initial costs by increasing foraging efficiency. Thus, the described system appears to meet all of the requirements for direct reciprocity. We argue that the nature of rabbitfish pairs provides favourable conditions for the establishment of direct reciprocity, as continuous interaction with the same partner, simultaneous needs, interdependence, and communication relax the cognitive demands of reciprocal cooperation.

  15. Aural exostoses (surfer's ear) provide vital fossil evidence of an aquatic phase in Man's early evolution.

    Science.gov (United States)

    Rhys Evans, P H; Cameron, M

    2017-11-01

    For over a century, otolaryngologists have recognised the condition of aural exostoses, but their significance and aetiology remains obscure, although they tend to be associated with frequent swimming and cold water immersion of the auditory canal. The fact that this condition is usually bilateral is predictable since both ears are immersed in water. However, why do exostoses only grow in swimmers and why do they grow in the deep bony meatus at two or three constant sites? Furthermore, from an evolutionary point of view, what is or was the purpose and function of these rather incongruous protrusions? In recent decades, paleoanthropological evidence has challenged ideas about early hominid evolution. In 1992 the senior author suggested that aural exostoses were evolved in early hominid Man for protection of the delicate tympanic membrane during swimming and diving by narrowing the ear canal in a similar fashion to other semiaquatic species. We now provide evidence for this theory and propose an aetiological explanation for the formation of exostoses.

  16. Hybrid wildebeest (Artiodactyla: Bovidae provide further evidence for shared signatures of admixture in mammalian crania

    Directory of Open Access Journals (Sweden)

    Bonita de Klerk

    2010-10-01

    Full Text Available The genus Connochaetes, Lichtenstein, 1814, contains two extant species, the blue wildebeest (C. taurinus, Burchell, 1823 and the black wildebeest (C. gnou, Zimmermann, 1780. In recent years, forced sympatry in confined areas within South Africa has led to interbreeding between these taxa and to fertile hybrid offspring. Here we report on a series of cranial characteristics of a hybrid wildebeest population culled at Spioenkop Dam Nature Reserve, KwaZulu-Natal, South Africa. Dental, sutural and horn morphological anomalies occur at high frequency within these animals. Similar cranial morphological anomalies have been shown in other mammalian hybrids and this study provides further evidence that such anomalies may characterise hybridisation more broadly across phylogenetically divergent mammalian groups, although the anomalies appear to differ in their expression across taxa. An increased ability to identify hybrids may also have important applications in the conservation of the endemic black wildebeest.

  17. Adoption of Evidence-Based Practices Among Substance Abuse Treatment Providers*

    Science.gov (United States)

    Haug, Nancy A.; Shopshire, Michael; Tajima, Barbara; Gruber, Valerie; Guydish, Joseph

    2009-01-01

    This research was conducted at a Substance Abuse Forum designed to address local community needs by focusing on Evidence-Based Practices (EBPs) in addiction treatment. The purpose of the study was to assess substance abuse treatment professionals’ readiness to adopt EBPs, experience with EBPs, and attitudes toward EBPs, as well as agency support for EBPs. A total of 119 addiction treatment providers completed pre-test measures, and 82% completed a post-test. Eighty-three percent of participants reported using some EBPs in the past year, and 75% reported currently using EBPs. Participants who were currently licensed or certified in addictions had less negative attitudes toward EBPs than those without credentials. While respondents reported agency support for EBPs, most expressed interest in further training. This study underscores the movement toward EBPs in addiction treatment and the need for effective dissemination and training in this area. PMID:18724657

  18. Putting research in place: an innovative approach to providing contextualized evidence synthesis for decision makers

    Directory of Open Access Journals (Sweden)

    Stephen Bornstein

    2017-11-01

    Full Text Available Abstract Background The Contextualized Health Research Synthesis Program (CHRSP, developed in 2007 by the Newfoundland and Labrador Centre for Applied Health Research, produces contextualized knowledge syntheses for health-system decision makers. The program provides timely, relevant, and easy-to-understand scientific evidence; optimizes evidence uptake; and, most importantly, attunes research questions and evidence to the specific context in which knowledge users must apply the findings. Methods As an integrated knowledge translation (KT method, CHRSP: Involves intensive partnerships with senior healthcare decision makers who propose priority research topics and participate on research teams; Considers local context both in framing the research question and in reporting the findings; Makes economical use of resources by utilizing a limited number of staff; Uses a combination of external and local experts; and Works quickly by synthesizing high-level systematic review evidence rather than primary studies. Although it was developed in the Canadian province of Newfoundland and Labrador, the CHRSP methodology is adaptable to a variety of settings with distinctive features, such as those in rural, remote, and small-town locations. Results CHRSP has published 25 syntheses on priority topics chosen by the provincial healthcare system, including: Clinical and cost-effectiveness: telehealth, rural renal dialysis, point-of-care testing; Community-based health services: helping seniors age in place, supporting seniors with dementia, residential treatment centers for at-risk youth; Healthcare organization/service delivery: reducing acute-care length of stay, promoting flu vaccination among health workers, safe patient handling, age-friendly acute care; and Health promotion: diabetes prevention, promoting healthy dietary habits. These studies have been used by decision makers to inform local policy and practice decisions. Conclusions By asking the health

  19. Evidence from mammalian studies on genetic effects of low level irradiation

    International Nuclear Information System (INIS)

    Searle, A.G.

    1989-01-01

    The major components of genetic damage and associated human risks are discussed, together with the experimental evidence on induction rates of chromosome anomalies in mice, and monkeys male and female germ cells, using low and high LET low level irradiation. (UK)

  20. Genetic evidence of hybridization between Onothera wolfii (Wolf's evening primrose) and O. glaziovana, a garden escape

    Science.gov (United States)

    Jennifer DeWoody; Leonel Arguello; David Imper; Robert D. Westfall; Valerie D. Hipkins

    2008-01-01

    Isozyme analysis of the rare Oenothera wolfii (Wolf's evening primrose) and the garden escape, O. glazioviana, indicates that hybridization between these species may be more widespread than morphological evidence indicates. Although both species contained low amounts of genetic variation, unique alleles were identified in...

  1. Educational needs of nurses to provide genetic services in prenatal care: A cross-sectional study from Turkey.

    Science.gov (United States)

    Seven, Memnun; Eroglu, Kafiye; Akyüz, Aygül; Ingvoldstad, Charlotta

    2017-09-01

    The latest advances in genetics/genomics have significantly impacted prenatal screening and diagnostic tests. This cross-sectional descriptive study was conducted in inpatient and outpatient obstetric clinics in 24 hospitals in Turkey to determine knowledge of genetics related to prenatal care and the educational needs of perinatal nurses. A total of 116 nurses working in these clinics agreed to participate. The results included the level of knowledge among nurses was not affected by sociodemographic factors. Also, there is a lack of knowledge and interest in genetics among prenatal nurses and in clinical practice to provide education and counseling related to genetics in prenatal settings as a part of prenatal care. © 2017 John Wiley & Sons Australia, Ltd.

  2. Mendelian randomisation analysis provides no evidence for a relationship between adult height and testicular cancer risk.

    Science.gov (United States)

    Levy, M; Hall, D; Sud, A; Law, P; Litchfield, K; Dudakia, D; Haugen, T B; Karlsson, R; Reid, A; Huddart, R A; Grotmol, T; Wiklund, F; Houlston, R S; Turnbull, C

    2017-09-01

    Observational studies have suggested anthropometric traits, particularly increased height are associated with an elevated risk of testicular cancer (testicular germ cell tumour). However, there is an inconsistency between study findings, suggesting the possibility of the influence of confounding factors. To examine the association between anthropometric traits and testicular germ cell tumour using an unbiased approach, we performed a Mendelian randomisation study. We used genotype data from genome wide association studies of testicular germ cell tumour totalling 5518 cases and 19,055 controls. Externally weighted polygenic risk scores were created and used to evaluate associations with testicular germ cell tumour risk per one standard deviation (s.d) increase in genetically-defined adult height, adult BMI, adult waist hip ratio adjusted for BMI (WHRadjBMI), adult hip circumference adjusted for BMI (HIPadjBMI), adult waist circumference adjusted for BMI (WCadjBMI), birth weight (BW) and childhood obesity. Mendelian randomisation analysis did not demonstrate an association between any anthropometric trait and testicular germ cell tumour risk. In particular, despite good power, there was no global evidence for association between height and testicular germ cell tumour. However, three SNPs for adult height individually showed association with testicular germ cell tumour (rs4624820: OR = 1.47, 95% CI: 1.41-1.55, p = 2.7 × 10 -57 ; rs12228415: OR = 1.17, 95% CI: 1.11-1.22, p = 3.1 × 10 -10 ; rs7568069: OR = 1.13, 95% CI: 1.07-1.18, p = 1.1 × 10 -6 ). This Mendelian randomisation analysis, based on the largest testicular germ cell tumour genome wide association dataset to date, does not support a causal etiological association between anthropometric traits and testicular germ cell tumour aetiology. Our findings are more compatible with confounding by shared environmental factors, possibly related to prenatal growth with exposure to these risk factors

  3. Contracting with private providers for primary care services: evidence from urban China.

    Science.gov (United States)

    Wang, Yan; Eggleston, Karen; Yu, Zhenjie; Zhang, Qiong

    2013-01-17

    Controversy surrounds the role of the private sector in health service delivery, including primary care and population health services. China's recent health reforms call for non-discrimination against private providers and emphasize strengthening primary care, but formal contracting-out initiatives remain few, and the associated empirical evidence is very limited. This paper presents a case study of contracting with private providers for urban primary and preventive health services in Shandong Province, China. The case study draws on three primary sources of data: administrative records; a household survey of over 1600 community residents in Weifang and City Y; and a provider survey of over 1000 staff at community health stations (CHS) in both Weifang and City Y. We supplement the quantitative data with one-on-one, in-depth interviews with key informants, including local officials in charge of public health and government finance.We find significant differences in patient mix: Residents in the communities served by private community health stations are of lower socioeconomic status (more likely to be uninsured and to report poor health), compared to residents in communities served by a government-owned CHS. Analysis of a household survey of 1013 residents shows that they are more willing to do a routine health exam at their neighborhood CHS if they are of low socioeconomic status (as measured either by education or income). Government and private community health stations in Weifang did not statistically differ in their performance on contracted dimensions, after controlling for size and other CHS characteristics. In contrast, the comparison City Y had lower performance and a large gap between public and private providers. We discuss why these patterns arose and what policymakers and residents considered to be the main issues and concerns regarding primary care services.

  4. Contracting with private providers for primary care services: evidence from urban China

    Science.gov (United States)

    2013-01-01

    Controversy surrounds the role of the private sector in health service delivery, including primary care and population health services. China’s recent health reforms call for non-discrimination against private providers and emphasize strengthening primary care, but formal contracting-out initiatives remain few, and the associated empirical evidence is very limited. This paper presents a case study of contracting with private providers for urban primary and preventive health services in Shandong Province, China. The case study draws on three primary sources of data: administrative records; a household survey of over 1600 community residents in Weifang and City Y; and a provider survey of over 1000 staff at community health stations (CHS) in both Weifang and City Y. We supplement the quantitative data with one-on-one, in-depth interviews with key informants, including local officials in charge of public health and government finance. We find significant differences in patient mix: Residents in the communities served by private community health stations are of lower socioeconomic status (more likely to be uninsured and to report poor health), compared to residents in communities served by a government-owned CHS. Analysis of a household survey of 1013 residents shows that they are more willing to do a routine health exam at their neighborhood CHS if they are of low socioeconomic status (as measured either by education or income). Government and private community health stations in Weifang did not statistically differ in their performance on contracted dimensions, after controlling for size and other CHS characteristics. In contrast, the comparison City Y had lower performance and a large gap between public and private providers. We discuss why these patterns arose and what policymakers and residents considered to be the main issues and concerns regarding primary care services. PMID:23327666

  5. Mapping allied health evidence-based practice: providing a basis for organisational realignment.

    Science.gov (United States)

    Ziviani, Jenny; Wilkinson, Shelley A; Hinchliffe, Fiona; Feeney, Rachel

    2015-06-01

    Ahead of the convergence of two major paediatric services, we examined evidence-based practice (EBP) self-efficacy, outcome expectance, knowledge and use among allied health (AH) staff in two major Queensland (Qld) paediatric services. This was to determine whether any differences existed based on organisational affiliation, profession and any previous training to inform a strategy to enhance AH EBP within the new organisational setting. All AH staff from the two Brisbane (Qld) tertiary paedritic hospitals were invited to participate in the survey. Using a cross-sectional design EBP self-efficacy, outcome expectancy, knowledge and use, as well as previous EBP training, were assessed with an online survey. Background demographic information obtained included professional discipline and hospital. One hundreD and thirty-eight health practitioners completed the survey (37% respone rate). Most practioners had accessed EBP training. Mean scores for EBP attitudes (self-efficacy and outcome expectancy) and knowledge were higher than for EBP use scores. Greater variation was observed across professional disciplines than organisations. Training impacted positively on EBP measures but explained a small proportion of total variance in regression models. The results underscore the need to provide organisational supports to AH staff ro EBP implementation. Strategies other than training are requred to maximally enhance EBP attitudes. The new organisational structure provides an oppotunity for this cultural shift to occur.

  6. Genetic Data Provide Evidence for Wind-Mediated Transmission of Highly Pathogenic Avian Influenza

    NARCIS (Netherlands)

    Ypma, R.J.F.; Jonges, M.; Bataille, A.M.A.; Stegeman, J.A.; Koch, G.; van Boven, R.M.; Koopmans, M.; van Ballegooijen, W.M.; Wallinga, J.

    2013-01-01

    Outbreaks of highly pathogenic avian influenza in poultry can cause severe economic damage and represent a public health threat. Development of efficient containment measures requires an understanding of how these influenza viruses are transmitted between farms. However, the actual mechanisms of

  7. No evidence for a genetic blueprint: The case of the "complex" mammalian photoreceptor

    Directory of Open Access Journals (Sweden)

    G Kumaramanickavel

    2015-01-01

    Full Text Available Despite the intensity of the search for genes causing inherited retinal degenerations over the past 3 decades, of the approximately 200 disease genes identified to date, all appear to be ordinary housekeeping genes specifying proteins playing basic structural and functional roles in the mature photoreceptor cells. No genes or genetic elements have been identified which can be construed as having a specific morphogenic role, directing the development of the cytoarchitecture of any particular retinal cell. The evidence suggests that the cytoarchitecture of the retinal photoreceptors, although enormously complex, arises from the self-organization of the cells constituents without any regulation or direction from an external genetic blueprint.

  8. First evidence of genetic intraspecific variability and occurrence of Entamoeba gingivalis in HIV(+/AIDS.

    Directory of Open Access Journals (Sweden)

    Sibeli B S Cembranelli

    Full Text Available Entamoeba gingivalis is considered an oral commensal but demonstrates a pathogenic potential associated with periodontal disease in immunocompromised individuals. Therefore, this study evaluated the occurrence, opportunistic conditions, and intraspecific genetic variability of E. gingivalis in HIV(+/AIDS patients. Entamoeba gingivalis was studied using fresh examination (FE, culture, and PCR from bacterial plaque samples collected from 82 HIV(+/AIDS patients. Genetic characterization of the lower ribosomal subunit of region 18S (18S-SSU rRNA was conducted in 9 positive samples using low-stringency single specific primer PCR (LSSP-PCR and sequencing analysis. Entamoeba gingivalis was detected in 63.4% (52/82 of the samples. No association was detected between the presence of E. gingivalis and the CD4(+ lymphocyte count (≤200 cells/mm(3 (p = 0.912 or viral load (p = 0.429. The LSSP-PCR results helped group E. gingivalis populations into 2 polymorphic groups (68.3% similarity: group I, associated with 63.6% (7/11 of the samples, and group II, associated with 36.4% (4/11 of the samples, which shared 74% and 83.7% similarity and association with C and E isolates from HIV(- individuals, respectively. Sequencing of 4 samples demonstrated 99% identity with the reference strain ATCC 30927 and also showed 2 divergent clusters, similar to those detected by LSSP-PCR. Opportunistic behavior of E. gingivalis was not detected, which may be related to the use of highly active antiretroviral therapy by all HIV(+/AIDS patients. The high occurrence of E. gingivalis in these patients can be influenced by multifactorial components not directly related to the CD4(+ lymphocyte counts, such as cholesterol and the oral microbiota host, which could mask the potential opportunistic ability of E. gingivalis. The identification of the 18S SSU-rRNA polymorphism by LSSP-PCR and sequencing analysis provides the first evidence of genetic variability in E. gingivalis

  9. Novel mitochondrial extensions provide evidence for a link between microtubule-directed movement and mitochondrial fission

    International Nuclear Information System (INIS)

    Bowes, Timothy; Gupta, Radhey S.

    2008-01-01

    Mitochondrial dynamics play an important role in a large number of cellular processes. Previously, we reported that treatment of mammalian cells with the cysteine-alkylators, N-ethylmaleimide and ethacrynic acid, induced rapid mitochondrial fusion forming a large reticulum approximately 30 min after treatment. Here, we further investigated this phenomenon using a number of techniques including live-cell confocal microscopy. In live cells, drug-induced fusion coincided with a cessation of fast mitochondrial movement which was dependent on microtubules. During this loss of movement, thin mitochondrial tubules extending from mitochondria were also observed, which we refer to as 'mitochondrial extensions'. The formation of these mitochondrial extensions, which were not observed in untreated cells, depended on microtubules and was abolished by pretreatment with nocodazole. In this study, we provide evidence that these extensions result from of a block in mitochondrial fission combined with continued application of motile force by microtubule-dependent motor complexes. Our observations strongly suggest the existence of a link between microtubule-based mitochondrial trafficking and mitochondrial fission

  10. The Healthcare Improvement Scotland evidence note rapid review process: providing timely, reliable evidence to inform imperative decisions on healthcare.

    Science.gov (United States)

    McIntosh, Heather M; Calvert, Julie; Macpherson, Karen J; Thompson, Lorna

    2016-06-01

    Rapid review has become widely adopted by health technology assessment agencies in response to demand for evidence-based information to support imperative decisions. Concern about the credibility of rapid reviews and the reliability of their findings has prompted a call for wider publication of their methods. In publishing this overview of the accredited rapid review process developed by Healthcare Improvement Scotland, we aim to raise awareness of our methods and advance the discourse on best practice. Healthcare Improvement Scotland produces rapid reviews called evidence notes using a process that has achieved external accreditation through the National Institute for Health and Care Excellence. Key components include a structured approach to topic selection, initial scoping, considered stakeholder involvement, streamlined systematic review, internal quality assurance, external peer review and updating. The process was introduced in 2010 and continues to be refined over time in response to user feedback and operational experience. Decision-makers value the responsiveness of the process and perceive it as being a credible source of unbiased evidence-based information supporting advice for NHSScotland. Many agencies undertaking rapid reviews are striving to balance efficiency with methodological rigour. We agree that there is a need for methodological guidance and that it should be informed by better understanding of current approaches and the consequences of different approaches to streamlining systematic review methods. Greater transparency in the reporting of rapid review methods is essential to enable that to happen.

  11. 'Faceness' and affectivity: evidence for genetic contributions to distinct components of electrocortical response to human faces.

    Science.gov (United States)

    Shannon, Robert W; Patrick, Christopher J; Venables, Noah C; He, Sheng

    2013-12-01

    The ability to recognize a variety of different human faces is undoubtedly one of the most important and impressive functions of the human perceptual system. Neuroimaging studies have revealed multiple brain regions (including the FFA, STS, OFA) and electrophysiological studies have identified differing brain event-related potential (ERP) components (e.g., N170, P200) possibly related to distinct types of face information processing. To evaluate the heritability of ERP components associated with face processing, including N170, P200, and LPP, we examined ERP responses to fearful and neutral face stimuli in monozygotic (MZ) and dizygotic (DZ) twins. Concordance levels for early brain response indices of face processing (N170, P200) were found to be stronger for MZ than DZ twins, providing evidence of a heritable basis to each. These findings support the idea that certain key neural mechanisms for face processing are genetically coded. Implications for understanding individual differences in recognition of facial identity and the emotional content of faces are discussed. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Genetic evidence for intra- and interspecific slavery in honey ants (genus Myrmecocystus).

    Science.gov (United States)

    Kronauer, D J C; Gadau, J; Hölldobler, B

    2003-04-22

    The New World honey ant species Myrmecocystus mimicus is well known for its highly stereotyped territorial tournaments, and for the raids on conspecific nests that can lead to intraspecific slavery. Our results from mitochondrial and nuclear markers show that the raided brood emerges in the raiding colony and is subsequently incorporated into the colony's worker force. We also found enslaved conspecifics in a second honey ant species, M. depilis, the sister taxon of M. mimicus, which occurs in sympatry with M. mimicus at the study site. Colonies of this species furthermore contained raided M. mimicus workers. Both species have an effective mating frequency that is not significantly different from 1. This study provides genetic evidence for facultative intra- and interspecific slavery in the genus Myrmecocystus. Slavery in ants has evolved repeatedly and supposedly by different means. We propose that, in honey ants, secondary contact between two closely related species that both exhibit intraspecific slavery gave rise to an early form of facultative interspecific slavery.

  13. Can genetic estimators provide robust estimates of the effective number of breeders in small populations?

    Directory of Open Access Journals (Sweden)

    Marion Hoehn

    Full Text Available The effective population size (N(e is proportional to the loss of genetic diversity and the rate of inbreeding, and its accurate estimation is crucial for the monitoring of small populations. Here, we integrate temporal studies of the gecko Oedura reticulata, to compare genetic and demographic estimators of N(e. Because geckos have overlapping generations, our goal was to demographically estimate N(bI, the inbreeding effective number of breeders and to calculate the N(bI/N(a ratio (N(a =number of adults for four populations. Demographically estimated N(bI ranged from 1 to 65 individuals. The mean reduction in the effective number of breeders relative to census size (N(bI/N(a was 0.1 to 1.1. We identified the variance in reproductive success as the most important variable contributing to reduction of this ratio. We used four methods to estimate the genetic based inbreeding effective number of breeders N(bI(gen and the variance effective populations size N(eV(gen estimates from the genotype data. Two of these methods - a temporal moment-based (MBT and a likelihood-based approach (TM3 require at least two samples in time, while the other two were single-sample estimators - the linkage disequilibrium method with bias correction LDNe and the program ONeSAMP. The genetic based estimates were fairly similar across methods and also similar to the demographic estimates excluding those estimates, in which upper confidence interval boundaries were uninformative. For example, LDNe and ONeSAMP estimates ranged from 14-55 and 24-48 individuals, respectively. However, temporal methods suffered from a large variation in confidence intervals and concerns about the prior information. We conclude that the single-sample estimators are an acceptable short-cut to estimate N(bI for species such as geckos and will be of great importance for the monitoring of species in fragmented landscapes.

  14. Relationship of Evidence-Based Practice and Treatments: A Survey of Community Mental Health Providers

    Science.gov (United States)

    DiMeo, Michelle A.; Moore, G. Kurt; Lichtenstein, Carolyn

    2012-01-01

    Evidence-based treatments (EBTs) are "interventions" that have been proven effective through rigorous research methodologies. Evidence-based practice (EBP), however, refers to a "decision-making process" that integrates the best available research, clinician expertise, and client characteristics. This study examined community mental health service…

  15. Genome-wide trans-ancestry meta-analysis provides insight into the genetic architecture of type 2 diabetes susceptibility

    DEFF Research Database (Denmark)

    Mahajan, Anubha; Go, Min Jin; Zhang, Weihua

    2014-01-01

    To further understanding of the genetic basis of type 2 diabetes (T2D) susceptibility, we aggregated published meta-analyses of genome-wide association studies (GWAS), including 26,488 cases and 83,964 controls of European, east Asian, south Asian and Mexican and Mexican American ancestry. We obs...... and characterization of complex trait loci and emphasize an exciting opportunity to extend insight into the genetic architecture and pathogenesis of human diseases across populations of diverse ancestry....... observed a significant excess in the directional consistency of T2D risk alleles across ancestry groups, even at SNPs demonstrating only weak evidence of association. By following up the strongest signals of association from the trans-ethnic meta-analysis in an additional 21,491 cases and 55,647 controls...

  16. Online genetic counseling from the providers' perspective: counselors' evaluations and a time and cost analysis

    Science.gov (United States)

    Otten, Ellen; Birnie, Erwin; Ranchor, Adelita V; van Langen, Irene M

    2016-01-01

    Telemedicine applications are increasingly being introduced in patient care in various disciplines, including clinical genetics, mainly to increase access to care and to reduce time and costs for patients and professionals. Most telegenetics reports describe applications in large geographical areas, showing positive patients' and professionals' satisfaction. One economic analysis published thus far reported lower costs than in-person care. We hypothesized that telegenetics can also be beneficial from the professional's view in relatively small geographical areas. We performed a pilot study in the Northern Netherlands of 51 home-based online counseling sessions for cardiogenetic and oncogenetic cascade screening, and urgent prenatal counseling. Previously, we showed patient satisfaction, anxiety, and perceived control of online counseling to be comparable to in-person counseling. This study focuses on expectations, satisfaction, and practical evaluations of the involved counselors, and the impact in terms of time and costs. Most counselors expected disadvantages of online counseling for themselves and their patients, mainly concerning insufficient non-verbal communication; few expected advantages for themselves. Afterwards, counselors additionally raised the disadvantage of insufficient verbal communication, and reported frequent technical problems. Their overall mean telemedicine satisfaction itemscore was 3.38 before, and 2.95 afterwards, being afterwards slightly below the minimum level we set for a satisfactory result. We estimated reduced time and costs by online counseling with about 8% and 10–12%, respectively. We showed online genetic counseling to be effective, feasible and cost-efficient, but technical improvements are needed to increase counselors' satisfaction. PMID:26785833

  17. Genetic structure and evidence of putative Darwinian diversifying selection in the Potato yellow vein virus (PYVV

    Directory of Open Access Journals (Sweden)

    Giovanni Chaves-Bedoya

    2013-08-01

    Full Text Available The population structure and genetic variation of Potato yellow vein virus (PYVV were estimated by analysis of the nucleotide and deduced amino acid sequence of the coat protein of 69 isolates, reported in GenBank, from Solanum tuberosum (ST and Solanum phureja (SP hosts from different regions; predominantly Cundinamarca, Antioquia and Nariño, located in central and southwestern Colombia. Bioinformatics analysis revealed that despite the wide geographic distribution of different hosts and different collecting years, PYVV maintains a genetic similarity between 97.1 to 100.0%, indicating high spatial and temporal genetic stability of the major coat protein. No recombination events were found, but evidence was seen for the first time that this protein could be undergoing Darwinian diversifying selection

  18. Evidence for Absolute Moral Opposition to Genetically Modified Food in the United States.

    Science.gov (United States)

    Scott, Sydney E; Inbar, Yoel; Rozin, Paul

    2016-05-01

    Public opposition to genetic modification (GM) technology in the food domain is widespread (Frewer et al., 2013). In a survey of U.S. residents representative of the population on gender, age, and income, 64% opposed GM, and 71% of GM opponents (45% of the entire sample) were "absolutely" opposed-that is, they agreed that GM should be prohibited no matter the risks and benefits. "Absolutist" opponents were more disgust sensitive in general and more disgusted by the consumption of genetically modified food than were non-absolutist opponents or supporters. Furthermore, disgust predicted support for legal restrictions on genetically modified foods, even after controlling for explicit risk-benefit assessments. This research suggests that many opponents are evidence insensitive and will not be influenced by arguments about risks and benefits. © The Author(s) 2016.

  19. [Social engineers--providers--bioethicists. Human genetics experts in West-Germany and Denmark between 1950 and 1990].

    Science.gov (United States)

    Thomaschke, Dirk

    2013-01-01

    The author compares the history of human genetics in the Federal Republic of Germany and Denmark from the 1950s to the 1980s. The paper combines a discourse analysis with the exploration of human genetics experts' subject forms along the lines of current considerations within cultural studies. In the 1950s and 1960s, human geneticists acted in close cooperation with other political, judicial and administrative expert groups. They monitored the 'overall genetic development' of the population and cautioned about 'genetic crises'. Laypersons were supposed to submit to 'objectively reasonable' behavioral patterns--to their own as well as society's benefit. In the 1970s, the experts turned into 'providers' of a 'precise, purely medical, diagnostic service'. The patients mainly appeared as 'de-personalized' sources of a common human demand for 'safe eugenic information'. In the 1980s, the demand and supply paradigm manifested psychological and ethical side effects. Human geneticists became aware of the social and historical interrelations of their research and practices. The results of this study contribute to a more complex understanding of the dominant 'individualization narrative' of human genetics history. In this context, the development in Germany and Denmark displays two complementary forms of a transnational discourse.

  20. Behavioral and Genetic Evidence for GIRK Channels in the CNS: Role in Physiology, Pathophysiology, and Drug Addiction.

    Science.gov (United States)

    Mayfield, Jody; Blednov, Yuri A; Harris, R Adron

    2015-01-01

    G protein-coupled inwardly rectifying potassium (GIRK) channels are widely expressed throughout the brain and mediate the inhibitory effects of many neurotransmitters. As a result, these channels are important for normal CNS function and have also been implicated in Down syndrome, Parkinson's disease, psychiatric disorders, epilepsy, and drug addiction. Knockout mouse models have provided extensive insight into the significance of GIRK channels under these conditions. This review examines the behavioral and genetic evidence from animal models and genetic association studies in humans linking GIRK channels with CNS disorders. We further explore the possibility that subunit-selective modulators and other advanced research tools will be instrumental in establishing the role of individual GIRK subunits in drug addiction and other relevant CNS diseases and in potentially advancing treatment options for these disorders. © 2015 Elsevier Inc. All rights reserved.

  1. New Horned Dinosaurs from Utah Provide Evidence for Intracontinental Dinosaur Endemism

    Science.gov (United States)

    Sampson, Scott D.; Loewen, Mark A.; Farke, Andrew A.; Roberts, Eric M.; Forster, Catherine A.; Smith, Joshua A.; Titus, Alan L.

    2010-01-01

    Background During much of the Late Cretaceous, a shallow, epeiric sea divided North America into eastern and western landmasses. The western landmass, known as Laramidia, although diminutive in size, witnessed a major evolutionary radiation of dinosaurs. Other than hadrosaurs (duck-billed dinosaurs), the most common dinosaurs were ceratopsids (large-bodied horned dinosaurs), currently known only from Laramidia and Asia. Remarkably, previous studies have postulated the occurrence of latitudinally arrayed dinosaur “provinces,” or “biomes,” on Laramidia. Yet this hypothesis has been challenged on multiple fronts and has remained poorly tested. Methodology/Principal Findings Here we describe two new, co-occurring ceratopsids from the Upper Cretaceous Kaiparowits Formation of Utah that provide the strongest support to date for the dinosaur provincialism hypothesis. Both pertain to the clade of ceratopsids known as Chasmosaurinae, dramatically increasing representation of this group from the southern portion of the Western Interior Basin of North America. Utahceratops gettyi gen. et sp. nov.—characterized by short, rounded, laterally projecting supraorbital horncores and an elongate frill with a deep median embayment—is recovered as the sister taxon to Pentaceratops sternbergii from the late Campanian of New Mexico. Kosmoceratops richardsoni gen. et sp. nov.—characterized by elongate, laterally projecting supraorbital horncores and a short, broad frill adorned with ten well developed hooks—has the most ornate skull of any known dinosaur and is closely allied to Chasmosaurus irvinensis from the late Campanian of Alberta. Conclusions/Significance Considered in unison, the phylogenetic, stratigraphic, and biogeographic evidence documents distinct, co-occurring chasmosaurine taxa north and south on the diminutive landmass of Laramidia. The famous Triceratops and all other, more nested chasmosaurines are postulated as descendants of forms previously restricted

  2. New horned dinosaurs from Utah provide evidence for intracontinental dinosaur endemism.

    Directory of Open Access Journals (Sweden)

    Scott D Sampson

    Full Text Available BACKGROUND: During much of the Late Cretaceous, a shallow, epeiric sea divided North America into eastern and western landmasses. The western landmass, known as Laramidia, although diminutive in size, witnessed a major evolutionary radiation of dinosaurs. Other than hadrosaurs (duck-billed dinosaurs, the most common dinosaurs were ceratopsids (large-bodied horned dinosaurs, currently known only from Laramidia and Asia. Remarkably, previous studies have postulated the occurrence of latitudinally arrayed dinosaur "provinces," or "biomes," on Laramidia. Yet this hypothesis has been challenged on multiple fronts and has remained poorly tested. METHODOLOGY/PRINCIPAL FINDINGS: Here we describe two new, co-occurring ceratopsids from the Upper Cretaceous Kaiparowits Formation of Utah that provide the strongest support to date for the dinosaur provincialism hypothesis. Both pertain to the clade of ceratopsids known as Chasmosaurinae, dramatically increasing representation of this group from the southern portion of the Western Interior Basin of North America. Utahceratops gettyi gen. et sp. nov.-characterized by short, rounded, laterally projecting supraorbital horncores and an elongate frill with a deep median embayment-is recovered as the sister taxon to Pentaceratops sternbergii from the late Campanian of New Mexico. Kosmoceratops richardsoni gen. et sp. nov.-characterized by elongate, laterally projecting supraorbital horncores and a short, broad frill adorned with ten well developed hooks-has the most ornate skull of any known dinosaur and is closely allied to Chasmosaurus irvinensis from the late Campanian of Alberta. CONCLUSIONS/SIGNIFICANCE: Considered in unison, the phylogenetic, stratigraphic, and biogeographic evidence documents distinct, co-occurring chasmosaurine taxa north and south on the diminutive landmass of Laramidia. The famous Triceratops and all other, more nested chasmosaurines are postulated as descendants of forms previously

  3. Endothelin: Visualization of mRNAs by in situ hybridization provides evidence for local action

    International Nuclear Information System (INIS)

    MacCumber, M.W.; Ross, C.A.; Glaser, B.M.; Snyder, S.H.

    1989-01-01

    Endothelin (ET) is a recently identified vasoactive peptide with three isoforms for which three genes have been cloned. The cellular sites of synthesis of this peptide have not yet been identified in vivo. Using Northern blot analysis, we have detected two forms of ET mRNA in rat tissues: a 3.7-kilobase form in the kidney, eye, and brain, a 2.5-kilobase form in the intestine, and both forms in the lung. We have localized these forms of ET mRNA in several rat tissues using in situ hybridization. In the 19-day rat fetus, ET mRNA is highest in the lung, intestine, and meninges. At high resolution, ET mRNA is localized in the lung to respiratory epithelial cells of bronchioles and apparently in blood vessels. In adult tissues, ET mRNA is present throughout the lung, in the renal medulla vasa recta, and in the iris of the eye. ET mRNA is synthesized in close proximity to ET binding sites in many organs (e.g., lung, kidney, intestine, and eye), suggesting a local action of this peptide. However, in other areas (e.g., heart and renal cortex), ET binding sites are present in the absence of ET mRNA, suggesting an action of ET from the bloodstream or from neurons. Northern blot analysis of ET mRNA in microvascular endothelial cells in culture indicates that ET is synthesized in small blood vessels and regulated similarly to its regulation in large vessels. Our results provide evidence that ET, like other regulatory peptides, may serve in several tissues as a neuromodulator or local hormone

  4. New horned dinosaurs from Utah provide evidence for intracontinental dinosaur endemism.

    Science.gov (United States)

    Sampson, Scott D; Loewen, Mark A; Farke, Andrew A; Roberts, Eric M; Forster, Catherine A; Smith, Joshua A; Titus, Alan L

    2010-09-22

    During much of the Late Cretaceous, a shallow, epeiric sea divided North America into eastern and western landmasses. The western landmass, known as Laramidia, although diminutive in size, witnessed a major evolutionary radiation of dinosaurs. Other than hadrosaurs (duck-billed dinosaurs), the most common dinosaurs were ceratopsids (large-bodied horned dinosaurs), currently known only from Laramidia and Asia. Remarkably, previous studies have postulated the occurrence of latitudinally arrayed dinosaur "provinces," or "biomes," on Laramidia. Yet this hypothesis has been challenged on multiple fronts and has remained poorly tested. Here we describe two new, co-occurring ceratopsids from the Upper Cretaceous Kaiparowits Formation of Utah that provide the strongest support to date for the dinosaur provincialism hypothesis. Both pertain to the clade of ceratopsids known as Chasmosaurinae, dramatically increasing representation of this group from the southern portion of the Western Interior Basin of North America. Utahceratops gettyi gen. et sp. nov.-characterized by short, rounded, laterally projecting supraorbital horncores and an elongate frill with a deep median embayment-is recovered as the sister taxon to Pentaceratops sternbergii from the late Campanian of New Mexico. Kosmoceratops richardsoni gen. et sp. nov.-characterized by elongate, laterally projecting supraorbital horncores and a short, broad frill adorned with ten well developed hooks-has the most ornate skull of any known dinosaur and is closely allied to Chasmosaurus irvinensis from the late Campanian of Alberta. Considered in unison, the phylogenetic, stratigraphic, and biogeographic evidence documents distinct, co-occurring chasmosaurine taxa north and south on the diminutive landmass of Laramidia. The famous Triceratops and all other, more nested chasmosaurines are postulated as descendants of forms previously restricted to the southern portion of Laramidia. Results further suggest the presence of

  5. Genomic evidence for the evolution of Streptococcus equi: host restriction, increased virulence, and genetic exchange with human pathogens.

    Directory of Open Access Journals (Sweden)

    Matthew T G Holden

    2009-03-01

    Full Text Available The continued evolution of bacterial pathogens has major implications for both human and animal disease, but the exchange of genetic material between host-restricted pathogens is rarely considered. Streptococcus equi subspecies equi (S. equi is a host-restricted pathogen of horses that has evolved from the zoonotic pathogen Streptococcus equi subspecies zooepidemicus (S. zooepidemicus. These pathogens share approximately 80% genome sequence identity with the important human pathogen Streptococcus pyogenes. We sequenced and compared the genomes of S. equi 4047 and S. zooepidemicus H70 and screened S. equi and S. zooepidemicus strains from around the world to uncover evidence of the genetic events that have shaped the evolution of the S. equi genome and led to its emergence as a host-restricted pathogen. Our analysis provides evidence of functional loss due to mutation and deletion, coupled with pathogenic specialization through the acquisition of bacteriophage encoding a phospholipase A(2 toxin, and four superantigens, and an integrative conjugative element carrying a novel iron acquisition system with similarity to the high pathogenicity island of Yersinia pestis. We also highlight that S. equi, S. zooepidemicus, and S. pyogenes share a common phage pool that enhances cross-species pathogen evolution. We conclude that the complex interplay of functional loss, pathogenic specialization, and genetic exchange between S. equi, S. zooepidemicus, and S. pyogenes continues to influence the evolution of these important streptococci.

  6. Topology of genetic associations between regional gray matter volume and intellectual ability: Evidence for a high capacity network.

    Science.gov (United States)

    Bohlken, Marc M; Brouwer, Rachel M; Mandl, René C W; Hedman, Anna M; van den Heuvel, Martijn P; van Haren, Neeltje E M; Kahn, René S; Hulshoff Pol, Hilleke E

    2016-01-01

    Intelligence is associated with a network of distributed gray matter areas including the frontal and parietal higher association cortices and primary processing areas of the temporal and occipital lobes. Efficient information transfer between gray matter regions implicated in intelligence is thought to be critical for this trait to emerge. Genetic factors implicated in intelligence and gray matter may promote a high capacity for information transfer. Whether these genetic factors act globally or on local gray matter areas separately is not known. Brain maps of phenotypic and genetic associations between gray matter volume and intelligence were made using structural equation modeling of 3T MRI T1-weighted scans acquired in 167 adult twins of the newly acquired U-TWIN cohort. Subsequently, structural connectivity analyses (DTI) were performed to test the hypothesis that gray matter regions associated with intellectual ability form a densely connected core. Gray matter regions associated with intellectual ability were situated in the right prefrontal, bilateral temporal, bilateral parietal, right occipital and subcortical regions. Regions implicated in intelligence had high structural connectivity density compared to 10,000 reference networks (p=0.031). The genetic association with intelligence was for 39% explained by a genetic source unique to these regions (independent of total brain volume), this source specifically implicated the right supramarginal gyrus. Using a twin design, we show that intelligence is genetically represented in a spatially distributed and densely connected network of gray matter regions providing a high capacity infrastructure. Although genes for intelligence have overlap with those for total brain volume, we present evidence that there are genes for intelligence that act specifically on the subset of brain areas that form an efficient brain network. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Providing reviews of evidence to COPD patients: controlled prospective 12-month trial.

    Science.gov (United States)

    Harris, M; Smith, B J; Veale, A J; Esterman, A; Frith, P A; Selim, P

    2009-01-01

    The aim of this study was to evaluate a novel patient-held manual designed to reduce the evidence-practice gap in chronic obstructive pulmonary disease (COPD). The intervention manual contained summaries of research evidence. It was developed using current best practice for patient information materials and designed to cause discussion of evidence between patient and doctor. A controlled before-and-after study was employed in two similar but geographically separate regions of metropolitan Adelaide, South Australia. Participants had moderate to severe COPD, with 249 included at baseline and 201 completing the study. Evidence-based COPD management was measured using an indicator with three components: rates of influenza vaccination, bone density testing, and pulmonary rehabilitation. A survey of behavioral steps leading to practice change was conducted with the trial. Analysis, by median split of socioeconomic disadvantage, showed significant difference between study arms for only one component of the indicator of evidence-based practice, enrollment in pulmonary rehabilitation and only for the most socioeconomically disadvantaged stratum. For both socioeconomic strata, more intervention participants than control participants reported remembering being given the information material, reading part or all, and finding it very or quite helpful. Other significant differences were restricted to the stratum of greatest socioeconomic disadvantage: reading all of the material, learning from it, referring back, and talking to a doctor about a topic from the material. Above 90% of all participants who received the manual reported reading from it, 42% reported discussing topics with a doctor, but only 10% reported treatment change attributable to the manual. We have found that people with COPD will read an evidence manual developed using current best practice. However, the study demonstrated improvement for only one of the three components of an indicator of evidence

  8. The evidence base regarding the experiences of and attitudes to preimplantation genetic diagnosis in prospective parents.

    Science.gov (United States)

    Cunningham, Jenny; Goldsmith, Lesley; Skirton, Heather

    2015-02-01

    Preimplantation genetic diagnosis was developed as an alternative to prenatal diagnosis for couples with a family history of genetic disease. After in vitro fertilization, the embryos can be analysed to ensure that only healthy embryos are transferred to the uterus. Past studies have suggested that couples who wish to avoid having a child with an inherited genetic condition look favourably on preimplantation genetic diagnosis as it prevents the need for termination of pregnancy following prenatal diagnosis of an affected fetus. However, it is important to understand the experiences of couples who have used or consider using this technique. To ascertain the current evidence base on this topic, we conducted a mixed methods systematic review. Four databases were searched for relevant peer-reviewed papers published between 2000 and 2013. Of 453 papers, nine satisfied the inclusion criteria and were assessed for quality. Results of nine papers were analysed and synthesised using a narrative approach. Three main themes emerged: (1) motivating factors; (2) emotional labour; (3) choices and uncertainty. The review has identified an emotional and difficult journey for couples pursuing preimplantation genetic diagnosis. While use of the technique gives hope to families who wish to prevent transmission of a genetic disease this is not without hard decision-making and periods of uncertainty. Lack of information was perceived as a barrier to access this reproductive option. Recommendations include: training and education in genetics for midwives who are the first point of contact for pregnant women; clinics to use a decision-making tool to emphasise the uncertainty involved in PGD and improved communication and psychological support to couples. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. The application of Dempster-Shafer theory demonstrated with justification provided by legal evidence

    Directory of Open Access Journals (Sweden)

    Shawn P. Curley

    2007-10-01

    Full Text Available In forecasting and decision making, people can and often do represent a degree of belief in some proposition. At least two separate constructs capture such degrees of belief: likelihoods capturing evidential balance and support capturing evidential weight. This paper explores the weight or justification that evidence affords propositions, with subjects communicating using a belief function in hypothetical legal situations, where justification is a relevant goal. Subjects evaluated the impact of sets of 1--3 pieces of evidence, varying in complexity, within a hypothetical legal situation. The study demonstrates the potential usefulness of this evidential weight measure as an alternative or complement to the more-studied probability measure. Subjects' responses indicated that weight and likelihood were distinguished; that subjects' evidential weight tended toward single elements in a targeted fashion; and, that there were identifiable individual differences in reactions to conflicting evidence. Specifically, most subjects reacted to conflicting evidence that supported disjoint sets of suspects with continued support in the implicated sets, although an identifiable minority reacted by pulling back their support, expressing indecisiveness. Such individuals would likely require a greater amount of evidence than the others to counteract this tendency in support. Thus, the study identifies the value of understanding evidential weight as distinct from likelihood, informs our understanding of the psychology of individuals' judgments of evidential weight, and furthers the application and meaningfulness of belief functions as a communication language.

  10. Linkage Map of Lissotriton Newts Provides Insight into the Genetic Basis of Reproductive Isolation

    Directory of Open Access Journals (Sweden)

    Marta Niedzicka

    2017-07-01

    Full Text Available Linkage maps are widely used to investigate structure, function, and evolution of genomes. In speciation research, maps facilitate the study of the genetic architecture of reproductive isolation by allowing identification of genomic regions underlying reduced fitness of hybrids. Here we present a linkage map for European newts of the Lissotriton vulgaris species complex, constructed using two families of F2 L. montandoni × L. vulgaris hybrids. The map consists of 1146 protein-coding genes on 12 linkage groups, equal to the haploid chromosome number, with a total length of 1484 cM (1.29 cM per marker. It is notably shorter than two other maps available for salamanders, but the differences in map length are consistent with cytogenetic estimates of the number of chiasmata per chromosomal arm. Thus, large salamander genomes do not necessarily translate into long linkage maps, as previously suggested. Consequently, salamanders are an excellent model to study evolutionary consequences of recombination rate variation in taxa with large genomes and a similar number of chromosomes. A complex pattern of transmission ratio distortion (TRD was detected: TRD occurred mostly in one family, in one breeding season, and was clustered in two genomic segments. This is consistent with environment-dependent mortality of individuals carrying L. montandoni alleles in these two segments and suggests a role of TRD blocks in reproductive isolation. The reported linkage map will empower studies on the genomic architecture of divergence and interactions between the genomes of hybridizing newts.

  11. Evolution of Hereditary Breast Cancer Genetic Services: Are Changes Reflected in the Knowledge and Clinical Practices of Florida Providers?

    Science.gov (United States)

    Cragun, Deborah; Scherr, Courtney; Camperlengo, Lucia; Vadaparampil, Susan T; Pal, Tuya

    2016-10-01

    We describe practitioner knowledge and practices related to hereditary breast and ovarian cancer (HBOC) in an evolving landscape of genetic testing. A survey was mailed in late 2013 to Florida providers who order HBOC testing. Descriptive statistics were conducted to characterize participants' responses. Of 101 respondents, 66% indicated either no genetics education or education through a commercial laboratory. Although 79% of respondents were aware of the Supreme Court ruling resulting in the loss of Myriad Genetics' BRCA gene patent, only 19% had ordered testing from a different laboratory. With regard to pretest counseling, 78% of respondents indicated they usually discuss 11 of 14 nationally recommended elements for informed consent. Pretest discussion times varied from 3 to 120 min, with approximately half spending 40% of respondents included (1) possibility of a variant of uncertain significance (VUS) and (2) issues related to life/disability insurance. With regard to genetic testing for HBOC, 88% would test an unaffected sister of a breast cancer patient identified with a BRCA VUS. Results highlight the need to identify whether variability in hereditary cancer service delivery impacts patient outcomes. Findings also reveal opportunities to facilitate ongoing outreach and education.

  12. Insights into mRNP biogenesis provided by new genetic interactions among export and transcription factors

    Directory of Open Access Journals (Sweden)

    Estruch Francisco

    2012-09-01

    Full Text Available Abstract Background The various steps of mRNP biogenesis (transcription, processing and export are interconnected. It has been shown that the transcription machinery plays a pivotal role in mRNP assembly, since several mRNA export factors are recruited during transcription and physically interact with components of the transcription machinery. Although the shuttling DEAD-box protein Dbp5p is concentrated on the cytoplasmic fibrils of the NPC, previous studies demonstrated that it interacts physically and genetically with factors involved in transcription initiation. Results We investigated the effect of mutations affecting various components of the transcription initiation apparatus on the phenotypes of mRNA export mutant strains. Our results show that growth and mRNA export defects of dbp5 and mex67 mutant strains can be suppressed by mutation of specific transcription initiation components, but suppression was not observed for mutants acting in the very first steps of the pre-initiation complex (PIC formation. Conclusions Our results indicate that mere reduction in the amount of mRNP produced is not sufficient to suppress the defects caused by a defective mRNA export factor. Suppression occurs only with mutants affecting events within a narrow window of the mRNP biogenesis process. We propose that reducing the speed with which transcription converts from initiation and promoter clearance to elongation may have a positive effect on mRNP formation by permitting more effective recruitment of partially-functional mRNP proteins to the nascent mRNP.

  13. Neighborhood alcohol outlet density and genetic influences on alcohol use: evidence for gene-environment interaction.

    Science.gov (United States)

    Slutske, Wendy S; Deutsch, Arielle R; Piasecki, Thomas M

    2018-05-07

    Genetic influences on alcohol involvement are likely to vary as a function of the 'alcohol environment,' given that exposure to alcohol is a necessary precondition for genetic risk to be expressed. However, few gene-environment interaction studies of alcohol involvement have focused on characteristics of the community-level alcohol environment. The goal of this study was to examine whether living in a community with more alcohol outlets would facilitate the expression of the genetic propensity to drink in a genetically-informed national survey of United States young adults. The participants were 2434 18-26-year-old twin, full-, and half-sibling pairs from Wave III of the National Longitudinal Study of Adolescent to Adult Health. Participants completed in-home interviews in which alcohol use was assessed. Alcohol outlet densities were extracted from state-level liquor license databases aggregated at the census tract level to derive the density of outlets. There was evidence that the estimates of genetic and environmental influences on alcohol use varied as a function of the density of alcohol outlets in the community. For example, the heritability of the frequency of alcohol use for those residing in a neighborhood with ten or more outlets was 74% (95% confidence limits = 55-94%), compared with 16% (95% confidence limits = 0-34%) for those in a neighborhood with zero outlets. This moderating effect of alcohol outlet density was not explained by the state of residence, population density, or neighborhood sociodemographic characteristics. The results suggest that living in a neighborhood with many alcohol outlets may be especially high-risk for those individuals who are genetically predisposed to frequently drink.

  14. Genetic evidence and integration of various data sources for classifying uncertain variants into a single model.

    NARCIS (Netherlands)

    Goldgar, D.E.; Easton, D.F.; Byrnes, G.B.; Spurdle, A.B.; Iversen, E.S.; Greenblatt, M.S.; Boffetta, P.; Couch, F.J.; Wind, N. de; Eccles, D.; Foulkes, W.D.; Genuardi, M.; Hofstra, R.M.; Hogervorst, F.; Hoogerbrugge-van der Linden, N.; Plon, S.E.; Radice, P.; Rasmussen, L.; Sinilnikova, O.M.; Tavtigian, S.V.

    2008-01-01

    Genetic testing often results in the finding of a variant whose clinical significance is unknown. A number of different approaches have been employed in the attempt to classify such variants. For some variants, case-control, segregation, family history, or other statistical studies can provide

  15. Comparative population genetics of two invading ticks: Evidence of the ecological mechanisms underlying tick range expansions.

    Science.gov (United States)

    Nadolny, Robyn; Gaff, Holly; Carlsson, Jens; Gauthier, David

    2015-10-01

    Two species of ixodid tick, Ixodes affinis Neumann and Amblyomma maculatum Koch, are simultaneously expanding their ranges throughout the mid-Atlantic region of the US. Although we have some understanding of the ecology and life history of these species, the ecological mechanisms governing where and how new populations establish and persist are unclear. To assess population connectivity and ancestry, we sequenced a fragment of the 16S mitochondrial rRNA gene from a representative sample of individuals of both species from populations throughout the eastern US. We found that despite overlapping host preferences throughout ontogeny, each species exhibited very different genetic and geographic patterns of population establishment and connectivity. I. affinis was of two distinct mitochondrial clades, with a clear geographic break separating northern and southern populations. Both I. affinis populations showed evidence of recent expansion, although the southern population was more genetically diverse, indicating a longer history of establishment. A. maculatum exhibited diverse haplotypes that showed no significant relationship with geographic patterns and little apparent connectivity between sites. Heteroplasmy was also observed in the 16S mitochondrial rRNA gene in 3.5% of A. maculatum individuals. Genetic evidence suggests that these species rely on different key life stages to successfully disperse into novel environments, and that host vagility, habitat stability and habitat connectivity all play critical roles in the establishment of new tick populations. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Three Molecular Markers Show No Evidence of Population Genetic Structure in the Gouldian Finch (Erythrura gouldiae.

    Directory of Open Access Journals (Sweden)

    Peri E Bolton

    Full Text Available Assessment of genetic diversity and connectivity between regions can inform conservation managers about risk of inbreeding, potential for adaptation and where population boundaries lie. The Gouldian finch (Erythrura gouldiae is a threatened species in northern Australia, occupying the savannah woodlands of the biogeographically complex monsoon tropics. We present the most comprehensive population genetic analysis of diversity and structure the Gouldian finch using 16 microsatellite markers, mitochondrial control region and 3,389 SNPs from genotyping-by-sequencing. Mitochondrial diversity is compared across three related, co-distributed finches with different conservation threat-statuses. There was no evidence of genetic differentiation across the western part of the range in any of the molecular markers, and haplotype diversity but not richness was lower than a common co-distributed species. Individuals within the panmictic population in the west may be highly dispersive within this wide area, and we urge caution when interpreting anecdotal observations of changes to the distribution and/or flock sizes of Gouldian finch populations as evidence of overall changes to the population size of this species.

  17. Late Cretaceous origin of the rice tribe provides evidence for early diversification in Poaceae.

    Science.gov (United States)

    Prasad, V; Strömberg, C A E; Leaché, A D; Samant, B; Patnaik, R; Tang, L; Mohabey, D M; Ge, S; Sahni, A

    2011-09-20

    Rice and its relatives are a focal point in agricultural and evolutionary science, but a paucity of fossils has obscured their deep-time history. Previously described cuticles with silica bodies (phytoliths) from the Late Cretaceous period (67-65 Ma) of India indicate that, by the latest Cretaceous, the grass family (Poaceae) consisted of members of the modern subclades PACMAD (Panicoideae-Aristidoideae-Chloridoideae-Micrairoideae-Arundinoideae-Danthonioideae) and BEP (Bambusoideae-Ehrhartoideae-Pooideae), including a taxon with proposed affinities to Ehrhartoideae. Here we describe additional fossils and show that, based on phylogenetic analyses that combine molecular genetic data and epidermal and phytolith features across Poaceae, these can be assigned to the rice tribe, Oryzeae, of grass subfamily Ehrhartoideae. The new Oryzeae fossils suggest substantial diversification within Ehrhartoideae by the Late Cretaceous, pushing back the time of origin of Poaceae as a whole. These results, therefore, necessitate a re-evaluation of current models for grass evolution and palaeobiogeography.

  18. Amplification of the flgE gene provides evidence for the existence of a Brazilian borreliosis

    Directory of Open Access Journals (Sweden)

    Elenice Mantovani

    2012-06-01

    Full Text Available INTRODUCTION: The symptoms of Brazilian borreliosis resemble the clinical manifestations of Lyme disease (LD. However, there are differences between the two in terms of epidemiological and laboratory findings. Primers usually employed to diagnose LD have failed to detect Borrelia strains in Brazil. OBJECTIVE: We aimed to identify the Brazilian Borrelia using a conserved gene that synthesizes the flagellar hook (flgE of Borrelia burgdorferi sensu lato. METHOD: Three patients presenting with erythema migrans and positive epidemiological histories were recruited for the study. Blood samples were collected, and the DNA was extracted by commercial kits. RESULTS: The gene flgE was amplified from DNA of all selected patients. Upon sequencing, these positive samples revealed 99% homology to B. burgdorferi flgE. CONCLUSION: These results support the existence of borreliosis in Brazil. However, it is unclear whether this borreliosis is caused by a genetically modified B. burgdorferi sensu stricto or by a new species of Borrelia spp.

  19. Statistical and population genetics issues of two Hungarian datasets from the aspect of DNA evidence interpretation.

    Science.gov (United States)

    Szabolcsi, Zoltán; Farkas, Zsuzsa; Borbély, Andrea; Bárány, Gusztáv; Varga, Dániel; Heinrich, Attila; Völgyi, Antónia; Pamjav, Horolma

    2015-11-01

    When the DNA profile from a crime-scene matches that of a suspect, the weight of DNA evidence depends on the unbiased estimation of the match probability of the profiles. For this reason, it is required to establish and expand the databases that reflect the actual allele frequencies in the population applied. 21,473 complete DNA profiles from Databank samples were used to establish the allele frequency database to represent the population of Hungarian suspects. We used fifteen STR loci (PowerPlex ESI16) including five, new ESS loci. The aim was to calculate the statistical, forensic efficiency parameters for the Databank samples and compare the newly detected data to the earlier report. The population substructure caused by relatedness may influence the frequency of profiles estimated. As our Databank profiles were considered non-random samples, possible relationships between the suspects can be assumed. Therefore, population inbreeding effect was estimated using the FIS calculation. The overall inbreeding parameter was found to be 0.0106. Furthermore, we tested the impact of the two allele frequency datasets on 101 randomly chosen STR profiles, including full and partial profiles. The 95% confidence interval estimates for the profile frequencies (pM) resulted in a tighter range when we used the new dataset compared to the previously published ones. We found that the FIS had less effect on frequency values in the 21,473 samples than the application of minimum allele frequency. No genetic substructure was detected by STRUCTURE analysis. Due to the low level of inbreeding effect and the high number of samples, the new dataset provides unbiased and precise estimates of LR for statistical interpretation of forensic casework and allows us to use lower allele frequencies. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. Evidence suggesting a genetic contribution to kidney stone in northeastern Thai population.

    Science.gov (United States)

    Sritippayawan, Suchai; Borvornpadungkitti, Sombat; Paemanee, Atchara; Predanon, Chagkrapan; Susaengrat, Wattanachai; Chuawattana, Duangporn; Sawasdee, Nunghathai; Nakjang, Sirintra; Pongtepaditep, Suttikarn; Nettuwakul, Choochai; Rungroj, Nanyawan; Vasuvattakul, Somkiat; Malasit, Prida; Yenchitsomanus, Pa-thai

    2009-06-01

    Genetic factor may play a role in the pathogenesis of kidney stone that is found in the northeastern (NE) Thai population. Herein, we report initial evidence suggesting genetic contribution to the disease in this population. We examined 1,034 subjects including 135 patients with kidney stone, 551 family members, and 348 villagers by radiography of kidney-ureter-bladder (KUB) and other methods, and also analyzed stones removed by surgical operations. One hundred and sixteen of 551 family members (21.05%) and 23 of the 348 villagers (6.61%) were affected with kidney stone. The relative risk (lambda(R)) of the disease among family members was 3.18. Calcium stones (whewellite, dahllite, and weddellite) were observed in about 88% of stones analyzed. Our data indicate familial aggregation of kidney stone in this population supporting that genetic factor should play some role in its pathogenesis. Genetic and genomic studies will be conducted to identify the genes associated with the disease.

  1. Approaches to the mechanisms of song memorization and singing provide evidence for a procedural memory

    OpenAIRE

    Hultsch,Henrike; Todt,Dietmar

    2004-01-01

    There is growing evidence that, during song learning, birds do not only acquire 'what to sing' (the inventory of behavior), but also 'how to sing' (the singing program), including order-features of song sequencing. Common Nightingales Luscinia megarhynchos acquire such serial information by segmenting long strings of heard songs into smaller subsets or packages, by a process reminiscent of the chunking of information as a coding mechanism in short term memory. Here we report three tutoring ex...

  2. BAD knockout provides metabolic seizure resistance in a genetic model of epilepsy with sudden unexplained death in epilepsy.

    Science.gov (United States)

    Foley, Jeannine; Burnham, Veronica; Tedoldi, Meghan; Danial, Nika N; Yellen, Gary

    2018-01-01

    Metabolic alteration, either through the ketogenic diet (KD) or by genetic alteration of the BAD protein, can produce seizure protection in acute chemoconvulsant models of epilepsy. To assess the seizure-protective role of knocking out (KO) the Bad gene in a chronic epilepsy model, we used the Kcna1 -/- model of epilepsy, which displays progressively increased seizure severity and recapitulates the early death seen in sudden unexplained death in epilepsy (SUDEP). Beginning on postnatal day 24 (P24), we continuously video monitored Kcna1 -/- and Kcna1 -/- Bad -/- double knockout mice to assess survival and seizure severity. We found that Kcna1 -/- Bad -/- mice outlived Kcna1 -/- mice by approximately 2 weeks. Kcna1 -/- Bad -/- mice also spent significantly less time in seizure than Kcna1 -/- mice on P24 and the day of death, showing that BadKO provides seizure resistance in a genetic model of chronic epilepsy. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

  3. Insights into HLA-G genetics provided by worldwide haplotype diversity

    Directory of Open Access Journals (Sweden)

    Erick C Castelli

    2014-10-01

    Full Text Available Human Leucocyte Antigen G (HLA-G belongs to the family of nonclassical HLA class I genes, located within the major histocompatibility complex (MHC. HLA-G has been the target of most recent research regarding the function of class I nonclassical genes. The main features that distinguish HLA-G from classical class I genes are: a limited protein variability; b alternative splicing generating several membrane bound and soluble isoforms; c short cytoplasmic tail; d modulation of immune response (immune tolerance; e restricted expression to certain tissues. In the present work, we describe the HLA-G gene structure and address the HLA-G variability and haplotype diversity among several populations around the world, considering each of its major segments (promoter, coding and 3’untranslated regions. For this purpose, we developed a pipeline to reevaluate the 1000Genomes data and recover miscalled or missing genotypes and haplotypes. It became clear that the overall structure of the HLA-G molecule has been maintained during the evolutionary process and that most of the variation sites found in the HLA-G coding region are either coding synonymous or intronic mutations. In addition, only a few frequent and divergent extended haplotypes are found when the promoter, coding and 3’ untranslated regions are evaluated together. The divergence is particularly evident for the regulatory regions. The population comparisons confirmed that most of the HLA-G variability has originated before human dispersion from Africa and that the allele and haplotype frequencies have probably been shaped by strong selective pressures.

  4. Genetic Evidence for Causal Relationships Between Maternal Obesity-Related Traits and Birth Weight.

    Science.gov (United States)

    Tyrrell, Jessica; Richmond, Rebecca C; Palmer, Tom M; Feenstra, Bjarke; Rangarajan, Janani; Metrustry, Sarah; Cavadino, Alana; Paternoster, Lavinia; Armstrong, Loren L; De Silva, N Maneka G; Wood, Andrew R; Horikoshi, Momoko; Geller, Frank; Myhre, Ronny; Bradfield, Jonathan P; Kreiner-Møller, Eskil; Huikari, Ville; Painter, Jodie N; Hottenga, Jouke-Jan; Allard, Catherine; Berry, Diane J; Bouchard, Luigi; Das, Shikta; Evans, David M; Hakonarson, Hakon; Hayes, M Geoffrey; Heikkinen, Jani; Hofman, Albert; Knight, Bridget; Lind, Penelope A; McCarthy, Mark I; McMahon, George; Medland, Sarah E; Melbye, Mads; Morris, Andrew P; Nodzenski, Michael; Reichetzeder, Christoph; Ring, Susan M; Sebert, Sylvain; Sengpiel, Verena; Sørensen, Thorkild I A; Willemsen, Gonneke; de Geus, Eco J C; Martin, Nicholas G; Spector, Tim D; Power, Christine; Järvelin, Marjo-Riitta; Bisgaard, Hans; Grant, Struan F A; Nohr, Ellen A; Jaddoe, Vincent W; Jacobsson, Bo; Murray, Jeffrey C; Hocher, Berthold; Hattersley, Andrew T; Scholtens, Denise M; Davey Smith, George; Hivert, Marie-France; Felix, Janine F; Hyppönen, Elina; Lowe, William L; Frayling, Timothy M; Lawlor, Debbie A; Freathy, Rachel M

    2016-03-15

    Neonates born to overweight or obese women are larger and at higher risk of birth complications. Many maternal obesity-related traits are observationally associated with birth weight, but the causal nature of these associations is uncertain. To test for genetic evidence of causal associations of maternal body mass index (BMI) and related traits with birth weight. Mendelian randomization to test whether maternal BMI and obesity-related traits are potentially causally related to offspring birth weight. Data from 30,487 women in 18 studies were analyzed. Participants were of European ancestry from population- or community-based studies in Europe, North America, or Australia and were part of the Early Growth Genetics Consortium. Live, term, singleton offspring born between 1929 and 2013 were included. Genetic scores for BMI, fasting glucose level, type 2 diabetes, systolic blood pressure (SBP), triglyceride level, high-density lipoprotein cholesterol (HDL-C) level, vitamin D status, and adiponectin level. Offspring birth weight from 18 studies. Among the 30,487 newborns the mean birth weight in the various cohorts ranged from 3325 g to 3679 g. The maternal genetic score for BMI was associated with a 2-g (95% CI, 0 to 3 g) higher offspring birth weight per maternal BMI-raising allele (P = .008). The maternal genetic scores for fasting glucose and SBP were also associated with birth weight with effect sizes of 8 g (95% CI, 6 to 10 g) per glucose-raising allele (P = 7 × 10(-14)) and -4 g (95% CI, -6 to -2 g) per SBP-raising allele (P = 1×10(-5)), respectively. A 1-SD ( ≈ 4 points) genetically higher maternal BMI was associated with a 55-g higher offspring birth weight (95% CI, 17 to 93 g). A 1-SD ( ≈ 7.2 mg/dL) genetically higher maternal fasting glucose concentration was associated with 114-g higher offspring birth weight (95% CI, 80 to 147 g). However, a 1-SD ( ≈ 10 mm Hg) genetically higher maternal SBP was associated with a 208-g

  5. Radiation inactivation method provides evidence that membrane-bound mitochondrial creatine kinase is an oligomer

    International Nuclear Information System (INIS)

    Quemeneur, E.; Eichenberger, D.; Goldschmidt, D.; Vial, C.; Beauregard, G.; Potier, M.

    1988-01-01

    Lyophilized suspensions of rabbit heart mitochondria have been irradiated with varying doses of gamma rays. Mitochondrial creatine kinase activity was inactivated exponentially with a radiation inactivation size of 352 or 377 kDa depending upon the initial medium. These values are in good agreement with the molecular mass previously deduced from by permeation experiments: 357 kDa. This is the first direct evidence showing that the native form of mitochondrial creatine kinase is associated to the inner membrane as an oligomer, very likely an octamer

  6. Preparing for fieldwork: Students' perceptions of their readiness to provide evidence-based practice.

    Science.gov (United States)

    Evenson, Mary E

    2013-01-01

    The purpose of this study was to explore students' perceptions of their confidence to use research evidence to complete a client case analysis assignment in preparation for participation in fieldwork and future practice. A convenience sample of 42 entry-level occupational therapy Masters students, included 41 females and one male, ages 24 to 35. A quasi-experimental pretest-posttest design was used. Students participated in a problem-based learning approach supported by educational technology. Measures included a pre- and post-semester confidence survey, a post-semester satisfaction survey, and an assignment rubric. Based on paired t-tests and Wilcoxin Signed Ranks Tests, statistically significant differences in pre- and post-test scores were noted for all 18 items on the confidence survey (plearning methods were significantly associated with students' perceptions of their confidence to use research evidence to analyze a client case. These results cannot necessarily be generalized due to the limitations of using non-standardized measures with a convenience sample, without a control group, within the context of a single course as part of one academic program curriculum.

  7. Chemical elemental distribution and soil DNA fingerprints provide the critical evidence in murder case investigation.

    Directory of Open Access Journals (Sweden)

    Giuseppe Concheri

    Full Text Available BACKGROUND: The scientific contribution to the solution of crime cases, or throughout the consequent forensic trials, is a crucial aspect of the justice system. The possibility to extract meaningful information from trace amounts of samples, and to match and validate evidences with robust and unambiguous statistical tests, are the key points of such process. The present report is the authorized disclosure of an investigation, carried out by Attorney General appointment, on a murder case in northern Italy, which yielded the critical supporting evidence for the judicial trial. METHODOLOGY/PRINCIPAL FINDINGS: The proportional distribution of 54 chemical elements and the bacterial community DNA fingerprints were used as signature markers to prove the similarity of two soil samples. The first soil was collected on the crime scene, along a corn field, while the second was found in trace amounts on the carpet of a car impounded from the main suspect in a distant location. The matching similarity of the two soils was proven by crossing the results of two independent techniques: a elemental analysis via inductively coupled plasma mass spectrometry (ICP-MS and optical emission spectrometry (ICP-OES approaches, and b amplified ribosomal DNA restriction analysis by gel electrophoresis (ARDRA. CONCLUSIONS: Besides introducing the novel application of these methods to forensic disciplines, the highly accurate level of resolution observed, opens new possibilities also in the fields of soil typing and tracking, historical analyses, geochemical surveys and global land mapping.

  8. Exploring the Symbiodinium rare biosphere provides evidence for symbiont switching in reef-building corals.

    Science.gov (United States)

    Boulotte, Nadine M; Dalton, Steven J; Carroll, Andrew G; Harrison, Peter L; Putnam, Hollie M; Peplow, Lesa M; van Oppen, Madeleine Jh

    2016-11-01

    Reef-building corals possess a range of acclimatisation and adaptation mechanisms to respond to seawater temperature increases. In some corals, thermal tolerance increases through community composition changes of their dinoflagellate endosymbionts (Symbiodinium spp.), but this mechanism is believed to be limited to the Symbiodinium types already present in the coral tissue acquired during early life stages. Compelling evidence for symbiont switching, that is, the acquisition of novel Symbiodinium types from the environment, by adult coral colonies, is currently lacking. Using deep sequencing analysis of Symbiodinium rDNA internal transcribed spacer 2 (ITS2) PCR amplicons from two pocilloporid coral species, we show evidence consistent with de novo acquisition of Symbiodinium types from the environment by adult corals following two consecutive bleaching events. Most of these newly detected symbionts remained in the rare biosphere (background types occurring below 1% relative abundance), but one novel type reached a relative abundance of ~33%. Two de novo acquired Symbiodinium types belong to the thermally resistant clade D, suggesting that this switching may have been driven by consecutive thermal bleaching events. Our results are particularly important given the maternal mode of Symbiodinium transmission in the study species, which generally results in high symbiont specificity. These findings will cause a paradigm shift in our understanding of coral-Symbiodinium symbiosis flexibility and mechanisms of environmental acclimatisation in corals.

  9. Genetic variation in South Indian castes: evidence from Y-chromosome, mitochondrial, and autosomal polymorphisms

    Directory of Open Access Journals (Sweden)

    Tirupati S

    2008-12-01

    Full Text Available Abstract Background Major population movements, social structure, and caste endogamy have influenced the genetic structure of Indian populations. An understanding of these influences is increasingly important as gene mapping and case-control studies are initiated in South Indian populations. Results We report new data on 155 individuals from four Tamil caste populations of South India and perform comparative analyses with caste populations from the neighboring state of Andhra Pradesh. Genetic differentiation among Tamil castes is low (RST = 0.96% for 45 autosomal short tandem repeat (STR markers, reflecting a largely common origin. Nonetheless, caste- and continent-specific patterns are evident. For 32 lineage-defining Y-chromosome SNPs, Tamil castes show higher affinity to Europeans than to eastern Asians, and genetic distance estimates to the Europeans are ordered by caste rank. For 32 lineage-defining mitochondrial SNPs and hypervariable sequence (HVS 1, Tamil castes have higher affinity to eastern Asians than to Europeans. For 45 autosomal STRs, upper and middle rank castes show higher affinity to Europeans than do lower rank castes from either Tamil Nadu or Andhra Pradesh. Local between-caste variation (Tamil Nadu RST = 0.96%, Andhra Pradesh RST = 0.77% exceeds the estimate of variation between these geographically separated groups (RST = 0.12%. Low, but statistically significant, correlations between caste rank distance and genetic distance are demonstrated for Tamil castes using Y-chromosome, mtDNA, and autosomal data. Conclusion Genetic data from Y-chromosome, mtDNA, and autosomal STRs are in accord with historical accounts of northwest to southeast population movements in India. The influence of ancient and historical population movements and caste social structure can be detected and replicated in South Indian caste populations from two different geographic regions.

  10. Genetic Evidence for Causal Relationships Between Maternal Obesity-Related Traits and Birth Weight

    DEFF Research Database (Denmark)

    Tyrrell, Jessica; Richmond, Rebecca C; Palmer, Tom M

    2016-01-01

    IMPORTANCE: Neonates born to overweight or obese women are larger and at higher risk of birth complications. Many maternal obesity-related traits are observationally associated with birth weight, but the causal nature of these associations is uncertain. OBJECTIVE: To test for genetic evidence...... of causal associations of maternal body mass index (BMI) and related traits with birth weight. DESIGN, SETTING, AND PARTICIPANTS: Mendelian randomization to test whether maternal BMI and obesity-related traits are potentially causally related to offspring birth weight. Data from 30,487 women in 18 studies...

  11. Identification of novel genetic risk loci in Maltese dogs with necrotizing meningoencephalitis and evidence of a shared genetic risk across toy dog breeds.

    Science.gov (United States)

    Schrauwen, Isabelle; Barber, Renee M; Schatzberg, Scott J; Siniard, Ashley L; Corneveaux, Jason J; Porter, Brian F; Vernau, Karen M; Keesler, Rebekah I; Matiasek, Kaspar; Flegel, Thomas; Miller, Andrew D; Southard, Teresa; Mariani, Christopher L; Johnson, Gayle C; Huentelman, Matthew J

    2014-01-01

    Necrotizing meningoencephalitis (NME) affects toy and small breed dogs causing progressive, often fatal, inflammation and necrosis in the brain. Genetic risk loci for NME previously were identified in pug dogs, particularly associated with the dog leukocyte antigen (DLA) class II complex on chromosome 12, but have not been investigated in other susceptible breeds. We sought to evaluate Maltese and Chihuahua dogs, in addition to pug dogs, to identify novel or shared genetic risk factors for NME development. Genome-wide association testing of single nucleotide polymorphisms (SNPs) in Maltese dogs with NME identified 2 regions of genome-wide significance on chromosomes 4 (chr4:74522353T>A, p = 8.1×10-7) and 15 (chr15:53338796A>G, p = 1.5×10-7). Haplotype analysis and fine-mapping suggests that ILR7 and FBXW7, respectively, both important for regulation of immune system function, could be the underlying associated genes. Further evaluation of these regions and the previously identified DLA II locus across all three breeds, revealed an enrichment of nominal significant SNPs associated with chromosome 15 in pug dogs and DLA II in Maltese and Chihuahua dogs. Meta-analysis confirmed effect sizes the same direction in all three breeds for both the chromosome 15 and DLA II loci (p = 8.6×10-11 and p = 2.5×10-7, respectively). This suggests a shared genetic background exists between all breeds and confers susceptibility to NME, but effect sizes might be different among breeds. In conclusion, we identified the first genetic risk factors for NME development in the Maltese, chromosome 4 and chromosome 15, and provide evidence for a shared genetic risk between breeds associated with chromosome 15 and DLA II. Last, DLA II and IL7R both have been implicated in human inflammatory diseases of the central nervous system such as multiple sclerosis, suggesting that similar pharmacotherapeutic targets across species should be investigated.

  12. Identification of novel genetic risk loci in Maltese dogs with necrotizing meningoencephalitis and evidence of a shared genetic risk across toy dog breeds.

    Directory of Open Access Journals (Sweden)

    Isabelle Schrauwen

    Full Text Available Necrotizing meningoencephalitis (NME affects toy and small breed dogs causing progressive, often fatal, inflammation and necrosis in the brain. Genetic risk loci for NME previously were identified in pug dogs, particularly associated with the dog leukocyte antigen (DLA class II complex on chromosome 12, but have not been investigated in other susceptible breeds. We sought to evaluate Maltese and Chihuahua dogs, in addition to pug dogs, to identify novel or shared genetic risk factors for NME development. Genome-wide association testing of single nucleotide polymorphisms (SNPs in Maltese dogs with NME identified 2 regions of genome-wide significance on chromosomes 4 (chr4:74522353T>A, p = 8.1×10-7 and 15 (chr15:53338796A>G, p = 1.5×10-7. Haplotype analysis and fine-mapping suggests that ILR7 and FBXW7, respectively, both important for regulation of immune system function, could be the underlying associated genes. Further evaluation of these regions and the previously identified DLA II locus across all three breeds, revealed an enrichment of nominal significant SNPs associated with chromosome 15 in pug dogs and DLA II in Maltese and Chihuahua dogs. Meta-analysis confirmed effect sizes the same direction in all three breeds for both the chromosome 15 and DLA II loci (p = 8.6×10-11 and p = 2.5×10-7, respectively. This suggests a shared genetic background exists between all breeds and confers susceptibility to NME, but effect sizes might be different among breeds. In conclusion, we identified the first genetic risk factors for NME development in the Maltese, chromosome 4 and chromosome 15, and provide evidence for a shared genetic risk between breeds associated with chromosome 15 and DLA II. Last, DLA II and IL7R both have been implicated in human inflammatory diseases of the central nervous system such as multiple sclerosis, suggesting that similar pharmacotherapeutic targets across species should be investigated.

  13. Directed evolution of a model primordial enzyme provides insights into the development of the genetic code.

    Directory of Open Access Journals (Sweden)

    Manuel M Müller

    Full Text Available The contemporary proteinogenic repertoire contains 20 amino acids with diverse functional groups and side chain geometries. Primordial proteins, in contrast, were presumably constructed from a subset of these building blocks. Subsequent expansion of the proteinogenic alphabet would have enhanced their capabilities, fostering the metabolic prowess and organismal fitness of early living systems. While the addition of amino acids bearing innovative functional groups directly enhances the chemical repertoire of proteomes, the inclusion of chemically redundant monomers is difficult to rationalize. Here, we studied how a simplified chorismate mutase evolves upon expanding its amino acid alphabet from nine to potentially 20 letters. Continuous evolution provided an enhanced enzyme variant that has only two point mutations, both of which extend the alphabet and jointly improve protein stability by >4 kcal/mol and catalytic activity tenfold. The same, seemingly innocuous substitutions (Ile→Thr, Leu→Val occurred in several independent evolutionary trajectories. The increase in fitness they confer indicates that building blocks with very similar side chain structures are highly beneficial for fine-tuning protein structure and function.

  14. Microsatellite polymorphism within pfcrt provides evidence of continuing evolution of chloroquine-resistant alleles in Papua New Guinea

    Directory of Open Access Journals (Sweden)

    Sharma Yagya D

    2007-03-01

    , pfcrt intronic MS variation provides evidence that the locus is still evolving. Further studies are needed to determine whether these intronic MS introduce the underlying genetic mechanisms that may generate pfcrt allelic diversity.

  15. Retinoblastoma and the Genetic Theory of Cancer: An Old Paradigm Trying to Survive to the Evidence

    International Nuclear Information System (INIS)

    Mastrangelo, D.; Lore, C.; Hadjistilianou, T.; De Francesco, S.

    2009-01-01

    Retinoblastoma (Rb) is considered to represent the prototype of cancer linked to the sequential loss or inactivation of both alleles of a so-called “tumor suppressor gene”, the Rb1 gene. The pathogenetic mechanism behind this tumor was first hypothesized by Knudson in 1971 and further confirmed by others who identified the Rb1 gene whose loss or inactivation was claimed to be responsible for the disease. However, after about four decades of continuous research in the field of molecular biology, the evidence behind the role of the Rb1 gene in Rb appears to be seriously flawed in the light of epidemiological, biological, and clinical evidences. This editorial summarizes the inconsistencies on this subject. Nevertheless, the molecular biology establishment still adheres to the biased view of the genetic origin of Rb and other cancers, and hardly any alternative explanations are taken into account.

  16. Genetic evidence for a novel competence inhibitor in the industrially important Bacillus licheniformis.

    Science.gov (United States)

    Muth, Christine; Buchholz, Meike; Schmidt, Christina; Volland, Sonja; Meinhardt, Friedhelm

    2017-12-01

    Natural genetic competence renders bacteria able to take up and, in case there is sufficient homology to the recipient's chromosome, integrate exogenously supplied DNA. Well studied in Bacillus subtilis, genetic competence is-in several aspects-known to be differently regulated in Bacillus licheniformis. We now report on the identification of a novel, chromosomally encoded homolog of a competence inhibitor in B. licheniformis (ComI) that has hitherto only been described as a plasmid borne trait in the ancestral B. subtilis NCIB3610. Bioinformatical analysis that included 80 Bacillus strains covering 20 different species revealed a ComI encoding gene in all of the examined B. licheniformis representatives, and was identified in few among the other species investigated. The predicted ComI of B. licheniformis is a highly conserved peptide consisting of 28 amino acids. Since deletion of comI in B. licheniformis DSM13 resulted in twofold increased transformation efficiency by genetic competence and overexpression resulted in threefold decreased transformability, the function as a competence inhibitor became evident.

  17. Approaches to the mechanisms of song memorization and singing provide evidence for a procedural memory

    Directory of Open Access Journals (Sweden)

    Hultsch Henrike

    2004-01-01

    Full Text Available There is growing evidence that, during song learning, birds do not only acquire 'what to sing' (the inventory of behavior, but also 'how to sing' (the singing program, including order-features of song sequencing. Common Nightingales Luscinia megarhynchos acquire such serial information by segmenting long strings of heard songs into smaller subsets or packages, by a process reminiscent of the chunking of information as a coding mechanism in short term memory. Here we report three tutoring experiments on nightingales that examined whether such 'chunking' was susceptible to experimental cueing. The experiments tested whether (1 'temporal phrasing' (silent intersong intervals spaced out at particular positions of a tutored string, or (2 'stimulus novelty' (groups of novel song-types added to a basic string, or (3 'pattern similarity' in the phonetic structure of songs (here: sharing of song initials would induce package boundaries (or chunking at the manipulated sequential positions. The results revealed cueing effects in experiments (1 and (2 but not in experiment (3. The finding that birds used temporal variables as cues for chunking does not require the assumption that package formation is a cognitive strategy. Rather, it points towards a mechanism of procedural memory operating in the song acquisition of birds.

  18. Approaches to the mechanisms of song memorization and singing provide evidence for a procedural memory.

    Science.gov (United States)

    Hultsch, Henrike; Todt, Dietmar

    2004-06-01

    There is growing evidence that, during song learning, birds do not only acquire 'what to sing' (the inventory of behavior), but also 'how to sing' (the singing program), including order-features of song sequencing. Common Nightingales Luscinia megarhynchos acquire such serial information by segmenting long strings of heard songs into smaller subsets or packages, by a process reminiscent of the chunking of information as a coding mechanism in short term memory. Here we report three tutoring experiments on nightingales that examined whether such 'chunking' was susceptible to experimental cueing. The experiments tested whether (1) 'temporal phrasing' (silent intersong intervals spaced out at particular positions of a tutored string), or (2) 'stimulus novelty' (groups of novel song-types added to a basic string), or (3) 'pattern similarity' in the phonetic structure of songs (here: sharing of song initials) would induce package boundaries (or chunking) at the manipulated sequential positions. The results revealed cueing effects in experiments (1) and (2) but not in experiment (3). The finding that birds used temporal variables as cues for chunking does not require the assumption that package formation is a cognitive strategy. Rather, it points towards a mechanism of procedural memory operating in the song acquisition of birds.

  19. Providing Evidence-Based, Intelligent Support for Flood Resilient Planning and Policy: The PEARL Knowledge Base

    Directory of Open Access Journals (Sweden)

    George Karavokiros

    2016-09-01

    Full Text Available While flood risk is evolving as one of the most imminent natural hazards and the shift from a reactive decision environment to a proactive one sets the basis of the latest thinking in flood management, the need to equip decision makers with necessary tools to think about and intelligently select options and strategies for flood management is becoming ever more pressing. Within this context, the Preparing for Extreme and Rare Events in Coastal Regions (PEARL intelligent knowledge-base (PEARL KB of resilience strategies is presented here as an environment that allows end-users to navigate from their observed problem to a selection of possible options and interventions worth considering within an intuitive visual web interface assisting advanced interactivity. Incorporation of real case studies within the PEARL KB enables the extraction of (evidence-based lessons from all over the word, while the KB’s collection of methods and tools directly supports the optimal selection of suitable interventions. The Knowledge-Base also gives access to the PEARL KB Flood Resilience Index (FRI tool, which is an online tool for resilience assessment at a city level available to authorities and citizens. We argue that the PEARL KB equips authorities with tangible and operational tools that can improve strategic and operational flood risk management by assessing and eventually increasing resilience, while building towards the strengthening of risk governance. The online tools that the PEARL KB gives access to were demonstrated and tested in the city of Rethymno, Greece.

  20. The influence of system quality characteristics on health care providers' performance: Empirical evidence from Malaysia.

    Science.gov (United States)

    Mohd Salleh, Mohd Idzwan; Zakaria, Nasriah; Abdullah, Rosni

    The Ministry of Health Malaysia initiated the total hospital information system (THIS) as the first national electronic health record system for use in selected public hospitals across the country. Since its implementation 15 years ago, there has been the critical requirement for a systematic evaluation to assess its effectiveness in coping with the current system, task complexity, and rapid technological changes. The study aims to assess system quality factors to predict the performance of electronic health in a single public hospital in Malaysia. Non-probability sampling was employed for data collection among selected providers in a single hospital for two months. Data cleaning and bias checking were performed before final analysis in partial least squares-structural equation modeling. Convergent and discriminant validity assessments were satisfied the required criterions in the reflective measurement model. The structural model output revealed that the proposed adequate infrastructure, system interoperability, security control, and system compatibility were the significant predictors, where system compatibility became the most critical characteristic to influence an individual health care provider's performance. The previous DeLone and McLean information system success models should be extended to incorporate these technological factors in the medical system research domain to examine the effectiveness of modern electronic health record systems. In this study, care providers' performance was expected when the system usage fits with patients' needs that eventually increased their productivity. Copyright © 2016 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  1. Evidence-based practice beliefs and behaviors of nurses providing cancer pain management: a mixed-methods approach.

    Science.gov (United States)

    Eaton, Linda H; Meins, Alexa R; Mitchell, Pamela H; Voss, Joachim; Doorenbos, Ardith Z

    2015-03-01

    To describe evidence-based practice (EBP) beliefs and behaviors of nurses who provide cancer pain management. Descriptive, cross-sectional with a mixed-methods approach. Two inpatient oncology units in the Pacific Northwest. 40 RNs.
 Data collected by interviews and web-based surveys. EBP beliefs, EBP implementation, evidence-based pain management. Nurses agreed with the positive aspects of EBP and their implementation ability, although implementation level was low. They were satisfied with their pain management practices. Oncology nursing certification was associated with innovativeness, and innovativeness was associated with EBP beliefs. Themes identified were (a) limited definition of EBP, (b) varied evidence-based pain management decision making, (c) limited identification of evidence-based pain management practices, and (d) integration of nonpharmacologic interventions into patient care. Nurses' low level of EBP implementation in the context of pain management was explained by their trust that standards of care and medical orders were evidence-based. Nurses' EBP beliefs and behaviors should be considered when developing strategies for sustaining evidence-based pain management practices. Implementation of the EBP process by nurses may not be realistic in the inpatient setting; therefore, hospital pain management policies need to be evidence-based and reinforced with nurses.

  2. No evidence for female discrimination against male house mice carrying a selfish genetic element.

    Science.gov (United States)

    Sutter, Andreas; Lindholm, Anna K

    2016-12-01

    Meiotic drivers distort transmission to the next generation in their favor, with detrimental effects on the fitness of their homologues and the rest of the genome. Male carriers of meiotic drivers commonly inflict costs on their mates through genetic incompatibility, reduced fecundity, or biased brood sex ratios. Given these costs, evidence for female discrimination against male carriers is surprisingly rare. One of few examples is the t haplotype in house mice, a meiotic driver that shows strong transmission distortion in males and is typically homozygote lethal. As a consequence, mating between 2 t heterozygous (+/ t ) mice leads to high embryo mortality. Previous experiments showing that +/ t females avoid this incompatibility cost by preferring +/+ versus +/ t males have inferred preference based on olfactory cues or brief social interactions. Evidence from mating contexts in laboratory settings and semi-natural populations has been inconclusive. Here, we investigated female choice from a large number of no-choice mating trials. We found no evidence for discrimination against +/ t males based on mating, remating, and copulatory behavior. Further, we found no evidence for avoidance of incompatibility through selective interactions between gametes. The likelihood of mating showed significant effects of female weight and genotype, suggesting that our test paradigm enabled females to exhibit mate choice. We discuss the strengths and limitations of our approach. By explicitly considering selection at both the individual and gene level, we argue why precopulatory female discrimination by +/ t females may be less evolutionarily stable than discrimination by all females based on postcopulatory mechanisms.

  3. An integrative computational analysis provides evidence for FBN1-associated network deregulation in trisomy 21

    Directory of Open Access Journals (Sweden)

    Mireia Vilardell

    2013-06-01

    Although approximately 50% of Down Syndrome (DS patients have heart abnormalities, they exhibit an overprotection against cardiac abnormalities related with the connective tissue, for example a lower risk of coronary artery disease. A recent study reported a case of a person affected by DS who carried mutations in FBN1, the gene causative for a connective tissue disorder called Marfan Syndrome (MFS. The fact that the person did not have any cardiac alterations suggested compensation effects due to DS. This observation is supported by a previous DS meta-analysis at the molecular level where we have found an overall upregulation of FBN1 (which is usually downregulated in MFS. Additionally, that result was cross-validated with independent expression data from DS heart tissue. The aim of this work is to elucidate the role of FBN1 in DS and to establish a molecular link to MFS and MFS-related syndromes using a computational approach. To reach that, we conducted different analytical approaches over two DS studies (our previous meta-analysis and independent expression data from DS heart tissue and revealed expression alterations in the FBN1 interaction network, in FBN1 co-expressed genes and FBN1-related pathways. After merging the significant results from different datasets with a Bayesian approach, we prioritized 85 genes that were able to distinguish control from DS cases. We further found evidence for several of these genes (47%, such as FBN1, DCN, and COL1A2, being dysregulated in MFS and MFS-related diseases. Consequently, we further encourage the scientific community to take into account FBN1 and its related network for the study of DS cardiovascular characteristics.

  4. Genetic Diversity and Evidence for Transmission of Streptococcus mutans by DiversiLab rep-PCR.

    Science.gov (United States)

    Momeni, Stephanie S; Whiddon, Jennifer; Cheon, Kyounga; Ghazal, Tariq; Moser, Stephen A; Childers, Noel K

    2016-09-01

    This two-part study investigated the genetic diversity and transmission of Streptococcus mutans using the DiversiLab repetitive extragenic palindromic PCR (rep-PCR) approach. For children with S. mutans and participating household members, analysis for evidence of unrelated child-to-child as well as intra-familial transmission was evaluated based on commonality of genotypes. A total of 169 index children and 425 household family members from Uniontown, Alabama were evaluated for genetic diversity using rep-PCR. Thirty-four unique rep-PCR genotypes were observed for 13,906 S. mutans isolates. For transmission, 117 child and household isolates were evaluated for shared genotype (by child and by genotype cases, multiple matches possible for each child). Overall, children had 1-9 genotypes and those with multiple genotypes were 2.3 times more likely to have caries experience (decayed, missing and filled teeth/surfaces>0). Only 28% of children shared all genotypes within the household, while 72% had at least 1 genotype not shared with anyone in the household. Children had genotype(s) not shared with any household members in 157 cases. In 158 cases children and household members shared a genotype in which 55% (87/158 cases) were shared with more than one family member. Children most frequently shared genotypes with their mothers (54%; 85/158), siblings (46%; 72/158) and cousins (23%; 37/158). A reference library for S. mutans for epidemiological surveillance using the DiversiLab rep-PCR approach is detailed. The genetic diversity of S. mutans in this population demonstrated frequent commonality of genotypes. Evidence for both child-to-child and intra-familial transmission of S. mutans was observed by rep-PCR. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Harbor porpoise Phocoena phocoena strandings on the Dutch coast: No genetic structure, but evidence of inbreeding

    Science.gov (United States)

    van der Plas-Duivesteijn, Suzanne J.; Smit, Femmie J. L.; van Alphen, Jacques J. M.; Kraaijeveld, Ken

    2015-03-01

    Conservation management in the North Sea is often motivated by the population size of marine mammals, like harbor porpoises Phocoena phocoena. In the Dutch part of the North Sea, sighting and stranding data are used to estimate population sizes, but these data give little insight into genetic structuring of the population. In this study we investigated genetic structure among animals stranded at different locations and times of year. We also tested whether there is a link between stranding and necropsy data, and genetic diversity. We made use of both mitochondrial (mtDNA) and microsatellite DNA analysis of samples from dead stranded porpoises along the Dutch coast during 2007. mtDNA analysis showed 6 variable positions in the control region, defining 3 different haplotypes. mtDNA haplotypes were not randomly distributed along the Dutch coastline. However, microsatellite analysis showed that these mtDNA haplotypes did not represent separate groups on a nuclear level. Furthermore, microsatellite analysis revealed no genotypic differences between seasons, locations or genders. The results of this study indicate that the Dutch population is panmictic. In contrast, heterozygosity levels were low, indicating some level of inbreeding in this population. However, this was not corroborated by other indices of inbreeding. This research provided insight into genetic structuring of stranded porpoises in 2007, but data from multiple years should be included to be able to help estimate population sizes.

  6. Rectal cancer: An evidence-based update for primary care providers

    Science.gov (United States)

    Gaertner, Wolfgang B; Kwaan, Mary R; Madoff, Robert D; Melton, Genevieve B

    2015-01-01

    Rectal adenocarcinoma is an important cause of cancer-related deaths worldwide, and key anatomic differences between the rectum and the colon have significant implications for management of rectal cancer. Many advances have been made in the diagnosis and management of rectal cancer. These include clinical staging with imaging studies such as endorectal ultrasound and pelvic magnetic resonance imaging, operative approaches such as transanal endoscopic microsurgery and laparoscopic and robotic assisted proctectomy, as well as refined neoadjuvant and adjuvant therapies. For stage II and III rectal cancers, combined chemoradiotherapy offers the lowest rates of local and distant relapse, and is delivered neoadjuvantly to improve tolerability and optimize surgical outcomes, particularly when sphincter-sparing surgery is an endpoint. The goal in rectal cancer treatment is to optimize disease-free and overall survival while minimizing the risk of local recurrence and toxicity from both radiation and systemic therapy. Optimal patient outcomes depend on multidisciplinary involvement for tailored therapy. The successful management of rectal cancer requires a multidisciplinary approach, with the involvement of enterostomal nurses, gastroenterologists, medical and radiation oncologists, radiologists, pathologists and surgeons. The identification of patients who are candidates for combined modality treatment is particularly useful to optimize outcomes. This article provides an overview of the diagnosis, staging and multimodal therapy of patients with rectal cancer for primary care providers. PMID:26167068

  7. Dental calculus and isotopes provide direct evidence of fish and plant consumption in Mesolithic Mediterranean.

    Science.gov (United States)

    Cristiani, Emanuela; Radini, Anita; Borić, Dušan; Robson, Harry K; Caricola, Isabella; Carra, Marialetizia; Mutri, Giuseppina; Oxilia, Gregorio; Zupancich, Andrea; Šlaus, Mario; Vujević, Dario

    2018-05-25

    In this contribution we dismantle the perceived role of marine resources and plant foods in the subsistence economy of Holocene foragers of the Central Mediterranean using a combination of dental calculus and stable isotope analyses. The discovery of fish scales and flesh fragments, starch granules and other plant and animal micro-debris in the dental calculus of a Mesolithic forager dated to the end of the 8th millenium BC and buried in the Vlakno Cave on Dugi Otok Island in the Croatian Archipelago demonstrates that marine resources were regularly consumed by the individual together with a variety of plant foods. Since previous stable isotope data in the Eastern Adriatic and the Mediterranean region emphasises that terrestrial-based resources contributed mainly to Mesolithic diets in the Mediterranean Basin, our results provide an alternative view of the dietary habits of Mesolithic foragers in the Mediterranean region based on a combination of novel methodologies and data.

  8. Wide variation in hospital and physician payment rates evidence of provider market power.

    Science.gov (United States)

    Ginsburg, Paul B

    2010-11-01

    Wide variation in private insurer payment rates to hospitals and physicians across and within local markets suggests that some providers, particularly hospitals, have significant market power to negotiate higher-than-competitive prices, according to a new study by the Center for Studying Health System Change (HSC). Looking across eight health care markets--Cleveland; Indianapolis; Los Angeles; Miami; Milwaukee; Richmond, Va.; San Francisco; and rural Wisconsin--average inpatient hospital payment rates of four large national insurers ranged from 147 percent of Medicare in Miami to 210 percent in San Francisco. In extreme cases, some hospitals command almost five times what Medicare pays for inpatient services and more than seven times what Medicare pays for outpatient care. Variation within markets was just as dramatic. For example, the hospital with prices at the 25th percentile of Los Angeles hospitals received 84 percent of Medicare rates for inpatient care, while the hospital with prices at the 75th percentile received 184 percent of Medicare rates. The highest-priced Los Angeles hospital with substantial inpatient claims volume received 418 percent of Medicare. While not as pronounced, significant variation in physician payment rates also exists across and within markets and by specialty. Few would characterize the variation in hospital and physician payment rates found in this study to be consistent with a highly competitive market. Purchasers and public policy makers can address provider market power, or the ability to negotiate higher-than-competitive prices, through two distinct approaches. One is to pursue market approaches to strengthen competitive forces, while the other is to constrain payment rates through regulation.

  9. Improvement of beef cattle genetics provided increasing sustainability of beef cattle production and protein consumption in Thailand

    Energy Technology Data Exchange (ETDEWEB)

    Boonyanuwat, K. [Beef Cattle Research and Development Group, Division of Animal Husbandry, Department of Livestock Development, Bangkok (Thailand)], E-mail: kalayabo@yahoo.com; Sirisom, P [Tak Livestock Breeding and Research Center, Meung (Thailand); Putharatanung, A [Nongkwang Livestock Research and Breeding Center, Photharam (Thailand)

    2009-07-01

    .00%. They were the smallest size. Farmers raised them by main of grass-fed and some added with concentrate. Meat quality from this group was the lowest. The meat texture of this group is the most firm. It was suitable for Thai food cooking. Meat from this group was used to make meatball and Thai food. The second group was around 38.50%. They were fattening 3-6 month. Meat from this group was medium quality. Farmers fed them with grass, agricultural by product, and concentrate. Meat from this group was used for general Thai food and steak cooking. The third and forth group were around 20.00%. In this group, it was added with other beef cattle: Kampangsaen and Ponyangkhum beef cattle. They were fed higher concentrate, up to 90% of concentrate in the last month of fattening. They were fattening 6-12 month. Farmers fed them following feeding plan of cooperative, so they had the greatest ADG and % carcass. Quality of meat from this group was the best, most tender. Meat from this group was used for steak and shabushabu. Meat from this group had quality the same as import meat. Some of them were better than import meat. It was tenderer. The fifth group was less than 0.5%. They were on experiment to establish new breed by DLD. This group was optimized for Thai farmers, small size and low mature age. Meat from this group had the most tenderness and marbling. Meat from this group had more quality than import meat. It was used for steak and shabushabu. Farmers could earn money from beef cattle raising occupation. Beef cattle genetic improvement provided sustainable productivity, profitability, quality of products, and sustained economic growth in rural Thailand. Beef meat production would be the mainly red meat production and provided protein sources for consumer in Thailand. (author)

  10. rbcL gene sequences provide evidence for the evolutionary lineages of leptosporangiate ferns.

    Science.gov (United States)

    Hasebe, M; Omori, T; Nakazawa, M; Sano, T; Kato, M; Iwatsuki, K

    1994-06-07

    Pteriodophytes have a longer evolutionary history than any other vascular land plant and, therefore, have endured greater loss of phylogenetically informative information. This factor has resulted in substantial disagreements in evaluating characters and, thus, controversy in establishing a stable classification. To compare competing classifications, we obtained DNA sequences of a chloroplast gene. The sequence of 1206 nt of the large subunit of the ribulose-bisphosphate carboxylase gene (rbcL) was determined from 58 species, representing almost all families of leptosporangiate ferns. Phlogenetic trees were inferred by the neighbor-joining and the parsimony methods. The two methods produced almost identical phylogenetic trees that provided insights concerning major general evolutionary trends in the leptosporangiate ferns. Interesting findings were as follows: (i) two morphologically distinct heterosporous water ferns, Marsilea and Salvinia, are sister genera; (ii) the tree ferns (Cyatheaceae, Dicksoniaceae, and Metaxyaceae) are monophyletic; and (iii) polypodioids are distantly related to the gleichenioids in spite of the similarity of their exindusiate soral morphology and are close to the higher indusiate ferns. In addition, the affinities of several "problematic genera" were assessed.

  11. Observations at the Mars Pathfinder site: Do they provide "unequivocal" evidence of catastrophic flooding?

    Science.gov (United States)

    Chapman, M.G.; Kargel, J.S.

    1999-01-01

    After Mars Pathfinder landed at the mouth of Ares Vallis, a large channel that drains into the Chryse Planitia basin, the mission reports unanimously supported the interpretation that the lander site is the locus of catastrophic flooding by noting that all aspects of the scene are consistent with this interpretation. However, alternatives cannot be ruled out by any site observations, as all aspects of the scene are equally consistent with other interpretations of origin, namely, ice and mass-flow processes subsequently modified by wind erosion. The authors discuss alternative explanations for the geologic history of the channel based on a regional view of the circum-Chryse channels from Viking images (our best broad-scale information to date) and the local view from the recent Pathfinder landing site. Mega-indicators of channel origin, the regional geomorphology, geology, and planetary climatic conditions, taken together suggest some combination of flood, mass flow, glacial, and eolian processes. The macro-indicators of channel origin (sedimentologic) are also not indicative of one process of emplacement, either as single criteria or taken cumulatively. Finally, the micro-indicators of channel origin (geochemical and mineralogic composition) do not provide very tight constraints on the deposits' possible origins other than that water was in some way involved.

  12. Companied P16 genetic and protein status together providing useful information on the clinical outcome of urinary bladder cancer.

    Science.gov (United States)

    Pu, Xiaohong; Zhu, Liya; Fu, Yao; Fan, Zhiwen; Zheng, Jinyu; Zhang, Biao; Yang, Jun; Guan, Wenyan; Wu, Hongyan; Ye, Qing; Huang, Qing

    2018-04-01

    SPEC P16/CEN3/7/17 Probe fluorescence-in-situ-hybridization (FISH) has become the most sensitive method in indentifying the urothelial tumors and loss of P16 has often been identified in low-grade urothelial lesions; however, little is known about the significations of other P16 genetic status (normal and amplification) in bladder cancer.We detected P16 gene status by FISH in 259 urine samples and divided these samples into 3 groups: 1, normal P16; 2, loss of P16; and 3, amplified P16. Meanwhile, p16 protein expression was measured by immunocytochemistry and we characterized the clinicopathologic features of cases with P16 gene status.Loss of P16 occurred in 26.2%, P16 amplification occurred in 41.3% and P16 gene normal occurred in 32.4% of all cases. P16 genetic status was significantly associated with tumor grade and primary tumor status (P = .008 and .017), but not with pathological tumor stage, overall survival, and p16 protein expression. However, P16 gene amplification accompanied protein high-expression has shorter overall survival compared with the overall patients (P = .023), and P16 gene loss accompanied loss of protein also had the tendency to predict bad prognosis (P = .067).Studies show that the genetic status of P16 has a close relation with the stages of bladder cancer. Loss of P16 is associated with low-grade urothelial malignancy while amplified P16 donotes high-grade. Neither P16 gene status nor p16 protein expression alone is an independent predictor of urothelial bladder carcinoma, but combine gene and protein status together providing useful information on the clinical outcome of these patients.

  13. The use of interest rate swaps by nonprofit organizations: evidence from nonprofit health care providers.

    Science.gov (United States)

    Stewart, Louis J; Trussel, John

    2006-01-01

    Although the use of derivatives, particularly interest rate swaps, has grown explosively over the past decade, derivative financial instrument use by nonprofits has received only limited attention in the research literature. Because little is known about the risk management activities of nonprofits, the impact of these instruments on the ability of nonprofits to raise capital may have significant public policy implications. The primary motivation of this study is to determine the types of derivatives used by nonprofits and estimate the frequency of their use among these organizations. Our study also extends contemporary finance theory by an empirical examination of the motivation for interest rate swap usage among nonprofits. Our empirical data came from 193 large nonprofit health care providers that issued debt to the public between 2000 and 2003. We used a univariate analysis and a multivariate analysis relying on logistic regression models to test alternative explanations of interest rate swaps usage by nonprofits, finding that more than 45 percent of our sample, 88 organizations, used interest rate swaps with an aggregate notional value in excess of $8.3 billion. Our empirical tests indicate the primary motive for nonprofits to use interest rate derivatives is to hedge their exposure to interest rate risk. Although these derivatives are a useful risk management tool, under conditions of falling bond market interest rates these derivatives may also expose a nonprofit swap user to the risk of a material unscheduled termination payment. Finally, we found considerable diversity in the informativeness of footnote disclosure among sample organizations that used interest rate swaps. Many nonprofits did not disclose these risks in their financial statements. In conclusion, we find financial managers in large nonprofits commonly use derivative financial instruments as risk management tools, but the use of interest rate swaps by nonprofits may expose them to other risks

  14. Two randomized trials provide no consistent evidence for nonmusical cognitive benefits of brief preschool music enrichment.

    Directory of Open Access Journals (Sweden)

    Samuel A Mehr

    Full Text Available Young children regularly engage in musical activities, but the effects of early music education on children's cognitive development are unknown. While some studies have found associations between musical training in childhood and later nonmusical cognitive outcomes, few randomized controlled trials (RCTs have been employed to assess causal effects of music lessons on child cognition and no clear pattern of results has emerged. We conducted two RCTs with preschool children investigating the cognitive effects of a brief series of music classes, as compared to a similar but non-musical form of arts instruction (visual arts classes, Experiment 1 or to a no-treatment control (Experiment 2. Consistent with typical preschool arts enrichment programs, parents attended classes with their children, participating in a variety of developmentally appropriate arts activities. After six weeks of class, we assessed children's skills in four distinct cognitive areas in which older arts-trained students have been reported to excel: spatial-navigational reasoning, visual form analysis, numerical discrimination, and receptive vocabulary. We initially found that children from the music class showed greater spatial-navigational ability than did children from the visual arts class, while children from the visual arts class showed greater visual form analysis ability than children from the music class (Experiment 1. However, a partial replication attempt comparing music training to a no-treatment control failed to confirm these findings (Experiment 2, and the combined results of the two experiments were negative: overall, children provided with music classes performed no better than those with visual arts or no classes on any assessment. Our findings underscore the need for replication in RCTs, and suggest caution in interpreting the positive findings from past studies of cognitive effects of music instruction.

  15. Two randomized trials provide no consistent evidence for nonmusical cognitive benefits of brief preschool music enrichment.

    Science.gov (United States)

    Mehr, Samuel A; Schachner, Adena; Katz, Rachel C; Spelke, Elizabeth S

    2013-01-01

    Young children regularly engage in musical activities, but the effects of early music education on children's cognitive development are unknown. While some studies have found associations between musical training in childhood and later nonmusical cognitive outcomes, few randomized controlled trials (RCTs) have been employed to assess causal effects of music lessons on child cognition and no clear pattern of results has emerged. We conducted two RCTs with preschool children investigating the cognitive effects of a brief series of music classes, as compared to a similar but non-musical form of arts instruction (visual arts classes, Experiment 1) or to a no-treatment control (Experiment 2). Consistent with typical preschool arts enrichment programs, parents attended classes with their children, participating in a variety of developmentally appropriate arts activities. After six weeks of class, we assessed children's skills in four distinct cognitive areas in which older arts-trained students have been reported to excel: spatial-navigational reasoning, visual form analysis, numerical discrimination, and receptive vocabulary. We initially found that children from the music class showed greater spatial-navigational ability than did children from the visual arts class, while children from the visual arts class showed greater visual form analysis ability than children from the music class (Experiment 1). However, a partial replication attempt comparing music training to a no-treatment control failed to confirm these findings (Experiment 2), and the combined results of the two experiments were negative: overall, children provided with music classes performed no better than those with visual arts or no classes on any assessment. Our findings underscore the need for replication in RCTs, and suggest caution in interpreting the positive findings from past studies of cognitive effects of music instruction.

  16. Diversity of management strategies in Mesoamerican turkeys: archaeological, isotopic and genetic evidence

    Science.gov (United States)

    Manin, Aurelie; Corona-M, Eduardo; Craig, Abigail; Thornton, Erin Kennedy; Yang, Dongya Y.; Richards, Michael

    2018-01-01

    The turkey (Meleagris gallopavo) represents one of the few domestic animals of the New World. While current research points to distinct domestication centres in the Southwest USA and Mesoamerica, several questions regarding the number of progenitor populations, and the timing and intensity of turkey husbandry remain unanswered. This study applied ancient mitochondrial DNA and stable isotope (δ13C, δ15N) analysis to 55 archaeological turkey remains from Mexico to investigate pre-contact turkey exploitation in Mesoamerica. Three different (sub)species of turkeys were identified in the archaeological record (M. g. mexicana, M. g. gallopavo and M. ocellata), indicating the exploitation of diverse local populations, as well as the trade of captively reared birds into the Maya area. No evidence of shared maternal haplotypes was observed between Mesoamerica and the Southwest USA, in contrast with archaeological evidence for trade of other domestic products. Isotopic analysis indicates a range of feeding behaviours in ancient Mesoamerican turkeys, including wild foraging, human provisioning and mixed feeding ecologies. This variability in turkey diet decreases through time, with archaeological, genetic and isotopic evidence all pointing to the intensification of domestic turkey management and husbandry, culminating in the Postclassic period. PMID:29410864

  17. Diversity of management strategies in Mesoamerican turkeys: archaeological, isotopic and genetic evidence.

    Science.gov (United States)

    Manin, Aurelie; Corona-M, Eduardo; Alexander, Michelle; Craig, Abigail; Thornton, Erin Kennedy; Yang, Dongya Y; Richards, Michael; Speller, Camilla F

    2018-01-01

    The turkey ( Meleagris gallopavo ) represents one of the few domestic animals of the New World. While current research points to distinct domestication centres in the Southwest USA and Mesoamerica, several questions regarding the number of progenitor populations, and the timing and intensity of turkey husbandry remain unanswered. This study applied ancient mitochondrial DNA and stable isotope ( δ 13 C, δ 15 N) analysis to 55 archaeological turkey remains from Mexico to investigate pre-contact turkey exploitation in Mesoamerica. Three different (sub)species of turkeys were identified in the archaeological record ( M. g. mexicana , M. g. gallopavo and M. ocellata ), indicating the exploitation of diverse local populations, as well as the trade of captively reared birds into the Maya area. No evidence of shared maternal haplotypes was observed between Mesoamerica and the Southwest USA, in contrast with archaeological evidence for trade of other domestic products. Isotopic analysis indicates a range of feeding behaviours in ancient Mesoamerican turkeys, including wild foraging, human provisioning and mixed feeding ecologies. This variability in turkey diet decreases through time, with archaeological, genetic and isotopic evidence all pointing to the intensification of domestic turkey management and husbandry, culminating in the Postclassic period.

  18. Genetic Evidence for Elevated Pathogenicity of Mitochondrial DNA Heteroplasmy in Autism Spectrum Disorder.

    Directory of Open Access Journals (Sweden)

    Yiqin Wang

    2016-10-01

    Full Text Available Increasing clinical and biochemical evidence implicate mitochondrial dysfunction in the pathophysiology of Autism Spectrum Disorder (ASD, but little is known about the biological basis for this connection. A possible cause of ASD is the genetic variation in the mitochondrial DNA (mtDNA sequence, which has yet to be thoroughly investigated in large genomic studies of ASD. Here we evaluated mtDNA variation, including the mixture of different mtDNA molecules in the same individual (i.e., heteroplasmy, using whole-exome sequencing data from mother-proband-sibling trios from simplex families (n = 903 where only one child is affected by ASD. We found that heteroplasmic mutations in autistic probands were enriched at non-polymorphic mtDNA sites (P = 0.0015, which were more likely to confer deleterious effects than heteroplasmies at polymorphic mtDNA sites. Accordingly, we observed a ~1.5-fold enrichment of nonsynonymous mutations (P = 0.0028 as well as a ~2.2-fold enrichment of predicted pathogenic mutations (P = 0.0016 in autistic probands compared to their non-autistic siblings. Both nonsynonymous and predicted pathogenic mutations private to probands conferred increased risk of ASD (Odds Ratio, OR[95% CI] = 1.87[1.14-3.11] and 2.55[1.26-5.51], respectively, and their influence on ASD was most pronounced in families with probands showing diminished IQ and/or impaired social behavior compared to their non-autistic siblings. We also showed that the genetic transmission pattern of mtDNA heteroplasmies with high pathogenic potential differed between mother-autistic proband pairs and mother-sibling pairs, implicating developmental and possibly in utero contributions. Taken together, our genetic findings substantiate pathogenic mtDNA mutations as a potential cause for ASD and synergize with recent work calling attention to their unique metabolic phenotypes for diagnosis and treatment of children with ASD.

  19. Molecular genetic evidence for the place of origin of the Pacific rat, Rattus exulans.

    Directory of Open Access Journals (Sweden)

    Vicki Thomson

    Full Text Available Commensal plants and animals have long been used to track human migrations, with Rattus exulans (the Pacific rat a common organism for reconstructing Polynesian dispersal in the Pacific. However, with no knowledge of the homeland of R. exulans, the place of origin of this human-commensal relationship is unknown. We conducted a mitochondrial DNA phylogeographic survey of R. exulans diversity across the potential natural range in mainland and Island Southeast Asia in order to establish the origin of this human-commensal dyad. We also conducted allozyme electrophoresis on samples from ISEA to obtain a perspective on patterns of genetic diversity in this critical region. Finally, we compared molecular genetic evidence with knowledge of prehistoric rodent faunas in mainland and ISEA. We find that ISEA populations of R. exulans contain the highest mtDNA lineage diversity including significant haplotype diversity not represented elsewhere in the species range. Within ISEA, the island of Flores in the Lesser Sunda group contains the highest diversity in ISEA (across all loci and also has a deep fossil record of small mammals that appears to include R. exulans. Therefore, in addition to Flores harboring unusual diversity in the form of Homo floresiensis, dwarfed stegodons and giant rats, this island appears to be the homeland of R. exulans.

  20. Development of E-Info geneca: a website providing computer-tailored information and question prompt prior to breast cancer genetic counseling.

    NARCIS (Netherlands)

    Albada, A.; Dulmen, S. van; Otten, R.; Bensing, J.M.; Ausems, M.G.E.M.

    2009-01-01

    This article describes the stepwise development of the website ‘E-info geneca’. The website provides counselees in breast cancer genetic counseling with computer-tailored information and a question prompt prior to their first consultation. Counselees generally do not know what to expect from genetic

  1. Genetic Evidence Supports the Multiethnic Character of Teopancazco, a Neighborhood Center of Teotihuacan, Mexico (AD 200-600.

    Directory of Open Access Journals (Sweden)

    Brenda A Álvarez-Sandoval

    Full Text Available Multiethnicity in Teopancazco, Teotihuacan, is supported by foreign individuals found in the neighborhood center as well as by the diversity observed in funerary rituals at the site. Studies of both stable and strontium isotopes as well as paleodietary analysis, suggest that the population of Teopancazco was composed by three population groups: people from Teotihuacan, people from nearby sites (Tlaxcala-Hidalgo-Puebla, and people from afar, including the coastal plains. In an attempt to understand the genetic dynamics in Teopancazco we conducted an ancient DNA (aDNA analysis based on mtDNA. Our results show that the level of genetic diversity is consistent with the multiethnicity phenomenon at the neighborhood center. Levels of genetic diversity at different time periods of Teopancazco's history show that multiethnicity was evident since the beginning and lasted until the collapse of the neighborhood center. However, a PCA and a Neighbor-Joining tree suggested the presence of a genetically differentiated group (buried at the Transitional phase compared to the population from the initial phase (Tlamimilolpa as well as the population from the final phase (Xolalpan of the history of Teopancazco. Genetic studies showed no differences in genetic diversity between males and females in the adult population of Teopancazco, this data along with ample archaeological evidence, suggest a neolocal post-marital pattern of residence in Teopancazco. Nevertheless, genetic analyses on the infant population showed that the males are significantly more heterogeneous than the females suggesting a possible differential role in cultural practices by sex in the infant sector. Regarding interpopulation analysis, we found similar indices of genetic diversity between Teopancazco and heterogeneous native groups, which support the multiethnic character of Teopancazco. Finally, our data showed a close genetic relationship between Teopancazco and populations from the

  2. Evidence for an Invasive Aphid “Superclone”: Extremely Low Genetic Diversity in Oleander Aphid (Aphis nerii) Populations in the Southern United States

    Science.gov (United States)

    Harrison, John Scott; Mondor, Edward B.

    2011-01-01

    Background The importance of genetic diversity in successful biological invasions is unclear. In animals, but not necessarily plants, increased genetic diversity is generally associated with successful colonization and establishment of novel habitats. The Oleander aphid, Aphis nerii, though native to the Mediterranean region, is an invasive pest species throughout much of the world. Feeding primarily on Oleander (Nerium oleander) and Milkweed (Asclepias spp.) under natural conditions, these plants are unlikely to support aphid populations year round in the southern US. The objective of this study was to describe the genetic variation within and among US populations of A. nerii, during extinction/recolonization events, to better understand the population ecology of this invasive species. Methodology/Principal Findings We used five microsatellite markers to assess genetic diversity over a two year period within and among three aphid populations separated by small (100 km) and large (3,700 km) geographic distances on two host plant species. Here we provide evidence for A. nerii “superclones”. Genotypic variation was absent in all populations (i.e., each population consisted of a single multilocus genotype (MLG) or “clone”) and the genetic composition of only one population completely changed across years. There was no evidence of sexual reproduction or host races on different plant species. Conclusions/Significance Aphis nerii is a well established invasive species despite having extremely low genetic diversity. As this aphid appears to be obligatorily asexual, it may share more similarities with clonally reproducing invasive plants, than with other animals. Patterns of temporal and geographic genetic variation, viewed in the context of its population dynamics, have important implications for the management of invasive pests and the evolutionary biology of asexual species. PMID:21408073

  3. Evidence for an invasive aphid "superclone": extremely low genetic diversity in Oleander aphid (Aphis nerii populations in the southern United States.

    Directory of Open Access Journals (Sweden)

    John Scott Harrison

    2011-03-01

    Full Text Available The importance of genetic diversity in successful biological invasions is unclear. In animals, but not necessarily plants, increased genetic diversity is generally associated with successful colonization and establishment of novel habitats. The Oleander aphid, Aphis nerii, though native to the Mediterranean region, is an invasive pest species throughout much of the world. Feeding primarily on Oleander (Nerium oleander and Milkweed (Asclepias spp. under natural conditions, these plants are unlikely to support aphid populations year round in the southern US. The objective of this study was to describe the genetic variation within and among US populations of A. nerii, during extinction/recolonization events, to better understand the population ecology of this invasive species.We used five microsatellite markers to assess genetic diversity over a two year period within and among three aphid populations separated by small (100 km and large (3,700 km geographic distances on two host plant species. Here we provide evidence for A. nerii "superclones". Genotypic variation was absent in all populations (i.e., each population consisted of a single multilocus genotype (MLG or "clone" and the genetic composition of only one population completely changed across years. There was no evidence of sexual reproduction or host races on different plant species.Aphis nerii is a well established invasive species despite having extremely low genetic diversity. As this aphid appears to be obligatorily asexual, it may share more similarities with clonally reproducing invasive plants, than with other animals. Patterns of temporal and geographic genetic variation, viewed in the context of its population dynamics, have important implications for the management of invasive pests and the evolutionary biology of asexual species.

  4. Nature, nurture, and capital punishment: How evidence of a genetic-environment interaction, future dangerousness, and deliberation affect sentencing decisions.

    Science.gov (United States)

    Gordon, Natalie; Greene, Edie

    2018-01-01

    Research has shown that the low-activity MAOA genotype in conjunction with a history of childhood maltreatment increases the likelihood of violent behaviors. This genetic-environment (G × E) interaction has been introduced as mitigation during the sentencing phase of capital trials, yet there is scant data on its effectiveness. This study addressed that issue. In a factorial design that varied mitigating evidence offered by the defense [environmental (i.e., childhood maltreatment), genetic, G × E, or none] and the likelihood of the defendant's future dangerousness (low or high), 600 mock jurors read sentencing phase evidence in a capital murder trial, rendered individual verdicts, and half deliberated as members of a jury to decide a sentence of death or life imprisonment. The G × E evidence had little mitigating effect on sentencing preferences: participants who received the G × E evidence were no less likely to sentence the defendant to death than those who received evidence of childhood maltreatment or a control group that received neither genetic nor maltreatment evidence. Participants with evidence of a G × E interaction were more likely to sentence the defendant to death when there was a high risk of future dangerousness than when there was a low risk. Sentencing preferences were more lenient after deliberation than before. We discuss limitations and future directions. Copyright © 2017 John Wiley & Sons, Ltd.

  5. Genetic Evidence for Contrasting Wetland and Savannah Habitat Specializations in Different Populations of Lions (Panthera leo).

    Science.gov (United States)

    Moore, Andy E; Cotterill, Fenton P D Woody; Winterbach, Christiaan W; Winterbach, Hanlie E K; Antunes, Agostinho; O'Brien, Stephen J

    2016-03-01

    South-central Africa is characterized by an archipelago of wetlands, which has evolved in time and space since at least the Miocene, providing refugia for animal species during Pleistocene arid episodes. Their importance for biodiversity in the region is reflected in the evolution of a variety of specialist mammal and bird species, adapted to exploit these wetland habitats. Populations of lions (Panthera leo) across south-central and east Africa have contrasting signatures of mitochondrial DNA haplotypes and biparental nuclear DNA in wetland and savannah habitats, respectively, pointing to the evolution of distinct habitat preferences. This explains the absence of genetic admixture of populations from the Kalahari savannah of southwest Botswana and the Okavango wetland of northern Botswana, despite separation by only 500 km. We postulate that ancestral lions were wetland specialists and that the savannah lions evolved from populations that were isolated during arid Pleistocene episodes. Expansion of grasslands and the resultant increase in herbivore populations during mesic Pleistocene climatic episodes provided the stimulus for the rapid population expansion and diversification of the highly successful savannah lion specialists. Our model has important implications for lion conservation. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Mitochondrial DNA provides evidence of a double origin for the stone crayfish Austropotamobius torrentium in the Elbe basin

    Czech Academy of Sciences Publication Activity Database

    Petrusek, A.; Pešek, P.; Leština, Dan; Martin, P.; Fischer, D.; Kozák, P.; Vlach, P.

    2017-01-01

    Roč. 62, JAN 01 (2017), s. 77-83 ISSN 0075-9511 Institutional support: RVO:60077344 Keywords : stone crayfish * Austropotamobius torrentium * Elbe basin Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 1.427, year: 2016 https://www.sciencedirect.com/science/article/pii/S0075951116300901

  7. Provider-agency fit in substance abuse treatment organizations: implications for learning climate, morale, and evidence-based practice implementation.

    Science.gov (United States)

    Ramsey, Alex T; van den Berk-Clark, Carissa

    2015-05-12

    Substance abuse agencies have been slow to adopt and implement evidence-based practices (EBPs), due in part to poor provider morale and organizational climates that are not conducive to successful learning and integration of these practices. Person-organization fit theory suggests that alignment, or fit, between provider- and agency-level characteristics regarding the implementation of EBPs may influence provider morale and organizational learning climate and, thus, implementation success. The current study hypothesized that discrepancies, or lack of fit, between provider- and agency-level contextual factors would negatively predict provider morale and organizational learning climate, outcomes shown to be associated with successful EBP implementation. Direct service providers (n = 120) from four substance abuse treatment agencies responded to a survey involving provider morale, organizational learning climate, agency expectations for EBP use, agency resources for EBP use, and provider attitudes towards EBP use. Difference scores between combinations of provider- and agency-level factors were computed to model provider-agency fit. Quadratic regression analyses were conducted to more adequately and comprehensively model the level of the dependent variables across the entire "fit continuum". Discrepancies, or misfit, between agency expectations and provider attitudes and between agency resources and provider attitudes were associated with poorer provider morale and weaker organizational learning climate. For all hypotheses, the curvilinear model of provider-agency discrepancies significantly predicted provider morale and organizational learning climate, indicating that both directions of misfit (provider factors more favorable than agency factors, and vice-versa) were detrimental to morale and climate. However, outcomes were most negative when providers viewed EBPs favorably, but perceived that agency expectations and resources were less supportive of EBP use. The

  8. Placoderm Assemblage from the Tetrapod-Bearing Locality of Strud (Belgium, Upper Famennian) Provides Evidence for a Fish Nursery

    Science.gov (United States)

    Clément, Gaël; Daeschler, Edward B.; Dupret, Vincent

    2016-01-01

    The placoderm fauna of the upper Famennian tetrapod-bearing locality of Strud, Belgium, includes the antiarch Grossilepis rikiki, the arthrodire groenlandaspidid Turrisaspis strudensis and the phyllolepidid Phyllolepis undulata. Based on morphological and morphometric evidence, the placoderm specimens from Strud are predominantly recognised as immature specimens and this locality as representing a placoderm nursery. The Strud depositional environment corresponds to a channel in an alluvial plain, and the presence of a nursery in such environment could have provided nutrients and protection to the placoderm offspring. This represents one of the earliest pieces of evidence for this sort of habitat partitioning in vertebrate history, with adults living more distantly from the nursery and using the nursery only to spawn or give live birth. PMID:27552196

  9. Genetic evidence of paleolithic colonization and neolithic expansion of modern humans on the tibetan plateau.

    Science.gov (United States)

    Qi, Xuebin; Cui, Chaoying; Peng, Yi; Zhang, Xiaoming; Yang, Zhaohui; Zhong, Hua; Zhang, Hui; Xiang, Kun; Cao, Xiangyu; Wang, Yi; Ouzhuluobu; Basang; Ciwangsangbu; Bianba; Gonggalanzi; Wu, Tianyi; Chen, Hua; Shi, Hong; Su, Bing

    2013-08-01

    Tibetans live on the highest plateau in the world, their current population size is approximately 5 million, and most of them live at an altitude exceeding 3,500 m. Therefore, the Tibetan Plateau is a remarkable area for cultural and biological studies of human population history. However, the chronological profile of the Tibetan Plateau's colonization remains an unsolved question of human prehistory. To reconstruct the prehistoric colonization and demographic history of modern humans on the Tibetan Plateau, we systematically sampled 6,109 Tibetan individuals from 41 geographic populations across the entire region of the Tibetan Plateau and analyzed the phylogeographic patterns of both paternal (n = 2,354) and maternal (n = 6,109) lineages as well as genome-wide single nucleotide polymorphism markers (n = 50) in Tibetan populations. We found that there have been two distinct, major prehistoric migrations of modern humans into the Tibetan Plateau. The first migration was marked by ancient Tibetan genetic signatures dated to approximately 30,000 years ago, indicating that the initial peopling of the Tibetan Plateau by modern humans occurred during the Upper Paleolithic rather than Neolithic. We also found evidences for relatively young (only 7-10 thousand years old) shared Y chromosome and mitochondrial DNA haplotypes between Tibetans and Han Chinese, suggesting a second wave of migration during the early Neolithic. Collectively, the genetic data indicate that Tibetans have been adapted to a high altitude environment since initial colonization of the Tibetan Plateau in the early Upper Paleolithic, before the last glacial maximum, followed by a rapid population expansion that coincided with the establishment of farming and yak pastoralism on the Plateau in the early Neolithic.

  10. Strong Genetic Differentiation of Submerged Plant Populations across Mountain Ranges: Evidence from Potamogeton pectinatus in Iran.

    Science.gov (United States)

    Abbasi, Shabnam; Afsharzadeh, Saeed; Saeidi, Hojjatollah; Triest, Ludwig

    2016-01-01

    Biogeographic barriers for freshwater biota can be effective at various spatial scales. At the largest spatial scale, freshwater organisms can become genetically isolated by their high mountain ranges, vast deserts, and inability to cross oceans. Isolation by distance of aquatic plants is expected to be stronger across than alongside mountain ridges whereas the heterogeneity of habitats among populations and temporary droughts may influence connectivity and hamper dispersal. Suitable aquatic plant habitats became reduced, even for the widespread submerged Potamogeton pectinatus L. (also named Stuckenia pectinata) giving structure to various aquatic habitats. We compared the level of genetic diversity in a heterogeneous series of aquatic habitats across Iran and tested their differentiation over distances and across mountain ranges (Alborz and Zagros) and desert zones (Kavir), with values obtained from temperate region populations. The diversity of aquatic ecosystems across and along large geographic barriers provided a unique ecological situation within Iran. P. pectinatus were considered from thirty-six sites across Iran at direct flight distances ranging from 20 to 1,200 km. Nine microsatellite loci revealed a very high number of alleles over all sites. A PCoA, NJT clustering and STRUCTURE analysis revealed a separate grouping of individuals of southeastern Iranian sites and was confirmed by their different nuclear ITS and cpDNA haplotypes thereby indicating an evolutionary significant unit (ESU). At the level of populations, a positive correlation between allelic differentiation Dest with geographic distance was found. Individual-based STRUCTURE analysis over 36 sites showed 7 genetic clusters. FST and RST values for ten populations reached 0.343 and 0.521, respectively thereby indicating that allele length differences are more important and contain evolutionary information. Overall, higher levels of diversity and a stronger differentiation was revealed among

  11. Seasonality shows evidence for polygenic architecture and genetic correlation with schizophrenia and bipolar disorder – a meta-analysis of genetic studies

    Science.gov (United States)

    Byrne, Enda M; Raheja, Uttam; Stephens, Sarah H.; Heath, Andrew C; Madden, Pamela AF; Vaswani, Dipika; Nijjar, Gagan V.; Ryan, Kathleen A.; Youssufi, Hassaan; Gehrman, Philip R; Shuldiner, Alan R; Martin, Nicholas G; Montgomery, Grant W; Wray, Naomi R; Nelson, Elliot C; Mitchell, Braxton D; Postolache, Teodor T

    2015-01-01

    Objective To test common genetic variants for association with seasonality (seasonal changes in mood and behavior) and to investigate whether there are shared genetic risk factors between psychiatric disorders and seasonality. Methods A meta-analysis of genome-wide association studies (GWAS) conducted in Australian and Amish populations in whom the Seasonal Pattern Assessment Questionnaire (SPAQ) had been administered. The total sample size was 4,156 individuals. Genetic risk scores based on results from prior large GWAS studies of bipolar disorder (BD), major depressive disorder (MDD), and schizophrenia (SCZ) were calculated to test for overlap in risk between psychiatric disorders and seasonality. Results The most significant association was with rs11825064 (p = 1.7 × 10−6, β = 0.64, S.E = 0.13), an intergenic SNP found on chromosome 11. The evidence for overlap in risk factors was strongest for SCZ and seasonality, with the SCZ genetic profile scores explaining 3% of the variance in log-transformed GSS. BD genetic profile scores were also significantly associated with seasonality, although at much weaker levels, and no evidence for overlap in risk was detected between MDD and seasonality. Conclusions Common SNPs of very large effect likely do not exist for seasonality in the populations examined. As expected, there was overlapping genetic risk factors for BD (but not MDD) with seasonality. Unexpectedly, the risk for SCZ and seasonality had the largest overlap, an unprecedented finding that requires replication in other populations, and has potential clinical implications considering overlapping cognitive deficits in seasonal affective disorders and SCZ PMID:25562672

  12. Group A Rotaviruses in Chinese Bats: Genetic Composition, Serology, and Evidence for Bat-to-Human Transmission and Reassortment.

    Science.gov (United States)

    He, Biao; Huang, Xiaohong; Zhang, Fuqiang; Tan, Weilong; Matthijnssens, Jelle; Qin, Shaomin; Xu, Lin; Zhao, Zihan; Yang, Ling'en; Wang, Quanxi; Hu, Tingsong; Bao, Xiaolei; Wu, Jianmin; Tu, Changchun

    2017-06-15

    Bats are natural reservoirs for many pathogenic viruses, and increasing evidence supports the notion that bats can also harbor group A rotaviruses (RVAs), important causative agents of diarrhea in children and young animals. Currently, 8 RVA strains possessing completely novel genotype constellations or genotypes possibly originating from other mammals have been identified from African and Chinese bats. However, all the data were mainly based on detection of RVA RNA, present only during acute infections, which does not permit assessment of the true exposure of a bat population to RVA. To systematically investigate the genetic diversity of RVAs, 547 bat anal swabs or gut samples along with 448 bat sera were collected from five South Chinese provinces. Specific reverse transcription-PCR (RT-PCR) screening found four RVA strains. Strain GLRL1 possessed a completely novel genotype constellation, whereas the other three possessed a constellation consistent with the MSLH14-like genotype, a newly characterized group of viruses widely prevalent in Chinese insectivorous bats. Among the latter, strain LZHP2 provided strong evidence of cross-species transmission of RVAs from bats to humans, whereas strains YSSK5 and BSTM70 were likely reassortants between typical MSLH14-like RVAs and human RVAs. RVA-specific antibodies were detected in 10.7% (48/448) of bat sera by an indirect immunofluorescence assay (IIFA). Bats in Guangxi and Yunnan had a higher RVA-specific antibody prevalence than those from Fujian and Zhejiang provinces. These observations provide evidence for cross-species transmission of MSLH14-like bat RVAs to humans, highlighting the impact of bats as reservoirs of RVAs on public health. IMPORTANCE Bat viruses, such as severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS), Ebola, Hendra, and Nipah viruses, are important pathogens causing outbreaks of severe emerging infectious diseases. However, little is known about bat viruses capable

  13. Spread of butternut canker in North America, host range, evidence of resistance within butternut populations and conservation genetics

    Science.gov (United States)

    M. E. Ostry; K. Woeste

    2004-01-01

    Butternut canker is killing trees throughout the range of butternut in North America and is threatening the viability of many populations in several areas. Although butternut is the primary host, other Juglans species and some hardwood species also are potential hosts. Evidence is building that genetic resistance within butternut populations may be...

  14. A Rickettsia Genome Overrun by Mobile Genetic Elements Provides Insight into the Acquisition of Genes Characteristic of an Obligate Intracellular Lifestyle

    Science.gov (United States)

    Joardar, Vinita; Williams, Kelly P.; Driscoll, Timothy; Hostetler, Jessica B.; Nordberg, Eric; Shukla, Maulik; Walenz, Brian; Hill, Catherine A.; Nene, Vishvanath M.; Azad, Abdu F.; Sobral, Bruno W.; Caler, Elisabet

    2012-01-01

    We present the draft genome for the Rickettsia endosymbiont of Ixodes scapularis (REIS), a symbiont of the deer tick vector of Lyme disease in North America. Among Rickettsia species (Alphaproteobacteria: Rickettsiales), REIS has the largest genome sequenced to date (>2 Mb) and contains 2,309 genes across the chromosome and four plasmids (pREIS1 to pREIS4). The most remarkable finding within the REIS genome is the extraordinary proliferation of mobile genetic elements (MGEs), which contributes to a limited synteny with other Rickettsia genomes. In particular, an integrative conjugative element named RAGE (for Rickettsiales amplified genetic element), previously identified in scrub typhus rickettsiae (Orientia tsutsugamushi) genomes, is present on both the REIS chromosome and plasmids. Unlike the pseudogene-laden RAGEs of O. tsutsugamushi, REIS encodes nine conserved RAGEs that include F-like type IV secretion systems similar to that of the tra genes encoded in the Rickettsia bellii and R. massiliae genomes. An unparalleled abundance of encoded transposases (>650) relative to genome size, together with the RAGEs and other MGEs, comprise ∼35% of the total genome, making REIS one of the most plastic and repetitive bacterial genomes sequenced to date. We present evidence that conserved rickettsial genes associated with an intracellular lifestyle were acquired via MGEs, especially the RAGE, through a continuum of genomic invasions. Robust phylogeny estimation suggests REIS is ancestral to the virulent spotted fever group of rickettsiae. As REIS is not known to invade vertebrate cells and has no known pathogenic effects on I. scapularis, its genome sequence provides insight on the origin of mechanisms of rickettsial pathogenicity. PMID:22056929

  15. A genetic basis for infectious mononucleosis: evidence from a family study of hospitalized cases in Denmark.

    Science.gov (United States)

    Rostgaard, Klaus; Wohlfahrt, Jan; Hjalgrim, Henrik

    2014-06-01

    Circumstantial evidence from genome-wide association and family studies of various Epstein-Barr virus-associated diseases suggests a substantial genetic component in infectious mononucleosis (IM) etiology. However, familial aggregation of IM has scarcely been studied. We used data from the Danish Civil Registration System and the Danish National Hospital Discharge Register to study rate ratios of IM in a cohort of 2 823 583 Danish children born between 1971 and 2011. Specifically, we investigated the risk of IM in twins and in first-, second-, and third-degree relatives of patients with IM. In the analyses, IM was defined as a diagnosis of IM in a hospital contact. Effects of contagion between family members were dealt with by excluding follow-up time the first year after the occurrence of IM in a relative. A total of 16 870 cases of IM were observed during 40.4 million person-years of follow-up from 1977 to 2011. The rate ratios and the associated 95% confidence intervals were 9.3 (3.0-29) in same-sex twins, 3.0 (2.6-3.5) in siblings, 1.9 (1.6-2.2) in children, 1.4 (1.3-1.6) in second-degree relatives, and 1.0 (0.9-1.2) in third-degree relatives of IM patients. The rate ratios were very similar for IM in children (aged 0-6 years) and older children/adolescents (aged 7-19 years). We found evidence of familial aggregation of IM that warrants genome-wide association studies on IM disease etiology, especially to examine commonalities with causal pathways in other Epstein-Barr virus-related diseases. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  16. Social stratification in the Sikh population of Punjab (India) has a genetic basis: evidence from serological and biochemical markers.

    Science.gov (United States)

    Chahal, Sukh Mohinder Singh; Virk, Rupinder Kaur; Kaur, Sukhvir; Bansal, Rupinder

    2011-01-01

    The present study was planned to assess whether social stratification in the Sikh population inhabiting the northwest border Indian state of Punjab has any genetic basis. Blood samples were collected randomly from a total of 2851 unrelated subjects belonging to 21 groups of two low-ranking Sikh scheduled caste populations, viz. Mazhabi and Ramdasi, and a high-ranking Jat Sikh caste population of Punjab. The genetic profile of Sikh groups was investigated using a total of nine serobiochemical genetic markers, comprising two blood groups (ABO, RH(D)) and a battery of seven red cell enzyme polymorphisms (ADA, AK1, ESD, PGM1, GLO1, ACP1, GPI), following standard serological and biochemical laboratory protocols. Genetic structure was studied using original allele frequency data and statistical measures of heterozygosity, genic differentiation, genetic distance, and genetic admixture. Great heterogeneity was observed between Sikh scheduled caste and Jat Sikh populations, especially in the RH(D) blood group system, and distribution of ESD, ACP1, and PGM1 enzyme markers was also found to be significantly different between many of their groups. Genetic distance trees demonstrated little or no genetic affinities between Sikh scheduled caste and Jat Sikh populations; the Mazhabi and Ramdasi also showed little genetic relationship. Genetic admixture analysis suggested a higher element of autochthonous tribal extraction in the Ramdasi. The present study revealed much genetic heterogeneity in differently ranking Sikh caste populations of Punjab, mainly attributable to their different ethnic backgrounds, and provided a genetic basis to social stratification present in this religious community of Punjab, India.

  17. A Chromosome-Scale Assembly of the Bactrocera cucurbitae Genome Provides Insight to the Genetic Basis of white pupae

    Directory of Open Access Journals (Sweden)

    Sheina B. Sim

    2017-06-01

    Full Text Available Genetic sexing strains (GSS used in sterile insect technique (SIT programs are textbook examples of how classical Mendelian genetics can be directly implemented in the management of agricultural insect pests. Although the foundation of traditionally developed GSS are single locus, autosomal recessive traits, their genetic basis are largely unknown. With the advent of modern genomic techniques, the genetic basis of sexing traits in GSS can now be further investigated. This study is the first of its kind to integrate traditional genetic techniques with emerging genomics to characterize a GSS using the tephritid fruit fly pest Bactrocera cucurbitae as a model. These techniques include whole-genome sequencing, the development of a mapping population and linkage map, and quantitative trait analysis. The experiment designed to map the genetic sexing trait in B. cucurbitae, white pupae (wp, also enabled the generation of a chromosome-scale genome assembly by integrating the linkage map with the assembly. Quantitative trait loci analysis revealed SNP loci near position 42 MB on chromosome 3 to be tightly linked to wp. Gene annotation and synteny analysis show a near perfect relationship between chromosomes in B. cucurbitae and Muller elements A–E in Drosophila melanogaster. This chromosome-scale genome assembly is complete, has high contiguity, was generated using a minimal input DNA, and will be used to further characterize the genetic mechanisms underlying wp. Knowledge of the genetic basis of genetic sexing traits can be used to improve SIT in this species and expand it to other economically important Diptera.

  18. Evidence of genetic differentiation and karyotype evolution of the sedges Cyperus ligularis L. and C. odoratus L. (Cyperaceae

    Directory of Open Access Journals (Sweden)

    Geyner Alves dos Santos Cruz

    2018-01-01

    Full Text Available ABSTRACT The taxonomy of Cyperaceae is complex, with genera like Cyperus harboring species complexes. We analyzed the genetic similarity between Cyperus ligularis L. and C. odoratus L. based on DNA fingerprinting and cytogenetics. Significative genetic differentiation (G ST = 0.363 and low gene flow (N m = 0.877 indicated a clear genetic distinction between the two species. Moreover, the clustering analysis showed two distinct genetic groups, suggesting a lack of evidence for hybridization. The phenogram revealed two different lineages, and although all individuals of C. odoratus were collected from plots close to each other, they possessed greater genetic diversity than that observed among individuals of C. ligularis, which were sampled over a wider geographic range. Variation in chromosome number within the two species exhibited the opposite pattern, indicating greater karyotype stability in C. odoratus with 2n = 72 and 2n = 76, while the diploid number for C. ligularis varied from 2n = 66 to 88. The lower genetic variation in C. ligularis may be a result of the founder effect associated with seed dispersion and clonal reproduction. Field observations and analysis of reproductive biology should enrich the understanding of the genetic structure of the investigated populations and their role in successional processes.

  19. Genetic variability, local selection and demographic history: genomic evidence of evolving towards allopatric speciation in Asian seabass.

    Science.gov (United States)

    Wang, Le; Wan, Zi Yi; Lim, Huan Sein; Yue, Gen Hua

    2016-08-01

    Genomewide analysis of genetic divergence is critically important in understanding the genetic processes of allopatric speciation. We sequenced RAD tags of 131 Asian seabass individuals of six populations from South-East Asia and Australia/Papua New Guinea. Using 32 433 SNPs, we examined the genetic diversity and patterns of population differentiation across all the populations. We found significant evidence of genetic heterogeneity between South-East Asian and Australian/Papua New Guinean populations. The Australian/Papua New Guinean populations showed a rather lower level of genetic diversity. FST and principal components analysis revealed striking divergence between South-East Asian and Australian/Papua New Guinean populations. Interestingly, no evidence of contemporary gene flow was observed. The demographic history was further tested based on the folded joint site frequency spectrum. The scenario of ancient migration with historical population size changes was suggested to be the best fit model to explain the genetic divergence of Asian seabass between South-East Asia and Australia/Papua New Guinea. This scenario also revealed that Australian/Papua New Guinean populations were founded by ancestors from South-East Asia during mid-Pleistocene and were completely isolated from the ancestral population after the last glacial retreat. We also detected footprints of local selection, which might be related to differential ecological adaptation. The ancient gene flow was examined and deemed likely insufficient to counteract the genetic differentiation caused by genetic drift. The observed genomic pattern of divergence conflicted with the 'genomic islands' scenario. Altogether, Asian seabass have likely been evolving towards allopatric speciation since the split from the ancestral population during mid-Pleistocene. © 2016 John Wiley & Sons Ltd.

  20. Provider report of the existence of detection and care of perinatal depression: quantitative evidence from public obstetric units in Mexico

    Directory of Open Access Journals (Sweden)

    Filipa de Castro

    2016-07-01

    Full Text Available Objective. To provide evidence on perinatal mental healthcare in Mexico. Materials and methods. Descriptive and bivariate analyses of data from a cross-sectional probabilistic survey of 211 public obstetric units. Results. Over half (64.0% of units offer mental healthcare; fewer offer perinatal depression (PND detection (37.1% and care (40.3%. More units had protocols/guidelines for PND detection and for care, respectively, in Mexico City-Mexico state (76.7%; 78.1% than in Southern (26.5%; 36.4%, Northern (27.3%; 28.1% and Central Mexico (50.0%; 52.7%. Conclusion. Protocols and provider training in PND, implementation of brief screening tools and psychosocial interventions delivered by non-clinical personnel are needed.      DOI: http://dx.doi.org/10.21149/spm.v58i4.8028

  1. Provider report of the existence of detection and care of perinatal depression: quantitative evidence from public obstetric units in Mexico.

    Science.gov (United States)

    Castro, Filipa de; Place, Jean Marie; Allen-Leigh, Betania; Rivera-Rivera, Leonor; Billings, Deborah

    2016-08-01

    To provide evidence on perinatal mental healthcare in Mexico. Descriptive and bivariate analyses of data from a cross-sectional probabilistic survey of 211 public obstetric units. Over half (64.0%) of units offer mental healthcare; fewer offer perinatal depression (PND) detection (37.1%) and care (40.3%). More units had protocols/guidelines for PND detection and for care, respectively, in Mexico City-Mexico state (76.7%; 78.1%) than in Southern (26.5%; 36.4%), Northern (27.3%; 28.1%) and Central Mexico (50.0%; 52.7%). Protocols and provider training in PND, implementation of brief screening tools and psychosocial interventions delivered by non-clinical personnel are needed.

  2. Genetic and phenotypic evidence of the Salmonella enterica serotype Enteritidis human-animal interface in Chile

    Directory of Open Access Journals (Sweden)

    Patricio eRetamal

    2015-05-01

    Full Text Available Salmonella enterica serotype Enteritidis is a worldwide zoonotic agent that has been recognized as a very important food-borne bacterial pathogen, mainly associated with consumption of poultry products. The aim of this work was to determine genotypic and phenotypic evidence of S. Enteritidis transmission among seabirds, poultry and humans in Chile. Genotyping was performed using PCR-based virulotyping, pulse-field gel electrophoresis (PFGE and multi-locus sequence typing (MLST. Pathogenicity-associated phenotypes were determined with survival to free radicals, acidic pH, starvation, antimicrobial resistance, and survival within human dendritic cells. As result of PCR and PFGE assays, some isolates from the three hosts showed identical genotypic patterns, and through MLST it was determined that all of them belong to sequence type 11. Results of phenotypic assays showed diversity of survival capabilities among isolates. When results were analyzed according to bacterial host, statistical differences were identified in starvation and dendritic cells survival assays. In addition, isolates from seabirds showed the highest rates of resistance to gentamycin, tetracycline and ampicillin. Overall, the very close genetic and phenotypic traits shown by isolates from humans, poultry and seabirds suggest the inter-species transmission of S. Enteritidis bacteria between hosts, likely through anthropogenic environmental contamination that determines infection of seabirds with bacteria that are potentially pathogenic for other susceptible organism, including humans.

  3. Dengue viruses in Papua New Guinea: evidence of endemicity and phylogenetic variation, including the evolution of new genetic lineages.

    Science.gov (United States)

    Moore, Peter R; van den Hurk, Andrew F; Mackenzie, John S; Pyke, Alyssa T

    2017-12-20

    Dengue is the most common cause of mosquito-borne viral disease in humans, and is endemic in more than 100 tropical and subtropical countries. Periodic outbreaks of dengue have been reported in Papua New Guinea (PNG), but there is only limited knowledge of its endemicity and disease burden. To help elucidate the status of the dengue viruses (DENVs) in PNG, we performed envelope (E) gene sequencing of DENV serotypes 1-4 (DENV 1-4) obtained from infected patients who traveled to Australia or from patients diagnosed during local DENV transmission events between 2001 and 2016. Phylogenetic analysis and comparison with globally available DENV sequences revealed new endemic PNG lineages for DENV 1-3 which have emerged within the last decade. We also identified another possible PNG lineage for DENV-4 from 2016. The DENV-1 and 3 PNG lineages were most closely related to recent lineages circulating on Pacific island nations while the DENV-2 lineage and putative DENV-4 PNG lineage were most similar to Indonesian sequences. This study has demonstrated for the first time the co-circulation of DENV 1-4 strains in PNG and provided molecular evidence of endemic DENV transmission. Our results provide an important platform for improved surveillance and monitoring of DENVs in PNG and broaden the global understanding of DENV genetic diversity.

  4. The Leadville Mine Drainage Tunnel Catastrophe: A Case Study of How Isotope Geochemistry Provided Forensic Evidence to Inform Policy Decisions

    Science.gov (United States)

    Williams, M. W.; Wireman, M.; Liu, F.; Gertson, J.

    2008-12-01

    A state of emergency was declared in February 2008 because of fears that a blocked drainage tunnel in the Leadville mining district of Colorado could cause a catastrophic flood. An estimated 1 billion gallons of metals-laden water poses an eminent threat to the city of Leadville and the headwaters of the Arkansas river. Within days of the declaration of a state of emergency, Governor Ritter and Senator Salazer of Colorado, along with a host of other local and statewide politicians, visited the site and emphasized the need to develop a fast yet safe mitigation plan. Here we provide information from a case study that illustrates how a suite of isotopic and hydrologic tools enables identification of critical, site-specific variables essential in developing a science plan to guide targeted remediation of the Leadville drainage tunnel. The isotopic tools, including both stable and radiogenic isotopes, provided clear and compelling evidence of water sources and flowpaths in an area that has undergone extensive perturbations, including the drilling of more than 2,000 mine shafts. This forensic evidence was the key information in developing a plan to plug the drainage tunnel several hundred feet underground, divert a major source of polluted water from reaching the collapsed tunnel and piping it to an existing treatment plant, and guidance on where to place pumps in additional mine shafts, and the drilling of new wells to pump water in case the plugging of the tunnel caused water to pool up and raise the water table to dangerous heights. This particular case of forensic hydrology using isotopic tools not only provides the scientific basis for an operational plan to defuse a life- and property-threatening situation, it also provides the basis for decommissioning an existing water treatment plant, which will result in savings of over 1 million annually in operational costs. Decommissioning the existing water treatment plant will pay for the tunnel mitigation within several

  5. Reconstruction of the feeding apparatus in Postgaardi mariagerensis provides evidence for character evolution within the Symbiontida (Euglenozoa).

    Science.gov (United States)

    Yubuki, Naoji; Simpson, Alastair G B; Leander, Brian S

    2013-01-01

    Microbial eukaryotes living in low oxygen environments often have novel physiological and morphological features that facilitate symbiotic relationships with bacteria and other means for acquiring nutrients. Comparative studies of these features provide evidence for phylogenetic relationships and evolutionary history. Postgaardi mariagerensis, for instance, is a euglenozoan that lives in low oxygen environments and is enveloped by episymbiotic bacteria. The general ultrastructure of P. mariagerensis was described more than a decade ago and no further studies have been carried out since, mainly because these cells are difficult to obtain. Postgaardi lacks the diagnostic features found in other major euglenozoan lineages (e.g., pellicle strips and kinetoplast-like mitochondrial inclusions) and no molecular data are available, so the phylogenetic position of this genus within the Euglenozoa remains unclear. We re-examined and reconstructed the ultrastructural organization of the feeding apparatus in Postgaardi by serial sectioning an existing block of resin-embedded cells. Postgaardi possesses distinctive finger-like projections within the feeding apparatus; this system has only been found in one other highly distinctive flagellate, namely the symbiontid Calkinsia. Detailed comparisons of the cytoskeleton in Postgaardi and in two symbiontids, Calkinsia and Bihospites, provided new evidence for phylogenetic relationships and character evolution in all three genera. Copyright © 2012 Elsevier GmbH. All rights reserved.

  6. Large-scale association analysis provides insights into the genetic architecture and pathophysiology of type 2 diabetes

    DEFF Research Database (Denmark)

    Morris, Andrew P; Voight, Benjamin F; Teslovich, Tanya M

    2012-01-01

    To extend understanding of the genetic architecture and molecular basis of type 2 diabetes (T2D), we conducted a meta-analysis of genetic variants on the Metabochip, including 34,840 cases and 114,981 controls, overwhelmingly of European descent. We identified ten previously unreported T2D...... processes, including CREBBP-related transcription, adipocytokine signaling and cell cycle regulation, in diabetes pathogenesis....

  7. Pleistocene glacial refugia across the Appalachian Mountains and coastal plain in the millipede genus Narceus: Evidence from population genetic, phylogeographic, and paleoclimatic data

    Science.gov (United States)

    Walker, Matt J; Stockman, Amy K; Marek, Paul E; Bond, Jason E

    2009-01-01

    Background Species that are widespread throughout historically glaciated and currently non-glaciated areas provide excellent opportunities to investigate the role of Pleistocene climatic change on the distribution of North American biodiversity. Many studies indicate that northern animal populations exhibit low levels of genetic diversity over geographically widespread areas whereas southern populations exhibit relatively high levels. Recently, paleoclimatic data have been combined with niche-based distribution modeling to locate possible refugia during the Last Glacial Maximum. Using phylogeographic, population, and paleoclimatic data, we show that the distribution and mitochondrial data for the millipede genus Narceus are consistent with classical examples of Pleistocene refugia and subsequent post-glacial population expansion seen in other organismal groups. Results The phylogeographic structure of Narceus reveals a complex evolutionary history with signatures of multiple refugia in southeastern North America followed by two major northern expansions. Evidence for refugial populations were found in the southern Appalachian Mountains and in the coastal plain. The northern expansions appear to have radiated from two separate refugia, one from the Gulf Coastal Plain area and the other from the mid-Atlantic coastal region. Distributional models of Narceus during the Last Glacial Maximum show a dramatic reduction from the current distribution, with suitable ecological zones concentrated along the Gulf and Atlantic coastal plain. We found a strong correlation between these zones of ecological suitability inferred from our paleo-model with levels of genetic diversity derived from phylogenetic and population estimates of genetic structuring. Conclusion The signature of climatic change, during and after the Pleistocene, on the distribution of the millipede genus Narceus is evident in the genetic data presented. Niche-based historical distribution modeling strengthens the

  8. Application of plant DNA markers in forensic botany: genetic comparison of Quercus evidence leaves to crime scene trees using microsatellites.

    Science.gov (United States)

    Craft, Kathleen J; Owens, Jeffrey D; Ashley, Mary V

    2007-01-05

    As highly polymorphic DNA markers become increasingly available for a wide range of plant and animal species, there will be increasing opportunities for applications to forensic investigations. To date, however, relatively few studies have reported using DNA profiles of non-human species to place suspects at or near crime scenes. Here we describe an investigation of a double homicide of a female and her near-term fetus. Leaf material taken from a suspect's vehicle was identified to be that of sand live oak, Quercus geminata, the same tree species that occurred near a shallow grave where the victims were found. Quercus-specific DNA microsatellites were used to genotype both dried and fresh material from trees located near the burial site and from the material taken from the suspect's car. Samples from the local population of Q. geminata were also collected and genotyped in order to demonstrate that genetic variation at four microsatellite loci was sufficient to assign leaves to an individual tree with high statistical certainty. The cumulative average probability of identity for these four loci was 2.06x10(-6). DNA was successfully obtained from the dried leaf material although PCR amplification was more difficult than amplification of DNA from fresh leaves. The DNA profiles of the dried leaves from the suspect's car did not match those of the trees near the crime scene. Although this investigation did not provide evidence that could be used against the suspect, it does demonstrate the potential for plant microsatellite markers providing physical evidence that links plant materials to live plants at or near crime scenes.

  9. Genetic Diversity and Demographic History of Wild and Cultivated/Naturalised Plant Populations: Evidence from Dalmatian Sage (Salvia officinalis L., Lamiaceae)

    Science.gov (United States)

    Rešetnik, Ivana; Baričevič, Dea; Batîr Rusu, Diana; Carović-Stanko, Klaudija; Chatzopoulou, Paschalina; Dajić-Stevanović, Zora; Gonceariuc, Maria; Grdiša, Martina; Greguraš, Danijela; Ibraliu, Alban; Jug-Dujaković, Marija; Krasniqi, Elez; Liber, Zlatko; Murtić, Senad; Pećanac, Dragana; Radosavljević, Ivan; Stefkov, Gjoshe; Stešević, Danijela; Šoštarić, Ivan; Šatović, Zlatko

    2016-01-01

    Dalmatian sage (Salvia officinalis L., Lamiaceae) is a well-known aromatic and medicinal Mediterranean plant that is native in coastal regions of the western Balkan and southern Apennine Peninsulas and is commonly cultivated worldwide. It is widely used in the food, pharmaceutical and cosmetic industries. Knowledge of its genetic diversity and spatiotemporal patterns is important for plant breeding programmes and conservation. We used eight microsatellite markers to investigate evolutionary history of indigenous populations as well as genetic diversity and structure within and among indigenous and cultivated/naturalised populations distributed across the Balkan Peninsula. The results showed a clear separation between the indigenous and cultivated/naturalised groups, with the cultivated material originating from one restricted geographical area. Most of the genetic diversity in both groups was attributable to differences among individuals within populations, although spatial genetic analysis of indigenous populations indicated the existence of isolation by distance. Geographical structuring of indigenous populations was found using clustering analysis, with three sub-clusters of indigenous populations. The highest level of gene diversity and the greatest number of private alleles were found in the central part of the eastern Adriatic coast, while decreases in gene diversity and number of private alleles were evident towards the northwestern Adriatic coast and southern and eastern regions of the Balkan Peninsula. The results of Ecological Niche Modelling during Last Glacial Maximum and Approximate Bayesian Computation suggested two plausible evolutionary trajectories: 1) the species survived in the glacial refugium in southern Adriatic coastal region with subsequent colonization events towards northern, eastern and southern Balkan Peninsula; 2) species survived in several refugia exhibiting concurrent divergence into three genetic groups. The insight into genetic

  10. Mutational analyses of molecularly cloned satellite tobacco mosaic virus during serial passage in plants: Evidence for hotspots of genetic change

    Science.gov (United States)

    Kurath, G.; Dodds, J.A.

    1995-01-01

    The high level of genetic diversity and rapid evolution of viral RNA genomes are well documented, but few studies have characterized the rate and nature of ongoing genetic change over time under controlled experimental conditions, especially in plant hosts. The RNA genome of satellite tobacco mosaic virus (STMV) was used as an effective model for such studies because of advantageous features of its genome structure and because the extant genetic heterogeneity of STMV has been characterized previously. In the present study, the process of genetic change over time was studied by monitoring multiple serial passage lines of STMV populations for changes in their consensus sequences. A total of 42 passage lines were initiated by inoculation of tobacco plants with a helper tobamovirus and one of four STMV RNA inocula that were transcribed from full-length infectious STMV clones or extracted from purified STMV type strain virions. Ten serial passages were carried out for each line and the consensus genotypes of progeny STMV populations were assessed for genetic change by RNase protection analyses of the entire 1,059-nt STMV genome. Three different types of genetic change were observed, including the fixation of novel mutations in 9 of 42 lines, mutation at the major heterogeneity site near nt 751 in 5 of the 19 lines inoculated with a single genotype, and selection of a single major genotype in 6 of the 23 lines inoculated with mixed genotypes. Sequence analyses showed that the majority of mutations were single base substitutions. The distribution of mutation sites included three clusters in which mutations occurred at or very near the same site, suggesting hot spots of genetic change in the STMV genome. The diversity of genetic changes in sibling lines is clear evidence for the important role of chance and random sampling events in the process of genetic diversification of STMV virus populations.

  11. Role of creatine kinase isoenzymes on muscular and cardiorespiratory endurance: genetic and molecular evidence.

    Science.gov (United States)

    Echegaray, M; Rivera, M A

    2001-01-01

    polymorphism, distinguished by the NcoI restriction enzyme, and an increase in cardiorespiratory endurance as indexed by maximal oxygen uptake following 20 weeks of training. In conclusion, there is now evidence at the tissue, cell and molecular level indicating that the CK-PCr system plays an important role in determining the phenotypes of muscular and cardiorespiratory endurance. It is envisioned that newer technologies will help determine how the genetic variability of these genes (and many others) impact on performance and health-related phenotypes.

  12. Genomic evidence for the population genetic differentiation of Misgurnus anguillicaudatus in the Yangtze River basin of China.

    Science.gov (United States)

    Yi, Shaokui; Wang, Weimin; Zhou, Xiaoyun

    2018-02-21

    Misgurnus anguillicaudatus, an important aquatic species, is mainly distributed in the Yangtze River basin. To reveal the population genetic structure of M. anguillicaudatus distributed in the Yangtze River basin, genotyping by sequencing (GBS) technique was employed to detect the genome wide genetic variations of M. anguillicaudatus. A total of 30.03 Gb raw data were yielded from 70 samples collected from 15 geographic sites located in the Yangtze River basin. Subsequently, 2092 high quality SNPs were genotyped across these samples and used for a series of genetic analysis. The results of genetic analysis showed that high levels of genetic diversity were observed and the populations from upper reaches (UR) were significantly differentiated from the middle and lower reaches (MLR) of Yangtze River basin. Meanwhile, no significant isolation by distance was detected among the populations. Ecological factors (e.g. complicated topography and climatic environment) and anthropogenic factors (e.g. aquaculture and agriculture cultivation) might account for the genetic disconnectivity between UR and MLR populations. This study provided valuable genetic data for the future breeding program and also for the conversation and scientific utilization of those abundant genetic resources stored in the Yangtze River basin. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. Beliefs and implementation of evidence-based practice among nurses and allied healthcare providers in the Valais hospital, Switzerland.

    Science.gov (United States)

    Verloo, Henk; Desmedt, Mario; Morin, Diane

    2017-02-01

    Evidence-based practice (EBP) is upheld as a means for patients to receive the most efficient care in a given context. Despite the available evidence and positive beliefs about it, implementing EBP as standard daily practice still faces many obstacles. This study investigated the beliefs about and implementation of EBP among nurses and allied healthcare providers (AHP) in 9 acute care hospitals in the canton of Valais, Switzerland. A cross-sectional descriptive survey was conducted. The target population was composed of 1899 nurses and 126 AHPs. Beliefs about and implementation of EBP were measured using EBP-Beliefs and EBP-Implementation scales of Melnyk et al. The initial sample consisted in 491 participants (overall response rate 24.2%): 421 nurses (22.4% response rate) and 78 AHPs (61.9% response rate). The final sample, composed only of those who declared previous exposure to EBP, included 391 participants (329 nurses and 62 AHPs). Overall, participants had positive attitudes towards EBP and were willing to increase their knowledge to guide practice. However, they acknowledged poor implementation of EBP in daily practice. A significantly higher level of EBP implementation was declared by those formally trained in it (P = 0.006) and by those occupying more senior professional functions (P = 0.004). EBP-Belief scores predicted 13% of the variance in the EBP-Implementation scores (R 2  = 0.13). EBP is poorly implemented despite positive beliefs about it. Continuing education and support on EBP would help to ensure that patients receive the best available care based on high-quality evidence, patient needs, clinical expertise, and a fair distribution of healthcare resources. This study's results will be used to guide institutional strategy to increase the use of EBP in daily practice. © 2016 John Wiley & Sons, Ltd.

  14. Physiologic and genetic evidence links hemopexin to triglycerides in mice and humans.

    Science.gov (United States)

    Lawson, H A; Zayed, M; Wayhart, J P; Fabbrini, E; Love-Gregory, L; Klein, S; Semenkovich, C F

    2017-04-01

    Elevated triglycerides predict insulin resistance and vascular disease in obesity, but how the inert triglyceride molecule is related to development of metabolic disease is unknown. To pursue novel potential mediators of triglyceride-associated metabolic disease, we used a forward genetics approach involving inbred mice and translated our findings to human subjects. Hemopexin (HPX) was identified as a differentially expressed gene within a quantitative trait locus associated with serum triglycerides in an F 16 advanced intercross between the LG/J and SM/J strains of mice. Hpx expression was evaluated in both the reproductive fat pads and livers of mice representing three strains, LG/J (n=25), SM/J (n=27) and C57Bl/6J (n=19), on high- and low-fat diets. The effect of altered Hpx expression on adipogenesis was studied in 3T3-L1 cells. Circulating HPX protein along with HPX expression were characterized in subcutaneous white adipose tissue samples obtained from a cohort of metabolically abnormal (n=18) and of metabolically normal (n=24) obese human subjects. We further examined the relationship between HPX and triglycerides in human atherosclerotic plaques (n=18). HPX expression in mouse adipose tissue, but not in liver, was regulated by dietary fat regardless of genetic background. HPX increased in concert with adipogenesis in 3T3-L1 cells, and disruption of its expression impaired adipocyte differentiation. RNAseq data from the adipose tissue of obese humans showed differential expression of HPX based on metabolic disease status (Ptriglycerides in these subjects (r=0.33; P=0.03). HPX was also found in an unbiased proteomic screen of human atherosclerotic plaques and shown to display differential abundance based on the extent of disease and triglyceride content (Ptriglycerides and provide a framework for understanding mechanisms underlying lipid metabolism and metabolic disease.

  15. Applying systems thinking to task shifting for mental health using lay providers: a review of the evidence.

    Science.gov (United States)

    Javadi, D; Feldhaus, I; Mancuso, A; Ghaffar, A

    2017-01-01

    This paper seeks to review the available evidence to determine whether a systems approach is employed in the implementation and evaluation of task shifting for mental health using lay providers in low- and middle-income countries, and to highlight system-wide effects of task-shifting strategies in order to better inform efforts to strength community mental health systems. Pubmed, CINAHL, and Cochrane Library databases were searched. Articles were screened by two independent reviewers with a third reviewer resolving discrepancies. Two stages of screens were done to ensure sensitivity. Studies were analysed using the World Health Organization's building blocks framework with the addition of a community building block, and systems thinking characteristics to determine the extent to which system-wide effects had been considered. Thirty studies were included. Almost all studies displayed positive findings on mental health using task shifting. One study showed no effect. No studies explicitly employed systems thinking tools, but some demonstrated systems thinking characteristics, such as exploring various stakeholder perspectives, capturing unintended consequences, and looking across sectors for system-wide impact. Twenty-five of the 30 studies captured elements other than the most directly relevant building blocks of service delivery and health workforce. There is a lack of systematic approaches to exploring complexity in the evaluation of task-shifting interventions. Systems thinking tools should support evidence-informed decision making for a more complete understanding of community-based systems strengthening interventions for mental health.

  16. Psychosocial interventions in opiate substitution treatment services: does the evidence provide a case for optimism or nihilism?

    Science.gov (United States)

    Day, Ed; Mitcheson, Luke

    2017-08-01

    Clinical guidelines from around the world recommend the delivery of psychosocial interventions as part of routine care in opiate substitution treatment (OST) programmes. However, although individual studies demonstrate benefit for structured psychosocial interventions, meta-analytical reviews find no benefit for manual-based treatments beyond 'routine counselling'. We consider the question of whether OST medication alone is sufficient to produce the required outcomes, or whether greater efforts should be made to provide high-quality psychosocial treatment alongside medication. In so doing, we consider the nuances and limitations of the evidence and the organizational barriers to transferring it into routine practice. The evidence base for psychosocial interventions in opiate substitution treatment (OST) services can be interpreted both positively and negatively. Steering a path between overly optimistic or nihilistic interpretations of the value of psychosocial treatment in OST programmes is the most pragmatic approach. Greater attention should be paid to elements common to all psychological treatments (such as therapeutic alliance), but also to the sequencing and packaging of psychosocial elements and their linkage to peer-led interventions. © 2017 Society for the Study of Addiction.

  17. Yangtze River, an insignificant genetic boundary in tufted deer (Elaphodus cephalophus): the evidence from a first population genetics study.

    Science.gov (United States)

    Sun, Zhonglou; Pan, Tao; Wang, Hui; Pang, Mujia; Zhang, Baowei

    2016-01-01

    Great rivers were generally looked at as the geographical barrier to gene flow for many taxonomic groups. The Yangtze River is the third largest river in the world, and flows across South China and into the East China Sea. Up until now, few studies have been carried out to evaluate its effect as a geographical barrier. In this study, we attempted to determine the barrier effect of the Yangtze River on the tufted deer ( Elaphodus cephalophus ) using the molecular ecology approach. Using mitochondrial DNA control region (CR) sequences and 13 nuclear microsatellite loci, we explored the genetic structure and gene flow in two adjacent tufted deer populations (Dabashan and Wulingshan populations), which are separated by the Yangtze River. Results indicated that there are high genetic diversity levels in the two populations, but no distinguishable haplotype group or potential genetic cluster was detected which corresponded to specific geographical population. At the same time, high gene flow was observed between Wulingshan and Dabashan populations. The tufted deer populations experienced population decrease from 0.3 to 0.09 Ma BP, then followed by a distinct population increase. A strong signal of recent population decline ( T = 4,396 years) was detected in the Wulingshan population by a Markov-Switching Vector Autoregressions(MSVAR) process population demography analysis. The results indicated that the Yangtze River may not act as an effective barrier to gene flow in the tufted deer. Finally, we surmised that the population demography of the tufted deer was likely affected by Pleistocene climate fluctuations and ancient human activities.

  18. Autosomal genetic diversity in non-breed horses from eastern Eurasia provides insights into historical population movements.

    Science.gov (United States)

    Warmuth, Vera; Manica, Andrea; Eriksson, Anders; Barker, Graeme; Bower, Mim

    2013-02-01

    Many events in the history of eastern Eurasia, including the process of domestication itself, the initial spread of domestic horses and subsequent movements, are believed to have affected the genetic structure of domestic horse populations in this area. We investigated levels of within- and between-population genetic diversity in 'non-breed horses' (working horses sampled in remote areas) from 17 locations in Asia and parts of Eastern Europe, using 26 autosomal microsatellite loci. Non-breed horses have not been subject to the same intensity of artificial selection and closed breeding as have most breed animals and are thus expected to better reflect the population history of domestic horses. Despite geographic distances of between 300 and 7000 km between sampling locations, pairwise F (ST) was very low (range: <0.001 to -0.033), suggesting historically high levels of gene flow. Our analyses of non-breed horses revealed a pattern of isolation by distance and a significant decline in genetic diversity (expected heterozygosity and allelic richness) from east to west, consistent with a westward expansion of horses out of East Asia. Although the timing of this putative expansion is unclear, our results highlight the benefit of studying animals that do not belong to particular breeds when investigating aspects of a population's history. © 2012 The Authors, Animal Genetics © 2012 Stichting International Foundation for Animal Genetics.

  19. Governance in Health - The Need for Exchange and Evidence Comment on "Governance, Government, and the Search for New Provider Models".

    Science.gov (United States)

    Chanturidze, Tata; Obermann, Konrad

    2016-05-17

    Governance in health is cited as one of the key factors in balancing the concerns of the government and public sector with the interests of civil society/private players, but often remains poorly described and operationalized. Richard Saltman and Antonio Duran look at two aspects in the search for new provider models in a context of health markets signalling liberalisation: (i) the role of the government to balance public and private interests and responsibilities in delivering care through modernised governance arrangements, and (ii) the finding that operational complexities may hinder well-designed provider governance models, unless governance reflects country-specific realities. This commentary builds on the discussion by Saltman and Duran, and argues that the concept of governance needs to be clearly defined and operationalized in order to be helpful for policy debate as well as for the development of an applicable framework for performance improvement. It provides a working definition of governance and includes a reflection on the prevailing cultural norms in an organization or society upon which any governance needs to be build. It proposes to explore whether the "evidence-based governance" concept can be introduced to generate knowledge about innovative and effective governance models, and concludes that studies similar to the one by Saltman and Duran can inform this debate. © 2016 by Kerman University of Medical Sciences.

  20. Dementia in SPG4 hereditary spastic paraplegia: clinical, genetic, and neuropathologic evidence.

    LENUS (Irish Health Repository)

    Murphy, S

    2012-02-01

    BACKGROUND: Cognitive impairment and dementia has been reported in autosomal dominant hereditary spastic paraparesis (HSP) linked to the SPG4 locus. There has only been one postmortem examination described; not all accept that progressive cognitive decline is a feature of this disorder. OBJECTIVE: A family with SPG4-HSP known to have a deletion of exon 17 in the spastin gene (SPG4delEx17) was cognitively assessed over a 7-year period. The index family member died and a postmortem examination was performed. METHODS: Thirteen family members older than 40 years were clinically and cognitively assessed using the Cambridge Cognitive Assessment over a 7-year period. The presence of SPG4delEx17 was assessed; a neuropathologic examination of the brain of the index family member was performed. RESULTS: Cognitive decline occurred in 6 of the 13 family members and in all 4 older than 60 years. Two genetic deletions were identified: SPG4delEx17 in 12 of the 13 family members and a deletion of SPG6 (SPG6del) in 5. Eight individuals had the SPG4delEx17 deletion only; 4 had evidence of progressive cognitive impairment. Four family members had both SPG4delEx17 and SPG6del; 2 of these had cognitive impairment. One family member with the SPG6del alone had neither HSP nor cognitive impairment. The index case with both deletions died with dementia; the brain showed widespread ubiquitin positivity within the neocortex and white matter. CONCLUSION: Cognitive decline and dementia is a feature of SPG4-HSP due to a deletion of exon 17 of the spastin gene.

  1. Long-term monitoring data provide evidence of declining species richness in a river valued for biodiversity conservation

    Science.gov (United States)

    Freeman, Mary C.; Hagler, Megan M.; Bumpers, Phillip M.; Wheeler, Kit; Wengerd, Seth J.; Freeman, Byron J.

    2017-01-01

    Free-flowing river segments provide refuges for many imperiled aquatic biota that have been extirpated elsewhere in their native ranges. These biodiversity refuges are also foci of conservation concerns because species persisting within isolated habitat fragments may be particularly vulnerable to local environmental change. We have analyzed long-term (14- and 20-y) survey data to assess evidence of fish species declines in two southeastern U.S. rivers where managers and stakeholders have identified potentially detrimental impacts of current and future land uses. The Conasauga River (Georgia and Tennessee) and the Etowah River (Georgia) form free-flowing headwaters of the extensively dammed Coosa River system. These rivers are valued in part because they harbor multiple species of conservation concern, including three federally endangered and two federally threatened fishes. We used data sets comprising annual surveys for fish species at multiple, fixed sites located at river shoals to analyze occupancy dynamics and temporal changes in species richness. Our analyses incorporated repeated site-specific surveys in some years to estimate and account for incomplete species detection, and test for species-specific (rarity, mainstem-restriction) and year-specific (elevated frequencies of low- or high-flow days) covariates on occupancy dynamics. In the Conasauga River, analysis of 26 species at 13 sites showed evidence of temporal declines in colonization rates for nearly all taxa, accompanied by declining species richness. Four taxa (including one federally endangered species) had reduced occupancy across the Conasauga study sites, with three of these taxa apparently absent for at least the last 5 y of the study. In contrast, a similar fauna of 28 taxa at 10 sites in the Etowah River showed no trends in species persistence, colonization, or occupancy. None of the tested covariates showed strong effects on persistence or colonization rates in either river. Previous studies

  2. Molecular evolution of avian reovirus: evidence for genetic diversity and reassortment of the S-class genome segments and multiple cocirculating lineages

    International Nuclear Information System (INIS)

    Liu, Hung J.; Lee, Long H.; Hsu, Hsiao W.; Kuo, Liam C.; Liao, Ming H.

    2003-01-01

    Nucleotide sequences of the S-class genome segments of 17 field-isolates and vaccine strains of avian reovirus (ARV) isolated over a 23-year period from different hosts, pathotypes, and geographic locations were examined and analyzed to define phylogenetic profiles and evolutionary mechanism. The S1 genome segment showed noticeably higher divergence than the other S-class genes. The σC-encoding gene has evolved into six distinct lineages. In contrast, the other S-class genes showed less divergence than that of the σC-encoding gene and have evolved into two to three major distinct lineages, respectively. Comparative sequence analysis provided evidence indicating extensive sequence divergence between ARV and other orthoreoviruses. The evolutionary trees of each gene were distinct, suggesting that these genes evolve in an independent manner. Furthermore, variable topologies were the result of frequent genetic reassortment among multiple cocirculating lineages. Results showed genetic diversity correlated more closely with date of isolation and geographic sites than with host species and pathotypes. This is the first evidence demonstrating genetic variability among circulating ARVs through a combination of evolutionary mechanisms involving multiple cocirculating lineages and genetic reassortment. The evolutionary rates and patterns of base substitutions were examined. The evolutionary rate for the σC-encoding gene and σC protein was higher than for the other S-class genes and other family of viruses. With the exception of the σC-encoding gene, which nonsynonymous substitutions predominate over synonymous, the evolutionary process of the other S-class genes can be explained by the neutral theory of molecular evolution. Results revealed that synonymous substitutions predominate over nonsynonymous in the S-class genes, even though genetic diversity and substitution rates vary among the viruses

  3. Genetic Risk by Experience Interaction for Childhood Internalizing Problems: Converging Evidence across Multiple Methods

    Science.gov (United States)

    Vendlinski, Matthew K.; Lemery-Chalfant, Kathryn; Essex, Marilyn J.; Goldsmith, H. Hill

    2011-01-01

    Background: Identifying how genetic risk interacts with experience to predict psychopathology is an important step toward understanding the etiology of mental health problems. Few studies have examined genetic risk by experience interaction (GxE) in the development of childhood psychopathology. Methods: We used both co-twin and parent mental…

  4. The correlation of fecundability among twins: Evidence of a genetic effect on fertility?

    DEFF Research Database (Denmark)

    Christensen, Kaare; Kohler, Hans-Peter; Basso, Olga

    2003-01-01

    BACKGROUND: Numerous rare genetic conditions are known to influence fecundability in both males and females. It is less clear to what extent more subtle genetic differences influence fecundability on a population level. METHODS: In 1994 a population-based survey was conducted among Danish twins b...

  5. Genetic diversity of Phytophthora infestans sensu lato in Ecuador provides new insight into the origin of this important plant pathogen

    NARCIS (Netherlands)

    Adler, N.E.; Erselius, L.J.; Chacón, G.M.; Flier, W.G.; Ordonez, M.E.; Kroon, L.P.N.M.; Forbes, G.A.

    2004-01-01

    The metapopulation structure of Phytophthora infestans sensu lato is genetically diverse in the highlands of Ecuador. Previous reports documented the diversity associated with four putative clonal lineages of the pathogen collected from various hosts in the genus Solanum. This paper simultaneously

  6. Negative self-referential processing is associated with genetic variation in the serotonin transporter-linked polymorphic region (5-HTTLPR): Evidence from two independent studies.

    Science.gov (United States)

    Dainer-Best, Justin; Disner, Seth G; McGeary, John E; Hamilton, Bethany J; Beevers, Christopher G

    2018-01-01

    The current research examined whether carriers of the short 5-HTTLPR allele (in SLC6A4), who have been shown to selectively attend to negative information, exhibit a bias towards negative self-referent processing. The self-referent encoding task (SRET) was used to measure self-referential processing of positive and negative adjectives. Ratcliff's diffusion model isolated and extracted decision-making components from SRET responses and reaction times. Across the initial (N = 183) and replication (N = 137) studies, results indicated that short 5-HTTLPR allele carriers more easily categorized negative adjectives as self-referential (i.e., higher drift rate). Further, drift rate was associated with recall of negative self-referential stimuli. Findings across both studies provide further evidence that genetic variation may contribute to the etiology of negatively biased processing of self-referent information. Large scale studies examining the genetic contributions to negative self-referent processing may be warranted.

  7. Morphological and genetic evidence of contemporary intersectional hybridisation in Mediterranean Helichrysum (Asteraceae, Gnaphalieae).

    Science.gov (United States)

    Galbany-Casals, M; Carnicero-Campmany, P; Blanco-Moreno, J M; Smissen, R D

    2012-09-01

    Hybridisation is considered an important evolutionary phenomenon in Gnaphalieae, but contemporary hybridisation has been little explored within the tribe. Here, hybridisation between Helichrysum orientale and Helichrysum stoechas is studied at two different localities in the islands of Crete and Rhodes (Greece). Using three different types of molecular data (AFLP, nrDNA ITS sequences and cpDNA ndhF sequences) and morphological data, the aim is to provide simultaneous and direct comparisons between molecular and morphological variation among the parental species and the studied hybrid populations. AFLP profiles, ITS sequences and morphological data support the existence of hybrids at the two localities studied, shown as morphological and genetic intermediates between the parental species. Chloroplast DNA sequences show that both parental species can act either as pollen donor or as maternal parent. Fertility of hybrids is demonstrated by the viability of seeds produced by hybrids from both localities, and the detection of a backcross specimen to H. orientale. Although there is general congruence of morphological and molecular data, the analysis of morphology and ITS sequences can fail to detect backcross hybrids. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.

  8. Genetic evidence for role of integration of fast and slow neurotransmission in schizophrenia.

    Science.gov (United States)

    Devor, A; Andreassen, O A; Wang, Y; Mäki-Marttunen, T; Smeland, O B; Fan, C-C; Schork, A J; Holland, D; Thompson, W K; Witoelar, A; Chen, C-H; Desikan, R S; McEvoy, L K; Djurovic, S; Greengard, P; Svenningsson, P; Einevoll, G T; Dale, A M

    2017-06-01

    The most recent genome-wide association studies (GWAS) of schizophrenia (SCZ) identified hundreds of risk variants potentially implicated in the disease. Further, novel statistical methodology designed for polygenic architecture revealed more potential risk variants. This can provide a link between individual genetic factors and the mechanistic underpinnings of SCZ. Intriguingly, a large number of genes coding for ionotropic and metabotropic receptors for various neurotransmitters-glutamate, γ-aminobutyric acid (GABA), dopamine, serotonin, acetylcholine and opioids-and numerous ion channels were associated with SCZ. Here, we review these findings from the standpoint of classical neurobiological knowledge of neuronal synaptic transmission and regulation of electrical excitability. We show that a substantial proportion of the identified genes are involved in intracellular cascades known to integrate 'slow' (G-protein-coupled receptors) and 'fast' (ionotropic receptors) neurotransmission converging on the protein DARPP-32. Inspection of the Human Brain Transcriptome Project database confirms that that these genes are indeed expressed in the brain, with the expression profile following specific developmental trajectories, underscoring their relevance to brain organization and function. These findings extend the existing pathophysiology hypothesis by suggesting a unifying role of dysregulation in neuronal excitability and synaptic integration in SCZ. This emergent model supports the concept of SCZ as an 'associative' disorder-a breakdown in the communication across different slow and fast neurotransmitter systems through intracellular signaling pathways-and may unify a number of currently competing hypotheses of SCZ pathophysiology.

  9. Genetics

    International Nuclear Information System (INIS)

    Hubitschek, H.E.

    1975-01-01

    Progress is reported on the following research projects: genetic effects of high LET radiations; genetic regulation, alteration, and repair; chromosome replication and the division cycle of Escherichia coli; effects of radioisotope decay in the DNA of microorganisms; initiation and termination of DNA replication in Bacillus subtilis; mutagenesis in mouse myeloma cells; lethal and mutagenic effects of near-uv radiation; effect of 8-methoxypsoralen on photodynamic lethality and mutagenicity in Escherichia coli; DNA repair of the lethal effects of far-uv; and near uv irradiation of bacterial cells

  10. Genetic structure of populations of whale sharks among ocean basins and evidence for their historic rise and recent decline

    KAUST Repository

    Vignaud, Thomas M.

    2014-05-01

    This study presents genetic evidence that whale sharks, Rhincodon typus, are comprised of at least two populations that rarely mix and is the first to document a population expansion. Relatively high genetic structure is found when comparing sharks from the Gulf of Mexico with sharks from the Indo-Pacific. If mixing occurs between the Indian and Atlantic Oceans, it is not sufficient to counter genetic drift. This suggests whale sharks are not all part of a single global metapopulation. The significant population expansion we found was indicated by both microsatellite and mitochondrial DNA. The expansion may have happened during the Holocene, when tropical species could expand their range due to sea-level rise, eliminating dispersal barriers and increasing plankton productivity. However, the historic trend of population increase may have reversed recently. Declines in genetic diversity are found for 6 consecutive years at Ningaloo Reef in Australia. The declines in genetic diversity being seen now in Australia may be due to commercial-scale harvesting of whale sharks and collision with boats in past decades in other countries in the Indo-Pacific. The study findings have implications for models of population connectivity for whale sharks and advocate for continued focus on effective protection of the world\\'s largest fish at multiple spatial scales. © 2014 John Wiley & Sons Ltd.

  11. Sensation seeking, peer deviance, and genetic influences on adolescent delinquency: Evidence for person-environment correlation and interaction.

    Science.gov (United States)

    Mann, Frank D; Patterson, Megan W; Grotzinger, Andrew D; Kretsch, Natalie; Tackett, Jennifer L; Tucker-Drob, Elliot M; Harden, K Paige

    2016-07-01

    Both sensation seeking and affiliation with deviant peer groups are risk factors for delinquency in adolescence. In this study, we use a sample of adolescent twins (n = 549), 13 to 20 years old (M age = 15.8 years), in order to test the interactive effects of peer deviance and sensation seeking on delinquency in a genetically informative design. Consistent with a socialization effect, affiliation with deviant peers was associated with higher delinquency even after controlling for selection effects using a co-twin-control comparison. At the same time, there was evidence for person-environment correlation; adolescents with genetic dispositions toward higher sensation seeking were more likely to report having deviant peer groups. Genetic influences on sensation seeking substantially overlapped with genetic influences on adolescent delinquency. Finally, the environmentally mediated effect of peer deviance on adolescent delinquency was moderated by individual differences in sensation seeking. Adolescents reporting high levels of sensation seeking were more susceptible to deviant peers, a Person × Environment interaction. These results are consistent with both selection and socialization processes in adolescent peer relationships, and they highlight the role of sensation seeking as an intermediary phenotype for genetic risk for delinquency. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  12. Genetic structure of populations of whale sharks among ocean basins and evidence for their historic rise and recent decline.

    Science.gov (United States)

    Vignaud, Thomas M; Maynard, Jeffrey A; Leblois, Raphael; Meekan, Mark G; Vázquez-Juárez, Ricardo; Ramírez-Macías, Dení; Pierce, Simon J; Rowat, David; Berumen, Michael L; Beeravolu, Champak; Baksay, Sandra; Planes, Serge

    2014-05-01

    This study presents genetic evidence that whale sharks, Rhincodon typus, are comprised of at least two populations that rarely mix and is the first to document a population expansion. Relatively high genetic structure is found when comparing sharks from the Gulf of Mexico with sharks from the Indo-Pacific. If mixing occurs between the Indian and Atlantic Oceans, it is not sufficient to counter genetic drift. This suggests whale sharks are not all part of a single global metapopulation. The significant population expansion we found was indicated by both microsatellite and mitochondrial DNA. The expansion may have happened during the Holocene, when tropical species could expand their range due to sea-level rise, eliminating dispersal barriers and increasing plankton productivity. However, the historic trend of population increase may have reversed recently. Declines in genetic diversity are found for 6 consecutive years at Ningaloo Reef in Australia. The declines in genetic diversity being seen now in Australia may be due to commercial-scale harvesting of whale sharks and collision with boats in past decades in other countries in the Indo-Pacific. The study findings have implications for models of population connectivity for whale sharks and advocate for continued focus on effective protection of the world's largest fish at multiple spatial scales. © 2014 John Wiley & Sons Ltd.

  13. Maternal smoking during pregnancy and offspring conduct problems: Evidence from three independent genetically-sensitive research designs

    Science.gov (United States)

    Gaysina, Darya; Fergusson, David M.; Leve, Leslie D.; Horwood, John; Reiss, David; Shaw, Daniel S.; Elam, Kit K.; Natsuaki, Misaki N.; Neiderhiser, Jenae M.; Harold, Gordon T.

    2013-01-01

    Context A number of studies report an association between maternal smoking during pregnancy and offspring conduct disorder. However, past research evidences difficulty disaggregating prenatal environmental from genetic and postnatal environmental influences. Objective To examine the relationship between maternal smoking during pregnancy and offspring conduct problems among children reared by genetically-related and genetically-unrelated mothers. Design, Setting and Participants Three studies employing distinct but complementary research designs were utilized: The Christchurch Health and Development Study (a longitudinal cohort study that includes biological and adopted children), the Early Growth and Development Study (a longitudinal adoption at birth study), and the Cardiff IVF Study (genetically-related and -unrelated families; an adoption at conception study). Maternal smoking during pregnancy was measured as the average number of cigarettes/day (0, 1–9 or 10+) smoked during pregnancy. A number of possible covariates (child gender, ethnicity, birth weight, breast feeding, maternal age at birth, maternal education, family SES, family breakdown, placement age, and parenting practices) were controlled in the analyses. Main Outcome Measure Child conduct problems (age 4–10 years) reported by parents and/or teachers using the Rutter and Conners behaviour scales, the Child Behavior Checklist and Children's Behavior Questionnaire, and the Strengths and Difficulties Questionnaire. Results A significant association between maternal smoking during pregnancy and child conduct problems was observed among children reared by genetically-related and genetically-unrelated mothers. Results from a meta-analysis affirmed this pattern of findings across pooled study samples. Conclusions Findings across the three studies using a complement of genetically-sensitive research designs suggest smoking during pregnancy is a prenatal risk factor for offspring conduct problems, when

  14. Large-scale association analysis provides insights into the genetic architecture and pathophysiology of type 2 diabetes

    Science.gov (United States)

    Morris, Andrew P; Voight, Benjamin F; Teslovich, Tanya M; Ferreira, Teresa; Segrè, Ayellet V; Steinthorsdottir, Valgerdur; Strawbridge, Rona J; Khan, Hassan; Grallert, Harald; Mahajan, Anubha; Prokopenko, Inga; Kang, Hyun Min; Dina, Christian; Esko, Tonu; Fraser, Ross M; Kanoni, Stavroula; Kumar, Ashish; Lagou, Vasiliki; Langenberg, Claudia; Luan, Jian'an; Lindgren, Cecilia M; Müller-Nurasyid, Martina; Pechlivanis, Sonali; Rayner, N William; Scott, Laura J; Wiltshire, Steven; Yengo, Loic; Kinnunen, Leena; Rossin, Elizabeth J; Raychaudhuri, Soumya; Johnson, Andrew D; Dimas, Antigone S; Loos, Ruth J F; Vedantam, Sailaja; Chen, Han; Florez, Jose C; Fox, Caroline; Liu, Ching-Ti; Rybin, Denis; Couper, David J; Kao, Wen Hong L; Li, Man; Cornelis, Marilyn C; Kraft, Peter; Sun, Qi; van Dam, Rob M; Stringham, Heather M; Chines, Peter S; Fischer, Krista; Fontanillas, Pierre; Holmen, Oddgeir L; Hunt, Sarah E; Jackson, Anne U; Kong, Augustine; Lawrence, Robert; Meyer, Julia; Perry, John RB; Platou, Carl GP; Potter, Simon; Rehnberg, Emil; Robertson, Neil; Sivapalaratnam, Suthesh; Stančáková, Alena; Stirrups, Kathleen; Thorleifsson, Gudmar; Tikkanen, Emmi; Wood, Andrew R; Almgren, Peter; Atalay, Mustafa; Benediktsson, Rafn; Bonnycastle, Lori L; Burtt, Noël; Carey, Jason; Charpentier, Guillaume; Crenshaw, Andrew T; Doney, Alex S F; Dorkhan, Mozhgan; Edkins, Sarah; Emilsson, Valur; Eury, Elodie; Forsen, Tom; Gertow, Karl; Gigante, Bruna; Grant, George B; Groves, Christopher J; Guiducci, Candace; Herder, Christian; Hreidarsson, Astradur B; Hui, Jennie; James, Alan; Jonsson, Anna; Rathmann, Wolfgang; Klopp, Norman; Kravic, Jasmina; Krjutškov, Kaarel; Langford, Cordelia; Leander, Karin; Lindholm, Eero; Lobbens, Stéphane; Männistö, Satu; Mirza, Ghazala; Mühleisen, Thomas W; Musk, Bill; Parkin, Melissa; Rallidis, Loukianos; Saramies, Jouko; Sennblad, Bengt; Shah, Sonia; Sigurðsson, Gunnar; Silveira, Angela; Steinbach, Gerald; Thorand, Barbara; Trakalo, Joseph; Veglia, Fabrizio; Wennauer, Roman; Winckler, Wendy; Zabaneh, Delilah; Campbell, Harry; van Duijn, Cornelia; Uitterlinden89-, Andre G; Hofman, Albert; Sijbrands, Eric; Abecasis, Goncalo R; Owen, Katharine R; Zeggini, Eleftheria; Trip, Mieke D; Forouhi, Nita G; Syvänen, Ann-Christine; Eriksson, Johan G; Peltonen, Leena; Nöthen, Markus M; Balkau, Beverley; Palmer, Colin N A; Lyssenko, Valeriya; Tuomi, Tiinamaija; Isomaa, Bo; Hunter, David J; Qi, Lu; Shuldiner, Alan R; Roden, Michael; Barroso, Ines; Wilsgaard, Tom; Beilby, John; Hovingh, Kees; Price, Jackie F; Wilson, James F; Rauramaa, Rainer; Lakka, Timo A; Lind, Lars; Dedoussis, George; Njølstad, Inger; Pedersen, Nancy L; Khaw, Kay-Tee; Wareham, Nicholas J; Keinanen-Kiukaanniemi, Sirkka M; Saaristo, Timo E; Korpi-Hyövälti, Eeva; Saltevo, Juha; Laakso, Markku; Kuusisto, Johanna; Metspalu, Andres; Collins, Francis S; Mohlke, Karen L; Bergman, Richard N; Tuomilehto, Jaakko; Boehm, Bernhard O; Gieger, Christian; Hveem, Kristian; Cauchi, Stephane; Froguel, Philippe; Baldassarre, Damiano; Tremoli, Elena; Humphries, Steve E; Saleheen, Danish; Danesh, John; Ingelsson, Erik; Ripatti, Samuli; Salomaa, Veikko; Erbel, Raimund; Jöckel, Karl-Heinz; Moebus, Susanne; Peters, Annette; Illig, Thomas; de Faire, Ulf; Hamsten, Anders; Morris, Andrew D; Donnelly, Peter J; Frayling, Timothy M; Hattersley, Andrew T; Boerwinkle, Eric; Melander, Olle; Kathiresan, Sekar; Nilsson, Peter M; Deloukas, Panos; Thorsteinsdottir, Unnur; Groop, Leif C; Stefansson, Kari; Hu, Frank; Pankow, James S; Dupuis, Josée; Meigs, James B; Altshuler, David; Boehnke, Michael; McCarthy, Mark I

    2012-01-01

    To extend understanding of the genetic architecture and molecular basis of type 2 diabetes (T2D), we conducted a meta-analysis of genetic variants on the Metabochip involving 34,840 cases and 114,981 controls, overwhelmingly of European descent. We identified ten previously unreported T2D susceptibility loci, including two demonstrating sex-differentiated association. Genome-wide analyses of these data are consistent with a long tail of further common variant loci explaining much of the variation in susceptibility to T2D. Exploration of the enlarged set of susceptibility loci implicates several processes, including CREBBP-related transcription, adipocytokine signalling and cell cycle regulation, in diabetes pathogenesis. PMID:22885922

  15. De novo assembly of mitochondrial genomes provides insights into genetic diversity and molecular evolution in wild boars and domestic pigs.

    Science.gov (United States)

    Ni, Pan; Bhuiyan, Ali Akbar; Chen, Jian-Hai; Li, Jingjin; Zhang, Cheng; Zhao, Shuhong; Du, Xiaoyong; Li, Hua; Yu, Hui; Liu, Xiangdong; Li, Kui

    2018-05-10

    Up to date, the scarcity of publicly available complete mitochondrial sequences for European wild pigs hampers deeper understanding about the genetic changes following domestication. Here, we have assembled 26 de novo mtDNA sequences of European wild boars from next generation sequencing (NGS) data and downloaded 174 complete mtDNA sequences to assess the genetic relationship, nucleotide diversity, and selection. The Bayesian consensus tree reveals the clear divergence between the European and Asian clade and a very small portion (10 out of 200 samples) of maternal introgression. The overall nucleotides diversities of the mtDNA sequences have been reduced following domestication. Interestingly, the selection efficiencies in both European and Asian domestic pigs are reduced, probably caused by changes in both selection constraints and maternal population size following domestication. This study suggests that de novo assembled mitogenomes can be a great boon to uncover the genetic turnover following domestication. Further investigation is warranted to include more samples from the ever-increasing amounts of NGS data to help us to better understand the process of domestication.

  16. Genetics

    DEFF Research Database (Denmark)

    Christensen, Kaare; McGue, Matt

    2016-01-01

    The sequenced genomes of individuals aged ≥80 years, who were highly educated, self-referred volunteers and with no self-reported chronic diseases were compared to young controls. In these data, healthy ageing is a distinct phenotype from exceptional longevity and genetic factors that protect...

  17. Crystallographic studies with xenon and nitrous oxide provide evidence for protein-dependent processes in the mechanisms of general anesthesia.

    Science.gov (United States)

    Abraini, Jacques H; Marassio, Guillaume; David, Helene N; Vallone, Beatrice; Prangé, Thierry; Colloc'h, Nathalie

    2014-11-01

    The mechanisms by which general anesthetics, including xenon and nitrous oxide, act are only beginning to be discovered. However, structural approaches revealed weak but specific protein-gas interactions. To improve knowledge, we performed x-ray crystallography studies under xenon and nitrous oxide pressure in a series of 10 binding sites within four proteins. Whatever the pressure, we show (1) hydrophobicity of the gas binding sites has a screening effect on xenon and nitrous oxide binding, with a threshold value of 83% beyond which and below which xenon and nitrous oxide, respectively, binds to their sites preferentially compared to each other; (2) xenon and nitrous oxide occupancies are significantly correlated respectively to the product and the ratio of hydrophobicity by volume, indicating that hydrophobicity and volume are binding parameters that complement and oppose each other's effects; and (3) the ratio of occupancy of xenon to nitrous oxide is significantly correlated to hydrophobicity of their binding sites. These data demonstrate that xenon and nitrous oxide obey different binding mechanisms, a finding that argues against all unitary hypotheses of narcosis and anesthesia, and indicate that the Meyer-Overton rule of a high correlation between anesthetic potency and solubility in lipids of general anesthetics is often overinterpreted. This study provides evidence that the mechanisms of gas binding to proteins and therefore of general anesthesia should be considered as the result of a fully reversible interaction between a drug ligand and a receptor as this occurs in classical pharmacology.

  18. Cortical gamma activity during auditory tone omission provides evidence for the involvement of oscillatory activity in top-down processing.

    Science.gov (United States)

    Gurtubay, I G; Alegre, M; Valencia, M; Artieda, J

    2006-11-01

    Perception is an active process in which our brains use top-down influences to modulate afferent information. To determine whether this modulation might be based on oscillatory activity, we asked seven subjects to detect a silence that appeared randomly in a rhythmic auditory sequence, counting the number of omissions ("count" task), or responding to each omission with a right index finger extension ("move" task). Despite the absence of physical stimuli, these tasks induced a 'non-phase-locked' gamma oscillation in temporal-parietal areas, providing evidence of intrinsically generated oscillatory activity during top-down processing. This oscillation is probably related to the local neural activation that takes place during the process of stimulus detection, involving the functional comparison between the tones and the absence of stimuli as well as the auditory echoic memory processes. The amplitude of the gamma oscillations was reduced with the repetition of the tasks. Moreover, it correlated positively with the number of correctly detected omissions and negatively with the reaction time. These findings indicate that these oscillations, like others described, may be modulated by attentional processes. In summary, our findings support the active and adaptive concept of brain function that has emerged over recent years, suggesting that the match of sensory information with memory contents generates gamma oscillations.

  19. A Randomized Controlled Trial Provides Evidence to Support Aromatherapy to Minimize Anxiety in Women Undergoing Breast Biopsy.

    Science.gov (United States)

    Trambert, Renee; Kowalski, Mildred Ortu; Wu, Betty; Mehta, Nimisha; Friedman, Paul

    2017-10-01

    Aromatherapy has been used to reduce anxiety in a variety of settings, but usefulness associated with breast biopsies has not been documented. This study was conducted in women undergoing image-guided breast biopsy. We explored the use of two different aromatherapy scents, compared to placebo, aimed at reducing anxiety with the intent of generating new knowledge. This was a randomized, placebo-controlled study of two different types of external aromatherapy tabs (lavender-sandalwood and orange-peppermint) compared with a matched placebo-control delivery system. Anxiety was self-reported before and after undergoing a breast biopsy using the Spielberger State Anxiety Inventory Scale. Eighty-seven women participated in this study. There was a statistically significant reduction in self-reported anxiety with the use of the lavender-sandalwood aromatherapy tab compared with the placebo group (p = .032). Aromatherapy tabs reduced anxiety during image-guided breast biopsy. The completion of the biopsy provided some relief from anxiety in all groups. The use of aromatherapy tabs offers an evidence-based nursing intervention to improve adaptation and reduce anxiety for women undergoing breast biopsy. Lavender-sandalwood aromatherapy reduced anxiety and promoted adaptation more than orange-peppermint aromatherapy or placebo. © 2017 Sigma Theta Tau International.

  20. Early atmospheric metal pollution provides evidence for Chalcolithic/Bronze Age mining and metallurgy in Southwestern Europe

    Energy Technology Data Exchange (ETDEWEB)

    Martínez Cortizas, Antonio, E-mail: antonio.martinez.cortizas@usc.es [Departamento de Edafoloxía e Química Agrícola, Facultade de Bioloxía, Universidade de Santiago de Compostela, Campus Sur s/n, Santiago de Compostela (Spain); López-Merino, Lourdes, E-mail: lourdes.lopez-merino@brunel.ac.uk [Institute of Environment, Health and Societies, Brunel University London, UB8 3PH Uxbridge (United Kingdom); Bindler, Richard, E-mail: richard.bindler@umu.se [Department of Ecology and Environmental Science, Umeå University, Umeå (Sweden); Mighall, Tim, E-mail: t.mighall@abdn.ac.uk [Department of Geography & Environment, School of Geosciences, University of Aberdeen, Elphinstone Road, Aberdeen AB24 3UF (United Kingdom); Kylander, Malin E., E-mail: malin.kylander@geo.su.se [Department of Geological Sciences and the Bolin Centre for Climate Research, Stockholm University, SE-10691, Stockholm (Sweden)

    2016-03-01

    Although archaeological research suggests that mining/metallurgy already started in the Chalcolithic (3rd millennium BC), the earliest atmospheric metal pollution in SW Europe has thus far been dated to ~ 3500–3200 cal. yr. BP in paleo-environmental archives. A low intensity, non-extensive mining/metallurgy and the lack of appropriately located archives may be responsible for this mismatch. We have analysed the older section (> 2100 cal. yr. BP) of a peat record from La Molina (Asturias, Spain), a mire located in the proximity (35–100 km) of mines which were exploited in the Chalcolithic/Bronze Age, with the aim of assessing evidence of this early mining/metallurgy. Analyses included the determination of C as a proxy for organic matter content, lithogenic elements (Si, Al, Ti) as markers of mineral matter, and trace metals (Cr, Cu, Zn, Pb) and stable Pb isotopes as tracers of atmospheric metal pollution. From ~ 8000 to ~ 4980 cal. yr. BP the Pb composition is similar to that of the underlying sediments (Pb 15 ± 4 μg g{sup −1}; {sup 206}Pb/{sup 207}Pb 1.204 ± 0.002). A sustained period of low {sup 206}Pb/{sup 207}Pb ratios occurred from ~ 4980 to ~ 2470 cal. yr. BP, which can be divided into four phases: Chalcolithic (~ 4980–3700 cal. yr. BP), {sup 206}Pb/{sup 207}Pb ratios decline to 1.175 and Pb/Al ratios increase; Early Bronze Age (~ 3700–3500 cal. yr. BP), {sup 206}Pb/{sup 207}Pb increase to 1.192 and metal/Al ratios remain stable; Late Bronze Age (~ 3500–2800 cal. yr. BP), {sup 206}Pb/{sup 207}Pb decline to their lowest values (1.167) while Pb/Al and Zn/Al increase; and Early Iron Age (~ 2800–2470 cal. yr. BP), {sup 206}Pb/{sup 207}Pb increase to 1.186, most metal/Al ratios decrease but Zn/Al shows a peak. At the beginning of the Late Iron Age, {sup 206}Pb/{sup 207}Pb ratios and metal enrichments show a rapid return to pre-anthropogenic values. These results provide evidence of regional/local atmospheric metal pollution triggered by the

  1. Early atmospheric metal pollution provides evidence for Chalcolithic/Bronze Age mining and metallurgy in Southwestern Europe.

    Science.gov (United States)

    Martínez Cortizas, Antonio; López-Merino, Lourdes; Bindler, Richard; Mighall, Tim; Kylander, Malin E

    2016-03-01

    Although archaeological research suggests that mining/metallurgy already started in the Chalcolithic (3rd millennium BC), the earliest atmospheric metal pollution in SW Europe has thus far been dated to ~3500-3200 cal.yr. BP in paleo-environmental archives. A low intensity, non-extensive mining/metallurgy and the lack of appropriately located archives may be responsible for this mismatch. We have analysed the older section (>2100 cal.yr. BP) of a peat record from La Molina (Asturias, Spain), a mire located in the proximity (35-100 km) of mines which were exploited in the Chalcolithic/Bronze Age, with the aim of assessing evidence of this early mining/metallurgy. Analyses included the determination of C as a proxy for organic matter content, lithogenic elements (Si, Al, Ti) as markers of mineral matter, and trace metals (Cr, Cu, Zn, Pb) and stable Pb isotopes as tracers of atmospheric metal pollution. From ~8000 to ~4980 cal.yr. BP the Pb composition is similar to that of the underlying sediments (Pb 15 ± 4 μg g(-1); (206)Pb/(207)Pb 1.204 ± 0.002). A sustained period of low (206)Pb/(207)Pb ratios occurred from ~4980 to ~2470 cal.yr. BP, which can be divided into four phases: Chalcolithic (~4980-3700 cal.yr. BP), (206)Pb/(207)Pb ratios decline to 1.175 and Pb/Al ratios increase; Early Bronze Age (~3700-3500 cal.yr. BP), (206)Pb/(207)Pb increase to 1.192 and metal/Al ratios remain stable; Late Bronze Age (~3500-2800 cal.yr. BP), (206)Pb/(207)Pb decline to their lowest values (1.167) while Pb/Al and Zn/Al increase; and Early Iron Age (~2800-2470 cal.yr. BP), (206)Pb/(207)Pb increase to 1.186, most metal/Al ratios decrease but Zn/Al shows a peak. At the beginning of the Late Iron Age, (206)Pb/(207)Pb ratios and metal enrichments show a rapid return to pre-anthropogenic values. These results provide evidence of regional/local atmospheric metal pollution triggered by the earliest phases of mining/metallurgy in the area, and reconcile paleo-environmental and

  2. Genetic mapping of QTLs controlling fatty acids provided insights into the genetic control of fatty acid synthesis pathway in peanut (Arachis hypogaea L..

    Directory of Open Access Journals (Sweden)

    Ming Li Wang

    Full Text Available Peanut, a high-oil crop with about 50% oil content, is either crushed for oil or used as edible products. Fatty acid composition determines the oil quality which has high relevance to consumer health, flavor, and shelf life of commercial products. In addition to the major fatty acids, oleic acid (C18:1 and linoleic acid (C18:2 accounting for about 80% of peanut oil, the six other fatty acids namely palmitic acid (C16:0, stearic acid (C18:0, arachidic acid (C20:0, gadoleic acid (C20:1, behenic acid (C22:0, and lignoceric acid (C24:0 are accounted for the rest 20%. To determine the genetic basis and to improve further understanding on effect of FAD2 genes on these fatty acids, two recombinant inbred line (RIL populations namely S-population (high oleic line 'SunOleic 97R' × low oleic line 'NC94022' and T-population (normal oleic line 'Tifrunner' × low oleic line 'GT-C20' were developed. Genetic maps with 206 and 378 marker loci for the S- and the T-population, respectively were used for quantitative trait locus (QTL analysis. As a result, a total of 164 main-effect (M-QTLs and 27 epistatic (E-QTLs QTLs associated with the minor fatty acids were identified with 0.16% to 40.56% phenotypic variation explained (PVE. Thirty four major QTLs (>10% of PVE mapped on five linkage groups and 28 clusters containing more than three QTLs were also identified. These results suggest that the major QTLs with large additive effects would play an important role in controlling composition of these minor fatty acids in addition to the oleic and linoleic acids in peanut oil. The interrelationship among these fatty acids should be considered while breeding for improved peanut genotypes with good oil quality and desired fatty acid composition.

  3. Evident?

    DEFF Research Database (Denmark)

    Plant, Peter

    2012-01-01

    Quality assurance and evidence in career guidance in Europe are often seen as self-evident approaches, but particular interests lie behind......Quality assurance and evidence in career guidance in Europe are often seen as self-evident approaches, but particular interests lie behind...

  4. Evidence for genetic differentiation at the microgeographic scale in Phlebotomus papatasi populations from Sudan

    Directory of Open Access Journals (Sweden)

    Khalid Noteila M

    2012-11-01

    Full Text Available Abstract Background Cutaneous Leishmaniasis (CL is endemic in Sudan. It is caused by Leishmania major parasites and transmitted by Phlebotomus papatasi sandflies. Recently, uncommon clinical manifestations of CL have been reported. Moreover, L. donovani parasites that cause Visceral Leishmaniasis (VL have been isolated from CL lesions of some patients who contracted the disease in Khartoum State, Central Sudan with no history of travelling to VL endemic sites on south-eastern Sudan. Because different clinical manifestations and the parasite behaviour could be related to genetic differentiation, or even sub-structuring within sandfly vector populations, a population genetic study was conducted on P. papatasi populations collected from different localities in Khartoum State known for their uncommon CL cases and characterized by contrasting environmental conditions. Methods A set of seven microsatellite loci was used to investigate the population structure of P. papatasi samples collected from different localities in Khartoum State, Central Sudan. Populations from Kassala State, Eastern Sudan and Egypt were also included in the analyses as outgroups. The level of genetic diversity and genetic differentiation among natural populations of P. papatasi was determined using FST statistics and Bayesian assignments. Results Genetic analyses revealed significant genetic differentiation (FST between the Sudanese and the Egyptian populations. Within the Sudanese P. papatasi populations, one population from Gerif West, Khartoum State, exhibited significant genetic differentiation from all other populations including those collected as near as 22 km. Conclusion The significant genetic differentiation of Gerif West P. papatasi population from other Sudanese populations may have important implication for the epidemiology of leishmaniasis in Khartoum State and needs to be further investigated. Primarily, it could be linked to the unique location of Gerif West

  5. Evidence of high genetic connectivity for the longnose spurdog Squalus blainville in the Mediterranean Sea

    Directory of Open Access Journals (Sweden)

    V. KOUSTENI

    2015-04-01

    Full Text Available Squalus blainville is one of the least studied Mediterranean shark species. Despite being intensively fished in several locations, biological knowledge is limited and no genetic structure information is available. This is the first study to examine the genetic structure of S. blainville in the Mediterranean Sea. Considering the high dispersal potential inferred for other squalid sharks, the hypothesis of panmixia was tested based on a 585 bp fragment of the mitochondrial DNA cytochrome c oxidase subunit I gene from 107 individuals and six nuclear microsatellite loci from 577 individuals. Samples were collected across the Ionian, Aegean and Libyan Seas and off the Balearic Islands. Twenty three additional sequences of Mediterranean and South African origin were retrieved from GenBank and included in the mitochondrial DNA analysis. The overall haplotype diversity was high, in contrast to the low nucleotide diversity. Low and non-significant pairwise ΦST and FST values along with a Bayesian cluster analysis suggested high connectivity with subsequent genetic homogeneity among the populations studied, and thus a high dispersal potential for S. blainville similar to other squalids. The historical demography of the species was also assessed, revealing a pattern of population expansion since the middle Pleistocene. These findings could be considered in species-specific conservation plans, although sampling over a larger spatial scale and more genetic markers are required to fully elucidate the genetic structure and dispersal potential of S. blainville.

  6. Low interbasin connectivity in a facultatively diadromous fish: evidence from genetics and otolith chemistry.

    Science.gov (United States)

    Hughes, Jane M; Schmidt, Daniel J; Macdonald, Jed I; Huey, Joel A; Crook, David A

    2014-03-01

    Southern smelts (Retropinna spp.) in coastal rivers of Australia are facultatively diadromous, with populations potentially containing individuals with diadromous or wholly freshwater life histories. The presence of diadromous individuals is expected to reduce genetic structuring between river basins due to larval dispersal via the sea. We use otolith chemistry to distinguish between diadromous and nondiadromous life histories and population genetics to examine interbasin connectivity resulting from diadromy. Otolith strontium isotope ((87) Sr:(86) Sr) transects identified three main life history patterns: amphidromy, freshwater residency and estuarine/marine residency. Despite the potential for interbasin connectivity via larval mixing in the marine environment, we found unprecedented levels of genetic structure for an amphidromous species. Strong hierarchical structure along putative taxonomic boundaries was detected, along with highly structured populations within groups using microsatellites (FST  = 0.046-0.181), and mtDNA (ΦST  = 0.498-0.816). The presence of strong genetic subdivision, despite the fact that many individuals reside in saline water during their early life history, appears incongruous. However, analysis of multielemental signatures in the otolith cores of diadromous fish revealed strong discrimination between river basins, suggesting that diadromous fish spend their early lives within chemically distinct estuaries rather than the more homogenous marine environment, thus avoiding dispersal and maintaining genetic structure. © 2014 John Wiley & Sons Ltd.

  7. Red blood cell distribution width: Genetic evidence for aging pathways in 116,666 volunteers.

    Directory of Open Access Journals (Sweden)

    Luke C Pilling

    Full Text Available Variability in red blood cell volumes (distribution width, RDW increases with age and is strongly predictive of mortality, incident coronary heart disease and cancer. We investigated inherited genetic variation associated with RDW in 116,666 UK Biobank human volunteers.A large proportion RDW is explained by genetic variants (29%, especially in the older group (60+ year olds, 33.8%, <50 year olds, 28.4%. RDW was associated with 194 independent genetic signals; 71 are known for conditions including autoimmune disease, certain cancers, BMI, Alzheimer's disease, longevity, age at menopause, bone density, myositis, Parkinson's disease, and age-related macular degeneration. Exclusion of anemic participants did not affect the overall findings. Pathways analysis showed enrichment for telomere maintenance, ribosomal RNA, and apoptosis. The majority of RDW-associated signals were intronic (119 of 194, including SNP rs6602909 located in an intron of oncogene GAS6, an eQTL in whole blood.Although increased RDW is predictive of cardiovascular outcomes, this was not explained by known CVD or related lipid genetic risks, and a RDW genetic score was not predictive of incident disease. The predictive value of RDW for a range of negative health outcomes may in part be due to variants influencing fundamental pathways of aging.

  8. Mitochondrial DNA variability among eight Tikúna villages: evidence for an intratribal genetic heterogeneity pattern.

    Science.gov (United States)

    Mendes-Junior, Celso Teixeira; Simões, Aguinaldo Luiz

    2009-11-01

    To study the genetic structure of the Tikúna tribe, four major Native American mitochondrial DNA (mtDNA) founder haplogroups were analyzed in 187 Amerindians from eight Tikúna villages located in the Brazilian Amazon. The central position of these villages in the continent makes them relevant for attempts to reconstruct population movements in South America. In this geographic region, there is particular concern regarding the genetic structure of the Tikúna tribe, formerly designated "enigmatic" due to its remarkable degree of intratribal homogeneity and the scarcity of private protein variants. In spite of its large population size and geographic distribution, the Tikúna tribe presents marked genetic and linguistic isolation. All individuals presented indigenous mtDNA haplogroups. An intratribal genetic heterogeneity pattern characterized by two highly homogeneous Tikúna groups that differ considerably from each other was observed. Such a finding was unexpected, since the Tikúna tribe is characterized by a social system that favors intratribal exogamy and patrilocality that would lead to a higher female migration rate and homogenization of the mtDNA gene pool. Demographic explosions and religious events, which significantly changed the sizes and compositions of many Tikúna villages, may be reflected in the genetic results presented here.

  9. Occupational trichloroethylene exposure and renal carcinoma risk: evidence of genetic susceptibility by reductive metabolism gene variants

    Science.gov (United States)

    Moore, Lee E.; Boffetta, Paolo; Karami, Sara; Brennan, Paul; Stewart, Patricia S; Hung, Rayjean; Zaridze, David; Matveev, Vsevolod; Janout, Vladimir; Kollarova, Helena; Bencko, Vladimir; Navratilova, Marie; Szeszenia-Dabrowska, Neonila; Mates, Dana; Gromiec, Jan; Holcatova, Ivana; Merino, Maria; Chanock, Stephen; Chow, Wong-Ho; Rothman, Nathaniel

    2010-01-01

    Trichloroethylene (TCE) is a suspected renal carcinogen. TCE-associated renal genotoxicity occurs predominantly through glutathione S-transferase (GST) conjugation and bioactivation by renal cysteine beta-lyase (CCBL1). We conducted a case-control study in Central Europe (1,097 cases/1,476 controls), specifically designed to assess risk associated with occupational exposure to TCE through analysis of detailed job histories. All jobs were coded for organic/chlorinated solvent and TCE exposure (ever/never) as well as the frequency and intensity of exposure based on detailed occupational questionnaires, specialized questionnaires, and expert assessments. Increased risk was observed among subjects ever TCE-exposed (OR=1.63, 95% CI: 1.04–2.54). Exposure-response trends were observed among subjects above and below the median exposure [average intensity (OR=1.38, 95% CI:0.81–2.35; OR=2.34, 95% CI:1.05–5.21, p-trend=0.02)]. A significant association was found among TCE-exposed subjects with at least one intact GSTT1 allele (active genotype) (OR=1.88, 95% CI:1.06–3.33) but not among subjects with two deleted alleles (null genotype) (OR=0.93, 95% CI:0.35–2.44, p-interaction=0.18). Similar associations for all exposure metrics including average intensity were observed among GSTT1 active subjects (OR=1.56, 95% CI:0.79–3.10; OR=2.77, 95% CI:1.01–7.58, p-trend=0.02) but not among GSTT1 nulls (OR=0.81, 95% CI:0.24–2.72; OR=1.16, 95% CI:0.27–5.04, p-trend=1.00, p-interaction=0.34). Further evidence of heterogeneity was seen among TCE-exposed subjects with ≥1 minor allele of several CCBL1 tagging SNPs: [rs2293968, rs2280841, rs2259043, rs941960]. These findings provide the strongest evidence to date that TCE exposure is associated with increased renal cancer risk, particularly among individuals carrying polymorphisms in genes that are important in the reductive metabolism of this chemical, and provides biological plausibility of the association in humans. PMID

  10. Gene alterations at Drosophila inversion breakpoints provide prima facie evidence for natural selection as an explanation for rapid chromosomal evolution

    Science.gov (United States)

    2012-01-01

    Background Chromosomal inversions have been pervasive during the evolution of the genus Drosophila, but there is significant variation between lineages in the rate of rearrangement fixation. D. mojavensis, an ecological specialist adapted to a cactophilic niche under extreme desert conditions, is a chromosomally derived species with ten fixed inversions, five of them not present in any other species. Results In order to explore the causes of the rapid chromosomal evolution in D. mojavensis, we identified and characterized all breakpoints of seven inversions fixed in chromosome 2, the most dynamic one. One of the inversions presents unequivocal evidence for its generation by ectopic recombination between transposon copies and another two harbor inverted duplications of non-repetitive DNA at the two breakpoints and were likely generated by staggered single-strand breaks and repair by non-homologous end joining. Four out of 14 breakpoints lay in the intergenic region between preexisting duplicated genes, suggesting an adaptive advantage of separating previously tightly linked duplicates. Four out of 14 breakpoints are associated with transposed genes, suggesting these breakpoints are fragile regions. Finally two inversions contain novel genes at their breakpoints and another three show alterations of genes at breakpoints with potential adaptive significance. Conclusions D. mojavensis chromosomal inversions were generated by multiple mechanisms, an observation that does not provide support for increased mutation rate as explanation for rapid chromosomal evolution. On the other hand, we have found a number of gene alterations at the breakpoints with putative adaptive consequences that directly point to natural selection as the cause of D. mojavensis rapid chromosomal evolution. PMID:22296923

  11. Gene alterations at Drosophila inversion breakpoints provide prima facie evidence for natural selection as an explanation for rapid chromosomal evolution.

    Science.gov (United States)

    Guillén, Yolanda; Ruiz, Alfredo

    2012-02-01

    Chromosomal inversions have been pervasive during the evolution of the genus Drosophila, but there is significant variation between lineages in the rate of rearrangement fixation. D. mojavensis, an ecological specialist adapted to a cactophilic niche under extreme desert conditions, is a chromosomally derived species with ten fixed inversions, five of them not present in any other species. In order to explore the causes of the rapid chromosomal evolution in D. mojavensis, we identified and characterized all breakpoints of seven inversions fixed in chromosome 2, the most dynamic one. One of the inversions presents unequivocal evidence for its generation by ectopic recombination between transposon copies and another two harbor inverted duplications of non-repetitive DNA at the two breakpoints and were likely generated by staggered single-strand breaks and repair by non-homologous end joining. Four out of 14 breakpoints lay in the intergenic region between preexisting duplicated genes, suggesting an adaptive advantage of separating previously tightly linked duplicates. Four out of 14 breakpoints are associated with transposed genes, suggesting these breakpoints are fragile regions. Finally two inversions contain novel genes at their breakpoints and another three show alterations of genes at breakpoints with potential adaptive significance. D. mojavensis chromosomal inversions were generated by multiple mechanisms, an observation that does not provide support for increased mutation rate as explanation for rapid chromosomal evolution. On the other hand, we have found a number of gene alterations at the breakpoints with putative adaptive consequences that directly point to natural selection as the cause of D. mojavensis rapid chromosomal evolution.

  12. Gene alterations at Drosophila inversion breakpoints provide prima facie evidence for natural selection as an explanation for rapid chromosomal evolution

    Directory of Open Access Journals (Sweden)

    Guillén Yolanda

    2012-02-01

    Full Text Available Abstract Background Chromosomal inversions have been pervasive during the evolution of the genus Drosophila, but there is significant variation between lineages in the rate of rearrangement fixation. D. mojavensis, an ecological specialist adapted to a cactophilic niche under extreme desert conditions, is a chromosomally derived species with ten fixed inversions, five of them not present in any other species. Results In order to explore the causes of the rapid chromosomal evolution in D. mojavensis, we identified and characterized all breakpoints of seven inversions fixed in chromosome 2, the most dynamic one. One of the inversions presents unequivocal evidence for its generation by ectopic recombination between transposon copies and another two harbor inverted duplications of non-repetitive DNA at the two breakpoints and were likely generated by staggered single-strand breaks and repair by non-homologous end joining. Four out of 14 breakpoints lay in the intergenic region between preexisting duplicated genes, suggesting an adaptive advantage of separating previously tightly linked duplicates. Four out of 14 breakpoints are associated with transposed genes, suggesting these breakpoints are fragile regions. Finally two inversions contain novel genes at their breakpoints and another three show alterations of genes at breakpoints with potential adaptive significance. Conclusions D. mojavensis chromosomal inversions were generated by multiple mechanisms, an observation that does not provide support for increased mutation rate as explanation for rapid chromosomal evolution. On the other hand, we have found a number of gene alterations at the breakpoints with putative adaptive consequences that directly point to natural selection as the cause of D. mojavensis rapid chromosomal evolution.

  13. Identical TP53 mutations in pelvic carcinosarcomas and associated serous tubal intraepithelial carcinomas provide evidence of their clonal relationship.

    Science.gov (United States)

    Ardighieri, Laura; Mori, Luigi; Conzadori, Sara; Bugatti, Mattia; Falchetti, Marcella; Donzelli, Carla Maria; Ravaggi, Antonella; Odicino, Franco E; Facchetti, Fabio

    2016-07-01

    Pelvic carcinosarcomas (PCSs) are rare aggressive biphasic tumors that localize in the ovary, fallopian tube, or peritoneum and present frequently as bilateral disease. We undertook a morphological, p53 immunohistochemical and TP53 gene mutational analysis study in a single institution cohort of 16 PCSs in order to investigate the nature of bilateral tumors and to shed light on their origin and pathogenesis. Of the 16 patients, 10 presented with bilateral disease, 6 with a carcinosarcoma in both adnexa, and the remaining cases with a carcinosarcoma in one adnexum and a carcinoma in the opposite. The carcinoma component showed high-grade serous features in 13/16 of cases (81 %). In 10 patients (63 %), a serous tubal intraepithelial carcinoma (STIC) was found, in one case bilateral, making a total of 11 STICs. STIC was found only in cases with a carcinoma component with high-grade serous features. All 10 bilateral tumors and all 11 PCS-associated STICs showed a similar p53 immunostaining pattern. At mutation analysis of the TP53 gene, all five bilateral PCS contained an identical mutation in both localizations. Furthermore, a TP53 mutation was found in 8 of 10 STICs, with an identical mutation in the associated PCS. The finding of similar p53 immunostaining in all bilateral cases and identical TP53 mutations in most PCS-associated STIC provides evidence for a clonal relation between these neoplastic lesions, supporting a metastatic nature of bilateral PCS and suggesting that they have an extraovarian origin in a STIC.

  14. Evidence that periweaning failure-to-thrive syndrome (PFTS) has a genetic predisposition.

    Science.gov (United States)

    Ramis, G; Marco, E; Magaña, V; González-Contreras, P; Swierczynski, G; Abellaneda, J M; Sáez-Acosta, A; Mrowiec, A; Pallarés, F J

    2015-06-06

    Genetic susceptibility or resistance to diseases is currently drawing increasing attention. This work describes two different breeding herds showing signs of periweaning failure-to-thrive syndrome (PFTS), an emergent swine disease. The disease was diagnosed based on clinical picture and confirmed by histopathology. The possibility of main infectious pathogens was ruled out by immunohistochemistry and PCR. In a simple approach, sires of the affected piglets have been determined using microsatellite paternity analysis, including a healthy group in each case. In each of the two farms, a single boar was found to have sired 45-50 per cent sick animals. Removal of this sire from two farms resulted in a significant decrease in the prevalence of the disease among the offspring, in accordance with other two cases diagnosed, although without including a control group. Since the analysed animals belonged to three different genetic lines, these findings point to the existence of individual genetic susceptibility to this syndrome. British Veterinary Association.

  15. Three genetically divergent lineages of the Oryx in eastern Africa: Evidence for an ancient introgressive hybridization

    DEFF Research Database (Denmark)

    Masembe, Charles; Muwanika, Vincent B.; Nyakaana, Silvester

    2006-01-01

    Phylogeographic and population genetic studies using sequence information are frequently used to infer species boundaries and history; and to assess hybridization and population level processes. In this study, partial mitochondrial DNA (mtDNA) control region (423 bp) and cytochrome b sequences (666...... bp) of Oryx beisa sampled from five isolated localities in its entire current range in Africa were analyzed to investigate the extent of genetic variation and differentiation between populations. We observed high nucleotide diversity at the control region in the total sample (6.3%) but within...... populations, it varied considerably ranging from 1.6% to 8.1%. Population pairwise genetic differentiation was generally significantly high (ranging from F ST¿=¿0.15, P

  16. Confirmation of linkage of Best`s macular dystrophy to 11q13, and evidence for genetic heterogeneity

    Energy Technology Data Exchange (ETDEWEB)

    Mansergh, F.C.; Kenna, P.F.; Farrar, G.J. [Trinity College, Dublin (United Kingdom)] [and others

    1994-09-01

    Best`s macular dystrophy, also known as vitelliform macular degeneration, is an autosomal dominant, early onset form of macular degeneration. The disease is characterized by a roughly circular deposit of lipofuscin beneath the pigment epithelium of the retinal macula. Linkage studies were performed in two families, one Irish and one German, segregating typical Best`s macular dystrophy. In the Irish family (BTMD1), linkage analysis mapped the disease causing gene to chromosome 11q13, in a 10 cM region between the microsatellite markers PYGM and D11S871. Both markers showed different recombinants with the disease phenotype. This is a region that has previously shown linkage in families affected with Best`s macular dystrophy. Lod scores of 9.63, 9.12, 6.92, and 6.83 at zero recombination, were obtained with markers D11S1344, D11S1361, D11S1357 and D11S903, respectively. This data places the disease locus definitvely within the region between PYGM and D11S871. Linkage has been significantly excluded in this region in the German family (FamE), thereby providing evidence for genetic heterogeneity in this disease. The retinal specific gene, rod outer membrane protein 1 (ROM1), which maps to this region, has been screened for mutations in family BTMD1 by SSCPE analysis and by direct sequencing. Some of the promoter region, the three exons, and both introns have been sequenced; however, no mutations were found. It is likely that a gene other than ROM1 within this region may be responsible for causing the disease phenotype.

  17. Evidence of a genetic instability induced by the incorporation of a DNA precursor marked with tritium

    International Nuclear Information System (INIS)

    Saintigny, Y.; Laurent, D.; Lahayel, J.B.; Roche, St.; Meynard, D.; Lopez, B.S.

    2009-01-01

    The authors report a molecular geno-toxicology investigation which allowed molecular events induced par intracellular incorporation of tritium to be studied, and the genetic instability resulting from a chronic exposure even at low dose to be analysed. For this purpose, they developed cell models (hamster tumorous cells and human fibroblasts) in which they know how to incorporate given quantities of marked nucleotides in the DNA. They show that the incorporation of tritium, even with doses which are said to be non toxic, causes a prolonged exposure of the cell to a genotoxic stress, and maybe a genetic instability due to a too great number of recombination events

  18. Mitogenomic phylogenetics of fin whales (Balaenoptera physalus spp.: genetic evidence for revision of subspecies.

    Directory of Open Access Journals (Sweden)

    Frederick I Archer

    Full Text Available There are three described subspecies of fin whales (Balaenoptera physalus: B. p. physalus Linnaeus, 1758 in the Northern Hemisphere, B. p. quoyi Fischer, 1829 in the Southern Hemisphere, and a recently described pygmy form, B. p. patachonica Burmeister, 1865. The discrete distribution in the North Pacific and North Atlantic raises the question of whether a single Northern Hemisphere subspecies is valid. We assess phylogenetic patterns using ~16 K base pairs of the complete mitogenome for 154 fin whales from the North Pacific, North Atlantic--including the Mediterranean Sea--and Southern Hemisphere. A Bayesian tree of the resulting 136 haplotypes revealed several well-supported clades representing each ocean basin, with no haplotypes shared among ocean basins. The North Atlantic haplotypes (n = 12 form a sister clade to those from the Southern Hemisphere (n = 42. The estimated time to most recent common ancestor (TMRCA for this Atlantic/Southern Hemisphere clade and 81 of the 97 samples from the North Pacific was approximately 2 Ma. 14 of the remaining North Pacific samples formed a well-supported clade within the Southern Hemisphere. The TMRCA for this node suggests that at least one female from the Southern Hemisphere immigrated to the North Pacific approximately 0.37 Ma. These results provide strong evidence that North Pacific and North Atlantic fin whales should not be considered the same subspecies, and suggest the need for revision of the global taxonomy of the species.

  19. Wasted research when systematic reviews fail to provide a complete and up-to-date evidence synthesis: the example of lung cancer

    OpenAIRE

    Cr?quit, Perrine; Trinquart, Ludovic; Yavchitz, Am?lie; Ravaud, Philippe

    2016-01-01

    Background Multiple treatments are frequently available for a given condition, and clinicians and patients need a comprehensive, up-to-date synthesis of evidence for all competing treatments. We aimed to quantify the waste of research related to the failure of systematic reviews to provide a complete and up-to-date evidence synthesis over time. Methods We performed a series of systematic overviews and networks of randomized trials assessing the gap between evidence covered by systematic revie...

  20. Genome-wide meta-analysis identifies 11 new loci for anthropometric traits and provides insights into genetic architecture

    Science.gov (United States)

    Berndt, Sonja I.; Gustafsson, Stefan; Mägi, Reedik; Ganna, Andrea; Wheeler, Eleanor; Feitosa, Mary F.; Justice, Anne E.; Monda, Keri L.; Croteau-Chonka, Damien C.; Day, Felix R.; Esko, Tõnu; Fall, Tove; Ferreira, Teresa; Gentilini, Davide; Jackson, Anne U.; Luan, Jian’an; Randall, Joshua C.; Vedantam, Sailaja; Willer, Cristen J.; Winkler, Thomas W.; Wood, Andrew R.; Workalemahu, Tsegaselassie; Hu, Yi-Juan; Lee, Sang Hong; Liang, Liming; Lin, Dan-Yu; Min, Josine L.; Neale, Benjamin M.; Thorleifsson, Gudmar; Yang, Jian; Albrecht, Eva; Amin, Najaf; Bragg-Gresham, Jennifer L.; Cadby, Gemma; den Heijer, Martin; Eklund, Niina; Fischer, Krista; Goel, Anuj; Hottenga, Jouke-Jan; Huffman, Jennifer E.; Jarick, Ivonne; Johansson, Åsa; Johnson, Toby; Kanoni, Stavroula; Kleber, Marcus E.; König, Inke R.; Kristiansson, Kati; Kutalik, Zoltán; Lamina, Claudia; Lecoeur, Cecile; Li, Guo; Mangino, Massimo; McArdle, Wendy L.; Medina-Gomez, Carolina; Müller-Nurasyid, Martina; Ngwa, Julius S.; Nolte, Ilja M.; Paternoster, Lavinia; Pechlivanis, Sonali; Perola, Markus; Peters, Marjolein J.; Preuss, Michael; Rose, Lynda M.; Shi, Jianxin; Shungin, Dmitry; Smith, Albert Vernon; Strawbridge, Rona J.; Surakka, Ida; Teumer, Alexander; Trip, Mieke D.; Tyrer, Jonathan; Van Vliet-Ostaptchouk, Jana V.; Vandenput, Liesbeth; Waite, Lindsay L.; Zhao, Jing Hua; Absher, Devin; Asselbergs, Folkert W.; Atalay, Mustafa; Attwood, Antony P.; Balmforth, Anthony J.; Basart, Hanneke; Beilby, John; Bonnycastle, Lori L.; Brambilla, Paolo; Bruinenberg, Marcel; Campbell, Harry; Chasman, Daniel I.; Chines, Peter S.; Collins, Francis S.; Connell, John M.; Cookson, William; de Faire, Ulf; de Vegt, Femmie; Dei, Mariano; Dimitriou, Maria; Edkins, Sarah; Estrada, Karol; Evans, David M.; Farrall, Martin; Ferrario, Marco M.; Ferrières, Jean; Franke, Lude; Frau, Francesca; Gejman, Pablo V.; Grallert, Harald; Grönberg, Henrik; Gudnason, Vilmundur; Hall, Alistair S.; Hall, Per; Hartikainen, Anna-Liisa; Hayward, Caroline; Heard-Costa, Nancy L.; Heath, Andrew C.; Hebebrand, Johannes; Homuth, Georg; Hu, Frank B.; Hunt, Sarah E.; Hyppönen, Elina; Iribarren, Carlos; Jacobs, Kevin B.; Jansson, John-Olov; Jula, Antti; Kähönen, Mika; Kathiresan, Sekar; Kee, Frank; Khaw, Kay-Tee; Kivimaki, Mika; Koenig, Wolfgang; Kraja, Aldi T.; Kumari, Meena; Kuulasmaa, Kari; Kuusisto, Johanna; Laitinen, Jaana H.; Lakka, Timo A.; Langenberg, Claudia; Launer, Lenore J.; Lind, Lars; Lindström, Jaana; Liu, Jianjun; Liuzzi, Antonio; Lokki, Marja-Liisa; Lorentzon, Mattias; Madden, Pamela A.; Magnusson, Patrik K.; Manunta, Paolo; Marek, Diana; März, Winfried; Mateo Leach, Irene; McKnight, Barbara; Medland, Sarah E.; Mihailov, Evelin; Milani, Lili; Montgomery, Grant W.; Mooser, Vincent; Mühleisen, Thomas W.; Munroe, Patricia B.; Musk, Arthur W.; Narisu, Narisu; Navis, Gerjan; Nicholson, George; Nohr, Ellen A.; Ong, Ken K.; Oostra, Ben A.; Palmer, Colin N.A.; Palotie, Aarno; Peden, John F.; Pedersen, Nancy; Peters, Annette; Polasek, Ozren; Pouta, Anneli; Pramstaller, Peter P.; Prokopenko, Inga; Pütter, Carolin; Radhakrishnan, Aparna; Raitakari, Olli; Rendon, Augusto; Rivadeneira, Fernando; Rudan, Igor; Saaristo, Timo E.; Sambrook, Jennifer G.; Sanders, Alan R.; Sanna, Serena; Saramies, Jouko; Schipf, Sabine; Schreiber, Stefan; Schunkert, Heribert; Shin, So-Youn; Signorini, Stefano; Sinisalo, Juha; Skrobek, Boris; Soranzo, Nicole; Stančáková, Alena; Stark, Klaus; Stephens, Jonathan C.; Stirrups, Kathleen; Stolk, Ronald P.; Stumvoll, Michael; Swift, Amy J.; Theodoraki, Eirini V.; Thorand, Barbara; Tregouet, David-Alexandre; Tremoli, Elena; Van der Klauw, Melanie M.; van Meurs, Joyce B.J.; Vermeulen, Sita H.; Viikari, Jorma; Virtamo, Jarmo; Vitart, Veronique; Waeber, Gérard; Wang, Zhaoming; Widén, Elisabeth; Wild, Sarah H.; Willemsen, Gonneke; Winkelmann, Bernhard R.; Witteman, Jacqueline C.M.; Wolffenbuttel, Bruce H.R.; Wong, Andrew; Wright, Alan F.; Zillikens, M. Carola; Amouyel, Philippe; Boehm, Bernhard O.; Boerwinkle, Eric; Boomsma, Dorret I.; Caulfield, Mark J.; Chanock, Stephen J.; Cupples, L. Adrienne; Cusi, Daniele; Dedoussis, George V.; Erdmann, Jeanette; Eriksson, Johan G.; Franks, Paul W.; Froguel, Philippe; Gieger, Christian; Gyllensten, Ulf; Hamsten, Anders; Harris, Tamara B.; Hengstenberg, Christian; Hicks, Andrew A.; Hingorani, Aroon; Hinney, Anke; Hofman, Albert; Hovingh, Kees G.; Hveem, Kristian; Illig, Thomas; Jarvelin, Marjo-Riitta; Jöckel, Karl-Heinz; Keinanen-Kiukaanniemi, Sirkka M.; Kiemeney, Lambertus A.; Kuh, Diana; Laakso, Markku; Lehtimäki, Terho; Levinson, Douglas F.; Martin, Nicholas G.; Metspalu, Andres; Morris, Andrew D.; Nieminen, Markku S.; Njølstad, Inger; Ohlsson, Claes; Oldehinkel, Albertine J.; Ouwehand, Willem H.; Palmer, Lyle J.; Penninx, Brenda; Power, Chris; Province, Michael A.; Psaty, Bruce M.; Qi, Lu; Rauramaa, Rainer; Ridker, Paul M.; Ripatti, Samuli; Salomaa, Veikko; Samani, Nilesh J.; Snieder, Harold; Sørensen, Thorkild I.A.; Spector, Timothy D.; Stefansson, Kari; Tönjes, Anke; Tuomilehto, Jaakko; Uitterlinden, André G.; Uusitupa, Matti; van der Harst, Pim; Vollenweider, Peter; Wallaschofski, Henri; Wareham, Nicholas J.; Watkins, Hugh; Wichmann, H.-Erich; Wilson, James F.; Abecasis, Goncalo R.; Assimes, Themistocles L.; Barroso, Inês; Boehnke, Michael; Borecki, Ingrid B.; Deloukas, Panos; Fox, Caroline S.; Frayling, Timothy; Groop, Leif C.; Haritunian, Talin; Heid, Iris M.; Hunter, David; Kaplan, Robert C.; Karpe, Fredrik; Moffatt, Miriam; Mohlke, Karen L.; O’Connell, Jeffrey R.; Pawitan, Yudi; Schadt, Eric E.; Schlessinger, David; Steinthorsdottir, Valgerdur; Strachan, David P.; Thorsteinsdottir, Unnur; van Duijn, Cornelia M.; Visscher, Peter M.; Di Blasio, Anna Maria; Hirschhorn, Joel N.; Lindgren, Cecilia M.; Morris, Andrew P.; Meyre, David; Scherag, André; McCarthy, Mark I.; Speliotes, Elizabeth K.; North, Kari E.; Loos, Ruth J.F.; Ingelsson, Erik

    2014-01-01

    Approaches exploiting extremes of the trait distribution may reveal novel loci for common traits, but it is unknown whether such loci are generalizable to the general population. In a genome-wide search for loci associated with upper vs. lower 5th percentiles of body mass index, height and waist-hip ratio, as well as clinical classes of obesity including up to 263,407 European individuals, we identified four new loci (IGFBP4, H6PD, RSRC1, PPP2R2A) influencing height detected in the tails and seven new loci (HNF4G, RPTOR, GNAT2, MRPS33P4, ADCY9, HS6ST3, ZZZ3) for clinical classes of obesity. Further, we show that there is large overlap in terms of genetic structure and distribution of variants between traits based on extremes and the general population and little etiologic heterogeneity between obesity subgroups. PMID:23563607

  1. Genetic Evidence of Importation of Drug-Resistant Plasmodium falciparum to Guatemala from the Democratic Republic of the Congo.

    Science.gov (United States)

    Patel, Jaymin C; Taylor, Steve M; Juliao, Patricia C; Parobek, Christian M; Janko, Mark; Gonzalez, Luis Demetrio; Ortiz, Lucia; Padilla, Norma; Tshefu, Antoinette K; Emch, Michael; Udhayakumar, Venkatachalam; Lindblade, Kim; Meshnick, Steven R

    2014-06-01

    Imported malaria threatens control and elimination efforts in countries that have low rates of transmission. In 2010, an outbreak of Plasmodium falciparum malaria was reported among United Nations peacekeeping soldiers from Guatemala who had recently returned from the Democratic Republic of the Congo (DRC). Epidemiologic evidence suggested that the soldiers were infected in the DRC, but local transmission could not be ruled out in all cases. We used population genetic analyses of neutral microsatellites to determine the outbreak source. Genetic relatedness was compared among parasites found in samples from the soldiers and parasite populations collected in the DRC and Guatemala; parasites identified in the soldiers were more closely related to those from the DRC. A phylogenetic clustering analysis confirms this identification with >99.9% confidence. Thus, results support the hypothesis that the soldiers likely imported malaria from the DRC. This study demonstrates the utility of molecular genotyping in outbreak investigations.

  2. No evidence that common genetic risk variation is shared between schizophrenia and autism

    NARCIS (Netherlands)

    Vorstman, Jacob A. S.; Anney, Richard J. L.; Derks, Eske M.; Gallagher, Louise; Gill, Michael; de Jonge, Maretha V.; van Engeland, Herman; Kahn, René S.; Ophoff, Roel A.

    2013-01-01

    The similarity between aspects of the clinical presentation of schizophrenia and autism spectrum disorders (ASD) suggests that elements of the biological etiology may also be shared between these two disorders. Recently, an increasing number of rare, mostly structural genetic variants are reported

  3. Aggressive Behavior between Siblings and the Development of Externalizing Problems: Evidence from a Genetically Sensitive Study

    Science.gov (United States)

    Natsuaki, Misaki N.; Ge, Xiaojia; Reiss, David; Neiderhiser, Jenae M.

    2009-01-01

    This study investigated the prospective links between sibling aggression and the development of externalizing problems using a multilevel modeling approach with a genetically sensitive design. The sample consisted of 780 adolescents (390 sibling pairs) who participated in 2 waves of the Nonshared Environment in Adolescent Development project.…

  4. Genetic evidence for causal relationships between maternal obesity-related traits and birth weight

    NARCIS (Netherlands)

    A.W.R. Tyrrell; R.C. Richmond (Rebecca C.); T.M. Palmer (Tom); B. Feenstra (Bjarke); J. Rangarajan (Janani); S. Metrustry (Sarah); A. Cavadino (Alana); L. Paternoster (Lavinia); L.L. Armstrong (Loren L.); N.M.G. De Silva (N. Maneka G.); A.R. Wood (Andrew); M. Horikoshi (Momoko); F. Geller (Frank); R. Myhre (Ronny); J.P. Bradfield (Jonathan); E. Kreiner-Møller (Eskil); I. Huikari (Ille); J.N. Painter (Jodie N.); J.J. Hottenga (Jouke Jan); C. Allard (Catherine); D. Berry (Diane); L. Bouchard (Luigi); S. Das (Shikta); D.M. Evans (David); H. Hakonarson (Hakon); M.G. Hayes (M. Geoffrey); J. Heikkinen (Jani); A. Hofman (Albert); B.A. Knight (Bridget); P.A. Lind (Penelope); M.I. McCarthy (Mark); G. Mcmahon (George); S.E. Medland (Sarah Elizabeth); M. Melbye (Mads); A.P. Morris (Andrew); M. Nodzenski (Michael); C. Reichetzeder (Christoph); S.M. Ring (Susan); S. Sebert (Sylvain); V. Sengpiel (Verena); T.I.A. Sørensen (Thorkild); G.A.H.M. Willemsen (Gonneke); E.J.C. de Geus (Eco); N.G. Martin (Nicholas); T.D. Spector (Timothy); C. Power (Christine); M.-R. Jarvelin (Marjo-Riitta); H. Bisgaard (Hans); S.F.A. Grant (Struan); C. Nohr (Christian); V.W.V. Jaddoe (Vincent); B. Jacobsson (Bo); J.C. Murray (Jeffrey C.); B. Hocher (Berthold); A.T. Hattersley (Andrew); D.M. Scholtens (Denise M.); G.D. Smith; M.-F. Hivert (Marie-France); J.F. Felix (Janine); E. Hypponen (Elina); W.L. Lowe Jr. (William); T.M. Frayling (Timothy); D.A. Lawlor (Debbie); R.M. Freathy (Rachel)

    2016-01-01

    textabstractIMPORTANCE Neonates born to overweight or obese women are larger and at higher risk of birth complications. Many maternal obesity-related traits are observationally associated with birth weight, but the causal nature of these associations is uncertain. OBJECTIVE To test for genetic

  5. Toward Evidence-Based Genetic Research on Lifelong Premature Ejaculation: A Critical Evaluation of Methodology

    Science.gov (United States)

    2011-01-01

    Recently, four premature ejaculation (PE) subtypes have been distinguished on the basis of the duration of the intravaginal ejaculation latency time (IELT). These four PE subtypes have different etiologies and pathogeneses. Genetic research on PE should consider the existence of these PE subtypes and the accurate measurement of the IELT with a stopwatch. Currently, three methods of genetic research on PE have been used. They differ in the investigated population, tool of measurement, study design, and variables of PE. From animal and human research, it is derived that the central serotonergic system "modulates" ejaculation, whereas the ejaculation (reflex) itself is probably not under direct influence of the serotonergic system, but rather under the influence of other neurotransmitter systems in the spinal cord. For genetic research on PE, it is important to take into account that the (serotonergic) modulation of the IELT is variable among men and may even be absent. This means that serotonergic genetic polymorphisms may only be found in men with PE who respond with an ejaculation delay treatment with a selective serotonin reuptake inhibitor. PMID:21344023

  6. Weight of the evidence of genetic investigations of ancestry informative markers

    DEFF Research Database (Denmark)

    Tvedebrink, Torben; Eriksen, Poul Svante; Mogensen, Helle Smidt

    2018-01-01

    Ancestry-informative markers (AIMs) are markers that give information about the ancestry of individuals. They are used in forensic genetics for predicting the geographic origin of the investigated individual in crime and identification cases. In the exploration of the genogeographic origin...

  7. Evidence for genetic association between chromosome 1q loci and predisposition to colorectal neoplasia.

    Czech Academy of Sciences Publication Activity Database

    Schubert, S.A.; Ruano, D.; Elsayed, F.A.; Boot, A.; Crobach, S.; Sarasqueta, A.F.; Wolffenbuttel, B.; van der Klauw, M.M.; Oosting, J.; Tops, C.M.; van Eijk, R.; Vasen, H.F.; Vossen, R.H.; Nielsen, M.; Castellví-Bel, S.; Ruiz-Ponte, C.; Tomlinson, I.; Dunlop, M.G.; Vodička, Pavel; Wijnen, J.T.; Hes, F.J.; Morreau, H.; de Miranda, N.F.; Sijmons, R.H.; van Wezel, T.

    2017-01-01

    Roč. 117, č. 8 (2017), s. 1215-1223 ISSN 0007-0920 R&D Projects: GA MŠk(CZ) LD14050 Institutional support: RVO:68378041 Keywords : hereditary colorectal cancer * colorectal polyps * homozygosity mapping Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biochemistry and molecular biology Impact factor: 6.176, year: 2016

  8. Behavioral and genetic evidence for a novel animal model of Attention-Deficit/Hyperactivity Disorder Predominantly Inattentive Subtype

    Directory of Open Access Journals (Sweden)

    Zhang-James Y

    2008-12-01

    genomic differences between the WKY/NCrl and WKY/NHsd rats for eight short tandem repeat loci and 2625 SNPs. About 33.5 percent of the genome differs between the two WKY rat substrains, with large stretches of divergence on each chromosome. Discussion These data provide solid behavioral and genetic evidence that the WKY/NCrl and WKY/NHsd rats should be considered as separate substrains. Moreover, the behavioral features of the WKY/NCrl rat indicate that it should be a useful model for ADHD-PI, the primarily inattentive subtype of ADHD. The SD/NTac and the WH/HanTac rats show significant genetic and/or behavioral differences from WKY/NHsd rats and appear not to be appropriate controls in studies using the SHR/NCrl. The present results support the conclusion that SHR/NCrl is the best validated animal model of ADHD-C. The overactivity, impulsiveness and deficient sustained attention of the SHR/NCrl strain are independent behaviors. Thus, overactivity does not account for this strain's impulsiveness and deficient sustained attention. Finally, the present study shows that great care has to be exercised to select the model and comparison groups.

  9. Joint SOGC-CCMG Opinion for Reproductive Genetic Carrier Screening: An Update for All Canadian Providers of Maternity and Reproductive Healthcare in the Era of Direct-to-Consumer Testing.

    Science.gov (United States)

    Wilson, R Douglas; De Bie, Isabelle; Armour, Christine M; Brown, Richard N; Campagnolo, Carla; Carroll, June C; Okun, Nan; Nelson, Tanya; Zwingerman, Rhonda; Audibert, Francois; Brock, Jo-Ann; Brown, Richard N; Campagnolo, Carla; Carroll, June C; De Bie, Isabelle; Johnson, Jo-Ann; Okun, Nan; Pastruck, Melanie; Vallée-Pouliot, Karine; Wilson, R Douglas; Zwingerman, Rhonda; Armour, Christine; Chitayat, David; De Bie, Isabelle; Fernandez, Sara; Kim, Raymond; Lavoie, Josee; Leonard, Norma; Nelson, Tanya; Taylor, Sherry; Van Allen, Margot; Van Karnebeek, Clara

    2016-08-01

    the most responsible maternity provider through the informed consent process with the patient. (III-A; GRADE low/moderate) SOGC OVERVIEW OF RECOMMENDATIONS QUALITY AND GRADE: There was a strong observational/expert opinion (quality and grade) for the genetic carrier literature with randomized controlled trial evidence being available only for the invasive testing. Both the Canadian Task Force on Preventive Health Care quality and classification and the GRADE evidence quality and grade are provided. MEDLINE; PubMed; government neonatal screening websites; key words/common reproductive genetic carrier screened diseases/previous SOGC Guidelines/medical academic societies (Society of Maternal-Fetal Medicine [SMFM]; American College of Medical Genetics and Genomics; American College of Obstetricians and Gynecologists [ACOG]; CCMG; Royal College Obstetrics and Gynaecology [RCOG] [UK]; American Society of Human Genetics [ASHG]; International Society of Prenatal Diagnosis [ISPD])/provincial neonatal screening policies and programs; search terms (carrier screening, prenatal screening, neonatal genetic/metabolic screening, cystic fibrosis (CF), thalassemia, hemoglobinopathy, hemophilia, Fragile X syndrome (FXS), spinal muscular atrophy, Ashkenazi Jewish carrier screening, genetic carrier screening protocols, AR, AD, XL). 10 years (June 2005-September 2015); initial search dates June 30, 2015 and September 15, 2015; completed final search January 4, 2016. Validation of articles was completed by primary authors RD Wilson and I De Bie. Benefits are to provide an evidenced based reproductive genetic carrier screening update consensus based on international opinions and publications for the use of Canadian women, who are planning a pregnancy or who are pregnant and have been identified to be at risk (personal or male partner family or reproductive history) for the transmission of a clinically significant genetic condition to their offspring with associated morbidity and

  10. Explaining individual differences in alcohol intake in adults: evidence for genetic and cultural transmission?

    Science.gov (United States)

    van Beek, Jenny H D A; de Moor, Marleen H M; Geels, Lot M; Willemsen, Gonneke; Boomsma, Dorret I

    2014-03-01

    The current study aimed to describe what proportion of variation in adult alcohol intake is attributable to genetic differences among individuals and what proportion to differences in environmental experiences individuals have been exposed to. Effects of age, gender, spousal resemblance, and cultural transmission of alcohol intake from parents to offspring were taken into account. In a twin-family design, the effects of genetic and cultural transmission and shared and nonshared environment on alcohol intake were estimated with genetic structural equation models. Data originated from adult twins, their siblings, parents (n = 12,587), and spouses (n = 429) registered with the population-based Netherlands Twin Register (63.5% female; ages 18-97 years). Alcohol intake (grams per day) was higher among men than women and increased with age. Broad-sense heritability estimates were similar across sex and age (53%). Spousal resemblance was observed (r = .39) but did not significantly affect the heritability estimates. No effects of cultural transmission were detected. In total, 23% of the variation in alcohol intake was explained by additive genetic effects, 30% by dominant (nonadditive) gene action, and 47% by environmental effects that were not shared among family members. Individual differences in adult alcohol intake are explained by genetic and individual-specific environmental effects. The same genes are expressed in males and females and in younger and older participants. A substantial part of the heritability of alcohol intake is attributable to nonadditive gene action. Effects of cultural transmission that have been reported in adolescence are not present in adulthood.

  11. What kind of evidence is it that Evidence-Based Medicine advocates want health care providers and consumers to pay attention to?

    Directory of Open Access Journals (Sweden)

    Haynes R Brian

    2002-03-01

    Full Text Available Abstract Background In 1992, Evidence-Based Medicine advocates proclaimed a "new paradigm", in which evidence from health care research is the best basis for decisions for individual patients and health systems. Hailed in New York Times Magazine in 2001 as one of the most influential ideas of the year, this approach was initially and provocatively pitted against the traditional teaching of medicine, in which the key elements of knowing for clinical purposes are understanding of basic pathophysiologic mechanisms of disease coupled with clinical experience. This paper reviews the origins, aspirations, philosophical limitations, and practical challenges of evidence-based medicine. Discussion EBM has long since evolved beyond its initial (misconception, that EBM might replace traditional medicine. EBM is now attempting to augment rather than replace individual clinical experience and understanding of basic disease mechanisms. EBM must continue to evolve, however, to address a number of issues including scientific underpinnings, moral stance and consequences, and practical matters of dissemination and application. For example, accelerating the transfer of research findings into clinical practice is often based on incomplete evidence from selected groups of people, who experience a marginal benefit from an expensive technology, raising issues of the generalizability of the findings, and increasing problems with how many and who can afford the new innovations in care. Summary Advocates of evidence-based medicine want clinicians and consumers to pay attention to the best findings from health care research that are both valid and ready for clinical application. Much remains to be done to reach this goal.

  12. Evidence for the control of phytolith formation in Cucurbita fruits by the hard rind (Hr) genetic locus: Archaeological and ecological implications

    Science.gov (United States)

    Piperno, Dolores R.; Holst, Irene; Wessel-Beaver, Linda; Andres, Thomas C.

    2002-01-01

    Many angiosperms, both monocotyledons and dicotyledons, heavily impregnate their vegetative and reproductive organs with solid particles of silicon dioxide (SiO2) known as opaline phytoliths. The underlying mechanisms accounting for the formation of phytoliths in plants are poorly understood, however. Using wild and domesticated species in the genus Cucurbita along with their F1 and F2 progeny, we have demonstrated that the production of large diagnostic phytoliths in fruit rinds exhibits a one-to-one correspondence to the lignification of these structures. We propose that phytolith formation in Cucurbita fruits is primarily determined by a dominant genetic locus, called hard rind (Hr), previously shown to code for lignin deposition. If true, this evidence represents a demonstration of genetic control over phytolith production in a dicotyledon and provides considerable support to hypotheses that silica phytoliths constitute another important system of mechanical defense in plants. Our research also identifies Hr as another single locus controlling more than one important phenotypic difference between wild and domesticated plants, and establishes rind tissue cell structure and hardness under the effects of Hr as an important determinant of phytolith morphology. When recovered from pre-Columbian archaeological sites, Cucurbita phytoliths represent genetically controlled fossil markers of exploitation and domestication in this important economic genus. PMID:12149443

  13. Comparative genome analysis of Lactobacillus plantarum GB-LP3 provides candidates of survival-related genetic factors.

    Science.gov (United States)

    Jeon, Soomin; Jung, Jaehoon; Kim, Kwondo; Yoo, DongAhn; Lee, Chanho; Kang, Jungsun; Cho, Kyungjin; Kang, Dae-Kyung; Kwak, Woori; Yoon, Sook Hee; Kim, Heebal; Cho, Seoae

    2017-09-01

    Lactobacillus plantarum is found in various environmental niches such as in the gastrointestinal tract of an animal host or a fermented food. This species isolated from a certain environment is known to possess a variety of properties according to inhabited environment's adaptation. However, a causal relationship of a genetic factor and phenotype affected by a specific environment has not been systematically comprehended. L. plantarum GB-LP3 strain was isolated from Korean traditional fermented vegetable and the whole genome of GB-LP3 was sequenced. Comparative genome analysis of GB-LP3, with other 14 L. plantarum strains, was conducted. In addition, genomic island regions were investigated. The assembled whole GB-LP3 genome contained a single circular chromosome of 3,206,111bp with the GC content of 44.7%. In the phylogenetic tree analysis, GB-LP3 was in the closest distance from ZJ316. The genomes of GB-LP3 and ZJ316 have the high level of synteny. Functional genes that are related to prophage, bacteriocin, and quorum sensing were found through comparative genomic analysis with ZJ316 and investigation of genomic islands. dN/dS analysis identified that the gene coding for phosphonate ABC transporter ATP-binding protein is evolutionarily accelerated in GB-LP3. Our study found that potential candidate genes that are affected by environmental adaptation in Korea traditional fermented vegetable. Copyright © 2017. Published by Elsevier B.V.

  14. Microsatellite and mitochondrial data provide evidence for a single major introduction for the Neartic leafhopper Scaphoideus titanus in Europe.

    Directory of Open Access Journals (Sweden)

    Daciana Papura

    Full Text Available Scaphoideus titanus, a leafhopper native to North America and invasive in Europe, is the vector of the Flavescence dorée phytoplasma, the causal agent of the most important form of grapevine yellows in European vineyards. We studied 10 polymorphic microsatellite loci and a 623 bp fragment of the mitochondrial cytochrome oxidase II gene in native S. titanus from north-eastern America and introduced European populations, to elucidate the colonization scenario. Consistent with their recent history, invasive European populations were less genetically diverse than American populations for both types of markers, suggesting a recent bottleneck. Significant isolation by distance was detected between American populations but not between European populations. None of the European mitochondrial haplotypes was found in the American vineyards, from which they are assumed to have originated. The precise source of the invasive S. titanus populations therefore remains unclear. Nevertheless, the high heterozygosity of North-East American populations (which contained 92% of the observed alleles suggests that this region is part of the native range of S. titanus. Clustering population genetics analyses with microsatellite and mitochondrial data suggested that European populations originated from a single introduction event. Most of the introduced populations clustered with populations from Long Island, the Atlantic Coast winegrowing region in which Vitis aestivalis occurs.

  15. Evidence for genetic variation in human mate preferences for sexually dimorphic physical traits.

    Directory of Open Access Journals (Sweden)

    Karin J H Verweij

    Full Text Available Intersexual selection has been proposed as an important force in shaping a number of morphological traits that differ between human populations and/or between the sexes. Important to these accounts is the source of mate preferences for such traits, but this has not been investigated. In a large sample of twins, we assess forced-choice, dichotomous mate preferences for height, skin colour, hair colour and length, chest hair, facial hair, and breast size. Across the traits, identical twins reported more similar preferences than nonidentical twins, suggesting genetic effects. However, the relative magnitude of estimated genetic and environmental effects differed greatly and significantly between different trait preferences, with heritability estimates ranging from zero to 57%.

  16. Molecular evidence and high genetic diversity of shrew-borne Seewis virus in Slovenia.

    Science.gov (United States)

    Resman, Katarina; Korva, Miša; Fajs, Luka; Zidarič, Tanja; Trilar, Tomi; Zupanc, Tatjana Avšič

    2013-10-01

    Seewis virus, the shrew-borne hantavirus from Sorex araneus, has been molecularly detected in reservoir hosts in many different central European countries and Russia. Slovenia is a known endemic country for rodent-borne hantaviruses, therefore the aim of the study was to investigate the presence of shrew-borne hantaviruses in insectivores. Viral L, S and M segment have been recovered only from tissue samples of 7 S. araneus, despite several shrew species were tested. Phylogenetic analysis showed high genetic diversity of SWSV in Slovenia, ranging from 3 to 19.4% for different viral segments. The most divergent were M segment sequences, with 19.4% nucleotide divergence among Slovenian strains. Above that, different SWSV strains from Slovenia do not group into separate geographic clusters. While three separate genetic clades were determined, two of them were simultaneously present in one location at the same time. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Host use evolution in Chrysochus milkweed beetles: evidence from behaviour, population genetics and phylogeny.

    Science.gov (United States)

    Dobler, S; Farrell, B D

    1999-08-01

    In two sister species of leaf beetles with overlapping host associations, Chrysochus auratus and C. cobaltinus, we established diet breadth and food preference of local populations for evaluation together with genetic differentiation between populations. While C. auratus turned out to be monophagous on the same plant wherever we collected the beetles, the studied populations of C. cobaltinus fed on three different plant species in the field. Plant preference and ranking of the potential host plants significantly differed between these populations. The amount of genetic differentiation between populations was measured by a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay of a 1300 bp mitochondrial DNA (mtDNA) sequence. In addition, the dominant genotypes of all populations were sequenced. No genetic differentiation between the populations of C. auratus could be detected in the RFLP assay and sequence divergence was low (= 0.3%). In C. cobaltinus, on the other hand, genetic differentiation between populations was high, revealing a lack of gene flow over a much smaller scale and a maximum of 1.3% sequence divergence. C. cobaltinus thereby has the prerequisites for host race formation on different plants from the original host spectrum. Our sequence-based phylogeny estimate allows us to reconstruct historical diet evolution in Chrysochus. Starting from an original association with Asclepiadaceae, the common ancestor of C. auratus and C. cobaltinus included Apocynaceae in its diet. The strict specialization on Apocynum and the loss of acceptance of Asclepiadaceae observed in C. auratus could have resulted from a process similar to that displayed by C. cobaltinus populations.

  18. Can abnormal returns be earned on bandwidth-bounded currencies? Evidence from a genetic algorithm

    OpenAIRE

    Pedro Godinho

    2012-01-01

    Most of the studies about the Foreign Exchange market (Forex) analyse the behaviour of currencies that are allowed to float freely (or almost freely), but some currencies are still bounded by bandwidths (either disclosed or undisclosed). In this paper, I try to find out whether two bandwidth-bounded currencies, the Hong Kong dollar (HKD) and the Singapore dollar (SGD), present opportunities for abnormal returns. I consider a set of trading rules, and I use a genetic algorithm to optimise both...

  19. Genetic evidence reveals improvement opportunities for tissue preparation in forensic analysis

    OpenAIRE

    Romero, Rosa Elena; Sandoval, Alejandro; Arango, Juliana; Camargo, Martha Lucia

    2016-01-01

    Introduction: Paraffin embedded tissues are an excellent alternative to obtain dna, especially when it is not possible to have fresh samples or when the tissue storage and preservation is not feasible; therefore, this sample is the only item available for matching purposes. The success in any genetic analysis implies having adequate tissue fixation and suitable dna extraction methods that allow to obtain good quality and quantity molecules, free of biological, chemical and microbiological con...

  20. Low genetic variation and evidence of limited dispersal in the regionally important Belize manatee

    Science.gov (United States)

    Hunter, M.E.; Auil-Gomez, N. E.; Tucker, K.P.; Bonde, R.K.; Powell, J.; McGuire, P.M.

    2010-01-01

    The Antillean subspecies of the West Indian manatee Trichechus manatus is found throughout Central and South America and the Caribbean. Because of severe hunting pressure during the 17th through 19th centuries, only small populations of the once widespread aquatic mammal remain. Fortunately, protections in Belize reduced hunting in the 1930s and allowed the country's manatee population to become the largest breeding population in the Wider Caribbean. However, increasing and emerging anthropogenic threats such as coastal development, pollution, watercraft collision and net entanglement represent challenges to this ecologically important population. To inform conservation and management decisions, a comprehensive molecular investigation of the genetic diversity, relatedness and population structure of the Belize manatee population was conducted using mitochondrial and microsatellite DNA. Compared with other mammal populations, a low degree of genetic diversity was detected (HE=0.455; NA=3.4), corresponding to the small population size and long-term exploitation. Manatees from the Belize City Cayes and Southern Lagoon system were genetically different, with microsatellite and mitochondrial FST values of 0.029 and 0.078, respectively (P≤0.05). This, along with the distinct habitats and threats, indicates that separate protection of these two groups would best preserve the region's diversity. The Belize population and Florida subspecies appear to be unrelated with microsatellite and mitochondrial FST values of 0.141 and 0.63, respectively (P≤0.001), supporting the subspecies designations and suggesting low vagility throughout the northern Caribbean habitat. Further monitoring and protection may allow an increase in the Belize manatee genetic diversity and population size. A large and expanding Belize population could potentially assist in the recovery of other threatened or functionally extinct Central American Antillean manatee populations.

  1. Genetic evidence for a worldwide chaotic dispersion pattern of the arbovirus vector, Aedes albopictus.

    Directory of Open Access Journals (Sweden)

    Mosè Manni

    2017-01-01

    Full Text Available Invasive species represent a global concern for their rapid spread and the possibility of infectious disease transmission. This is the case of the global invader Aedes albopictus, the Asian tiger mosquito. This species is a vector of medically important arboviruses, notably chikungunya (CHIKV, dengue (DENV and Zika (ZIKV. The reconstruction of the complex colonization pattern of this mosquito has great potential for mitigating its spread and, consequently, disease risks.Classical population genetics analyses and Approximate Bayesian Computation (ABC approaches were combined to disentangle the demographic history of Aedes albopictus populations from representative countries in the Southeast Asian native range and in the recent and more recently colonized areas. In Southeast Asia, the low differentiation and the high co-ancestry values identified among China, Thailand and Japan indicate that, in the native range, these populations maintain high genetic connectivity, revealing their ancestral common origin. China appears to be the oldest population. Outside Southeast Asia, the invasion process in La Réunion, America and the Mediterranean Basin is primarily supported by a chaotic propagule distribution, which cooperates in maintaining a relatively high genetic diversity within the adventive populations.From our data, it appears that independent and also trans-continental introductions of Ae. albopictus may have facilitated the rapid establishment of adventive populations through admixture of unrelated genomes. As a consequence, a great amount of intra-population variability has been detected, and it is likely that this variability may extend to the genetic mechanisms controlling vector competence. Thus, in the context of the invasion process of this mosquito, it is possible that both population ancestry and admixture contribute to create the conditions for the efficient transmission of arboviruses and for outbreak establishment.

  2. Population Genetic Structure and Evidence of Demographic Expansion of the Ayu (Plecoglossus altivelis in East Asia

    Directory of Open Access Journals (Sweden)

    Ye-Seul Kwan

    2012-10-01

    Full Text Available Plecoglossus altivelis (ayu is an amphidromous fish widely distributed in Northeastern Asia from the East China Sea to the northern Japanese coastal waters, encompassing the Korean Peninsula within its range. The shore lines of northeastern region in Asia have severely fluctuated following glaciations in the Quaternary. In the present study, we investigate the population genetic structure and historical demographic change of P. altivelis at a population level in East Asia. Analysis of molecular variance (AMOVA based on 244 mitochondrial control region DNA sequences clearly showed that as the sampling scope extended to a larger geographic area, genetic differentiation began to become significant, particularly among Northeastern populations. A series of hierarchical AMOVA could detect the genetic relationship of three closely located islands between Korea and Japan that might have been tightly connected by the regional Tsushima current. Neutrality and mismatch distribution analyses revealed a strong signature of a recent population expansion of P. altivelis in East Asia, estimated at 126 to 391 thousand years ago during the late Pleistocene. Therefore it suggests that the present population of P. altivelis traces back to its approximate demographic change long before the last glacial maximum. This contrasts our a priori expectation that the most recent glacial event might have the most crucial effect on the present day demography of marine organisms through bottleneck and subsequent increase of effective population size in this region.

  3. Genetic evidence for landscape effects on dispersal in the army ant Eciton burchellii.

    Science.gov (United States)

    Soare, Thomas W; Kumar, Anjali; Naish, Kerry A; O'Donnell, Sean

    2014-01-01

    Inhibited dispersal, leading to reduced gene flow, threatens populations with inbreeding depression and local extinction. Fragmentation may be especially detrimental to social insects because inhibited gene flow has important consequences for cooperation and competition within and among colonies. Army ants have winged males and permanently wingless queens; these traits imply male-biased dispersal. However, army ant colonies are obligately nomadic and have the potential to traverse landscapes. Eciton burchellii, the most regularly nomadic army ant, is a forest interior species: colony raiding activities are limited in the absence of forest cover. To examine whether nomadism and landscape (forest clearing and elevation) affect population genetic structure in a montane E. burchellii population, we reconstructed queen and male genotypes from 25 colonies at seven polymorphic microsatellite loci. Pairwise genetic distances among individuals were compared to pairwise geographical and resistance distances using regressions with permutations, partial Mantel tests and random forests analyses. Although there was no significant spatial genetic structure in queens or males in montane forest, dispersal may be male-biased. We found significant isolation by landscape resistance for queens based on land cover (forest clearing), but not on elevation. Summed colony emigrations over the lifetime of the queen may contribute to gene flow in this species and forest clearing impedes these movements and subsequent gene dispersal. Further forest cover removal may increasingly inhibit Eciton burchellii colony dispersal. We recommend maintaining habitat connectivity in tropical forests to promote population persistence for this keystone species. © 2013 John Wiley & Sons Ltd.

  4. Providing education on evidence-based practice improved knowledge but did not change behaviour: a before and after study

    Directory of Open Access Journals (Sweden)

    Lovarini Meryl

    2005-12-01

    Full Text Available Abstract Background Many health professionals lack the skills to find and appraise published research. This lack of skills and associated knowledge needs to be addressed, and practice habits need to change, for evidence-based practice to occur. The aim of this before and after study was to evaluate the effect of a multifaceted intervention on the knowledge, skills, attitudes and behaviour of allied health professionals. Methods 114 self-selected occupational therapists were recruited. The intervention included a 2-day workshop combined with outreach support for eight months. Support involved email and telephone contact and a workplace visit. Measures were collected at baseline, post-workshop, and eight months later. The primary outcome was knowledge, measured using the Adapted Fresno Test of Evidence-Based Practice (total score 0 to 156. Secondary outcomes were attitude to evidence-based practice (% reporting improved skills and confidence; % reporting barriers, and behaviour measured using an activity diary (% engaging/not engaging in search and appraisal activities, and assignment completion. Results Post-workshop, there were significant gains in knowledge which were maintained at follow-up. The mean difference in the Adapted Fresno Test total score was 20.6 points (95% CI, 15.6 to 25.5. The change from post-workshop to follow-up was small and non-significant (mean difference 1.2 points, 95% CI, -6.0 to 8.5. Fewer participants reported lack of searching and appraisal skills as barriers to evidence-based practice over time (searching = 61%, 53%, 24%; appraisal 60%, 65%, 41%. These differences were statistically significant (p = 0.0001 and 0.010 respectively. Behaviour changed little. Pre-workshop, 6% engaged in critical appraisal increasing to 18% post-workshop and 18% at follow-up. Nearly two thirds (60% were not reading any research literature at follow-up. Twenty-three participants (20.2% completed their assignment. Conclusion Evidence

  5. Impact of an online medical internet site on knowledge and practice of health care providers: a mixed methods study of the Spinal Cord Injury Rehabilitation Evidence project.

    Science.gov (United States)

    Eng, Janice J; Noonan, Vanessa K; Townson, Andrea F; Higgins, Caroline E; Rogers, Jess; Wolfe, Dalton L

    2014-12-23

    It is not known whether ongoing access to a broad-based Internet knowledge resource can influence the practice of health care providers. We undertook a study to evaluate the impact of a Web-based knowledge resource on increasing access to evidence and facilitating best practice of health care providers. The objective of this study was to evaluate (1) the impact of the Spinal Cord Injury Rehabilitation Evidence (SCIRE) project on access to information for health care providers and researchers and (2) how SCIRE influenced health care providers' management of clients. A 4-part mixed methods evaluation was undertaken: (1) monitoring website traffic and utilization using Google Analytics, (2) online survey of users who accessed the SCIRE website, (3) online survey of targeted end-users, that is, rehabilitation health care providers known to work with spinal cord injury (SCI) clients, as well as researchers, and (4) focus groups with health care providers who had previously accessed SCIRE. The online format allowed the content for a relatively specialized field to have far reach (eg, 26 countries and over 6500 users per month). The website survey and targeted end-user survey confirmed that health care providers, as well as researchers perceived that the website increased their access to SCI evidence. Access to SCIRE not only improved knowledge of SCI evidence but helped inform changes to the health providers' clinical practice and improved their confidence in treating SCI clients. The SCIRE information directly influenced the health providers' clinical decision making, in terms of choice of intervention, equipment needs, or assessment tool. A Web-based knowledge resource may be a relatively inexpensive method to increase access to evidence-based information, increase knowledge of the evidence, inform changes to the health providers' practice, and influence their clinical decision making.

  6. Evidence for Genetic Similarity of Vegetative Compatibility Groupings in Sclerotinia homoeocarpa

    Directory of Open Access Journals (Sweden)

    Seog Won Chang

    2014-12-01

    Full Text Available Vegetative compatibility groups (VCGs are determined for many fungi to test for the ability of fungal isolates to undergo heterokaryon formation. In several fungal plant pathogens, isolates belonging to a VCG have been shown to share significantly higher genetic similarity than those of different VCGs. In this study we sought to examine the relationship between VCG and genetic similarity of an important cool season turfgrass pathogen, Sclerotinia homoeocarpa. Twenty-two S. homoeocarpa isolates from the Midwest and Eastern US, which were previously characterized in several studies, were all evaluated for VCG using an improved nit mutant assay. These isolates were also genotyped using 19 microsatellites developed from partial genome sequence of S. homoeocarpa. Additionally, partial sequences of mitochondrial genes cytochrome oxidase II and mitochondrial small subunit (mtSSU rRNA, and the atp6-rns intergenic spacer, were generated for isolates from each nit mutant VCG to determine if mitochondrial haplotypes differed among VCGs. Of the 22 isolates screened, 15 were amenable to the nit mutant VCG assay and were grouped into six VCGs. The 19 microsatellites gave 57 alleles for this set. Unweighted pair group methods with arithmetic mean (UPGMA tree of binary microsatellite data were used to produce a dendrogram of the isolate genotypes based on microsatellite alleles, which showed high genetic similarity of nit mutant VCGs. Analysis of molecular variance of microsatellite data demonstrates that the current nit mutant VCGs explain the microsatellite genotypic variation among isolates better than the previous nit mutant VCGs or the conventionally determined VCGs. Mitochondrial sequences were identical among all isolates, suggesting that this marker type may not be informative for US populations of S. homoeocarpa.

  7. 4-aminobutyrate aminotransferase (ABAT: genetic and pharmacological evidence for an involvement in gastro esophageal reflux disease.

    Directory of Open Access Journals (Sweden)

    Johan Jirholt

    Full Text Available Gastro-esophageal reflux disease (GERD is partly caused by genetic factors. The underlying susceptibility genes are currently unknown, with the exception of COL3A1. We used three independent GERD patient cohorts to identify GERD susceptibility genes. Thirty-six families, demonstrating dominant transmission of GERD were subjected to whole genome microsatellite genotyping and linkage analysis. Five linked regions were identified. Two families shared a linked region (LOD 3.9 and 2.0 on chromosome 16. We used two additional independent GERD patient cohorts, one consisting of 219 trios (affected child with parents and the other an adult GERD case control cohort consisting of 256 cases and 485 controls, to validate individual genes in the linked region through association analysis. Sixty six single nucleotide polymorphism (SNP markers distributed over the nine genes present in the linked region were genotyped in the independent GERD trio cohort. Transmission disequilibrium test analysis followed by multiple testing adjustments revealed a significant genetic association for one SNP located in an intron of the gene 4-aminobutyrate aminotransferase (ABAT (P(adj = 0.027. This association did not replicate in the adult case-control cohort, possibly due to the differences in ethnicity between the cohorts. Finally, using the selective ABAT inhibitor vigabatrin (γ-vinyl GABA in a dog study, we were able to show a reduction of transient lower esophageal sphincter relaxations (TLESRs by 57.3 ± 11.4 % (p = 0.007 and the reflux events from 3.1 ± 0.4 to 0.8 ± 0.4 (p = 0.007. Our results demonstrate the direct involvement of ABAT in pathways affecting lower esophageal sphincter (LES control and identifies ABAT as a genetic risk factor for GERD.

  8. 4-aminobutyrate aminotransferase (ABAT): genetic and pharmacological evidence for an involvement in gastro esophageal reflux disease.

    Science.gov (United States)

    Jirholt, Johan; Asling, Bengt; Hammond, Paul; Davidson, Geoffrey; Knutsson, Mikael; Walentinsson, Anna; Jensen, Jörgen M; Lehmann, Anders; Agreus, Lars; Lagerström-Fermer, Maria

    2011-04-28

    Gastro-esophageal reflux disease (GERD) is partly caused by genetic factors. The underlying susceptibility genes are currently unknown, with the exception of COL3A1. We used three independent GERD patient cohorts to identify GERD susceptibility genes. Thirty-six families, demonstrating dominant transmission of GERD were subjected to whole genome microsatellite genotyping and linkage analysis. Five linked regions were identified. Two families shared a linked region (LOD 3.9 and 2.0) on chromosome 16. We used two additional independent GERD patient cohorts, one consisting of 219 trios (affected child with parents) and the other an adult GERD case control cohort consisting of 256 cases and 485 controls, to validate individual genes in the linked region through association analysis. Sixty six single nucleotide polymorphism (SNP) markers distributed over the nine genes present in the linked region were genotyped in the independent GERD trio cohort. Transmission disequilibrium test analysis followed by multiple testing adjustments revealed a significant genetic association for one SNP located in an intron of the gene 4-aminobutyrate aminotransferase (ABAT) (P(adj) = 0.027). This association did not replicate in the adult case-control cohort, possibly due to the differences in ethnicity between the cohorts. Finally, using the selective ABAT inhibitor vigabatrin (γ-vinyl GABA) in a dog study, we were able to show a reduction of transient lower esophageal sphincter relaxations (TLESRs) by 57.3 ± 11.4 % (p = 0.007) and the reflux events from 3.1 ± 0.4 to 0.8 ± 0.4 (p = 0.007). Our results demonstrate the direct involvement of ABAT in pathways affecting lower esophageal sphincter (LES) control and identifies ABAT as a genetic risk factor for GERD.

  9. Genetic variability in MCF-7 sublines: evidence of rapid genomic and RNA expression profile modifications

    International Nuclear Information System (INIS)

    Nugoli, Mélanie; Theillet, Charles; Chuchana, Paul; Vendrell, Julie; Orsetti, Béatrice; Ursule, Lisa; Nguyen, Catherine; Birnbaum, Daniel; Douzery, Emmanuel JP; Cohen, Pascale

    2003-01-01

    Both phenotypic and cytogenetic variability have been reported for clones of breast carcinoma cell lines but have not been comprehensively studied. Despite this, cell lines such as MCF-7 cells are extensively used as model systems. In this work we documented, using CGH and RNA expression profiles, the genetic variability at the genomic and RNA expression levels of MCF-7 cells of different origins. Eight MCF-7 sublines collected from different sources were studied as well as 3 subclones isolated from one of the sublines by limit dilution. MCF-7 sublines showed important differences in copy number alteration (CNA) profiles. Overall numbers of events ranged from 28 to 41. Involved chromosomal regions varied greatly from a subline to another. A total of 62 chromosomal regions were affected by either gains or losses in the 11 sublines studied. We performed a phylogenetic analysis of CGH profiles using maximum parsimony in order to reconstruct the putative filiation of the 11 MCF-7 sublines. The phylogenetic tree obtained showed that the MCF-7 clade was characterized by a restricted set of 8 CNAs and that the most divergent subline occupied the position closest to the common ancestor. Expression profiles of 8 MCF-7 sublines were analyzed along with those of 19 unrelated breast cancer cell lines using home made cDNA arrays comprising 720 genes. Hierarchical clustering analysis of the expression data showed that 7/8 MCF-7 sublines were grouped forming a cluster while the remaining subline clustered with unrelated breast cancer cell lines. These data thus showed that MCF-7 sublines differed at both the genomic and phenotypic levels. The analysis of CGH profiles of the parent subline and its three subclones supported the heteroclonal nature of MCF-7 cells. This strongly suggested that the genetic plasticity of MCF-7 cells was related to their intrinsic capacity to generate clonal heterogeneity. We propose that MCF-7, and possibly the breast tumor it was derived from, evolved

  10. Fossil and Genetic Evidence for the Polyphyletic Nature of the Planktonic Foraminifera "Globigerinoides", and Description of the New Genus Trilobatus

    Science.gov (United States)

    Spezzaferri, Silvia; Kucera, Michal; Pearson, Paul Nicholas; Wade, Bridget Susan; Rappo, Sacha; Poole, Christopher Robert; Morard, Raphaël; Stalder, Claudio

    2015-01-01

    Planktonic foraminifera are one of the most abundant and diverse protists in the oceans. Their utility as paleo proxies requires rigorous taxonomy and comparison with living and genetically related counterparts. We merge genetic and fossil evidence of “Globigerinoides”, characterized by supplementary apertures on spiral side, in a new approach to trace their “total evidence phylogeny” since their first appearance in the latest Paleogene. Combined fossil and molecular genetic data indicate that this genus, as traditionally understood, is polyphyletic. Both datasets indicate the existence of two distinct lineages that evolved independently. One group includes “Globigerinoides” trilobus and its descendants, the extant “Globigerinoides” sacculifer, Orbulina universa and Sphaeroidinella dehiscens. The second group includes the Globigerinoides ruber clade with the extant G. conglobatus and G. elongatus and ancestors. In molecular phylogenies, the trilobus group is not the sister taxon of the ruber group. The ruber group clusters consistently together with the modern Globoturborotalita rubescens as a sister taxon. The re-analysis of the fossil record indicates that the first “Globigerinoides” in the late Oligocene are ancestral to the trilobus group, whereas the ruber group first appeared at the base of the Miocene with representatives distinct from the trilobus group. Therefore, polyphyly of the genus "Globigerinoides" as currently defined can only be avoided either by broadening the genus concept to include G. rubescens and a large number of fossil species without supplementary apertures, or if the trilobus group is assigned to a separate genus. Since the former is not feasible due to the lack of a clear diagnosis for such a broad genus, we erect a new genus Trilobatus for the trilobus group (type species Globigerina triloba Reuss) and amend Globoturborotalita and Globigerinoides to clarify morphology and wall textures of these genera. In the new

  11. No compelling evidence that sibutramine prolongs life in rodents despite providing a dose-dependent reduction in body weight

    Science.gov (United States)

    Smith, Daniel L.; Robertson, Henry; Desmond, Renee; Nagy, Tim R.; Allison, David B.

    2010-01-01

    Objective The health and longevity effects of body weight reduction resulting from exercise and caloric restriction in rodents are well known, but less is known about whether similar effects occur with weight reduction from the use of a pharmaceutical agent such as sibutramine, a serotonin-norepinephrine reuptake inhibitor. Results & Conclusion Using data from a two-year toxicology study of sibutramine in CD rats and CD-1 mice, despite a dose-dependent reduction in food intake and body weight in rats compared to controls, and a body weight reduction in mice at the highest dose, there was no compelling evidence for reductions in mortality rate. PMID:21079617

  12. Low-density lipoproteins cause atherosclerotic cardiovascular disease. 1. Evidence from genetic, epidemiologic, and clinical studies. A consensus statement from the European Atherosclerosis Society Consensus Panel

    NARCIS (Netherlands)

    Ference, Brian A.; Ginsberg, Henry N.; Graham, Ian; Ray, Kausik K.; Packard, Chris J.; Bruckert, Eric; Hegele, Robert A.; Krauss, Ronald M.; Raal, Frederick J.; Schunkert, Heribert; Watts, Gerald F.; Boren, Jan; Fazio, Sergio; Horton, Jay D.; Masana, Luis; Nicholls, Stephen J.; Nordestgaard, Borge G.; van de Sluis, Bart; Taskinen, Marja-Riitta; Tokgozoglu, Lale; Landmesser, Ulf; Laufs, Ulrich; Wiklund, Olov; Stock, Jane K.; Chapman, M. John; Catapano, Alberico L.

    2017-01-01

    Aims: To appraise the clinical and genetic evidence that low-density lipoproteins (LDLs) cause atherosclerotic cardiovascular disease (ASCVD). Methods and results: We assessed whether the association between LDL and ASCVD fulfils the criteria for causality by evaluating the totality of evidence from

  13. Evidence for coordinate genetic control of Na,K pump density in erythrocytes and lymphocytes

    International Nuclear Information System (INIS)

    DeLuise, M.; Flier, J.S.

    1985-01-01

    The erythrocyte is widely used as a model cell for studies of the Na,K pump in health and disease. However, little is known about the factors that control the number of Na,K pumps expressed on the erythrocytes of a given individual, nor about the extent to which erythrocytes can be used to validly assess the pump density on other cell types. In this report, the authors have compared the interindividual variance of Na,K pump density in erythrocytes of unrelated individuals to that seen with identical twins. Unlike unrelated individuals, in whom pump parameters, i.e., ouabain binding sites, 86 Rb uptake, and cell Na concentration vary widely, identical twin pairs showed no significant intrapair variation for these values. Thus, a role for genetic factors is suggested. In addition, the authors established and validated a method for determining Na,K pump density and pump-mediated 86 Rb uptake in human peripheral lymphocytes. Using this method, they show that whereas Na,K pump density differs markedly between erythrocytes (mean of 285 sites per cell) and lymphocytes (mean 40,600 sites per cell), there is a strong and highly significant correlation (r = 0.79, P less than 0.001) between the pump density in these cell types in any given individual. Taken together, these studies suggest that genetic factors are important determinants of Na,K pump expression, and that pump density appears to be coordinately regulated in two cell types in healthy individuals

  14. Genetic structure of Mount Huang honey bee (Apis cerana) populations: evidence from microsatellite polymorphism.

    Science.gov (United States)

    Liu, Fang; Shi, Tengfei; Huang, Sisi; Yu, Linsheng; Bi, Shoudong

    2016-01-01

    The Mount Huang eastern honey bees ( Apis cerana ) are an endemic population, which is well adapted to the local agricultural and ecological environment. In this study, the genetic structure of seven eastern honey bees ( A. cerana ) populations from Mount Huang in China were analyzed by SSR (simple sequence repeat) markers. The results revealed that 16 pairs of primers used amplified a total of 143 alleles. The number of alleles per locus ranged from 6 to 13, with a mean value of 8.94 alleles per locus. Observed and expected heterozygosities showed mean values of 0.446 and 0.831 respectively. UPGMA cluster analysis grouped seven eastern honey bees in three groups. The results obtained show a high genetic diversity in the honey bee populations studied in Mount Huang, and high differentiation among all the populations, suggesting that scarce exchange of honey bee species happened in Mount Huang. Our study demonstrated that the Mount Huang honey bee populations still have a natural genome worth being protected for conservation.

  15. Evidence that hippocampal-parahippocampal dysfunction is related to genetic risk for schizophrenia.

    Science.gov (United States)

    Di Giorgio, A; Gelao, B; Caforio, G; Romano, R; Andriola, I; D'Ambrosio, E; Papazacharias, A; Elifani, F; Bianco, L Lo; Taurisano, P; Fazio, L; Popolizio, T; Blasi, G; Bertolino, A

    2013-08-01

    Abnormalities in hippocampal-parahippocampal (H-PH) function are prominent features of schizophrenia and have been associated with deficits in episodic memory. However, it remains unclear whether these abnormalities represent a phenotype related to genetic risk for schizophrenia or whether they are related to disease state. We investigated H-PH-mediated behavior and physiology, using blood oxygenation level-dependent functional magnetic resonance imaging (BOLD fMRI), during episodic memory in a sample of patients with schizophrenia, clinically unaffected siblings and healthy subjects. Patients with schizophrenia and unaffected siblings displayed abnormalities in episodic memory performance. During an fMRI memory encoding task, both patients and siblings demonstrated a similar pattern of reduced H-PH engagement compared with healthy subjects. Our findings suggest that the pathophysiological mechanism underlying the inability of patients with schizophrenia to properly engage the H-PH during episodic memory is related to genetic risk for the disorder. Therefore, H-PH dysfunction can be assumed as a schizophrenia susceptibility-related phenotype.

  16. Fragile X-associated primary ovarian insufficiency: evidence for additional genetic contributions to severity.

    Science.gov (United States)

    Hunter, Jessica Ezzell; Epstein, Michael P; Tinker, Stuart W; Charen, Krista H; Sherman, Stephanie L

    2008-09-01

    The fragile X mental retardation gene (FMR1) contains a CGG repeat sequence in its 5' untranslated region that can become unstable and expand in length from generation to generation. Alleles with expanded repeats in the range of approximately 55-199, termed premutation alleles, are associated with an increased risk for fragile-X-associated primary ovarian insufficiency (FXPOI). However, not all women who carry the premutation develop FXPOI. To determine if additional genes could explain variability in onset and severity, we used a random-effects Cox proportional hazards model to analyze age at menopause on 680 women from 225 families who have a history of fragile X syndrome and 321 women from 219 families from the general population. We tested for the presence of a residual additive genetic effect after adjustment for FMR1 repeat length, race, smoking, body mass index, and method of ascertainment. Results showed significant familial aggregation of age at menopause with an estimated additive genetic variance of 0.55-0.96 depending on the parameterization of FMR1 repeat size and definition of age at menopause (P-values ranging between 0.0002 and 0.0027). This is the first study to analyze familial aggregation of FXPOI. This result is important for proper counseling of women who carry FMR1 premutation alleles and for guidance of future studies to identify additional genes that influence ovarian insufficiency. (c) 2008 Wiley-Liss, Inc.

  17. Barcoding of Asian seabass across its geographic range provides evidence for its bifurcation into two distinct species

    Directory of Open Access Journals (Sweden)

    Shubha eVij

    2014-08-01

    Full Text Available Asian seabass or barramundi (Lates calcarifer is an important food fish with commercial value and a wide geographic distribution. Though some reports based on molecular and/or morphological data exist, a comprehensive effort to establish species identity across its range is lacking. In order to address this issue and especially to ascertain whether the wide-spread distribution has resulted in bifurcation of the species, we collected Asian seabass samples from various locations representing the Western and Eastern Coastline of India, Andaman and Nicobar Islands, Bangladesh and Australia. Samples from Malaysia, Indonesia, Thailand and Singapore were collected as part of a previous study. DNA sequence variations, including cytochrome c oxidase subunit 1 (COI, 16S rDNA and the highly variable D-loop (or control region, were examined to establish species delineation. Data from all the sequences analyzed concordantly point to the existence of at least two distinct species - one representing the Indian subcontinent plus Myanmar, and a second, representing Southeast Asia (Singapore, Malaysia, Thailand and Indonesia plus Northern Australia. These data are useful for conservation ecology, aquaculture management, for establishing the extent of genetic diversity in the Asian seabass and implementing selective breeding programs for members of this species complex.

  18. Providers of antenatal care services in Ghana: evidence from Ghana demographic and health surveys 1988-2014.

    Science.gov (United States)

    Dickson, Kwamena Sekyi; Darteh, Eugene Kofuor Maafo; Kumi-Kyereme, Akwasi

    2017-03-14

    Antenatal care is one of the three most essential care - antenatal, delivery and post-natal, given to women during pregnancy and has the potential to contribute towards the achievement of the Sustainable Development Goal (SDG) target 3.1- reducing the global maternal mortality ratio to less than 70 per 100,000 and target 3.8 - achieve universal health coverage. The main objective is to examine the contribution of the various providers of antenatal care services in Ghana from 1988 to 2014. The study uses data from all the six rounds of the Ghana Demographic and Health Survey (GDHS). Binary logistic regression models were applied to examine the association between background characteristics of respondents and providers of antenatal care services. The results show that majority of antenatal care services were provided by nurses over the period under review. The proportion of women who received antenatal care services from nurses improved over the period from 55% in 1988 to 89.5% in 2014. Moreover, there was a decline in antenatal care services provided by traditional birth attendants and women who did not receive antenatal care services from any service provider over the years under review. It was observed that women from rural areas were more likely to utilise antenatal care services provided by traditional birth attendants, whilst those from urban areas were more likely to utilise antenatal care from doctors and nurses. To further improve access to and utilisation of antenatal care services provided by nurses and doctors it is recommended that the Ghana Health Service and the Ministry of Health should put in place systems aimed at improving on the quality of care given such as regular training workshops for health personnel and assessment of patient's satisfaction with services provided. Also, they should encourage women in rural areas especially those from the savannah zone to utilise antenatal care services from skilled providers through social and behaviour

  19. Complete genome sequences of two avian infectious bronchitis viruses isolated in Egypt: Evidence for genetic drift and genetic recombination in the circulating viruses.

    Science.gov (United States)

    Abozeid, Hassanein H; Paldurai, Anandan; Khattar, Sunil K; Afifi, Manal A; El-Kady, Magdy F; El-Deeb, Ayman H; Samal, Siba K

    2017-09-01

    Avian infectious bronchitis virus (IBV) is highly prevalent in chicken populations and is responsible for severe economic losses to poultry industry worldwide. In this study, we report the complete genome sequences of two IBV field strains, CU/1/2014 and CU/4/2014, isolated from vaccinated chickens in Egypt in 2014. The genome lengths of the strains CU/1/2014 and CU/4/2014 were 27,615 and 27,637 nucleotides, respectively. Both strains have a common genome organization in the order of 5'-UTR-1a-1b-S-3a-3b-E-M-4b-4c-5a-5b-N-6b-UTR-poly(A) tail-3'. Interestingly, strain CU/1/2014 showed a novel 15-nt deletion in the 4b-4c gene junction region. Phylogenetic analysis of the full S1 genes showed that the strains CU/1/2014 and CU/4/2014 belonged to IBV genotypes GI-1 lineage and GI-23 lineage, respectively. The genome of strain CU/1/2014 is closely related to vaccine strain H120 but showed genome-wide point mutations that lead to 27, 14, 11, 1, 1, 2, 2, and 2 amino acid differences between the two strains in 1a, 1b, S, 3a, M, 4b, 4c, and N proteins, respectively, suggesting that strain CU/1/2014 is probably a revertant of the vaccine strain H120 and evolved by accumulation of point mutations. Recombination analysis of strain CU/4/2014 showed evidence for recombination from at least three different IBV strains, namely, the Italian strain 90254/2005 (QX-like strain), 4/91, and H120. These results indicate the continuing evolution of IBV field strains by genetic drift and by genetic recombination leading to outbreaks in the vaccinated chicken populations in Egypt. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Circadian pathway genetic variation and cancer risk: evidence from genome-wide association studies.

    Science.gov (United States)

    Mocellin, Simone; Tropea, Saveria; Benna, Clara; Rossi, Carlo Riccardo

    2018-02-19

    Dysfunction of the circadian clock and single polymorphisms of some circadian genes have been linked to cancer susceptibility, although data are scarce and findings inconsistent. We aimed to investigate the association between circadian pathway genetic variation and risk of developing common cancers based on the findings of genome-wide association studies (GWASs). Single nucleotide polymorphisms (SNPs) of 17 circadian genes reported by three GWAS meta-analyses dedicated to breast (Discovery, Biology, and Risk of Inherited Variants in Breast Cancer (DRIVE) Consortium; cases, n = 15,748; controls, n = 18,084), prostate (Elucidating Loci Involved in Prostate Cancer Susceptibility (ELLIPSE) Consortium; cases, n = 14,160; controls, n = 12,724) and lung carcinoma (Transdisciplinary Research In Cancer of the Lung (TRICL) Consortium; cases, n = 12,160; controls, n = 16,838) in patients of European ancestry were utilized to perform pathway analysis by means of the adaptive rank truncated product (ARTP) method. Data were also available for the following subgroups: estrogen receptor negative breast cancer, aggressive prostate cancer, squamous lung carcinoma and lung adenocarcinoma. We found a highly significant statistical association between circadian pathway genetic variation and the risk of breast (pathway P value = 1.9 × 10 -6 ; top gene RORA, gene P value = 0.0003), prostate (pathway P value = 4.1 × 10 -6 ; top gene ARNTL, gene P value = 0.0002) and lung cancer (pathway P value = 6.9 × 10 -7 ; top gene RORA, gene P value = 2.0 × 10 -6 ), as well as all their subgroups. Out of 17 genes investigated, 15 were found to be significantly associated with the risk of cancer: four genes were shared by all three malignancies (ARNTL, CLOCK, RORA and RORB), two by breast and lung cancer (CRY1 and CRY2) and three by prostate and lung cancer (NPAS2, NR1D1 and PER3), whereas four genes were specific for lung cancer

  1. Neotropics provide insights into the emergence of New World monkeys: New dental evidence from the late Oligocene of Peruvian Amazonia.

    Science.gov (United States)

    Marivaux, Laurent; Adnet, Sylvain; Altamirano-Sierra, Ali J; Boivin, Myriam; Pujos, François; Ramdarshan, Anusha; Salas-Gismondi, Rodolfo; Tejada-Lara, Julia V; Antoine, Pierre-Olivier

    2016-08-01

    Recent field efforts in Peruvian Amazonia (Contamana area, Loreto Department) have resulted in the discovery of a late Oligocene (ca. 26.5 Ma; Chambira Formation) fossil primate-bearing locality (CTA-61). In this paper, we analyze the primate material consisting of two isolated upper molars, the peculiar morphology of which allows us to describe a new medium-sized platyrrhine monkey: Canaanimico amazonensis gen. et sp. nov. In addition to the recent discovery of Perupithecus ucayaliensis, a primitive anthropoid taxon of African affinities from the alleged latest Eocene Santa Rosa locality (Peruvian Amazonia), the discovery of Canaanimico adds to the evidence that primates were well-established in the Amazonian Basin during the Paleogene. Our phylogenetic results based on dental evidence show that none of the early Miocene Patagonian taxa (Homunculus, Carlocebus, Soriacebus, Mazzonicebus, Dolichocebus, Tremacebus, and Chilecebus), the late Oligocene Bolivian Branisella, or the Peruvian Canaanimico, is nested within a crown platyrrhine clade. All these early taxa are closely related and considered here as stem Platyrrhini. Canaanimico is nested within the Patagonian Soriacebinae, and closely related to Soriacebus, thereby extending back the soriacebine lineage to 26.5 Ma. Given the limited dental evidence, it is difficult to assess if Canaanimico was engaged in a form of pitheciine-like seed predation as is observed in Soriacebus and Mazzonicebus, but dental microwear patterns recorded on one upper molar indicate that Canaanimico was possibly a fruit and hard-object eater. If Panamacebus, a recently discovered stem cebine from the early Miocene of Panama, indicates that the crown platyrrhine radiation was already well underway by the earliest Miocene, Canaanimico indicates in turn that the "homunculid" radiation (as a part of the stem radiation) was well underway by the late Oligocene. These new data suggest that the stem radiation likely occurred in the Neotropics

  2. Provider Training to Screen and Initiate Evidence-Based Pediatric Obesity Treatment in Routine Practice Settings: A Randomized Pilot Trial.

    Science.gov (United States)

    Kolko, Rachel P; Kass, Andrea E; Hayes, Jacqueline F; Levine, Michele D; Garbutt, Jane M; Proctor, Enola K; Wilfley, Denise E

    This randomized pilot trial evaluated two training modalities for first-line, evidence-based pediatric obesity services (screening and goal setting) among nursing students. Participants (N = 63) were randomized to live interactive training or Web-facilitated self-study training. Pretraining, post-training, and 1-month follow-up assessments evaluated training feasibility, acceptability, and impact (knowledge and skill via simulation). Moderator (previous experience) and predictor (content engagement) analyses were conducted. Nearly all participants (98%) completed assessments. Both types of training were acceptable, with higher ratings for live training and participants with previous experience (ps pediatric obesity services. Copyright © 2016 National Association of Pediatric Nurse Practitioners. Published by Elsevier Inc. All rights reserved.

  3. Phylogeographic Evidence for 2 Genetically Distinct Zoonotic Plasmodium knowlesi Parasites, Malaysia.

    Science.gov (United States)

    Yusof, Ruhani; Ahmed, Md Atique; Jelip, Jenarun; Ngian, Hie Ung; Mustakim, Sahlawati; Hussin, Hani Mat; Fong, Mun Yik; Mahmud, Rohela; Sitam, Frankie Anak Thomas; Japning, J Rovie-Ryan; Snounou, Georges; Escalante, Ananias A; Lau, Yee Ling

    2016-08-01

    Infections of humans with the zoonotic simian malaria parasite Plasmodium knowlesi occur throughout Southeast Asia, although most cases have occurred in Malaysia, where P. knowlesi is now the dominant malaria species. This apparently skewed distribution prompted an investigation of the phylogeography of this parasite in 2 geographically separated regions of Malaysia, Peninsular Malaysia and Malaysian Borneo. We investigated samples collected from humans and macaques in these regions. Haplotype network analyses of sequences from 2 P. knowlesi genes, type A small subunit ribosomal 18S RNA and cytochrome c oxidase subunit I, showed 2 genetically distinct divergent clusters, 1 from each of the 2 regions of Malaysia. We propose that these parasites represent 2 distinct P. knowlesi types that independently became zoonotic. These types would have evolved after the sea-level rise at the end of the last ice age, which separated Malaysian Borneo from Peninsular Malaysia.

  4. Human toddlers' attempts to match two simple behaviors provide no evidence for an inherited, dedicated imitation mechanism.

    Directory of Open Access Journals (Sweden)

    Susan S Jones

    Full Text Available Influential theories of imitation have proposed that humans inherit a neural mechanism - an "active intermodal matching " (AIM mechanism or a mirror neuron system - that functions from birth to automatically match sensory input from others' actions to motor programs for performing those same actions, and thus produces imitation. To test these proposals, 160 1- to 2½-year-old toddlers were asked to imitate two simple movements- bending the arm to make an elbow, and moving the bent elbow laterally. Both behaviors were almost certain to be in each child's repertoire, and the lateral movement was goal-directed (used to hit a plastic cup. Thus, one or both behaviors should have been imitable by toddlers with a functioning AIM or mirror neuron system. Each child saw the two behaviors repeated 18 times, and was encouraged to imitate. Children were also asked to locate their own elbows. Almost no children below age 2 imitated either behavior. Instead, younger children gave clear evidence of a developmental progression, from reproducing only the outcome of the models' movements (hitting the object, through trying (but failing to reproduce the model's arm posture and/or the arm-cup relations they had seen, to accurate imitation of arm bending by age 2 and of both movements by age 2½. Across age levels, almost all children who knew the word 'elbow' imitated both behaviors: very few who did not know the word imitated either behavior. The evidence is most consistent with a view of early imitation as the product of a complex system of language, cognitive, social, and motor competencies that develop in infancy. The findings do not rule out a role for an inherited neural mechanism, but they suggest that such a system would not by itself be sufficient to explain imitation at any age.

  5. Human Toddlers’ Attempts to Match Two Simple Behaviors Provide No Evidence for an Inherited, Dedicated Imitation Mechanism

    Science.gov (United States)

    Jones, Susan S.

    2012-01-01

    Influential theories of imitation have proposed that humans inherit a neural mechanism – an “active intermodal matching “ (AIM) mechanism or a mirror neuron system - that functions from birth to automatically match sensory input from others’ actions to motor programs for performing those same actions, and thus produces imitation. To test these proposals, 160 1- to 2½-year-old toddlers were asked to imitate two simple movements– bending the arm to make an elbow, and moving the bent elbow laterally. Both behaviors were almost certain to be in each child’s repertoire, and the lateral movement was goal-directed (used to hit a plastic cup). Thus, one or both behaviors should have been imitable by toddlers with a functioning AIM or mirror neuron system. Each child saw the two behaviors repeated 18 times, and was encouraged to imitate. Children were also asked to locate their own elbows. Almost no children below age 2 imitated either behavior. Instead, younger children gave clear evidence of a developmental progression, from reproducing only the outcome of the models’ movements (hitting the object), through trying (but failing) to reproduce the model’s arm posture and/or the arm-cup relations they had seen, to accurate imitation of arm bending by age 2 and of both movements by age 2½. Across age levels, almost all children who knew the word ‘elbow’ imitated both behaviors: very few who did not know the word imitated either behavior. The evidence is most consistent with a view of early imitation as the product of a complex system of language, cognitive, social, and motor competencies that develop in infancy. The findings do not rule out a role for an inherited neural mechanism, but they suggest that such a system would not by itself be sufficient to explain imitation at any age. PMID:23251500

  6. Evidence of new risk genetic factor to systemic lupus erythematosus: the UBASH3A gene.

    Directory of Open Access Journals (Sweden)

    Lina-Marcela Diaz-Gallo

    Full Text Available The ubiquitin associated and Src-homology 3 (SH3 domain containing A (UBASH3a is a suppressor of T-cell receptor signaling, underscoring antigen presentation to T-cells as a critical shared mechanism of diseases pathogenesis. The aim of the present study was to determine whether the UBASH3a gene influence the susceptibility to systemic lupus erythematosus (SLE in Caucasian populations. We evaluated five UBASH3a polymorphisms (rs2277798, rs2277800, rs9976767, rs13048049 and rs17114930, using TaqMan® allelic discrimination assays, in a discovery cohort that included 906 SLE patients and 1165 healthy controls from Spain. The SNPs that exhibit statistical significance difference were evaluated in a German replication cohort of 360 SLE patients and 379 healthy controls. The case-control analysis in the Spanish population showed a significant association between the rs9976767 and SLE (Pc = 9.9E-03 OR = 1.21 95%CI = 1.07-1.37 and a trend of association for the rs2277798 analysis (P = 0.09 OR = 0.9 95%CI = 0.79-1.02. The replication in a German cohort and the meta-analysis confirmed that the rs9976767 (Pc = 0.02; Pc = 2.4E-04, for German cohort and meta-analysis, respectively and rs2277798 (Pc = 0.013; Pc = 4.7E-03, for German cohort and meta-analysis, respectively UBASH3a variants are susceptibility factors for SLE. Finally, a conditional regression analysis suggested that the most likely genetic variation responsible for the association was the rs9976767 polymorphism. Our results suggest that UBASH3a gene plays a role in the susceptibility to SLE. Moreover, our study indicates that UBASH3a can be considered as a common genetic factor in autoimmune diseases.

  7. Genetic Relationships among Hylocereus and Selenicereus Vine Cacti (Cactaceae): Evidence from Hybridization and Cytological Studies

    Science.gov (United States)

    TEL-ZUR, NOEMI; ABBO, SHAHAL; BAR-ZVI, DUDY; MIZRAHI, YOSEF

    2004-01-01

    • Background and Aims Hylocereus and Selenicereus are native to tropical and sub-tropical America. Based on its taxonomic status and crossability relations it was postulated that H. megalanthus (syn. S. megalanthus) is an allotetraploid (2n = 4x = 44) derived from natural hybridization between two closely related diploid taxa. The present work aimed at elucidating the genetic relationships between species of the two genera. • Methods Crosses were performed and the putative hybrids were analysed by chromosome counts and morphological traits. The ploidy level of hybrids was confirmed by fluorescent in situ hybridization (FISH) of rDNA sites. Genomic in situ hybridization (GISH) was used in an attempt to identify the putative diploid genome donors of H. megalanthus and an artificial interploid hybrid. • Key Results Reciprocal crosses among four diploid Hylocereus species (H. costaricensis, H. monacanthus (syn. H. polyrhizus), H. undatus and Hylocereus sp.) yielded viable diploid hybrids, with regular chromosome pairing. Reciprocal crosses between these Hylocereus spp. and H. megalanthus yielded viable triploid, pentaploid, hexaploid and aneuploid hybrids. Morphological and phenological traits confirm the hybrid origin. In situ detection of rDNA sites was in accord with the ploidy status of the species and hybrid studied. GISH results indicated that overall sequence composition of H. megalanthus is similar to that of H. ocamponis and S. grandiflorus. High sequence similarity was also found between the parental genomes of H. monacanthus and H. megalanthus in one triploid hybrid. • Conclusions The ease of obtaining partially fertile F1 hybrids and the relative sequence similarity (in GISH study) suggest close genetic relationships among the taxa analysed. PMID:15329334

  8. Genetic and Functional Evidence Supports LPAR1 as a Susceptibility Gene for Hypertension.

    Science.gov (United States)

    Xu, Ke; Ma, Lu; Li, Yang; Wang, Fang; Zheng, Gu-Yan; Sun, Zhijun; Jiang, Feng; Chen, Yundai; Liu, Huirong; Dang, Aimin; Chen, Xi; Chun, Jerold; Tian, Xiao-Li

    2015-09-01

    Essential hypertension is a complex disease affected by genetic and environmental factors and serves as a major risk factor for cardiovascular diseases. Serum lysophosphatidic acid correlates with an elevated blood pressure in rats, and lysophosphatidic acid interacts with 6 subtypes of receptors. In this study, we assessed the genetic association of lysophosphatidic acid receptors with essential hypertension by genotyping 28 single-nucleotide polymorphisms from genes encoding for lysophosphatidic acid receptors, LPAR1, LPAR2, LPAR3, LPAR4, LPAR5, and LPAR6 and their flanking sequences, in 3 Han Chinese cohorts consisting of 2630 patients and 3171 controls in total. We identified a single-nucleotide polymorphism, rs531003 in the 3'-flanking genomic region of LPAR1, associated with hypertension (the Bonferroni corrected P=1.09×10(-5), odds ratio [95% confidence interval]=1.23 [1.13-1.33]). The risk allele C of rs531003 is associated with the increased expression of LPAR1 and the susceptibility of hypertension, particularly in those with a shortage of sleep (P=4.73×10(-5), odds ratio [95% confidence interval]=1.75 [1.34-2.28]). We further demonstrated that blood pressure elevation caused by sleep deprivation and phenylephrine-induced vasoconstriction was both diminished in LPAR1-deficient mice. Together, we show that LPAR1 is a novel susceptibility gene for human essential hypertension and that stress, such as shortage of sleep, increases the susceptibility of patients with risk allele to essential hypertension. © 2015 American Heart Association, Inc.

  9. Two decades of genetic profiling yields first evidence of natal philopatry and long-term fidelity to parturition sites in sharks

    KAUST Repository

    Feldheim, Kevin Andrew

    2013-12-09

    Sharks are a globally threatened group of marine fishes that often breed in their natal region of origin. There has even been speculation that female sharks return to their exact birthplace to breed (\\'natal philopatry\\'), which would have important conservation implications. Genetic profiling of lemon sharks (Negaprion brevirostris) from 20 consecutive cohorts (1993-2012) at Bimini, Bahamas, showed that certain females faithfully gave birth at this site for nearly two decades. At least six females born in the 1993-1997 cohorts returned to give birth 14-17 years later, providing the first direct evidence of natal philopatry in the chondrichthyans. Long-term fidelity to specific nursery sites coupled with natal philopatry highlights the merits of emerging spatial and local conservation efforts for these threatened predators. © 2013 John Wiley & Sons Ltd.

  10. Tree rings provide a new class of phenotypes for genetic associations that foster insights into adaptation of conifers to climate change.

    Science.gov (United States)

    Housset, Johann M; Nadeau, Simon; Isabel, Nathalie; Depardieu, Claire; Duchesne, Isabelle; Lenz, Patrick; Girardin, Martin P

    2018-04-01

    Local adaptation in tree species has been documented through a long history of common garden experiments where functional traits (height, bud phenology) are used as proxies for fitness. However, the ability to identify genes or genomic regions related to adaptation to climate requires the evaluation of traits that precisely reflect how and when climate exerts selective constraints. We combine dendroecology with association genetics to establish a link between genotypes, phenotypes and interannual climatic fluctuations. We illustrate this approach by examining individual tree responses embedded in the annual rings of 233 Pinus strobus trees growing in a common garden experiment representing 38 populations from the majority of its range. We found that interannual variability in growth was affected by low temperatures during spring and autumn, and by summer heat and drought. Among-population variation in climatic sensitivity was significantly correlated with the mean annual temperature of the provenance, suggesting local adaptation. Genotype-phenotype associations using these new tree-ring phenotypes validated nine candidate genes identified in a previous genetic-environment association study. Combining dendroecology with association genetics allowed us to assess tree vulnerability to past climate at fine temporal scales and provides avenues for future genomic studies on functional adaptation in forest trees. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.

  11. Molecular genetic studies of natives on Easter Island: evidence of an early European and Amerindian contribution to the Polynesian gene pool.

    Science.gov (United States)

    Lie, B A; Dupuy, B M; Spurkland, A; Fernández-Viña, M A; Hagelberg, E; Thorsby, E

    2007-01-01

    Most archaeological and linguistic evidence suggest a Polynesian origin of the population of Easter Island (Rapanui), and this view has been supported by the identification of Polynesian mitochondrial DNA (mtDNA) polymorphisms in prehistoric skeletal remains. However, some evidence of an early South American contact also exists (the sweet potato, bottle gourd etc.), but genetic studies have so far failed to show an early Amerindian contribution to the gene pool on Easter Island. To address this issue, we analyzed mtDNA and Y chromosome markers and performed high-resolution human leukocyte antigen (HLA) genotyping of DNA harvested from previously collected sera of 48 reputedly nonadmixed native Easter Islanders. All individuals carried mtDNA types and HLA alleles previously found in Polynesia, and most men carried Y chromosome markers of Polynesian origin, providing further evidence of a Polynesian origin of the population of Easter Island. A few individuals carried HLA alleles and/or Y chromosome markers of European origin. More interestingly, some individuals carried the HLA alleles A*0212 and B*3905, which are of typical Amerindian origin. The genealogy of some of the individuals carrying these non-Polynesian HLA alleles and their haplotypic backgrounds suggest an introduction into Easter Island in the early 1800s, or earlier. Thus, there may have been an early European and Amerindian contribution to the Polynesian gene pool of Easter Island.

  12. Studies of the aggregation of mutant proteins in vitro provide insights into the genetics of amyloid diseases.

    Science.gov (United States)

    Chiti, Fabrizio; Calamai, Martino; Taddei, Niccolo; Stefani, Massimo; Ramponi, Giampietro; Dobson, Christopher M

    2002-12-10

    Protein aggregation and the formation of highly insoluble amyloid structures is associated with a range of debilitating human conditions, which include Alzheimer's disease, Parkinson's disease, and the Creutzfeldt-Jakob disease. Muscle acylphosphatase (AcP) has already provided significant insights into mutational changes that modulate amyloid formation. In the present paper, we have used this system to investigate the effects of mutations that modify the charge state of a protein without affecting significantly the hydrophobicity or secondary structural propensities of the polypeptide chain. A highly significant inverse correlation was found to exist between the rates of aggregation of the protein variants under denaturing conditions and their overall net charge. This result indicates that aggregation is generally favored by mutations that bring the net charge of the protein closer to neutrality. In light of this finding, we have analyzed natural mutations associated with familial forms of amyloid diseases that involve alteration of the net charge of the proteins or protein fragments associated with the diseases. Sixteen mutations have been identified for which the mechanism of action that causes the pathological condition is not yet known or fully understood. Remarkably, 14 of these 16 mutations cause the net charge of the corresponding peptide or protein that converts into amyloid deposits to be reduced. This result suggests that charge has been a key parameter in molecular evolution to ensure the avoidance of protein aggregation and identifies reduction of the net charge as an important determinant in at least some forms of protein deposition diseases.

  13. Adaptation and validation of the Evidence-Based Practice Belief and Implementation scales for French-speaking Swiss nurses and allied healthcare providers.

    Science.gov (United States)

    Verloo, Henk; Desmedt, Mario; Morin, Diane

    2017-09-01

    To evaluate two psychometric properties of the French versions of the Evidence-Based Practice Beliefs and Evidence-Based Practice Implementation scales, namely their internal consistency and construct validity. The Evidence-Based Practice Beliefs and Evidence-Based Practice Implementation scales developed by Melnyk et al. are recognised as valid, reliable instruments in English. However, no psychometric validation for their French versions existed. Secondary analysis of a cross sectional survey. Source data came from a cross-sectional descriptive study sample of 382 nurses and other allied healthcare providers. Cronbach's alpha was used to evaluate internal consistency, and principal axis factor analysis and varimax rotation were computed to determine construct validity. The French Evidence-Based Practice Beliefs and Evidence-Based Practice Implementation scales showed excellent reliability, with Cronbach's alphas close to the scores established by Melnyk et al.'s original versions. Principal axis factor analysis showed medium-to-high factor loading scores without obtaining collinearity. Principal axis factor analysis with varimax rotation of the 16-item Evidence-Based Practice Beliefs scale resulted in a four-factor loading structure. Principal axis factor analysis with varimax rotation of the 17-item Evidence-Based Practice Implementation scale revealed a two-factor loading structure. Further research should attempt to understand why the French Evidence-Based Practice Implementation scale showed a two-factor loading structure but Melnyk et al.'s original has only one. The French versions of the Evidence-Based Practice Beliefs and Evidence-Based Practice Implementation scales can both be considered valid and reliable instruments for measuring Evidence-Based Practice beliefs and implementation. The results suggest that the French Evidence-Based Practice Beliefs and Evidence-Based Practice Implementation scales are valid and reliable and can therefore be used to

  14. Wasted research when systematic reviews fail to provide a complete and up-to-date evidence synthesis: the example of lung cancer.

    Science.gov (United States)

    Créquit, Perrine; Trinquart, Ludovic; Yavchitz, Amélie; Ravaud, Philippe

    2016-01-20

    Multiple treatments are frequently available for a given condition, and clinicians and patients need a comprehensive, up-to-date synthesis of evidence for all competing treatments. We aimed to quantify the waste of research related to the failure of systematic reviews to provide a complete and up-to-date evidence synthesis over time. We performed a series of systematic overviews and networks of randomized trials assessing the gap between evidence covered by systematic reviews and available trials of second-line treatments for advanced non-small cell lung cancer. We searched the Cochrane Database of Systematic Reviews, Database of Abstracts of Reviews of Effects, MEDLINE, EMBASE, and other resources sequentially by year from 2009 to March 2, 2015. We sequentially compared the amount of evidence missing from systematic reviews to the randomized evidence available for inclusion each year. We constructed cumulative networks of randomized evidence over time and evaluated the proportion of trials, patients, treatments, and treatment comparisons not covered by systematic reviews on December 31 each year from 2009 to 2015. We identified 77 trials (28,636 patients) assessing 47 treatments with 54 comparisons and 29 systematic reviews (13 published after 2013). From 2009 to 2015, the evidence covered by existing systematic reviews was consistently incomplete: 45 % to 70 % of trials; 30 % to 58 % of patients; 40 % to 66 % of treatments; and 38 % to 71 % of comparisons were missing. In the cumulative networks of randomized evidence, 10 % to 17 % of treatment comparisons were partially covered by systematic reviews and 55 % to 85 % were partially or not covered. We illustrate how systematic reviews of a given condition provide a fragmented, out-of-date panorama of the evidence for all treatments. This waste of research might be reduced by the development of live cumulative network meta-analyses.

  15. Genetic evidence for gonochoristic reproduction in gynogenetic silver crucian carp (Carassius auratus gibelio bloch) as revealed by RAPD assays.

    Science.gov (United States)

    Zhou, L; Wang, Y; Gui, J F

    2000-11-01

    Sex evolution has been a debating focus in evolutionary genetics. In lower vertebrates of reptiles, amphibians, and fish, a species or a bioform reproduces either sexually or asexually but never both. A few species were found to consist of all females in fish. These all-female species can propagate by asexual reproduction modes, such as gynogenesis and hybridogenesis. However, the coexistence of sexuality and asexuality in a single species was recently noted only in a cyprinid fish silver crucian carp, Carassius auratus gibelio. This fish had been demonstrated to be capable of gynogenesis stimulated by sperm from other related species. Surprisingly, natural populations of this fish consist of a minor but significant portion (approx. 20%) of males. As different clones with specific phenotypic and genetic characteristics have been found, and RAPD markers specific to each clone have recently been identified, this fish offers many advantages for analyzing whether or not genetic recombination occurs between different clones. In this study, artificial propagation was performed in clone F and clone D. Ovulated eggs from clone F were divided into two parts and respectively inseminated with sperm from a clone D male and from a red common carp (Cyprinus carpio) male. The control clone D individuals were selected from gynogenetic offspring of clone D activated by sperm of red common carp. The phenotype and sex ratio in the experimental groups were also observed. Using RAPD molecular markers, which allow for reliable discrimination and genetic analysis of different clones, we have revealed direct molecular evidence for gonochoristic reproduction in the gynogenetic silver crucian carp and confirmed a previous hypothesis that the silver crucian carp might reproduce both gynogenetically and gonochoristically. Therefore, we conclude that the silver crucian carp possesses two reproductive modes, i.e., gynogenetic and gonochoristic reproduction. The response mechanism of two

  16. Sixteen kiwi (Apteryx spp) transcriptomes provide a wealth of genetic markers and insight into sex chromosome evolution in birds.

    Science.gov (United States)

    Ramstad, Kristina M; Miller, Hilary C; Kolle, Gabriel

    2016-05-26

    here will provide a rich resource for polymorphic marker development and studies of adaptation of these highly unusual and endangered birds.

  17. Role of Private Sector in Providing Tuberculosis Care: Evidence from a Population-based Survey in India.

    Science.gov (United States)

    Hazarika, Indrajit

    2011-01-01

    In India, a large segment of the population seeks health care services from individual or institutional private health-care providers for health care. We analyzed a nationally representative data to identify the role of private providers in delivering health care for patients with tuberculosis. The primary data source for the present analysis was the 60(th) round of the National Sample Survey. Distribution frequencies were used to analyze the distribution of key sociodemographic variables and multiple logistic regression was used to analyze the association between these variables and healthcare seeking behavior. A sample of 2203 respondents who had received ambulatory care for tuberculosis, and 4568 respondents who had received inpatient treatment were analyzed. About half of the respondents had attended private facilities for TB care. Sociodemographic variables such as paediatric age group, females, higher level of education, and economic groups were associated with attendance at private sector. Dissatisfaction with services in government facilities was cited as the main reason for preferring private facilities. Private providers play an important role in providing health care services to a large proportion of patients with tuberculosis. There is a need for innovative measures to increase participation of the private sector in the national TB control program and to improve the quality of services in government facilities.

  18. Role of private sector in providing tuberculosis care: Evidence from a population-based survey in India

    Directory of Open Access Journals (Sweden)

    Indrajit Hazarika

    2011-01-01

    Full Text Available Background: In India, a large segment of the population seeks health care services from individual or institutional private health-care providers for health care. We analyzed a nationally representative data to identify the role of private providers in delivering health care for patients with tuberculosis. Materials and Methods: The primary data source for the present analysis was the 60 th round of the National Sample Survey. Distribution frequencies were used to analyze the distribution of key sociodemographic variables and multiple logistic regression was used to analyze the association between these variables and healthcare seeking behavior. Results: A sample of 2203 respondents who had received ambulatory care for tuberculosis, and 4568 respondents who had received inpatient treatment were analyzed. About half of the respondents had attended private facilities for TB care. Sociodemographic variables such as paediatric age group, females, higher level of education, and economic groups were associated with attendance at private sector. Dissatisfaction with services in government facilities was cited as the main reason for preferring private facilities. Conclusions: Private providers play an important role in providing health care services to a large proportion of patients with tuberculosis. There is a need for innovative measures to increase participation of the private sector in the national TB control program and to improve the quality of services in government facilities.

  19. Results of an intervention for individuals and families with BRCA mutations: a model for providing medical updates and psychosocial support following genetic testing.

    Science.gov (United States)

    McKinnon, Wendy; Naud, Shelly; Ashikaga, Taka; Colletti, Rose; Wood, Marie

    2007-08-01

    : Providing medical management updates and long-term support to families with hereditary cancer syndromes in rural areas is a challenge. To address this, we designed a one-day retreat for BRCA1/2 carriers in our region. The retreat included educational updates about medical management, genetic privacy and discrimination, and addressed psychological and family issues. Evaluations completed at the conclusion of the retreat were overwhelmingly positive with requests for a similar event in the future. The impact of this retreat on a variety of health behaviors was assessed. Eligible participants completed questionnaires before and 6 months after the retreat. Questionnaires focused on lifestyle, cancer screening and prevention practices, psychological history and distress, decision-making regarding genetic testing, and family communication issues. For individuals who completed both the pre and post retreat questionnaires, one-half made lifestyle changes and nearly two-thirds increased cancer screening, initiated chemoprevention, completed or planned to complete preventative surgery in the future. We conclude that this type of forum provides a valuable opportunity for BRCA carriers and their families to receive updated medical information, share personal experiences, provide and receive support, as well as change health behaviors.

  20. Dissecting molecular events in thyroid neoplasia provides evidence for distinct evolution of follicular thyroid adenoma and carcinoma.

    Science.gov (United States)

    Krause, Kerstin; Prawitt, Susanne; Eszlinger, Markus; Ihling, Christian; Sinz, Andrea; Schierle, Katrin; Gimm, Oliver; Dralle, Henning; Steinert, Frank; Sheu, Sien-Yi; Schmid, Kurt W; Fuhrer, Dagmar

    2011-12-01

    Benign hypofunctional cold thyroid nodules (CTNs) are a frequent scintiscan finding and need to be distinguished from thyroid carcinomas. The origin of CTNs with follicular morphologic features is unresolved. The DNA damage response might act as a physiologic barrier, inhibiting the progression of preneoplastic lesions to neoplasia. We investigated the following in hypofunctional follicular adenoma (FA) and follicular thyroid cancer (FTC): i) the mutation rate of frequently activated oncogenes, ii) the activation of DNA damage response checkpoints, and iii) the differential proteomic pattern between FA and FTC. Both FTC and FA, which did not harbor RAS, phosphoinositide-3-kinase, or PAX/peroxisome proliferator activated receptor-γ mutations, express various proteins in common and others that are more distinctly expressed in FTC rather than in FA or normal thyroid tissue. This finding is in line with the finding of constitutive DNA damage checkpoint activation (p-Chk2, γ-H2AX) and evidence for replicative stress causing genomic instability (increased cyclin E, retinoblastoma, or E2F1 mRNA expression) in FTC but not FA. We discuss the findings of the increased expression of translationally controlled tumor protein, phosphatase 2A inhibitor, and DJ-1 in FTC compared with FA identified by proteomics and their potential implication in follicular thyroid carcinogenesis. Our present findings argue for the definition of FA as a truly benign entity and against progressive development of FA to FTC. Copyright © 2011 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  1. Population Trends of Central European Montane Birds Provide Evidence for Adverse Impacts of Climate Change on High-Altitude Species.

    Directory of Open Access Journals (Sweden)

    Jiří Flousek

    Full Text Available Climate change is among the most important global threats to biodiversity and mountain areas are supposed to be under especially high pressure. Although recent modelling studies suggest considerable future range contractions of montane species accompanied with increased extinction risk, data allowing to test actual population consequences of the observed climate changes and identifying traits associated to their adverse impacts are very scarce. To fill this knowledge gap, we estimated long-term population trends of montane birds from 1984 to 2011 in a central European mountain range, the Giant Mountains (Krkonoše, where significant warming occurred over this period. We then related the population trends to several species' traits related to the climate change effects. We found that the species breeding in various habitats at higher altitudes had more negative trends than species breeding at lower altitudes. We also found that the species moved upwards as a response to warming climate, and these altitudinal range shifts were associated with more positive population trends at lower altitudes than at higher altitudes. Moreover, long-distance migrants declined more than residents or species migrating for shorter distances. Taken together, these results indicate that the climate change, besides other possible environmental changes, already influences populations of montane birds with particularly adverse impacts on high-altitude species such as water pipit (Anthus spinoletta. It is evident that the alpine species, predicted to undergo serious climatically induced range contractions due to warming climate in the future, already started moving along this trajectory.

  2. Evidence of a plate-wide tectonic pressure pulse provided by extensometric monitoring in the Balkan Mountains (Bulgaria

    Directory of Open Access Journals (Sweden)

    Briestenský Miloš

    2015-10-01

    Full Text Available The EU-TecNet monitoring network uses customized three-dimensional extensometers to record transient deformations across individual faults. This paper presents the first results from two newly established monitoring points in the Balkan Mountains in Bulgaria. The data from Saeva Dupka, recorded across an EEN-WWS striking fault, show sinistral strike-slip along the fault and subsidence of the southern block. Much of the subsidence occurred around the time of the distal MW = 5.6 Pernik Earthquake. An important transient deformation event, which began in autumn 2012, was reflected by significant compression and following extension, across the monitored fault. The data from Bacho Kiro, recorded across a NE–SW striking fault, show sinistral strike-slip along the fault and subsidence of the north-western block. The same important deformation event was reflected by changes in the strike-slip, dip-slip, and horizontal opening/closing trends. These results have been compared to data from other monitoring points in the Western Carpathians, External Dinarides, and Tian Shan. Many of the sites show evidence of simultaneous displacement anomalies and this observation is interpreted as a reflection of the plate-wide propagation of a tectonic pressure pulse towards the end of 2012.

  3. Haplotype Study in SCA10 Families Provides Further Evidence for a Common Ancestral Origin of the Mutation.

    Science.gov (United States)

    Bampi, Giovana B; Bisso-Machado, Rafael; Hünemeier, Tábita; Gheno, Tailise C; Furtado, Gabriel V; Veliz-Otani, Diego; Cornejo-Olivas, Mario; Mazzeti, Pillar; Bortolini, Maria Cátira; Jardim, Laura B; Saraiva-Pereira, Maria Luiza

    2017-12-01

    Spinocerebellar ataxia type 10 (SCA10) is an autosomal dominant neurodegenerative disorder characterized by progressive cerebellar ataxia and epilepsy. The disease is caused by a pentanucleotide ATTCT expansion in intron 9 of the ATXN10 gene on chromosome 22q13.3. SCA10 has shown a geographical distribution throughout America with a likely degree of Amerindian ancestry from different countries so far. Currently available data suggest that SCA10 mutation might have spread out early during the peopling of the Americas. However, the ancestral origin of SCA10 mutation remains under speculation. Samples of SCA10 patients from two Latin American countries were analysed, being 16 families from Brazil (29 patients) and 21 families from Peru (27 patients) as well as 49 healthy individuals from Indigenous Quechua population and 51 healthy Brazilian individuals. Four polymorphic markers spanning a region of 5.2 cM harbouring the ATTCT expansion were used to define the haplotypes, which were genotyped by different approaches. Our data have shown that 19-CGGC-14 shared haplotype was found in 47% of Brazilian and in 63% of Peruvian families. Frequencies from both groups are not statistically different from Quechua controls (57%), but they are statistically different from Brazilian controls (12%) (p Quechuas, 19-15-CGGC-14-10, is found in 50% of Brazilian and in 65% of Peruvian patients with SCA10. These findings bring valuable evidence that ATTCT expansion may have arisen in a Native American chromosome.

  4. A multigenerational family study of oral and hand motor sequencing ability provides evidence for a familial speech sound disorder subtype

    Science.gov (United States)

    Peter, Beate; Raskind, Wendy H.

    2011-01-01

    Purpose To evaluate phenotypic expressions of speech sound disorder (SSD) in multigenerational families with evidence of familial forms of SSD. Method Members of five multigenerational families (N = 36) produced rapid sequences of monosyllables and disyllables and tapped computer keys with repetitive and alternating movements. Results Measures of repetitive and alternating motor speed were correlated within and between the two motor systems. Repetitive and alternating motor speeds increased in children and decreased in adults as a function of age. In two families with children who had severe speech deficits consistent with disrupted praxis, slowed alternating, but not repetitive, oral movements characterized most of the affected children and adults with a history of SSD, and slowed alternating hand movements were seen in some of the biologically related participants as well. Conclusion Results are consistent with a familial motor-based SSD subtype with incomplete penetrance, motivating new clinical questions about motor-based intervention not only in the oral but also the limb system. PMID:21909176

  5. Oldest skeleton of a plesiadapiform provides additional evidence for an exclusively arboreal radiation of stem primates in the Palaeocene

    Science.gov (United States)

    Chester, Stephen G. B.; Williamson, Thomas E.; Bloch, Jonathan I.; Silcox, Mary T.; Sargis, Eric J.

    2017-05-01

    Palaechthonid plesiadapiforms from the Palaeocene of western North America have long been recognized as among the oldest and most primitive euarchontan mammals, a group that includes extant primates, colugos and treeshrews. Despite their relatively sparse fossil record, palaechthonids have played an important role in discussions surrounding adaptive scenarios for primate origins for nearly a half-century. Likewise, palaechthonids have been considered important for understanding relationships among plesiadapiforms, with members of the group proposed as plausible ancestors of Paromomyidae and Microsyopidae. Here, we describe a dentally associated partial skeleton of Torrejonia wilsoni from the early Palaeocene (approx. 62 Ma) of New Mexico, which is the oldest known plesiadapiform skeleton and the first postcranial elements recovered for a palaechthonid. Results from a cladistic analysis that includes new data from this skeleton suggest that palaechthonids are a paraphyletic group of stem primates, and that T. wilsoni is most closely related to paromomyids. New evidence from the appendicular skeleton of T. wilsoni fails to support an influential hypothesis based on inferences from craniodental morphology that palaechthonids were terrestrial. Instead, the postcranium of T. wilsoni indicates that it was similar to that of all other plesiadapiforms for which skeletons have been recovered in having distinct specializations consistent with arboreality.

  6. Evidence of Allopolyploidy in Urochloa humidicola Based on Cytological Analysis and Genetic Linkage Mapping.

    Directory of Open Access Journals (Sweden)

    Bianca B Z Vigna

    Full Text Available The African species Urochloa humidicola (Rendle Morrone & Zuloaga (syn. Brachiaria humidicola (Rendle Schweick. is an important perennial forage grass found throughout the tropics. This species is polyploid, ranging from tetra to nonaploid, and apomictic, which makes genetic studies challenging; therefore, the number of currently available genetic resources is limited. The genomic architecture and evolution of U. humidicola and the molecular markers linked to apomixis were investigated in a full-sib F1 population obtained by crossing the sexual accession H031 and the apomictic cultivar U. humidicola cv. BRS Tupi, both of which are hexaploid. A simple sequence repeat (SSR-based linkage map was constructed for the species from 102 polymorphic and specific SSR markers based on simplex and double-simplex markers. The map consisted of 49 linkage groups (LGs and had a total length of 1702.82 cM, with 89 microsatellite loci and an average map density of 10.6 cM. Eight homology groups (HGs were formed, comprising 22 LGs, and the other LGs remained ungrouped. The locus that controls apospory (apo-locus was mapped in LG02 and was located 19.4 cM from the locus Bh027.c.D2. In the cytological analyses of some hybrids, bi- to hexavalents at diakinesis were observed, as well as two nucleoli in some meiocytes, smaller chromosomes with preferential allocation within the first metaphase plate and asynchronous chromosome migration to the poles during anaphase. The linkage map and the meiocyte analyses confirm previous reports of hybridization and suggest an allopolyploid origin of the hexaploid U. humidicola. This is the first linkage map of an Urochloa species, and it will be useful for future quantitative trait locus (QTL analysis after saturation of the map and for genome assembly and evolutionary studies in Urochloa spp. Moreover, the results of the apomixis mapping are consistent with previous reports and confirm the need for additional studies to search for

  7. APOE moderates the association between lifestyle activities and cognitive performance: evidence of genetic plasticity in aging.

    Science.gov (United States)

    Runge, Shannon K; Small, Brent J; McFall, G Peggy; Dixon, Roger A

    2014-05-01

    The current study examined independent and interactive effects between Apolipoprotein E (APOE) genotype and two types of cognitively-stimulating lifestyle activities (CSLA)-integrated information processing (CSLA-II) and novel information processing (CSLA-NI)-on concurrent and longitudinal changes in cognition. Three-wave data across 6 years of follow-up from the Victoria Longitudinal Study (n=278; ages 55-94) and linear mixed model analyses were used to characterize the effects of APOE genotype and participation in CSLA-II and CSLA-NI in four cognitive domains. Significant CSLA effects on cognition were observed. More frequent participation in challenging activities (i.e., CSLA-NI) was associated with higher baseline scores on word recall, fact recall, vocabulary and verbal fluency. Conversely, higher participation in less cognitively-challenging activities (i.e., CSLA-II) was associated with lower scores on fact recall and verbal fluency. No longitudinal CSLA-cognition effects were found. Two significant genetic effects were observed. First, APOE moderated CSLA-II and CSLA-NI associations with baseline verbal fluency and fact recall scores. Second, APOE non-ɛ4 carriers' baseline performance were more likely to be moderated by CSLA participation, compared to APOE-ɛ4 carriers. Our findings suggest APOE may be a "plasticity" gene that makes individuals more or less amenable to the influence of protective factors such as CSLA.

  8. POPULATION GENETICS. Genomic evidence for the Pleistocene and recent population history of Native Americans.

    Science.gov (United States)

    Raghavan, Maanasa; Steinrücken, Matthias; Harris, Kelley; Schiffels, Stephan; Rasmussen, Simon; DeGiorgio, Michael; Albrechtsen, Anders; Valdiosera, Cristina; Ávila-Arcos, María C; Malaspinas, Anna-Sapfo; Eriksson, Anders; Moltke, Ida; Metspalu, Mait; Homburger, Julian R; Wall, Jeff; Cornejo, Omar E; Moreno-Mayar, J Víctor; Korneliussen, Thorfinn S; Pierre, Tracey; Rasmussen, Morten; Campos, Paula F; de Barros Damgaard, Peter; Allentoft, Morten E; Lindo, John; Metspalu, Ene; Rodríguez-Varela, Ricardo; Mansilla, Josefina; Henrickson, Celeste; Seguin-Orlando, Andaine; Malmström, Helena; Stafford, Thomas; Shringarpure, Suyash S; Moreno-Estrada, Andrés; Karmin, Monika; Tambets, Kristiina; Bergström, Anders; Xue, Yali; Warmuth, Vera; Friend, Andrew D; Singarayer, Joy; Valdes, Paul; Balloux, Francois; Leboreiro, Ilán; Vera, Jose Luis; Rangel-Villalobos, Hector; Pettener, Davide; Luiselli, Donata; Davis, Loren G; Heyer, Evelyne; Zollikofer, Christoph P E; Ponce de León, Marcia S; Smith, Colin I; Grimes, Vaughan; Pike, Kelly-Anne; Deal, Michael; Fuller, Benjamin T; Arriaza, Bernardo; Standen, Vivien; Luz, Maria F; Ricaut, Francois; Guidon, Niede; Osipova, Ludmila; Voevoda, Mikhail I; Posukh, Olga L; Balanovsky, Oleg; Lavryashina, Maria; Bogunov, Yuri; Khusnutdinova, Elza; Gubina, Marina; Balanovska, Elena; Fedorova, Sardana; Litvinov, Sergey; Malyarchuk, Boris; Derenko, Miroslava; Mosher, M J; Archer, David; Cybulski, Jerome; Petzelt, Barbara; Mitchell, Joycelynn; Worl, Rosita; Norman, Paul J; Parham, Peter; Kemp, Brian M; Kivisild, Toomas; Tyler-Smith, Chris; Sandhu, Manjinder S; Crawford, Michael; Villems, Richard; Smith, David Glenn; Waters, Michael R; Goebel, Ted; Johnson, John R; Malhi, Ripan S; Jakobsson, Mattias; Meltzer, David J; Manica, Andrea; Durbin, Richard; Bustamante, Carlos D; Song, Yun S; Nielsen, Rasmus; Willerslev, Eske

    2015-08-21

    How and when the Americas were populated remains contentious. Using ancient and modern genome-wide data, we found that the ancestors of all present-day Native Americans, including Athabascans and Amerindians, entered the Americas as a single migration wave from Siberia no earlier than 23 thousand years ago (ka) and after no more than an 8000-year isolation period in Beringia. After their arrival to the Americas, ancestral Native Americans diversified into two basal genetic branches around 13 ka, one that is now dispersed across North and South America and the other restricted to North America. Subsequent gene flow resulted in some Native Americans sharing ancestry with present-day East Asians (including Siberians) and, more distantly, Australo-Melanesians. Putative "Paleoamerican" relict populations, including the historical Mexican Pericúes and South American Fuego-Patagonians, are not directly related to modern Australo-Melanesians as suggested by the Paleoamerican Model. Copyright © 2015, American Association for the Advancement of Science.

  9. Genetic evidence from mitochondrial DNA corroborates the origin of Tibetan chickens.

    Directory of Open Access Journals (Sweden)

    Long Zhang

    Full Text Available Chicken is the most common poultry species and is important to human societies. Tibetan chicken (Gallus gallus domesticus is a breed endemic to China that is distributed mainly on the Qinghai-Tibet Plateau. However, its origin has not been well characterized. In the present study, we sequenced partial mitochondrial DNA (mtDNA control region of 239 and 283 samples from Tibetan and Sichuan indigenous chickens, respectively. Incorporating 1091 published sequences, we constructed the matrilineal genealogy of Tibetan chickens to further document their domestication history. We found that the genetic structure of the mtDNA haplotypes of Tibetan chickens are dominated by seven major haplogroups (A-G. In addition, phylogenetic and network analyses showed that Tibetan chickens are not distinguishable from the indigenous chickens in surrounding areas. Furthermore, some clades of Tibetan chickens may have originated from game fowls. In summary, our results collectively indicated that Tibetan chickens may have diverged from indigenous chickens in the adjacent regions and hybridized with various chickens.

  10. Evidence of a prominent genetic basis for associations between psychoneurometric traits and common mental disorders.

    Science.gov (United States)

    Venables, Noah C; Hicks, Brian M; Yancey, James R; Kramer, Mark D; Nelson, Lindsay D; Strickland, Casey M; Krueger, Robert F; Iacono, William G; Patrick, Christopher J

    2017-05-01

    Threat sensitivity (THT) and weak inhibitory control (or disinhibition; DIS) are trait constructs that relate to multiple types of psychopathology and can be assessed psychoneurometrically (i.e., using self-report and physiological indicators combined). However, to establish that psychoneurometric assessments of THT and DIS index biologically-based liabilities, it is important to clarify the etiologic bases of these variables and their associations with clinical problems. The current work addressed this important issue using data from a sample of identical and fraternal adult twins (N=454). THT was quantified using a scale measure and three physiological indicators of emotional reactivity to visual aversive stimuli. DIS was operationalized using scores on two scale measures combined with two brain indicators from cognitive processing tasks. THT and DIS operationalized in these ways both showed appreciable heritability (0.45, 0.68), and genetic variance in these traits accounted for most of their phenotypic associations with fear, distress, and substance use disorder symptoms. Our findings suggest that, as indices of basic dispositional liabilities for multiple forms of psychopathology with direct links to neurophysiology, psychoneurometric assessments of THT and DIS represent novel and important targets for biologically-oriented research on psychopathology. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. UV-induced mitotic co-segregation of genetic markers in Candida albicans: Evidence for linkage

    International Nuclear Information System (INIS)

    Crandall, M.

    1983-01-01

    Parasexual genetic studies of the medically important yeast Candida albicans were performed using the method of UV-induced mitotic segregation. UV-irradiation of the Hoffmann-La Roche type culture of C. albicans yielded a limited spectrum of mutants at a relatively high fequency. This observation suggested natural heterozygosity. Canavanine-sensitive (CanS) segregants were induced at a frequency of 7.6 . 10 -3 . Double mutants that were both CanS and methionine (Met - ) auxotrophs were induced at a frequency of 7.4 . 10 -3 . The single Met - segregant class was missing indicating linkage. UV-induced CanS or Met - CanS segregants occurred occasionally in twin-sectored colonies. Analyses of the sectors as well as the observed and missing classes of segregants indicated that genes met and can are linked in the cis configuration. The proposed gene order is: centromere - met - can. Thus, it is concluded that the Hoffmann-La Roche strain of C. albicans is naturally heterozygous at two linked loci. These findings are consistent with diploidy. (orig.)

  12. Pendred syndrome: evidence for genetic homogeneity and further refinement of linkage.

    Science.gov (United States)

    Gausden, E; Coyle, B; Armour, J A; Coffey, R; Grossman, A; Fraser, G R; Winter, R M; Pembrey, M E; Kendall-Taylor, P; Stephens, D; Luxon, L M; Phelps, P D; Reardon, W; Trembath, R

    1997-02-01

    Pendred syndrome is the association between congenital sensorineural deafness and goitre. The disorder is characterised by the incomplete discharge of radioiodide from a primed thyroid following perchlorate challenge. However, the molecular basis of the association between hearing loss and a defect in organification of iodide remains unclear. Pendred syndrome is inherited as an autosomal recessive trait and has recently been mapped to 7q31 coincident with the non-syndromic deafness locus DFNB4. To define the critical linkage interval for Pendred syndrome we have studied five kindreds, each with members affected by Pendred syndrome. All families support linkage to the chromosome 7 region, defined by the microsatellite markers D7S501-D7S523. Detailed haplotype analysis refines the Pendred syndrome linkage interval to a region flanked by the marker loci D7S501 and D7S525, separated by a genetic distance estimated to be 2.5 cM. As potential candidate genes have as yet not been mapped to this interval, these data will contribute to a positional cloning approach for the identification of the Pendred syndrome gene.

  13. Glomus tumors in neurofibromatosis type 1: genetic, functional, and clinical evidence of a novel association.

    Science.gov (United States)

    Brems, Hilde; Park, Caroline; Maertens, Ophélia; Pemov, Alexander; Messiaen, Ludwine; Messia, Ludwine; Upadhyaya, Meena; Claes, Kathleen; Beert, Eline; Peeters, Kristel; Mautner, Victor; Sloan, Jennifer L; Yao, Lawrence; Lee, Chyi-Chia Richard; Sciot, Raf; De Smet, Luc; Legius, Eric; Stewart, Douglas R

    2009-09-15

    Neurofibromatosis type 1 (NF1) is a common disorder that arises secondary to mutations in the tumor suppressor gene NF1. Glomus tumors are small, benign but painful tumors that originate from the glomus body, a thermoregulatory shunt concentrated in the fingers and toes. We report 11 individuals with NF1 who harbored 20 glomus tumors of the fingers and 1 in the toe; 5 individuals had multiple glomus tumors. We hypothesized that biallelic inactivation of NF1 underlies the pathogenesis of these tumors. In 12 NF1-associated glomus tumors, we used cell culture and laser capture microdissection to isolate DNA. We also analyzed two sporadic (not NF1-associated) glomus tumors. Genetic analysis showed germ line and somatic NF1 mutations in seven tumors. RAS mitogen-activated protein kinase hyperactivation was observed in cultured NF1(-/-) glomus cells, reflecting a lack of inhibition of the pathway by functional neurofibromin, the protein product of NF1. No abnormalities in NF1 or RAS mitogen-activated protein kinase activation were found in sporadic glomus tumors. By comparative genomic hybridization, we observed amplification of the 3'-end of CRTAC1 and a deletion of the 5'-end of WASF1 in two NF1-associated glomus tumors. For the first time, we show that loss of neurofibromin function is crucial in the pathogenesis of glomus tumors in NF1. Glomus tumors of the fingers or toes should be considered as part of the tumor spectrum of NF1.

  14. Genetic risk for schizophrenia, obstetric complications, and adolescent school outcome: evidence for gene-environment interaction.

    Science.gov (United States)

    Forsyth, Jennifer K; Ellman, Lauren M; Tanskanen, Antti; Mustonen, Ulla; Huttunen, Matti O; Suvisaari, Jaana; Cannon, Tyrone D

    2013-09-01

    Low birth weight (LBW) and hypoxia are among the environmental factors most reliably associated with schizophrenia; however, the nature of this relationship is unclear and both gene-environment interaction and gene-environment covariation models have been proposed as explanations. High-risk (HR) designs that explore whether obstetric complications differentially predict outcomes in offspring at low risk (LR) vs HR for schizophrenia, while accounting for differences in rates of maternal risk factors, may shed light on this question. This study used prospectively obtained data to examine relationships between LBW and hypoxia on school outcome at age 15-16 years in a Finnish sample of 1070 offspring at LR for schizophrenia and 373 offspring at HR for schizophrenia, based on parental psychiatric history. Controlling for offspring sex, maternal smoking, social support, parity, age, and number of prenatal care visits, HR offspring performed worse than LR offspring across academic, nonacademic, and physical education domains. LBW predicted poorer academic and physical education performance in HR offspring, but not in LR offspring, and this association was similar for offspring of fathers vs mothers with schizophrenia. Hypoxia predicted poorer physical education score across risk groups. Rates of LBW and hypoxia were similar for LR and HR offspring and for offspring of fathers vs mothers with schizophrenia. Results support the hypothesis that genetic susceptibility to schizophrenia confers augmented vulnerability of the developing brain to the effects of obstetric complications, possibly via epigenetic mechanisms.

  15. Evidence of genetic predisposition for metabolically healthy obesity and metabolically obese normal weight

    DEFF Research Database (Denmark)

    Huang, Lam Opal; Loos, Ruth JF; Oskari Kilpeläinen, Tuomas

    2018-01-01

    Obesity has evolved into a global pandemic that constitutes a major threat to public health. The majority of obesity-related health care costs are due to cardiometabolic complications, such as insulin resistance, dyslipidemia, and hypertension, which are risk factors for Type 2 diabetes and cardi......Obesity has evolved into a global pandemic that constitutes a major threat to public health. The majority of obesity-related health care costs are due to cardiometabolic complications, such as insulin resistance, dyslipidemia, and hypertension, which are risk factors for Type 2 diabetes...... are located in or near genes that implicate pathways involved in adipogenesis, fat distribution, insulin signaling, and insulin resistance. It has been suggested that a threshold for subcutaneous adipose tissue expandability may be at play in the manifestation of MHO and MONW, where expiry of adipose tissue...... storage capacity could lead to ectopic lipid accumulation in non-adipose tissues such as liver, muscle, heart, and pancreatic beta cells. Understanding the genetic aspects of the mechanisms that underpin MHO and MONW is crucial to define appropriate public health action points and to develop effective...

  16. Bio-Spectroscopic Imaging Provides Evidence of Hippocampal Zn Deficiency and Decreased Lipid Unsaturation in an Accelerated Ageing Mouse Model.

    Science.gov (United States)

    Fimognari, Nicholas; Hollings, Ashley; Lam, Virginie; Tidy, Rebecca J; Kewish, Cameron M; Albrecht, Matthew A; Takechi, Ryu; Mamo, John C L; Hackett, Mark J

    2018-06-14

    Western society is facing a health epidemic due to the increasing incidence of dementia in ageing populations, and there are still few effective diagnostic methods, minimal treatment options, and no cure. Ageing is the greatest risk factor for memory loss that occurs during the natural ageing process, as well as being the greatest risk factor for neurodegenerative disease such as Alzheimer's disease. Therefore, greater understanding of the biochemical pathways that drive a healthy ageing brain towards dementia (pathological ageing or Alzheimer's disease), is required to accelerate the development of improved diagnostics and therapies. Unfortunately, many animal models of dementia model chronic amyloid precursor protein over-expression, which although highly relevant to mechanisms of amyloidosis and familial Alzheimer's disease, does not model well dementia during the natural ageing process. A promising animal model reported to model mechanisms of accelerated natural ageing and memory impairments, is the senescence accelerated murine prone strain 8 (SAMP8), which has been adopted by many research group to study the biochemical transitions that occur during brain ageing. A limitation to traditional methods of biochemical characterisation is that many important biochemical and elemental markers (lipid saturation, lactate, transition metals) cannot be imaged at meso- or micro-spatial resolution. Therefore, in this investigation we report the first multi-modal biospectroscopic characterisation of the SAMP8 model, and have identified important biochemical and elemental alterations, and co-localisations, between 4 month old SAMP8 mice and the relevant control (SAMR1) mice. Specifically, we demonstrate direct evidence of altered metabolism and disturbed lipid homeostasis within corpus callosum white matter, in addition to localised hippocampal metal deficiencies, in the accelerated ageing phenotype. Such findings have important implication for future research aimed at

  17. Variable sulfur isotope composition of sulfides provide evidence for multiple sources of contamination in the Rustenburg Layered Suite, Bushveld Complex

    Science.gov (United States)

    Magalhães, Nivea; Penniston-Dorland, Sarah; Farquhar, James; Mathez, Edmond A.

    2018-06-01

    The Rustenburg Layered Suite (RLS) of the Bushveld Complex (BC) is famous for its platinum group element (PGE) ore, which is hosted in sulfides. The source of sulfur necessary to generate this type of mineralization is inferred to be the host rock of the intrusion. The RLS has a sulfur isotopic signature that indicates the presence of Archean surface-derived material (Δ33 S ≠ 0) in the magma. This signature, with an average value of Δ33 S = 0.112 ± 0.024 ‰, deviates from the expected Δ33 S value of the mantle of 0 ± 0.008 ‰. Previous work suggested that this signature is uniform throughout the RLS, which contrasts with radiogenic isotopes which vary throughout the igneous stratigraphy of the RLS. In this study, samples from key intervals within the igneous stratigraphy were analyzed, showing that Δ33 S values vary in the same stratigraphic levels as Sr and Nd isotopes. However, the variation is not consistent; in some levels there is a positive correlation and in others a negative correlation. This observation suggests that in some cases distinct magma pulses contained assimilated sulfur from different sources. Textural analysis shows no evidence for late addition of sulfur. These results also suggest that it is unlikely that large-scale assimilation and/or efficient mixing of host rock material in a single magma chamber occurred during emplacement. The data do not uniquely identify the source of sulfur in the different layers of the RLS, but the variation in sulfur isotope composition and its relationship to radiogenic isotope data calls for a reevaluation of the models for the formation and evolution of the RLS, which has the potential to impact the knowledge of how PGE deposits form.

  18. In search of the Boston Strangler: genetic evidence from the exhumation of Mary Sullivan.

    Science.gov (United States)

    Foran, David R; Starrs, James E

    2004-01-01

    The Boston Strangler was one of the United States' most notorious serial killers, raping and strangling with decorative ligatures thirteen woman in Boston during the early 1960s. Albert DeSalvo, never a suspect in the slayings, confessed in prison (where he was later murdered) to being the Boston Strangler, and the investigation largely ended. Mary Sullivan was the last victim of the Boston Strangler, found sexually assaulted and strangled in her Boston apartment in 1964. Recently, a team of forensic scientists undertook the exhumation and subsequent scientific analysis of Mary Sullivan's remains, in hope of finding consistencies or inconsistencies between DeSalvo's confessed description of the murder and any evidence left behind. Included in these analyses was extensive DNA testing of all UV fluorescent material associated with the body. The large majority of results were negative, however, fluorescent material located on the underwear and entwined in her pubic hair generated two human mitochondrial DNA sequences. Neither of these matched the victim nor members of the forensic team who worked on the evidence. Most importantly, neither DNA sequence could have originated from Albert DeSalvo.

  19. The complex biogeography of the plant pathogen Xylella fastidiosa: genetic evidence of introductions and Subspecific introgression in Central America.

    Science.gov (United States)

    Nunney, Leonard; Ortiz, Beatriz; Russell, Stephanie A; Ruiz Sánchez, Rebeca; Stouthamer, Richard

    2014-01-01

    The bacterium Xylella fastidiosa is a plant pathogen with a history of economically damaging introductions of subspecies to regions where its other subspecies are native. Genetic evidence is presented demonstrating the introduction of two new taxa into Central America and their introgression into the native subspecies, X. fastidiosa subsp. fastidiosa. The data are from 10 genetic outliers detected by multilocus sequence typing (MLST) of isolates from Costa Rica. Six (five from oleander, one from coffee) defined a new sequence type (ST53) that carried alleles at six of the eight loci sequenced (five of the seven MLST loci) diagnostic of the South American subspecies Xylella fastidiosa subsp. pauca which causes two economically damaging plant diseases, citrus variegated chlorosis and coffee leaf scorch. The two remaining loci of ST53 carried alleles from what appears to be a new South American form of X. fastidiosa. Four isolates, classified as X. fastidiosa subsp. fastidiosa, showed a low level of introgression of non-native DNA. One grapevine isolate showed introgression of an allele from X. fastidiosa subsp. pauca while the other three (from citrus and coffee) showed introgression of an allele with similar ancestry to the alleles of unknown origin in ST53. The presence of X. fastidiosa subsp. pauca in Central America is troubling given its disease potential, and establishes another route for the introduction of this economically damaging subspecies into the US or elsewhere, a threat potentially compounded by the presence of a previously unknown form of X. fastidiosa.

  20. The complex biogeography of the plant pathogen Xylella fastidiosa: genetic evidence of introductions and Subspecific introgression in Central America.

    Directory of Open Access Journals (Sweden)

    Leonard Nunney

    Full Text Available The bacterium Xylella fastidiosa is a plant pathogen with a history of economically damaging introductions of subspecies to regions where its other subspecies are native. Genetic evidence is presented demonstrating the introduction of two new taxa into Central America and their introgression into the native subspecies, X. fastidiosa subsp. fastidiosa. The data are from 10 genetic outliers detected by multilocus sequence typing (MLST of isolates from Costa Rica. Six (five from oleander, one from coffee defined a new sequence type (ST53 that carried alleles at six of the eight loci sequenced (five of the seven MLST loci diagnostic of the South American subspecies Xylella fastidiosa subsp. pauca which causes two economically damaging plant diseases, citrus variegated chlorosis and coffee leaf scorch. The two remaining loci of ST53 carried alleles from what appears to be a new South American form of X. fastidiosa. Four isolates, classified as X. fastidiosa subsp. fastidiosa, showed a low level of introgression of non-native DNA. One grapevine isolate showed introgression of an allele from X. fastidiosa subsp. pauca while the other three (from citrus and coffee showed introgression of an allele with similar ancestry to the alleles of unknown origin in ST53. The presence of X. fastidiosa subsp. pauca in Central America is troubling given its disease potential, and establishes another route for the introduction of this economically damaging subspecies into the US or elsewhere, a threat potentially compounded by the presence of a previously unknown form of X. fastidiosa.

  1. Genetic variation in the extended major histocompatibility complex and susceptibility to childhood acute lymphoblastic leukemia: a review of the evidence

    Directory of Open Access Journals (Sweden)

    Kevin Y Urayama

    2013-12-01

    Full Text Available The enduring suspicion that infections and immunologic response may play a role in the etiology of childhood leukemia, particularly acute lymphoblastic leukemia (ALL, is now supported, albeit still indirectly, by numerous epidemiological studies. The cumulative evidence includes, for example, descriptive observations of a peculiar peak incidence at age 2-5 years for ALL in economically developed countries, clustering of cases in situations of population mixing associated with unusual patterns of personal contacts, associations with various proxy measures for immune modulatory exposures early in life, and genetic susceptibility conferred by variation in genes involved in the immune system. In this review, our focus is the extended major histocompatibility complex (xMHC, an approximately 7.6 megabase region that is well-known for its high density of expressed genes, extensive polymorphisms exhibiting complex linkage disequilibrium patterns, and its disproportionately large number of immune-related genes, including human leukocyte antigen (HLA. First discovered through the role they play in transplant rejection, the classical HLA class I (HLA-A, -B, and -C and class II (HLA-DR, HLA-DQ, and HLA-DP molecules reside at the epicenter of the immune response pathways and are now the targets of many disease susceptibility studies, including those for childhood leukemia. The genes encoding the HLA molecules are only a minority of the over 250 expressed genes in the xMHC, and a growing number of studies are beginning to evaluate other loci through targeted investigations or utilizing a mapping approach with a comprehensive screen of the entire region. Here, we review the current epidemiologic evidence available to date regarding genetic variation contained within this highly unique region of the genome and its relationship with childhood ALL risk.

  2. Further evidence of the etiology of prune belly syndrome provided by a transient massive intraabdominal cyst in a female.

    Science.gov (United States)

    Wijesinghe, Uddaka S; Muthucumaru, Mathievathaniy; Beasley, Spencer W

    2016-08-01

    We present a female neonate born with prune belly syndrome (PBS) in whom a large intraabdominal cyst was diagnosed at 12weeks of gestation. Rapid and exponential growth of the cyst caused pressure effects on the intraabdominal organs and stretching of the anterior abdominal wall by 19weeks of gestation. This led to drainage of the massive cyst at 20weeks of gestation to prevent fetal demise. This case provides further clues to the likely etiology of PBS: transient stretching and attenuation of the fetal abdominal wall secondary to gross fetal abdominal distension - from any cause. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Combining noninvasive genetics and a new mammalian sex-linked marker provides new tools to investigate population size, structure and individual behaviour: An application to bats.

    Science.gov (United States)

    Zarzoso-Lacoste, Diane; Jan, Pierre-Loup; Lehnen, Lisa; Girard, Thomas; Besnard, Anne-Laure; Puechmaille, Sebastien J; Petit, Eric J

    2018-03-01

    Monitoring wild populations is crucial for their effective management. Noninvasive genetic methods provide robust data from individual free-ranging animals, which can be used in capture-mark-recapture (CMR) models to estimate demographic parameters without capturing or disturbing them. However, sex- and status-specific behaviour, which may lead to differences in detection probabilities, is rarely considered in monitoring. Here, we investigated population size, sex ratio, sex- and status-related behaviour in 19 Rhinolophus hipposideros maternity colonies (Northern France) with a noninvasive genetic CMR approach (using faeces) combined with parentage assignments. The use of the DDX3X/Y-Mam sexual marker designed in this study, which shows inter- and intrachromosomal length polymorphism across placental mammals, together with eight polymorphic microsatellite markers, produced high-quality genetic data with limited genotyping errors and allowed us to reliably distinguish different categories of individuals (males, reproductive and nonreproductive females) and to estimate population sizes. We showed that visual counts represent well-adult female numbers and that population composition in maternity colonies changes dynamically during the summer. Before parturition, colonies mainly harbour pregnant and nonpregnant females with a few visiting males, whereas after parturition, colonies are mainly composed of mothers and their offspring with a few visiting nonmothers and males. Our approach gives deeper insight into sex- and status-specific behaviour, a prerequisite for understanding population dynamics and developing effective monitoring and management strategies. Provided sufficient samples can be obtained, this approach can be readily applied to a wide range of species. © 2017 John Wiley & Sons Ltd.

  4. Genome-wide meta-analysis of myopia and hyperopia provides evidence for replication of 11 loci.

    Directory of Open Access Journals (Sweden)

    Claire L Simpson

    Full Text Available Refractive error (RE is a complex, multifactorial disorder characterized by a mismatch between the optical power of the eye and its axial length that causes object images to be focused off the retina. The two major subtypes of RE are myopia (nearsightedness and hyperopia (farsightedness, which represent opposite ends of the distribution of the quantitative measure of spherical refraction. We performed a fixed effects meta-analysis of genome-wide association results of myopia and hyperopia from 9 studies of European-derived populations: AREDS, KORA, FES, OGP-Talana, MESA, RSI, RSII, RSIII and ERF. One genome-wide significant region was observed for myopia, corresponding to a previously identified myopia locus on 8q12 (p = 1.25×10(-8, which has been reported by Kiefer et al. as significantly associated with myopia age at onset and Verhoeven et al. as significantly associated to mean spherical-equivalent (MSE refractive error. We observed two genome-wide significant associations with hyperopia. These regions overlapped with loci on 15q14 (minimum p value = 9.11×10(-11 and 8q12 (minimum p value 1.82×10(-11 previously reported for MSE and myopia age at onset. We also used an intermarker linkage- disequilibrium-based method for calculating the effective number of tests in targeted regional replication analyses. We analyzed myopia (which represents the closest phenotype in our data to the one used by Kiefer et al. and showed replication of 10 additional loci associated with myopia previously reported by Kiefer et al. This is the first replication of these loci using myopia as the trait under analysis. "Replication-level" association was also seen between hyperopia and 12 of Kiefer et al.'s published loci. For the loci that show evidence of association to both myopia and hyperopia, the estimated effect of the risk alleles were in opposite directions for the two traits. This suggests that these loci are important contributors to variation of

  5. Strong evidence for a genetic contribution to late-onset Alzheimer's disease mortality: a population-based study.

    Directory of Open Access Journals (Sweden)

    John S K Kauwe

    Full Text Available Alzheimer's disease (AD is an international health concern that has a devastating effect on patients and families. While several genetic risk factors for AD have been identified much of the genetic variance in AD remains unexplained. There are limited published assessments of the familiality of Alzheimer's disease. Here we present the largest genealogy-based analysis of AD to date.We assessed the familiality of AD in The Utah Population Database (UPDB, a population-based resource linking electronic health data repositories for the state with the computerized genealogy of the Utah settlers and their descendants. We searched UPDB for significant familial clustering of AD to evaluate the genetic contribution to disease. We compared the Genealogical Index of Familiality (GIF between AD individuals and randomly selected controls and estimated the Relative Risk (RR for a range of family relationships. Finally, we identified pedigrees with a significant excess of AD deaths.The GIF analysis showed that pairs of individuals dying from AD were significantly more related than expected. This excess of relatedness was observed for both close and distant relationships. RRs for death from AD among relatives of individuals dying from AD were significantly increased for both close and more distant relatives. Multiple pedigrees had a significant excess of AD deaths.These data strongly support a genetic contribution to the observed clustering of individuals dying from AD. This report is the first large population-based assessment of the familiality of AD mortality and provides the only reported estimates of relative risk of AD mortality in extended relatives to date. The high-risk pedigrees identified show a true excess of AD mortality (not just multiple cases and are greater in depth and width than published AD pedigrees. The presence of these high-risk pedigrees strongly supports the possibility of rare predisposition variants not yet identified.

  6. Genetic evidence of a causal effect of insulin resistance on branched-chain amino acid levels.

    Science.gov (United States)

    Mahendran, Yuvaraj; Jonsson, Anna; Have, Christian T; Allin, Kristine H; Witte, Daniel R; Jørgensen, Marit E; Grarup, Niels; Pedersen, Oluf; Kilpeläinen, Tuomas O; Hansen, Torben

    2017-05-01

    Fasting plasma levels of branched-chain amino acids (BCAAs) are associated with insulin resistance, but it remains unclear whether there is a causal relation between the two. We aimed to disentangle the causal relations by performing a Mendelian randomisation study using genetic variants associated with circulating BCAA levels and insulin resistance as instrumental variables. We measured circulating BCAA levels in blood plasma by NMR spectroscopy in 1,321 individuals from the ADDITION-PRO cohort. We complemented our analyses by using previously published genome-wide association study (GWAS) results from the Meta-Analyses of Glucose and Insulin-related traits Consortium (MAGIC) (n = 46,186) and from a GWAS of serum BCAA levels (n = 24,925). We used a genetic risk score (GRS), calculated using ten established fasting serum insulin associated variants, as an instrumental variable for insulin resistance. A GRS of three variants increasing circulating BCAA levels was used as an instrumental variable for circulating BCAA levels. Fasting plasma BCAA levels were associated with higher HOMA-IR in ADDITION-PRO (β 0.137 [95% CI 0.08, 0.19] p = 6 × 10 -7 ). However, the GRS for circulating BCAA levels was not associated with fasting insulin levels or HOMA-IR in ADDITION-PRO (β -0.011 [95% CI -0.053, 0.032] p = 0.6 and β -0.011 [95% CI -0.054, 0.031] p = 0.6, respectively) or in GWAS results for HOMA-IR from MAGIC (β for valine-increasing GRS -0.012 [95% CI -0.069, 0.045] p = 0.7). By contrast, the insulin-resistance-increasing GRS was significantly associated with increased BCAA levels in ADDITION-PRO (β 0.027 [95% CI 0.005, 0.048] p = 0.01) and in GWAS results for serum BCAA levels (β 1.22 [95% CI 0.71, 1.73] p = 4 × 10 -6 , β 0.96 [95% CI 0.45, 1.47] p = 3 × 10 -4 , and β 0.67 [95% CI 0.16, 1.18] p = 0.01 for isoleucine, leucine and valine levels, respectively) and instrumental variable analyses in ADDITION

  7. No evidence of association of MUC-1 genetic polymorphism with embryo implantation failure

    Directory of Open Access Journals (Sweden)

    D.B. Dentillo

    2007-06-01

    Full Text Available Pregnancy loss can be caused by several factors involved in human reproduction. Although up to 50% of cases remain unexplained, it has been postulated that the major cause of failed pregnancy is an error of embryo implantation. Transmembrane mucin-1 (MUC-1 is a glycoprotein expressed on the endometrial cell surface which acts as a barrier to implantation. The gene that codes for this molecule is composed of a polymorphic tandem repeat of 60 nucleotides. Our objective was to determine if MUC-1 genetic polymorphism is associated with implantation failure in patients with a history of recurrent abortion. The study was conducted on 10 women aged 25 to 35 years with no history of successful pregnancy and with a diagnosis of infertility. The control group consisted of 32 patients aged 25 to 35 years who had delivered at least two full-term live children and who had no history of abortions or fetal losses. MUC-1 amplicons were obtained by PCR and observed on agarose and polyacrylamide gel after electrophoresis. Statistical analysis showed no significant difference in the number of MUC-1 variable number of tandem repeats between these groups (P > 0.05. Our results suggest that there is no effect of the polymorphic MUC-1 sequence on the implantation failure. However, the data do not exclude MUC-1 relevance during embryo implantation. The process is related to several associated factors such as the mechanisms of gene expression in the uterus, specific MUC-1 post-translational modifications and appropriate interactions with other molecules during embryo implantation.

  8. Supporting patients in obtaining and oncologists in providing evidence-based health-related quality of life information prior to and after esophageal cancer surgery

    NARCIS (Netherlands)

    Jacobs, M.

    2015-01-01

    The overall aim of this thesis was to support patients in obtaining and oncologists in providing evidence-based HRQL data prior to and following esophageal cancer surgery. This thesis is divided in two parts. In Part I, we addressed the information needs of esophageal cancer patients prior to and

  9. Patient and provider perspectives on quality and health system effectiveness in a transition economy: evidence from Ukraine.

    Science.gov (United States)

    Luck, J; Peabody, J W; DeMaria, L M; Alvarado, C S; Menon, R

    2014-08-01

    Facing a severe population health crisis due to noncommunicable diseases, Ukraine and other former Soviet republics and Eastern European countries have a pressing need for more effective health systems. Policies to enhance health system effectiveness should consider the perspectives of different stakeholder groups, including providers as well as patients. In addition, policies that directly target the quality of clinical care should be based on objective performance measures. In 2009 and 2010 we conducted a coordinated series of household and facility-level surveys to capture the perspectives of Ukrainian household members, outpatient clinic patients, and physicians regarding the country's health system overall, as well as the quality, access, and affordability of health care. We objectively measured the quality of care for heart failure and chronic obstructive pulmonary disease using CPV(®) vignettes. There was broad agreement among household respondents (79%) and physicians (95%) that Ukraine's health system should be reformed. CPV(®) results indicate that the quality of care for common noncommunicable diseases is poor in all regions of the country and in hospitals as well as polyclinics. However, perspectives about the quality of care differ, with household respondents seeing quality as a serious concern, clinic patients having more positive perceptions, and physicians not viewing quality as a reform priority. All stakeholder groups viewed affordability as a problem. These findings have several implications for policies to enhance health system effectiveness. The shared desire for health system reform among all stakeholder groups provides a basis for action in Ukraine. Improving quality, strengthening primary care, and enhancing affordability should be major goals of new health policies. Policies to improve quality directly, such as pay-for-performance, would be mutually reinforcing with purchasing reforms such as transparent payment mechanisms. Such policies

  10. Firm-level perspectives on public sector engagement with private healthcare providers: survey evidence from Ghana and Kenya.

    Directory of Open Access Journals (Sweden)

    Neeraj Sood

    Full Text Available BACKGROUND: Health systems in Sub-Saharan Africa (SSA are in urgent need of improvement. The private health sector is a major provider of care in the region and it will remain a significant actor in the future. Any efforts by SSA governments to improve health systems performance therefore has to account for the private health sector. Regional and international actors increasingly recognize importance of effectively engaging with the private health sector, and initiatives to improve engagement are underway in several countries. However, there is little systematic analysis of private health providers' view and experience with engagement. METHODOLOGY/PRINCIPAL FINDINGS: In this study we surveyed private health facilities in Kenya and Ghana to understand the extent to which and how governments interact and engage with these facilities. The results suggest that government engagement with private health facilities is quite limited. The primary focus of this engagement is "command-and-control" type regulations to improve the quality of care. There is little attention paid to building the capacity of health care businesses through either technical or financial assistance. The vast majority of these facilities also receive no government assistance in meeting public health and social goals. Finally, government engagement with private pharmacies is often neglected and clinics receive a disproportionate share of government assistance. CONCLUSIONS/SIGNIFICANCE: Overall, our findings suggest that there may be considerable untapped potential for greater engagement with private health facilities--particularly pharmacies. Improving engagement will likely help governments with limited resources to better take advantage of the private sector capacity to meet access and equity objectives and to accelerate the achievement of the Millennium Development Goals.

  11. Firm-Level Perspectives on Public Sector Engagement with Private Healthcare Providers: Survey Evidence from Ghana and Kenya

    Science.gov (United States)

    Sood, Neeraj; Burger, Nicholas; Yoong, Joanne; Kopf, Dan; Spreng, Connor

    2011-01-01

    Background Health systems in Sub-Saharan Africa (SSA) are in urgent need of improvement. The private health sector is a major provider of care in the region and it will remain a significant actor in the future. Any efforts by SSA governments to improve health systems performance therefore has to account for the private health sector. Regional and international actors increasingly recognize importance of effectively engaging with the private health sector, and initiatives to improve engagement are underway in several countries. However, there is little systematic analysis of private health providers' view and experience with engagement. Methodology/Principal Findings In this study we surveyed private health facilities in Kenya and Ghana to understand the extent to which and how governments interact and engage with these facilities. The results suggest that government engagement with private health facilities is quite limited. The primary focus of this engagement is “command-and-control” type regulations to improve the quality of care. There is little attention paid to building the capacity of health care businesses through either technical or financial assistance. The vast majority of these facilities also receive no government assistance in meeting public health and social goals. Finally, government engagement with private pharmacies is often neglected and clinics receive a disproportionate share of government assistance. Conclusions/Significance Overall, our findings suggest that there may be considerable untapped potential for greater engagement with private health facilities—particularly pharmacies. Improving engagement will likely help governments with limited resources to better take advantage of the private sector capacity to meet access and equity objectives and to accelerate the achievement of the Millennium Development Goals. PMID:22132092

  12. Toward an evidence-based patient-provider communication in rehabilitation: linking communication elements to better rehabilitation outcomes.

    Science.gov (United States)

    Jesus, Tiago Silva; Silva, Isabel Lopes

    2016-04-01

    There is a growing interest in linking aspects of patient-provider communication to rehabilitation outcomes. However, the field lacks a conceptual understanding on: (a) 'how' rehabilitation outcomes can be improved by communication; and (b) through 'which' elements in particular. This article elaborates on the conceptual developments toward informing further practice and research. Existing models of communication in healthcare were adapted to rehabilitation, and its outcomes through a comprehensive literature review. After depicting mediating mechanisms and variables (e.g. therapeutic engagement, adjustment toward disability), this article presents the '4 Rehab Communication Elements' deemed likely to underpin rehabilitation outcomes. The four elements are: (a) knowing the person and building a supportive relationship; (b) effective information exchange and education; (c) shared goal-setting and action planning; and (d) fostering a more positive, yet realistic, cognitive and self-reframing. This article describes an unprecedented, outcomes-oriented approach toward the design of rehabilitation communication, which has resulted in the development of a new intervention model: the '4 Rehab Communication Elements'. Further trials are needed to evaluate the impact of this whole intervention model on rehabilitation outcomes. © The Author(s) 2015.

  13. Familial clustering of epilepsy and behavioral disorders: Evidence for a shared genetic basis

    Science.gov (United States)

    Hesdorffer, Dale C.; Caplan, Rochelle; Berg, Anne T.

    2011-01-01

    Purpose To examine whether family history of unprovoked seizures is associated with behavioral disorders in epilepsy probands, thereby supporting the hypothesis of shared underlying genetic susceptibility to these disorders. Methods We conducted an analysis of the 308 probands with childhood onset epilepsy from the Connecticut Study of Epilepsy with information on first degree family history of unprovoked seizures and of febrile seizures whose parents completed the Child Behavior Checklist (CBCL) at the 9-year follow-up. Clinical cut-offs for CBCL problem and DSM-Oriented scales were examined. The association between first degree family history of unprovoked seizure and behavioral disorders was assessed separately in uncomplicated and complicated epilepsy and separately for first degree family history of febrile seizures. A subanalysis, accounting for the tendency for behavioral disorders to run in families, adjusted for siblings with the same disorder as the proband. Prevalence ratios were used to describe the associations. Key findings In probands with uncomplicated epilepsy, first degree family history of unprovoked seizure was significantly associated with clinical cut-offs for Total Problems and Internalizing Disorders. Among Internalizing Disorders, clinical cut-offs for Withdrawn/Depressed, and DSM-Oriented scales for Affective Disorder and Anxiety Disorder were significantly associated with family history of unprovoked seizures. Clinical cut-offs for Aggressive Behavior and Delinquent Behavior, and DSM-Oriented scales for Conduct Disorder and Oppositional Defiant Disorder were significantly associated with family history of unprovoked seizure. Adjustment for siblings with the same disorder revealed significant associations for the relationship between first degree family history of unprovoked seizure and Total Problems and Agressive Behavior in probands with uncomplicated epilepsy; marginally significant results were seen for Internalizing Disorder

  14. [Genetic evidence for recombination and mutation in the emergence of human enterovirus 71].

    Science.gov (United States)

    Liu, Ai-Ping; Tan, Hui; Xie, Qun; Chen, Bai-Tang; Liu, Xiao-Feng; Zhang, Yong

    2014-09-01

    We wished to understand the genetic recombination and phylogenetic characteristics of human en- terovirus A71 (EV-A71) and to explore its potential virulence-related sites. Full-length genomes of three EV-A71 strains isolated from patients in Chenzhou City (China) were sequenced and analyzed. Possible re- combination events and crossover sites were analyzed with Recombination Detection Program v4. 1. 6 by comparison with the complete genome sequences of 231 strains of EV-A71. Similarly, plot and bootscanning analyses were undertaken with SimPlot v3. 5. 1. Phylogenetic trees based on the sequences of VP1 regions were constructed with MEGA v5. 2 using the Kimura two-parameter model and neighbor-joining method. Results suggested that recombination events were detected among the three EV-A71 isolates from Chenzhou City. The common main parent sequence was from JF799986 isolated from samples in Guang- zhou City (China) in 2009, and the minor parent sequence was TW/70516/08. Intertypic recombination e- vents were found in the C4b strain (strain SHZH98 isolated in 1998) and C4a strain (Fuyang strain isola- ted in 2008) with the prototype strains of CVA4 and CVA14 in the 3D region. The chi-square test was used to screen-out potential virulence-related sites with nucleotide substitutions of different types of hand, foot, and mouth disease (HFMD) cases using SPSS v19.0. Results suggested that there were no significant nucleotide substitutions between death cases and severe-HFMD cases. Eighteen significant nucleotide substitutions were found between death/severe-HFMD cases and mild-HFMD cases, and all these 18 substitutions were distributed only in P2 and P3 regions. Intertypic recombination among the predominant circulating EV-A71 strains in the Chinese mainland and other EV-A strains probably dates before 1998, and intratypic recombination might have occurred frequently in the HFMD outbreak from 2008 to 2012. Substitutions in the non-capsid region may be correlated with the

  15. Flat and complex temperate reefs provide similar support for fish: Evidence for a unimodal species-habitat relationship.

    Directory of Open Access Journals (Sweden)

    Avery B Paxton

    Full Text Available Structural complexity, a form of habitat heterogeneity, influences the structure and function of ecological communities, generally supporting increased species density, richness, and diversity. Recent research, however, suggests the most complex habitats may not harbor the highest density of individuals and number of species, especially in areas with elevated human influence. Understanding nuances in relationships between habitat heterogeneity and ecological communities is warranted to guide habitat-focused conservation and management efforts. We conducted fish and structural habitat surveys of thirty warm-temperate reefs on the southeastern US continental shelf to quantify how structural complexity influences fish communities. We found that intermediate complexity maximizes fish abundance on natural and artificial reefs, as well as species richness on natural reefs, challenging the current paradigm that abundance and other fish community metrics increase with increasing complexity. Naturally occurring rocky reefs of flat and complex morphologies supported equivalent abundance, biomass, species richness, and community composition of fishes. For flat and complex morphologies of rocky reefs to receive equal consideration as essential fish habitat (EFH, special attention should be given to detecting pavement type rocky reefs because their ephemeral nature makes them difficult to detect with typical seafloor mapping methods. Artificial reefs of intermediate complexity also maximized fish abundance, but human-made structures composed of low-lying concrete and metal ships differed in community types, with less complex, concrete structures supporting lower numbers of fishes classified largely as demersal species and metal ships protruding into the water column harboring higher numbers of fishes, including more pelagic species. Results of this study are essential to the process of evaluating habitat function provided by different types and shapes of

  16. Evidence of low dimensional chaos in renal blood flow control in genetic and experimental hypertension

    Science.gov (United States)

    Yip, K.-P.; Marsh, D. J.; Holstein-Rathlou, N.-H.

    1995-01-01

    We applied a surrogate data technique to test for nonlinear structure in spontaneous fluctuations of hydrostatic pressure in renal tubules of hypertensive rats. Tubular pressure oscillates at 0.03-0.05 Hz in animals with normal blood pressure, but the fluctuations become irregular with chronic hypertension. Using time series from rats with hypertension we produced surrogate data sets to test whether they represent linearly correlated noise or ‘static’ nonlinear transforms of a linear stochastic process. The correlation dimension and the forecasting error were used as discriminating statistics to compare surrogate with experimental data. The results show that the original experimental time series can be distinguished from both linearly and static nonlinearly correlated noise, indicating that the nonlinear behavior is due to the intrinsic dynamics of the system. Together with other evidence this strongly suggests that a low dimensional chaotic attractor governs renal hemodynamics in hypertension. This appears to be the first demonstration of a transition to chaotic dynamics in an integrated physiological control system occurring in association with a pathological condition.

  17. Bilateral first branchial cleft anomaly with evidence of a genetic aetiology.

    Science.gov (United States)

    Gonzalez-Perez, L M; Prats-Golczer, V E; Montes Carmona, J F; Heurtebise Saavedra, J M

    2014-03-01

    Anomalies of the first branchial cleft (FBC) are uncommon, and recognizing them can be difficult. Although present at birth, many cases do not become evident until later in childhood or adolescence, with an initial clinical presentation in adulthood being encountered only rarely. Typically, FBC anomalies present as a unilateral cyst, sinus, or fistula associated with the external auditory canal, or with swelling or an inflammatory opening in the peri-auricular/parotid area. They are commonly misdiagnosed and are often treated inadequately before being excised completely. A 40-year-old woman presented to the maxillofacial outpatient clinic with an episode of bilateral pre-auricular tumefaction, initially diagnosed as temporomandibular dysfunction syndrome. This was associated with bilateral pre-auricular pain that increased with mandibular movements. In relation to the patient's history, and given the bilateral presence of a pre-auricular pit, a diagnosis of FBC anomaly was made. Further investigation showed a related asymptomatic history in five other cases across four generations of the same family. The authors describe here the case, the diagnostic methodology, and the wide local excision technique used for removal of the branchial sinus. Copyright © 2013 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  18. Genetic evidence implicates the immune system and cholesterol metabolism in the aetiology of Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Lesley Jones

    2010-11-01

    Full Text Available Late Onset Alzheimer's disease (LOAD is the leading cause of dementia. Recent large genome-wide association studies (GWAS identified the first strongly supported LOAD susceptibility genes since the discovery of the involvement of APOE in the early 1990s. We have now exploited these GWAS datasets to uncover key LOAD pathophysiological processes.We applied a recently developed tool for mining GWAS data for biologically meaningful information to a LOAD GWAS dataset. The principal findings were then tested in an independent GWAS dataset.We found a significant overrepresentation of association signals in pathways related to cholesterol metabolism and the immune response in both of the two largest genome-wide association studies for LOAD.Processes related to cholesterol metabolism and the innate immune response have previously been implicated by pathological and epidemiological studies of Alzheimer's disease, but it has been unclear whether those findings reflected primary aetiological events or consequences of the disease process. Our independent evidence from two large studies now demonstrates that these processes are aetiologically relevant, and suggests that they may be suitable targets for novel and existing therapeutic approaches.

  19. Lipid biomarkers in ooids from different locations and ages provide evidence for a common bacterial flora (Invited)

    Science.gov (United States)

    Summons, R. E.; Bird, L. R.; Gillespie, A. L.; Pruss, S. B.; Sessions, A. L.

    2010-12-01

    Modern and holocene ooid samples, collected from outcrops and beaches in the Bahamas and in Shark Bay in Western Australia, were examined for their contents of lipid biomarkers. Modern samples from Cat and Andros islands in the Bahamas and from Carbla Beach in Hamelin Pool, Western Australia, showed abundant and surprisingly similar distributions of hydrocarbons, fatty acids and alcohols. A large fraction of these lipids were bound into the carbonate matrix and only released on acid dissolution, which suggests that these lipids were being incorporated continuously during ooid growth. The distributions of hydrocarbons, and their disparate carbon isotopic signatures, were consistent with mixed input from cyanobacteria (C17-C19; δ13C -15 to -24 ‰VPDB) together with small and variable amounts of vascular plant leaf wax (C27-C35; δ13C -25 to -32 ‰VPDB). The fatty acids (FA) comprised a complex mixture of C12-C18 normal and branched short chain isomers with the predominant straight-chained components attributable to bacteria and/or cyanobacteria. Branched FA isomers, and especially the 10-MeC16 and 10-MeC18, together with the prevalence of elemental sulfur in the extracts, indicate an origin from sulfate reducing bacteria. The iso- and anteiso- FA were very variable in their 13C contents suggesting that they come from organisms with diverse physiologies. Hydrogen isotopic compositions may provide further insights into this issue. The most enigmatic lipid assemblage is an homologous series of long-chain (C24-C32) FA with pronounced even carbon number preference. Typically such long-chain FA are thought to come from land plant leaf wax but their heavy C-isotopic signatures (C24-C32; δ13C -18 to -22 ‰VPDB), indicates that a microbial origin in this case. Lastly, we identified homohopanoic acid, bishomohopanol and their 2-methyl analogues as the degradation products of bacterial and/or cyanobacterial hopanoids. The distributions of lipids isolated from Holocene

  20. An evidence synthesis of the international knowledge base for new care models to inform and mobilise knowledge for multispecialty community providers (MCPs).

    Science.gov (United States)

    Turner, Alison; Mulla, Abeda; Booth, Andrew; Aldridge, Shiona; Stevens, Sharon; Battye, Fraser; Spilsbury, Peter

    2016-10-01

    NHS England's Five Year Forward View (NHS England, Five Year Forward View, 2014) formally introduced a strategy for new models of care driven by simultaneous pressures to contain costs, improve care and deliver services closer to home through integrated models. This synthesis focuses on a multispecialty community provider (MCP) model. This new model of care seeks to overcome the limitations in current models of care, often based around single condition-focused pathways, in contrast to patient-focused delivery (Royal College of General Practitioners, The 2022 GP: compendium of evidence, 2012) which offers greater continuity of care in recognition of complex needs and multimorbidity. The synthesis, an innovative combination of best fit framework synthesis and realist synthesis, will develop a "blueprint" which articulates how and why MCP models work, to inform design of future iterations of the MCP model. A systematic search will be conducted to identify research and practice-derived evidence to achieve a balance that captures the historical legacy of MCP models but focuses on contemporary evidence. Sources will include bibliographic databases including MEDLINE, PreMEDLINE, CINAHL, Embase, HMIC and Cochrane Library; and grey literature sources. The Best Fit synthesis methodology will be combined with a synthesis following realist principles which are particularly suited to exploring what works, when, for whom and in what circumstances. The aim of this synthesis is to provide decision makers in health and social care with a practical evidence base relating to the multispecialty community provider (MCP) model of care. PROSPERO CRD42016039552 .

  1. Mixed Methods for Implementation Research: Application to Evidence-Based Practice Implementation and Staff Turnover in Community Based Organizations Providing Child Welfare Services

    Science.gov (United States)

    Aarons, Gregory A.; Fettes, Danielle L.; Sommerfeld, David H.; Palinkas, Lawrence

    2013-01-01

    Many public sector services systems and provider organizations are in some phase of learning about or implementing evidence-based interventions. Child welfare service systems represent a context where implementation spans system, management, and organizational concerns. Research utilizing mixed methods that combine qualitative and quantitative design, data collection, and analytic approaches are particularly well-suited to understanding both the process and outcomes of dissemination and implementation efforts in child welfare systems. This paper describes the process of using mixed methods in implementation research and provides an applied example of an examination of factors impacting staff retention during an evidence-based intervention implementation in a statewide child welfare system. We integrate qualitative data with previously published quantitative analyses of job autonomy and staff turnover during this statewide implementation project in order to illustrate the utility of mixed method approaches in providing a more comprehensive understanding of opportunities and challenges in implementation research. PMID:22146861

  2. Mixed methods for implementation research: application to evidence-based practice implementation and staff turnover in community-based organizations providing child welfare services.

    Science.gov (United States)

    Aarons, Gregory A; Fettes, Danielle L; Sommerfeld, David H; Palinkas, Lawrence A

    2012-02-01

    Many public sector service systems and provider organizations are in some phase of learning about or implementing evidence-based interventions. Child welfare service systems represent a context where implementation spans system, management, and organizational concerns. Research utilizing mixed methods that combine qualitative and quantitative design, data collection, and analytic approaches are particularly well suited to understanding both the process and outcomes of dissemination and implementation efforts in child welfare systems. This article describes the process of using mixed methods in implementation research and provides an applied example of an examination of factors impacting staff retention during an evidence-based intervention implementation in a statewide child welfare system. The authors integrate qualitative data with previously published quantitative analyses of job autonomy and staff turnover during this statewide implementation project in order to illustrate the utility of mixed method approaches in providing a more comprehensive understanding of opportunities and challenges in implementation research.

  3. A Molecular Genetic Lab to Generate Inclusive and Exclusive Forensic Evidence: Two Suspects, a Victim, and a Bloodstained T-Shirt

    Science.gov (United States)

    Smit, Julie; Heath, Daniel D.; Walter, Ryan P.

    2014-01-01

    Molecular genetic laboratory exercises can be ineffective due the student's lack of connection to the complex and sequential protocols. In this inquiry-based molecular genetic laboratory exercise, we harness students' fascination with human forensics and provide a real-life scenario using biomolecular techniques to identify "whose…

  4. Genetic architecture of the Delis-Kaplan Executive Function System Trail Making Test: evidence for distinct genetic influences on executive function.

    Science.gov (United States)

    Vasilopoulos, Terrie; Franz, Carol E; Panizzon, Matthew S; Xian, Hong; Grant, Michael D; Lyons, Michael J; Toomey, Rosemary; Jacobson, Kristen C; Kremen, William S

    2012-03-01

    To examine how genes and environments contribute to relationships among Trail Making Test (TMT) conditions and the extent to which these conditions have unique genetic and environmental influences. Participants included 1,237 middle-aged male twins from the Vietnam Era Twin Study of Aging. The Delis-Kaplan Executive Function System TMT included visual searching, number and letter sequencing, and set-shifting components. Phenotypic correlations among TMT conditions ranged from 0.29 to 0.60, and genes accounted for the majority (58-84%) of each correlation. Overall heritability ranged from 0.34 to 0.62 across conditions. Phenotypic factor analysis suggested a single factor. In contrast, genetic models revealed a single common genetic factor but also unique genetic influences separate from the common factor. Genetic variance (i.e., heritability) of number and letter sequencing was completely explained by the common genetic factor while unique genetic influences separate from the common factor accounted for 57% and 21% of the heritabilities of visual search and set shifting, respectively. After accounting for general cognitive ability, unique genetic influences accounted for 64% and 31% of those heritabilities. A common genetic factor, most likely representing a combination of speed and sequencing, accounted for most of the correlation among TMT 1-4. Distinct genetic factors, however, accounted for a portion of variance in visual scanning and set shifting. Thus, although traditional phenotypic shared variance analysis techniques suggest only one general factor underlying different neuropsychological functions in nonpatient populations, examining the genetic underpinnings of cognitive processes with twin analysis can uncover more complex etiological processes.

  5. Exploring evidence of positive selection reveals genetic basis of meat quality traits in Berkshire pigs through whole genome sequencing.

    Science.gov (United States)

    Jeong, Hyeonsoo; Song, Ki-Duk; Seo, Minseok; Caetano-Anollés, Kelsey; Kim, Jaemin; Kwak, Woori; Oh, Jae-Don; Kim, EuiSoo; Jeong, Dong Kee; Cho, Seoae; Kim, Heebal; Lee, Hak-Kyo

    2015-08-20

    Natural and artificial selection following domestication has led to the existence of more than a hundred pig breeds, as well as incredible variation in phenotypic traits. Berkshire pigs are regarded as having superior meat quality compared to other breeds. As the meat production industry seeks selective breeding approaches to improve profitable traits such as meat quality, information about genetic determinants of these traits is in high demand. However, most of the studies have been performed using trained sensory panel analysis without investigating the underlying genetic factors. Here we investigate the relationship between genomic composition and this phenotypic trait by scanning for signatures of positive selection in whole-genome sequencing data. We generated genomes of 10 Berkshire pigs at a total of 100.6 coverage depth, using the Illumina Hiseq2000 platform. Along with the genomes of 11 Landrace and 13 Yorkshire pigs, we identified genomic variants of 18.9 million SNVs and 3.4 million Indels in the mapped regions. We identified several associated genes related to lipid metabolism, intramuscular fatty acid deposition, and muscle fiber type which attribute to pork quality (TG, FABP1, AKIRIN2, GLP2R, TGFBR3, JPH3, ICAM2, and ERN1) by applying between population statistical tests (XP-EHH and XP-CLR). A statistical enrichment test was also conducted to detect breed specific genetic variation. In addition, de novo short sequence read assembly strategy identified several candidate genes (SLC25A14, IGF1, PI4KA, CACNA1A) as also contributing to lipid metabolism. Results revealed several candidate genes involved in Berkshire meat quality; most of these genes are involved in lipid metabolism and intramuscular fat deposition. These results can provide a basis for future research on the genomic characteristics of Berkshire pigs.

  6. Phylogeography and postglacial recolonization of Europe by Rhinolophus hipposideros: evidence from multiple genetic markers.

    Science.gov (United States)

    Dool, Serena E; Puechmaille, Sébastien J; Dietz, Christian; Juste, Javier; Ibáñez, Carlos; Hulva, Pavel; Roué, Stéphane G; Petit, Eric J; Jones, Gareth; Russo, Danilo; Toffoli, Roberto; Viglino, Andrea; Martinoli, Adriano; Rossiter, Stephen J; Teeling, Emma C

    2013-08-01

    The demographic history of Rhinolophus hipposideros (lesser horseshoe bat) was reconstructed across its European, North African and Middle-Eastern distribution prior to, during and following the most recent glaciations by generating and analysing a multimarker data set. This data set consisted of an X-linked nuclear intron (Bgn; 543 bp), mitochondrial DNA (cytb-tRNA-control region; 1630 bp) and eight variable microsatellite loci for up to 373 individuals from 86 localities. Using this data set of diverse markers, it was possible to determine the species' demography at three temporal stages. Nuclear intron data revealed early colonization into Europe from the east, which pre-dates the Quaternary glaciations. The mtDNA data supported multiple glacial refugia across the Mediterranean, the largest of which were found in the Ibero-Maghreb region and an eastern location (Anatolia/Middle East)-that were used by R. hipposideros during the most recent glacial cycles. Finally, microsatellites provided the most recent information on these species' movements since the Last Glacial Maximum and suggested that lineages that had diverged into glacial refugia, such as in the Ibero-Maghreb region, have remained isolated. These findings should be used to inform future conservation management strategies for R. hipposideros and show the power of using a multimarker data set for phylogeographic studies. © 2013 John Wiley & Sons Ltd.

  7. Neuroimmune Pathways in Alcohol Consumption: Evidence from Behavioral and Genetic Studies in Rodents and Humans

    Science.gov (United States)

    Robinson, Gizelle; Most, Dana; Ferguson, Laura B.; Mayfield, Jody; Harris, R. Adron; Blednov, Yuri A.

    2014-01-01

    Immune or brain proinflammatory signaling has been linked to some of the behavioral effects of alcohol. Immune signaling appears to regulate voluntary ethanol intake in rodent models, and ethanol intake activates the immune system in multiple models. This bidirectional link raises the possibility that consumption increases immune signaling, which in turn further increases consumption in a feed-forward cycle. Data from animal and human studies provide overlapping support for the involvement of immune-related genes and proteins in alcohol action, and combining animal and human data is a promising approach to systematically evaluate and nominate relevant pathways. Based on rodent models, neuroimmune pathways may represent unexplored, nontraditional targets for medication development to reduce alcohol consumption and prevent relapse. Peroxisome proliferator-activated receptor agonists are one class of anti-inflammatory medications that demonstrate antiaddictive properties for alcohol and other drugs of abuse. Expression of immune-related genes is altered in animals and humans following chronic alcohol exposure, and the regulatory influences of specific mRNAs, microRNAs, and activated cell types are areas of intense study. Ultimately, the use of multiple datasets combined with behavioral validation will be needed to link specific neuroimmune pathways to addiction vulnerability. PMID:25175860

  8. Understanding the roles of faith-based health-care providers in Africa: review of the evidence with a focus on magnitude, reach, cost, and satisfaction.

    Science.gov (United States)

    Olivier, Jill; Tsimpo, Clarence; Gemignani, Regina; Shojo, Mari; Coulombe, Harold; Dimmock, Frank; Nguyen, Minh Cong; Hines, Harrison; Mills, Edward J; Dieleman, Joseph L; Haakenstad, Annie; Wodon, Quentin

    2015-10-31

    At a time when many countries might not achieve the health targets of the Millennium Development Goals and the post-2015 agenda for sustainable development is being negotiated, the contribution of faith-based health-care providers is potentially crucial. For better partnership to be achieved and for health systems to be strengthened by the alignment of faith-based health-providers with national systems and priorities, improved information is needed at all levels. Comparisons of basic factors (such as magnitude, reach to poor people, cost to patients, modes of financing, and satisfaction of patients with the services received) within faith-based health-providers and national systems show some differences. As the first report in the Series on faith-based health care, we review a broad body of published work and introduce some empirical evidence on the role of faith-based health-care providers, with a focus on Christian faith-based health providers in sub-Saharan Africa (on which the most detailed documentation has been gathered). The restricted and diverse evidence reported supports the idea that faith-based health providers continue to play a part in health provision, especially in fragile health systems, and the subsequent reports in this Series review controversies in faith-based health care and recommendations for how public and faith sectors might collaborate more effectively. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Supporting patients in obtaining and oncologists in providing evidence-based health-related quality of life information prior to and after esophageal cancer surgery

    OpenAIRE

    Jacobs, M.

    2015-01-01

    The overall aim of this thesis was to support patients in obtaining and oncologists in providing evidence-based HRQL data prior to and following esophageal cancer surgery. This thesis is divided in two parts. In Part I, we addressed the information needs of esophageal cancer patients prior to and following esophageal surgery, the barriers and facilitators patients experienced when discussing their information needs with their oncologist, and the development of a web-based question prompt shee...

  10. Genetic evidence for polygynandry in the black-striped pipefish Syngnathus abaster: a microsatellite-based parentage analysis.

    Science.gov (United States)

    Hübner, Kerstin; Gonzalez-Wanguemert, Mercedes; Diekmann, Onno E; Serrão, Ester A

    2013-01-01

    Sexual selection theory predicts that, in organisms with reversed sex roles, more polyandrous species exhibit higher levels of sexual dimorphism. In the family Syngnathidae (pipefish, seahorses, and seadragons), males provide all parental care by carrying developing embryos on their ventral surfaces, and females develop secondary sex characters. Syngnathids exhibit a variety of genetic mating patterns, making them an ideal group to test predictions of sexual selection theory. Here, we describe the mating system of the black-striped pipefish Syngnathus abaster, using 4 highly variable microsatellites to analyze parentage of 102 embryos. Results revealed that 1) both sexes mate multiple times over the course of a pregnancy (polygynandrous mating system), 2) eggs are spatially segregated by maternity within each brood pouch, and 3) larger females have higher mating success (Kolmogorov-Smirnov test; P sexual dimorphism.

  11. Evidence-based obstetrics in four hospitals in China: An observational study to explore clinical practice, women's preferences and provider's views

    Directory of Open Access Journals (Sweden)

    Liang Ji

    2001-05-01

    Full Text Available Abstract Background Evidence-based obstetric care is widely promoted in developing countries, but the success of implementation is not known. Using selected childbirth care procedures in four hospitals in Shanghai, we compared practice against evidence-based information, and explored user and provider views about each procedure. Methods Observational study. Using the Cochrane Library, we identified six procedures that should be avoided as routine and two that should be encouraged. Procedure rate determined by exit interviews with women, verified using hospital notes. Views of women and providers explored with in depth interviews. The study sites were three hospitals in Shanghai and one in neighbouring province of Jiangsu. 150 women at each centre for procedure rate, and 48 in-depth interviews with women and providers. Results Vaginal births were 50% (303/599 of the total. Of the six practices where evidence suggests they should be avoided as routine, three were performed with rates above 70%: pubic shaving (3 hospitals, rectal examination (3 hospitals, and episiotomy (3 hospitals. Most women delivered lying down, pain relief was rarely given, and only in the urban district hospital did women routinely have a companion. Most women wanted support or companionship during labour and to be given pain relief; but current practice is insufficient to meet women's needs. Conclusion Obstetric practice is not following best available evidence in the hospitals studied. There is a need to adjust hospital policy to support the use of interventions proven to be of benefit to women during childbirth, and develop approaches that ensure clinical practice changes.

  12. Can small wildlife conservancies maintain genetically stable populations of large mammals? Evidence for increased genetic drift in geographically restricted populations of Cape buffalo in East Africa

    DEFF Research Database (Denmark)

    Heller, R; Okello, J B A; Siegismund, H

    2010-01-01

    populations, the level of genetic differentiation found here is comparable to that among pan-African populations. Overall, correlations between conservancy area and indices of genetic diversity suggest buffalo populations inhabiting small parks are showing signs of genetic erosion, stressing the need for more......The Cape buffalo (Syncerus caffer caffer) is one of the dominant and most widespread herbivores in sub-Saharan Africa. High levels of genetic diversity and exceptionally low levels of population differentiation have been found in the Cape buffalo compared to other African savannah ungulates...... active management of such populations. Our findings raise concerns about the future of other African savannah ungulates with lower population sizes and inferior dispersal capabilities compared with the buffalo....

  13. Providers' perspectives of factors influencing implementation of evidence-based treatments in a community mental health setting: A qualitative investigation of the training-practice gap.

    Science.gov (United States)

    Marques, Luana; Dixon, Louise; Valentine, Sarah E; Borba, Christina P C; Simon, Naomi M; Wiltsey Stirman, Shannon

    2016-08-01

    This study aims to elucidate relations between provider perceptions of aspects of the consolidated framework for implementation research (Damschroder et al., 2009) and provider attitudes toward the implementation of evidence-based treatments (EBTs) in an ethnically diverse community health setting. Guided by directed content analysis, we analyzed 28 semistructured interviews that were conducted with providers during the pre-implementation phase of a larger implementation study for cognitive processing therapy for posttraumatic stress disorder (Resick et al., 2008). Our findings extend the existing literature by also presenting provider-identified client-level factors that contribute to providers' positive and negative attitudes toward EBTs. Provider-identified client-level factors include the following: client motivation to engage in treatment, client openness to EBTs, support networks of family and friends, client use of community and government resources, the connection and relationship with their therapist, client treatment adherence, client immediate needs or crises, low literacy or illiteracy, low levels of education, client cognitive limitations, and misconceptions about therapy. These results highlight the relations between provider perceptions of their clients, provider engagement in EBT training, and subsequent adoption of EBTs. We present suggestions for future implementation research in this area. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  14. The European and Japanese outbreaks of H5N8 derive from a single source population providing evidence for the dispersal along the long distance bird migratory flyways

    Directory of Open Access Journals (Sweden)

    Andrew R. Dalby

    2015-04-01

    Full Text Available The origin of recent parallel outbreaks of the high pathogenicity H5N8 avian flu virus in Europe and in Japan can be traced to a single source population, which has most likely been spread by migratory birds. By using Bayesian coalescent methods to analyze the DNA sequences of the virus to find the times for divergence and combining this sequence data with bird migration data we can show the most likely locations and migratory pathways involved in the origin of the current outbreak. This population was most likely located in the Siberian summer breeding grounds of long-range migratory birds. These breeding grounds provide a connection between different migratory flyways and explain the current outbreaks in remote locations. By combining genetic methods and epidemiological data we can rapidly identify the sources and the dispersion pathways for novel avian influenza outbreaks.

  15. Providing Family Planning Services at Primary Care Organizations after the Exclusion of Planned Parenthood from Publicly Funded Programs in Texas: Early Qualitative Evidence.

    Science.gov (United States)

    White, Kari; Hopkins, Kristine; Grossman, Daniel; Potter, Joseph E

    2017-10-20

    To explore organizations' experiences providing family planning during the first year of an expanded primary care program in Texas. Between November 2014 and February 2015, in-depth interviews were conducted with program administrators at 30 organizations: 7 women's health organizations, 13 established primary care contractors (e.g., community health centers, public health departments), and 10 new primary care contractors. Interviews addressed organizational capacities to expand family planning and integrate services with primary care. Interview transcripts were analyzed using a theme-based approach. Themes were compared across the three types of organizations. Established and new primary care contractors identified several challenges expanding family planning services, which were uncommon among women's health organizations. Clinicians often lacked training to provide intrauterine devices and contraceptive implants. Organizations often recruited existing clients into family planning services, rather than expanding their patient base, and new contractors found family planning difficult to integrate because of clients' other health needs. Primary care contractors frequently described contraceptive provision protocols that were not evidence-based. Many primary care organizations in Texas initially lacked the capacity to provide evidence-based family planning services that women's health organizations already provided. © Health Research and Educational Trust.

  16. Characterization of early follicular cDNA library suggests evidence for genetic polymorphisms in the inbred strain C108 of Bombyx mori.

    Science.gov (United States)

    Mills, D R; Goldsmith, M R

    2000-04-01

    Recent work towards the completion of a saturated molecular genetic linkage map for the lepidopteran silkworm, Bombyx mori (n = 28), has provided evidence for existing polymorphisms in the inbred strain C108. Two inbred parental strains, p50 and C108, were crossed to produce the F1 (P/C) hybrid offspring. The populations used in this project were comprised of a combination of 29 F2 (F1 x F1) and 31 reciprocal backcross (P/C x C/C, P/C x P/P) progeny. All restriction fragment length polymorphisms (RFLPs) for the initial analysis were hybridized with anonymous probes derived from a random early follicular cDNA (Rcf) library from Bombyx. A total of 19 Rcf probes were selected as showing scorable codominant polymorphic patterns when screened against F2 and backcross DNAs digested with the restriction enzymes EcoRI, HindIII, or PstI, and Southern blotted to nylon membranes for hybridization. Of the newly reported Rcf probes, 7 (37%) were characterized as producing 'simple' polymorphic patterns, while 12 (63%) were characterized as producing 'complex' polymorphic patterns. Further characterization of the complex patterns subdivided this group into two general classes: polymorphisms that contained an additional allele, and multiple bands that contained an easily scored two banded polymorphism. Because the extra allele class was limited to the (P/C x C/C) backcross progeny, it is suggested that the inbred parental strain C108 harbors polymorphic loci that are inherited in a simple Mendelian fashion. A genetic analysis discussing plausible origins and maintenance of these polymorphisms is presented.

  17. The effectiveness and feasibility of videoconferencing technology to provide evidence-based treatment to rural domestic violence and sexual assault populations.

    Science.gov (United States)

    Hassija, Christina; Gray, Matt J

    2011-05-01

    Although evidence-based treatments for post-traumatic stress disorder (PTSD) have been available for some time, many treatment-seeking trauma survivors are unable to access such services. This is especially the case in remote and rural areas where access to specialists is an exception rather than a rule. Advances in videoconferencing-based technologies are improving rural residents' access to specialized psychological services. However, at present, little is known about the viability and efficacy of providing psychological interventions via distal technologies to individuals who present at rural domestic violence and rape crisis centers. The present study attempts to partially address this void by evaluating, in the context of an uncontrolled trial, the effectiveness and feasibility of providing evidence-based, trauma-focused treatment via videoconferencing to rural survivors of domestic violence and sexual assault. Participants in the present study were clients referred to the Wyoming Trauma Telehealth Treatment Clinic (WTTTC) for psychological services via videoconferencing from distal domestic violence and rape crisis centers located in the state of Wyoming. Fifteen female victims of assaultive violence who received at least four sessions of trauma-focused treatment via videoconferencing-based technology at distal rape and domestic violence crisis centers were included in the present study. Participants completed measures of PTSD and depression symptom severity and client satisfaction. Participants evidenced large reductions on measures of PTSD (d = 1.17) and depression (d = 1.24) symptom severity following treatment via videoconferencing. Additionally, participants reported a high degree of satisfaction with videoconferencing-administered services. Results provide evidence in support of videoconferencing as an effective means to provide psychological services to rural domestic violence and sexual assault populations. Clinical implications and avenues

  18. Identification of the sex-determining locus in grass puffer (Takifugu niphobles) provides evidence for sex-chromosome turnover in a subset of Takifugu species

    Science.gov (United States)

    Atsumi, Kazufumi; Kamiya, Takashi; Nozawa, Aoi; Aoki, Yuma; Tasumi, Satoshi; Koyama, Takashi; Nakamura, Osamu; Suzuki, Yuzuru

    2018-01-01

    There is increasing evidence for frequent turnover in sex chromosomes in vertebrates. Yet experimental systems suitable for tracing the detailed process of turnover are rare. In theory, homologous turnover is possible if the new sex-determining locus is established on the existing sex-chromosome. However, there is no empirical evidence for such an event. The genus Takifugu includes fugu (Takifugu rubripes) and its two closely-related species whose sex is most likely determined by a SNP at the Amhr2 locus. In these species, males are heterozygous, with G and C alleles at the SNP site, while females are homozygous for the C allele. To determine if a shift in the sex-determining locus occurred in another member of this genus, we used genetic mapping to characterize the sex-chromosome systems of Takifugu niphobles. We found that the G allele of Amhr2 is absent in T. niphobles. Nevertheless, our initial mapping suggests a linkage between the phenotypic sex and the chromosome 19, which harbors the Amhr2 locus. Subsequent high-resolution analysis using a sex-reversed fish demonstrated that the sex-determining locus maps to the proximal end of chromosome 19, far from the Amhr2 locus. Thus, it is likely that homologous turnover involving these species has occurred. The data also showed that there is a male-specific reduction of recombination around the sex-determining locus. Nevertheless, no evidence for sex-chromosome differentiation was detected: the reduced recombination depended on phenotypic sex rather than genotypic sex; no X- or Y-specific maker was obtained; the YY individual was viable. Furthermore, fine-scale mapping narrowed down the new sex-determining locus to the interval corresponding to approximately 300-kb of sequence in the fugu genome. Thus, T. niphobles is determined to have a young and small sex-determining region that is suitable for studying an early phase of sex-chromosome evolution and the mechanisms underlying turnover of sex chromosome. PMID

  19. Molybdenum isotopic evidence for the origin of chondrules and a distinct genetic heritage of carbonaceous and non-carbonaceous meteorites

    Science.gov (United States)

    Budde, Gerrit; Burkhardt, Christoph; Brennecka, Gregory A.; Fischer-Gödde, Mario; Kruijer, Thomas S.; Kleine, Thorsten

    2016-11-01

    dichotomy of meteorites provides a new means to determine the provenance of meteoritic and planetary materials, and to assess genetic links between chondrites and differentiated meteorites.

  20. An ancestral human genetic variant linked to an ancient disease: A novel association of FMO2 polymorphisms with tuberculosis (TB in Ethiopian populations provides new insight into the differential ethno-geographic distribution of FMO2*1.

    Directory of Open Access Journals (Sweden)

    Ephrem Mekonnen

    with distinct genetic variants underlying the TB-progression pathway. The results were robust for population stratification. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC" explaining the overall association (haplotype-specific-p = 0.000103. Strikingly, not only was FMO2*1 nominally associated with reduced risk to "Active TB" (p = 0.0118, OR = 0.496 but it also does not co-segregate with the 5'-3' flanking top high-TB-risk alleles. The study provides an evidence for the existence of an evolutionary adaptation to an ancient disease based on an ancestral genetic variant acting in a haplotypic framework in Ethiopian populations.

  1. Should We Add History of Science to Provide Nature of Science into Vietnamese Biology Textbook: A Case of Evolution and Genetics Teaching?

    Science.gov (United States)

    Diem, Huynh Thi Thuy; Yuenyong, Chokchai

    2018-01-01

    History of science (HOS) plays a substantial role in the enhancement of rooted understanding in science teaching and learning. HOS of evolution and genetics has not been included in Vietnamese biology textbooks. This study aims to investigate the necessity of introducing evolution and genetics HOS into Vietnamese textbooks. A case study approach…

  2. Modifying Provider Practice To Improve Assessment of Unhealthy Weight and Lifestyle in Young Children: Translating Evidence in a Quality Improvement Initiative for At-Risk Children.

    Science.gov (United States)

    Camp, Nadine L; Robert, Rebecca C; Nash, Jessica E; Lichtenstein, Cara B; Dawes, Candice S; Kelly, Katherine Patterson

    2017-06-01

    We designed a quality improvement (QI) project to address the high prevalence of childhood overweight and obesity (OW/OB) in our patient population and the inconsistencies among primary care providers in recognizing and addressing OW/OB. We used mixed methods data collection approach to evaluate a QI project, the Childhood Healthy Behaviors Intervention (CHBI), to improve provider obesity prevention practice in two low-income, predominantly African American pediatric primary care clinics. Electronic record data were extracted from all 2-9 year well visits pre- and postintervention for frequency of appropriate diagnostic coding of OW/OB. We reviewed a random sample of records for details of health habit assessment and counseling documentation. Focused interviews were conducted to elicit provider responses regarding impressions of the intervention. The preintervention sample of records (n = 267) was extracted from 18 providers and the postsample (n = 253) from 19 providers. Providers showed improvement in the recognition of OW/OB with appropriate diagnostic coding (52% pre, 68% post), improvement in assessment of health habits informed by the habit survey (0% pre, 76% post), improvement in counseling of healthy behaviors (86% pre, 92% post), and improvement in goal setting of healthy behaviors (12% pre, 70% post). Our findings suggest that implementing a time efficient primary care intervention with brief provider training can improve provider recognition of OW/OB, as well as improve provider behavior targeted at childhood obesity prevention. This project contributes needed QI evidence on interventions to prevent and address OW/OB in primary care settings and calls for further work to strengthen implementation in similar contexts.

  3. Comparative genomics of phylogenetically diverse unicellular eukaryotes provide new insights into the genetic basis for the evolution of the programmed cell death machinery.

    Science.gov (United States)

    Nedelcu, Aurora M

    2009-03-01

    Programmed cell death (PCD) represents a significant component of normal growth and development in multicellular organisms. Recently, PCD-like processes have been reported in single-celled eukaryotes, implying that some components of the PCD machinery existed early in eukaryotic evolution. This study provides a comparative analysis of PCD-related sequences across more than 50 unicellular genera from four eukaryotic supergroups: Unikonts, Excavata, Chromalveolata, and Plantae. A complex set of PCD-related sequences that correspond to domains or proteins associated with all main functional classes--from ligands and receptors to executors of PCD--was found in many unicellular lineages. Several PCD domains and proteins previously thought to be restricted to animals or land plants are also present in unicellular species. Noteworthy, the yeast, Saccharomyces cerevisiae--used as an experimental model system for PCD research, has a rather reduced set of PCD-related sequences relative to other unicellular species. The phylogenetic distribution of the PCD-related sequences identified in unicellular lineages suggests that the genetic basis for the evolution of the complex PCD machinery present in extant multicellular lineages has been established early in the evolution of eukaryotes. The shaping of the PCD machinery in multicellular lineages involved the duplication, co-option, recruitment, and shuffling of domains already present in their unicellular ancestors.

  4. Evidence for the Involvement of Membranous Bodies in the Processes Leading to Genetic Transformation in Bacillus subtilis

    Science.gov (United States)

    Wolstenholme, David R.; Vermeulen, Cornelius A.; Venema, Gerhardus

    1966-01-01

    Wolstenholme, David R. (Max-Planck-Institut für Biologie, Tübingen, Germany), Cornelius A. Vermeulen, and Gerhardus Venema. Evidence for the involvement of membranous bodies in the processes leading to genetic transformation in Bacillus subtilis. J. Bacteriol. 92:1111–1121. 1966.—Data obtained from electron microscopic autoradiographs of profiles of cells of a Bacillus subtilis population exposed to H3-thymidine-labeled donor deoxyribonucleic acid (DNA) during the phase of maximal competence indicated that molecules originating from absorbed DNA are closely associated with membranous bodies, particularly with those situated in the cytoplasm, but that most if not all of the radioactive molecules are outside the bodies. It is suggested that membranous bodies produce enzymes essential to the eventual incorporation of transforming DNA into the bacterial genome, or to the breakdown and utilization or expulsion of absorbed DNA not incorporated as transformant (or to both processes). During the phase of maximal competence, the total number of membranous bodies seen in profiles increased continuously to as much as 2.3 times the numbers found during earlier stages of culture. This increase was not accounted for by a decrease in bacterial cell volume, but resulted from an actual increase in total volume of membranous bodies. The number of membranous bodies visibly connecting plasma membrane and nuclear region increased during maximal competence to as much as 30 times the numbers found in earlier stages. As both increases were found in the absence of donor DNA and only began after maximal competence was attained, it seemed most probable that they were an expression of a physiological state influenced by the continuing deficiency of nutrients in the growth medium during this phase of culture. Images PMID:4959042

  5. Whole genome characterization of a novel porcine reproductive and respiratory syndrome virus 1 isolate: Genetic evidence for recombination between Amervac vaccine and circulating strains in mainland China.

    Science.gov (United States)

    Chen, Nanhua; Liu, Qiaorong; Qiao, Mingming; Deng, Xiaoyu; Chen, Xizhao; Sun, Ming

    2017-10-01

    Genotype 1 porcine reproductive and respiratory syndrome virus (PRRSV 1) have been continuously isolated in China in recent years. Complete genome sequences of these isolates are important to investigate the prevalence and evolution of Chinese PRRSV 1. Herein, we describe the isolation of a novel PRRSV 1 isolate, denominated HLJB1, in the Heilongjiang province of China. Complete genome sequencing of HLJB1 showed that it shares 90.66% and 58.21% nucleotide identities with PRRSV 1 and 2 prototypic strains Lelystad virus and ATCC VR-2332, respectively. HLJB1 has a unique 5-amino-acid insertion in nsp2, which has never been described in other PRRSV 1 isolates. Whole genome-based phylogenetic analysis revealed that all Chinese PRRSV 1 isolates are clustered in pan-European subtype 1 and can be divided into four subgroups. HLJB1 resides in the subgroup of BJEU06-1-like isolates but is also closely related to the Amervac-like isolates. Additionally, recombination analyses suggested that HLJB1 is a recombinant from the Amervac vaccine and the BJEU06-1 isolate. To our best knowledge, our results provide the first genetic evidence for recombination between Amervac vaccine and circulating strains. These findings are also beneficial for studying the origin and evolution of PRRSV 1 in China. Copyright © 2017. Published by Elsevier B.V.

  6. Evidence for a role of the oxytocin system, indexed by genetic variation in CD38, in the social bonding effects of expressed gratitude.

    Science.gov (United States)

    Algoe, Sara B; Way, Baldwin M

    2014-12-01

    Oxytocin is thought to play a central role in promoting close social bonds via influence on social interactions. The current investigation targeted interactions involving expressed gratitude between members of romantic relationships because recent evidence suggests gratitude and its expression provides behavioral and psychological 'glue' to bind individuals closer together. Specifically, we took a genetic approach to test the hypothesis that social interactions involving expressed gratitude would be associated with variation in a gene, CD38, which has been shown to affect oxytocin secretion. A polymorphism (rs6449182) that affects CD38 expression was significantly associated with global relationship satisfaction, perceived partner responsiveness and positive emotions (particularly love) after lab-based interactions, observed behavioral expression of gratitude toward a romantic partner in the lab, and frequency of expressed gratitude in daily life. A separate polymorphism in CD38 (rs3796863) previously associated with plasma oxytocin levels and social engagement was also associated with perceived responsiveness in the benefactor after an expression of gratitude. The combined influence of the two polymorphisms was associated with a broad range of gratitude-related behaviors and feelings. The consistent pattern of findings suggests that the oxytocin system is associated with solidifying the glue that binds adults into meaningful and important relationships. © The Author (2014). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  7. Provider cost analysis supports results-based contracting out of maternal and newborn health services: an evidence-based policy perspective.

    Science.gov (United States)

    Hatcher, Peter; Shaikh, Shiraz; Fazli, Hassan; Zaidi, Shehla; Riaz, Atif

    2014-11-13

    There is dearth of evidence on provider cost of contracted out services particularly for Maternal and Newborn Health (MNH). The evidence base is weak for policy makers to estimate resources required for scaling up contracting. This paper ascertains provider unit costs and expenditure distribution at contracted out government primary health centers to inform the development of optimal resource envelopes for contracting out MNH services. This is a case study of provider costs of MNH services at two government Rural Health Centers (RHCs) contracted out to a non-governmental organization in Pakistan. It reports on four selected Basic Emergency Obstetrical and Newborn Care (BEmONC) services provided in one RHC and six Comprehensive Emergency Obstetrical and Newborn Care (CEmONC) services in the other. Data were collected using staff interviews and record review to compile resource inputs and service volumes, and analyzed using the CORE Plus tool. Unit costs are based on actual costs of MNH services and are calculated for actual volumes in 2011 and for volumes projected to meet need with optimal resource inputs. The unit costs per service for actual 2011 volumes at the BEmONC RHC were antenatal care (ANC) visit USD$ 18.78, normal delivery US$ 84.61, newborn care US$ 16.86 and a postnatal care (PNC) visit US$ 13.86; and at the CEmONC RHC were ANC visit US$ 45.50, Normal Delivery US$ 148.43, assisted delivery US$ 167.43, C-section US$ 183.34, Newborn Care US$ 41.07, and PNC visit US$ 27.34. The unit costs for the projected volumes needed were lower due to optimal utilization of resources. The percentage distribution of expenditures at both RHCs was largest for salaries of technical staff, followed by salaries of administrative staff, and then operating costs, medicines, medical and diagnostic supplies. The unit costs of MNH services at the two contracted out government rural facilities remain higher than is optimal, primarily due to underutilization. Provider cost analysis

  8. The phenology of Rubus fruticosus in Ireland: herbarium specimens provide evidence for the response of phenophases to temperature, with implications for climate warming

    Science.gov (United States)

    Diskin, E.; Proctor, H.; Jebb, M.; Sparks, T.; Donnelly, A.

    2012-11-01

    To date, phenological research has provided evidence that climate warming is impacting both animals and plants, evidenced by the altered timing of phenophases. Much of the evidence supporting these findings has been provided by analysis of historic records and present-day fieldwork; herbaria have been identified recently as an alternative source of phenological data. Here, we used Rubus specimens to evaluate herbaria as potential sources of phenological data for use in climate change research and to develop the methodology for using herbaria specimens in phenological studies. Data relevant to phenology (collection date) were recorded from the information cards of over 600 herbarium specimens at Ireland's National Herbarium in Dublin. Each specimen was assigned a score (0-5) corresponding to its phenophase. Temperature data for the study period (1852 - 2007) were obtained from the University of East Anglia's Climate Research Unit (CRU); relationships between temperature and the dates of first flower, full flower, first fruit and full fruit were assessed using weighted linear regression. Of the five species of Rubus examined in this study, specimens of only one ( R. fruticosus) were sufficiently abundant to yield statistically significant relationships with temperature. The results revealed a trend towards earlier dates of first flower, full flower and first fruit phenophases with increasing temperature. Through its multi-phenophase approach, this research serves to extend the most recent work—which validated the use of herbaria through use of a single phenophase—to confirm herbarium-based research as a robust methodology for use in future phenological studies.

  9. Heritable influences on behavioural problems from early childhood to mid-adolescence: evidence for genetic stability and innovation.

    Science.gov (United States)

    Lewis, G J; Plomin, R

    2015-07-01

    Although behavioural problems (e.g., anxiety, conduct, hyperactivity, peer problems) are known to be heritable both in early childhood and in adolescence, limited work has examined prediction across these ages, and none using a genetically informative sample. We examined, first, whether parental ratings of behavioural problems (indexed by the Strengths and Difficulties questionnaire) at ages 4, 7, 9, 12, and 16 years were stable across these ages. Second, we examined the extent to which stability reflected genetic or environmental effects through multivariate quantitative genetic analysis on data from a large (n > 3000) population (UK) sample of monozygotic and dizygotic twins. Behavioural problems in early childhood (age 4 years) showed significant associations with the corresponding behavioural problem at all subsequent ages. Moreover, stable genetic influences were observed across ages, indicating that biological bases underlying behavioural problems in adolescence are underpinned by genetic influences expressed as early as age 4 years. However, genetic and environmental innovations were also observed at each age. These observations indicate that genetic factors are important for understanding stable individual differences in behavioural problems across childhood and adolescence, although novel genetic influences also facilitate change in such behaviours.

  10. Human red cell 2,3-diphosphoglycerate mutase and monophosphoglycerate mutase: genetic evidence for two separate loci.

    Science.gov (United States)

    Chen, S H; Anderson, J E; Giblett, E R

    1977-01-01

    Rare genetic variants of human red cell 2,3-diphosphoglycerate mutase (DPGM) and monophosphoglycerate mutase (MPGM) were compared by starch gel electrophoresis. The isozyme patterns showed that genetic variation of the enzymes were independent from each other, thus DPGM and MPGM must be controlled by two separate loci. Images Fig. 1 PMID:195467

  11. Testing the Children: Do Non-Genetic Health-Care Providers Differ in Their Decision to Advise Genetic Presymptomatic Testing on Minors? A Cross-Sectional Study in Five Countries in the European Union

    NARCIS (Netherlands)

    Plass, Anne Marie C.; Baars, Marieke J. H.; Cornel, Martina C.; Julian-Reynier, Claire; Nippert, Irmgard; Harris, Hillary; Kristoffersson, Ulf; Schmidtke, Jörg; Anionwu, Elizabeth N.; Benjamin, Caroline; Challen, Kirsty; Harris, Rodney; ten Kate, Leo P.

    2009-01-01

    Background: Within Europe many guidelines exist regarding the genetic testing of minors. Predictive and presymptomatic genetic testing of minors is recommended for disorders for which medical intervention/preventive measures exist, and for which early detection improves future medical health. Aim:

  12. Testing the children: do non-genetic health-care providers differ in their decision to advise genetic presymptomatic testing on minors? A cross-sectional study in five countries in the European Union.

    NARCIS (Netherlands)

    Plass, A.M.C.; Baars, M.J.H.; Cornel, M.C.; Julian-Reynier, C.; Nippert, I.; Harris, H.; Kristoffersson, U.; Schmidtke, J.; Anionwu, E.N.; Benjamin, C.; Challen, K.; Harris, R.; Kate, L.P. ten

    2009-01-01

    BACKGROUND: Within Europe many guidelines exist regarding the genetic testing of minors. Predictive and presymptomatic genetic testing of minors is recommended for disorders for which medical intervention/preventive measures exist, and for which early detection improves future medical health. AIM:

  13. Allochronic speciation, secondary contact, and reproductive character displacement in periodical cicadas (Hemiptera: Magicicada spp.): genetic, morphological, and behavioural evidence.

    Science.gov (United States)

    Cooley, J R; Simon, C; Marshall, D C; Slon, K; Ehrhardt, C

    2001-03-01

    Periodical cicadas have proven useful in testing a variety of ecological and evolutionary hypotheses because of their unusual life history, extraordinary abundance, and wide geographical range. Periodical cicadas provide the best examples of synchronous periodicity and predator satiation in the animal kingdom, and are excellent illustrations of habitat partitioning (by the three morphologically distinct species groups), incipient species (the year classes or broods), and cryptic species (a newly discovered 13-year species, Magicicada neotredecim). They are particularly useful for exploring questions regarding speciation via temporal isolation, or allochronic speciation. Recently, data were presented that provided strong support for an instance of allochronic speciation by life-cycle switching. This speciation event resulted in the formation of a new 13-year species from a 17-year species and led to secondary contact between two formerly separated lineages, one represented by the new 13-year cicadas (and their 17-year ancestors), and the other represented by the pre-existing 13-year cicadas. Allozyme frequency data, mitochondrial DNA (mtDNA), and abdominal colour were shown to be correlated genetic markers supporting the life-cycle switching/allochronic speciation hypothesis. In addition, a striking pattern of reproductive character displacement in male call pitch and female pitch preference between the two 13-year species was discovered. In this paper we report a strong association between calling song pitch and mtDNA haplotype for 101 individuals from a single locality within the M. tredecim/M. neotredecim contact zone and a strong association between abdomen colour and mtDNA haplotype. We conclude by reviewing proposed mechanisms for allochronic speciation and reproductive character displacement.

  14. Chapter 2: Genetic Variability in Nuclear Ribosomal and Chloroplast DNA in Utah (Juniperus Osteosperma) and Western (J. Occidentalis) Juniper (Cupressaceae): Evidence for Interspecific Gene Flow1

    Energy Technology Data Exchange (ETDEWEB)

    Terry, Randall G.; Tausch, Robin J.; Nowak, Robert S.

    1998-02-14

    Early studies of evolutionary change in chloroplast DNA indicated limited variability within species. This finding has been attributed to relatively low rates of sequence evolution and has been maintained as justification for the lack of intraspecific sampling in studies examining, relationships at the species level and above. However, documentation of intraspecific variation in cpDNA has become increasingly common and has been attributed in many cases to ''chloroplast capture'' following genetic exchange across species boundaries. Rleseberg and Wendel (1993) list 37 cases of proposed hybridization in plants that include intraspecific variation in cpDNA, 24 (65%) of which they considered to be probable instances of introgression. Rieseberg (1995) suspected that a review of the literature at that time would reveal over 100 cases of intraspecific variation in CPDNA that could be attributed to hybridization and introgression. That intraspecific variation in cpDNA is potentially indicative of hybridization is founded on the expectation that slowly evolving loci or genomes will produce greater molecular variation between than within species. In cases where a species is polymorphic for CPDNA and at least one of the molecular variants is diagnostic for a second species, interspecific hybridization is a plausible explanation. Incongruence between relationships suggested by cpDNA variation and those supported by other types of data (e.g., morphology or molecular data from an additional locus) provides additional support for introgression. One aspect of hybridization in both animals and plants that has become increasingly evident is incongruence in the phylogenetic and geographic distribution of cytoplasmic and nuclear markers. In most cases cytoplasmic introgression appears to be more pervasive than nuclear exchange. This discordance appears attributable to several factors including differences in the mutation rate, number of effective alleles, and modes

  15. Behavioral Genetics in Criminal and Civil Courts.

    Science.gov (United States)

    Sabatello, Maya; Appelbaum, Paul S

    Although emerging findings in psychiatric and behavioral genetics create hope for improved prevention, diagnosis, and treatment of disorders, the introduction of such data as evidence in criminal and civil proceedings raises a host of ethical, legal, and social issues. Should behavioral and psychiatric genetic data be admissible in judicial proceedings? If so, what are the various means for obtaining such evidence, and for what purposes should its admission be sought and permitted? How could-and should-such evidence affect judicial outcomes in criminal and civil proceedings? And what are the potential implications of using behavioral and psychiatric genetic evidence for individuals and communities, and for societal values of equality and justice? This article provides an overview of the historical and current developments in behavioral genetics. We then explore the extent to which behavioral genetic evidence has-and should-affect determinations of criminal responsibility and sentencing, as well as the possible ramifications of introducing such evidence in civil courts, with a focus on tort litigation and child custody disputes. We also consider two ways in which behavioral genetic evidence may come to court in the future-through genetic theft or the subpoena of a litigant's biospecimen data that was previously obtained for clinical or research purposes-and the concerns that these possibilities raise. Finally, we highlight the need for caution and for approaches to prevent the misuse of behavioral genetic evidence in courts.

  16. Genetic structure and admixture between Bayash Roma from northwestern Croatia and general Croatian population: evidence from Bayesian clustering analysis.

    Science.gov (United States)

    Novokmet, Natalija; Galov, Ana; Marjanović, Damir; Škaro, Vedrana; Projić, Petar; Lauc, Gordan; Primorac, Dragan; Rudan, Pavao

    2015-01-01

    The European Roma represent a transnational mosaic of minority population groups with different migration histories and contrasting experiences in their interactions with majority populations across the European continent. Although historical genetic contributions of European lineages to the Roma pool were investigated before, the extent of contemporary genetic admixture between Bayash Roma and non-Romani majority population remains elusive. The aim of this study was to assess the genetic structure of the Bayash Roma population from northwestern Croatia and the general Croatian population and to investigate the extent of admixture between them. A set of genetic data from two original studies (100 Bayash Roma from northwestern Croatia and 195 individuals from the general Croatian population) was analyzed by Bayesian clustering implemented in STRUCTURE software. By re-analyzing published data we intended to focus for the first time on genetic differentiation and structure and in doing so we clearly pointed to the importance of considering social phenomena in understanding genetic structuring. Our results demonstrated that two population clusters best explain the genetic structure, which is consistent with social exclusion of Roma and the demographic history of Bayash Roma who have settled in NW Croatia only about 150 years ago and mostly applied rules of endogamy. The presence of admixture was revealed, while the percentage of non-Croatian individuals in general Croatian population was approximately twofold higher than the percentage of non-Romani individuals in Roma population corroborating the presence of ethnomimicry in Roma.

  17. Whole-Genome Sequencing and Comparative Genome Analysis Provided Insight into the Predatory Features and Genetic Diversity of Two Bdellovibrio Species Isolated from Soil

    Directory of Open Access Journals (Sweden)

    Omotayo Opemipo Oyedara

    2018-01-01

    Full Text Available Bdellovibrio spp. are predatory bacteria with great potential as antimicrobial agents. Studies have shown that members of the genus Bdellovibrio exhibit peculiar characteristics that influence their ecological adaptations. In this study, whole genomes of two different Bdellovibrio spp. designated SKB1291214 and SSB218315 isolated from soil were sequenced. The core genes shared by all the Bdellovibrio spp. considered for the pangenome analysis including the epibiotic B. exovorus were 795. The number of unique genes identified in Bdellovibrio spp. SKB1291214, SSB218315, W, and B. exovorus JJS was 1343, 113, 857, and 1572, respectively. These unique genes encode hydrolytic, chemotaxis, and transporter proteins which might be useful for predation in the Bdellovibrio strains. Furthermore, the two Bdellovibrio strains exhibited differences based on the % GC content, amino acid identity, and 16S rRNA gene sequence. The 16S rRNA gene sequence of Bdellovibrio sp. SKB1291214 shared 99% identity with that of an uncultured Bdellovibrio sp. clone 12L 106 (a pairwise distance of 0.008 and 95–97% identity (a pairwise distance of 0.043 with that of other culturable terrestrial Bdellovibrio spp., including strain SSB218315. In Bdellovibrio sp. SKB1291214, 174 bp sequence was inserted at the host interaction (hit locus region usually attributed to prey attachment, invasion, and development of host independent Bdellovibrio phenotypes. Also, a gene equivalent to Bd0108 in B. bacteriovorus HD100 was not conserved in Bdellovibrio sp. SKB1291214. The results of this study provided information on the genetic characteristics and diversity of the genus Bdellovibrio that can contribute to their successful applications as a biocontrol agent.

  18. A soluble RecN homologue provides means for biochemical and genetic analysis of DNA double-strand break repair in Escherichia coli.

    Science.gov (United States)

    Grove, Jane I; Wood, Stuart R; Briggs, Geoffrey S; Oldham, Neil J; Lloyd, Robert G

    2009-12-03

    RecN is a highly conserved, SMC-like protein in bacteria. It plays an important role in the repair of DNA double-strand breaks and is therefore a key factor in maintaining genome integrity. The insolubility of Escherichia coli RecN has limited efforts to unravel its function. We overcame this limitation by replacing the resident coding sequence with that of Haemophilus influenzae RecN. The heterologous construct expresses Haemophilus RecN from the SOS-inducible E. coli promoter. The hybrid gene is fully functional, promoting survival after I-SceI induced DNA breakage, gamma irradiation or exposure to mitomycin C as effectively as the native gene, indicating that the repair activity is conserved between these two species. H. influenzae RecN is quite soluble, even when expressed at high levels, and is readily purified. Its analysis by ionisation-mass spectrometry, gel filtration and glutaraldehyde crosslinking indicates that it is probably a dimer under physiological conditions, although a higher multimer cannot be excluded. The purified protein displays a weak ATPase activity that is essential for its DNA repair function in vivo. However, no DNA-binding activity was detected, which contrasts with RecN from Bacillus subtilis. RecN proteins from Aquifex aeolicus and Bacteriodes fragilis also proved soluble. Neither binds DNA, but the Aquifex RecN has weak ATPase activity. Our findings support studies indicating that RecN, and the SOS response in general, behave differently in E. coli and B. subtilis. The hybrid recN reported provides new opportunities to study the genetics and biochemistry of how RecN operates in E. coli.

  19. Genome Analysis of the First Extensively Drug-Resistant (XDR Mycobacterium tuberculosis in Malaysia Provides Insights into the Genetic Basis of Its Biology and Drug Resistance.

    Directory of Open Access Journals (Sweden)

    Chee Sian Kuan

    Full Text Available The outbreak of extensively drug-resistant tuberculosis (XDR-TB has become an increasing problem in many TB-burdened countries. The underlying drug resistance mechanisms, including the genetic variation favored by selective pressure in the resistant population, are partially understood. Recently, the first case of XDR-TB was reported in Malaysia. However, the detailed genotype family and mechanisms of the formation of multiple drugs resistance are unknown. We sequenced the whole genome of the UM 1072388579 strain with a 2-kb insert-size library and combined with that from previously sequenced 500-bp-insert paired-end reads to produce an improved sequence with maximal sequencing coverage across the genome. In silico spoligotyping and phylogenetic analyses demonstrated that UM 1072388579 strain belongs to an ancestral-like, non-Beijing clade of East Asia lineage. This is supported by the presence of a number of lineage-specific markers, including fadD28, embA, nuoD and pks7. Polymorphism analysis showed that the drug-susceptibility profile is correlated with the pattern of resistance mutations. Mutations in drug-efflux pumps and the cell wall biogenesis pathway such as mmpL, pks and fadD genes may play an important role in survival and adaptation of this strain to its surrounding environment. In this work, fifty-seven putative promoter SNPs were identified. Among them, we identified a novel SNP located at -4 T allele of TetR/acrR promoter as an informative marker to recognize strains of East Asian lineage. Our work indicates that the UM 1072388579 harbors both classical and uncommon SNPs that allow it to escape from inhibition by many antibiotics. This study provides a strong foundation to dissect the biology and underlying resistance mechanisms of the first reported XDR M. tuberculosis in Malaysia.

  20. A Genome-wide Association Study Provides Evidence of Sex-specific Involvement of Chr1p35.1 (ZSCAN20-TLR12P and Chr8p23.1 (HMGB1P46 With Diabetic Neuropathic Pain

    Directory of Open Access Journals (Sweden)

    Weihua Meng

    2015-10-01

    Full Text Available Neuropathic pain is defined as pain arising as a direct consequence of a lesion or a disease affecting the somatosensory system and it affects around 1 in 4 diabetic patients in the UK. The purpose of this genome-wide association study (GWAS was to identify genetic contributors to this disorder. Cases of neuropathic pain were defined as diabetic patients with a multiple prescription history of at least one of five drugs specifically indicated for the treatment of neuropathic pain. Controls were diabetic individuals who were not prescribed any of these drugs, nor amitriptyline, carbamazepine, or nortriptyline. Overall, 961 diabetic neuropathic pain cases and 3260 diabetic controls in the Genetics of Diabetes Audit and Research Tayside (GoDARTS cohort were identified. We found a cluster in the Chr1p35.1 (ZSCAN20-TLR12P with a lowest P value of 2.74 × 10−7 at rs71647933 in females and a cluster in the Chr8p23.1, next to HMGB1P46 with a lowest P value of 8.02 × 10−7 at rs6986153 in males. Sex-specific narrow sense heritability was higher in males (30.0% than in females (14.7%. This GWAS on diabetic neuropathic pain provides evidence for the sex-specific involvement of Chr1p35.1 (ZSCAN20-TLR12P and Chr8p23.1 (HMGB1P46 with the disorder, indicating the need for further research.

  1. Analysis of complete genome sequences of G9P[19] rotavirus strains from human and piglet with diarrhea provides evidence for whole-genome interspecies transmission of nonreassorted porcine rotavirus.

    Science.gov (United States)

    Yodmeeklin, Arpaporn; Khamrin, Pattara; Chuchaona, Watchaporn; Kumthip, Kattareeya; Kongkaew, Aphisek; Vachirachewin, Ratchaya; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

    2017-01-01

    Whole genomes of G9P[19] human (RVA/Human-wt/THA/CMH-S070-13/2013/G9P[19]) and porcine (RVA/Pig-wt/THA/CMP-015-12/2012/G9P[19]) rotaviruses concurrently detected in the same geographical area in northern Thailand were sequenced and analyzed for their genetic relationships using bioinformatic tools. The complete genome sequence of human rotavirus RVA/Human-wt/THA/CMH-S070-13/2013/G9P[19] was most closely related to those of porcine rotavirus RVA/Pig-wt/THA/CMP-015-12/2012/G9P[19] and to those of porcine-like human and porcine rotaviruses reference strains than to those of human rotavirus reference strains. The genotype constellation of G9P[19] detected in human and piglet were identical and displayed as the G9-P[19]-I5-R1-C1-M1-A8-N1-T1-E1-H1 genotypes with the nucleotide sequence identities of VP7, VP4, VP6, VP1, VP2, VP3, NSP1, NSP2, NSP3, NSP4, and NSP5 at 99.0%, 99.5%, 93.2%, 97.7%, 97.7%, 85.6%, 89.5%, 93.2%, 92.9%, 94.0%, and 98.1%, respectively. The findings indicate that human rotavirus strain RVA/Human-wt/THA/CMH-S070-13/2013/G9P[19] containing the genome segments of porcine genetic backbone is most likely a human rotavirus of porcine origin. Our data provide an evidence of interspecies transmission and whole-genome transmission of nonreassorted G9P[19] porcine RVA to human occurring in nature in northern Thailand. Copyright © 2016. Published by Elsevier B.V.

  2. The Human Salivary Microbiome Is Shaped by Shared Environment Rather than Genetics: Evidence from a Large Family of Closely Related Individuals.

    Science.gov (United States)

    Shaw, Liam; Ribeiro, Andre L R; Levine, Adam P; Pontikos, Nikolas; Balloux, Francois; Segal, Anthony W; Roberts, Adam P; Smith, Andrew M

    2017-09-12

    The human microbiome is affected by multiple factors, including the environment and host genetics. In this study, we analyzed the salivary microbiomes of an extended family of Ashkenazi Jewish individuals living in several cities and investigated associations with both shared household and host genetic similarities. We found that environmental effects dominated over genetic effects. While there was weak evidence of geographical structuring at the level of cities, we observed a large and significant effect of shared household on microbiome composition, supporting the role of the immediate shared environment in dictating the presence or absence of taxa. This effect was also seen when including adults who had grown up in the same household but moved out prior to the time of sampling, suggesting that the establishment of the salivary microbiome earlier in life may affect its long-term composition. We found weak associations between host genetic relatedness and microbiome dissimilarity when using family pedigrees as proxies for genetic similarity. However, this association disappeared when using more-accurate measures of kinship based on genome-wide genetic markers, indicating that the environment rather than host genetics is the dominant factor affecting the composition of the salivary microbiome in closely related individuals. Our results support the concept that there is a consistent core microbiome conserved across global scales but that small-scale effects due to a shared living environment significantly affect microbial community composition. IMPORTANCE Previous research shows that the salivary microbiomes of relatives are more similar than those of nonrelatives, but it remains difficult to distinguish the effects of relatedness and shared household environment. Furthermore, pedigree measures may not accurately measure host genetic similarity. In this study, we include genetic relatedness based on genome-wide single nucleotide polymorphisms (SNPs) (rather than

  3. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  4. Comparative Genomics of Field Isolates of Mycobacterium bovis and M. caprae Provides Evidence for Possible Correlates with Bacterial Viability and Virulence.

    Directory of Open Access Journals (Sweden)

    José de la Fuente

    2015-11-01

    Full Text Available Mycobacteria of the Mycobacterium tuberculosis complex (MTBC greatly affect humans and animals worldwide. The life cycle of mycobacteria is complex and the mechanisms resulting in pathogen infection and survival in host cells are not fully understood. Recently, comparative genomics analyses have provided new insights into the evolution and adaptation of the MTBC to survive inside the host. However, most of this information has been obtained using M. tuberculosis but not other members of the MTBC such as M. bovis and M. caprae. In this study, the genome of three M. bovis (MB1, MB3, MB4 and one M. caprae (MB2 field isolates with different lesion score, prevalence and host distribution phenotypes were sequenced. Genome sequence information was used for whole-genome and protein-targeted comparative genomics analysis with the aim of finding correlates with phenotypic variation with potential implications for tuberculosis (TB disease risk assessment and control. At the whole-genome level the results of the first comparative genomics study of field isolates of M. bovis including M. caprae showed that as previously reported for M. tuberculosis, sequential chromosomal nucleotide substitutions were the main driver of the M. bovis genome evolution. The phylogenetic analysis provided a strong support for the M. bovis/M. caprae clade, but supported M. caprae as a separate species. The comparison of the MB1 and MB4 isolates revealed differences in genome sequence, including gene families that are important for bacterial infection and transmission, thus highlighting differences with functional implications between isolates otherwise classified with the same spoligotype. Strategic protein-targeted analysis using the ESX or type VII secretion system, proteins linking stress response with lipid metabolism, host T cell epitopes of mycobacteria, antigens and peptidoglycan assembly protein identified new genetic markers and candidate vaccine antigens that warrant

  5. Comparative Genomics of Field Isolates of Mycobacterium bovis and M. caprae Provides Evidence for Possible Correlates with Bacterial Viability and Virulence.

    Science.gov (United States)

    de la Fuente, José; Díez-Delgado, Iratxe; Contreras, Marinela; Vicente, Joaquín; Cabezas-Cruz, Alejandro; Tobes, Raquel; Manrique, Marina; López, Vladimir; Romero, Beatriz; Bezos, Javier; Dominguez, Lucas; Sevilla, Iker A; Garrido, Joseba M; Juste, Ramón; Madico, Guillermo; Jones-López, Edward; Gortazar, Christian

    2015-11-01

    Mycobacteria of the Mycobacterium tuberculosis complex (MTBC) greatly affect humans and animals worldwide. The life cycle of mycobacteria is complex and the mechanisms resulting in pathogen infection and survival in host cells are not fully understood. Recently, comparative genomics analyses have provided new insights into the evolution and adaptation of the MTBC to survive inside the host. However, most of this information has been obtained using M. tuberculosis but not other members of the MTBC such as M. bovis and M. caprae. In this study, the genome of three M. bovis (MB1, MB3, MB4) and one M. caprae (MB2) field isolates with different lesion score, prevalence and host distribution phenotypes were sequenced. Genome sequence information was used for whole-genome and protein-targeted comparative genomics analysis with the aim of finding correlates with phenotypic variation with potential implications for tuberculosis (TB) disease risk assessment and control. At the whole-genome level the results of the first comparative genomics study of field isolates of M. bovis including M. caprae showed that as previously reported for M. tuberculosis, sequential chromosomal nucleotide substitutions were the main driver of the M. bovis genome evolution. The phylogenetic analysis provided a strong support for the M. bovis/M. caprae clade, but supported M. caprae as a separate species. The comparison of the MB1 and MB4 isolates revealed differences in genome sequence, including gene families that are important for bacterial infection and transmission, thus highlighting differences with functional implications between isolates otherwise classified with the same spoligotype. Strategic protein-targeted analysis using the ESX or type VII secretion system, proteins linking stress response with lipid metabolism, host T cell epitopes of mycobacteria, antigens and peptidoglycan assembly protein identified new genetic markers and candidate vaccine antigens that warrant further study to

  6. Governance in Health – The Need for Exchange and Evidence; Comment on “Governance, Government, and the Search for New Provider Models”

    Directory of Open Access Journals (Sweden)

    Tata Chanturidze

    2016-08-01

    Full Text Available Governance in health is cited as one of the key factors in balancing the concerns of the government and public sector with the interests of civil society/private players, but often remains poorly described and operationalized. Richard Saltman and Antonio Duran look at two aspects in the search for new provider models in a context of health markets signalling liberalisation: (i the role of the government to balance public and private interests and responsibilities in delivering care through modernised governance arrangements, and (ii the finding that operational complexities may hinder well–designed provider governance models, unless governance reflects country-specific realities. This commentary builds on the discussion by Saltman and Duran, and argues that the concept of governance needs to be clearly defined and operationalized in order to be helpful for policy debate as well as for the development of an applicable framework for performance improvement. It provides a working definition of governance and includes a reflection on the prevailing cultural norms in an organization or society upon which any governance needs to be build. It proposes to explore whether the “evidence-based governance” concept can be introduced to generate knowledge about innovative and effective governance models, and concludes that studies similar to the one by Saltman and Duran can inform this debate.

  7. Population genetic analysis and evidence of inter-specific introgression in Helichrysum armenium and H. rubicundum (Asteraceae

    Directory of Open Access Journals (Sweden)

    Taban Malahat

    2015-01-01

    Full Text Available Helichrysum armenium and H. rubicundum are two medicinally important plants of Iran that are distributed in various regions of the country. They are extensively used by locals as medicinal plants and a great negative selection pressure is applied on them. Therefore, due to importance of these plant species, we performed a population genetic study in both species. For this study, we used 66 randomly collected plants from 24 geographical populations of Helichrysum armenium and H. rubicundu. These species had areas of overlap and contact and we found some intermediate plants that were included in our study too. UPGMA and MDS analyses revealed morphological separation of these closely related species and placed intermediate plants in an intermediate position. ISSR analysis revealed inter-population genetic diversity and K-Means clustering and STRUCTURE analyses revealed populations. Genetic stratification in both species. Genetic difference of the studied populations was not correlated to geographical distance. Triangle plot of Bayesian analysis and NeighborNet plot showed inter-specific gene flow. The studied populations showed plants with 2n = 2x = 14 and 2n = 4x = 28 chromosomes and differed significantly in their meiotic behavior. Therefore, a combination of genetic stratification, and genetic admixture as well as polyploidy and chromosomes structural changes, have played rule in Helichrysum diversification.

  8. Genetic Architecture of Group A Streptococcal Necrotizing Soft Tissue Infections in the Mouse

    DEFF Research Database (Denmark)

    Chella Krishnan, Karthickeyan; Mukundan, Santhosh; Alagarsamy, Jeyashree

    2016-01-01

    Host genetic variations play an important role in several pathogenic diseases, and we have previously provided strong evidences that these genetic variations contribute significantly to differences in susceptibility and clinical outcomes of invasive Group A Streptococcus (GAS) infections, includi...

  9. Genetic and environmental overlap between borderline personality disorder traits and psychopathy: evidence for promotive effects of factor 2 and protective effects of factor 1.

    Science.gov (United States)

    Hunt, E; Bornovalova, M A; Patrick, C J

    2015-05-01

    Previous studies have reported strong genetic and environmental overlap between antisocial-externalizing (factor 2; F2) features of psychopathy and borderline personality disorder (BPD) tendencies. However, this line of research has yet to examine etiological associations of affective-interpersonal (factor 1, F1) features of psychopathy with BPD tendencies. The current study investigated differential phenotypic and genetic overlap of psychopathy factors 1 and 2 with BPD tendencies in a sample of over 250 male and female community-recruited adult twin pairs. Consistent with previous research, biometric analyses revealed strong genetic and non-shared environmental correlations of F2 with BPD tendencies, suggesting that common genetic and non-shared environmental factors contribute to both phenotypes. In contrast, negative genetic and non-shared environmental correlations were observed between F1 and BPD tendencies, indicating that the genetic factors underlying F1 serve as protective factors against BPD. No gender differences emerged in the analyses. These findings provide further insight into associations of psychopathic features - F1 as well as F2 - and BPD tendencies. Implications for treatment and intervention are discussed, along with how psychopathic traits may differentially influence the manifestation of BPD tendencies.

  10. Clinical and genetic characterization of families with arrhythmogenic right ventricular dysplasia/cardiomyopathy provides novel insights into patterns of disease expression.

    LENUS (Irish Health Repository)

    Sen-Chowdhry, Srijita

    2007-04-03

    According to clinical-pathological correlation studies, the natural history of arrhythmogenic right ventricular dysplasia\\/cardiomyopathy is purported to progress from localized to global right ventricular dysfunction, followed by left ventricular (LV) involvement and biventricular pump failure. The inevitable focus on sudden death victims and transplant recipients may, however, have created a skewed perspective of a genetic disease. We hypothesized that unbiased representation of the spectrum of disease expression in arrhythmogenic right ventricular dysplasia\\/cardiomyopathy would require in vivo assessment of families in a genetically heterogeneous population.

  11. Meta-Analysis of Genome-Wide Association Studies in African Americans Provides Insights into the Genetic Architecture of Type 2 Diabetes

    OpenAIRE

    Ng, Maggie C. Y.; Shriner, Daniel; Chen, Brian H.; Li, Jiang; Chen, Wei-Min; Guo, Xiuqing; Liu, Jiankang; Bielinski, Suzette J.; Yanek, Lisa R.; Nalls, Michael A.; Comeau, Mary E.; Rasmussen-Torvik, Laura J.; Jensen, Richard A.; Evans, Daniel S.; Sun, Yan V.

    2014-01-01

    Type 2 diabetes (T2D) is more prevalent in African Americans than in Europeans. However, little is known about the genetic risk in African Americans despite the recent identification of more than 70 T2D loci primarily by genome-wide association studies (GWAS) in individuals of European ancestry. In order to investigate the genetic architecture of T2D in African Americans, the MEta-analysis of type 2 DIabetes in African Americans (MEDIA) Consortium examined 17 GWAS on T2D comprising 8,284 case...

  12. Cancer Genetics Services Directory

    Science.gov (United States)

    ... Services Directory Cancer Prevention Overview Research NCI Cancer Genetics Services Directory This directory lists professionals who provide services related to cancer genetics (cancer risk assessment, genetic counseling, genetic susceptibility testing, ...

  13. Fine-scale genetic structure and cryptic associations reveal evidence of kin-based sociality in the African forest elephant.

    Directory of Open Access Journals (Sweden)

    Stephanie G Schuttler

    Full Text Available Spatial patterns of relatedness within animal populations are important in the evolution of mating and social systems, and have the potential to reveal information on species that are difficult to observe in the wild. This study examines the fine-scale genetic structure and connectivity of groups within African forest elephants, Loxodonta cyclotis, which are often difficult to observe due to forest habitat. We tested the hypothesis that genetic similarity will decline with increasing geographic distance, as we expect kin to be in closer proximity, using spatial autocorrelation analyses and Tau K(r tests. Associations between individuals were investigated through a non-invasive genetic capture-recapture approach using network models, and were predicted to be more extensive than the small groups found in observational studies, similar to fission-fusion sociality found in African savanna (Loxodonta africana and Asian (Elephas maximus species. Dung samples were collected in Lopé National Park, Gabon in 2008 and 2010 and genotyped at 10 microsatellite loci, genetically sexed, and sequenced at the mitochondrial DNA control region. We conducted analyses on samples collected at three different temporal scales: a day, within six-day sampling sessions, and within each year. Spatial autocorrelation and Tau K(r tests revealed genetic structure, but results were weak and inconsistent between sampling sessions. Positive spatial autocorrelation was found in distance classes of 0-5 km, and was strongest for the single day session. Despite weak genetic structure, individuals within groups were significantly more related to each other than to individuals between groups. Social networks revealed some components to have large, extensive groups of up to 22 individuals, and most groups were composed of individuals of the same matriline. Although fine-scale population genetic structure was weak, forest elephants are typically found in groups consisting of kin and

  14. Fine-scale genetic structure and cryptic associations reveal evidence of kin-based sociality in the African forest elephant.

    Science.gov (United States)

    Schuttler, Stephanie G; Philbrick, Jessica A; Jeffery, Kathryn J; Eggert, Lori S

    2014-01-01

    Spatial patterns of relatedness within animal populations are important in the evolution of mating and social systems, and have the potential to reveal information on species that are difficult to observe in the wild. This study examines the fine-scale genetic structure and connectivity of groups within African forest elephants, Loxodonta cyclotis, which are often difficult to observe due to forest habitat. We tested the hypothesis that genetic similarity will decline with increasing geographic distance, as we expect kin to be in closer proximity, using spatial autocorrelation analyses and Tau K(r) tests. Associations between individuals were investigated through a non-invasive genetic capture-recapture approach using network models, and were predicted to be more extensive than the small groups found in observational studies, similar to fission-fusion sociality found in African savanna (Loxodonta africana) and Asian (Elephas maximus) species. Dung samples were collected in Lopé National Park, Gabon in 2008 and 2010 and genotyped at 10 microsatellite loci, genetically sexed, and sequenced at the mitochondrial DNA control region. We conducted analyses on samples collected at three different temporal scales: a day, within six-day sampling sessions, and within each year. Spatial autocorrelation and Tau K(r) tests revealed genetic structure, but results were weak and inconsistent between sampling sessions. Positive spatial autocorrelation was found in distance classes of 0-5 km, and was strongest for the single day session. Despite weak genetic structure, individuals within groups were significantly more related to each other than to individuals between groups. Social networks revealed some components to have large, extensive groups of up to 22 individuals, and most groups were composed of individuals of the same matriline. Although fine-scale population genetic structure was weak, forest elephants are typically found in groups consisting of kin and based on matrilines

  15. Sequence analysis of the PIP5K locus in Eimeria maxima provides further evidence for eimerian genome plasticity and segmental organization.

    Science.gov (United States)

    Song, B K; Pan, M Z; Lau, Y L; Wan, K L

    2014-07-29

    Commercial flocks infected by Eimeria species parasites, including Eimeria maxima, have an increased risk of developing clinical or subclinical coccidiosis; an intestinal enteritis associated with increased mortality rates in poultry. Currently, infection control is largely based on chemotherapy or live vaccines; however, drug resistance is common and vaccines are relatively expensive. The development of new cost-effective intervention measures will benefit from unraveling the complex genetic mechanisms that underlie host-parasite interactions, including the identification and characterization of genes encoding proteins such as phosphatidylinositol 4-phosphate 5-kinase (PIP5K). We previously identified a PIP5K coding sequence within the E. maxima genome. In this study, we analyzed two bacterial artificial chromosome clones presenting a ~145-kb E. maxima (Weybridge strain) genomic region spanning the PIP5K gene locus. Sequence analysis revealed that ~95% of the simple sequence repeats detected were located within regions comparable to the previously described feature-rich segments of the Eimeria tenella genome. Comparative sequence analysis with the orthologous E. maxima (Houghton strain) region revealed a moderate level of conserved synteny. Unique segmental organizations and telomere-like repeats were also observed in both genomes. A number of incomplete transposable elements were detected and further scrutiny of these elements in both orthologous segments revealed interesting nesting events, which may play a role in facilitating genome plasticity in E. maxima. The current analysis provides more detailed information about the genome organization of E. maxima and may help to reveal genotypic differences that are important for expression of traits related to pathogenicity and virulence.

  16. Introducing eHealth and other innovative options into clinical genetic patient care in view of increased efficiency and maintenance of quality of care : Patients' and providers' perspectives

    NARCIS (Netherlands)

    Otten, Ellen

    2015-01-01

    Innovations in clinical genetics patient care This year some 40,000 patients will visit a clinical geneticist. This number is increasing because there are ever-expanding possibilities for DNA testing. Most patients are seen individually in an outpatient clinic. But partly because the healthcare

  17. Development of Microsatellite Markers in the Branched Broomrape Phelipanche ramosa L. (Pomel and Evidence for Host-Associated Genetic Divergence

    Directory of Open Access Journals (Sweden)

    Valérie Le Corre

    2014-01-01

    Full Text Available Phelipanche ramosa is a parasitic plant that infects numerous crops worldwide. In Western Europe it recently expanded to a new host crop, oilseed rape, in which it can cause severe yield losses. We developed 13 microsatellite markers for P. ramosa using next-generation 454 sequencing data. The polymorphism at each locus was assessed in a sample of 96 individuals collected in France within 6 fields cultivated with tobacco, hemp or oilseed rape. Two loci were monomorphic. At the other 11 loci, the number of alleles and the expected heterozygosity ranged from 3 to 6 and from 0.31 to 0.60, respectively. Genetic diversity within each cultivated field was very low. The host crop from which individuals were collected was the key factor structuring genetic variation. Individuals collected on oilseed rape were strongly differentiated from individuals collected on hemp or tobacco, which suggests that P. ramosa infecting oilseed rape forms a genetically diverged race. The microsatellites we developed will be useful for population genetics studies and for elucidating host-associated genetic divergence in P. ramosa.

  18. Translating research into practice: the role of provider-based research networks in the diffusion of an evidence-based colon cancer treatment innovation.

    Science.gov (United States)

    Carpenter, William R; Meyer, Anne-Marie; Wu, Yang; Qaqish, Bahjat; Sanoff, Hanna K; Goldberg, Richard M; Weiner, Bryan J

    2012-08-01

    Provider-based research networks (PBRNs)--collaborative research partnerships between academic centers and community-based practitioners--are a promising model for accelerating the translation of research into practice; however, empirical evidence of accelerated translation is limited. Oxaliplatin in adjuvant combination chemotherapy is an innovation with clinical trial-proven survival benefit compared with prior therapies. The goal of this study is to examine the diffusion of oxaliplatin into community practice, and whether affiliation with the National Cancer Institute's (NCI's) Community Clinical Oncology Program (CCOP)--a nationwide cancer-focused PBRN--is associated with accelerated innovation adoption. This retrospective observational study used linked Surveillance, Epidemiology, and End Results-Medicare and NCI CCOP data to examine Medicare participants with stage III colon cancer initiating treatment in 2003 through 2006, the years surrounding oxaliplatin's Food and Drug Administration approval. A fixed-effects analysis examined chemotherapy use among patients treated outside academic centers at CCOP-affiliated practices compared with non-CCOP practices. Two-group modeling controlled for multiple levels of clustering, year of chemotherapy initiation, tumor characteristics, patient age, race, comorbidity, Medicaid dual-eligibility status, and education. Of 4055 community patients, 35% received 5-fluoruracil, 20% received oxaliplatin, 7% received another chemotherapy, and 38% received no chemotherapy. Twenty-five percent of CCOP patients received oxaliplatin, compared with 19% of non-CCOP patients. In multivariable analysis, CCOP exposure was associated with higher odds of receiving guideline-concordant treatment in general, and oxaliplatin specifically. These findings contribute to a growing set of evidence linking PBRNs with a greater probability of receiving treatment innovations and high-quality cancer care, with implications for clinical and research

  19. The limits of child effects: evidence for genetically mediated child effects on corporal punishment but not on physical maltreatment.

    Science.gov (United States)

    Jaffee, Sara R; Caspi, Avshalom; Moffitt, Terrie E; Polo-Tomas, Monica; Price, Thomas S; Taylor, Alan

    2004-11-01

    Research on child effects has demonstrated that children's difficult and coercive behavior provokes harsh discipline from adults. Using a genetically sensitive design, the authors tested the limits of child effects on adult behavior that ranged from the normative (corporal punishment) to the nonnormative (physical maltreatment). The sample was a 1994-1995 nationally representative birth cohort of 1,116 twins and their families who participated in the Environmental Risk Longitudinal Study. Results showed that environmental factors accounted for most of the variation in corporal punishment and physical maltreatment. However, corporal punishment was genetically mediated in part, and the genetic factors that influenced corporal punishment were largely the same as those that influenced children's antisocial behavior, suggesting a child effect. The authors conclude that risk factors for maltreatment are less likely to reside within the child and more likely to reside in characteristics that differ between families. (c) 2004 APA, all rights reserved

  20. Evidence that multiple genetic variants of MC4R play a functional role in the regulation of energy expenditure and appetite in Hispanic children1234

    Science.gov (United States)

    Cole, Shelley A; Voruganti, V Saroja; Cai, Guowen; Haack, Karin; Kent, Jack W; Blangero, John; Comuzzie, Anthony G; McPherson, John D; Gibbs, Richard A

    2010-01-01

    Background: Melanocortin-4-receptor (MC4R) haploinsufficiency is the most common form of monogenic obesity; however, the frequency of MC4R variants and their functional effects in general populations remain uncertain. Objective: The aim was to identify and characterize the effects of MC4R variants in Hispanic children. Design: MC4R was resequenced in 376 parents, and the identified single nucleotide polymorphisms (SNPs) were genotyped in 613 parents and 1016 children from the Viva la Familia cohort. Measured genotype analysis (MGA) tested associations between SNPs and phenotypes. Bayesian quantitative trait nucleotide (BQTN) analysis was used to infer the most likely functional polymorphisms influencing obesity-related traits. Results: Seven rare SNPs in coding and 18 SNPs in flanking regions of MC4R were identified. MGA showed suggestive associations between MC4R variants and body size, adiposity, glucose, insulin, leptin, ghrelin, energy expenditure, physical activity, and food intake. BQTN analysis identified SNP 1704 in a predicted micro-RNA target sequence in the downstream flanking region of MC4R as a strong, probable functional variant influencing total, sedentary, and moderate activities with posterior probabilities of 1.0. SNP 2132 was identified as a variant with a high probability (1.0) of exerting a functional effect on total energy expenditure and sleeping metabolic rate. SNP rs34114122 was selected as having likely functional effects on the appetite hormone ghrelin, with a posterior probability of 0.81. Conclusion: This comprehensive investigation provides strong evidence that MC4R genetic variants are likely to play a functional role in the regulation of weight, not only through energy intake but through energy expenditure. PMID:19889825

  1. The Burden of Provider-Initiated Preterm Birth and Associated Factors: Evidence from the Brazilian Multicenter Study on Preterm Birth (EMIP.

    Directory of Open Access Journals (Sweden)

    Renato T Souza

    .49; 4.86-32.05, and chronic diabetes (OR 5.24; 2.68-10.25 were the most significant factors independently associated with pi-PTB.pi-PTB is responsible for about one-third of all preterm births, requiring special attention. The decision-making process relative to the choice of provider-initiated birth is complex, and many factors should be elucidated to improve strategies for its prevention, including evidence-based guidelines on proper management of the corresponding clinical conditions.

  2. Prevalence and genetic diversity of haematozoa in South American waterfowl and evidence for intercontinental redistribution of parasites by migratory birds

    Science.gov (United States)

    Smith, Matthew M.; Ramey, Andy M.

    2015-01-01

    To understand the role of migratory birds in the movement and transmission of haematozoa within and between continental regions, we examined 804 blood samples collected from eleven endemic species of South American waterfowl in Peru and Argentina for infection by Haemoproteus, Plasmodium, and/or Leucocytozono blood parasites. Infections were detected in 25 individuals of six species for an overall apparent prevalence rate of 3.1%. Analysis of haematozoa mitochondrial DNA revealed twelve distinct parasite haplotypes infecting South American waterfowl, four of which were identical to lineages previously observed infecting ducks and swans sampled in North America. Analysis of parasite mitochondrial DNA sequences revealed close phylogenetic relationships between lineages originating from waterfowl samples regardless of continental affiliation. In contrast, more distant phylogenetic relationships were observed between parasite lineages from waterfowl and passerines sampled in South America for Haemoproteus and Leucocytozoon, suggesting some level of host specificity for parasites of these genera. The detection of identical parasite lineages in endemic, South American waterfowl and North American ducks and swans, paired with the close phylogenetic relationships of haematozoa infecting waterfowl on both continents, provides evidence for parasite redistribution between these regions by migratory birds.

  3. ESTIMATION OF RECURRENCE RISK AND GENETIC COUNSELLING OF FAMILIES WITH EVIDENCE OF ISOLATED (UNSYNDROMIC CLEFT LIP AND PALATE IN SUCEAVA COUNTY, ROMANIA

    Directory of Open Access Journals (Sweden)

    Crsitian Tudose

    2007-08-01

    Full Text Available : Cleft lip and/or palate are the most frequent facial congenital malformations and represent a dramatic situation at birth, which involves important functional, aesthetic, psychological and social impairment that motivates the necessity of a thorough genetic study in the view of genetic counselling. We have studied the families of 100 children with clefts born during the years 1985-1996 in Suceava county and selected from the evidences of the Children Hospital Suceava. The recurrence risk was determined in accordance with the rules of calculation for multifactorial inheritance; it varied between 2 – 5% for the majority of cases (77% which corresponds to a small risk degree; only in 23% of cases the risk varied between 6 – 15% which corresponds to a medium risk degree

  4. Androgenetic Alopecia: Identification of Four Genetic Risk Loci and Evidence for the Contribution of WNT Signaling to Its Etiology

    NARCIS (Netherlands)

    Heilmann, S.; Kiefer, A.K.; Fricker, N.; Drichel, D.; Hillmer, A.M.; Herold, C.; Tung, J.Y.; Eriksson, N.; Redler, S.; Betz, R.C.; Li, R.; Karason, A.; Nyholt, D.R.; Song, K.; Vermeulen, S.; Kanoni, S.; Dedoussis, G.; Martin, N.G.; Kiemeney, L.A.L.M.; Mooser, V.; Stefansson, K.; Richards, J.B.; Becker, T.; Brockschmidt, F.F.; Hinds, D.A.; Nothen, M.M.

    2013-01-01

    The pathogenesis of androgenetic alopecia (AGA, male-pattern baldness) is driven by androgens, and genetic predisposition is the major prerequisite. Candidate gene and genome-wide association studies have reported that single-nucleotide polymorphisms (SNPs) at eight different genomic loci are

  5. Genetic evidence for function of the bHLH-PAS protein Gce/Met as a juvenile hormone receptor

    Czech Academy of Sciences Publication Activity Database

    Jindra, Marek; Uhlířová, M.; Charles, J.-P.; Smýkal, V.; Hill, R. J.

    2015-01-01

    Roč. 11, č. 7 (2015), e1005394 ISSN 1553-7404 Grant - others:Marie Curie International Outgoing Fellowship Award(CZ) 276569 Institutional support: RVO:60077344 Keywords : juvenile hormone Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.661, year: 2015 http://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1005394

  6. Experimental evidence that kin discrimination in the Seychelles warbler is based on association and not on genetic relatedness

    NARCIS (Netherlands)

    Komdeur, J; Richardson, DS; Burke, T; Richardson, David S.

    2004-01-01

    In cooperative breeding systems driven by kin selection, effective kin-recognition cues are important. Recognition could be achieved by the direct assessment of the genetic relatedness of individuals or by learning through association. In the Seychelles warbler, Acrocephalus sechellensis, female

  7. Exploratory subsetting of autism families based on savant skills improves evidence of genetic linkage to 15q11-q13.

    Science.gov (United States)

    Nurmi, Erika L; Dowd, Michael; Tadevosyan-Leyfer, Ovsanna; Haines, Jonathan L; Folstein, Susan E; Sutcliffe, James S

    2003-07-01

    Autism displays a remarkably high heritability but a complex genetic etiology. One approach to identifying susceptibility loci under these conditions is to define more homogeneous subsets of families on the basis of genetically relevant phenotypic or biological characteristics that vary from case to case. The authors performed a principal components analysis, using items from the Autism Diagnostic Interview, which resulted in six clusters of variables, five of which showed significant sib-sib correlation. The utility of these phenotypic subsets was tested in an exploratory genetic analysis of the autism candidate region on chromosome 15q11-q13. When the Collaborative Linkage Study of Autism sample was divided, on the basis of mean proband score for the "savant skills" cluster, the heterogeneity logarithm of the odds under a recessive model at D15S511, within the GABRB3 gene, increased from 0.6 to 2.6 in the subset of families in which probands had greater savant skills. These data are consistent with the genetic contribution of a 15q locus to autism susceptibility in a subset of affected individuals exhibiting savant skills. Similar types of skills have been noted in individuals with Prader-Willi syndrome, which results from deletions of this chromosomal region.

  8. Extremely low genetic variation in endangered Tatra chamois and evidence for hybridization with an introduced Alpine population