WorldWideScience

Sample records for providing genetic evidence

  1. Genetic data provide evidence for wind-mediated transmission of highly pathogenic avian influenza.

    Science.gov (United States)

    Ypma, Rolf J F; Jonges, Marcel; Bataille, Arnaud; Stegeman, Arjan; Koch, Guus; van Boven, Michiel; Koopmans, Marion; van Ballegooijen, W Marijn; Wallinga, Jacco

    2013-03-01

    Outbreaks of highly pathogenic avian influenza in poultry can cause severe economic damage and represent a public health threat. Development of efficient containment measures requires an understanding of how these influenza viruses are transmitted between farms. However, the actual mechanisms of interfarm transmission are largely unknown. Dispersal of infectious material by wind has been suggested, but never demonstrated, as a possible cause of transmission between farms. Here we provide statistical evidence that the direction of spread of avian influenza A(H7N7) is correlated with the direction of wind at date of infection. Using detailed genetic and epidemiological data, we found the direction of spread by reconstructing the transmission tree for a large outbreak in the Netherlands in 2003. We conservatively estimate the contribution of a possible wind-mediated mechanism to the total amount of spread during this outbreak to be around 18%.

  2. Cytoplasmic-genetic male sterility gene provides direct evidence for some hybrid rice recently evolving into weedy rice

    Science.gov (United States)

    Zhang, Jingxu; Lu, Zuomei; Dai, Weimin; Song, Xiaoling; Peng, Yufa; Valverde, Bernal E.; Qiang, Sheng

    2015-01-01

    Weedy rice infests paddy fields worldwide at an alarmingly increasing rate. There is substantial evidence indicating that many weedy rice forms originated from or are closely related to cultivated rice. There is suspicion that the outbreak of weedy rice in China may be related to widely grown hybrid rice due to its heterosis and the diversity of its progeny, but this notion remains unsupported by direct evidence. We screened weedy rice accessions by both genetic and molecular marker tests for the cytoplasmic male sterility (CMS) genes (Wild abortive, WA, and Boro type, BT) most widely used in the production of indica and japonica three-line hybrid rice as a diagnostic trait of direct parenthood. Sixteen weedy rice accessions of the 358 tested (4.5%) contained the CMS-WA gene; none contained the CMS-BT gene. These 16 accessions represent weedy rices recently evolved from maternal hybrid rice derivatives, given the primarily maternal inheritance of this trait. Our results provide key direct evidence that hybrid rice can be involved in the evolution of some weedy rice accessions, but is not a primary factor in the recent outbreak of weedy rice in China. PMID:26012494

  3. Cytoplasmic-genetic male sterility gene provides direct evidence for some hybrid rice recently evolving into weedy rice.

    Science.gov (United States)

    Zhang, Jingxu; Lu, Zuomei; Dai, Weimin; Song, Xiaoling; Peng, Yufa; Valverde, Bernal E; Qiang, Sheng

    2015-05-27

    Weedy rice infests paddy fields worldwide at an alarmingly increasing rate. There is substantial evidence indicating that many weedy rice forms originated from or are closely related to cultivated rice. There is suspicion that the outbreak of weedy rice in China may be related to widely grown hybrid rice due to its heterosis and the diversity of its progeny, but this notion remains unsupported by direct evidence. We screened weedy rice accessions by both genetic and molecular marker tests for the cytoplasmic male sterility (CMS) genes (Wild abortive, WA, and Boro type, BT) most widely used in the production of indica and japonica three-line hybrid rice as a diagnostic trait of direct parenthood. Sixteen weedy rice accessions of the 358 tested (4.5%) contained the CMS-WA gene; none contained the CMS-BT gene. These 16 accessions represent weedy rices recently evolved from maternal hybrid rice derivatives, given the primarily maternal inheritance of this trait. Our results provide key direct evidence that hybrid rice can be involved in the evolution of some weedy rice accessions, but is not a primary factor in the recent outbreak of weedy rice in China.

  4. Autosomal STRs provide genetic evidence for the hypothesis that Tai people originate from southern China.

    Directory of Open Access Journals (Sweden)

    Hao Sun

    Full Text Available Tai people are widely distributed in Thailand, Laos and southwestern China and are a large population of Southeast Asia. Although most anthropologists and historians agree that modern Tai people are from southwestern China and northern Thailand, the place from which they historically migrated remains controversial. Three popular hypotheses have been proposed: northern origin hypothesis, southern origin hypothesis or an indigenous origin. We compared the genetic relationships between the Tai in China and their "siblings" to test different hypotheses by analyzing 10 autosomal microsatellites. The genetic data of 916 samples from 19 populations were analyzed in this survey. The autosomal STR data from 15 of the 19 populations came from our previous study (Lin et al., 2010. 194 samples from four additional populations were genotyped in this study: Han (Yunnan, Dai (Dehong, Dai (Yuxi and Mongolian. The results of genetic distance comparisons, genetic structure analyses and admixture analyses all indicate that populations from northern origin hypothesis have large genetic distances and are clearly differentiated from the Tai. The simulation-based ABC analysis also indicates this. The posterior probability of the northern origin hypothesis is just 0.04 [95%CI: (0.01-0.06]. Conversely, genetic relationships were very close between the Tai and populations from southern origin or an indigenous origin hypothesis. Simulation-based ABC analyses were also used to distinguish the southern origin hypothesis from the indigenous origin hypothesis. The results indicate that the posterior probability of the southern origin hypothesis [0.640, 95%CI: (0.524-0.757] is greater than that of the indigenous origin hypothesis [0.324, 95%CI: (0.211-0.438]. Therefore, we propose that the genetic evidence does not support the hypothesis of northern origin. Our genetic data indicate that the southern origin hypothesis has higher probability than the other two hypotheses

  5. Genetic Evidence for Modifying Oceanic Boundaries Relative to Fiji.

    Science.gov (United States)

    Shipley, Gerhard P; Taylor, Diana A; N'Yeurt, Antoine D R; Tyagi, Anand; Tiwari, Geetanjali; Redd, Alan J

    2016-07-01

    We present the most comprehensive genetic characterization to date of five Fijian island populations: Viti Levu, Vanua Levu, Kadavu, the Lau Islands, and Rotuma, including nonrecombinant Y (NRY) chromosome and mitochondrial DNA (mtDNA) haplotypes and haplogroups. As a whole, Fijians are genetically intermediate between Melanesians and Polynesians, but the individual Fijian island populations exhibit significant genetic structure reflecting different settlement experiences in which the Rotumans and the Lau Islanders were more influenced by Polynesians, and the other Fijian island populations were more influenced by Melanesians. In particular, Rotuman and Lau Islander NRY chromosomal and mtDNA haplogroup frequencies and Rotuman mtDNA hypervariable segment 1 region haplotypes more closely resemble those of Polynesians, while genetic markers of the other populations more closely resemble those of the Near Oceanic Melanesians. Our findings provide genetic evidence supportive of modifying regional boundaries relative to Fiji, as has been suggested by others based on a variety of nongenetic evidence. Specifically, for the traditional Melanesia/Polynesia/Micronesia scheme, our findings support moving the Melanesia-Polynesia boundary to include Rotuma and the Lau Islands in Polynesia. For the newer Near/Remote Oceania scheme, our findings support keeping Rotuma and the Lau Islands in Remote Oceania and locating the other Fijian island populations in an intermediate or "Central Oceania" region to better reflect the great diversity of Oceania.

  6. Genetic evidence for patrilocal mating behavior among Neandertal groups

    DEFF Research Database (Denmark)

    Lalueza-Fox, Carles; Rosas, Antonio; Estalrrich, Almudena

    2011-01-01

    The remains of 12 Neandertal individuals have been found at the El Sidrón site (Asturias, Spain), consisting of six adults, three adolescents, two juveniles, and one infant. Archaeological, paleontological, and geological evidence indicates that these individuals represent all or part of a contem...... of the three adult females carried different mtDNA lineages. These findings provide evidence to indicate that Neandertal groups not only were small and characterized by low genetic diversity but also were likely to have practiced patrilocal mating behavior....

  7. Tourette's Disorder: Genetic Update, Neurological Correlates, and Evidence-Based Interventions

    Science.gov (United States)

    Phelps, LeAdelle

    2008-01-01

    This article provides an update of the search for genetic markers related to Tourette's Disorder. The probable neurophysiology of the disorder is reviewed. Frequently prescribed medications are related to the probable biological bases of the disorder. Behavioral interventions and assessment tools are examined. It is concluded that evidence based…

  8. Evidence that pairing with genetically similar mates is maladaptive in a monogamous bird

    Science.gov (United States)

    Mulard, Hervé; Danchin, E.; Talbot, S.L.; Ramey, A.M.; Hatch, Shyla A.; White, J.F.; Helfenstein, F.; Wagner, R.H.

    2009-01-01

    Background. Evidence of multiple genetic criteria of mate choice is accumulating in numerous taxa. In many species, females have been shown to pair with genetically dissimilar mates or with extra-pair partners that are more genetically compatible than their social mates, thereby increasing their offsprings' heterozygosity which often correlates with offspring fitness. While most studies have focused on genetically promiscuous species, few studies have addressed genetically monogamous species, in which mate choice tends to be mutual. Results. Here, we used microsatellite markers to assess individual global heterozygosity and genetic similarity of pairs in a socially and genetically monogamous seabird, the black-legged kittiwake Rissa tridactyla. We found that pairs were more genetically dissimilar than expected by chance. We also identified fitness costs of breeding with genetically similar partners: (i) genetic similarity of pairs was negatively correlated with the number of chicks hatched, and (ii) offspring heterozygosity was positively correlated with growth rate and survival. Conclusion. These findings provide evidence that breeders in a genetically monogamous species may avoid the fitness costs of reproducing with a genetically similar mate. In such species that lack the opportunity to obtain extra-pair fertilizations, mate choice may therefore be under high selective pressure. ?? 2009 Mulard et al; licensee BioMed Central Ltd.

  9. Evidence that pairing with genetically similar mates is maladaptive in a monogamous bird

    Directory of Open Access Journals (Sweden)

    Ramey Andrew M

    2009-06-01

    Full Text Available Abstract Background Evidence of multiple genetic criteria of mate choice is accumulating in numerous taxa. In many species, females have been shown to pair with genetically dissimilar mates or with extra-pair partners that are more genetically compatible than their social mates, thereby increasing their offsprings' heterozygosity which often correlates with offspring fitness. While most studies have focused on genetically promiscuous species, few studies have addressed genetically monogamous species, in which mate choice tends to be mutual. Results Here, we used microsatellite markers to assess individual global heterozygosity and genetic similarity of pairs in a socially and genetically monogamous seabird, the black-legged kittiwake Rissa tridactyla. We found that pairs were more genetically dissimilar than expected by chance. We also identified fitness costs of breeding with genetically similar partners: (i genetic similarity of pairs was negatively correlated with the number of chicks hatched, and (ii offspring heterozygosity was positively correlated with growth rate and survival. Conclusion These findings provide evidence that breeders in a genetically monogamous species may avoid the fitness costs of reproducing with a genetically similar mate. In such species that lack the opportunity to obtain extra-pair fertilizations, mate choice may therefore be under high selective pressure.

  10. Levels of Evidence: Cancer Genetics Studies (PDQ®)—Health Professional Version

    Science.gov (United States)

    Levels of Evidence for Cancer Genetics Studies addresses the process and challenges of developing evidence-based summaries. Get information about how to weigh the strength of the evidence from cancer genetics studies in this summary for clinicians.

  11. Genetics of Schizophrenia: Historical Insights and Prevailing Evidence.

    Science.gov (United States)

    van de Leemput, J; Hess, J L; Glatt, S J; Tsuang, M T

    2016-01-01

    Schizophrenia's (SZ's) heritability and familial transmission have been known for several decades; however, despite the clear evidence for a genetic component, it has been very difficult to pinpoint specific causative genes. Even so genetic studies have taught us a lot, even in the pregenomic era, about the molecular underpinnings and disease-relevant pathways. Recurring themes emerged revealing the involvement of neurodevelopmental processes, glutamate regulation, and immune system differential activation in SZ etiology. The recent emergence of epigenetic studies aimed at shedding light on the biological mechanisms underlying SZ has provided another layer of information in the investigation of gene and environment interactions. However, this epigenetic insight also brings forth another layer of complexity to the (epi)genomic landscape such as interactions between genetic variants, epigenetic marks-including cross-talk between DNA methylation and histone modification processes-, gene expression regulation, and environmental influences. In this review, we seek to synthesize perspectives, including limitations and obstacles yet to overcome, from genetic and epigenetic literature on SZ through a qualitative review of risk factors and prevailing hypotheses. Encouraged by the findings of both genetic and epigenetic studies to date, as well as the continued development of new technologies to collect and interpret large-scale studies, we are left with a positive outlook for the future of elucidating the molecular genetic mechanisms underlying SZ and other complex neuropsychiatric disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Impact of behavioral genetic evidence on the adjudication of criminal behavior.

    Science.gov (United States)

    Appelbaum, Paul S; Scurich, Nicholas

    2014-01-01

    Recent advances in behavioral genetics suggest a modest relationship among certain gene variants, early childhood experiences, and criminal behavior. Although scientific research examining this link is still at an early stage, genetic data are already being introduced in criminal trials. However, the extent to which such evidence is likely to affect jurors' decisions has not been explored. In the present study, a representative sample of the U.S. population (n = 250) received a vignette describing an apparently impulsive homicide, accompanied by one of four explanations of the defendant's impulsivity: childhood abuse, genetic predisposition, childhood abuse and genetic predisposition, or simple impulsive behavior. The participants were asked to identify the crime that the defendant had committed and to select an appropriate sentence range. Evidence of genetic predisposition did not affect the crime of which the defendant was convicted or the sentence. However, participants who received the abuse or genetic + abuse explanation imposed longer prison sentences. Paradoxically, the genetic and genetic + abuse conditions engendered the greatest fear of the defendant. These findings should allay concerns that genetic evidence in criminal adjudications will be overly persuasive to jurors, but should raise questions about the impact of genetic attributions on perceptions of dangerousness.

  13. Gene × Environment Interactions in Schizophrenia: Evidence from Genetic Mouse Models.

    Science.gov (United States)

    Moran, Paula; Stokes, Jennifer; Marr, Julia; Bock, Gavin; Desbonnet, Lieve; Waddington, John; O'Tuathaigh, Colm

    2016-01-01

    The study of gene × environment, as well as epistatic interactions in schizophrenia, has provided important insight into the complex etiopathologic basis of schizophrenia. It has also increased our understanding of the role of susceptibility genes in the disorder and is an important consideration as we seek to translate genetic advances into novel antipsychotic treatment targets. This review summarises data arising from research involving the modelling of gene × environment interactions in schizophrenia using preclinical genetic models. Evidence for synergistic effects on the expression of schizophrenia-relevant endophenotypes will be discussed. It is proposed that valid and multifactorial preclinical models are important tools for identifying critical areas, as well as underlying mechanisms, of convergence of genetic and environmental risk factors, and their interaction in schizophrenia.

  14. Gene × Environment Interactions in Schizophrenia: Evidence from Genetic Mouse Models

    Science.gov (United States)

    Marr, Julia; Bock, Gavin; Desbonnet, Lieve; Waddington, John

    2016-01-01

    The study of gene × environment, as well as epistatic interactions in schizophrenia, has provided important insight into the complex etiopathologic basis of schizophrenia. It has also increased our understanding of the role of susceptibility genes in the disorder and is an important consideration as we seek to translate genetic advances into novel antipsychotic treatment targets. This review summarises data arising from research involving the modelling of gene × environment interactions in schizophrenia using preclinical genetic models. Evidence for synergistic effects on the expression of schizophrenia-relevant endophenotypes will be discussed. It is proposed that valid and multifactorial preclinical models are important tools for identifying critical areas, as well as underlying mechanisms, of convergence of genetic and environmental risk factors, and their interaction in schizophrenia. PMID:27725886

  15. Evidence for a genetic etiology of early-onset delinquency.

    Science.gov (United States)

    Taylor, J; Iacono, W G; McGue, M

    2000-11-01

    Age at onset of antisocial behavior discriminates persistent and transitory offenders. The authors proposed that early-onset delinquency has an underlying genetic influence that manifests in problems related to inhibition, whereas late-onset delinquency is more environmentally mediated. To test these notions, they selected 36 early starters, 86 late starters, and 25 nondelinquent controls from a large sample of 11-year-old twins and compared them on several measures related to inhibition and a peer group measure. As expected, early starters had more psychological, behavioral, and emotional problems related to inhibition than late starters and controls. A longitudinal analysis indicated an increase an antisocial behavior among peers of late starters shortly before their delinquency onset. Family history data and a twin analysis provided evidence of greater genetic influence on early-onset than late-onset delinquency.

  16. Review: domestic animal forensic genetics - biological evidence, genetic markers, analytical approaches and challenges.

    Science.gov (United States)

    Kanthaswamy, S

    2015-10-01

    This review highlights the importance of domestic animal genetic evidence sources, genetic testing, markers and analytical approaches as well as the challenges this field is facing in view of the de facto 'gold standard' human DNA identification. Because of the genetic similarity between humans and domestic animals, genetic analysis of domestic animal hair, saliva, urine, blood and other biological material has generated vital investigative leads that have been admitted into a variety of court proceedings, including criminal and civil litigation. Information on validated short tandem repeat, single nucleotide polymorphism and mitochondrial DNA markers and public access to genetic databases for forensic DNA analysis is becoming readily available. Although the fundamental aspects of animal forensic genetic testing may be reliable and acceptable, animal forensic testing still lacks the standardized testing protocols that human genetic profiling requires, probably because of the absence of monetary support from government agencies and the difficulty in promoting cooperation among competing laboratories. Moreover, there is a lack in consensus about how to best present the results and expert opinion to comply with court standards and bear judicial scrutiny. This has been the single most persistent challenge ever since the earliest use of domestic animal forensic genetic testing in a criminal case in the mid-1990s. Crime laboratory accreditation ensures that genetic test results have the courts' confidence. Because accreditation requires significant commitments of effort, time and resources, the vast majority of animal forensic genetic laboratories are not accredited nor are their analysts certified forensic examiners. The relevance of domestic animal forensic genetics in the criminal justice system is undeniable. However, further improvements are needed in a wide range of supporting resources, including standardized quality assurance and control protocols for sample

  17. Gene × Environment Interactions in Schizophrenia: Evidence from Genetic Mouse Models

    Directory of Open Access Journals (Sweden)

    Paula Moran

    2016-01-01

    Full Text Available The study of gene × environment, as well as epistatic interactions in schizophrenia, has provided important insight into the complex etiopathologic basis of schizophrenia. It has also increased our understanding of the role of susceptibility genes in the disorder and is an important consideration as we seek to translate genetic advances into novel antipsychotic treatment targets. This review summarises data arising from research involving the modelling of gene × environment interactions in schizophrenia using preclinical genetic models. Evidence for synergistic effects on the expression of schizophrenia-relevant endophenotypes will be discussed. It is proposed that valid and multifactorial preclinical models are important tools for identifying critical areas, as well as underlying mechanisms, of convergence of genetic and environmental risk factors, and their interaction in schizophrenia.

  18. The genetics of music accomplishment: evidence for gene-environment correlation and interaction.

    Science.gov (United States)

    Hambrick, David Z; Tucker-Drob, Elliot M

    2015-02-01

    Theories of skilled performance that emphasize training history, such as K. Anders Ericsson and colleagues' deliberate-practice theory, have received a great deal of recent attention in both the scientific literature and the popular press. Twin studies, however, have demonstrated evidence for moderate-to-strong genetic influences on skilled performance. Focusing on musical accomplishment in a sample of over 800 pairs of twins, we found evidence for gene-environment correlation, in the form of a genetic effect on music practice. However, only about one quarter of the genetic effect on music accomplishment was explained by this genetic effect on music practice, suggesting that genetically influenced factors other than practice contribute to individual differences in music accomplishment. We also found evidence for gene-environment interaction, such that genetic effects on music accomplishment were most pronounced among those engaging in music practice, suggesting that genetic potentials for skilled performance are most fully expressed and fostered by practice.

  19. Assessing the evidence for shared genetic risks across psychiatric disorders and traits.

    Science.gov (United States)

    Martin, Joanna; Taylor, Mark J; Lichtenstein, Paul

    2017-12-04

    Genetic influences play a significant role in risk for psychiatric disorders, prompting numerous endeavors to further understand their underlying genetic architecture. In this paper, we summarize and review evidence from traditional twin studies and more recent genome-wide molecular genetic analyses regarding two important issues that have proven particularly informative for psychiatric genetic research. First, emerging results are beginning to suggest that genetic risk factors for some (but not all) clinically diagnosed psychiatric disorders or extreme manifestations of psychiatric traits in the population share genetic risks with quantitative variation in milder traits of the same disorder throughout the general population. Second, there is now evidence for substantial sharing of genetic risks across different psychiatric disorders. This extends to the level of characteristic traits throughout the population, with which some clinical disorders also share genetic risks. In this review, we summarize and evaluate the evidence for these two issues, for a range of psychiatric disorders. We then critically appraise putative interpretations regarding the potential meaning of genetic correlation across psychiatric phenotypes. We highlight several new methods and studies which are already using these insights into the genetic architecture of psychiatric disorders to gain additional understanding regarding the underlying biology of these disorders. We conclude by outlining opportunities for future research in this area.

  20. Current Evidence and Insights about Genetics in Thoracic Aorta Disease

    Science.gov (United States)

    Muneretto, Claudio

    2013-01-01

    Thoracic aortic aneurysms have been historically considered to be caused by etiologic factors similar to those implied in abdominal aortic aneurysms. However, during the past decade, there has been increasing evidence that almost 20% of thoracic aortic aneurysms may be associated with a genetic disease, often within a syndromic or familial disorder. Moreover, the presence of congenital anomalies, such as bicuspid aortic valve, may have a unique common genetic underlying cause. Finally, also sporadic forms have been found to be potentially associated with genetic disorders, as highlighted by the analysis of rare variants and expression of specific microRNAs. We therefore sought to perform a comprehensive review of the role of genetic causes in the development of thoracic aortic aneurysms, by analyzing in detail the current evidence of genetic alterations in syndromes such as Marfan, Loeys-Dietz, and Ehler-Danlos, familial or sporadic forms, or forms associated with bicuspid aortic valve. PMID:24453931

  1. Whole-Genome Scans Provide Evidence of Adaptive Evolution in Malawian Plasmodium falciparum Isolates

    DEFF Research Database (Denmark)

    Ocholla, Harold; Preston, Mark D; Mipando, Mwapatsa

    2014-01-01

    BACKGROUND:  Selection by host immunity and antimalarial drugs has driven extensive adaptive evolution in Plasmodium falciparum and continues to produce ever-changing landscapes of genetic variation. METHODS:  We performed whole-genome sequencing of 69 P. falciparum isolates from Malawi and used......, an area of high malaria transmission. Allele frequency-based tests provided evidence of recent population growth in Malawi and detected potential targets of host immunity and candidate vaccine antigens. Comparison of the sequence variation between isolates from Malawi and those from 5 geographically...... dispersed countries (Kenya, Burkina Faso, Mali, Cambodia, and Thailand) detected population genetic differences between Africa and Asia, within Southeast Asia, and within Africa. Haplotype-based tests of selection to sequence data from all 6 populations identified signals of directional selection at known...

  2. Genetic Evidence Highlights Potential Impacts of By-Catch to Cetaceans

    Science.gov (United States)

    Mendez, Martin; Rosenbaum, Howard C.; Wells, Randall S.; Stamper, Andrew; Bordino, Pablo

    2010-01-01

    Incidental entanglement in fishing gear is arguably the most serious threat to many populations of small cetaceans, judging by the alarming number of captured animals. However, other aspects of this threat, such as the potential capture of mother-offspring pairs or reproductive pairs, could be equally or even more significant but have rarely been evaluated. Using a combination of demographic and genetic data we provide evidence that i) Franciscana dolphin pairs that are potentially reproductive and mother-offspring pairs form temporal bonds, and ii) are entangled simultaneously. Our results highlight potential demographic and genetic impacts of by-catch to cetacean populations: the joint entanglement of mother-offspring or reproductive pairs, compared to random individuals, might exacerbate the demographic consequences of by-catch, and the loss of groups of relatives means that significant components of genetic diversity could be lost together. Given the social nature of many odontocetes (toothed cetaceans), we suggest that these potential impacts could be rather general to the group and therefore by-catch could be more detrimental than previously considered. PMID:21179542

  3. Effects of Behavioral Genetic Evidence on Perceptions of Criminal Responsibility and Appropriate Punishment

    Science.gov (United States)

    Appelbaum, Paul S.; Scurich, Nicholas; Raad, Raymond

    2015-01-01

    Demonstrations of a link between genetic variants and criminal behavior have stimulated increasing use of genetic evidence to reduce perceptions of defendants’ responsibility for criminal behavior and to mitigate punishment. However, because only limited data exist regarding the impact of such evidence on decision makers and the public at large, we recruited a representative sample of the U.S. adult population (n=960) for a web-based survey. Participants were presented with descriptions of three legal cases and were asked to: determine the length of incarceration for a convicted murderer; adjudicate an insanity defense; and decide whether a defendant should receive the death penalty. A fully crossed, between-participants, factorial design was used, varying the type of evidence (none, genetic, neuroimaging, both), heinousness of the crime, and past criminal record, with sentence or verdict as the primary outcome. Also assessed were participants’ apprehension of the defendant, belief in free will, political ideology, and genetic knowledge. Across all three cases, genetic evidence had no significant effects on outcomes. Neuroimaging data showed an inconsistent effect in one of the two cases in which it was introduced. In contrast, heinousness of the offense and past criminal record were strongly related to participants’ decisions. Moreover, participants’ beliefs about the controllability of criminal behavior and political orientations were significantly associated with their choices. Our findings suggest that neither hopes that genetic evidence will modify judgments of culpability and punishment nor fears about the impact of genetic evidence on decision makers are likely to come to fruition. PMID:26240516

  4. Effects of Behavioral Genetic Evidence on Perceptions of Criminal Responsibility and Appropriate Punishment.

    Science.gov (United States)

    Appelbaum, Paul S; Scurich, Nicholas; Raad, Raymond

    2015-05-01

    Demonstrations of a link between genetic variants and criminal behavior have stimulated increasing use of genetic evidence to reduce perceptions of defendants' responsibility for criminal behavior and to mitigate punishment. However, because only limited data exist regarding the impact of such evidence on decision makers and the public at large, we recruited a representative sample of the U.S. adult population (n=960) for a web-based survey. Participants were presented with descriptions of three legal cases and were asked to: determine the length of incarceration for a convicted murderer; adjudicate an insanity defense; and decide whether a defendant should receive the death penalty. A fully crossed, between-participants, factorial design was used, varying the type of evidence (none, genetic, neuroimaging, both), heinousness of the crime, and past criminal record, with sentence or verdict as the primary outcome. Also assessed were participants' apprehension of the defendant, belief in free will, political ideology, and genetic knowledge. Across all three cases, genetic evidence had no significant effects on outcomes. Neuroimaging data showed an inconsistent effect in one of the two cases in which it was introduced. In contrast, heinousness of the offense and past criminal record were strongly related to participants' decisions. Moreover, participants' beliefs about the controllability of criminal behavior and political orientations were significantly associated with their choices. Our findings suggest that neither hopes that genetic evidence will modify judgments of culpability and punishment nor fears about the impact of genetic evidence on decision makers are likely to come to fruition.

  5. Evidence for Genetic Overlap Between Schizophrenia and Age at First Birth in Women

    DEFF Research Database (Denmark)

    Mehta, Divya; Tropf, Felix C; Gratten, Jacob

    2016-01-01

    IMPORTANCE: A recently published study of national data by McGrath et al in 2014 showed increased risk of schizophrenia (SCZ) in offspring associated with both early and delayed parental age, consistent with a U-shaped relationship. However, it remains unclear if the risk to the child is due......), reflecting the published relationship between maternal age and SCZ risk in offspring by McGrath et al in 2014. CONCLUSIONS AND RELEVANCE: This study provides evidence for a significant overlap between genetic factors associated with risk of SCZ and genetic factors associated with AFB. It has been reported...

  6. Primary care providers' lived experiences of genetics in practice.

    Science.gov (United States)

    Harding, Brittany; Webber, Colleen; Ruhland, Lucia; Dalgarno, Nancy; Armour, Christine M; Birtwhistle, Richard; Brown, Glenn; Carroll, June C; Flavin, Michael; Phillips, Susan; MacKenzie, Jennifer J

    2018-04-26

    To effectively translate genetic advances into practice, engagement of primary care providers (PCPs) is essential. Using a qualitative, phenomenological methodology, we analyzed key informant interviews and focus groups designed to explore perspectives of urban and rural PCPs. PCPs endorsed a responsibility to integrate genetics into their practices and expected advances in genetic medicine to expand. However, PCPs reported limited knowledge and difficulties accessing resources, experts, and continuing education. Rural practitioners' additional concerns included cost, distance, and poor patient engagement. PCPs' perspectives are crucial to develop relevant educational and systems-based interventions to further expand genetic medicine in primary care.

  7. Psychiatric genetic testing: Attitudes and intentions among future users and providers

    DEFF Research Database (Denmark)

    Laegsgaard, Mett Marri; Mors, Ole

    2008-01-01

    as a guide in this field, but the optimal utilization of genetic testing has also been recognized to depend on knowledge of the potential consumers' attitudes. To provide knowledge to inform the public debate on mental illness and genetics, and the future conducting of psychiatric genetic testing....... Psychiatric and somatic genetic testing attracted the same amounts of accept. General attitudes toward access to psychiatric genetic testing and information revealed substantial support for bioethical principles of autonomy and privacy. However, questions describing more specific situations revealed......Psychiatric genetic research may eventually render possible psychiatric genetic testing. Whereas all genetic knowledge has certain characteristics raising ethical, legal, and social issues, psychiatric genetic knowledge adds more controversial issues. Ethical principles have been proposed...

  8. An X chromosome association scan of the Norfolk Island genetic isolate provides evidence for a novel migraine susceptibility locus at Xq12.

    Directory of Open Access Journals (Sweden)

    Bridget H Maher

    Full Text Available Migraine is a common and debilitating neurovascular disorder with a complex envirogenomic aetiology. Numerous studies have demonstrated a preponderance of women affected with migraine and previous pedigree linkage studies in our laboratory have identified susceptibility loci on chromosome Xq24-Xq28. In this study we have used the genetic isolate of Norfolk Island to further analyse the X chromosome for migraine susceptibility loci.An association approach was employed to analyse 14,124 SNPs spanning the entire X chromosome. Genotype data from 288 individuals comprising a large core-pedigree, of which 76 were affected with migraine, were analysed. Although no SNP reached chromosome-wide significance (empirical α = 1 × 10(-5 ranking by P-value revealed two primary clusters of SNPs in the top 25. A 10 SNP cluster represents a novel migraine susceptibility locus at Xq12 whilst a 11 SNP cluster represents a previously identified migraine susceptibility locus at Xq27. The strongest association at Xq12 was seen for rs599958 (OR = 1.75, P = 8.92 × 10(-4, whilst at Xq27 the strongest association was for rs6525667 (OR = 1.53, P = 1.65 × 10(-4. Further analysis of SNPs at these loci was performed in 5,122 migraineurs from the Women's Genome Health Study and provided additional evidence for association at the novel Xq12 locus (P<0.05.Overall, this study provides evidence for a novel migraine susceptibility locus on Xq12. The strongest effect SNP (rs102834, joint P = 1.63 × 10(-5 is located within the 5'UTR of the HEPH gene, which is involved in iron homeostasis in the brain and may represent a novel pathway for involvement in migraine pathogenesis.

  9. Can lip prints provide biologic evidence?

    Science.gov (United States)

    Sharma, Preeti; Sharma, Neeraj; Wadhwan, Vijay; Aggarwal, Pooja

    2016-01-01

    Lip prints are unique and can be used in personal identification. Very few studies are available which establish them as biological evidence in the court of law. Thus, the objective of this study was to attempt to isolate DNA and obtain full short tandem repeat (STR) loci of the individual from the lip prints on different surfaces. Twelve lip prints were procured on different surfaces such as tissue paper, cotton cloth, ceramic tile, and glass surface. Latent lip prints were developed using fingerprint black powder. Lipstick-coated lip prints were also collected on the same supporting items. DNA was isolated, quantified, and amplified using Identifiler™ kit to type 15 STR loci. Ample quantity of DNA was extracted from all the lip print impressions and 15 loci were successfully located in seven samples. Fourteen loci were successfully typed in 3 lip impressions while 13 loci were typed in 2 samples. This study emphasizes the relevance of lip prints at the scene of crime. Extraction of DNA followed by typing of STR loci establishes the lip prints as biological evidence too. Tissue papers, napkins, cups, and glasses may have imprints of the suspect's lips. Thus, the full genetic profile is extremely useful for the forensic team.

  10. Extensive genetic diversity, unique population structure and evidence of genetic exchange in the sexually transmitted parasite Trichomonas vaginalis.

    Directory of Open Access Journals (Sweden)

    Melissa D Conrad

    Full Text Available Trichomonas vaginalis is the causative agent of human trichomoniasis, the most common non-viral sexually transmitted infection world-wide. Despite its prevalence, little is known about the genetic diversity and population structure of this haploid parasite due to the lack of appropriate tools. The development of a panel of microsatellite makers and SNPs from mining the parasite's genome sequence has paved the way to a global analysis of the genetic structure of the pathogen and association with clinical phenotypes.Here we utilize a panel of T. vaginalis-specific genetic markers to genotype 235 isolates from Mexico, Chile, India, Australia, Papua New Guinea, Italy, Africa and the United States, including 19 clinical isolates recently collected from 270 women attending New York City sexually transmitted disease clinics. Using population genetic analysis, we show that T. vaginalis is a genetically diverse parasite with a unique population structure consisting of two types present in equal proportions world-wide. Parasites belonging to the two types (type 1 and type 2 differ significantly in the rate at which they harbor the T. vaginalis virus, a dsRNA virus implicated in parasite pathogenesis, and in their sensitivity to the widely-used drug, metronidazole. We also uncover evidence of genetic exchange, indicating a sexual life-cycle of the parasite despite an absence of morphologically-distinct sexual stages.Our study represents the first robust and comprehensive evaluation of global T. vaginalis genetic diversity and population structure. Our identification of a unique two-type structure, and the clinically relevant phenotypes associated with them, provides a new dimension for understanding T. vaginalis pathogenesis. In addition, our demonstration of the possibility of genetic exchange in the parasite has important implications for genetic research and control of the disease.

  11. Extensive genetic diversity, unique population structure and evidence of genetic exchange in the sexually transmitted parasite Trichomonas vaginalis.

    Science.gov (United States)

    Conrad, Melissa D; Gorman, Andrew W; Schillinger, Julia A; Fiori, Pier Luigi; Arroyo, Rossana; Malla, Nancy; Dubey, Mohan Lal; Gonzalez, Jorge; Blank, Susan; Secor, William E; Carlton, Jane M

    2012-01-01

    Trichomonas vaginalis is the causative agent of human trichomoniasis, the most common non-viral sexually transmitted infection world-wide. Despite its prevalence, little is known about the genetic diversity and population structure of this haploid parasite due to the lack of appropriate tools. The development of a panel of microsatellite makers and SNPs from mining the parasite's genome sequence has paved the way to a global analysis of the genetic structure of the pathogen and association with clinical phenotypes. Here we utilize a panel of T. vaginalis-specific genetic markers to genotype 235 isolates from Mexico, Chile, India, Australia, Papua New Guinea, Italy, Africa and the United States, including 19 clinical isolates recently collected from 270 women attending New York City sexually transmitted disease clinics. Using population genetic analysis, we show that T. vaginalis is a genetically diverse parasite with a unique population structure consisting of two types present in equal proportions world-wide. Parasites belonging to the two types (type 1 and type 2) differ significantly in the rate at which they harbor the T. vaginalis virus, a dsRNA virus implicated in parasite pathogenesis, and in their sensitivity to the widely-used drug, metronidazole. We also uncover evidence of genetic exchange, indicating a sexual life-cycle of the parasite despite an absence of morphologically-distinct sexual stages. Our study represents the first robust and comprehensive evaluation of global T. vaginalis genetic diversity and population structure. Our identification of a unique two-type structure, and the clinically relevant phenotypes associated with them, provides a new dimension for understanding T. vaginalis pathogenesis. In addition, our demonstration of the possibility of genetic exchange in the parasite has important implications for genetic research and control of the disease.

  12. Multiple genetic interaction experiments provide complementary information useful for gene function prediction.

    Directory of Open Access Journals (Sweden)

    Magali Michaut

    Full Text Available Genetic interactions help map biological processes and their functional relationships. A genetic interaction is defined as a deviation from the expected phenotype when combining multiple genetic mutations. In Saccharomyces cerevisiae, most genetic interactions are measured under a single phenotype - growth rate in standard laboratory conditions. Recently genetic interactions have been collected under different phenotypic readouts and experimental conditions. How different are these networks and what can we learn from their differences? We conducted a systematic analysis of quantitative genetic interaction networks in yeast performed under different experimental conditions. We find that networks obtained using different phenotypic readouts, in different conditions and from different laboratories overlap less than expected and provide significant unique information. To exploit this information, we develop a novel method to combine individual genetic interaction data sets and show that the resulting network improves gene function prediction performance, demonstrating that individual networks provide complementary information. Our results support the notion that using diverse phenotypic readouts and experimental conditions will substantially increase the amount of gene function information produced by genetic interaction screens.

  13. Understanding the cognitive and genetic underpinnings of procrastination: Evidence for shared genetic influences with goal management and executive function abilities.

    Science.gov (United States)

    Gustavson, Daniel E; Miyake, Akira; Hewitt, John K; Friedman, Naomi P

    2015-12-01

    Previous research has suggested that individual differences in procrastination are tied to everyday goal-management abilities, but little research has been conducted on specific cognitive abilities that may underlie tendencies for procrastination, such as executive functions (EFs). In this study, we used behavioral genetics methodology to investigate 2 hypotheses about the relationships between procrastination and EF ability: (a) that procrastination is negatively correlated with general EF ability, and (b) that this relationship is due to the genetic components of procrastination that are most related to other everyday goal-management abilities. The results confirmed both of these hypotheses. Procrastination was related to worse general EF ability at both the phenotypic and genetic levels, and this relationship was due to the component of procrastination shared with self-report measures of everyday goal-management failures. These results were observed even after controlling for potential self-report biases stemming from the urge to respond in a socially desirable manner. Together, these findings provide strong evidence for growing theories of procrastination emphasizing the importance of goal-related cognitive abilities and further highlight important genetic influences that underlie procrastination. (c) 2015 APA, all rights reserved).

  14. Genetic and biochemical evidences reveal novel insights into the ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences; Volume 41; Issue 4. Genetic and biochemical evidences reveal novel insights into the mechanism underlying Saccharomyces cerevisiae Sae2-mediated abrogation of DNA replication stress. INDRAJEET GHODKE K MUNIYAPPA. ARTICLE Volume 41 Issue 4 December 2016 pp ...

  15. New technologies provide insights into genetic basis of psychiatric disorders and explain their co-morbidity.

    Science.gov (United States)

    Rudan, Igor

    2010-06-01

    The completion of Human Genome Project and the "HapMap" project was followed by translational activities from companies within the private sector. This led to the introduction of genome-wide scans based on hundreds of thousands of single nucleotide polymorphysms (SNP). These scans were based on common genetic variants in human populations. This new and powerful technology was then applied to the existing DNA-based datasets with information on psychiatric disorders. As a result, an unprecedented amount of novel scientific insights related to the underlying biology and genetics of psychiatric disorders was obtained. The dominant design of these studies, so called "genome-wide association studies" (GWAS), used statistical methods which minimized the risk of false positive reports and provided much greater power to detect genotype-phenotype associations. All findings were entirely data-driven rather than hypothesis-driven, which often made it difficult for researchers to understand or interpret the findings. Interestingly, this work in genetics is indicating how non-specific some genes are for psychiatric disorders, having associations in common for schizophrenia, bipolar disorder and autism. This suggests that the earlier stages of psychiatric disorders may be multi-valent and that early detection, coupled with a clearer understanding of the environmental factors, may allow prevention. At the present time, the rich "harvest" from GWAS still has very limited power to predict the variation in psychiatric disease status at individual level, typically explaining less than 5% of the total risk variance. The most recent studies of common genetic variation implicated the role of major histocompatibility complex in schizophrenia and other disorders. They also provided molecular evidence for a substantial polygenic component to the risk of psychiatric diseases, involving thousands of common alleles of very small effect. The studies of structural genetic variation, such as copy

  16. Genetic evidence for a Paleolithic human population expansion in Africa

    Science.gov (United States)

    Reich, David E.; Goldstein, David B.

    1998-01-01

    Human populations have undergone dramatic expansions in size, but other than the growth associated with agriculture, the dates and magnitudes of those expansions have never been resolved. Here, we introduce two new statistical tests for population expansion, which use variation at a number of unlinked genetic markers to study the demographic histories of natural populations. By analyzing genetic variation in various aboriginal populations from throughout the world, we show highly significant evidence for a major human population expansion in Africa, but no evidence of expansion outside of Africa. The inferred African expansion is estimated to have occurred between 49,000 and 640,000 years ago, certainly before the Neolithic expansions, and probably before the splitting of African and non-African populations. In showing a significant difference between African and non-African populations, our analysis supports the unique role of Africa in human evolutionary history, as has been suggested by most other genetic work. In addition, the missing signal in non-African populations may be the result of a population bottleneck associated with the emergence of these populations from Africa, as postulated in the “Out of Africa” model of modern human origins. PMID:9653150

  17. Morphological and genetic evidence for early Holocene cattle management in northeastern China

    DEFF Research Database (Denmark)

    Zhang, Hucai; Paijmans, Johanna L. A.; Chang, Fengqin

    2013-01-01

    The domestication of cattle is generally accepted to have taken place in two independent centres: around 10,500 years ago in the Near East, giving rise to modern taurine cattle, and two millennia later in southern Asia, giving rise to zebu cattle. Here we provide firmly dated morphological...... and genetic evidence for early Holocene management of taurine cattle in northeastern China. We describe conjoining mandibles from this region that show evidence of oral stereotypy, dated to the early Holocene by two independent (14)C dates. Using Illumina high-throughput sequencing coupled with DNA...... hybridization capture, we characterize 15,406 bp of the mitogenome with on average 16.7-fold coverage. Phylogenetic analyses reveal a hitherto unknown mitochondrial haplogroup that falls outside the known taurine diversity. Our data suggest that the first attempts to manage cattle in northern China predate...

  18. A systems genetics approach provides a bridge from discovered genetic variants to biological pathways in rheumatoid arthritis.

    Directory of Open Access Journals (Sweden)

    Hirofumi Nakaoka

    Full Text Available Genome-wide association studies (GWAS have yielded novel genetic loci underlying common diseases. We propose a systems genetics approach to utilize these discoveries for better understanding of the genetic architecture of rheumatoid arthritis (RA. Current evidence of genetic associations with RA was sought through PubMed and the NHGRI GWAS catalog. The associations of 15 single nucleotide polymorphisms and HLA-DRB1 alleles were confirmed in 1,287 cases and 1,500 controls of Japanese subjects. Among these, HLA-DRB1 alleles and eight SNPs showed significant associations and all but one of the variants had the same direction of effect as identified in the previous studies, indicating that the genetic risk factors underlying RA are shared across populations. By receiver operating characteristic curve analysis, the area under the curve (AUC for the genetic risk score based on the selected variants was 68.4%. For seropositive RA patients only, the AUC improved to 70.9%, indicating good but suboptimal predictive ability. A simulation study shows that more than 200 additional loci with similar effect size as recent GWAS findings or 20 rare variants with intermediate effects are needed to achieve AUC = 80.0%. We performed the random walk with restart (RWR algorithm to prioritize genes for future mapping studies. The performance of the algorithm was confirmed by leave-one-out cross-validation. The RWR algorithm pointed to ZAP70 in the first rank, in which mutation causes RA-like autoimmune arthritis in mice. By applying the hierarchical clustering method to a subnetwork comprising RA-associated genes and top-ranked genes by the RWR, we found three functional modules relevant to RA etiology: "leukocyte activation and differentiation", "pattern-recognition receptor signaling pathway", and "chemokines and their receptors".These results suggest that the systems genetics approach is useful to find directions of future mapping strategies to illuminate

  19. Impact of Behavioral Genetic Evidence on the Adjudication of Criminal Behavior

    OpenAIRE

    Appelbaum, Paul S.; Scurich, Nicholas

    2014-01-01

    Recent advances in behavioral genetics suggest a modest relationship among certain gene variants, early childhood experiences, and criminal behavior. Although scientific research examining this link is still at an early stage, genetic data are already being introduced in criminal trials. However, the extent to which such evidence is likely to affect jurors’ decisions has not previously been explored. In the present study, a representative sample of the U.S. population (n=250) received a vigne...

  20. Indirect evidence for genetic differentiation in vulnerability to embolism in Pinus halepensis

    Directory of Open Access Journals (Sweden)

    Rakefet eDavid-Schwartz

    2016-06-01

    Full Text Available Climate change is increasing mean temperatures and in the eastern Mediterranean is expected to decrease annual precipitation. The resulting increase in aridity may be too rapid for adaptation of tree species unless their gene pool already possesses variation in drought resistance. Vulnerability to embolism, estimated by the pressure inducing 50% loss of xylem hydraulic conductivity (P50, is strongly associated with drought stress resistance in trees. Yet, previous studies on various tree species reported low intraspecific genetic variation for this trait, and therefore limited adaptive capacities to increasing aridity. Here we quantified differences in hydraulic efficiency (xylem hydraulic conductance and safety (resistance to embolism in four contrasting provenances of Pinus halepensis (Aleppo pine in a provenance trial, which is indirect evidence for genetic differences. Results obtained with three techniques (bench dehydration, centrifugation and X-ray micro-CT evidenced significant differentiation with similar ranking between provenances. Inter-provenance variation in P50 correlated with pit anatomical properties (torus overlap and pit aperture size. These results suggest that adaptation of P. halepensis to xeric habitats has been accompanied by modifications of bordered pit function driven by variation in pit aperture. This study thus provides evidence that appropriate exploitation of provenance differences will allow continued forestry with P. halepensis in future climates of the Eastern Mediterranean.

  1. Evidence for nonallelic genetic heterogeneity in autosomal recessive retinitis pigmentosa

    NARCIS (Netherlands)

    Bleeker-Wagemakers, L. M.; Gal, A.; Kumar-Singh, R.; van den Born, L. I.; Li, Y.; Schwinger, E.; Sandkuijl, L. A.; Bergen, A. A.; Kenna, P.; Humphries, P.

    1992-01-01

    Recent evidence suggesting the involvement of mutant rhodopsin proteins in the pathogenesis of autosomal recessive retinitis pigmentosa has prompted us to investigate whether this form of the disease shows non-allelic genetic heterogeneity, as has previously been shown to be the case in autosomal

  2. Evidence for weak genetic recombination at the PTP2 locus of Nosema ceranae.

    Science.gov (United States)

    Gómez-Moracho, Tamara; Bartolomé, Carolina; Martín-Hernández, Raquel; Higes, Mariano; Maside, Xulio

    2015-04-01

    The microsporidian Nosema ceranae is an emergent pathogen that threatens the health of honeybees and other pollinators all over the world. Its recent rapid spread across a wide variety of host species and environments demonstrated an enhanced ability of adaptation, which seems to contradict the lack of evidence for genetic recombination and the absence of a sexual stage in its life cycle. Here we retrieved fresh data of the patterns of genetic variation at the PTP2 locus in naturally infected Apis mellifera colonies, by means of single genome amplification. This technique, designed to prevent the formation of chimeric haplotypes during polymerase chain reaction (PCR), provides more reliable estimates of the diversity levels and haplotype structure than standard PCR-cloning methods. Our results are consistent with low but significant rates of recombination in the history of the haplotypes detected: estimates of the population recombination rate are of the order of 30 and support recent evidence for unexpectedly high levels of variation of the parasites within honeybee colonies. These observations suggest the existence of a diploid stage at some point in the life cycle of this parasite and are relevant for our understanding of the dynamics of its expanding population. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  3. Population genetic structure in a Robertsonian race of house mice: evidence from microsatellite polymorphism

    NARCIS (Netherlands)

    Dallas, J.F.; Bonhomme, F.; Boursot, P.; Britton-Davidian, J.; Bauchau, V.

    1998-01-01

    Genetic evidence was assessed for inbreeding and population subdivision in a Robertsonian fusion (Rb) race of the western European form of house mouse, Mus musculus domesticus, in central Belgium. Inbreeding, and the factors responsible for subdivision (genetic drift and extinction-recolonization)

  4. Evidence of two genetic clusters of manatees with low genetic diversity in Mexico and implications for their conservation

    Science.gov (United States)

    Nourisson, C.; Morales-Vela, B.; Padilla-Saldivar, J.; Tucker, K.P.; Clark, A.; Olivera-Gomez, L. D.; Bonde, R.; McGuire, P.

    2011-01-01

    The Antillean manatee (Trichechus manatus manatus) occupies the tropical coastal waters of the Greater Antilles and Caribbean, extending from Mexico along Central and South America to Brazil. Historically, manatees were abundant in Mexico, but hunting during the pre-Columbian period, the Spanish colonization and throughout the history of Mexico, has resulted in the significantly reduced population occupying Mexico today. The genetic structure, using microsatellites, shows the presence of two populations in Mexico: the Gulf of Mexico (GMx) and Chetumal Bay (ChB) on the Caribbean coast, with a zone of admixture in between. Both populations show low genetic diversity (GMx: NA=2.69; HE=0.41 and ChB: NA=3.0; HE=0.46). The lower genetic diversity found in the GMx, the largest manatee population in Mexico, is probably due to a combination of a founder effect, as this is the northern range of the sub-species of T. m. manatus, and a bottleneck event. The greater genetic diversity observed along the Caribbean coast, which also has the smallest estimated number of individuals, is possibly due to manatees that come from the GMx and Belize. There is evidence to support limited or unidirectional gene flow between these two important areas. The analyses presented here also suggest minimal evidence of a handful of individual migrants possibly between Florida and Mexico. To address management issues we suggest considering two distinct genetic populations in Mexico, one along the Caribbean coast and one in the riverine systems connected to the GMx. ?? 2011 Springer Science+Business Media B.V.

  5. Evidence of two genetic clusters of manatees with low genetic diversity in Mexico and implications for their conservation.

    Science.gov (United States)

    Nourisson, Coralie; Morales-Vela, Benjamín; Padilla-Saldívar, Janneth; Tucker, Kimberly Pause; Clark, Annmarie; Olivera-Gómez, Leon David; Bonde, Robert; McGuire, Peter

    2011-07-01

    The Antillean manatee (Trichechus manatus manatus) occupies the tropical coastal waters of the Greater Antilles and Caribbean, extending from Mexico along Central and South America to Brazil. Historically, manatees were abundant in Mexico, but hunting during the pre-Columbian period, the Spanish colonization and throughout the history of Mexico, has resulted in the significantly reduced population occupying Mexico today. The genetic structure, using microsatellites, shows the presence of two populations in Mexico: the Gulf of Mexico (GMx) and Chetumal Bay (ChB) on the Caribbean coast, with a zone of admixture in between. Both populations show low genetic diversity (GMx: N(A) = 2.69; H(E) = 0.41 and ChB: N(A) = 3.0; H(E) = 0.46). The lower genetic diversity found in the GMx, the largest manatee population in Mexico, is probably due to a combination of a founder effect, as this is the northern range of the sub-species of T. m. manatus, and a bottleneck event. The greater genetic diversity observed along the Caribbean coast, which also has the smallest estimated number of individuals, is possibly due to manatees that come from the GMx and Belize. There is evidence to support limited or unidirectional gene flow between these two important areas. The analyses presented here also suggest minimal evidence of a handful of individual migrants possibly between Florida and Mexico. To address management issues we suggest considering two distinct genetic populations in Mexico, one along the Caribbean coast and one in the riverine systems connected to the GMx.

  6. Evidence of two genetic clusters of manatees with low genetic diversity in Mexico and implications for their conservation

    Science.gov (United States)

    Nourisson, Coralie; Morales-Vela, Benjamin; Padilla-Saldivar, Janneth; Tucker, Kimberly Pause; Clark, Ann Marie; Olivera-Gomez, Leon David; Bonde, Robert; McGuire, Peter

    2011-01-01

    The Antillean manatee (Trichechus manatus manatus) occupies the tropical coastal waters of the Greater Antilles and Caribbean, extending from Mexico along Central and South America to Brazil. Historically, manatees were abundant in Mexico, but hunting during the pre-Columbian period, the Spanish colonization and throughout the history of Mexico, has resulted in the significantly reduced population occupying Mexico today. The genetic structure, using microsatellites, shows the presence of two populations in Mexico: the Gulf of Mexico (GMx) and Chetumal Bay (ChB) on the Caribbean coast, with a zone of admixture in between. Both populations show low genetic diversity (GMx: NA = 2.69; HE = 0.41 and ChB: NA = 3.0; HE = 0.46). The lower genetic diversity found in the GMx, the largest manatee population in Mexico, is probably due to a combination of a founder effect, as this is the northern range of the sub-species of T. m. manatus, and a bottleneck event. The greater genetic diversity observed along the Caribbean coast, which also has the smallest estimated number of individuals, is possibly due to manatees that come from the GMx and Belize. There is evidence to support limited or unidirectional gene flow between these two important areas. The analyses presented here also suggest minimal evidence of a handful of individual migrants possibly between Florida and Mexico. To address management issues we suggest considering two distinct genetic populations in Mexico, one along the Caribbean coast and one in the riverine systems connected to the GMx.

  7. Preliminary evidence for genetic overlap between body mass index and striatal reward response.

    Science.gov (United States)

    Lancaster, T M; Ihssen, I; Brindley, L M; Linden, D E

    2018-01-10

    The reward-processing network is implicated in the aetiology of obesity. Several lines of evidence suggest obesity-linked genetic risk loci (such as DRD2 and FTO) may influence individual variation in body mass index (BMI) through neuropsychological processes reflected in alterations in activation of the striatum during reward processing. However, no study has tested the broader hypotheses that (a) the relationship between BMI and reward-related brain activation (measured through the blood oxygenation-dependent (BOLD) signal) may be observed in a large population study and (b) the overall genetic architecture of these phenotypes overlap, an assumption critical for the progression of imaging genetic studies in obesity research. Using data from the Human Connectome Project (N = 1055 healthy, young individuals: average BMI = 26.4), we first establish a phenotypic relationship between BMI and ventral striatal (VS) BOLD during the processing of rewarding (monetary) stimuli (β = 0.44, P = 0.013), accounting for potential confounds. BMI and VS BOLD were both significantly influenced by additive genetic factors (H2r = 0.57; 0.12, respectively). Further decomposition of this variance suggested that the relationship was driven by shared genetic (ρ g  = 0.47, P = 0.011), but not environmental (ρ E  = -0.07, P = 0.29) factors. To validate the assumption of genetic pleiotropy between BMI and VS BOLD, we further show that polygenic risk for higher BMI is also associated with increased VS BOLD response to appetitive stimuli (calorically high food images), in an independent sample (N = 81; P FWE-ROI  < 0.005). Together, these observations suggest that the genetic factors link risk to obesity to alterations within key nodes of the brain's reward circuity. These observations provide a basis for future work exploring the mechanistic role of genetic loci that confer risk for obesity using the imaging genetics approach.

  8. Evidence from mammalian studies on genetic effects of low level irradiation

    International Nuclear Information System (INIS)

    Searle, A.G.

    1989-01-01

    The major components of genetic damage and associated human risks are discussed, together with the experimental evidence on induction rates of chromosome anomalies in mice, and monkeys male and female germ cells, using low and high LET low level irradiation. (UK)

  9. Technology assessment and resource allocation for predictive genetic testing: A study of the perspectives of Canadian genetic health care providers

    Directory of Open Access Journals (Sweden)

    Einsiedel Edna

    2009-06-01

    Full Text Available Abstract Background With a growing number of genetic tests becoming available to the health and consumer markets, genetic health care providers in Canada are faced with the challenge of developing robust decision rules or guidelines to allocate a finite number of public resources. The objective of this study was to gain Canadian genetic health providers' perspectives on factors and criteria that influence and shape resource allocation decisions for publically funded predictive genetic testing in Canada. Methods The authors conducted semi-structured interviews with 16 senior lab directors and clinicians at publically funded Canadian predictive genetic testing facilities. Participants were drawn from British Columbia, Alberta, Manitoba, Ontario, Quebec and Nova Scotia. Given the community sampled was identified as being relatively small and challenging to access, purposive sampling coupled with snowball sampling methodologies were utilized. Results Surveyed lab directors and clinicians indicated that predictive genetic tests were funded provincially by one of two predominant funding models, but they themselves played a significant role in how these funds were allocated for specific tests and services. They also rated and identified several factors that influenced allocation decisions and patients' decisions regarding testing. Lastly, participants provided recommendations regarding changes to existing allocation models and showed support for a national evaluation process for predictive testing. Conclusion Our findings suggest that largely local and relatively ad hoc decision making processes are being made in relation to resource allocations for predictive genetic tests and that a more coordinated and, potentially, national approach to allocation decisions in this context may be appropriate.

  10. Genetic Contributions to Clinical Pain and Analgesia: Avoiding Pitfalls in Genetic Research

    Science.gov (United States)

    Kim, Hyungsuk; Clark, David; Dionne, Raymond A.

    2010-01-01

    Understanding the genetic basis of human variations in pain is critical to elucidating the molecular basis of pain sensitivity, variable responses to analgesic drugs, and, ultimately, to individualized treatment of pain and improved public health. With the help of recently accumulated knowledge and advanced technologies, pain researchers hope to gain insight into genetic mechanisms of pain and eventually apply this knowledge to pain treatment. Perspective We critically reviewed the published literature to examine the strength of evidence supporting genetic influences on clinical and human experimental pain. Based on this evidence and the experience of false associations that have occurred in other related disciplines, we provide recommendations for avoiding pitfalls in pain genetic research. PMID:19559388

  11. Genetic evidence of population structuring in the neotropical freshwater fish Brycon hilarii (Valenciennes, 1850

    Directory of Open Access Journals (Sweden)

    A Sanches

    Full Text Available Brycon hilarii is a migratory fish widely distributed throughout the Paraguay River Basin. It is appreciated in sport fishing and for its superior meat quality. It is also the main species for tourist attraction in the Bonito region (State of Mato Grosso do Sul, Brazil. Considering the lack of information on the genetic structure of the fish of this species, the aim of the present study was to detect the genetic variability of Brycon hilarii through RAPD markers. A total of eighty specimens collected in different seasons at four sites of the Miranda River sub-basin (Paraguay River Basin, Brazil were used for analysis. The results of genetic similarity, Shannon diversity, and AMOVA revealed differences between the sampling sites. Through AMOVA, differences between populations were more evident among the animals collected during the non-reproductive season, corresponding to a time of less movement of these fish. A population structuring model in which B. hilarii appears organized into genetically differentiated reproductive units that coexist and co-migrate through the studied system was suggested, contrasting the currently accepted idea that freshwater migratory fish form large panmictic populations in a determined hydrographic system. Despite the lack of a complete picture regarding the distribution of B. hilarii in the studied region, this initial idea on its population genetic structure could be an important contribution to providing aid for management and conservation programs of these fish.

  12. The role and impact of personal faith and religion among genetic service providers.

    Science.gov (United States)

    Geller, Gail; Micco, Ellyn; Silver, Rachel J; Kolodner, Ken; Bernhardt, Barbara A

    2009-02-15

    This paper describes the impact of genetic service providers' personal faith and religious values on their experiences interacting with colleagues and patients. We surveyed 480 clinical geneticists (MDs), genetic counselors (GCs), and genetic nurses randomly selected from their professional associations, and then interviewed a sample of survey respondents. Outcomes included religiosity, coping with distress through spiritual beliefs, and personal value conflicts (PVCs). Two hundred fourteen providers completed the survey out of an estimated 348 eligible (61% response rate). Importance attributed to regular attendance at religious services ranged from 39% (not at all important) to 27% (very important). Reliance on religion and spiritual beliefs as a source of comfort ranged from 48% (never) to 33% (sometimes or often). Religiosity varied by discipline with 58% of nurses thinking regular attendance at religious services was moderately or very important as compared to 47% of GCs and 30% of MDs (P = 0.006). Ten percent of respondents had difficulty reconciling their own faith with being a genetics professional, 14% felt the need to hide their own faith from their colleagues or patients, 7% thought their professional stance was not consistent with their personal values, and 4% felt ostracized by the genetics community because of their personal beliefs. The experience of such PVCs was positively correlated with religiosity (r = 0.35; P religion among genetics professionals. (c) 2009 Wiley-Liss, Inc.

  13. Seasonality shows evidence for polygenic architecture and genetic correlation with schizophrenia and bipolar disorder – a meta-analysis of genetic studies

    Science.gov (United States)

    Byrne, Enda M; Raheja, Uttam; Stephens, Sarah H.; Heath, Andrew C; Madden, Pamela AF; Vaswani, Dipika; Nijjar, Gagan V.; Ryan, Kathleen A.; Youssufi, Hassaan; Gehrman, Philip R; Shuldiner, Alan R; Martin, Nicholas G; Montgomery, Grant W; Wray, Naomi R; Nelson, Elliot C; Mitchell, Braxton D; Postolache, Teodor T

    2015-01-01

    Objective To test common genetic variants for association with seasonality (seasonal changes in mood and behavior) and to investigate whether there are shared genetic risk factors between psychiatric disorders and seasonality. Methods A meta-analysis of genome-wide association studies (GWAS) conducted in Australian and Amish populations in whom the Seasonal Pattern Assessment Questionnaire (SPAQ) had been administered. The total sample size was 4,156 individuals. Genetic risk scores based on results from prior large GWAS studies of bipolar disorder (BD), major depressive disorder (MDD), and schizophrenia (SCZ) were calculated to test for overlap in risk between psychiatric disorders and seasonality. Results The most significant association was with rs11825064 (p = 1.7 × 10−6, β = 0.64, S.E = 0.13), an intergenic SNP found on chromosome 11. The evidence for overlap in risk factors was strongest for SCZ and seasonality, with the SCZ genetic profile scores explaining 3% of the variance in log-transformed GSS. BD genetic profile scores were also significantly associated with seasonality, although at much weaker levels, and no evidence for overlap in risk was detected between MDD and seasonality. Conclusions Common SNPs of very large effect likely do not exist for seasonality in the populations examined. As expected, there was overlapping genetic risk factors for BD (but not MDD) with seasonality. Unexpectedly, the risk for SCZ and seasonality had the largest overlap, an unprecedented finding that requires replication in other populations, and has potential clinical implications considering overlapping cognitive deficits in seasonal affective disorders and SCZ PMID:25562672

  14. Genetic evidence for hybrid trait speciation in heliconius butterflies.

    Directory of Open Access Journals (Sweden)

    Camilo Salazar

    2010-04-01

    Full Text Available Homoploid hybrid speciation is the formation of a new hybrid species without change in chromosome number. So far, there has been a lack of direct molecular evidence for hybridization generating novel traits directly involved in animal speciation. Heliconius butterflies exhibit bright aposematic color patterns that also act as cues in assortative mating. Heliconius heurippa has been proposed as a hybrid species, and its color pattern can be recreated by introgression of the H. m. melpomene red band into the genetic background of the yellow banded H. cydno cordula. This hybrid color pattern is also involved in mate choice and leads to reproductive isolation between H. heurippa and its close relatives. Here, we provide molecular evidence for adaptive introgression by sequencing genes across the Heliconius red band locus and comparing them to unlinked wing patterning genes in H. melpomene, H. cydno, and H. heurippa. 670 SNPs distributed among 29 unlinked coding genes (25,847bp showed H. heurippa was related to H. c. cordula or the three species were intermixed. In contrast, among 344 SNPs distributed among 13 genes in the red band region (18,629bp, most showed H. heurippa related with H. c. cordula, but a block of around 6,5kb located in the 3' of a putative kinesin gene grouped H. heurippa with H. m. melpomene, supporting the hybrid introgression hypothesis. Genealogical reconstruction showed that this introgression occurred after divergence of the parental species, perhaps around 0.43Mya. Expression of the kinesin gene is spatially restricted to the distal region of the forewing, suggesting a mechanism for pattern regulation. This gene therefore constitutes the first molecular evidence for adaptive introgression during hybrid speciation and is the first clear candidate for a Heliconius wing patterning locus.

  15. Behavioral Genetics in Criminal and Civil Courts.

    Science.gov (United States)

    Sabatello, Maya; Appelbaum, Paul S

    Although emerging findings in psychiatric and behavioral genetics create hope for improved prevention, diagnosis, and treatment of disorders, the introduction of such data as evidence in criminal and civil proceedings raises a host of ethical, legal, and social issues. Should behavioral and psychiatric genetic data be admissible in judicial proceedings? If so, what are the various means for obtaining such evidence, and for what purposes should its admission be sought and permitted? How could-and should-such evidence affect judicial outcomes in criminal and civil proceedings? And what are the potential implications of using behavioral and psychiatric genetic evidence for individuals and communities, and for societal values of equality and justice? This article provides an overview of the historical and current developments in behavioral genetics. We then explore the extent to which behavioral genetic evidence has-and should-affect determinations of criminal responsibility and sentencing, as well as the possible ramifications of introducing such evidence in civil courts, with a focus on tort litigation and child custody disputes. We also consider two ways in which behavioral genetic evidence may come to court in the future-through genetic theft or the subpoena of a litigant's biospecimen data that was previously obtained for clinical or research purposes-and the concerns that these possibilities raise. Finally, we highlight the need for caution and for approaches to prevent the misuse of behavioral genetic evidence in courts.

  16. Nucleotide variation in the mitochondrial genome provides evidence for dual routes of postglacial recolonization and genetic recombination in the northeastern brook trout (Salvelinus fontinalis).

    Science.gov (United States)

    Pilgrim, B L; Perry, R C; Barron, J L; Marshall, H D

    2012-09-26

    Levels and patterns of mitochondrial DNA (mtDNA) variation were examined to investigate the population structure and possible routes of postglacial recolonization of the world's northernmost native populations of brook trout (Salvelinus fontinalis), which are found in Labrador, Canada. We analyzed the sequence diversity of a 1960-bp portion of the mitochondrial genome (NADH dehydrogenase 1 gene and part of cytochrome oxidase 1) of 126 fish from 32 lakes distributed throughout seven regions of northeastern Canada. These populations were found to have low levels of mtDNA diversity, a characteristic trait of populations at northern extremes, with significant structuring at the level of the watershed. Upon comparison of northeastern brook trout sequences to the publicly available brook trout whole mitochondrial genome (GenBank AF154850), we infer that the GenBank sequence is from a fish whose mtDNA has recombined with that of Arctic charr (S. alpinus). The haplotype distribution provides evidence of two different postglacial founding groups contributing to present-day brook trout populations in the northernmost part of their range; the evolution of the majority of the haplotypes coincides with the timing of glacier retreat from Labrador. Our results exemplify the strong influence that historical processes such as glaciations have had on shaping the current genetic structure of northern species such as the brook trout.

  17. Evidence suggesting a genetic contribution to kidney stone in northeastern Thai population.

    Science.gov (United States)

    Sritippayawan, Suchai; Borvornpadungkitti, Sombat; Paemanee, Atchara; Predanon, Chagkrapan; Susaengrat, Wattanachai; Chuawattana, Duangporn; Sawasdee, Nunghathai; Nakjang, Sirintra; Pongtepaditep, Suttikarn; Nettuwakul, Choochai; Rungroj, Nanyawan; Vasuvattakul, Somkiat; Malasit, Prida; Yenchitsomanus, Pa-thai

    2009-06-01

    Genetic factor may play a role in the pathogenesis of kidney stone that is found in the northeastern (NE) Thai population. Herein, we report initial evidence suggesting genetic contribution to the disease in this population. We examined 1,034 subjects including 135 patients with kidney stone, 551 family members, and 348 villagers by radiography of kidney-ureter-bladder (KUB) and other methods, and also analyzed stones removed by surgical operations. One hundred and sixteen of 551 family members (21.05%) and 23 of the 348 villagers (6.61%) were affected with kidney stone. The relative risk (lambda(R)) of the disease among family members was 3.18. Calcium stones (whewellite, dahllite, and weddellite) were observed in about 88% of stones analyzed. Our data indicate familial aggregation of kidney stone in this population supporting that genetic factor should play some role in its pathogenesis. Genetic and genomic studies will be conducted to identify the genes associated with the disease.

  18. Genetic Evidence Supports the Multiethnic Character of Teopancazco, a Neighborhood Center of Teotihuacan, Mexico (AD 200-600.

    Directory of Open Access Journals (Sweden)

    Brenda A Álvarez-Sandoval

    Full Text Available Multiethnicity in Teopancazco, Teotihuacan, is supported by foreign individuals found in the neighborhood center as well as by the diversity observed in funerary rituals at the site. Studies of both stable and strontium isotopes as well as paleodietary analysis, suggest that the population of Teopancazco was composed by three population groups: people from Teotihuacan, people from nearby sites (Tlaxcala-Hidalgo-Puebla, and people from afar, including the coastal plains. In an attempt to understand the genetic dynamics in Teopancazco we conducted an ancient DNA (aDNA analysis based on mtDNA. Our results show that the level of genetic diversity is consistent with the multiethnicity phenomenon at the neighborhood center. Levels of genetic diversity at different time periods of Teopancazco's history show that multiethnicity was evident since the beginning and lasted until the collapse of the neighborhood center. However, a PCA and a Neighbor-Joining tree suggested the presence of a genetically differentiated group (buried at the Transitional phase compared to the population from the initial phase (Tlamimilolpa as well as the population from the final phase (Xolalpan of the history of Teopancazco. Genetic studies showed no differences in genetic diversity between males and females in the adult population of Teopancazco, this data along with ample archaeological evidence, suggest a neolocal post-marital pattern of residence in Teopancazco. Nevertheless, genetic analyses on the infant population showed that the males are significantly more heterogeneous than the females suggesting a possible differential role in cultural practices by sex in the infant sector. Regarding interpopulation analysis, we found similar indices of genetic diversity between Teopancazco and heterogeneous native groups, which support the multiethnic character of Teopancazco. Finally, our data showed a close genetic relationship between Teopancazco and populations from the

  19. Evidence for shared genetic risk between ADHD symptoms and reduced mathematics ability: a twin study.

    Science.gov (United States)

    Greven, Corina U; Kovas, Yulia; Willcutt, Erik G; Petrill, Stephen A; Plomin, Robert

    2014-01-01

    Attention-deficit/hyperactivity disorder (ADHD) symptoms and mathematics ability are associated, but little is known about the genetic and environmental influences underlying this association. Data came from more than 6,000 twelve-year-old twin pairs from the UK population-representative Twins Early Development Study. Parents rated each twin's behaviour using a DSM-IV-based 18-item questionnaire of inattentive and hyperactive-impulsive ADHD symptoms. Mathematics tests based on the UK National Curriculum were completed by each twin. The twins also completed standardised tests of reading and general cognitive ability. Multivariate twin model fitting was applied. Inattentive and hyperactive-impulsive ADHD symptoms were highly heritable (67% and 73% respectively). Mathematics ability was moderately heritable (46%). Mathematics ability and inattentiveness showed a significantly greater phenotypic correlation (r(p) = -.26) and genetic correlation (r(A) = -.41) than mathematics ability and hyperactivity-impulsivity (r(p) = -.18; r(A) = -.22). The genetic correlation between inattentiveness and mathematics ability was largely independent from hyperactivity-impulsivity, and was only partially accounted for by genetic influences related to reading and general cognitive ability. Results revealed the novel finding that mathematics ability shows significantly stronger phenotypic and genetic associations with inattentiveness than with hyperactivity-impulsivity. Genetic associations between inattentiveness and mathematics ability could only partially be accounted for by hyperactivity-impulsivity, reading and general cognitive ability. Results suggest that mathematics ability is associated with ADHD symptoms largely because it shares genetic risk factors with inattentiveness, and provide further evidence for considering inattentiveness and hyperactivity-impulsivity separately. DNA markers for ADHD symptoms (especially inattentiveness) may also be candidate risk factors for

  20. Genetic evidence for natural selection in humans in the contemporary United States.

    Science.gov (United States)

    Beauchamp, Jonathan P

    2016-07-12

    Recent findings from molecular genetics now make it possible to test directly for natural selection by analyzing whether genetic variants associated with various phenotypes have been under selection. I leverage these findings to construct polygenic scores that use individuals' genotypes to predict their body mass index, educational attainment (EA), glucose concentration, height, schizophrenia, total cholesterol, and (in females) age at menarche. I then examine associations between these scores and fitness to test whether natural selection has been occurring. My study sample includes individuals of European ancestry born between 1931 and 1953 who participated in the Health and Retirement Study, a representative study of the US population. My results imply that natural selection has been slowly favoring lower EA in both females and males, and are suggestive that natural selection may have favored a higher age at menarche in females. For EA, my estimates imply a rate of selection of about -1.5 mo of education per generation (which pales in comparison with the increases in EA observed in contemporary times). Although they cannot be projected over more than one generation, my results provide additional evidence that humans are still evolving-albeit slowly, especially compared with the rapid changes that have occurred over the past few generations due to cultural and environmental factors.

  1. Evidence of genetic heterogeneity in Alberta Hutterites with Usher syndrome type I.

    Science.gov (United States)

    Zhou, Qi; Lenger, Chaeli; Smith, Richard; Kimberling, William J; Ye, Ming; Lehmann, Ordan; MacDonald, Ian

    2012-01-01

    To identify the genetic defect in a Hutterite population from northern Alberta with Usher syndrome type I. Complete ophthalmic examinations were conducted on two boys and two girls from two related Hutterite families diagnosed with Usher syndrome type I. DNA from patients and their parents was first evaluated for a mutation in exon 10 of the protocadherin-related 15 (PCDH15) gene (c.1471delG), previously reported in southern Alberta Hutterite patients with Usher syndrome (USH1F). Single nucleotide polymorphic linkage analysis was then used to confirm another locus, and DNA was analyzed with the Usher Chip v4.0 platform. Severe hearing impairment, unintelligible speech, and retinitis pigmentosa with varying degrees of visual acuity and visual field loss established a clinical diagnosis of Usher syndrome type I. The patients did not carry the exon 10 mutation in the PCDH15 gene; however, with microarray analysis, a previously reported mutation (c.52C>T; p.Q18X) in the myosin VIIA (MYO7A) gene was found in the homozygous state in the affected siblings. The finding of a MYO7A mutation in two related Hutterite families from northern Alberta provides evidence of genetic heterogeneity in Hutterites affected by Usher syndrome type I.

  2. Genomic evidence for the evolution of Streptococcus equi: host restriction, increased virulence, and genetic exchange with human pathogens.

    Directory of Open Access Journals (Sweden)

    Matthew T G Holden

    2009-03-01

    Full Text Available The continued evolution of bacterial pathogens has major implications for both human and animal disease, but the exchange of genetic material between host-restricted pathogens is rarely considered. Streptococcus equi subspecies equi (S. equi is a host-restricted pathogen of horses that has evolved from the zoonotic pathogen Streptococcus equi subspecies zooepidemicus (S. zooepidemicus. These pathogens share approximately 80% genome sequence identity with the important human pathogen Streptococcus pyogenes. We sequenced and compared the genomes of S. equi 4047 and S. zooepidemicus H70 and screened S. equi and S. zooepidemicus strains from around the world to uncover evidence of the genetic events that have shaped the evolution of the S. equi genome and led to its emergence as a host-restricted pathogen. Our analysis provides evidence of functional loss due to mutation and deletion, coupled with pathogenic specialization through the acquisition of bacteriophage encoding a phospholipase A(2 toxin, and four superantigens, and an integrative conjugative element carrying a novel iron acquisition system with similarity to the high pathogenicity island of Yersinia pestis. We also highlight that S. equi, S. zooepidemicus, and S. pyogenes share a common phage pool that enhances cross-species pathogen evolution. We conclude that the complex interplay of functional loss, pathogenic specialization, and genetic exchange between S. equi, S. zooepidemicus, and S. pyogenes continues to influence the evolution of these important streptococci.

  3. Evidence for an invasive aphid "superclone": extremely low genetic diversity in Oleander aphid (Aphis nerii populations in the southern United States.

    Directory of Open Access Journals (Sweden)

    John Scott Harrison

    2011-03-01

    Full Text Available The importance of genetic diversity in successful biological invasions is unclear. In animals, but not necessarily plants, increased genetic diversity is generally associated with successful colonization and establishment of novel habitats. The Oleander aphid, Aphis nerii, though native to the Mediterranean region, is an invasive pest species throughout much of the world. Feeding primarily on Oleander (Nerium oleander and Milkweed (Asclepias spp. under natural conditions, these plants are unlikely to support aphid populations year round in the southern US. The objective of this study was to describe the genetic variation within and among US populations of A. nerii, during extinction/recolonization events, to better understand the population ecology of this invasive species.We used five microsatellite markers to assess genetic diversity over a two year period within and among three aphid populations separated by small (100 km and large (3,700 km geographic distances on two host plant species. Here we provide evidence for A. nerii "superclones". Genotypic variation was absent in all populations (i.e., each population consisted of a single multilocus genotype (MLG or "clone" and the genetic composition of only one population completely changed across years. There was no evidence of sexual reproduction or host races on different plant species.Aphis nerii is a well established invasive species despite having extremely low genetic diversity. As this aphid appears to be obligatorily asexual, it may share more similarities with clonally reproducing invasive plants, than with other animals. Patterns of temporal and geographic genetic variation, viewed in the context of its population dynamics, have important implications for the management of invasive pests and the evolutionary biology of asexual species.

  4. Review: fetal programming of polycystic ovary syndrome by androgen excess: evidence from experimental, clinical, and genetic association studies.

    Science.gov (United States)

    Xita, Nectaria; Tsatsoulis, Agathocles

    2006-05-01

    Polycystic ovary syndrome (PCOS) is a common endocrine disorder of premenopausal women, characterized by hyperandrogenism, polycystic ovaries, and chronic anovulation along with insulin resistance and abdominal obesity as frequent metabolic traits. Although PCOS manifests clinically during adolescence, emerging data suggest that the natural history of PCOS may originate in intrauterine life. Evidence from experimental, clinical, and genetic research supporting the hypothesis for the fetal origins of PCOS has been analyzed. Female primates, exposed in utero to androgen excess, exhibit the phenotypic features of PCOS during adult life. Clinical observations also support a potential fetal origin of PCOS. Women with fetal androgen excess disorders, including congenital 21-hydroxylase deficiency and congenital adrenal virilizing tumors, develop features characteristic of PCOS during adulthood despite the normalization of androgen excess after birth. The potential mechanisms of fetal androgen excess leading to a PCOS phenotype in humans are not clearly understood. However, maternal and/or fetal hyperandrogenism can provide a plausible mechanism for fetal programing of PCOS, and this, in part, may be genetically determined. Thus, genetic association studies have indicated that common polymorphic variants of genes determining androgen activity or genes that influence the availability of androgens to target tissues are associated with PCOS and increased androgen levels. These genomic variants may provide the genetic link to prenatal androgenization in human PCOS. Prenatal androgenization of the female fetus induced by genetic and environmental factors, or the interaction of both, may program differentiating target tissues toward the development of PCOS phenotype in adult life.

  5. First evidence of intraclonal genetic exchange in trypanosomatids using two Leishmania infantum fluorescent transgenic clones.

    Directory of Open Access Journals (Sweden)

    Estefanía Calvo-Álvarez

    2014-09-01

    Full Text Available The mode of reproduction in Leishmania spp has been argued to be essentially clonal. However, recent data (genetic analysis of populations and co-infections in sand flies have proposed the existence of a non-obligate sexual cycle in the extracellular stage of the parasite within the sand fly vector. In this article we propose the existence of intraclonal genetic exchange in the natural vector of Leishmania infantum.We have developed transgenic L. infantum lines expressing drug resistance markers linked to green and red fluorescent reporters. We hypothesized whether those cells with identical genotype can recognize each other and mate. Both types of markers were successfully exchanged within the sand fly midgut of the natural vector Phlebotomus perniciosus when individuals from these species were fed with a mixture of parental clones. Using the yellow phenotype and drug resistance markers, we provide evidence for genetic exchange in L. infantum. The hybrid progeny appeared to be triploid based on DNA content analysis. The hybrid clone analyzed was stable throughout the complete parasite life cycle. The progress of infections by the hybrid clone in BALB/c mice caused a reduction in parasite loads in both spleen and liver, and provided weight values similar to those obtained with uninfected mice. Spleen arginase activity was also significantly reduced relative to parental strains.A L. infantum hybrid lineage was obtained from intraclonal genetic exchange within the midgut of the natural vector, suggesting the ability of this parasite to recognize the same genotype and mate. The yellow hybrid progeny is stable throughout the whole parasite life cycle but with a slower virulence, which correlates well with the lower arginase activity detected both in vitro and in vivo infections.

  6. Behavioral and Genetic Evidence for GIRK Channels in the CNS: Role in Physiology, Pathophysiology, and Drug Addiction.

    Science.gov (United States)

    Mayfield, Jody; Blednov, Yuri A; Harris, R Adron

    2015-01-01

    G protein-coupled inwardly rectifying potassium (GIRK) channels are widely expressed throughout the brain and mediate the inhibitory effects of many neurotransmitters. As a result, these channels are important for normal CNS function and have also been implicated in Down syndrome, Parkinson's disease, psychiatric disorders, epilepsy, and drug addiction. Knockout mouse models have provided extensive insight into the significance of GIRK channels under these conditions. This review examines the behavioral and genetic evidence from animal models and genetic association studies in humans linking GIRK channels with CNS disorders. We further explore the possibility that subunit-selective modulators and other advanced research tools will be instrumental in establishing the role of individual GIRK subunits in drug addiction and other relevant CNS diseases and in potentially advancing treatment options for these disorders. © 2015 Elsevier Inc. All rights reserved.

  7. Evidence for Within-Host Genetic Recombination among the Human Pegiviral Strains in HIV Infected Subjects.

    Science.gov (United States)

    Wu, Haoming; Padhi, Abinash; Xu, Junqiang; Gong, Xiaoyan; Tien, Po

    2016-01-01

    The non-pathogenic Human Pegivirus (HPgV, formerly GBV-C/HGV), the most prevalent RNA virus worldwide, is known to be associated with reduced morbidity and mortality in HIV-infected individuals. Although previous studies documented its ubiquity and important role in HIV-infected individuals, little is known about the underlying genetic mechanisms that maintain high genetic diversity of HPgV within the HIV-infected individuals. To assess the within-host genetic diversity of HPgV and forces that maintain such diversity within the co-infected hosts, we performed phylogenetic analyses taking into account 229 HPgV partial E1-E2 clonal sequences representing 15 male and 8 female co-infected HIV patients from Hubei province of central China. Our results revealed the presence of eleven strongly supported clades. While nine clades belonged to genotype 3, two clades belonged to genotype 2. Additionally, four clades that belonged to genotype 3 exhibited inter-clade recombination events. The presence of clonal sequences representing multiple clades within the HIV-infected individual provided the evidence of co-circulation of HPgV strains across the region. Of the 23 patients, six patients (i.e., five males and one female) were detected to have HPgV recombinant sequences. Our results also revealed that while male patients shared the viral strains with other patients, viral strains from the female patients had restricted dispersal. Taken together, the present study revealed that multiple infections with divergent HPgV viral strains may have caused within-host genetic recombination, predominantly in male patients, and therefore, could be the major driver in shaping genetic diversity of HPgV.

  8. Evidence for Absolute Moral Opposition to Genetically Modified Food in the United States.

    Science.gov (United States)

    Scott, Sydney E; Inbar, Yoel; Rozin, Paul

    2016-05-01

    Public opposition to genetic modification (GM) technology in the food domain is widespread (Frewer et al., 2013). In a survey of U.S. residents representative of the population on gender, age, and income, 64% opposed GM, and 71% of GM opponents (45% of the entire sample) were "absolutely" opposed-that is, they agreed that GM should be prohibited no matter the risks and benefits. "Absolutist" opponents were more disgust sensitive in general and more disgusted by the consumption of genetically modified food than were non-absolutist opponents or supporters. Furthermore, disgust predicted support for legal restrictions on genetically modified foods, even after controlling for explicit risk-benefit assessments. This research suggests that many opponents are evidence insensitive and will not be influenced by arguments about risks and benefits. © The Author(s) 2016.

  9. Interpreting genetics in the context of eating disorders: evidence of disease, not diversity.

    Science.gov (United States)

    Easter, Michele

    2014-07-01

    How is genetic involvement interpreted for disorders whose medicalisation is contested? Framing psychiatric and behavioural disorders in terms of genetics is expected to make them seem more medical. Yet a genetic aetiology can also be used to frame behaviour as acceptable human variation, rather than a medical problem (for example, sexual orientation). I analyse responses to the idea that there is a genetic component in anorexia and bulimia nervosa (AN or BN) via semi-structured interviews with a sample of 50 women diagnosed with an eating disorder (25 had recovered). All but three volunteered that genetics would medicalise AN or BN by (i) making eating disorders seem more like 'real diseases'; implying that these disorders need (ii) professional treatment or (iii) a biologically based treatment. The results also indicate there are several counter-logics by which genetic framing could support non-medical definitions of AN or BN. I argue that genetic framing reduces perceived individual responsibility, which can support definitions of behaviour as either a reflection of disease (which entails intervention) or a reflection of normal human diversity (which does not). In the context of public scepticism as to the 'reality' of AN or BN, genetic involvement was taken as evidence of disease in ongoing negotiations about the medical and moral status of people with eating disorders. © 2013 The Author. Sociology of Health & Illness © 2013 Foundation for the Sociology of Health & Illness/John Wiley & Sons Ltd.

  10. Nature, nurture, and capital punishment: How evidence of a genetic-environment interaction, future dangerousness, and deliberation affect sentencing decisions.

    Science.gov (United States)

    Gordon, Natalie; Greene, Edie

    2018-01-01

    Research has shown that the low-activity MAOA genotype in conjunction with a history of childhood maltreatment increases the likelihood of violent behaviors. This genetic-environment (G × E) interaction has been introduced as mitigation during the sentencing phase of capital trials, yet there is scant data on its effectiveness. This study addressed that issue. In a factorial design that varied mitigating evidence offered by the defense [environmental (i.e., childhood maltreatment), genetic, G × E, or none] and the likelihood of the defendant's future dangerousness (low or high), 600 mock jurors read sentencing phase evidence in a capital murder trial, rendered individual verdicts, and half deliberated as members of a jury to decide a sentence of death or life imprisonment. The G × E evidence had little mitigating effect on sentencing preferences: participants who received the G × E evidence were no less likely to sentence the defendant to death than those who received evidence of childhood maltreatment or a control group that received neither genetic nor maltreatment evidence. Participants with evidence of a G × E interaction were more likely to sentence the defendant to death when there was a high risk of future dangerousness than when there was a low risk. Sentencing preferences were more lenient after deliberation than before. We discuss limitations and future directions. Copyright © 2017 John Wiley & Sons, Ltd.

  11. Population genetics of non-genetic traits: Evolutionary roles of stochasticity in gene expression

    KAUST Repository

    Mineta, Katsuhiko

    2015-05-01

    The role of stochasticity in evolutionary genetics has long been debated. To date, however, the potential roles of non-genetic traits in evolutionary processes have been largely neglected. In molecular biology, growing evidence suggests that stochasticity in gene expression (SGE) is common and that SGE has major impacts on phenotypes and fitness. Here, we provide a general overview of the potential effects of SGE on population genetic parameters, arguing that SGE can indeed have a profound effect on evolutionary processes. Our analyses suggest that SGE potentially alters the fate of mutations by influencing effective population size and fixation probability. In addition, a genetic control of SGE magnitude could evolve under certain conditions, if the fitness of the less-fit individual increases due to SGE and environmental fluctuation. Although empirical evidence for our arguments is yet to come, methodological developments for precisely measuring SGE in living organisms will further advance our understanding of SGE-driven evolution.

  12. Population genetics of non-genetic traits: Evolutionary roles of stochasticity in gene expression

    KAUST Repository

    Mineta, Katsuhiko; Matsumoto, Tomotaka; Osada, Naoki; Araki, Hitoshi

    2015-01-01

    The role of stochasticity in evolutionary genetics has long been debated. To date, however, the potential roles of non-genetic traits in evolutionary processes have been largely neglected. In molecular biology, growing evidence suggests that stochasticity in gene expression (SGE) is common and that SGE has major impacts on phenotypes and fitness. Here, we provide a general overview of the potential effects of SGE on population genetic parameters, arguing that SGE can indeed have a profound effect on evolutionary processes. Our analyses suggest that SGE potentially alters the fate of mutations by influencing effective population size and fixation probability. In addition, a genetic control of SGE magnitude could evolve under certain conditions, if the fitness of the less-fit individual increases due to SGE and environmental fluctuation. Although empirical evidence for our arguments is yet to come, methodological developments for precisely measuring SGE in living organisms will further advance our understanding of SGE-driven evolution.

  13. Providers' Attitudes Toward Evidence-Based Practices: Is it Just About Providers, or do Practices Matter, Too?

    Science.gov (United States)

    Reding, Michael E. J.; Chorpita, Bruce F.; Lau, Anna S.; Innes-Gomberg, Debbie

    2014-01-01

    Evidence-based practice (EBP) attitudes were measured in a sample of Los Angeles County mental health service providers. Three types of data were collected: provider demographic characteristics, attitudes toward EBP in general, and attitudes toward specific EBPs being implemented in the county. Providers could reliably rate characteristics of specific EBPs, and these ratings differed across interventions. Preliminary implementation data indicate that appealing features of an EBP relate to the degree to which providers use it. These findings suggest that assessing EBP-specific attitudes is feasible and may offer implementation-relevant information beyond that gained solely from providers' general attitudes toward EBP. PMID:24166077

  14. Genetic evidence for intra- and interspecific slavery in honey ants (genus Myrmecocystus).

    Science.gov (United States)

    Kronauer, D J C; Gadau, J; Hölldobler, B

    2003-04-22

    The New World honey ant species Myrmecocystus mimicus is well known for its highly stereotyped territorial tournaments, and for the raids on conspecific nests that can lead to intraspecific slavery. Our results from mitochondrial and nuclear markers show that the raided brood emerges in the raiding colony and is subsequently incorporated into the colony's worker force. We also found enslaved conspecifics in a second honey ant species, M. depilis, the sister taxon of M. mimicus, which occurs in sympatry with M. mimicus at the study site. Colonies of this species furthermore contained raided M. mimicus workers. Both species have an effective mating frequency that is not significantly different from 1. This study provides genetic evidence for facultative intra- and interspecific slavery in the genus Myrmecocystus. Slavery in ants has evolved repeatedly and supposedly by different means. We propose that, in honey ants, secondary contact between two closely related species that both exhibit intraspecific slavery gave rise to an early form of facultative interspecific slavery.

  15. Evidence for an Invasive Aphid “Superclone”: Extremely Low Genetic Diversity in Oleander Aphid (Aphis nerii) Populations in the Southern United States

    Science.gov (United States)

    Harrison, John Scott; Mondor, Edward B.

    2011-01-01

    Background The importance of genetic diversity in successful biological invasions is unclear. In animals, but not necessarily plants, increased genetic diversity is generally associated with successful colonization and establishment of novel habitats. The Oleander aphid, Aphis nerii, though native to the Mediterranean region, is an invasive pest species throughout much of the world. Feeding primarily on Oleander (Nerium oleander) and Milkweed (Asclepias spp.) under natural conditions, these plants are unlikely to support aphid populations year round in the southern US. The objective of this study was to describe the genetic variation within and among US populations of A. nerii, during extinction/recolonization events, to better understand the population ecology of this invasive species. Methodology/Principal Findings We used five microsatellite markers to assess genetic diversity over a two year period within and among three aphid populations separated by small (100 km) and large (3,700 km) geographic distances on two host plant species. Here we provide evidence for A. nerii “superclones”. Genotypic variation was absent in all populations (i.e., each population consisted of a single multilocus genotype (MLG) or “clone”) and the genetic composition of only one population completely changed across years. There was no evidence of sexual reproduction or host races on different plant species. Conclusions/Significance Aphis nerii is a well established invasive species despite having extremely low genetic diversity. As this aphid appears to be obligatorily asexual, it may share more similarities with clonally reproducing invasive plants, than with other animals. Patterns of temporal and geographic genetic variation, viewed in the context of its population dynamics, have important implications for the management of invasive pests and the evolutionary biology of asexual species. PMID:21408073

  16. No evidence for a genetic blueprint: The case of the "complex" mammalian photoreceptor

    Directory of Open Access Journals (Sweden)

    G Kumaramanickavel

    2015-01-01

    Full Text Available Despite the intensity of the search for genes causing inherited retinal degenerations over the past 3 decades, of the approximately 200 disease genes identified to date, all appear to be ordinary housekeeping genes specifying proteins playing basic structural and functional roles in the mature photoreceptor cells. No genes or genetic elements have been identified which can be construed as having a specific morphogenic role, directing the development of the cytoarchitecture of any particular retinal cell. The evidence suggests that the cytoarchitecture of the retinal photoreceptors, although enormously complex, arises from the self-organization of the cells constituents without any regulation or direction from an external genetic blueprint.

  17. Genetic structure of populations of whale sharks among ocean basins and evidence for their historic rise and recent decline

    KAUST Repository

    Vignaud, Thomas M.; Maynard, Jeffrey Allen; Leblois, Raphaë l; Meekan, Mark G.; Vá zquez-Juá rez, Ricardo; Ramí rez-Mací as, Dení ; Pierce, Simon J.; Rowat, David; Berumen, Michael L.; Beeravolu, Champak R.; Baksay, Sandra; Planes, Serge

    2014-01-01

    This study presents genetic evidence that whale sharks, Rhincodon typus, are comprised of at least two populations that rarely mix and is the first to document a population expansion. Relatively high genetic structure is found when comparing sharks

  18. Genetic variability, local selection and demographic history: genomic evidence of evolving towards allopatric speciation in Asian seabass.

    Science.gov (United States)

    Wang, Le; Wan, Zi Yi; Lim, Huan Sein; Yue, Gen Hua

    2016-08-01

    Genomewide analysis of genetic divergence is critically important in understanding the genetic processes of allopatric speciation. We sequenced RAD tags of 131 Asian seabass individuals of six populations from South-East Asia and Australia/Papua New Guinea. Using 32 433 SNPs, we examined the genetic diversity and patterns of population differentiation across all the populations. We found significant evidence of genetic heterogeneity between South-East Asian and Australian/Papua New Guinean populations. The Australian/Papua New Guinean populations showed a rather lower level of genetic diversity. FST and principal components analysis revealed striking divergence between South-East Asian and Australian/Papua New Guinean populations. Interestingly, no evidence of contemporary gene flow was observed. The demographic history was further tested based on the folded joint site frequency spectrum. The scenario of ancient migration with historical population size changes was suggested to be the best fit model to explain the genetic divergence of Asian seabass between South-East Asia and Australia/Papua New Guinea. This scenario also revealed that Australian/Papua New Guinean populations were founded by ancestors from South-East Asia during mid-Pleistocene and were completely isolated from the ancestral population after the last glacial retreat. We also detected footprints of local selection, which might be related to differential ecological adaptation. The ancient gene flow was examined and deemed likely insufficient to counteract the genetic differentiation caused by genetic drift. The observed genomic pattern of divergence conflicted with the 'genomic islands' scenario. Altogether, Asian seabass have likely been evolving towards allopatric speciation since the split from the ancestral population during mid-Pleistocene. © 2016 John Wiley & Sons Ltd.

  19. Three Molecular Markers Show No Evidence of Population Genetic Structure in the Gouldian Finch (Erythrura gouldiae.

    Directory of Open Access Journals (Sweden)

    Peri E Bolton

    Full Text Available Assessment of genetic diversity and connectivity between regions can inform conservation managers about risk of inbreeding, potential for adaptation and where population boundaries lie. The Gouldian finch (Erythrura gouldiae is a threatened species in northern Australia, occupying the savannah woodlands of the biogeographically complex monsoon tropics. We present the most comprehensive population genetic analysis of diversity and structure the Gouldian finch using 16 microsatellite markers, mitochondrial control region and 3,389 SNPs from genotyping-by-sequencing. Mitochondrial diversity is compared across three related, co-distributed finches with different conservation threat-statuses. There was no evidence of genetic differentiation across the western part of the range in any of the molecular markers, and haplotype diversity but not richness was lower than a common co-distributed species. Individuals within the panmictic population in the west may be highly dispersive within this wide area, and we urge caution when interpreting anecdotal observations of changes to the distribution and/or flock sizes of Gouldian finch populations as evidence of overall changes to the population size of this species.

  20. Genetic evidence linking lung cancer and COPD: a new perspective

    Directory of Open Access Journals (Sweden)

    Crapo JD

    2011-07-01

    Full Text Available Robert P Young1,4, Raewyn J Hopkins1, Gregory D Gamble1, Carol Etzel2, Randa El-Zein2, James D Crapo31Department of Medicine and School of Biological Sciences, University of Auckland, Auckland, New Zealand; 2Department of Epidemiology, UT MD Anderson Cancer Center, Houston, TX, USA; 3National Jewish Health, Denver, CO, USA; 4Synergenz Biosciences Ltd, Auckland, New ZealandAbstract: Epidemiological studies indicate that tobacco smoke exposure accounts for nearly 90% of cases of chronic obstructive pulmonary disease (COPD and lung cancer. However, genetic factors may explain why 10%–30% of smokers develop these complications. This perspective reviews the evidence suggesting that COPD is closely linked to susceptibility to lung cancer and outlines the potential relevance of this observation. Epidemiological studies show that COPD is the single most important risk factor for lung cancer among smokers and predates lung cancer in up to 80% of cases. Genome-wide association studies of lung cancer, lung function, and COPD have identified a number of overlapping “susceptibility” loci. With stringent phenotyping, it has recently been shown that several of these overlapping loci are independently associated with both COPD and lung cancer. These loci implicate genes underlying pulmonary inflammation and apoptotic processes mediated by the bronchial epithelium, and link COPD with lung cancer at a molecular genetic level. It is currently possible to derive risk models for lung cancer that incorporate lung cancer-specific genetic variants, recently identified “COPD-related” genetic variants, and clinical variables. Early studies suggest that single nucleotide polymorphism-based risk stratification of smokers might help better target novel prevention and early diagnostic strategies in lung cancer.Keywords: lung cancer, chronic obstructive pulmonary disease, association study, single nucleotide polymorphism, risk model

  1. Identification of novel genetic risk loci in Maltese dogs with necrotizing meningoencephalitis and evidence of a shared genetic risk across toy dog breeds.

    Directory of Open Access Journals (Sweden)

    Isabelle Schrauwen

    Full Text Available Necrotizing meningoencephalitis (NME affects toy and small breed dogs causing progressive, often fatal, inflammation and necrosis in the brain. Genetic risk loci for NME previously were identified in pug dogs, particularly associated with the dog leukocyte antigen (DLA class II complex on chromosome 12, but have not been investigated in other susceptible breeds. We sought to evaluate Maltese and Chihuahua dogs, in addition to pug dogs, to identify novel or shared genetic risk factors for NME development. Genome-wide association testing of single nucleotide polymorphisms (SNPs in Maltese dogs with NME identified 2 regions of genome-wide significance on chromosomes 4 (chr4:74522353T>A, p = 8.1×10-7 and 15 (chr15:53338796A>G, p = 1.5×10-7. Haplotype analysis and fine-mapping suggests that ILR7 and FBXW7, respectively, both important for regulation of immune system function, could be the underlying associated genes. Further evaluation of these regions and the previously identified DLA II locus across all three breeds, revealed an enrichment of nominal significant SNPs associated with chromosome 15 in pug dogs and DLA II in Maltese and Chihuahua dogs. Meta-analysis confirmed effect sizes the same direction in all three breeds for both the chromosome 15 and DLA II loci (p = 8.6×10-11 and p = 2.5×10-7, respectively. This suggests a shared genetic background exists between all breeds and confers susceptibility to NME, but effect sizes might be different among breeds. In conclusion, we identified the first genetic risk factors for NME development in the Maltese, chromosome 4 and chromosome 15, and provide evidence for a shared genetic risk between breeds associated with chromosome 15 and DLA II. Last, DLA II and IL7R both have been implicated in human inflammatory diseases of the central nervous system such as multiple sclerosis, suggesting that similar pharmacotherapeutic targets across species should be investigated.

  2. Identification of novel genetic risk loci in Maltese dogs with necrotizing meningoencephalitis and evidence of a shared genetic risk across toy dog breeds.

    Science.gov (United States)

    Schrauwen, Isabelle; Barber, Renee M; Schatzberg, Scott J; Siniard, Ashley L; Corneveaux, Jason J; Porter, Brian F; Vernau, Karen M; Keesler, Rebekah I; Matiasek, Kaspar; Flegel, Thomas; Miller, Andrew D; Southard, Teresa; Mariani, Christopher L; Johnson, Gayle C; Huentelman, Matthew J

    2014-01-01

    Necrotizing meningoencephalitis (NME) affects toy and small breed dogs causing progressive, often fatal, inflammation and necrosis in the brain. Genetic risk loci for NME previously were identified in pug dogs, particularly associated with the dog leukocyte antigen (DLA) class II complex on chromosome 12, but have not been investigated in other susceptible breeds. We sought to evaluate Maltese and Chihuahua dogs, in addition to pug dogs, to identify novel or shared genetic risk factors for NME development. Genome-wide association testing of single nucleotide polymorphisms (SNPs) in Maltese dogs with NME identified 2 regions of genome-wide significance on chromosomes 4 (chr4:74522353T>A, p = 8.1×10-7) and 15 (chr15:53338796A>G, p = 1.5×10-7). Haplotype analysis and fine-mapping suggests that ILR7 and FBXW7, respectively, both important for regulation of immune system function, could be the underlying associated genes. Further evaluation of these regions and the previously identified DLA II locus across all three breeds, revealed an enrichment of nominal significant SNPs associated with chromosome 15 in pug dogs and DLA II in Maltese and Chihuahua dogs. Meta-analysis confirmed effect sizes the same direction in all three breeds for both the chromosome 15 and DLA II loci (p = 8.6×10-11 and p = 2.5×10-7, respectively). This suggests a shared genetic background exists between all breeds and confers susceptibility to NME, but effect sizes might be different among breeds. In conclusion, we identified the first genetic risk factors for NME development in the Maltese, chromosome 4 and chromosome 15, and provide evidence for a shared genetic risk between breeds associated with chromosome 15 and DLA II. Last, DLA II and IL7R both have been implicated in human inflammatory diseases of the central nervous system such as multiple sclerosis, suggesting that similar pharmacotherapeutic targets across species should be investigated.

  3. Molecular evolution of avian reovirus: evidence for genetic diversity and reassortment of the S-class genome segments and multiple cocirculating lineages

    International Nuclear Information System (INIS)

    Liu, Hung J.; Lee, Long H.; Hsu, Hsiao W.; Kuo, Liam C.; Liao, Ming H.

    2003-01-01

    Nucleotide sequences of the S-class genome segments of 17 field-isolates and vaccine strains of avian reovirus (ARV) isolated over a 23-year period from different hosts, pathotypes, and geographic locations were examined and analyzed to define phylogenetic profiles and evolutionary mechanism. The S1 genome segment showed noticeably higher divergence than the other S-class genes. The σC-encoding gene has evolved into six distinct lineages. In contrast, the other S-class genes showed less divergence than that of the σC-encoding gene and have evolved into two to three major distinct lineages, respectively. Comparative sequence analysis provided evidence indicating extensive sequence divergence between ARV and other orthoreoviruses. The evolutionary trees of each gene were distinct, suggesting that these genes evolve in an independent manner. Furthermore, variable topologies were the result of frequent genetic reassortment among multiple cocirculating lineages. Results showed genetic diversity correlated more closely with date of isolation and geographic sites than with host species and pathotypes. This is the first evidence demonstrating genetic variability among circulating ARVs through a combination of evolutionary mechanisms involving multiple cocirculating lineages and genetic reassortment. The evolutionary rates and patterns of base substitutions were examined. The evolutionary rate for the σC-encoding gene and σC protein was higher than for the other S-class genes and other family of viruses. With the exception of the σC-encoding gene, which nonsynonymous substitutions predominate over synonymous, the evolutionary process of the other S-class genes can be explained by the neutral theory of molecular evolution. Results revealed that synonymous substitutions predominate over nonsynonymous in the S-class genes, even though genetic diversity and substitution rates vary among the viruses

  4. Genetic influences on political ideologies

    DEFF Research Database (Denmark)

    Hatemi, Peter K; Medland, Sarah E; Klemmensen, Robert

    2014-01-01

    Almost 40 years ago, evidence from large studies of adult twins and their relatives suggested that between 30 and 60 % of the variance in social and political attitudes could be explained by genetic influences. However, these findings have not been widely accepted or incorporated into the dominant...... paradigms that explain the etiology of political ideology. This has been attributed in part to measurement and sample limitations, as well the relative absence of molecular genetic studies. Here we present results from original analyses of a combined sample of over 12,000 twins pairs, ascertained from nine...... different studies conducted in five democracies, sampled over the course of four decades. We provide evidence that genetic factors play a role in the formation of political ideology, regardless of how ideology is measured, the era, or the population sampled. The only exception is a question that explicitly...

  5. Conceptualizing genetic counseling as psychotherapy in the era of genomic medicine.

    Science.gov (United States)

    Austin, Jehannine; Semaka, Alicia; Hadjipavlou, George

    2014-12-01

    Discussions about genetic contributions to medical illness have become increasingly commonplace. Physicians and other health-care providers in all quarters of medicine, from oncology to psychiatry, routinely field questions about the genetic basis of the medical conditions they treat. Communication about genetic testing and risk also enter into these conversations, as knowledge about genetics is increasingly expected of all medical specialists. Attendant to this evolving medical landscape is some uncertainty regarding the future of the genetic counseling profession, with the potential for both increases and decreases in demand for genetic counselors being possible outcomes. This emerging uncertainty provides the opportunity to explicitly conceptualize the potentially distinct value and contributions of the genetic counselor over and above education about genetics and risk that may be provided by other health professionals. In this paper we suggest conceptualizing genetic counseling as a highly circumscribed form of psychotherapy in which effective communication of genetic information is a central therapeutic goal. While such an approach is by no means new--in 1979 Seymour Kessler explicitly described genetic counseling as a "kind of psychotherapeutic encounter," an "interaction with a psychotherapeutic potential"--we expand on his view, and provide research evidence in support of our position. We review available evidence from process and outcome studies showing that genetic counseling is a therapeutic encounter that cannot be reduced to one where the counselor performs a simple "conduit for information" function, without losing effectiveness. We then discuss potential barriers that may have impeded greater uptake of a psychotherapeutic model of practice, and close by discussing implications for practice.

  6. Pleistocene glacial refugia across the Appalachian Mountains and coastal plain in the millipede genus Narceus: Evidence from population genetic, phylogeographic, and paleoclimatic data

    Science.gov (United States)

    Walker, Matt J; Stockman, Amy K; Marek, Paul E; Bond, Jason E

    2009-01-01

    Background Species that are widespread throughout historically glaciated and currently non-glaciated areas provide excellent opportunities to investigate the role of Pleistocene climatic change on the distribution of North American biodiversity. Many studies indicate that northern animal populations exhibit low levels of genetic diversity over geographically widespread areas whereas southern populations exhibit relatively high levels. Recently, paleoclimatic data have been combined with niche-based distribution modeling to locate possible refugia during the Last Glacial Maximum. Using phylogeographic, population, and paleoclimatic data, we show that the distribution and mitochondrial data for the millipede genus Narceus are consistent with classical examples of Pleistocene refugia and subsequent post-glacial population expansion seen in other organismal groups. Results The phylogeographic structure of Narceus reveals a complex evolutionary history with signatures of multiple refugia in southeastern North America followed by two major northern expansions. Evidence for refugial populations were found in the southern Appalachian Mountains and in the coastal plain. The northern expansions appear to have radiated from two separate refugia, one from the Gulf Coastal Plain area and the other from the mid-Atlantic coastal region. Distributional models of Narceus during the Last Glacial Maximum show a dramatic reduction from the current distribution, with suitable ecological zones concentrated along the Gulf and Atlantic coastal plain. We found a strong correlation between these zones of ecological suitability inferred from our paleo-model with levels of genetic diversity derived from phylogenetic and population estimates of genetic structuring. Conclusion The signature of climatic change, during and after the Pleistocene, on the distribution of the millipede genus Narceus is evident in the genetic data presented. Niche-based historical distribution modeling strengthens the

  7. Evidence for genetic association of RORB with bipolar disorder

    Directory of Open Access Journals (Sweden)

    Mick Eric

    2009-11-01

    Full Text Available Abstract Background Bipolar disorder, particularly in children, is characterized by rapid cycling and switching, making circadian clock genes plausible molecular underpinnings for bipolar disorder. We previously reported work establishing mice lacking the clock gene D-box binding protein (DBP as a stress-reactive genetic animal model of bipolar disorder. Microarray studies revealed that expression of two closely related clock genes, RAR-related orphan receptors alpha (RORA and beta (RORB, was altered in these mice. These retinoid-related receptors are involved in a number of pathways including neurogenesis, stress response, and modulation of circadian rhythms. Here we report association studies between bipolar disorder and single-nucleotide polymorphisms (SNPs in RORA and RORB. Methods We genotyped 355 RORA and RORB SNPs in a pediatric cohort consisting of a family-based sample of 153 trios and an independent, non-overlapping case-control sample of 152 cases and 140 controls. Bipolar disorder in children and adolescents is characterized by increased stress reactivity and frequent episodes of shorter duration; thus our cohort provides a potentially enriched sample for identifying genes involved in cycling and switching. Results We report that four intronic RORB SNPs showed positive associations with the pediatric bipolar phenotype that survived Bonferroni correction for multiple comparisons in the case-control sample. Three RORB haplotype blocks implicating an additional 11 SNPs were also associated with the disease in the case-control sample. However, these significant associations were not replicated in the sample of trios. There was no evidence for association between pediatric bipolar disorder and any RORA SNPs or haplotype blocks after multiple-test correction. In addition, we found no strong evidence for association between the age-at-onset of bipolar disorder with any RORA or RORB SNPs. Conclusion Our findings suggest that clock genes in

  8. Genetic influences on schizophrenia and subcortical brain volumes

    DEFF Research Database (Denmark)

    Franke, Barbara; Stein, Jason L; Ripke, Stephan

    2016-01-01

    and subcortical volume measures either at the level of common variant genetic architecture or for single genetic markers. These results provide a proof of concept (albeit based on a limited set of structural brain measures) and define a roadmap for future studies investigating the genetic covariance between...... genome-wide data to investigate genetic overlap. Here we integrated results from common variant studies of schizophrenia (33,636 cases, 43,008 controls) and volumes of several (mainly subcortical) brain structures (11,840 subjects). We did not find evidence of genetic overlap between schizophrenia risk...

  9. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  10. Genetic evidence for a novel competence inhibitor in the industrially important Bacillus licheniformis.

    Science.gov (United States)

    Muth, Christine; Buchholz, Meike; Schmidt, Christina; Volland, Sonja; Meinhardt, Friedhelm

    2017-12-01

    Natural genetic competence renders bacteria able to take up and, in case there is sufficient homology to the recipient's chromosome, integrate exogenously supplied DNA. Well studied in Bacillus subtilis, genetic competence is-in several aspects-known to be differently regulated in Bacillus licheniformis. We now report on the identification of a novel, chromosomally encoded homolog of a competence inhibitor in B. licheniformis (ComI) that has hitherto only been described as a plasmid borne trait in the ancestral B. subtilis NCIB3610. Bioinformatical analysis that included 80 Bacillus strains covering 20 different species revealed a ComI encoding gene in all of the examined B. licheniformis representatives, and was identified in few among the other species investigated. The predicted ComI of B. licheniformis is a highly conserved peptide consisting of 28 amino acids. Since deletion of comI in B. licheniformis DSM13 resulted in twofold increased transformation efficiency by genetic competence and overexpression resulted in threefold decreased transformability, the function as a competence inhibitor became evident.

  11. Topology of genetic associations between regional gray matter volume and intellectual ability: Evidence for a high capacity network.

    Science.gov (United States)

    Bohlken, Marc M; Brouwer, Rachel M; Mandl, René C W; Hedman, Anna M; van den Heuvel, Martijn P; van Haren, Neeltje E M; Kahn, René S; Hulshoff Pol, Hilleke E

    2016-01-01

    Intelligence is associated with a network of distributed gray matter areas including the frontal and parietal higher association cortices and primary processing areas of the temporal and occipital lobes. Efficient information transfer between gray matter regions implicated in intelligence is thought to be critical for this trait to emerge. Genetic factors implicated in intelligence and gray matter may promote a high capacity for information transfer. Whether these genetic factors act globally or on local gray matter areas separately is not known. Brain maps of phenotypic and genetic associations between gray matter volume and intelligence were made using structural equation modeling of 3T MRI T1-weighted scans acquired in 167 adult twins of the newly acquired U-TWIN cohort. Subsequently, structural connectivity analyses (DTI) were performed to test the hypothesis that gray matter regions associated with intellectual ability form a densely connected core. Gray matter regions associated with intellectual ability were situated in the right prefrontal, bilateral temporal, bilateral parietal, right occipital and subcortical regions. Regions implicated in intelligence had high structural connectivity density compared to 10,000 reference networks (p=0.031). The genetic association with intelligence was for 39% explained by a genetic source unique to these regions (independent of total brain volume), this source specifically implicated the right supramarginal gyrus. Using a twin design, we show that intelligence is genetically represented in a spatially distributed and densely connected network of gray matter regions providing a high capacity infrastructure. Although genes for intelligence have overlap with those for total brain volume, we present evidence that there are genes for intelligence that act specifically on the subset of brain areas that form an efficient brain network. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Genetic background of Prop1(df) mutants provides remarkable protection against hypothyroidism-induced hearing impairment.

    Science.gov (United States)

    Fang, Qing; Giordimaina, Alicia M; Dolan, David F; Camper, Sally A; Mustapha, Mirna

    2012-04-01

    Hypothyroidism is a cause of genetic and environmentally induced deafness. The sensitivity of cochlear development and function to thyroid hormone (TH) mandates understanding TH action in this sensory organ. Prop1(df) and Pou1f1(dw) mutant mice carry mutations in different pituitary transcription factors, each resulting in pituitary thyrotropin deficiency. Despite the same lack of detectable serum TH, these mutants have very different hearing abilities: Prop1(df) mutants are mildly affected, while Pou1f1(dw) mutants are completely deaf. Genetic studies show that this difference is attributable to the genetic backgrounds. Using embryo transfer, we discovered that factors intrinsic to the fetus are the major contributor to this difference, not maternal effects. We analyzed Prop1(df) mutants to identify processes in cochlear development that are disrupted in other hypothyroid animal models but protected in Prop1(df) mutants by the genetic background. The development of outer hair cell (OHC) function is delayed, but Prestin and KCNQ4 immunostaining appear normal in mature Prop1(df) mutants. The endocochlear potential and KCNJ10 immunostaining in the stria vascularis are indistinguishable from wild type, and no differences in neurofilament or synaptophysin staining are evident in Prop1(df) mutants. The synaptic vesicle protein otoferlin normally shifts expression from OHC to IHC as temporary afferent fibers beneath the OHC regress postnatally. Prop1(df) mutants exhibit persistent, abnormal expression of otoferlin in apical OHC, suggesting delayed maturation of synaptic function. Thus, the genetic background of Prop1(df) mutants is remarkably protective for most functions affected in other hypothyroid mice. The Prop1(df) mutant is an attractive model for identifying the genes that protect against deafness.

  13. Genome-wide trans-ancestry meta-analysis provides insight into the genetic architecture of type 2 diabetes susceptibility

    DEFF Research Database (Denmark)

    Mahajan, Anubha; Go, Min Jin; Zhang, Weihua

    2014-01-01

    To further understanding of the genetic basis of type 2 diabetes (T2D) susceptibility, we aggregated published meta-analyses of genome-wide association studies (GWAS), including 26,488 cases and 83,964 controls of European, east Asian, south Asian and Mexican and Mexican American ancestry. We obs...... and characterization of complex trait loci and emphasize an exciting opportunity to extend insight into the genetic architecture and pathogenesis of human diseases across populations of diverse ancestry....... observed a significant excess in the directional consistency of T2D risk alleles across ancestry groups, even at SNPs demonstrating only weak evidence of association. By following up the strongest signals of association from the trans-ethnic meta-analysis in an additional 21,491 cases and 55,647 controls...

  14. Genetic structure and evidence of putative Darwinian diversifying selection in the Potato yellow vein virus (PYVV

    Directory of Open Access Journals (Sweden)

    Giovanni Chaves-Bedoya

    2013-08-01

    Full Text Available The population structure and genetic variation of Potato yellow vein virus (PYVV were estimated by analysis of the nucleotide and deduced amino acid sequence of the coat protein of 69 isolates, reported in GenBank, from Solanum tuberosum (ST and Solanum phureja (SP hosts from different regions; predominantly Cundinamarca, Antioquia and Nariño, located in central and southwestern Colombia. Bioinformatics analysis revealed that despite the wide geographic distribution of different hosts and different collecting years, PYVV maintains a genetic similarity between 97.1 to 100.0%, indicating high spatial and temporal genetic stability of the major coat protein. No recombination events were found, but evidence was seen for the first time that this protein could be undergoing Darwinian diversifying selection

  15. Genetic Evidence for Causal Relationships Between Maternal Obesity-Related Traits and Birth Weight.

    Science.gov (United States)

    Tyrrell, Jessica; Richmond, Rebecca C; Palmer, Tom M; Feenstra, Bjarke; Rangarajan, Janani; Metrustry, Sarah; Cavadino, Alana; Paternoster, Lavinia; Armstrong, Loren L; De Silva, N Maneka G; Wood, Andrew R; Horikoshi, Momoko; Geller, Frank; Myhre, Ronny; Bradfield, Jonathan P; Kreiner-Møller, Eskil; Huikari, Ville; Painter, Jodie N; Hottenga, Jouke-Jan; Allard, Catherine; Berry, Diane J; Bouchard, Luigi; Das, Shikta; Evans, David M; Hakonarson, Hakon; Hayes, M Geoffrey; Heikkinen, Jani; Hofman, Albert; Knight, Bridget; Lind, Penelope A; McCarthy, Mark I; McMahon, George; Medland, Sarah E; Melbye, Mads; Morris, Andrew P; Nodzenski, Michael; Reichetzeder, Christoph; Ring, Susan M; Sebert, Sylvain; Sengpiel, Verena; Sørensen, Thorkild I A; Willemsen, Gonneke; de Geus, Eco J C; Martin, Nicholas G; Spector, Tim D; Power, Christine; Järvelin, Marjo-Riitta; Bisgaard, Hans; Grant, Struan F A; Nohr, Ellen A; Jaddoe, Vincent W; Jacobsson, Bo; Murray, Jeffrey C; Hocher, Berthold; Hattersley, Andrew T; Scholtens, Denise M; Davey Smith, George; Hivert, Marie-France; Felix, Janine F; Hyppönen, Elina; Lowe, William L; Frayling, Timothy M; Lawlor, Debbie A; Freathy, Rachel M

    2016-03-15

    Neonates born to overweight or obese women are larger and at higher risk of birth complications. Many maternal obesity-related traits are observationally associated with birth weight, but the causal nature of these associations is uncertain. To test for genetic evidence of causal associations of maternal body mass index (BMI) and related traits with birth weight. Mendelian randomization to test whether maternal BMI and obesity-related traits are potentially causally related to offspring birth weight. Data from 30,487 women in 18 studies were analyzed. Participants were of European ancestry from population- or community-based studies in Europe, North America, or Australia and were part of the Early Growth Genetics Consortium. Live, term, singleton offspring born between 1929 and 2013 were included. Genetic scores for BMI, fasting glucose level, type 2 diabetes, systolic blood pressure (SBP), triglyceride level, high-density lipoprotein cholesterol (HDL-C) level, vitamin D status, and adiponectin level. Offspring birth weight from 18 studies. Among the 30,487 newborns the mean birth weight in the various cohorts ranged from 3325 g to 3679 g. The maternal genetic score for BMI was associated with a 2-g (95% CI, 0 to 3 g) higher offspring birth weight per maternal BMI-raising allele (P = .008). The maternal genetic scores for fasting glucose and SBP were also associated with birth weight with effect sizes of 8 g (95% CI, 6 to 10 g) per glucose-raising allele (P = 7 × 10(-14)) and -4 g (95% CI, -6 to -2 g) per SBP-raising allele (P = 1×10(-5)), respectively. A 1-SD ( ≈ 4 points) genetically higher maternal BMI was associated with a 55-g higher offspring birth weight (95% CI, 17 to 93 g). A 1-SD ( ≈ 7.2 mg/dL) genetically higher maternal fasting glucose concentration was associated with 114-g higher offspring birth weight (95% CI, 80 to 147 g). However, a 1-SD ( ≈ 10 mm Hg) genetically higher maternal SBP was associated with a 208-g

  16. Genetic evidence of hybridization between Onothera wolfii (Wolf's evening primrose) and O. glaziovana, a garden escape

    Science.gov (United States)

    Jennifer DeWoody; Leonel Arguello; David Imper; Robert D. Westfall; Valerie D. Hipkins

    2008-01-01

    Isozyme analysis of the rare Oenothera wolfii (Wolf's evening primrose) and the garden escape, O. glazioviana, indicates that hybridization between these species may be more widespread than morphological evidence indicates. Although both species contained low amounts of genetic variation, unique alleles were identified in...

  17. Evolving perspectives on genetic discrimination in health insurance among health care providers.

    Science.gov (United States)

    Huizenga, Carin R; Lowstuter, Katrina; Banks, Kimberly C; Lagos, Veronica I; Vandergon, Virginia O; Weitzel, Jeffrey N

    2010-06-01

    Previous studies have documented that concerns about genetic discrimination (GD) may influence access to and participation in medically necessary care. We sought to characterize how GD issues influence current cancer genetics professional (CGP) practice, determine if their attitudes regarding GD have changed over time, and compare their knowledge and attitudes regarding laws prohibiting GD to a contemporary cohort of non-genetics clinicians. Members of the National Society of Genetic Counselors Familial Cancer Special Interest Group were invited to complete a 39 item online survey, adapted from previously published instruments. The resulting data were compared to a survey of CGPs published in 2000 and to a contemporary cohort of non-genetics clinicians (n = 1,181). There were 153 qualified respondents. Compared to the historical CGP cohort (n = 163), a significantly greater proportion said they would bill insurance for the cost of genetic testing for themselves (P genetics clinicians (P genetics clinicians. Better knowledge of GD and protective legislation, may facilitate non-genetics clinician utilization of genetics and personalized medicine.

  18. Educational needs of nurses to provide genetic services in prenatal care: A cross-sectional study from Turkey.

    Science.gov (United States)

    Seven, Memnun; Eroglu, Kafiye; Akyüz, Aygül; Ingvoldstad, Charlotta

    2017-09-01

    The latest advances in genetics/genomics have significantly impacted prenatal screening and diagnostic tests. This cross-sectional descriptive study was conducted in inpatient and outpatient obstetric clinics in 24 hospitals in Turkey to determine knowledge of genetics related to prenatal care and the educational needs of perinatal nurses. A total of 116 nurses working in these clinics agreed to participate. The results included the level of knowledge among nurses was not affected by sociodemographic factors. Also, there is a lack of knowledge and interest in genetics among prenatal nurses and in clinical practice to provide education and counseling related to genetics in prenatal settings as a part of prenatal care. © 2017 John Wiley & Sons Australia, Ltd.

  19. Genetic testing for exercise prescription and injury prevention: AIS-Athlome consortium-FIMS joint statement.

    Science.gov (United States)

    Vlahovich, Nicole; Hughes, David C; Griffiths, Lyn R; Wang, Guan; Pitsiladis, Yannis P; Pigozzi, Fabio; Bachl, Nobert; Eynon, Nir

    2017-11-14

    There has been considerable growth in basic knowledge and understanding of how genes are influencing response to exercise training and predisposition to injuries and chronic diseases. On the basis of this knowledge, clinical genetic tests may in the future allow the personalisation and optimisation of physical activity, thus providing an avenue for increased efficiency of exercise prescription for health and disease. This review provides an overview of the current status of genetic testing for the purposes of exercise prescription and injury prevention. As such there are a variety of potential uses for genetic testing, including identification of risks associated with participation in sport and understanding individual response to particular types of exercise. However, there are many challenges remaining before genetic testing has evidence-based practical applications; including adoption of international standards for genomics research, as well as resistance against the agendas driven by direct-to-consumer genetic testing companies. Here we propose a way forward to develop an evidence-based approach to support genetic testing for exercise prescription and injury prevention. Based on current knowledge, there is no current clinical application for genetic testing in the area of exercise prescription and injury prevention, however the necessary steps are outlined for the development of evidence-based clinical applications involving genetic testing.

  20. Joint SOGC-CCMG Opinion for Reproductive Genetic Carrier Screening: An Update for All Canadian Providers of Maternity and Reproductive Healthcare in the Era of Direct-to-Consumer Testing.

    Science.gov (United States)

    Wilson, R Douglas; De Bie, Isabelle; Armour, Christine M; Brown, Richard N; Campagnolo, Carla; Carroll, June C; Okun, Nan; Nelson, Tanya; Zwingerman, Rhonda; Audibert, Francois; Brock, Jo-Ann; Brown, Richard N; Campagnolo, Carla; Carroll, June C; De Bie, Isabelle; Johnson, Jo-Ann; Okun, Nan; Pastruck, Melanie; Vallée-Pouliot, Karine; Wilson, R Douglas; Zwingerman, Rhonda; Armour, Christine; Chitayat, David; De Bie, Isabelle; Fernandez, Sara; Kim, Raymond; Lavoie, Josee; Leonard, Norma; Nelson, Tanya; Taylor, Sherry; Van Allen, Margot; Van Karnebeek, Clara

    2016-08-01

    the most responsible maternity provider through the informed consent process with the patient. (III-A; GRADE low/moderate) SOGC OVERVIEW OF RECOMMENDATIONS QUALITY AND GRADE: There was a strong observational/expert opinion (quality and grade) for the genetic carrier literature with randomized controlled trial evidence being available only for the invasive testing. Both the Canadian Task Force on Preventive Health Care quality and classification and the GRADE evidence quality and grade are provided. MEDLINE; PubMed; government neonatal screening websites; key words/common reproductive genetic carrier screened diseases/previous SOGC Guidelines/medical academic societies (Society of Maternal-Fetal Medicine [SMFM]; American College of Medical Genetics and Genomics; American College of Obstetricians and Gynecologists [ACOG]; CCMG; Royal College Obstetrics and Gynaecology [RCOG] [UK]; American Society of Human Genetics [ASHG]; International Society of Prenatal Diagnosis [ISPD])/provincial neonatal screening policies and programs; search terms (carrier screening, prenatal screening, neonatal genetic/metabolic screening, cystic fibrosis (CF), thalassemia, hemoglobinopathy, hemophilia, Fragile X syndrome (FXS), spinal muscular atrophy, Ashkenazi Jewish carrier screening, genetic carrier screening protocols, AR, AD, XL). 10 years (June 2005-September 2015); initial search dates June 30, 2015 and September 15, 2015; completed final search January 4, 2016. Validation of articles was completed by primary authors RD Wilson and I De Bie. Benefits are to provide an evidenced based reproductive genetic carrier screening update consensus based on international opinions and publications for the use of Canadian women, who are planning a pregnancy or who are pregnant and have been identified to be at risk (personal or male partner family or reproductive history) for the transmission of a clinically significant genetic condition to their offspring with associated morbidity and

  1. Genetic Diversity and Demographic History of Wild and Cultivated/Naturalised Plant Populations: Evidence from Dalmatian Sage (Salvia officinalis L., Lamiaceae)

    Science.gov (United States)

    Rešetnik, Ivana; Baričevič, Dea; Batîr Rusu, Diana; Carović-Stanko, Klaudija; Chatzopoulou, Paschalina; Dajić-Stevanović, Zora; Gonceariuc, Maria; Grdiša, Martina; Greguraš, Danijela; Ibraliu, Alban; Jug-Dujaković, Marija; Krasniqi, Elez; Liber, Zlatko; Murtić, Senad; Pećanac, Dragana; Radosavljević, Ivan; Stefkov, Gjoshe; Stešević, Danijela; Šoštarić, Ivan; Šatović, Zlatko

    2016-01-01

    Dalmatian sage (Salvia officinalis L., Lamiaceae) is a well-known aromatic and medicinal Mediterranean plant that is native in coastal regions of the western Balkan and southern Apennine Peninsulas and is commonly cultivated worldwide. It is widely used in the food, pharmaceutical and cosmetic industries. Knowledge of its genetic diversity and spatiotemporal patterns is important for plant breeding programmes and conservation. We used eight microsatellite markers to investigate evolutionary history of indigenous populations as well as genetic diversity and structure within and among indigenous and cultivated/naturalised populations distributed across the Balkan Peninsula. The results showed a clear separation between the indigenous and cultivated/naturalised groups, with the cultivated material originating from one restricted geographical area. Most of the genetic diversity in both groups was attributable to differences among individuals within populations, although spatial genetic analysis of indigenous populations indicated the existence of isolation by distance. Geographical structuring of indigenous populations was found using clustering analysis, with three sub-clusters of indigenous populations. The highest level of gene diversity and the greatest number of private alleles were found in the central part of the eastern Adriatic coast, while decreases in gene diversity and number of private alleles were evident towards the northwestern Adriatic coast and southern and eastern regions of the Balkan Peninsula. The results of Ecological Niche Modelling during Last Glacial Maximum and Approximate Bayesian Computation suggested two plausible evolutionary trajectories: 1) the species survived in the glacial refugium in southern Adriatic coastal region with subsequent colonization events towards northern, eastern and southern Balkan Peninsula; 2) species survived in several refugia exhibiting concurrent divergence into three genetic groups. The insight into genetic

  2. Training medical providers in evidence-based approaches to suicide prevention.

    Science.gov (United States)

    DeHay, Tamara; Ross, Sarah; McFaul, Mimi

    2015-01-01

    Suicide is a significant issue in the United States and worldwide, and its prevention is a public health imperative. Primary care practices are an important setting for suicide prevention, as primary care providers have more frequent contact with patients at risk for suicide than any other type of health-care provider. The Western Interstate Commission for Higher Education, in partnership with the Suicide Prevention Resource Center, has developed a Suicide Prevention Toolkit and an associated training curriculum. These resources support the education of primary care providers in evidence-based strategies for identifying and treating patients at risk for suicide. The application of this curriculum to post-graduate medical training is presented here. © The Author(s) 2015.

  3. Role of genetics in infection-associated arthritis.

    Science.gov (United States)

    Benham, Helen; Robinson, Philip C; Baillet, Athan C; Rehaume, Linda M; Thomas, Ranjeny

    2015-04-01

    Genetic discoveries in arthritis and their associated biological pathways spanning the innate and adaptive immune system demonstrate the strong association between susceptibility to arthritis and control of exogenous organisms. The canonical theory of the aetiology of immune-mediated arthritis and other immune-mediated diseases is that the introduction of exogenous antigenic stimuli to a genetically susceptible host sets up the environment for an abnormal immune response manifesting as disease. A disruption in host-microbe homeostasis driven by disease-associated genetic variants could ultimately provide the source of exogenous antigen triggering disease development. We discuss genetic variants impacting the innate and adaptive arms of the immune system and their relationship to microbial control and arthritic disease. We go on to consider the evidence for a relationship between HLA-B27, infection and arthritis, and then emerging evidence for an interaction between microbiota and rheumatoid arthritis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. GENETIC ASPECTS OF AUTISM

    Directory of Open Access Journals (Sweden)

    Anastas LAKOSKI

    1997-06-01

    Full Text Available In the first paper on the syndrome of autism, Kanner described it as innate and inborn. He drew attention to the abnormalities in infancy without evidence of prior normal development and the intellectual, non emotional qualities shown by many of the parents and grandparents. Subsequently, the supposed lack of parental warmth led many clinicians to abandon the notions of constitutional deficit in the child and instead to postulate a psychogenic origin etiology was likely, genetic factors probably did not play a major role. Attention was draw to the low rate of autism in siblings, the lack of chromosome anomalies, and the similarities with syndromes associated with known brain trauma. Although the rate of autism in siblings was indeed low, it was much higher than in the general population rate providing a strong pointer to the genetic factors. The recognition that this was so, associated with the parallel finding of apparently high familiar loading for language delay, stimulated the first, systematic, twin study of autism, which suggested a strong genetic component. Subsequent research has produced findings in the same direction, although many questions remain unanswered. In this paper the evidence that has accumulated on genetic influences on autism is summarized and the remained dilemmas on this field are discussed.

  5. Diversity of management strategies in Mesoamerican turkeys: archaeological, isotopic and genetic evidence

    Science.gov (United States)

    Manin, Aurelie; Corona-M, Eduardo; Craig, Abigail; Thornton, Erin Kennedy; Yang, Dongya Y.; Richards, Michael

    2018-01-01

    The turkey (Meleagris gallopavo) represents one of the few domestic animals of the New World. While current research points to distinct domestication centres in the Southwest USA and Mesoamerica, several questions regarding the number of progenitor populations, and the timing and intensity of turkey husbandry remain unanswered. This study applied ancient mitochondrial DNA and stable isotope (δ13C, δ15N) analysis to 55 archaeological turkey remains from Mexico to investigate pre-contact turkey exploitation in Mesoamerica. Three different (sub)species of turkeys were identified in the archaeological record (M. g. mexicana, M. g. gallopavo and M. ocellata), indicating the exploitation of diverse local populations, as well as the trade of captively reared birds into the Maya area. No evidence of shared maternal haplotypes was observed between Mesoamerica and the Southwest USA, in contrast with archaeological evidence for trade of other domestic products. Isotopic analysis indicates a range of feeding behaviours in ancient Mesoamerican turkeys, including wild foraging, human provisioning and mixed feeding ecologies. This variability in turkey diet decreases through time, with archaeological, genetic and isotopic evidence all pointing to the intensification of domestic turkey management and husbandry, culminating in the Postclassic period. PMID:29410864

  6. Diversity of management strategies in Mesoamerican turkeys: archaeological, isotopic and genetic evidence.

    Science.gov (United States)

    Manin, Aurelie; Corona-M, Eduardo; Alexander, Michelle; Craig, Abigail; Thornton, Erin Kennedy; Yang, Dongya Y; Richards, Michael; Speller, Camilla F

    2018-01-01

    The turkey ( Meleagris gallopavo ) represents one of the few domestic animals of the New World. While current research points to distinct domestication centres in the Southwest USA and Mesoamerica, several questions regarding the number of progenitor populations, and the timing and intensity of turkey husbandry remain unanswered. This study applied ancient mitochondrial DNA and stable isotope ( δ 13 C, δ 15 N) analysis to 55 archaeological turkey remains from Mexico to investigate pre-contact turkey exploitation in Mesoamerica. Three different (sub)species of turkeys were identified in the archaeological record ( M. g. mexicana , M. g. gallopavo and M. ocellata ), indicating the exploitation of diverse local populations, as well as the trade of captively reared birds into the Maya area. No evidence of shared maternal haplotypes was observed between Mesoamerica and the Southwest USA, in contrast with archaeological evidence for trade of other domestic products. Isotopic analysis indicates a range of feeding behaviours in ancient Mesoamerican turkeys, including wild foraging, human provisioning and mixed feeding ecologies. This variability in turkey diet decreases through time, with archaeological, genetic and isotopic evidence all pointing to the intensification of domestic turkey management and husbandry, culminating in the Postclassic period.

  7. Genetic educational needs and the role of genetics in primary care: a focus group study with multiple perspectives

    Directory of Open Access Journals (Sweden)

    van der Vleuten Cees

    2011-02-01

    Full Text Available Abstract Background Available evidence suggests that improvements in genetics education are needed to prepare primary care providers for the impact of ongoing rapid advances in genomics. Postgraduate (physician training and master (midwifery training programmes in primary care and public health are failing to meet these perceived educational needs. The aim of this study was to explore the role of genetics in primary care (i.e. family medicine and midwifery care and the need for education in this area as perceived by primary care providers, patient advocacy groups and clinical genetics professionals. Methods Forty-four participants took part in three types of focus groups: mono-disciplinary groups of general practitioners and midwives, respectively and multidisciplinary groups composed of a diverse set of experts. The focus group sessions were audio-taped, transcribed verbatim and analysed using content analysis. Recurrent themes were identified. Results Four themes emerged regarding the educational needs and the role of genetics in primary care: (1 genetics knowledge, (2 family history, (3 ethical dilemmas and psychosocial effects in relation to genetics and (4 insight into the organisation and role of clinical genetics services. These themes reflect a shift in the role of genetics in primary care with implications for education. Although all focus group participants acknowledged the importance of genetics education, general practitioners felt this need more urgently than midwives and more strongly emphasized their perceived knowledge deficiencies. Conclusion The responsibilities of primary care providers with regard to genetics require further study. The results of this study will help to develop effective genetics education strategies to improve primary care providers' competencies in this area. More research into the educational priorities in genetics is needed to design courses that are suitable for postgraduate and master programmes for

  8. Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease

    NARCIS (Netherlands)

    van der Harst, Pim; Verweij, Niek

    2018-01-01

    Rationale: Coronary artery disease (CAD) is a complex phenotype driven by genetic and environmental factors. Ninety-seven genetic risk loci have been identified to date, but the identification of additional susceptibility loci might be important to enhance our understanding of the genetic

  9. Genetic Architecture of Group A Streptococcal Necrotizing Soft Tissue Infections in the Mouse

    DEFF Research Database (Denmark)

    Chella Krishnan, Karthickeyan; Mukundan, Santhosh; Alagarsamy, Jeyashree

    2016-01-01

    Host genetic variations play an important role in several pathogenic diseases, and we have previously provided strong evidences that these genetic variations contribute significantly to differences in susceptibility and clinical outcomes of invasive Group A Streptococcus (GAS) infections, includi...

  10. Organizational Culture and Climate and Mental Health Provider Attitudes Toward Evidence-Based Practice

    OpenAIRE

    Aarons, Gregory A.; Sawitzky, Angelina C.

    2006-01-01

    Mental health provider attitudes toward adopting evidence-based practice (EBP) are associated with organizational context and provider individual differences. Organizational culture and climate are contextual factors that can affect staff acceptance of innovation. This study examined the association of organizational culture and climate with attitudes toward adopting EBP. Participants were 301 public sector mental health service providers from 49 programs providing mental health services for ...

  11. Genetic aspects of pathological gambling: a complex disorder with shared genetic vulnerabilities.

    Science.gov (United States)

    Lobo, Daniela S S; Kennedy, James L

    2009-09-01

    To summarize and discuss findings from genetic studies conducted on pathological gambling (PG). Searches were conducted on PubMed and PsychInfo databases using the keywords: 'gambling and genes', 'gambling and family' and 'gambling and genetics', yielding 18 original research articles investigating the genetics of PG. Twin studies using the Vietnam Era Twin Registry have found that: (i) the heritability of PG is estimated to be 50-60%; (ii) PG and subclinical PG are a continuum of the same disorder; (iii) PG shares genetic vulnerability factors with antisocial behaviours, alcohol dependence and major depressive disorder; (iv) genetic factors underlie the association between exposure to traumatic life-events and PG. Molecular genetic investigations on PG are at an early stage and published studies have reported associations with genes involved in the brain's reward and impulse control systems. Despite the paucity of studies in this area, published studies have provided considerable evidence of the influence of genetic factors on PG and its complex interaction with other psychiatric disorders and environmental factors. The next step would be to investigate the association and interaction of these variables in larger molecular genetic studies with subphenotypes that underlie PG. Results from family and genetic investigations corroborate further the importance of understanding the biological underpinnings of PG in the development of more specific treatment and prevention strategies.

  12. First evidence of genetic intraspecific variability and occurrence of Entamoeba gingivalis in HIV(+/AIDS.

    Directory of Open Access Journals (Sweden)

    Sibeli B S Cembranelli

    Full Text Available Entamoeba gingivalis is considered an oral commensal but demonstrates a pathogenic potential associated with periodontal disease in immunocompromised individuals. Therefore, this study evaluated the occurrence, opportunistic conditions, and intraspecific genetic variability of E. gingivalis in HIV(+/AIDS patients. Entamoeba gingivalis was studied using fresh examination (FE, culture, and PCR from bacterial plaque samples collected from 82 HIV(+/AIDS patients. Genetic characterization of the lower ribosomal subunit of region 18S (18S-SSU rRNA was conducted in 9 positive samples using low-stringency single specific primer PCR (LSSP-PCR and sequencing analysis. Entamoeba gingivalis was detected in 63.4% (52/82 of the samples. No association was detected between the presence of E. gingivalis and the CD4(+ lymphocyte count (≤200 cells/mm(3 (p = 0.912 or viral load (p = 0.429. The LSSP-PCR results helped group E. gingivalis populations into 2 polymorphic groups (68.3% similarity: group I, associated with 63.6% (7/11 of the samples, and group II, associated with 36.4% (4/11 of the samples, which shared 74% and 83.7% similarity and association with C and E isolates from HIV(- individuals, respectively. Sequencing of 4 samples demonstrated 99% identity with the reference strain ATCC 30927 and also showed 2 divergent clusters, similar to those detected by LSSP-PCR. Opportunistic behavior of E. gingivalis was not detected, which may be related to the use of highly active antiretroviral therapy by all HIV(+/AIDS patients. The high occurrence of E. gingivalis in these patients can be influenced by multifactorial components not directly related to the CD4(+ lymphocyte counts, such as cholesterol and the oral microbiota host, which could mask the potential opportunistic ability of E. gingivalis. The identification of the 18S SSU-rRNA polymorphism by LSSP-PCR and sequencing analysis provides the first evidence of genetic variability in E. gingivalis

  13. Genetic Evidence for Causal Relationships Between Maternal Obesity-Related Traits and Birth Weight

    DEFF Research Database (Denmark)

    Tyrrell, Jessica; Richmond, Rebecca C; Palmer, Tom M

    2016-01-01

    IMPORTANCE: Neonates born to overweight or obese women are larger and at higher risk of birth complications. Many maternal obesity-related traits are observationally associated with birth weight, but the causal nature of these associations is uncertain. OBJECTIVE: To test for genetic evidence...... of causal associations of maternal body mass index (BMI) and related traits with birth weight. DESIGN, SETTING, AND PARTICIPANTS: Mendelian randomization to test whether maternal BMI and obesity-related traits are potentially causally related to offspring birth weight. Data from 30,487 women in 18 studies...

  14. Genetic education and nongenetic health professionals: educational providers and curricula in Europe

    NARCIS (Netherlands)

    Challen, K.; Harris, H.J.; Julian-Reynier, C.; Kate, L.P. ten; Kristoffersson, U.; Nippert, I.; Schmidtke, J.; Benjamin, C.; Harris, R

    2005-01-01

    PURPOSE: Advances in and diffusion of genetic technology mean that nongeneticist health professionals have an increasing need to develop and maintain genetic competencies. This has been recognized by patient support groups and the European Commission. As the first phase of the GenEd (Genetic

  15. Genetic Diversity and Evidence for Transmission of Streptococcus mutans by DiversiLab rep-PCR.

    Science.gov (United States)

    Momeni, Stephanie S; Whiddon, Jennifer; Cheon, Kyounga; Ghazal, Tariq; Moser, Stephen A; Childers, Noel K

    2016-09-01

    This two-part study investigated the genetic diversity and transmission of Streptococcus mutans using the DiversiLab repetitive extragenic palindromic PCR (rep-PCR) approach. For children with S. mutans and participating household members, analysis for evidence of unrelated child-to-child as well as intra-familial transmission was evaluated based on commonality of genotypes. A total of 169 index children and 425 household family members from Uniontown, Alabama were evaluated for genetic diversity using rep-PCR. Thirty-four unique rep-PCR genotypes were observed for 13,906 S. mutans isolates. For transmission, 117 child and household isolates were evaluated for shared genotype (by child and by genotype cases, multiple matches possible for each child). Overall, children had 1-9 genotypes and those with multiple genotypes were 2.3 times more likely to have caries experience (decayed, missing and filled teeth/surfaces>0). Only 28% of children shared all genotypes within the household, while 72% had at least 1 genotype not shared with anyone in the household. Children had genotype(s) not shared with any household members in 157 cases. In 158 cases children and household members shared a genotype in which 55% (87/158 cases) were shared with more than one family member. Children most frequently shared genotypes with their mothers (54%; 85/158), siblings (46%; 72/158) and cousins (23%; 37/158). A reference library for S. mutans for epidemiological surveillance using the DiversiLab rep-PCR approach is detailed. The genetic diversity of S. mutans in this population demonstrated frequent commonality of genotypes. Evidence for both child-to-child and intra-familial transmission of S. mutans was observed by rep-PCR. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. [Social engineers--providers--bioethicists. Human genetics experts in West-Germany and Denmark between 1950 and 1990].

    Science.gov (United States)

    Thomaschke, Dirk

    2013-01-01

    The author compares the history of human genetics in the Federal Republic of Germany and Denmark from the 1950s to the 1980s. The paper combines a discourse analysis with the exploration of human genetics experts' subject forms along the lines of current considerations within cultural studies. In the 1950s and 1960s, human geneticists acted in close cooperation with other political, judicial and administrative expert groups. They monitored the 'overall genetic development' of the population and cautioned about 'genetic crises'. Laypersons were supposed to submit to 'objectively reasonable' behavioral patterns--to their own as well as society's benefit. In the 1970s, the experts turned into 'providers' of a 'precise, purely medical, diagnostic service'. The patients mainly appeared as 'de-personalized' sources of a common human demand for 'safe eugenic information'. In the 1980s, the demand and supply paradigm manifested psychological and ethical side effects. Human geneticists became aware of the social and historical interrelations of their research and practices. The results of this study contribute to a more complex understanding of the dominant 'individualization narrative' of human genetics history. In this context, the development in Germany and Denmark displays two complementary forms of a transnational discourse.

  17. Comparative population genetics of two invading ticks: Evidence of the ecological mechanisms underlying tick range expansions.

    Science.gov (United States)

    Nadolny, Robyn; Gaff, Holly; Carlsson, Jens; Gauthier, David

    2015-10-01

    Two species of ixodid tick, Ixodes affinis Neumann and Amblyomma maculatum Koch, are simultaneously expanding their ranges throughout the mid-Atlantic region of the US. Although we have some understanding of the ecology and life history of these species, the ecological mechanisms governing where and how new populations establish and persist are unclear. To assess population connectivity and ancestry, we sequenced a fragment of the 16S mitochondrial rRNA gene from a representative sample of individuals of both species from populations throughout the eastern US. We found that despite overlapping host preferences throughout ontogeny, each species exhibited very different genetic and geographic patterns of population establishment and connectivity. I. affinis was of two distinct mitochondrial clades, with a clear geographic break separating northern and southern populations. Both I. affinis populations showed evidence of recent expansion, although the southern population was more genetically diverse, indicating a longer history of establishment. A. maculatum exhibited diverse haplotypes that showed no significant relationship with geographic patterns and little apparent connectivity between sites. Heteroplasmy was also observed in the 16S mitochondrial rRNA gene in 3.5% of A. maculatum individuals. Genetic evidence suggests that these species rely on different key life stages to successfully disperse into novel environments, and that host vagility, habitat stability and habitat connectivity all play critical roles in the establishment of new tick populations. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Evidence of genetic differentiation and karyotype evolution of the sedges Cyperus ligularis L. and C. odoratus L. (Cyperaceae

    Directory of Open Access Journals (Sweden)

    Geyner Alves dos Santos Cruz

    2018-01-01

    Full Text Available ABSTRACT The taxonomy of Cyperaceae is complex, with genera like Cyperus harboring species complexes. We analyzed the genetic similarity between Cyperus ligularis L. and C. odoratus L. based on DNA fingerprinting and cytogenetics. Significative genetic differentiation (G ST = 0.363 and low gene flow (N m = 0.877 indicated a clear genetic distinction between the two species. Moreover, the clustering analysis showed two distinct genetic groups, suggesting a lack of evidence for hybridization. The phenogram revealed two different lineages, and although all individuals of C. odoratus were collected from plots close to each other, they possessed greater genetic diversity than that observed among individuals of C. ligularis, which were sampled over a wider geographic range. Variation in chromosome number within the two species exhibited the opposite pattern, indicating greater karyotype stability in C. odoratus with 2n = 72 and 2n = 76, while the diploid number for C. ligularis varied from 2n = 66 to 88. The lower genetic variation in C. ligularis may be a result of the founder effect associated with seed dispersion and clonal reproduction. Field observations and analysis of reproductive biology should enrich the understanding of the genetic structure of the investigated populations and their role in successional processes.

  19. Genetic basis of atrial fibrillation

    Directory of Open Access Journals (Sweden)

    Oscar Campuzano

    2016-12-01

    Full Text Available Atrial fibrillation is the most common sustained arrhythmia and remains as one of main challenges in current clinical practice. The disease may be induced secondary to other diseases such as hypertension, valvular heart disease, and heart failure, conferring an increased risk of stroke and sudden death. Epidemiological studies have provided evidence that genetic factors play an important role and up to 30% of clinically diagnosed patients may have a family history of atrial fibrillation. To date, several rare variants have been identified in a wide range of genes associated with ionic channels, calcium handling protein, fibrosis, conduction and inflammation. Important advances in clinical, genetic and molecular basis have been performed over the last decade, improving diagnosis and treatment. However, the genetics of atrial fibrillation is complex and pathophysiological data remains still unraveling. A better understanding of the genetic basis will induce accurate risk stratification and personalized clinical treatment. In this review, we have focused on current genetics basis of atrial fibrillation.

  20. Neighborhood alcohol outlet density and genetic influences on alcohol use: evidence for gene-environment interaction.

    Science.gov (United States)

    Slutske, Wendy S; Deutsch, Arielle R; Piasecki, Thomas M

    2018-05-07

    Genetic influences on alcohol involvement are likely to vary as a function of the 'alcohol environment,' given that exposure to alcohol is a necessary precondition for genetic risk to be expressed. However, few gene-environment interaction studies of alcohol involvement have focused on characteristics of the community-level alcohol environment. The goal of this study was to examine whether living in a community with more alcohol outlets would facilitate the expression of the genetic propensity to drink in a genetically-informed national survey of United States young adults. The participants were 2434 18-26-year-old twin, full-, and half-sibling pairs from Wave III of the National Longitudinal Study of Adolescent to Adult Health. Participants completed in-home interviews in which alcohol use was assessed. Alcohol outlet densities were extracted from state-level liquor license databases aggregated at the census tract level to derive the density of outlets. There was evidence that the estimates of genetic and environmental influences on alcohol use varied as a function of the density of alcohol outlets in the community. For example, the heritability of the frequency of alcohol use for those residing in a neighborhood with ten or more outlets was 74% (95% confidence limits = 55-94%), compared with 16% (95% confidence limits = 0-34%) for those in a neighborhood with zero outlets. This moderating effect of alcohol outlet density was not explained by the state of residence, population density, or neighborhood sociodemographic characteristics. The results suggest that living in a neighborhood with many alcohol outlets may be especially high-risk for those individuals who are genetically predisposed to frequently drink.

  1. Holistic Nursing in the Genetic/Genomic Era.

    Science.gov (United States)

    Sharoff, Leighsa

    2016-06-01

    Holistic nursing practice is an ever-evolving transformative process with core values that require continued growth, professional leadership, and advocacy. Holistic nurses are required to stay current with all new required competencies, such as the Core Competencies in Genetics for Health Professional, and, as such, be adept at translating scientific evidence relating to genetics/genomics in the clinical setting. Knowledge of genetics/genomics in relation to nursing practice, policy, utilization, and research influence nurses' responsibilities. In addition to holistic nursing competencies, the holistic nurse must have basic knowledge and skills to integrate genetics/genomics aspects. It is important for holistic nurses to enhance their overall knowledge foundation, skills, and attitudes about genetics to prepare for the transformation in health care that is already underway. Holistic nurses can provide an important perspective to the application of genetics and genomics, focusing on health promotion, caring, and understanding the relationship between caring and families, community, and society. Yet there may be a lack of genetic and genomic knowledge to fully participate in the current genomic era. This article will explore the required core competencies for all health care professionals, share linkage of holistic nurses in practice with genetic/genomic conditions, and provide resources to further one's knowledge base. © The Author(s) 2015.

  2. Availability and accessibility of evidence-based information resources provided by medical libraries in Australia.

    Science.gov (United States)

    Ritchie, A; Sowter, B

    2000-01-01

    This article reports on the results of an exploratory survey of the availability and accessibility of evidence-based information resources provided by medical libraries in Australia. Although barriers impede access to evidence-based information for hospital clinicians, the survey revealed that Medline and Cinahl are available in over 90% of facilities. In most cases they are widely accessible via internal networks and the Internet. The Cochrane Library is available in 69% of cases. The Internet is widely accessible and most libraries provide access to some full-text, electronic journals. Strategies for overcoming restrictions and integrating information resources with clinical workflow are being pursued. State, regional and national public and private consortia are developing agreements utilising on-line technology. These could produce cost savings and more equitable access to a greater range of evidence-based resources.

  3. Evidence for the control of phytolith formation in Cucurbita fruits by the hard rind (Hr) genetic locus: Archaeological and ecological implications

    Science.gov (United States)

    Piperno, Dolores R.; Holst, Irene; Wessel-Beaver, Linda; Andres, Thomas C.

    2002-01-01

    Many angiosperms, both monocotyledons and dicotyledons, heavily impregnate their vegetative and reproductive organs with solid particles of silicon dioxide (SiO2) known as opaline phytoliths. The underlying mechanisms accounting for the formation of phytoliths in plants are poorly understood, however. Using wild and domesticated species in the genus Cucurbita along with their F1 and F2 progeny, we have demonstrated that the production of large diagnostic phytoliths in fruit rinds exhibits a one-to-one correspondence to the lignification of these structures. We propose that phytolith formation in Cucurbita fruits is primarily determined by a dominant genetic locus, called hard rind (Hr), previously shown to code for lignin deposition. If true, this evidence represents a demonstration of genetic control over phytolith production in a dicotyledon and provides considerable support to hypotheses that silica phytoliths constitute another important system of mechanical defense in plants. Our research also identifies Hr as another single locus controlling more than one important phenotypic difference between wild and domesticated plants, and establishes rind tissue cell structure and hardness under the effects of Hr as an important determinant of phytolith morphology. When recovered from pre-Columbian archaeological sites, Cucurbita phytoliths represent genetically controlled fossil markers of exploitation and domestication in this important economic genus. PMID:12149443

  4. Development of E-Info geneca: a website providing computer-tailored information and question prompt prior to breast cancer genetic counseling.

    NARCIS (Netherlands)

    Albada, A.; Dulmen, S. van; Otten, R.; Bensing, J.M.; Ausems, M.G.E.M.

    2009-01-01

    This article describes the stepwise development of the website ‘E-info geneca’. The website provides counselees in breast cancer genetic counseling with computer-tailored information and a question prompt prior to their first consultation. Counselees generally do not know what to expect from genetic

  5. The evidence base regarding the experiences of and attitudes to preimplantation genetic diagnosis in prospective parents.

    Science.gov (United States)

    Cunningham, Jenny; Goldsmith, Lesley; Skirton, Heather

    2015-02-01

    Preimplantation genetic diagnosis was developed as an alternative to prenatal diagnosis for couples with a family history of genetic disease. After in vitro fertilization, the embryos can be analysed to ensure that only healthy embryos are transferred to the uterus. Past studies have suggested that couples who wish to avoid having a child with an inherited genetic condition look favourably on preimplantation genetic diagnosis as it prevents the need for termination of pregnancy following prenatal diagnosis of an affected fetus. However, it is important to understand the experiences of couples who have used or consider using this technique. To ascertain the current evidence base on this topic, we conducted a mixed methods systematic review. Four databases were searched for relevant peer-reviewed papers published between 2000 and 2013. Of 453 papers, nine satisfied the inclusion criteria and were assessed for quality. Results of nine papers were analysed and synthesised using a narrative approach. Three main themes emerged: (1) motivating factors; (2) emotional labour; (3) choices and uncertainty. The review has identified an emotional and difficult journey for couples pursuing preimplantation genetic diagnosis. While use of the technique gives hope to families who wish to prevent transmission of a genetic disease this is not without hard decision-making and periods of uncertainty. Lack of information was perceived as a barrier to access this reproductive option. Recommendations include: training and education in genetics for midwives who are the first point of contact for pregnant women; clinics to use a decision-making tool to emphasise the uncertainty involved in PGD and improved communication and psychological support to couples. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Negative self-referential processing is associated with genetic variation in the serotonin transporter-linked polymorphic region (5-HTTLPR): Evidence from two independent studies.

    Science.gov (United States)

    Dainer-Best, Justin; Disner, Seth G; McGeary, John E; Hamilton, Bethany J; Beevers, Christopher G

    2018-01-01

    The current research examined whether carriers of the short 5-HTTLPR allele (in SLC6A4), who have been shown to selectively attend to negative information, exhibit a bias towards negative self-referent processing. The self-referent encoding task (SRET) was used to measure self-referential processing of positive and negative adjectives. Ratcliff's diffusion model isolated and extracted decision-making components from SRET responses and reaction times. Across the initial (N = 183) and replication (N = 137) studies, results indicated that short 5-HTTLPR allele carriers more easily categorized negative adjectives as self-referential (i.e., higher drift rate). Further, drift rate was associated with recall of negative self-referential stimuli. Findings across both studies provide further evidence that genetic variation may contribute to the etiology of negatively biased processing of self-referent information. Large scale studies examining the genetic contributions to negative self-referent processing may be warranted.

  7. Legal implications of genetics and crime research.

    Science.gov (United States)

    Denno, D W

    1996-01-01

    Two controversial topics dominate discussions of the legal implications of genetics and crime research; (1) the viability and politics of such research, which has sparked fervent debate in the USA; and (2) the current status of new or atypical criminal law defences, which would include a genetic-defect defence to criminal behaviour. This chapter begins by examining the scientifically discredited XYY chromosome syndrome defence, the major genetic-defect defence that defendants have attempted, albeit unsuccessfully. It then focuses on attorneys' efforts to test for evidence of genetic abnormality in the recent and highly publicized case involving convicted murderer Stephen Mobley, whose family history reveals four generations of violent, aggressive and behaviourally disordered men and women. Mobley is currently appealing his death sentence before the Georgia Supreme Court on the basis that the trial court denied his request both to have genetic testing performed and to have such testing allowed as evidence into court. This chapter concludes by emphasizing that the question is not whether genetic evidence will ever be admitted into court, but when and under what kinds of circumstances. No doubt, genetic evidence, and comparable kinds of biological evidence, will have a major impact on juries when such evidence is more fully accepted by the legal and scientific communities.

  8. Noninvasive genetics provides insights into the population size and genetic diversity of an Amur tiger population in China.

    Science.gov (United States)

    Wang, Dan; Hu, Yibo; Ma, Tianxiao; Nie, Yonggang; Xie, Yan; Wei, Fuwen

    2016-01-01

    Understanding population size and genetic diversity is critical for effective conservation of endangered species. The Amur tiger (Panthera tigris altaica) is the largest felid and a flagship species for wildlife conservation. Due to habitat loss and human activities, available habitat and population size are continuously shrinking. However, little is known about the true population size and genetic diversity of wild tiger populations in China. In this study, we collected 55 fecal samples and 1 hair sample to investigate the population size and genetic diversity of wild Amur tigers in Hunchun National Nature Reserve, Jilin Province, China. From the samples, we determined that 23 fecal samples and 1 hair sample were from 7 Amur tigers: 2 males, 4 females and 1 individual of unknown sex. Interestingly, 2 fecal samples that were presumed to be from tigers were from Amur leopards, highlighting the significant advantages of noninvasive genetics over traditional methods in studying rare and elusive animals. Analyses from this sample suggested that the genetic diversity of wild Amur tigers is much lower than that of Bengal tigers, consistent with previous findings. Furthermore, the genetic diversity of this Hunchun population in China was lower than that of the adjoining subpopulation in southwest Primorye Russia, likely due to sampling bias. Considering the small population size and relatively low genetic diversity, it is urgent to protect this endangered local subpopulation in China. © 2015 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

  9. Genetic variation in South Indian castes: evidence from Y-chromosome, mitochondrial, and autosomal polymorphisms

    Directory of Open Access Journals (Sweden)

    Tirupati S

    2008-12-01

    Full Text Available Abstract Background Major population movements, social structure, and caste endogamy have influenced the genetic structure of Indian populations. An understanding of these influences is increasingly important as gene mapping and case-control studies are initiated in South Indian populations. Results We report new data on 155 individuals from four Tamil caste populations of South India and perform comparative analyses with caste populations from the neighboring state of Andhra Pradesh. Genetic differentiation among Tamil castes is low (RST = 0.96% for 45 autosomal short tandem repeat (STR markers, reflecting a largely common origin. Nonetheless, caste- and continent-specific patterns are evident. For 32 lineage-defining Y-chromosome SNPs, Tamil castes show higher affinity to Europeans than to eastern Asians, and genetic distance estimates to the Europeans are ordered by caste rank. For 32 lineage-defining mitochondrial SNPs and hypervariable sequence (HVS 1, Tamil castes have higher affinity to eastern Asians than to Europeans. For 45 autosomal STRs, upper and middle rank castes show higher affinity to Europeans than do lower rank castes from either Tamil Nadu or Andhra Pradesh. Local between-caste variation (Tamil Nadu RST = 0.96%, Andhra Pradesh RST = 0.77% exceeds the estimate of variation between these geographically separated groups (RST = 0.12%. Low, but statistically significant, correlations between caste rank distance and genetic distance are demonstrated for Tamil castes using Y-chromosome, mtDNA, and autosomal data. Conclusion Genetic data from Y-chromosome, mtDNA, and autosomal STRs are in accord with historical accounts of northwest to southeast population movements in India. The influence of ancient and historical population movements and caste social structure can be detected and replicated in South Indian caste populations from two different geographic regions.

  10. Sensation seeking, peer deviance, and genetic influences on adolescent delinquency: Evidence for person-environment correlation and interaction.

    Science.gov (United States)

    Mann, Frank D; Patterson, Megan W; Grotzinger, Andrew D; Kretsch, Natalie; Tackett, Jennifer L; Tucker-Drob, Elliot M; Harden, K Paige

    2016-07-01

    Both sensation seeking and affiliation with deviant peer groups are risk factors for delinquency in adolescence. In this study, we use a sample of adolescent twins (n = 549), 13 to 20 years old (M age = 15.8 years), in order to test the interactive effects of peer deviance and sensation seeking on delinquency in a genetically informative design. Consistent with a socialization effect, affiliation with deviant peers was associated with higher delinquency even after controlling for selection effects using a co-twin-control comparison. At the same time, there was evidence for person-environment correlation; adolescents with genetic dispositions toward higher sensation seeking were more likely to report having deviant peer groups. Genetic influences on sensation seeking substantially overlapped with genetic influences on adolescent delinquency. Finally, the environmentally mediated effect of peer deviance on adolescent delinquency was moderated by individual differences in sensation seeking. Adolescents reporting high levels of sensation seeking were more susceptible to deviant peers, a Person × Environment interaction. These results are consistent with both selection and socialization processes in adolescent peer relationships, and they highlight the role of sensation seeking as an intermediary phenotype for genetic risk for delinquency. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  11. US system of oversight for genetic testing: a report from the Secretary's Advisory Committee on Genetics, Health and Society.

    Science.gov (United States)

    Ferreira-Gonzalez, Andrea; Teutsch, Steven; Williams, Marc S; Au, Sylvia M; Fitzgerald, Kevin T; Miller, Paul Steven; Fomous, Cathy

    2008-09-01

    As genetic testing technology is integrated into healthcare, increasingly detailed information about individual and population genetic variation is available to patients and providers. Health professionals use genetic testing to diagnose or assess the risk of disease in individuals, families and populations and to guide healthcare decisions. Consumers are beginning to explore personalized genomic services in an effort to learn more about their risk for common diseases. Scientific and technological advances in genetic testing, as with any newly introduced medical technology, present certain challenges to existing frameworks of oversight. In addition, the growing use of genetic testing will require a significant investment in evidence-based assessments to understand the validity and utility of these tests in clinical and personal decisionmaking. To optimize the use of genetic testing in healthcare, all sectors of the oversight system need to be strengthened and yet remain flexible in order to adapt to advances that will inevitably increase the range of genetic tests and methodologies.

  12. Genetic determinants of common epilepsies

    DEFF Research Database (Denmark)

    2014-01-01

    and insufficient power. We aimed to identify risk loci through meta-analyses of genome-wide association studies for all epilepsy and the two largest clinical subtypes (genetic generalised epilepsy and focal epilepsy). METHODS: We combined genome-wide association data from 12 cohorts of individuals with epilepsy...... not previously implicated in epilepsy and provides further evidence about the genetic architecture of these disorders, with the ultimate aim of assisting in disease classification and prognosis. The data suggest that specific loci can act pleiotropically raising risk for epilepsy broadly, or can have effects...... and controls from population-based datasets. Controls were ethnically matched with cases. We phenotyped individuals with epilepsy into categories of genetic generalised epilepsy, focal epilepsy, or unclassified epilepsy. After standardised filtering for quality control and imputation to account for different...

  13. The genetic history of Peninsular Malaysia.

    Science.gov (United States)

    Norhalifah, Hanim Kamis; Syaza, Fatnin Hisham; Chambers, Geoffrey Keith; Edinur, Hisham Atan

    2016-07-15

    This article explores the genetic history of the various sub-populations currently living in Peninsular Malaysia. This region has received multiple waves of migrants like the Orang Asli in prehistoric times and the Chinese, Indians, Europeans and Arabs during historic times. There are three highly distinct lineages that make up the Orang Asli; Semang, Senoi and Proto-Malays. The Semang, who have 'Negrito' characteristics, represent the first human settlers in Peninsular Malaysia arriving from about 50,000ya. The Senoi later migrated from Indochina and are a mix between an Asian Neolithic population and the Semang. These Asian genomes probably came in before Austroasiatic languages arrived between 5000 and 4000years ago. Semang and Senoi both now speak Austro-Asiatic languages indicative of cultural diffusion from Senoi to Semang. In contrast, the Proto-Malays who came last to the southern part of this region speak Austronesian language and are Austronesians with some Negrito admixture. It is from this group that the contemporary Malays emerged. Here we provide an overview of the best available genetic evidences (single nucleotide polymorphisms, mitochondrial DNA, Y-chromosome, blood groups, human platelet antigen, human leukocyte antigen, human neutrophil antigen and killer-cell immunoglobulin-like receptor) supporting the complex genetic history of Peninsular Malaysia. Large scale sampling and high throughput genetic screening programmes such as those using genome-wide single nucleotide polymorphism analyses have provided insights into various ancestral and admixture genetic fractions in this region. Given the now extensive admixture present in the contemporary descendants of ancient sub-populations in Peninsular Malaysia, improved reconstruction of human migration history in this region will require new evidence from ancient DNA in well-preserved skeletons. All other aspects of the highly diverse and complex genetic makeup in Peninsular Malaysia should be

  14. Maternal smoking during pregnancy and offspring conduct problems: Evidence from three independent genetically-sensitive research designs

    Science.gov (United States)

    Gaysina, Darya; Fergusson, David M.; Leve, Leslie D.; Horwood, John; Reiss, David; Shaw, Daniel S.; Elam, Kit K.; Natsuaki, Misaki N.; Neiderhiser, Jenae M.; Harold, Gordon T.

    2013-01-01

    Context A number of studies report an association between maternal smoking during pregnancy and offspring conduct disorder. However, past research evidences difficulty disaggregating prenatal environmental from genetic and postnatal environmental influences. Objective To examine the relationship between maternal smoking during pregnancy and offspring conduct problems among children reared by genetically-related and genetically-unrelated mothers. Design, Setting and Participants Three studies employing distinct but complementary research designs were utilized: The Christchurch Health and Development Study (a longitudinal cohort study that includes biological and adopted children), the Early Growth and Development Study (a longitudinal adoption at birth study), and the Cardiff IVF Study (genetically-related and -unrelated families; an adoption at conception study). Maternal smoking during pregnancy was measured as the average number of cigarettes/day (0, 1–9 or 10+) smoked during pregnancy. A number of possible covariates (child gender, ethnicity, birth weight, breast feeding, maternal age at birth, maternal education, family SES, family breakdown, placement age, and parenting practices) were controlled in the analyses. Main Outcome Measure Child conduct problems (age 4–10 years) reported by parents and/or teachers using the Rutter and Conners behaviour scales, the Child Behavior Checklist and Children's Behavior Questionnaire, and the Strengths and Difficulties Questionnaire. Results A significant association between maternal smoking during pregnancy and child conduct problems was observed among children reared by genetically-related and genetically-unrelated mothers. Results from a meta-analysis affirmed this pattern of findings across pooled study samples. Conclusions Findings across the three studies using a complement of genetically-sensitive research designs suggest smoking during pregnancy is a prenatal risk factor for offspring conduct problems, when

  15. Genetics of Post-Traumatic Stress Disorder: Informing Clinical Conceptualizations and Promoting Future Research

    Science.gov (United States)

    Nugent, Nicole R.; Amstadter, Ananda B.; Koenen, Karestan C.

    2009-01-01

    The purpose of this article is to provide an overview of genetic research involving post-traumatic stress disorder (PTSD). First, we summarize evidence for genetic influences on PTSD from family investigations. Second, we discuss the distinct contributions to our understanding of the genetics of PTSD permitted by twin studies. Finally, we summarize findings from molecular genetic studies, which have the potential to inform our understanding of underlying biological mechanisms for the development of PTSD. PMID:18412098

  16. A Tri-Part Model for Genetics Literacy: Exploring Undergraduate Student Reasoning about Authentic Genetics Dilemmas

    Science.gov (United States)

    Shea, Nicole A.; Duncan, Ravit Golan; Stephenson, Celeste

    2015-01-01

    Genetics literacy is becoming increasingly important as advancements in our application of genetic technologies such as stem cell research, cloning, and genetic screening become more prevalent. Very few studies examine how genetics literacy is applied when reasoning about authentic genetic dilemmas. However, there is evidence that situational…

  17. Genetic and environmental influence on asthma

    DEFF Research Database (Denmark)

    Skadhauge, L.R.; Christensen, Kaare; Kyvik, Kirsten Ohm

    1999-01-01

    The aim of this study was to estimate the relative influence of genetic and environmental factors on the aetiology of asthma. The classic twin study design was used to analyse data on self-reported asthma obtained by a questionnaire mailed to 34,076 individuals, aged 12-41 yrs and originating from...... in the monozygotic than in the dizygotic twins. Using biometric modelling, a model including additive genetic and nonshared environmental effects provided the best overall fit to the data. According to this model, 73% of the variation in liability to asthma was explained by genetic factors. No sex difference or age......-dependency in the magnitude of genetic effects was observed. The biometric analysis emphasized a major influence of genetic factors in the aetiology of asthma. However, a substantial part of the variation in liability to asthma is due to the impact of environmental factors specific to the individual. There is no evidence...

  18. Genetic testing for hearing impairment.

    Science.gov (United States)

    Topsakal, V; Van Camp, G; Van de Heyning, P

    2005-01-01

    For some patients, genetic testing can reveal the etiology of their hearing impairment, and can provide evidence for a medical diagnosis. However, a gap between fundamental genetic research on hereditary deafness and clinical otology emerges because of the steadily increasing number of discovered genes for hereditary hearing impairment (HHI) and the comparably low clinical differentiation of the HHIs. In an attempt to keep up with the scientific progress, this article enumerates the indications of genetic testing for HHI from a clinical point of view and describes the most frequently encountered HHIs in Belgium. Domains of recent scientific interest, molecular biological aspects, and some pitfalls with HHIs are highlighted. The overview comprises bilateral congenital hearing loss, late-onset progressive high frequency hearing loss, progressive bilateral cochleo-vestibular deficit, and progressive low frequency hearing loss. Also, several syndromal forms of HHI are summarized, and the availability of genetic tests mentioned. Finally, the requirements for successful linkage analysis, an important genetic research tool for localizing the potential genes of a trait on a chromosome, are briefly described.

  19. Human mutagens: evidence from paternal exposure

    International Nuclear Information System (INIS)

    Narod, S.A.; Douglas, G.R.; Nestmann, E.R.; Blakey, D.H.

    1988-01-01

    The importance of inherited mutations as a cause of human disease has been established clearly through examples of well-defined genetic anomalies, such as Down syndrome and retinoblastoma. Furthermore, it is suspected that environmental contaminants induce mutations resulting in increased risk for such defects in subsequent generations of persons exposed. The present lack of direct evidence for induced inherited genetic disorders in human beings hampers the development of risk estimation techniques for extrapolation from animal models. The most extensive prospective epidemiologic studies of inherited genetic effects have involved survivors of atomic bomb detonations and patients treated with cancer chemotherapy. In neither case has a significant elevation in inherited genetic effects or cancer been detected in the offspring of exposed individuals. Epidemiologic studies of subjects receiving chronic exposure may be confounded by the effect of maternal exposure during pregnancy. Consideration of only paternal exposure can minimize the confounding influence of teratogenicity, enhancing the resolving power of studies for inherited effects. Using this approach, retrospective (case-control) studies of childhood cancer patients have provided limited but suggestive evidence for inheritance of induced effects. Endpoints, such as congenital malformations and spontaneous abortion following paternal exposure, can also be considered as indicators of heritable mutagenic effects. For example, there is limited evidence suggesting that paternal exposure to anaesthetic gases may cause miscarriage and congenital abnormalities as a result of induced male germ cell mutations. 104 references

  20. Genealogical evidence for epidemics of selfish genes.

    Science.gov (United States)

    Ingvarsson, Par K; Taylor, Douglas R

    2002-08-20

    Some genetic elements spread infectiously in populations by increasing their rate of genetic transmission at the expense of other genes in the genome. These so-called selfish genetic elements comprise a substantial portion of eukaryotic genomes and have long been viewed as a potent evolutionary force. Despite this view, little is known about the evolutionary history of selfish genetic elements in natural populations, or their genetic effects on other portions of the genome. Here we use nuclear and chloroplast gene genealogies in two species of Silene to show the historical pattern of selection on a well known selfish genetic element, cytoplasmic male sterility. We provide evidence that evolution of cytoplasmic male sterility has been characterized by frequent turnovers of mutations in natural populations, thus supporting an epidemic model for the evolution of selfish genes, where new mutations repeatedly arise and rapidly sweep through populations.

  1. Group A Rotaviruses in Chinese Bats: Genetic Composition, Serology, and Evidence for Bat-to-Human Transmission and Reassortment.

    Science.gov (United States)

    He, Biao; Huang, Xiaohong; Zhang, Fuqiang; Tan, Weilong; Matthijnssens, Jelle; Qin, Shaomin; Xu, Lin; Zhao, Zihan; Yang, Ling'en; Wang, Quanxi; Hu, Tingsong; Bao, Xiaolei; Wu, Jianmin; Tu, Changchun

    2017-06-15

    Bats are natural reservoirs for many pathogenic viruses, and increasing evidence supports the notion that bats can also harbor group A rotaviruses (RVAs), important causative agents of diarrhea in children and young animals. Currently, 8 RVA strains possessing completely novel genotype constellations or genotypes possibly originating from other mammals have been identified from African and Chinese bats. However, all the data were mainly based on detection of RVA RNA, present only during acute infections, which does not permit assessment of the true exposure of a bat population to RVA. To systematically investigate the genetic diversity of RVAs, 547 bat anal swabs or gut samples along with 448 bat sera were collected from five South Chinese provinces. Specific reverse transcription-PCR (RT-PCR) screening found four RVA strains. Strain GLRL1 possessed a completely novel genotype constellation, whereas the other three possessed a constellation consistent with the MSLH14-like genotype, a newly characterized group of viruses widely prevalent in Chinese insectivorous bats. Among the latter, strain LZHP2 provided strong evidence of cross-species transmission of RVAs from bats to humans, whereas strains YSSK5 and BSTM70 were likely reassortants between typical MSLH14-like RVAs and human RVAs. RVA-specific antibodies were detected in 10.7% (48/448) of bat sera by an indirect immunofluorescence assay (IIFA). Bats in Guangxi and Yunnan had a higher RVA-specific antibody prevalence than those from Fujian and Zhejiang provinces. These observations provide evidence for cross-species transmission of MSLH14-like bat RVAs to humans, highlighting the impact of bats as reservoirs of RVAs on public health. IMPORTANCE Bat viruses, such as severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS), Ebola, Hendra, and Nipah viruses, are important pathogens causing outbreaks of severe emerging infectious diseases. However, little is known about bat viruses capable

  2. Genetics of Human Sexual Behavior: Where We Are, Where We Are Going.

    Science.gov (United States)

    Jannini, Emmanuele A; Burri, Andrea; Jern, Patrick; Novelli, Giuseppe

    2015-04-01

    One of the never-ending debates in the developing field of sexual medicine is the extent to which genetics and experiences (i.e., "nature and nurture") contribute to sexuality. The debate continues despite the fact that these two sides have different abilities to create a scientific environment to support their cause. Contemporary genetics has produced plenty of recent evidence, however, not always confirmed or sufficiently robust. On the other hand, the more traditional social theorists, frequently without direct evidence confirming their positions, criticize, sometimes with good arguments, the methods and results of the other side. The aim of this article is to critically evaluate existent evidence that used genetic approaches to understand human sexuality. An expert in sexual medicine (E.A.J.), an expert in medical genetics (G.N.), and two experts in genetic epidemiology and quantitative genetics, with particular scientific experience in female sexual dysfunction (A.B.) and in premature ejaculation (P.J.), contributed to this review. Expert opinion supported by critical review of the currently available literature. The existing literature on human sexuality provides evidence that many sexuality-related behaviors previously considered to be the result of cultural influences (such as mating strategies, attractiveness and sex appeal, propensity to fidelity or infidelity, and sexual orientation) or dysfunctions (such as premature ejaculation or female sexual dysfunction) seem to have a genetic component. Current evidence from genetic epidemiologic studies underlines the existence of biological and congenital factors regulating male and female sexuality. However, these relatively recent findings ask for replication in methodologically more elaborated studies. Clearly, increased research efforts are needed to further improve understanding the genetics of human sexuality. Jannini EA, Burri A, Jern P, and Novelli G. Genetics of human sexual behavior: Where we are, where

  3. Spread of butternut canker in North America, host range, evidence of resistance within butternut populations and conservation genetics

    Science.gov (United States)

    M. E. Ostry; K. Woeste

    2004-01-01

    Butternut canker is killing trees throughout the range of butternut in North America and is threatening the viability of many populations in several areas. Although butternut is the primary host, other Juglans species and some hardwood species also are potential hosts. Evidence is building that genetic resistance within butternut populations may be...

  4. Genetics of human hydrocephalus

    Science.gov (United States)

    Williams, Michael A.; Rigamonti, Daniele

    2006-01-01

    Human hydrocephalus is a common medical condition that is characterized by abnormalities in the flow or resorption of cerebrospinal fluid (CSF), resulting in ventricular dilatation. Human hydrocephalus can be classified into two clinical forms, congenital and acquired. Hydrocephalus is one of the complex and multifactorial neurological disorders. A growing body of evidence indicates that genetic factors play a major role in the pathogenesis of hydrocephalus. An understanding of the genetic components and mechanism of this complex disorder may offer us significant insights into the molecular etiology of impaired brain development and an accumulation of the cerebrospinal fluid in cerebral compartments during the pathogenesis of hydrocephalus. Genetic studies in animal models have started to open the way for understanding the underlying pathology of hydrocephalus. At least 43 mutants/loci linked to hereditary hydrocephalus have been identified in animal models and humans. Up to date, 9 genes associated with hydrocephalus have been identified in animal models. In contrast, only one such gene has been identified in humans. Most of known hydrocephalus gene products are the important cytokines, growth factors or related molecules in the cellular signal pathways during early brain development. The current molecular genetic evidence from animal models indicate that in the early development stage, impaired and abnormal brain development caused by abnormal cellular signaling and functioning, all these cellular and developmental events would eventually lead to the congenital hydrocephalus. Owing to our very primitive knowledge of the genetics and molecular pathogenesis of human hydrocephalus, it is difficult to evaluate whether data gained from animal models can be extrapolated to humans. Initiation of a large population genetics study in humans will certainly provide invaluable information about the molecular and cellular etiology and the developmental mechanisms of human

  5. Socioeconomic status and genetic influences on cognitive development.

    Science.gov (United States)

    Figlio, David N; Freese, Jeremy; Karbownik, Krzysztof; Roth, Jeffrey

    2017-12-19

    Accurate understanding of environmental moderation of genetic influences is vital to advancing the science of cognitive development as well as for designing interventions. One widely reported idea is increasing genetic influence on cognition for children raised in higher socioeconomic status (SES) families, including recent proposals that the pattern is a particularly US phenomenon. We used matched birth and school records from Florida siblings and twins born in 1994-2002 to provide the largest, most population-diverse consideration of this hypothesis to date. We found no evidence of SES moderation of genetic influence on test scores, suggesting that articulating gene-environment interactions for cognition is more complex and elusive than previously supposed.

  6. Pathway analysis of GWAS provides new insights into genetic susceptibility to 3 inflammatory diseases.

    Directory of Open Access Journals (Sweden)

    Hariklia Eleftherohorinou

    2009-11-01

    Full Text Available Although the introduction of genome-wide association studies (GWAS have greatly increased the number of genes associated with common diseases, only a small proportion of the predicted genetic contribution has so far been elucidated. Studying the cumulative variation of polymorphisms in multiple genes acting in functional pathways may provide a complementary approach to the more common single SNP association approach in understanding genetic determinants of common disease. We developed a novel pathway-based method to assess the combined contribution of multiple genetic variants acting within canonical biological pathways and applied it to data from 14,000 UK individuals with 7 common diseases. We tested inflammatory pathways for association with Crohn's disease (CD, rheumatoid arthritis (RA and type 1 diabetes (T1D with 4 non-inflammatory diseases as controls. Using a variable selection algorithm, we identified variants responsible for the pathway association and evaluated their use for disease prediction using a 10 fold cross-validation framework in order to calculate out-of-sample area under the Receiver Operating Curve (AUC. The generalisability of these predictive models was tested on an independent birth cohort from Northern Finland. Multiple canonical inflammatory pathways showed highly significant associations (p 10(-3-10(-20 with CD, T1D and RA. Variable selection identified on average a set of 205 SNPs (149 genes for T1D, 350 SNPs (189 genes for RA and 493 SNPs (277 genes for CD. The pattern of polymorphisms at these SNPS were found to be highly predictive of T1D (91% AUC and RA (85% AUC, and weakly predictive of CD (60% AUC. The predictive ability of the T1D model (without any parameter refitting had good predictive ability (79% AUC in the Finnish cohort. Our analysis suggests that genetic contribution to common inflammatory diseases operates through multiple genes interacting in functional pathways.

  7. Improving your genetic literacy in epilepsy-A new series.

    Science.gov (United States)

    Tan, Nigel C K; Lowenstein, Daniel H

    2015-11-01

    Advances in epilepsy genetics have been rapid, and it is challenging for clinicians on the ground to keep pace with these advances. The International League Against Epilepsy (ILAE) Genetics Commission has thus crafted a new Genetic Literacy series targeted at busy clinicians. Our goal is to help provide a concise, accessible resource on epilepsy genetics for the busy, on-the-ground clinician so that he/she can apply that knowledge at point-of-care to help patients. This new series is grounded in educational theories and evidence to ensure that learning is effective and efficient. We hope that by promoting and encouraging continuing medical education in epilepsy genetics, this eventually translates to better patient management and therefore better patient health outcomes. Wiley Periodicals, Inc. © 2015 International League Against Epilepsy.

  8. 'Faceness' and affectivity: evidence for genetic contributions to distinct components of electrocortical response to human faces.

    Science.gov (United States)

    Shannon, Robert W; Patrick, Christopher J; Venables, Noah C; He, Sheng

    2013-12-01

    The ability to recognize a variety of different human faces is undoubtedly one of the most important and impressive functions of the human perceptual system. Neuroimaging studies have revealed multiple brain regions (including the FFA, STS, OFA) and electrophysiological studies have identified differing brain event-related potential (ERP) components (e.g., N170, P200) possibly related to distinct types of face information processing. To evaluate the heritability of ERP components associated with face processing, including N170, P200, and LPP, we examined ERP responses to fearful and neutral face stimuli in monozygotic (MZ) and dizygotic (DZ) twins. Concordance levels for early brain response indices of face processing (N170, P200) were found to be stronger for MZ than DZ twins, providing evidence of a heritable basis to each. These findings support the idea that certain key neural mechanisms for face processing are genetically coded. Implications for understanding individual differences in recognition of facial identity and the emotional content of faces are discussed. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. The Talking Neanderthals: What Do Fossils, Genetics, and Archeology Say?

    Directory of Open Access Journals (Sweden)

    Sverker Johansson

    2013-02-01

    Full Text Available Did Neanderthals have language? This issue has been debated back and forth for decades, without resolution. But in recent years new evidence has become available. New fossils and archeological finds cast light on relevant Neanderthal anatomy and behavior. New DNA evidence, both fossil and modern, provides clues both to the relationship between Neanderthals and Homo sapiens, and to the genetics of language. In this paper, I review and evaluate the available evidence. My conclusion is that the preponderance of the evidence supports the presence of some form of language in Neanderthals.

  10. Translation and Adaptation of the Genetic Counselling Outcome Scale (GCOS-24) for Use in Denmark

    DEFF Research Database (Denmark)

    Diness, Birgitte Rode; Overbeck, Gritt; Hjortshøj, Tina Duelund

    2017-01-01

    Outcome measurement in clinical genetics is challenging. Robust outcome measures are needed to provide evidence to support service development within genetic counseling. The Genetic Counselling Outcome Scale (GCOS-24), a Patient Reported Outcome Measure (PROM), was developed in English...... and validated with clinical genetics patients in the British NHS. This study reports the translation and adaptation of the GCOS-24 for use in Denmark. GCOS-24 was translated and back translated, supervised by an expert committee. Feedback on the first version was collected from genetic counseling patients...

  11. Genetic evidence for the association between the early growth response 3 (EGR3 gene and schizophrenia.

    Directory of Open Access Journals (Sweden)

    Rui Zhang

    Full Text Available Recently, two genome scan meta-analysis studies have found strong evidence for the association of loci on chromosome 8p with schizophrenia. The early growth response 3 (EGR3 gene located in chromosome 8p21.3 was also found to be involved in the etiology of schizophrenia. However, subsequent studies failed to replicate this finding. To investigate the genetic role of EGR3 in Chinese patients, we genotyped four SNPs (average interval ∼2.3 kb in the chromosome region of EGR3 in 470 Chinese schizophrenia patients and 480 healthy control subjects. The SNP rs35201266 (located in intron 1 of EGR3 showed significant differences between cases and controls in both genotype frequency distribution (P = 0.016 and allele frequency distribution (P = 0.009. Analysis of the haplotype rs35201266-rs3750192 provided significant evidence for association with schizophrenia (P = 0.0012; a significant difference was found for the common haplotype AG (P = 0.0005. Furthermore, significant associations were also found in several other two-, and three-SNP tests of haplotype analyses. The meta-analysis revealed a statistically significant association between rs35201266 and schizophrenia (P = 0.0001. In summary, our study supports the association of EGR3 with schizophrenia in our Han Chinese sample, and further functional exploration of the EGR3 gene will contribute to the molecular basis for the complex network underlying schizophrenia pathogenesis.

  12. Two decades of genetic profiling yields first evidence of natal philopatry and long-term fidelity to parturition sites in sharks

    KAUST Repository

    Feldheim, Kevin Andrew

    2013-12-09

    Sharks are a globally threatened group of marine fishes that often breed in their natal region of origin. There has even been speculation that female sharks return to their exact birthplace to breed (\\'natal philopatry\\'), which would have important conservation implications. Genetic profiling of lemon sharks (Negaprion brevirostris) from 20 consecutive cohorts (1993-2012) at Bimini, Bahamas, showed that certain females faithfully gave birth at this site for nearly two decades. At least six females born in the 1993-1997 cohorts returned to give birth 14-17 years later, providing the first direct evidence of natal philopatry in the chondrichthyans. Long-term fidelity to specific nursery sites coupled with natal philopatry highlights the merits of emerging spatial and local conservation efforts for these threatened predators. © 2013 John Wiley & Sons Ltd.

  13. Low-density lipoproteins cause atherosclerotic cardiovascular disease. 1. Evidence from genetic, epidemiologic, and clinical studies. A consensus statement from the European Atherosclerosis Society Consensus Panel

    NARCIS (Netherlands)

    Ference, Brian A.; Ginsberg, Henry N.; Graham, Ian; Ray, Kausik K.; Packard, Chris J.; Bruckert, Eric; Hegele, Robert A.; Krauss, Ronald M.; Raal, Frederick J.; Schunkert, Heribert; Watts, Gerald F.; Boren, Jan; Fazio, Sergio; Horton, Jay D.; Masana, Luis; Nicholls, Stephen J.; Nordestgaard, Borge G.; van de Sluis, Bart; Taskinen, Marja-Riitta; Tokgozoglu, Lale; Landmesser, Ulf; Laufs, Ulrich; Wiklund, Olov; Stock, Jane K.; Chapman, M. John; Catapano, Alberico L.

    2017-01-01

    Aims: To appraise the clinical and genetic evidence that low-density lipoproteins (LDLs) cause atherosclerotic cardiovascular disease (ASCVD). Methods and results: We assessed whether the association between LDL and ASCVD fulfils the criteria for causality by evaluating the totality of evidence from

  14. Genetic Variance in Homophobia: Evidence from Self- and Peer Reports.

    Science.gov (United States)

    Zapko-Willmes, Alexandra; Kandler, Christian

    2018-01-01

    The present twin study combined self- and peer assessments of twins' general homophobia targeting gay men in order to replicate previous behavior genetic findings across different rater perspectives and to disentangle self-rater-specific variance from common variance in self- and peer-reported homophobia (i.e., rater-consistent variance). We hypothesized rater-consistent variance in homophobia to be attributable to genetic and nonshared environmental effects, and self-rater-specific variance to be partially accounted for by genetic influences. A sample of 869 twins and 1329 peer raters completed a seven item scale containing cognitive, affective, and discriminatory homophobic tendencies. After correction for age and sex differences, we found most of the genetic contributions (62%) and significant nonshared environmental contributions (16%) to individual differences in self-reports on homophobia to be also reflected in peer-reported homophobia. A significant genetic component, however, was self-report-specific (38%), suggesting that self-assessments alone produce inflated heritability estimates to some degree. Different explanations are discussed.

  15. Sex reduces genetic variation: a multidisciplinary review.

    Science.gov (United States)

    Gorelick, Root; Heng, Henry H Q

    2011-04-01

    For over a century, the paradigm has been that sex invariably increases genetic variation, despite many renowned biologists asserting that sex decreases most genetic variation. Sex is usually perceived as the source of additive genetic variance that drives eukaryotic evolution vis-à-vis adaptation and Fisher's fundamental theorem. However, evidence for sex decreasing genetic variation appears in ecology, paleontology, population genetics, and cancer biology. The common thread among many of these disciplines is that sex acts like a coarse filter, weeding out major changes, such as chromosomal rearrangements (that are almost always deleterious), but letting minor variation, such as changes at the nucleotide or gene level (that are often neutral), flow through the sexual sieve. Sex acts as a constraint on genomic and epigenetic variation, thereby limiting adaptive evolution. The diverse reasons for sex reducing genetic variation (especially at the genome level) and slowing down evolution may provide a sufficient benefit to offset the famed costs of sex. © 2010 The Author(s). Evolution© 2010 The Society for the Study of Evolution.

  16. Utilisation of evidence-based practices by ASD early intervention service providers.

    Science.gov (United States)

    Paynter, Jessica M; Ferguson, Sarah; Fordyce, Kathryn; Joosten, Annette; Paku, Sofia; Stephens, Miranda; Trembath, David; Keen, Deb

    2017-02-01

    A number of autism intervention practices have been demonstrated to be effective. However, the use of unsupported practices persists in community early intervention settings. Recent research has suggested that personal, professional and workplace factors may influence intervention choices. The aim of this research was to investigate knowledge and use of strategies, organisational culture, individual attitudes, sources of information and considerations informing intervention choices by early intervention providers. An online survey was completed by 72 early intervention providers from four organisations across Australia. Providers reported high levels of trust and access of information from internal professional development, therapists and external professional development. A range of considerations including child factors, family values and research were rated as important in informing intervention choices. Participants reported greater knowledge and use of evidence-based and emerging practices than unsupported. Levels of use were linked to levels of knowledge, as well as some organisational and attitudinal factors. Areas for future research and implications are discussed.

  17. Organizational Culture and Climate and Mental Health Provider Attitudes Toward Evidence-Based Practice.

    Science.gov (United States)

    Aarons, Gregory A; Sawitzky, Angelina C

    2006-02-01

    Mental health provider attitudes toward adopting evidence-based practice (EBP) are associated with organizational context and provider individual differences. Organizational culture and climate are contextual factors that can affect staff acceptance of innovation. This study examined the association of organizational culture and climate with attitudes toward adopting EBP. Participants were 301 public sector mental health service providers from 49 programs providing mental health services for youths and families. Correlation analyses and multilevel hierarchical regressions, controlling for effects of provider characteristics, showed that constructive culture was associated with more positive attitudes toward adoption of EBP and poor organizational climates with perceived divergence of usual practice and EBP. Behavioral health organizations may benefit from consideration of how culture and climate affect staff attitudes toward change in practice.

  18. A rapid evidence-based service by librarians provided information to answer primary care clinical questions.

    Science.gov (United States)

    McGowan, Jessie; Hogg, William; Rader, Tamara; Salzwedel, Doug; Worster, Danielle; Cogo, Elise; Rowan, Margo

    2010-03-01

    A librarian consultation service was offered to 88 primary care clinicians during office hours. This included a streamlined evidence-based process to answer questions in fewer than 20 min. This included a contact centre accessed through a Web-based platform and using hand-held devices and computers with Web access. Librarians were given technical training in evidence-based medicine, including how to summarise evidence. To describe the process and lessons learned from developing and operating a rapid response librarian consultation service for primary care clinicians. Evaluation included librarian interviews and a clinician exit satisfaction survey. Clinicians were positive about its impact on their clinical practice and decision making. The project revealed some important 'lessons learned' in the clinical use of hand-held devices, knowledge translation and training for clinicians and librarians. The Just-in-Time Librarian Consultation Service showed that it was possible to provide evidence-based answers to clinical questions in 15 min or less. The project overcame a number of barriers using innovative solutions. There are many opportunities to build on this experience for future joint projects of librarians and healthcare providers.

  19. Cultural transmission of tool use combined with habitat specializations leads to fine-scale genetic structure in bottlenose dolphins

    NARCIS (Netherlands)

    Kopps, Anna M.; Ackermann, Corinne Y.; Sherwin, William B.; Allen, Simon J.; Bejder, Lars; Kruetzen, Michael

    2014-01-01

    Socially learned behaviours leading to genetic population structure have rarely been described outside humans. Here, we provide evidence of fine-scale genetic structure that has probably arisen based on socially transmitted behaviours in bottlenose dolphins (Tursiops sp.) in western Shark Bay,

  20. Does a ban on informal health providers save lives? Evidence from Malawi

    Science.gov (United States)

    Godlonton, Susan; Okeke, Edward N.

    2015-01-01

    Informal health providers ranging from drug vendors to traditional healers account for a large fraction of health care provision in developing countries. They are, however, largely unlicensed and unregulated leading to concern that they provide ineffective and, in some cases, even harmful care. A new and controversial policy tool that has been proposed to alter household health seeking behavior is an outright ban on these informal providers. The theoretical effects of such a ban are ambiguous. In this paper, we study the effect of a ban on informal (traditional) birth attendants imposed by the Malawi government in 2007. To measure the effect of the ban, we use a difference-in-difference strategy exploiting variation across time and space in the intensity of exposure to the ban. Our most conservative estimates suggest that the ban decreased use of traditional attendants by about 15 percentage points. Approximately three quarters of this decline can be attributed to an increase in use of the formal sector and the remainder is accounted for by an increase in relative/friend-attended births. Despite the rather large shift from the informal to the formal sector, we do not find any evidence of a statistically significant reduction in newborn mortality on average. The results are robust to a triple difference specification using young children as a control group. We examine several explanations for this result and find evidence consistent with quality of formal care acting as a constraint on improvements in newborn health. PMID:26681821

  1. Genomic evidence for the population genetic differentiation of Misgurnus anguillicaudatus in the Yangtze River basin of China.

    Science.gov (United States)

    Yi, Shaokui; Wang, Weimin; Zhou, Xiaoyun

    2018-02-21

    Misgurnus anguillicaudatus, an important aquatic species, is mainly distributed in the Yangtze River basin. To reveal the population genetic structure of M. anguillicaudatus distributed in the Yangtze River basin, genotyping by sequencing (GBS) technique was employed to detect the genome wide genetic variations of M. anguillicaudatus. A total of 30.03 Gb raw data were yielded from 70 samples collected from 15 geographic sites located in the Yangtze River basin. Subsequently, 2092 high quality SNPs were genotyped across these samples and used for a series of genetic analysis. The results of genetic analysis showed that high levels of genetic diversity were observed and the populations from upper reaches (UR) were significantly differentiated from the middle and lower reaches (MLR) of Yangtze River basin. Meanwhile, no significant isolation by distance was detected among the populations. Ecological factors (e.g. complicated topography and climatic environment) and anthropogenic factors (e.g. aquaculture and agriculture cultivation) might account for the genetic disconnectivity between UR and MLR populations. This study provided valuable genetic data for the future breeding program and also for the conversation and scientific utilization of those abundant genetic resources stored in the Yangtze River basin. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Genetics of Alzheimer’s Disease: Lessons Learned in Two Decades

    Directory of Open Access Journals (Sweden)

    Nilüfer Ertekin Taner

    2010-03-01

    Full Text Available Alzheimer’s disease (AD is the most common type of dementia. It is estimated that more than 35 million people worldwide will suffer from dementia in 2010. Without effective therapies, this epidemic is expected to affect more than 115 million patients worldwide by 2050. Genetic studies can help us understand the disease pathophysiology, thereby providing potential therapeutic, presymptomatic predictive and preventative avenues. Since 1990, there has been evidence for a substantial genetic component underlying the risk for AD. Three genes with autosomal dominant mutations lead to early-onset familial AD, which explains less than 1% of all AD. Apolipoprotein ε4, the only widely accepted genetic risk factor for late-onset AD, accounts for only a portion of this risk. Genetic linkage and association studies have identified multiple candidate gene regions, although many resulting candidate genes suffer from lack of replication, at least partially due to underpowered studies in the setting of genetic heterogeneity and small-tomoderate effect size. Genome-wide association studies that assess hundreds of thousands of single-nucleotide polymorphisms (SNPs in thousands of subjects have been viewed as a potentially powerful approach in uncovering common risk variations for genetically complex diseases such as AD. To date, 11 independent genome-wide association studies have been completed in late-onset AD (LOAD that led to candidate regions and genes for follow-up. These studies provide evidence for novel, plausible genetic risk factors for AD, but still fail to account for all of the estimated risk. Additional genetic risk factors of even smaller effect size, rare variants and/or structural DNA polymorphisms may exist, which may escape detection by conventional methods. Alternative approaches such as nextgeneration sequencing, use of quantitative endophenotypes, copy number variation analyses, and meta-analyses may be required. This review summarizes the

  3. Genetics of Alzheimer’s Disease: Lessons Learned in Two Decades

    Directory of Open Access Journals (Sweden)

    Nilüfer Ertekin Taner

    2010-03-01

    Full Text Available Alzheimer’s disease (AD is the most common type of dementia. It is estimated that more than 35 million people worldwide will suffer from dementia in 2010. Without effective therapies, this epidemic is expected to affect more than 115 million patients worldwide by 2050. Genetic studies can help us understand the disease pathophysiology, thereby providing potential therapeutic, presymptomatic predictive and preventative avenues. Since 1990, there has been evidence for a substantial genetic component underlying the risk for AD. Three genes with autosomal dominant mutations lead to early-onset familial AD, which explains less than 1% of all AD. Apolipoprotein ε4, the only widely accepted genetic risk factor for late-onset AD, accounts for only a portion of this risk. Genetic linkage and association studies have identified multiple candidate gene regions, although many resulting candidate genes suffer from lack of replication, at least partially due to underpowered studies in the setting of genetic heterogeneity and small-tomoderate effect size. Genome-wide association studies that assess hundreds of thousands of single-nucleotide polymorphisms (SNPs in thousands of subjects have been viewed as a potentially powerful approach in uncovering common risk variations for genetically complex diseases such as AD. To date, 11 independent genome-wide association studies have been completed in late-onset AD (LOAD that led to candidate regions and genes for follow-up. These studies provide evidence for novel, plausible genetic risk factors for AD, but still fail to account for all of the estimated risk. Additional genetic risk factors of even smaller effect size, rare variants and/or structural DNA polymorphisms may exist, which may escape detection by conventional methods. Alternative approaches such as nextgeneration sequencing, use of quantitative endophenotypes, copy number variation analyses, and meta-analyses may be required. This review summarizes the

  4. Appearance traits in fish farming: progress from classical genetics to genomics, providing insight into current and potential genetic improvement

    Directory of Open Access Journals (Sweden)

    Nelson eColihueque

    2014-08-01

    Full Text Available Appearance traits in fish, those external body characteristics that influence consumer acceptance at point of sale, have come to the forefront of commercial fish farming, as culture profitability is closely linked to management of these traits. Appearance traits comprise mainly body shape and skin pigmentation. Analysis of the genetic basis of these traits in different fish reveals significant genetic variation within populations, indicating potential for their genetic improvement. Work into ascertaining the minor or major genes underlying appearance traits for commercial fish is emerging, with substantial progress in model fish in terms of identifying genes that control body shape and skin colors. In this review, we describe research progress to date, especially with regard to commercial fish, and discuss genomic findings in model fish in order to better address the genetic basis of the traits. Given that appearance traits are important in commercial fish, the genomic information related to this issue promises to accelerate the selection process in coming years.

  5. Appearance traits in fish farming: progress from classical genetics to genomics, providing insight into current and potential genetic improvement

    Science.gov (United States)

    Colihueque, Nelson; Araneda, Cristian

    2014-01-01

    Appearance traits in fish, those external body characteristics that influence consumer acceptance at point of sale, have come to the forefront of commercial fish farming, as culture profitability is closely linked to management of these traits. Appearance traits comprise mainly body shape and skin pigmentation. Analysis of the genetic basis of these traits in different fish reveals significant genetic variation within populations, indicating potential for their genetic improvement. Work into ascertaining the minor or major genes underlying appearance traits for commercial fish is emerging, with substantial progress in model fish in terms of identifying genes that control body shape and skin colors. In this review, we describe research progress to date, especially with regard to commercial fish, and discuss genomic findings in model fish in order to better address the genetic basis of the traits. Given that appearance traits are important in commercial fish, the genomic information related to this issue promises to accelerate the selection process in coming years. PMID:25140172

  6. Skin pigmentation provides evidence of convergent melanism in extinct marine reptiles.

    Science.gov (United States)

    Lindgren, Johan; Sjövall, Peter; Carney, Ryan M; Uvdal, Per; Gren, Johan A; Dyke, Gareth; Schultz, Bo Pagh; Shawkey, Matthew D; Barnes, Kenneth R; Polcyn, Michael J

    2014-02-27

    Throughout the animal kingdom, adaptive colouration serves critical functions ranging from inconspicuous camouflage to ostentatious sexual display, and can provide important information about the environment and biology of a particular organism. The most ubiquitous and abundant pigment, melanin, also has a diverse range of non-visual roles, including thermoregulation in ectotherms. However, little is known about the functional evolution of this important biochrome through deep time, owing to our limited ability to unambiguously identify traces of it in the fossil record. Here we present direct chemical evidence of pigmentation in fossilized skin, from three distantly related marine reptiles: a leatherback turtle, a mosasaur and an ichthyosaur. We demonstrate that dark traces of soft tissue in these fossils are dominated by molecularly preserved eumelanin, in intimate association with fossilized melanosomes. In addition, we suggest that contrary to the countershading of many pelagic animals, at least some ichthyosaurs were uniformly dark-coloured in life. Our analyses expand current knowledge of pigmentation in fossil integument beyond that of feathers, allowing for the reconstruction of colour over much greater ranges of extinct taxa and anatomy. In turn, our results provide evidence of convergent melanism in three disparate lineages of secondarily aquatic tetrapods. Based on extant marine analogues, we propose that the benefits of thermoregulation and/or crypsis are likely to have contributed to this melanisation, with the former having implications for the ability of each group to exploit cold environments.

  7. Do patents impede the provision of genetic tests in Australia?

    Science.gov (United States)

    Nicol, Dianne; Liddicoat, John

    2013-06-01

    Health policy and law reform agencies lack a sound evidence base of the impacts of patents on innovation and access to healthcare to assist them in their deliberations. This paper reports the results of a survey of managers of Australian genetic testing laboratories that asked a series of questions relating to the tests they perform, whether they pay to access patented inventions and whether they have received notifications from patent holders about patents associated with particular tests. Some diagnostics facilities are exposed to patent costs, but they are all located in the private sector. No public hospitals reported paying licence fees or royalties beyond those included in the price of commercial test kits. Some respondents reported having received enforcement notices from patent holders, but almost all related to the widely known breast cancer-associated patents. Respondents were also asked for their views on the most effective mechanisms to protect their ability to provide genetic tests now and in the future. Going to the media, paying licence fees, ignoring patent rights and relying on the government to take action were widely seen as most effective. Litigation and applications for compulsory licences were seen as some of the least effective mechanisms. These results provide an evidence base for development of health policy and law reform. What is known about the topic? The impact of patents on the delivery of genetic testing services remains unclear in Australia. What does this paper add? The survey reported in this paper suggests that, aside from well-known enforcement actions relating to the breast cancer associated patents, there is little evidence that providers of genetic testing services are being exposed to aggressive patent-enforcement practices. What are the implications for practitioners? Although patent-enforcement actions may increase in the future, a range of strategies are available to providers of testing services to protect them against

  8. Genetic component of flammability variation in a Mediterranean shrub.

    Science.gov (United States)

    Moreira, B; Castellanos, M C; Pausas, J G

    2014-03-01

    Recurrent fires impose a strong selection pressure in many ecosystems worldwide. In such ecosystems, plant flammability is of paramount importance because it enhances population persistence, particularly in non-resprouting species. Indeed, there is evidence of phenotypic divergence of flammability under different fire regimes. Our general hypothesis is that flammability-enhancing traits are adaptive; here, we test whether they have a genetic component. To test this hypothesis, we used the postfire obligate seeder Ulex parviflorus from sites historically exposed to different fire recurrence. We associated molecular variation in potentially adaptive loci detected with a genomic scan (using AFLP markers) with individual phenotypic variability in flammability across fire regimes. We found that at least 42% of the phenotypic variation in flammability was explained by the genetic divergence in a subset of AFLP loci. In spite of generalized gene flow, the genetic variability was structured by differences in fire recurrence. Our results provide the first field evidence supporting that traits enhancing plant flammability have a genetic component and thus can be responding to natural selection driven by fire. These results highlight the importance of flammability as an adaptive trait in fire-prone ecosystems. © 2014 John Wiley & Sons Ltd.

  9. Coordinated vigilance provides evidence for direct reciprocity in coral reef fishes.

    Science.gov (United States)

    Brandl, Simon J; Bellwood, David R

    2015-09-25

    Reciprocity is frequently assumed to require complex cognitive abilities. Therefore, it has been argued that reciprocity may be restricted to animals that can meet these demands. Here, we provide evidence for the potential presence of direct reciprocity in teleost fishes. We demonstrate that in pairs of coral reef rabbitfishes (f. Siganidae), one fish frequently assumes an upright vigilance position in the water column, while the partner forages in small crevices in the reef substratum. Both behaviours are strongly coordinated and partners regularly alternate their positions, resulting in a balanced distribution of foraging activity. Compared to solitary individuals, fishes in pairs exhibit longer vigilance bouts, suggesting that the help provided to the partner is costly. In turn, fishes in pairs take more consecutive bites and penetrate deeper into crevices than solitary individuals, suggesting that the safety provided by a vigilant partner may outweigh initial costs by increasing foraging efficiency. Thus, the described system appears to meet all of the requirements for direct reciprocity. We argue that the nature of rabbitfish pairs provides favourable conditions for the establishment of direct reciprocity, as continuous interaction with the same partner, simultaneous needs, interdependence, and communication relax the cognitive demands of reciprocal cooperation.

  10. Comorbidity of Alcohol Use Disorder and Chronic Pain: Genetic Influences on Brain Reward and Stress Systems.

    Science.gov (United States)

    Yeung, Ellen W; Craggs, Jason G; Gizer, Ian R

    2017-11-01

    Alcohol use disorder (AUD) is highly comorbid with chronic pain (CP). Evidence has suggested that neuroadaptive processes characterized by reward deficit and stress surfeit are involved in the development of AUD and pain chronification. Neurological data suggest that shared genetic architecture associated with the reward and stress systems may contribute to the comorbidity of AUD and CP. This monograph first delineates the prevailing theories of the development of AUD and pain chronification focusing on the reward and stress systems. It then provides a brief summary of relevant neurological findings followed by an evaluation of evidence documented by molecular genetic studies. Candidate gene association studies have provided some initial support for the genetic overlap between AUD and CP; however, these results must be interpreted with caution until studies with sufficient statistical power are conducted and replications obtained. Genomewide association studies have suggested a number of genes (e.g., TBX19, HTR7, and ADRA1A) that are either directly or indirectly related to the reward and stress systems in the AUD and CP literature. Evidence reviewed in this monograph suggests that shared genetic liability underlying the comorbidity between AUD and CP, if present, is likely to be complex. As the advancement in molecular genetic methods continues, future studies may show broader central nervous system involvement in AUD-CP comorbidity. Copyright © 2017 by the Research Society on Alcoholism.

  11. NCI Dictionary of Genetics Terms

    Science.gov (United States)

    A dictionary of more than 150 genetics-related terms written for healthcare professionals. This resource was developed to support the comprehensive, evidence-based, peer-reviewed PDQ cancer genetics information summaries.

  12. Selfish genetic elements, genetic conflict, and evolutionary innovation.

    Science.gov (United States)

    Werren, John H

    2011-06-28

    Genomes are vulnerable to selfish genetic elements (SGEs), which enhance their own transmission relative to the rest of an individual's genome but are neutral or harmful to the individual as a whole. As a result, genetic conflict occurs between SGEs and other genetic elements in the genome. There is growing evidence that SGEs, and the resulting genetic conflict, are an important motor for evolutionary change and innovation. In this review, the kinds of SGEs and their evolutionary consequences are described, including how these elements shape basic biological features, such as genome structure and gene regulation, evolution of new genes, origin of new species, and mechanisms of sex determination and development. The dynamics of SGEs are also considered, including possible "evolutionary functions" of SGEs.

  13. Insights into the genetic foundations of human communication.

    Science.gov (United States)

    Graham, Sarah A; Deriziotis, Pelagia; Fisher, Simon E

    2015-03-01

    The human capacity to acquire sophisticated language is unmatched in the animal kingdom. Despite the discontinuity in communicative abilities between humans and other primates, language is built on ancient genetic foundations, which are being illuminated by comparative genomics. The genetic architecture of the language faculty is also being uncovered by research into neurodevelopmental disorders that disrupt the normally effortless process of language acquisition. In this article, we discuss the strategies that researchers are using to reveal genetic factors contributing to communicative abilities, and review progress in identifying the relevant genes and genetic variants. The first gene directly implicated in a speech and language disorder was FOXP2. Using this gene as a case study, we illustrate how evidence from genetics, molecular cell biology, animal models and human neuroimaging has converged to build a picture of the role of FOXP2 in neurodevelopment, providing a framework for future endeavors to bridge the gaps between genes, brains and behavior.

  14. Genetic and educational assortative mating among US adults.

    Science.gov (United States)

    Domingue, Benjamin W; Fletcher, Jason; Conley, Dalton; Boardman, Jason D

    2014-06-03

    Understanding the social and biological mechanisms that lead to homogamy (similar individuals marrying one another) has been a long-standing issue across many fields of scientific inquiry. Using a nationally representative sample of non-Hispanic white US adults from the Health and Retirement Study and information from 1.7 million single-nucleotide polymorphisms, we compare genetic similarity among married couples to noncoupled pairs in the population. We provide evidence for genetic assortative mating in this population but the strength of this association is substantially smaller than the strength of educational assortative mating in the same sample. Furthermore, genetic similarity explains at most 10% of the assortative mating by education levels. Results are replicated using comparable data from the Framingham Heart Study.

  15. Genetic Evidence for Elevated Pathogenicity of Mitochondrial DNA Heteroplasmy in Autism Spectrum Disorder.

    Directory of Open Access Journals (Sweden)

    Yiqin Wang

    2016-10-01

    Full Text Available Increasing clinical and biochemical evidence implicate mitochondrial dysfunction in the pathophysiology of Autism Spectrum Disorder (ASD, but little is known about the biological basis for this connection. A possible cause of ASD is the genetic variation in the mitochondrial DNA (mtDNA sequence, which has yet to be thoroughly investigated in large genomic studies of ASD. Here we evaluated mtDNA variation, including the mixture of different mtDNA molecules in the same individual (i.e., heteroplasmy, using whole-exome sequencing data from mother-proband-sibling trios from simplex families (n = 903 where only one child is affected by ASD. We found that heteroplasmic mutations in autistic probands were enriched at non-polymorphic mtDNA sites (P = 0.0015, which were more likely to confer deleterious effects than heteroplasmies at polymorphic mtDNA sites. Accordingly, we observed a ~1.5-fold enrichment of nonsynonymous mutations (P = 0.0028 as well as a ~2.2-fold enrichment of predicted pathogenic mutations (P = 0.0016 in autistic probands compared to their non-autistic siblings. Both nonsynonymous and predicted pathogenic mutations private to probands conferred increased risk of ASD (Odds Ratio, OR[95% CI] = 1.87[1.14-3.11] and 2.55[1.26-5.51], respectively, and their influence on ASD was most pronounced in families with probands showing diminished IQ and/or impaired social behavior compared to their non-autistic siblings. We also showed that the genetic transmission pattern of mtDNA heteroplasmies with high pathogenic potential differed between mother-autistic proband pairs and mother-sibling pairs, implicating developmental and possibly in utero contributions. Taken together, our genetic findings substantiate pathogenic mtDNA mutations as a potential cause for ASD and synergize with recent work calling attention to their unique metabolic phenotypes for diagnosis and treatment of children with ASD.

  16. The Tourette International Collaborative Genetics (TIC Genetics) study, finding the genes causing Tourette syndrome

    DEFF Research Database (Denmark)

    Dietrich, Andrea; Fernandez, Thomas V; King, Robert A

    2015-01-01

    Tourette syndrome (TS) is a neuropsychiatric disorder characterized by recurrent motor and vocal tics, often accompanied by obsessive-compulsive disorder and/or attention-deficit/hyperactivity disorder. While the evidence for a genetic contribution is strong, its exact nature has yet to be clarif......Tourette syndrome (TS) is a neuropsychiatric disorder characterized by recurrent motor and vocal tics, often accompanied by obsessive-compulsive disorder and/or attention-deficit/hyperactivity disorder. While the evidence for a genetic contribution is strong, its exact nature has yet......, it is clear that large patient cohorts and open-access repositories will be essential to further advance the field. To that end, the large multicenter Tourette International Collaborative Genetics (TIC Genetics) study was established. The goal of the TIC Genetics study is to undertake a comprehensive gene...... discovery effort, focusing both on familial genetic variants with large effects within multiply affected pedigrees and on de novo mutations ascertained through the analysis of apparently simplex parent-child trios with non-familial tics. The clinical data and biomaterials (DNA, transformed cell lines, RNA...

  17. Genetic risk from diagnostic X-ray procedures

    International Nuclear Information System (INIS)

    Stephan, G.

    1980-01-01

    This essay introduces epidemiologic studies concerned with the question whether diagnostic X-ray procedures might be the cause of an increased genetic risk. All studies have selected Down's syndrome (mongolism) as genetic indicator. They indiscriminately present the opinion of the respective author. Approximately one half of the studies conclude that radiation exposure will not influence the spontaneous incidence of Down's syndrome in diagnostics, the other half finds a positive relationship between frequent radiation exposure and the incidence of the syndrome. For various reasons, explained in detail, the results of the studies under discussion are suitable for forming hypotheses, but should not be viewed as providing evidence. (orig.) [de

  18. Genetic discrimination: international perspectives.

    Science.gov (United States)

    Otlowski, M; Taylor, S; Bombard, Y

    2012-01-01

    Genetic discrimination (GD) is a complex, multifaceted ethical, psychosocial, and legal phenomenon. It is defined as the differential treatment of asymptomatic individuals or their relatives on the basis of their real or assumed genetic characteristics. This article presents an overview of GD within the contemporary international context. It describes the concept of GD and its contextual features, reviews research evidence regarding people's experiences of GD and the impact of GD within a range of domains, and provides an overview of legal and policy responses to GD that have emerged globally. We argue that GD is a significant and internationally established phenomenon that requires multilevel responses to ensure social justice and equitable outcomes for all citizens. Future research should monitor GD and its impacts within the community as well as institutions and should evaluate the effectiveness of legislative, policy, community education, and systemic responses.

  19. Imaging Genetics and Genomics in Psychiatry: A Critical Review of Progress and Potential.

    Science.gov (United States)

    Bogdan, Ryan; Salmeron, Betty Jo; Carey, Caitlin E; Agrawal, Arpana; Calhoun, Vince D; Garavan, Hugh; Hariri, Ahmad R; Heinz, Andreas; Hill, Matthew N; Holmes, Andrew; Kalin, Ned H; Goldman, David

    2017-08-01

    Imaging genetics and genomics research has begun to provide insight into the molecular and genetic architecture of neural phenotypes and the neural mechanisms through which genetic risk for psychopathology may emerge. As it approaches its third decade, imaging genetics is confronted by many challenges, including the proliferation of studies using small sample sizes and diverse designs, limited replication, problems with harmonization of neural phenotypes for meta-analysis, unclear mechanisms, and evidence that effect sizes may be more modest than originally posited, with increasing evidence of polygenicity. These concerns have encouraged the field to grow in many new directions, including the development of consortia and large-scale data collection projects and the use of novel methods (e.g., polygenic approaches, machine learning) that enhance the quality of imaging genetic studies but also introduce new challenges. We critically review progress in imaging genetics and offer suggestions and highlight potential pitfalls of novel approaches. Ultimately, the strength of imaging genetics and genomics lies in their translational and integrative potential with other research approaches (e.g., nonhuman animal models, psychiatric genetics, pharmacologic challenge) to elucidate brain-based pathways that give rise to the vast individual differences in behavior as well as risk for psychopathology. Copyright © 2017 Society of Biological Psychiatry. All rights reserved.

  20. No evidence for female discrimination against male house mice carrying a selfish genetic element.

    Science.gov (United States)

    Sutter, Andreas; Lindholm, Anna K

    2016-12-01

    Meiotic drivers distort transmission to the next generation in their favor, with detrimental effects on the fitness of their homologues and the rest of the genome. Male carriers of meiotic drivers commonly inflict costs on their mates through genetic incompatibility, reduced fecundity, or biased brood sex ratios. Given these costs, evidence for female discrimination against male carriers is surprisingly rare. One of few examples is the t haplotype in house mice, a meiotic driver that shows strong transmission distortion in males and is typically homozygote lethal. As a consequence, mating between 2 t heterozygous (+/ t ) mice leads to high embryo mortality. Previous experiments showing that +/ t females avoid this incompatibility cost by preferring +/+ versus +/ t males have inferred preference based on olfactory cues or brief social interactions. Evidence from mating contexts in laboratory settings and semi-natural populations has been inconclusive. Here, we investigated female choice from a large number of no-choice mating trials. We found no evidence for discrimination against +/ t males based on mating, remating, and copulatory behavior. Further, we found no evidence for avoidance of incompatibility through selective interactions between gametes. The likelihood of mating showed significant effects of female weight and genotype, suggesting that our test paradigm enabled females to exhibit mate choice. We discuss the strengths and limitations of our approach. By explicitly considering selection at both the individual and gene level, we argue why precopulatory female discrimination by +/ t females may be less evolutionarily stable than discrimination by all females based on postcopulatory mechanisms.

  1. Genetic structure of populations of whale sharks among ocean basins and evidence for their historic rise and recent decline

    KAUST Repository

    Vignaud, Thomas M.

    2014-05-01

    This study presents genetic evidence that whale sharks, Rhincodon typus, are comprised of at least two populations that rarely mix and is the first to document a population expansion. Relatively high genetic structure is found when comparing sharks from the Gulf of Mexico with sharks from the Indo-Pacific. If mixing occurs between the Indian and Atlantic Oceans, it is not sufficient to counter genetic drift. This suggests whale sharks are not all part of a single global metapopulation. The significant population expansion we found was indicated by both microsatellite and mitochondrial DNA. The expansion may have happened during the Holocene, when tropical species could expand their range due to sea-level rise, eliminating dispersal barriers and increasing plankton productivity. However, the historic trend of population increase may have reversed recently. Declines in genetic diversity are found for 6 consecutive years at Ningaloo Reef in Australia. The declines in genetic diversity being seen now in Australia may be due to commercial-scale harvesting of whale sharks and collision with boats in past decades in other countries in the Indo-Pacific. The study findings have implications for models of population connectivity for whale sharks and advocate for continued focus on effective protection of the world\\'s largest fish at multiple spatial scales. © 2014 John Wiley & Sons Ltd.

  2. Genetic structure of populations of whale sharks among ocean basins and evidence for their historic rise and recent decline.

    Science.gov (United States)

    Vignaud, Thomas M; Maynard, Jeffrey A; Leblois, Raphael; Meekan, Mark G; Vázquez-Juárez, Ricardo; Ramírez-Macías, Dení; Pierce, Simon J; Rowat, David; Berumen, Michael L; Beeravolu, Champak; Baksay, Sandra; Planes, Serge

    2014-05-01

    This study presents genetic evidence that whale sharks, Rhincodon typus, are comprised of at least two populations that rarely mix and is the first to document a population expansion. Relatively high genetic structure is found when comparing sharks from the Gulf of Mexico with sharks from the Indo-Pacific. If mixing occurs between the Indian and Atlantic Oceans, it is not sufficient to counter genetic drift. This suggests whale sharks are not all part of a single global metapopulation. The significant population expansion we found was indicated by both microsatellite and mitochondrial DNA. The expansion may have happened during the Holocene, when tropical species could expand their range due to sea-level rise, eliminating dispersal barriers and increasing plankton productivity. However, the historic trend of population increase may have reversed recently. Declines in genetic diversity are found for 6 consecutive years at Ningaloo Reef in Australia. The declines in genetic diversity being seen now in Australia may be due to commercial-scale harvesting of whale sharks and collision with boats in past decades in other countries in the Indo-Pacific. The study findings have implications for models of population connectivity for whale sharks and advocate for continued focus on effective protection of the world's largest fish at multiple spatial scales. © 2014 John Wiley & Sons Ltd.

  3. Molecular genetic studies of natives on Easter Island: evidence of an early European and Amerindian contribution to the Polynesian gene pool.

    Science.gov (United States)

    Lie, B A; Dupuy, B M; Spurkland, A; Fernández-Viña, M A; Hagelberg, E; Thorsby, E

    2007-01-01

    Most archaeological and linguistic evidence suggest a Polynesian origin of the population of Easter Island (Rapanui), and this view has been supported by the identification of Polynesian mitochondrial DNA (mtDNA) polymorphisms in prehistoric skeletal remains. However, some evidence of an early South American contact also exists (the sweet potato, bottle gourd etc.), but genetic studies have so far failed to show an early Amerindian contribution to the gene pool on Easter Island. To address this issue, we analyzed mtDNA and Y chromosome markers and performed high-resolution human leukocyte antigen (HLA) genotyping of DNA harvested from previously collected sera of 48 reputedly nonadmixed native Easter Islanders. All individuals carried mtDNA types and HLA alleles previously found in Polynesia, and most men carried Y chromosome markers of Polynesian origin, providing further evidence of a Polynesian origin of the population of Easter Island. A few individuals carried HLA alleles and/or Y chromosome markers of European origin. More interestingly, some individuals carried the HLA alleles A*0212 and B*3905, which are of typical Amerindian origin. The genealogy of some of the individuals carrying these non-Polynesian HLA alleles and their haplotypic backgrounds suggest an introduction into Easter Island in the early 1800s, or earlier. Thus, there may have been an early European and Amerindian contribution to the Polynesian gene pool of Easter Island.

  4. Measuring Provider Attitudes Toward Evidence-Based Practice: Consideration of Organizational Context and Individual Differences

    OpenAIRE

    Aarons, Gregory A.

    2005-01-01

    Mental health provider attitudes toward adoption of innovation in general, and toward evidence-based practice (EBP) in particular, are important in considering how best to disseminate and implement EBPs. This article first explores the role of attitudes in acceptance of innovation and proposes a model of organizational and individual factors that may affect or be affected by attitudes toward adoption of EBP. Next, a recently developed measure of mental health provider attitudes toward adoptio...

  5. Resequencing data provide no evidence for a human bottleneck in Africa during the penultimate glacial period.

    Science.gov (United States)

    Sjödin, Per; E Sjöstrand, Agnès; Jakobsson, Mattias; Blum, Michael G B

    2012-07-01

    Based on the accumulation of genetic, climatic, and fossil evidence, a central theory in paleoanthropology stipulates that a demographic bottleneck coincided with the origin of our species Homo Sapiens. This theory proposes that anatomically modern humans--which were only present in Africa at the time--experienced a drastic bottleneck during the penultimate glacial age (130-190 kya) when a cold and dry climate prevailed. Two scenarios have been proposed to describe the bottleneck, which involve either a fragmentation of the range occupied by humans or the survival of one small group of humans. Here, we analyze DNA sequence data from 61 nuclear loci sequenced in three African populations using Approximate Bayesian Computation and numerical simulations. In contrast to the bottleneck theory, we show that a simple model without any bottleneck during the penultimate ice age has the greatest statistical support compared with bottleneck models. Although the proposed bottleneck is ancient, occurring at least 130 kya, we can discard the possibility that it did not leave detectable footprints in the DNA sequence data except if the bottleneck involves a less than a 3-fold reduction in population size. Finally, we confirm that a simple model without a bottleneck is able to reproduce the main features of the observed patterns of genetic variation. We conclude that models of Pleistocene refugium for modern human origins now require substantial revision.

  6. Genetic variability of the tokay gecko based on mitochondrial and nuclear DNA.

    Science.gov (United States)

    Wang, Gaochao; Gong, Shu; Jiang, Lichun; Peng, Rui; Shan, Xiang; Zou, Dandan; Yang, Chengzhong; Zou, Fangdong

    2013-10-01

    With largely allopatric distribution, the black tokay and the red tokay are two distinct morphs of the subspecies Gekko gecko gecko. In consideration of their different morphological characteristics, the taxonomic status of G. g. gecko is disputed. Through detailed morphological comparison, it has been proposed that the black tokay should be elevated to species ranking, but without strong genetic evidence. In order to further investigate the taxonomic status of the tokay gecko (G. gecko), we used one mitochondrial marker (ND2) and three nuclear markers (RAG1, c-mos, and ITS2) to explore the phylogenetic and taxonomic relationship of the tokay gecko. Our results revealed a deep phylogeographical divergence in tokay gecko and at the same time provided us with the evidence of possible introgressive hybridization or/and incomplete lineage sorting between the black tokay and the red tokay. The elevation of the black tokay to species level is also supported by our results. However, due to limited sampling and genetic data, this elevation should be further corroborated by more genetic evidence.

  7. The Evidence Against Learnability of Early Motor Skills Reconsidered.

    Science.gov (United States)

    Razel, Micha

    This paper attempts to refute the assumption that early motor development is determined genetically and is not influenced by environmental factors. The paper re-examines three studies which are consistently cited as providing evidence for a maturational theory of motor development: the "early training study" by Gesell and Thompson, the "swaddling…

  8. Population Genetic Status of the Western Indian Ocean: What do we ...

    African Journals Online (AJOL)

    The Western Indian Ocean (WIO) is faced with increasing evidence of degradation and effective management initiatives are needed to curtail the environmental decline. The management of the WIO region can therefore benefit from the information that population genetics can provide. Extensive literature searches revealed ...

  9. Mutational analyses of molecularly cloned satellite tobacco mosaic virus during serial passage in plants: Evidence for hotspots of genetic change

    Science.gov (United States)

    Kurath, G.; Dodds, J.A.

    1995-01-01

    The high level of genetic diversity and rapid evolution of viral RNA genomes are well documented, but few studies have characterized the rate and nature of ongoing genetic change over time under controlled experimental conditions, especially in plant hosts. The RNA genome of satellite tobacco mosaic virus (STMV) was used as an effective model for such studies because of advantageous features of its genome structure and because the extant genetic heterogeneity of STMV has been characterized previously. In the present study, the process of genetic change over time was studied by monitoring multiple serial passage lines of STMV populations for changes in their consensus sequences. A total of 42 passage lines were initiated by inoculation of tobacco plants with a helper tobamovirus and one of four STMV RNA inocula that were transcribed from full-length infectious STMV clones or extracted from purified STMV type strain virions. Ten serial passages were carried out for each line and the consensus genotypes of progeny STMV populations were assessed for genetic change by RNase protection analyses of the entire 1,059-nt STMV genome. Three different types of genetic change were observed, including the fixation of novel mutations in 9 of 42 lines, mutation at the major heterogeneity site near nt 751 in 5 of the 19 lines inoculated with a single genotype, and selection of a single major genotype in 6 of the 23 lines inoculated with mixed genotypes. Sequence analyses showed that the majority of mutations were single base substitutions. The distribution of mutation sites included three clusters in which mutations occurred at or very near the same site, suggesting hot spots of genetic change in the STMV genome. The diversity of genetic changes in sibling lines is clear evidence for the important role of chance and random sampling events in the process of genetic diversification of STMV virus populations.

  10. Genetic diversity in Trichomonas vaginalis.

    Science.gov (United States)

    Meade, John C; Carlton, Jane M

    2013-09-01

    Recent advances in genetic characterisation of Trichomonas vaginalis isolates show that the extensive clinical variability in trichomoniasis and its disease sequelae are matched by significant genetic diversity in the organism itself, suggesting a connection between the genetic identity of isolates and their clinical manifestations. Indeed, a high degree of genetic heterogeneity in T vaginalis isolates has been observed using multiple genotyping techniques. A unique two-type population structure that is both local and global in distribution has been identified, and there is evidence of recombination within each group, although sexual recombination between the groups appears to be constrained. There is conflicting evidence in these studies for correlations between T vaginalis genetic identity and clinical presentation, metronidazole susceptibility, and the presence of T vaginalis virus, underscoring the need for adoption of a common standard for genotyping the parasite. Moving forward, microsatellite genotyping and multilocus sequence typing are the most robust techniques for future investigations of T vaginalis genotype-phenotype associations.

  11. Genetic diversity of Ascaris in southwestern Uganda

    DEFF Research Database (Denmark)

    Betson, Martha; Nejsum, Peter; Llewellyn-Hughes, Julia

    2012-01-01

    . Microsatellite analysis using eight loci provided evidence for high gene flow between worm populations from the two villages but comparing these worms with others obtained in a prior study on Unguja, Zanzibar, confirmed little genetic exchange and mixing of worm populations between the two areas. By adding......Despite the common occurrence of ascariasis in southwestern Uganda, helminth control in the region has been limited. To gain further insights into the genetic diversity of Ascaris in this area, a parasitological survey in mothers (n=41) and children (n=74) living in two villages, Habutobere...... and Musezero, was carried out. Adult Ascaris worms were collected from infected individuals by chemo-expulsion using pyrantel pamoate treatment. Genetic diversity within these worms was assessed by inspection of DNA sequence variation in a mitochondrial marker and length polymorphism at microsatellite loci...

  12. The genetic prehistory of the Baltic Sea region.

    Science.gov (United States)

    Mittnik, Alissa; Wang, Chuan-Chao; Pfrengle, Saskia; Daubaras, Mantas; Zariņa, Gunita; Hallgren, Fredrik; Allmäe, Raili; Khartanovich, Valery; Moiseyev, Vyacheslav; Tõrv, Mari; Furtwängler, Anja; Andrades Valtueña, Aida; Feldman, Michal; Economou, Christos; Oinonen, Markku; Vasks, Andrejs; Balanovska, Elena; Reich, David; Jankauskas, Rimantas; Haak, Wolfgang; Schiffels, Stephan; Krause, Johannes

    2018-01-30

    While the series of events that shaped the transition between foraging societies and food producers are well described for Central and Southern Europe, genetic evidence from Northern Europe surrounding the Baltic Sea is still sparse. Here, we report genome-wide DNA data from 38 ancient North Europeans ranging from ~9500 to 2200 years before present. Our analysis provides genetic evidence that hunter-gatherers settled Scandinavia via two routes. We reveal that the first Scandinavian farmers derive their ancestry from Anatolia 1000 years earlier than previously demonstrated. The range of Mesolithic Western hunter-gatherers extended to the east of the Baltic Sea, where these populations persisted without gene-flow from Central European farmers during the Early and Middle Neolithic. The arrival of steppe pastoralists in the Late Neolithic introduced a major shift in economy and mediated the spread of a new ancestry associated with the Corded Ware Complex in Northern Europe.

  13. An investigation of the genetic toxicology of irradiated foodstuffs using short-term systems

    International Nuclear Information System (INIS)

    Phillips, B.J.; Kranz, E.; Elias, P.S.; Muenzner, R.

    1980-01-01

    The genetic toxicology of irradiated foodstuffs has been investigated by the use of a battery of short-term tests for genetic damage. Appropriate methods are discussed for the preparation of food samples for testing by techniques involving micro-organisms and mammalian cells in culture. A new method of sample preparation by enzymatic digestion in vitro is described and its use in the testing of three irradiated foodstuffs by the Salmonella typhimurium reverse mutation test is reported. The results of the mutation tests provide further evidence of the lack of genetic toxicity of irradiated foods. (author)

  14. Retinoblastoma and the Genetic Theory of Cancer: An Old Paradigm Trying to Survive to the Evidence

    International Nuclear Information System (INIS)

    Mastrangelo, D.; Lore, C.; Hadjistilianou, T.; De Francesco, S.

    2009-01-01

    Retinoblastoma (Rb) is considered to represent the prototype of cancer linked to the sequential loss or inactivation of both alleles of a so-called “tumor suppressor gene”, the Rb1 gene. The pathogenetic mechanism behind this tumor was first hypothesized by Knudson in 1971 and further confirmed by others who identified the Rb1 gene whose loss or inactivation was claimed to be responsible for the disease. However, after about four decades of continuous research in the field of molecular biology, the evidence behind the role of the Rb1 gene in Rb appears to be seriously flawed in the light of epidemiological, biological, and clinical evidences. This editorial summarizes the inconsistencies on this subject. Nevertheless, the molecular biology establishment still adheres to the biased view of the genetic origin of Rb and other cancers, and hardly any alternative explanations are taken into account.

  15. Molecular genetic evidence for the place of origin of the Pacific rat, Rattus exulans.

    Directory of Open Access Journals (Sweden)

    Vicki Thomson

    Full Text Available Commensal plants and animals have long been used to track human migrations, with Rattus exulans (the Pacific rat a common organism for reconstructing Polynesian dispersal in the Pacific. However, with no knowledge of the homeland of R. exulans, the place of origin of this human-commensal relationship is unknown. We conducted a mitochondrial DNA phylogeographic survey of R. exulans diversity across the potential natural range in mainland and Island Southeast Asia in order to establish the origin of this human-commensal dyad. We also conducted allozyme electrophoresis on samples from ISEA to obtain a perspective on patterns of genetic diversity in this critical region. Finally, we compared molecular genetic evidence with knowledge of prehistoric rodent faunas in mainland and ISEA. We find that ISEA populations of R. exulans contain the highest mtDNA lineage diversity including significant haplotype diversity not represented elsewhere in the species range. Within ISEA, the island of Flores in the Lesser Sunda group contains the highest diversity in ISEA (across all loci and also has a deep fossil record of small mammals that appears to include R. exulans. Therefore, in addition to Flores harboring unusual diversity in the form of Homo floresiensis, dwarfed stegodons and giant rats, this island appears to be the homeland of R. exulans.

  16. Feedback to providers improves evidence-based implantable cardioverter-defibrillator programming and reduces shocks.

    Science.gov (United States)

    Silver, Marc T; Sterns, Laurence D; Piccini, Jonathan P; Joung, Boyoung; Ching, Chi-Keong; Pickett, Robert A; Rabinovich, Rafael; Liu, Shufeng; Peterson, Brett J; Lexcen, Daniel R

    2015-03-01

    Implantable cardioverter-defibrillator (ICD) shocks are associated with increased anxiety, health care utilization, and potentially mortality. The purpose of the Shock-Less Study was to determine if providing feedback reports to physicians on their adherence to evidence-based shock reduction programming could improve their programming behavior and reduce shocks. Shock-Less enrolled primary prevention (PP) and secondary prevention (SP) ICD patients between 2009 and 2012 at 118 study centers worldwide and followed patients longitudinally after their ICD implant. Center-specific therapy programming reports (TPRs) were delivered to each center 9 to 12 months after their first enrollment. The reports detailed adherence to evidence-based programming targets: number of intervals to detect ventricular fibrillation (VF NID), longest treatment interval (LTI), supraventricular tachycardia (SVT) discriminators (Wavelet, PR Logic), SVT limit, Lead Integrity Alert (LIA), and antitachycardia pacing (ATP). Clinicians programmed ICDs at their discretion. The primary outcome measure was the change in utilization of evidence-based shock reduction programming before (phase I, n = 2694 patients) and after initiation of the TPR (phase II, n = 1438 patients). Patients implanted after feedback reports (phase II) were up to 20% more likely to have their ICDs programmed in line with evidence-based shock reduction programming (eg, VF NID in PP patients 30/40 in 33.5% vs 18.6%, P programming feedback reports improves adherence to evidence-based shock reduction programming and is associated with lower risk of ICD shocks. Copyright © 2015 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  17. Genetics in the art and art in genetics.

    Science.gov (United States)

    Bukvic, Nenad; Elling, John W

    2015-01-15

    "Healing is best accomplished when art and science are conjoined, when body and spirit are probed together", says Bernard Lown, in his book "The Lost Art of Healing". Art has long been a witness to disease either through diseases which affected artists or diseases afflicting objects of their art. In particular, artists have often portrayed genetic disorders and malformations in their work. Sometimes genetic disorders have mystical significance; other times simply have intrinsic interest. Recognizing genetic disorders is also an art form. From the very beginning of my work as a Medical Geneticist I have composed personal "algorithms" to piece together evidence of genetics syndromes and diseases from the observable signs and symptoms. In this paper we apply some 'gestalt' Genetic Syndrome Diagnostic algorithms to virtual patients found in some art masterpieces. In some the diagnosis is clear and in others the artists' depiction only supports a speculative differential diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Unravelling fears of genetic discrimination: an exploratory study of Dutch HCM families in an era of genetic non-discrimination acts.

    Science.gov (United States)

    Geelen, Els; Horstman, Klasien; Marcelis, Carlo L M; Doevendans, Pieter A; Van Hoyweghen, Ine

    2012-10-01

    Since the 1990s, many countries in Europe and the United States have enacted genetic non-discrimination legislation to prevent people from deferring genetic tests for fear that insurers or employers would discriminate against them based on that information. Although evidence for genetic discrimination exists, little is known about the origins and backgrounds of fears of discrimination and how it affects decisions for uptake of genetic testing. The aim of this article is to gain a better understanding of these fears and its possible impact on the uptake of testing by studying the case of hypertrophic cardiomyopathy (HCM). In a qualitative study, we followed six Dutch extended families involved in genetic testing for HCM for three-and-a-half years. Semi-structured interviews were conducted with 57 members of these families. Based on the narratives of the families, we suggest that fears of discrimination have to be situated in the broader social and life-course context of family and kin. We describe the processes in which families developed meaningful interpretations of genetic discrimination and how these interpretations affected family members' decisions to undergo genetic testing. Our findings show that fears of genetic discrimination do not so much stem from the opportunity of genetic testing but much more from earlier experiences of discrimination of diseased family members. These results help identify the possible limitations of genetic non-discrimination regulations and provide direction to clinicians supporting their clients as they confront issues of genetic testing and genetic discrimination.

  19. Evolution of Hereditary Breast Cancer Genetic Services: Are Changes Reflected in the Knowledge and Clinical Practices of Florida Providers?

    Science.gov (United States)

    Cragun, Deborah; Scherr, Courtney; Camperlengo, Lucia; Vadaparampil, Susan T; Pal, Tuya

    2016-10-01

    We describe practitioner knowledge and practices related to hereditary breast and ovarian cancer (HBOC) in an evolving landscape of genetic testing. A survey was mailed in late 2013 to Florida providers who order HBOC testing. Descriptive statistics were conducted to characterize participants' responses. Of 101 respondents, 66% indicated either no genetics education or education through a commercial laboratory. Although 79% of respondents were aware of the Supreme Court ruling resulting in the loss of Myriad Genetics' BRCA gene patent, only 19% had ordered testing from a different laboratory. With regard to pretest counseling, 78% of respondents indicated they usually discuss 11 of 14 nationally recommended elements for informed consent. Pretest discussion times varied from 3 to 120 min, with approximately half spending 40% of respondents included (1) possibility of a variant of uncertain significance (VUS) and (2) issues related to life/disability insurance. With regard to genetic testing for HBOC, 88% would test an unaffected sister of a breast cancer patient identified with a BRCA VUS. Results highlight the need to identify whether variability in hereditary cancer service delivery impacts patient outcomes. Findings also reveal opportunities to facilitate ongoing outreach and education.

  20. Genetic effects of nonionizing electromagnetic fields

    International Nuclear Information System (INIS)

    Lai, Henry

    2001-01-01

    Due to the increased use of electricity and wireless communication devices, there is a concern on whether exposure to nonionizing electromagnetic fields (50/60 Hz fields and radiofrequency radiation) can lead to harmful health effects, particularly, genetic effects and cancer development. This presentation will review recent research on genetic effects of power line frequency and radiofrequency electromagnetic fields. Even though the mechanism of interaction is still unknown, there is increasing evidence that these electromagnetic fields at low intensities can cause genetic damage in cells. There is also evidence suggesting that the effects are caused by oxidative stress. (author)

  1. Common genetic variants influence human subcortical brain structures

    Science.gov (United States)

    Hibar, Derrek P.; Stein, Jason L.; Renteria, Miguel E.; Arias-Vasquez, Alejandro; Desrivières, Sylvane; Jahanshad, Neda; Toro, Roberto; Wittfeld, Katharina; Abramovic, Lucija; Andersson, Micael; Aribisala, Benjamin S.; Armstrong, Nicola J.; Bernard, Manon; Bohlken, Marc M.; Boks, Marco P.; Bralten, Janita; Brown, Andrew A.; Chakravarty, M. Mallar; Chen, Qiang; Ching, Christopher R. K.; Cuellar-Partida, Gabriel; den Braber, Anouk; Giddaluru, Sudheer; Goldman, Aaron L.; Grimm, Oliver; Guadalupe, Tulio; Hass, Johanna; Woldehawariat, Girma; Holmes, Avram J.; Hoogman, Martine; Janowitz, Deborah; Jia, Tianye; Kim, Sungeun; Klein, Marieke; Kraemer, Bernd; Lee, Phil H.; Olde Loohuis, Loes M.; Luciano, Michelle; Macare, Christine; Mather, Karen A.; Mattheisen, Manuel; Milaneschi, Yuri; Nho, Kwangsik; Papmeyer, Martina; Ramasamy, Adaikalavan; Risacher, Shannon L.; Roiz-Santiañez, Roberto; Rose, Emma J.; Salami, Alireza; Sämann, Philipp G.; Schmaal, Lianne; Schork, Andrew J.; Shin, Jean; Strike, Lachlan T.; Teumer, Alexander; van Donkelaar, Marjolein M. J.; van Eijk, Kristel R.; Walters, Raymond K.; Westlye, Lars T.; Whelan, Christopher D.; Winkler, Anderson M.; Zwiers, Marcel P.; Alhusaini, Saud; Athanasiu, Lavinia; Ehrlich, Stefan; Hakobjan, Marina M. H.; Hartberg, Cecilie B.; Haukvik, Unn K.; Heister, Angelien J. G. A. M.; Hoehn, David; Kasperaviciute, Dalia; Liewald, David C. M.; Lopez, Lorna M.; Makkinje, Remco R. R.; Matarin, Mar; Naber, Marlies A. M.; McKay, D. Reese; Needham, Margaret; Nugent, Allison C.; Pütz, Benno; Royle, Natalie A.; Shen, Li; Sprooten, Emma; Trabzuni, Daniah; van der Marel, Saskia S. L.; van Hulzen, Kimm J. E.; Walton, Esther; Wolf, Christiane; Almasy, Laura; Ames, David; Arepalli, Sampath; Assareh, Amelia A.; Bastin, Mark E.; Brodaty, Henry; Bulayeva, Kazima B.; Carless, Melanie A.; Cichon, Sven; Corvin, Aiden; Curran, Joanne E.; Czisch, Michael; de Zubicaray, Greig I.; Dillman, Allissa; Duggirala, Ravi; Dyer, Thomas D.; Erk, Susanne; Fedko, Iryna O.; Ferrucci, Luigi; Foroud, Tatiana M.; Fox, Peter T.; Fukunaga, Masaki; Gibbs, J. Raphael; Göring, Harald H. H.; Green, Robert C.; Guelfi, Sebastian; Hansell, Narelle K.; Hartman, Catharina A.; Hegenscheid, Katrin; Heinz, Andreas; Hernandez, Dena G.; Heslenfeld, Dirk J.; Hoekstra, Pieter J.; Holsboer, Florian; Homuth, Georg; Hottenga, Jouke-Jan; Ikeda, Masashi; Jack, Clifford R.; Jenkinson, Mark; Johnson, Robert; Kanai, Ryota; Keil, Maria; Kent, Jack W.; Kochunov, Peter; Kwok, John B.; Lawrie, Stephen M.; Liu, Xinmin; Longo, Dan L.; McMahon, Katie L.; Meisenzahl, Eva; Melle, Ingrid; Mohnke, Sebastian; Montgomery, Grant W.; Mostert, Jeanette C.; Mühleisen, Thomas W.; Nalls, Michael A.; Nichols, Thomas E.; Nilsson, Lars G.; Nöthen, Markus M.; Ohi, Kazutaka; Olvera, Rene L.; Perez-Iglesias, Rocio; Pike, G. Bruce; Potkin, Steven G.; Reinvang, Ivar; Reppermund, Simone; Rietschel, Marcella; Romanczuk-Seiferth, Nina; Rosen, Glenn D.; Rujescu, Dan; Schnell, Knut; Schofield, Peter R.; Smith, Colin; Steen, Vidar M.; Sussmann, Jessika E.; Thalamuthu, Anbupalam; Toga, Arthur W.; Traynor, Bryan J.; Troncoso, Juan; Turner, Jessica A.; Valdés Hernández, Maria C.; van ’t Ent, Dennis; van der Brug, Marcel; van der Wee, Nic J. A.; van Tol, Marie-Jose; Veltman, Dick J.; Wassink, Thomas H.; Westman, Eric; Zielke, Ronald H.; Zonderman, Alan B.; Ashbrook, David G.; Hager, Reinmar; Lu, Lu; McMahon, Francis J.; Morris, Derek W.; Williams, Robert W.; Brunner, Han G.; Buckner, Randy L.; Buitelaar, Jan K.; Cahn, Wiepke; Calhoun, Vince D.; Cavalleri, Gianpiero L.; Crespo-Facorro, Benedicto; Dale, Anders M.; Davies, Gareth E.; Delanty, Norman; Depondt, Chantal; Djurovic, Srdjan; Drevets, Wayne C.; Espeseth, Thomas; Gollub, Randy L.; Ho, Beng-Choon; Hoffmann, Wolfgang; Hosten, Norbert; Kahn, René S.; Le Hellard, Stephanie; Meyer-Lindenberg, Andreas; Müller-Myhsok, Bertram; Nauck, Matthias; Nyberg, Lars; Pandolfo, Massimo; Penninx, Brenda W. J. H.; Roffman, Joshua L.; Sisodiya, Sanjay M.; Smoller, Jordan W.; van Bokhoven, Hans; van Haren, Neeltje E. M.; Völzke, Henry; Walter, Henrik; Weiner, Michael W.; Wen, Wei; White, Tonya; Agartz, Ingrid; Andreassen, Ole A.; Blangero, John; Boomsma, Dorret I.; Brouwer, Rachel M.; Cannon, Dara M.; Cookson, Mark R.; de Geus, Eco J. C.; Deary, Ian J.; Donohoe, Gary; Fernández, Guillén; Fisher, Simon E.; Francks, Clyde; Glahn, David C.; Grabe, Hans J.; Gruber, Oliver; Hardy, John; Hashimoto, Ryota; Hulshoff Pol, Hilleke E.; Jönsson, Erik G.; Kloszewska, Iwona; Lovestone, Simon; Mattay, Venkata S.; Mecocci, Patrizia; McDonald, Colm; McIntosh, Andrew M.; Ophoff, Roel A.; Paus, Tomas; Pausova, Zdenka; Ryten, Mina; Sachdev, Perminder S.; Saykin, Andrew J.; Simmons, Andy; Singleton, Andrew; Soininen, Hilkka; Wardlaw, Joanna M.; Weale, Michael E.; Weinberger, Daniel R.; Adams, Hieab H. H.; Launer, Lenore J.; Seiler, Stephan; Schmidt, Reinhold; Chauhan, Ganesh; Satizabal, Claudia L.; Becker, James T.; Yanek, Lisa; van der Lee, Sven J.; Ebling, Maritza; Fischl, Bruce; Longstreth, W. T.; Greve, Douglas; Schmidt, Helena; Nyquist, Paul; Vinke, Louis N.; van Duijn, Cornelia M.; Xue, Luting; Mazoyer, Bernard; Bis, Joshua C.; Gudnason, Vilmundur; Seshadri, Sudha; Ikram, M. Arfan; Martin, Nicholas G.; Wright, Margaret J.; Schumann, Gunter; Franke, Barbara; Thompson, Paul M.; Medland, Sarah E.

    2015-01-01

    The highly complex structure of the human brain is strongly shaped by genetic influences1. Subcortical brain regions form circuits with cortical areas to coordinate movement2, learning, memory3 and motivation4, and altered circuits can lead to abnormal behaviour and disease2. To investigate how common genetic variants affect the structure of these brain regions, here we conduct genome-wide association studies of the volumes of seven subcortical regions and the intracranial volume derived from magnetic resonance images of 30,717 individuals from 50 cohorts. We identify five novel genetic variants influencing the volumes of the putamen and caudate nucleus. We also find stronger evidence for three loci with previously established influences on hippocampal volume5 and intracranial volume6. These variants show specific volumetric effects on brain structures rather than global effects across structures. The strongest effects were found for the putamen, where a novel intergenic locus with replicable influence on volume (rs945270; P = 1.08 × 10−33; 0.52% variance explained) showed evidence of altering the expression of the KTN1 gene in both brain and blood tissue. Variants influencing putamen volume clustered near developmental genes that regulate apoptosis, axon guidance and vesicle transport. Identification of these genetic variants provides insight into the causes of variability inhuman brain development, and may help to determine mechanisms of neuropsychiatric dysfunction. PMID:25607358

  2. Common genetic variants influence human subcortical brain structures.

    Science.gov (United States)

    Hibar, Derrek P; Stein, Jason L; Renteria, Miguel E; Arias-Vasquez, Alejandro; Desrivières, Sylvane; Jahanshad, Neda; Toro, Roberto; Wittfeld, Katharina; Abramovic, Lucija; Andersson, Micael; Aribisala, Benjamin S; Armstrong, Nicola J; Bernard, Manon; Bohlken, Marc M; Boks, Marco P; Bralten, Janita; Brown, Andrew A; Chakravarty, M Mallar; Chen, Qiang; Ching, Christopher R K; Cuellar-Partida, Gabriel; den Braber, Anouk; Giddaluru, Sudheer; Goldman, Aaron L; Grimm, Oliver; Guadalupe, Tulio; Hass, Johanna; Woldehawariat, Girma; Holmes, Avram J; Hoogman, Martine; Janowitz, Deborah; Jia, Tianye; Kim, Sungeun; Klein, Marieke; Kraemer, Bernd; Lee, Phil H; Olde Loohuis, Loes M; Luciano, Michelle; Macare, Christine; Mather, Karen A; Mattheisen, Manuel; Milaneschi, Yuri; Nho, Kwangsik; Papmeyer, Martina; Ramasamy, Adaikalavan; Risacher, Shannon L; Roiz-Santiañez, Roberto; Rose, Emma J; Salami, Alireza; Sämann, Philipp G; Schmaal, Lianne; Schork, Andrew J; Shin, Jean; Strike, Lachlan T; Teumer, Alexander; van Donkelaar, Marjolein M J; van Eijk, Kristel R; Walters, Raymond K; Westlye, Lars T; Whelan, Christopher D; Winkler, Anderson M; Zwiers, Marcel P; Alhusaini, Saud; Athanasiu, Lavinia; Ehrlich, Stefan; Hakobjan, Marina M H; Hartberg, Cecilie B; Haukvik, Unn K; Heister, Angelien J G A M; Hoehn, David; Kasperaviciute, Dalia; Liewald, David C M; Lopez, Lorna M; Makkinje, Remco R R; Matarin, Mar; Naber, Marlies A M; McKay, D Reese; Needham, Margaret; Nugent, Allison C; Pütz, Benno; Royle, Natalie A; Shen, Li; Sprooten, Emma; Trabzuni, Daniah; van der Marel, Saskia S L; van Hulzen, Kimm J E; Walton, Esther; Wolf, Christiane; Almasy, Laura; Ames, David; Arepalli, Sampath; Assareh, Amelia A; Bastin, Mark E; Brodaty, Henry; Bulayeva, Kazima B; Carless, Melanie A; Cichon, Sven; Corvin, Aiden; Curran, Joanne E; Czisch, Michael; de Zubicaray, Greig I; Dillman, Allissa; Duggirala, Ravi; Dyer, Thomas D; Erk, Susanne; Fedko, Iryna O; Ferrucci, Luigi; Foroud, Tatiana M; Fox, Peter T; Fukunaga, Masaki; Gibbs, J Raphael; Göring, Harald H H; Green, Robert C; Guelfi, Sebastian; Hansell, Narelle K; Hartman, Catharina A; Hegenscheid, Katrin; Heinz, Andreas; Hernandez, Dena G; Heslenfeld, Dirk J; Hoekstra, Pieter J; Holsboer, Florian; Homuth, Georg; Hottenga, Jouke-Jan; Ikeda, Masashi; Jack, Clifford R; Jenkinson, Mark; Johnson, Robert; Kanai, Ryota; Keil, Maria; Kent, Jack W; Kochunov, Peter; Kwok, John B; Lawrie, Stephen M; Liu, Xinmin; Longo, Dan L; McMahon, Katie L; Meisenzahl, Eva; Melle, Ingrid; Mohnke, Sebastian; Montgomery, Grant W; Mostert, Jeanette C; Mühleisen, Thomas W; Nalls, Michael A; Nichols, Thomas E; Nilsson, Lars G; Nöthen, Markus M; Ohi, Kazutaka; Olvera, Rene L; Perez-Iglesias, Rocio; Pike, G Bruce; Potkin, Steven G; Reinvang, Ivar; Reppermund, Simone; Rietschel, Marcella; Romanczuk-Seiferth, Nina; Rosen, Glenn D; Rujescu, Dan; Schnell, Knut; Schofield, Peter R; Smith, Colin; Steen, Vidar M; Sussmann, Jessika E; Thalamuthu, Anbupalam; Toga, Arthur W; Traynor, Bryan J; Troncoso, Juan; Turner, Jessica A; Valdés Hernández, Maria C; van 't Ent, Dennis; van der Brug, Marcel; van der Wee, Nic J A; van Tol, Marie-Jose; Veltman, Dick J; Wassink, Thomas H; Westman, Eric; Zielke, Ronald H; Zonderman, Alan B; Ashbrook, David G; Hager, Reinmar; Lu, Lu; McMahon, Francis J; Morris, Derek W; Williams, Robert W; Brunner, Han G; Buckner, Randy L; Buitelaar, Jan K; Cahn, Wiepke; Calhoun, Vince D; Cavalleri, Gianpiero L; Crespo-Facorro, Benedicto; Dale, Anders M; Davies, Gareth E; Delanty, Norman; Depondt, Chantal; Djurovic, Srdjan; Drevets, Wayne C; Espeseth, Thomas; Gollub, Randy L; Ho, Beng-Choon; Hoffmann, Wolfgang; Hosten, Norbert; Kahn, René S; Le Hellard, Stephanie; Meyer-Lindenberg, Andreas; Müller-Myhsok, Bertram; Nauck, Matthias; Nyberg, Lars; Pandolfo, Massimo; Penninx, Brenda W J H; Roffman, Joshua L; Sisodiya, Sanjay M; Smoller, Jordan W; van Bokhoven, Hans; van Haren, Neeltje E M; Völzke, Henry; Walter, Henrik; Weiner, Michael W; Wen, Wei; White, Tonya; Agartz, Ingrid; Andreassen, Ole A; Blangero, John; Boomsma, Dorret I; Brouwer, Rachel M; Cannon, Dara M; Cookson, Mark R; de Geus, Eco J C; Deary, Ian J; Donohoe, Gary; Fernández, Guillén; Fisher, Simon E; Francks, Clyde; Glahn, David C; Grabe, Hans J; Gruber, Oliver; Hardy, John; Hashimoto, Ryota; Hulshoff Pol, Hilleke E; Jönsson, Erik G; Kloszewska, Iwona; Lovestone, Simon; Mattay, Venkata S; Mecocci, Patrizia; McDonald, Colm; McIntosh, Andrew M; Ophoff, Roel A; Paus, Tomas; Pausova, Zdenka; Ryten, Mina; Sachdev, Perminder S; Saykin, Andrew J; Simmons, Andy; Singleton, Andrew; Soininen, Hilkka; Wardlaw, Joanna M; Weale, Michael E; Weinberger, Daniel R; Adams, Hieab H H; Launer, Lenore J; Seiler, Stephan; Schmidt, Reinhold; Chauhan, Ganesh; Satizabal, Claudia L; Becker, James T; Yanek, Lisa; van der Lee, Sven J; Ebling, Maritza; Fischl, Bruce; Longstreth, W T; Greve, Douglas; Schmidt, Helena; Nyquist, Paul; Vinke, Louis N; van Duijn, Cornelia M; Xue, Luting; Mazoyer, Bernard; Bis, Joshua C; Gudnason, Vilmundur; Seshadri, Sudha; Ikram, M Arfan; Martin, Nicholas G; Wright, Margaret J; Schumann, Gunter; Franke, Barbara; Thompson, Paul M; Medland, Sarah E

    2015-04-09

    The highly complex structure of the human brain is strongly shaped by genetic influences. Subcortical brain regions form circuits with cortical areas to coordinate movement, learning, memory and motivation, and altered circuits can lead to abnormal behaviour and disease. To investigate how common genetic variants affect the structure of these brain regions, here we conduct genome-wide association studies of the volumes of seven subcortical regions and the intracranial volume derived from magnetic resonance images of 30,717 individuals from 50 cohorts. We identify five novel genetic variants influencing the volumes of the putamen and caudate nucleus. We also find stronger evidence for three loci with previously established influences on hippocampal volume and intracranial volume. These variants show specific volumetric effects on brain structures rather than global effects across structures. The strongest effects were found for the putamen, where a novel intergenic locus with replicable influence on volume (rs945270; P = 1.08 × 10(-33); 0.52% variance explained) showed evidence of altering the expression of the KTN1 gene in both brain and blood tissue. Variants influencing putamen volume clustered near developmental genes that regulate apoptosis, axon guidance and vesicle transport. Identification of these genetic variants provides insight into the causes of variability in human brain development, and may help to determine mechanisms of neuropsychiatric dysfunction.

  3. A Rickettsia Genome Overrun by Mobile Genetic Elements Provides Insight into the Acquisition of Genes Characteristic of an Obligate Intracellular Lifestyle

    Science.gov (United States)

    Joardar, Vinita; Williams, Kelly P.; Driscoll, Timothy; Hostetler, Jessica B.; Nordberg, Eric; Shukla, Maulik; Walenz, Brian; Hill, Catherine A.; Nene, Vishvanath M.; Azad, Abdu F.; Sobral, Bruno W.; Caler, Elisabet

    2012-01-01

    We present the draft genome for the Rickettsia endosymbiont of Ixodes scapularis (REIS), a symbiont of the deer tick vector of Lyme disease in North America. Among Rickettsia species (Alphaproteobacteria: Rickettsiales), REIS has the largest genome sequenced to date (>2 Mb) and contains 2,309 genes across the chromosome and four plasmids (pREIS1 to pREIS4). The most remarkable finding within the REIS genome is the extraordinary proliferation of mobile genetic elements (MGEs), which contributes to a limited synteny with other Rickettsia genomes. In particular, an integrative conjugative element named RAGE (for Rickettsiales amplified genetic element), previously identified in scrub typhus rickettsiae (Orientia tsutsugamushi) genomes, is present on both the REIS chromosome and plasmids. Unlike the pseudogene-laden RAGEs of O. tsutsugamushi, REIS encodes nine conserved RAGEs that include F-like type IV secretion systems similar to that of the tra genes encoded in the Rickettsia bellii and R. massiliae genomes. An unparalleled abundance of encoded transposases (>650) relative to genome size, together with the RAGEs and other MGEs, comprise ∼35% of the total genome, making REIS one of the most plastic and repetitive bacterial genomes sequenced to date. We present evidence that conserved rickettsial genes associated with an intracellular lifestyle were acquired via MGEs, especially the RAGE, through a continuum of genomic invasions. Robust phylogeny estimation suggests REIS is ancestral to the virulent spotted fever group of rickettsiae. As REIS is not known to invade vertebrate cells and has no known pathogenic effects on I. scapularis, its genome sequence provides insight on the origin of mechanisms of rickettsial pathogenicity. PMID:22056929

  4. Genetic architecture of the Delis-Kaplan Executive Function System Trail Making Test: evidence for distinct genetic influences on executive function.

    Science.gov (United States)

    Vasilopoulos, Terrie; Franz, Carol E; Panizzon, Matthew S; Xian, Hong; Grant, Michael D; Lyons, Michael J; Toomey, Rosemary; Jacobson, Kristen C; Kremen, William S

    2012-03-01

    To examine how genes and environments contribute to relationships among Trail Making Test (TMT) conditions and the extent to which these conditions have unique genetic and environmental influences. Participants included 1,237 middle-aged male twins from the Vietnam Era Twin Study of Aging. The Delis-Kaplan Executive Function System TMT included visual searching, number and letter sequencing, and set-shifting components. Phenotypic correlations among TMT conditions ranged from 0.29 to 0.60, and genes accounted for the majority (58-84%) of each correlation. Overall heritability ranged from 0.34 to 0.62 across conditions. Phenotypic factor analysis suggested a single factor. In contrast, genetic models revealed a single common genetic factor but also unique genetic influences separate from the common factor. Genetic variance (i.e., heritability) of number and letter sequencing was completely explained by the common genetic factor while unique genetic influences separate from the common factor accounted for 57% and 21% of the heritabilities of visual search and set shifting, respectively. After accounting for general cognitive ability, unique genetic influences accounted for 64% and 31% of those heritabilities. A common genetic factor, most likely representing a combination of speed and sequencing, accounted for most of the correlation among TMT 1-4. Distinct genetic factors, however, accounted for a portion of variance in visual scanning and set shifting. Thus, although traditional phenotypic shared variance analysis techniques suggest only one general factor underlying different neuropsychological functions in nonpatient populations, examining the genetic underpinnings of cognitive processes with twin analysis can uncover more complex etiological processes.

  5. Genetic evidence for monogamy in the dwarf seahorse, Hippocampus zosterae.

    Science.gov (United States)

    Rose, Emily; Small, Clayton M; Saucedo, Hector A; Harper, Cristin; Jones, Adam G

    2014-01-01

    Syngnathid fishes (pipefishes, seahorses, and seadragons) exhibit a wide array of mating systems ranging from monogamy with long-term pair bonds to more promiscuous mating systems, such as polyandry and polygynandry. Some seahorses, including the dwarf seahorse Hippocampus zosterae, have been found to be socially monogamous. Although several seahorse species have also been shown to be genetically monogamous, parentage analysis has not yet been applied to the dwarf seahorse. We developed 8 novel microsatellites for the dwarf seahorse to conduct genetic parentage analysis to confirm that this species is indeed monogamous. Using 4 selected loci and a total of 16 pregnant male seahorses, with 8 collected in Florida and 8 sampled in Texas, we genotyped all of the offspring within each male's brood to determine the maternal contributions to each brood. We found a maximum of 4 alleles per locus segregating within each pregnant male's brood, a pattern consistent with each brood having exactly 1 mother and 1 father. These results support previous laboratory-based behavioral studies and indicate that the dwarf seahorse, H. zosterae, is genetically monogamous. © The American Genetic Association 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. A Molecular Genetic Lab to Generate Inclusive and Exclusive Forensic Evidence: Two Suspects, a Victim, and a Bloodstained T-Shirt

    Science.gov (United States)

    Smit, Julie; Heath, Daniel D.; Walter, Ryan P.

    2014-01-01

    Molecular genetic laboratory exercises can be ineffective due the student's lack of connection to the complex and sequential protocols. In this inquiry-based molecular genetic laboratory exercise, we harness students' fascination with human forensics and provide a real-life scenario using biomolecular techniques to identify "whose…

  7. Evidence-based practice beliefs and behaviors of nurses providing cancer pain management: a mixed-methods approach.

    Science.gov (United States)

    Eaton, Linda H; Meins, Alexa R; Mitchell, Pamela H; Voss, Joachim; Doorenbos, Ardith Z

    2015-03-01

    To describe evidence-based practice (EBP) beliefs and behaviors of nurses who provide cancer pain management. Descriptive, cross-sectional with a mixed-methods approach. Two inpatient oncology units in the Pacific Northwest. 40 RNs.
 Data collected by interviews and web-based surveys. EBP beliefs, EBP implementation, evidence-based pain management. Nurses agreed with the positive aspects of EBP and their implementation ability, although implementation level was low. They were satisfied with their pain management practices. Oncology nursing certification was associated with innovativeness, and innovativeness was associated with EBP beliefs. Themes identified were (a) limited definition of EBP, (b) varied evidence-based pain management decision making, (c) limited identification of evidence-based pain management practices, and (d) integration of nonpharmacologic interventions into patient care. Nurses' low level of EBP implementation in the context of pain management was explained by their trust that standards of care and medical orders were evidence-based. Nurses' EBP beliefs and behaviors should be considered when developing strategies for sustaining evidence-based pain management practices. Implementation of the EBP process by nurses may not be realistic in the inpatient setting; therefore, hospital pain management policies need to be evidence-based and reinforced with nurses.

  8. Genetically modified foods and allergy.

    Science.gov (United States)

    Lee, T H; Ho, H K; Leung, T F

    2017-06-01

    2015 marked the 25th anniversary of the commercial use and availability of genetically modified crops. The area of planted biotech crops cultivated globally occupies a cumulative two billion hectares, equivalent to twice the land size of China or the United States. Foods derived from genetically modified plants are widely consumed in many countries and genetically modified soybean protein is extensively used in processed foods throughout the industrialised countries. Genetically modified food technology offers a possible solution to meet current and future challenges in food and medicine. Yet there is a strong undercurrent of anxiety that genetically modified foods are unsafe for human consumption, sometimes fuelled by criticisms based on little or no firm evidence. This has resulted in some countries turning away food destined for famine relief because of the perceived health risks of genetically modified foods. The major concerns include their possible allergenicity and toxicity despite the vigorous testing of genetically modified foods prior to marketing approval. It is imperative that scientists engage the public in a constructive evidence-based dialogue to address these concerns. At the same time, improved validated ways to test the safety of new foods should be developed. A post-launch strategy should be established routinely to allay concerns. Mandatory labelling of genetically modified ingredients should be adopted for the sake of transparency. Such ingredient listing and information facilitate tracing and recall if required.

  9. An imaging genetics approach to understanding social influence

    Directory of Open Access Journals (Sweden)

    Emily eFalk

    2012-06-01

    Full Text Available Normative social influences shape nearly every aspect of our lives, yet the biological processes mediating the impact of these social influences on behavior remain incompletely understood. In this Hypothesis, we outline a theoretical framework and an integrative research approach to the study of social influences on the brain and genetic moderators of such effects. First, we review neuroimaging evidence linking social influence and conformity to the brain’s reward system. We next review neuroimaging evidence linking social punishment (exclusion to brain systems involved in the experience of pain, as well as evidence linking exclusion to conformity. We suggest that genetic variants that increase sensitivity to social cues may predispose individuals to be more sensitive to either social rewards or punishments (or potentially both, which in turn increases conformity and susceptibility to normative social influences more broadly. To this end, we review evidence for genetic moderators of neurochemical responses in the brain, and suggest ways in which genes and pharmacology may modulate sensitivity to social influences. We conclude by proposing an integrative imaging genetics approach to the study of brain mediators and genetic modulators of a variety of social influences on human attitudes, beliefs, and actions.

  10. An imaging genetics approach to understanding social influence.

    Science.gov (United States)

    Falk, Emily B; Way, Baldwin M; Jasinska, Agnes J

    2012-01-01

    Normative social influences shape nearly every aspect of our lives, yet the biological processes mediating the impact of these social influences on behavior remain incompletely understood. In this Hypothesis, we outline a theoretical framework and an integrative research approach to the study of social influences on the brain and genetic moderators of such effects. First, we review neuroimaging evidence linking social influence and conformity to the brain's reward system. We next review neuroimaging evidence linking social punishment (exclusion) to brain systems involved in the experience of pain, as well as evidence linking exclusion to conformity. We suggest that genetic variants that increase sensitivity to social cues may predispose individuals to be more sensitive to either social rewards or punishments (or potentially both), which in turn increases conformity and susceptibility to normative social influences more broadly. To this end, we review evidence for genetic moderators of neurochemical responses in the brain, and suggest ways in which genes and pharmacology may modulate sensitivity to social influences. We conclude by proposing an integrative imaging genetics approach to the study of brain mediators and genetic modulators of a variety of social influences on human attitudes, beliefs, and actions.

  11. Social stratification in the Sikh population of Punjab (India) has a genetic basis: evidence from serological and biochemical markers.

    Science.gov (United States)

    Chahal, Sukh Mohinder Singh; Virk, Rupinder Kaur; Kaur, Sukhvir; Bansal, Rupinder

    2011-01-01

    The present study was planned to assess whether social stratification in the Sikh population inhabiting the northwest border Indian state of Punjab has any genetic basis. Blood samples were collected randomly from a total of 2851 unrelated subjects belonging to 21 groups of two low-ranking Sikh scheduled caste populations, viz. Mazhabi and Ramdasi, and a high-ranking Jat Sikh caste population of Punjab. The genetic profile of Sikh groups was investigated using a total of nine serobiochemical genetic markers, comprising two blood groups (ABO, RH(D)) and a battery of seven red cell enzyme polymorphisms (ADA, AK1, ESD, PGM1, GLO1, ACP1, GPI), following standard serological and biochemical laboratory protocols. Genetic structure was studied using original allele frequency data and statistical measures of heterozygosity, genic differentiation, genetic distance, and genetic admixture. Great heterogeneity was observed between Sikh scheduled caste and Jat Sikh populations, especially in the RH(D) blood group system, and distribution of ESD, ACP1, and PGM1 enzyme markers was also found to be significantly different between many of their groups. Genetic distance trees demonstrated little or no genetic affinities between Sikh scheduled caste and Jat Sikh populations; the Mazhabi and Ramdasi also showed little genetic relationship. Genetic admixture analysis suggested a higher element of autochthonous tribal extraction in the Ramdasi. The present study revealed much genetic heterogeneity in differently ranking Sikh caste populations of Punjab, mainly attributable to their different ethnic backgrounds, and provided a genetic basis to social stratification present in this religious community of Punjab, India.

  12. Cannabis Controversies: How genetics can inform the study of comorbidity

    Science.gov (United States)

    Agrawal, Arpana; Lynskey, Michael T.

    2014-01-01

    Aims To review three key and controversial comorbidities of cannabis use – other illicit drug use, psychosis and depression as well as suicide, from a genetically informed perspective. Design Selective review. Results Genetic factors play a critical role in the association between cannabis use, particularly early-onset use and use of other illicit drugs, psychosis and depression as well as suicide, albeit via differing mechanisms. For other illicit drugs, while there is strong evidence for shared genetic influences, residual association that is attributable to causal or person-specific environmental factors cannot be ruled out. For depression, common genetic influences are solely responsible for the association with cannabis use but for suicidal attempt, evidence for person-specific factors persists. Finally, even though rates of cannabis use are inordinately high in those with psychotic disorders, there is no evidence of shared genetic etiologies underlying this comorbidity. Instead, there is limited evidence that adolescent cannabis use might moderate the extent to which diathesis influences psychosis. Conclusions Overlapping genetic influences underlie the association between early-onset cannabis use and other illicit drug use as well as depression and suicide. For psychosis, mechanisms other than shared genetic influences might be at play. PMID:24438181

  13. Genetic and neurobiological aspects of attention deficit hyperactive disorder: a review.

    OpenAIRE

    Hechtman, L

    1994-01-01

    This paper reviews key studies that have addressed genetic and neurobiological aspects in attention deficit hyperactive disorder. Genetic studies can be divided into three distinct types: twin, adoption, and family studies. Evidence for a particular mode of inheritance and the possible specific genetic abnormalities are also explored. There is strong evidence of genetic involvement in this condition, although a clear-cut mode of inheritance and specific genetic abnormalities are yet to be det...

  14. Statistical aspects of forensic genetics

    DEFF Research Database (Denmark)

    Tvedebrink, Torben

    This PhD thesis deals with statistical models intended for forensic genetics, which is the part of forensic medicine concerned with analysis of DNA evidence from criminal cases together with calculation of alleged paternity and affinity in family reunification cases. The main focus of the thesis...... is on crime cases as these differ from the other types of cases since the biological material often is used for person identification contrary to affinity. Common to all cases, however, is that the DNA is used as evidence in order to assess the probability of observing the biological material given different...... of the DNA evidence under competing hypotheses the biological evidence may be used in the court’s deliberation and trial on equal footing with other evidence and expert statements. These probabilities are based on population genetic models whose assumptions must be validated. The thesis’s first two articles...

  15. The contribution of genetics and environment to obesity.

    Science.gov (United States)

    Albuquerque, David; Nóbrega, Clévio; Manco, Licínio; Padez, Cristina

    2017-09-01

    Obesity is a global health problem mainly attributed to lifestyle changes such as diet, low physical activity or socioeconomics factors. However, several evidences consistently showed that genetics contributes significantly to the weight-gain susceptibility. A systematic literature search of most relevant original, review and meta-analysis, restricted to English was conducted in PubMed, Web of Science and Google scholar up to May 2017 concerning the contribution of genetics and environmental factors to obesity. Several evidences suggest that obesogenic environments contribute to the development of an obese phenotype. However, not every individual from the same population, despite sharing the same obesogenic environment, develop obesity. After more than 10 years of investigation on the genetics of obesity, the variants found associated with obesity represent only 3% of the estimated BMI-heritability, which is around 47-80%. Moreover, genetic factors per se were unable to explain the rapid spread of obesity prevalence. The integration of multi-omics data enables scientists having a better picture and to elucidate unknown pathways contributing to obesity. New studies based on case-control or gene candidate approach will be important to identify new variants associated with obesity susceptibility and consequently unveiling its genetic architecture. This will lead to an improvement of our understanding about underlying mechanisms involved in development and origin of the actual obesity epidemic. The integration of several omics will also provide insights about the interplay between genes and environments contributing to the obese phenotype. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  16. Genetic Evidence of Importation of Drug-Resistant Plasmodium falciparum to Guatemala from the Democratic Republic of the Congo.

    Science.gov (United States)

    Patel, Jaymin C; Taylor, Steve M; Juliao, Patricia C; Parobek, Christian M; Janko, Mark; Gonzalez, Luis Demetrio; Ortiz, Lucia; Padilla, Norma; Tshefu, Antoinette K; Emch, Michael; Udhayakumar, Venkatachalam; Lindblade, Kim; Meshnick, Steven R

    2014-06-01

    Imported malaria threatens control and elimination efforts in countries that have low rates of transmission. In 2010, an outbreak of Plasmodium falciparum malaria was reported among United Nations peacekeeping soldiers from Guatemala who had recently returned from the Democratic Republic of the Congo (DRC). Epidemiologic evidence suggested that the soldiers were infected in the DRC, but local transmission could not be ruled out in all cases. We used population genetic analyses of neutral microsatellites to determine the outbreak source. Genetic relatedness was compared among parasites found in samples from the soldiers and parasite populations collected in the DRC and Guatemala; parasites identified in the soldiers were more closely related to those from the DRC. A phylogenetic clustering analysis confirms this identification with >99.9% confidence. Thus, results support the hypothesis that the soldiers likely imported malaria from the DRC. This study demonstrates the utility of molecular genotyping in outbreak investigations.

  17. Verification of consumers' experiences and perceptions of genetic discrimination and its impact on utilization of genetic testing.

    Science.gov (United States)

    Barlow-Stewart, Kristine; Taylor, Sandra D; Treloar, Susan A; Stranger, Mark; Otlowski, Margaret

    2009-03-01

    To undertake a systematic process of verification of consumer accounts of alleged genetic discrimination. Verification of incidents reported in life insurance and other contexts that met the criteria of genetic discrimination, and the impact of fear of such treatment, was determined, with consent, through interview, document analysis and where appropriate, direct contact with the third party involved. The process comprised obtaining evidence that the alleged incident was accurately reported and determining whether the decision or action seemed to be justifiable and/or ethical. Reported incidents of genetic discrimination were verified in life insurance access, underwriting and coercion (9), applications for worker's compensation (1) and early release from prison (1) and in two cases of fear of discrimination impacting on access to genetic testing. Relevant conditions were inherited cancer susceptibility (8), Huntington disease (3), hereditary hemochromatosis (1), and polycystic kidney disease (1). In two cases, the reversal of an adverse underwriting decision to standard rate after intervention with insurers by genetics health professionals was verified. The mismatch between consumer and third party accounts in three life insurance incidents involved miscommunication or lack of information provision by financial advisers. These first cases of verified genetic discrimination make it essential for policies and guidelines to be developed and implemented to ensure appropriate use of genetic test results in insurance underwriting, to promote education and training in the financial industry, and to provide support for consumers and health professionals undertaking challenges of adverse decisions.

  18. Adoption of Evidence-Based Practices Among Substance Abuse Treatment Providers*

    Science.gov (United States)

    Haug, Nancy A.; Shopshire, Michael; Tajima, Barbara; Gruber, Valerie; Guydish, Joseph

    2009-01-01

    This research was conducted at a Substance Abuse Forum designed to address local community needs by focusing on Evidence-Based Practices (EBPs) in addiction treatment. The purpose of the study was to assess substance abuse treatment professionals’ readiness to adopt EBPs, experience with EBPs, and attitudes toward EBPs, as well as agency support for EBPs. A total of 119 addiction treatment providers completed pre-test measures, and 82% completed a post-test. Eighty-three percent of participants reported using some EBPs in the past year, and 75% reported currently using EBPs. Participants who were currently licensed or certified in addictions had less negative attitudes toward EBPs than those without credentials. While respondents reported agency support for EBPs, most expressed interest in further training. This study underscores the movement toward EBPs in addiction treatment and the need for effective dissemination and training in this area. PMID:18724657

  19. Genetic information, non-discrimination, and privacy protections in genetic counseling practice.

    Science.gov (United States)

    Prince, Anya E R; Roche, Myra I

    2014-12-01

    The passage of the Genetic Information Non Discrimination Act (GINA) was hailed as a pivotal achievement that was expected to calm the fears of both patients and research participants about the potential misuse of genetic information. However, 6 years later, patient and provider awareness of legal protections at both the federal and state level remains discouragingly low, thereby, limiting their potential effectiveness. The increasing demand for genetic testing will expand the number of individuals and families who could benefit from obtaining accurate information about the privacy and anti-discriminatory protections that GINA and other laws extend. In this paper we describe legal protections that are applicable to individuals seeking genetic counseling, review the literature on patient and provider fears of genetic discrimination and examine their awareness and understandings of existing laws, and summarize how genetic counselors currently discuss genetic discrimination. We then present three genetic counseling cases to illustrate issues of genetic discrimination and provide relevant information on applicable legal protections. Genetic counselors have an unprecedented opportunity, as well as the professional responsibility, to disseminate accurate knowledge about existing legal protections to their patients. They can strengthen their effectiveness in this role by achieving a greater knowledge of current protections including being able to identify specific steps that can help protect genetic information.

  20. Genetic evidence and integration of various data sources for classifying uncertain variants into a single model.

    NARCIS (Netherlands)

    Goldgar, D.E.; Easton, D.F.; Byrnes, G.B.; Spurdle, A.B.; Iversen, E.S.; Greenblatt, M.S.; Boffetta, P.; Couch, F.J.; Wind, N. de; Eccles, D.; Foulkes, W.D.; Genuardi, M.; Hofstra, R.M.; Hogervorst, F.; Hoogerbrugge-van der Linden, N.; Plon, S.E.; Radice, P.; Rasmussen, L.; Sinilnikova, O.M.; Tavtigian, S.V.

    2008-01-01

    Genetic testing often results in the finding of a variant whose clinical significance is unknown. A number of different approaches have been employed in the attempt to classify such variants. For some variants, case-control, segregation, family history, or other statistical studies can provide

  1. Adaptive divergence despite strong genetic drift: genomic analysis of the evolutionary mechanisms causing genetic differentiation in the island fox (Urocyon littoralis)

    Science.gov (United States)

    FUNK, W. CHRIS; LOVICH, ROBERT E.; HOHENLOHE, PAUL A.; HOFMAN, COURTNEY A.; MORRISON, SCOTT A.; SILLETT, T. SCOTT; GHALAMBOR, CAMERON K.; MALDONADO, JESUS E.; RICK, TORBEN C.; DAY, MITCH D.; POLATO, NICHOLAS R.; FITZPATRICK, SARAH W.; COONAN, TIMOTHY J.; CROOKS, KEVIN R.; DILLON, ADAM; GARCELON, DAVID K.; KING, JULIE L.; BOSER, CHRISTINA L.; GOULD, NICHOLAS; ANDELT, WILLIAM F.

    2016-01-01

    The evolutionary mechanisms generating the tremendous biodiversity of islands have long fascinated evolutionary biologists. Genetic drift and divergent selection are predicted to be strong on islands and both could drive population divergence and speciation. Alternatively, strong genetic drift may preclude adaptation. We conducted a genomic analysis to test the roles of genetic drift and divergent selection in causing genetic differentiation among populations of the island fox (Urocyon littoralis). This species consists of 6 subspecies, each of which occupies a different California Channel Island. Analysis of 5293 SNP loci generated using Restriction-site Associated DNA (RAD) sequencing found support for genetic drift as the dominant evolutionary mechanism driving population divergence among island fox populations. In particular, populations had exceptionally low genetic variation, small Ne (range = 2.1–89.7; median = 19.4), and significant genetic signatures of bottlenecks. Moreover, islands with the lowest genetic variation (and, by inference, the strongest historical genetic drift) were most genetically differentiated from mainland gray foxes, and vice versa, indicating genetic drift drives genome-wide divergence. Nonetheless, outlier tests identified 3.6–6.6% of loci as high FST outliers, suggesting that despite strong genetic drift, divergent selection contributes to population divergence. Patterns of similarity among populations based on high FST outliers mirrored patterns based on morphology, providing additional evidence that outliers reflect adaptive divergence. Extremely low genetic variation and small Ne in some island fox populations, particularly on San Nicolas Island, suggest that they may be vulnerable to fixation of deleterious alleles, decreased fitness, and reduced adaptive potential. PMID:26992010

  2. Adaptive divergence despite strong genetic drift: genomic analysis of the evolutionary mechanisms causing genetic differentiation in the island fox (Urocyon littoralis).

    Science.gov (United States)

    Funk, W Chris; Lovich, Robert E; Hohenlohe, Paul A; Hofman, Courtney A; Morrison, Scott A; Sillett, T Scott; Ghalambor, Cameron K; Maldonado, Jesus E; Rick, Torben C; Day, Mitch D; Polato, Nicholas R; Fitzpatrick, Sarah W; Coonan, Timothy J; Crooks, Kevin R; Dillon, Adam; Garcelon, David K; King, Julie L; Boser, Christina L; Gould, Nicholas; Andelt, William F

    2016-05-01

    The evolutionary mechanisms generating the tremendous biodiversity of islands have long fascinated evolutionary biologists. Genetic drift and divergent selection are predicted to be strong on islands and both could drive population divergence and speciation. Alternatively, strong genetic drift may preclude adaptation. We conducted a genomic analysis to test the roles of genetic drift and divergent selection in causing genetic differentiation among populations of the island fox (Urocyon littoralis). This species consists of six subspecies, each of which occupies a different California Channel Island. Analysis of 5293 SNP loci generated using Restriction-site Associated DNA (RAD) sequencing found support for genetic drift as the dominant evolutionary mechanism driving population divergence among island fox populations. In particular, populations had exceptionally low genetic variation, small Ne (range = 2.1-89.7; median = 19.4), and significant genetic signatures of bottlenecks. Moreover, islands with the lowest genetic variation (and, by inference, the strongest historical genetic drift) were most genetically differentiated from mainland grey foxes, and vice versa, indicating genetic drift drives genome-wide divergence. Nonetheless, outlier tests identified 3.6-6.6% of loci as high FST outliers, suggesting that despite strong genetic drift, divergent selection contributes to population divergence. Patterns of similarity among populations based on high FST outliers mirrored patterns based on morphology, providing additional evidence that outliers reflect adaptive divergence. Extremely low genetic variation and small Ne in some island fox populations, particularly on San Nicolas Island, suggest that they may be vulnerable to fixation of deleterious alleles, decreased fitness and reduced adaptive potential. © 2016 John Wiley & Sons Ltd.

  3. Human genetics of infectious diseases: between proof of principle and paradigm.

    Science.gov (United States)

    Alcaïs, Alexandre; Abel, Laurent; Casanova, Jean-Laurent

    2009-09-01

    The observation that only a fraction of individuals infected by infectious agents develop clinical disease raises fundamental questions about the actual pathogenesis of infectious diseases. Epidemiological and experimental evidence is accumulating to suggest that human genetics plays a major role in this process. As we discuss here, human predisposition to infectious diseases seems to cover a continuous spectrum from monogenic to polygenic inheritance. Although many studies have provided proof of principle that infectious diseases may result from various types of inborn errors of immunity, the genetic determinism of most infectious diseases in most patients remains unclear. However, in the future, studies in human genetics are likely to establish a new paradigm for infectious diseases.

  4. Selecting the Best Forecasting-Implied Volatility Model Using Genetic Programming

    Directory of Open Access Journals (Sweden)

    Wafa Abdelmalek

    2009-01-01

    Full Text Available The volatility is a crucial variable in option pricing and hedging strategies. The aim of this paper is to provide some initial evidence of the empirical relevance of genetic programming to volatility's forecasting. By using real data from S&P500 index options, the genetic programming's ability to forecast Black and Scholes-implied volatility is compared between time series samples and moneyness-time to maturity classes. Total and out-of-sample mean squared errors are used as forecasting's performance measures. Comparisons reveal that the time series model seems to be more accurate in forecasting-implied volatility than moneyness time to maturity models. Overall, results are strongly encouraging and suggest that the genetic programming approach works well in solving financial problems.

  5. Developing a good practice for the review of evidence relevant to GMO risk assessment

    DEFF Research Database (Denmark)

    Kohl, Christian; Craig, Wendy; Frampton, Geoff

    2013-01-01

    such research results in a transparent, reproducible and unbiased manner. The EU-funded project GRACE (GMO Risk Assessment and Communication of Evidence) aims to explore, adapt, apply, and promote these tools to enhance accountability in decision-making by providing policy makers with comprehensive, science......-based information on potential impacts (scenarios) of genetically modified plants and their derived products. Furthermore, GRACE will establish an open-access database in order to support the review process, to mirror the evidence synthesis, to assist the dissemination of results and conclusions, as well as to act......, in more general terms, as an information resource on biosafety of genetically modified plants....

  6. Ancient DNA reveals substantial genetic diversity in the California Condor (Gymnogyps californianus) prior to a population bottleneck

    Science.gov (United States)

    D'Elia, Jesse; Haig, Susan M.; Mullins, Thomas D.; Miller, Mark P.

    2016-01-01

    Critically endangered species that have undergone severe population bottlenecks often have little remaining genetic variation, making it difficult to reconstruct population histories to apply in reintroduction and recovery strategies. By using ancient DNA techniques, it is possible to combine genetic evidence from the historical population with contemporary samples to provide a more complete picture of a species' genetic variation across its historical range and through time. Applying this approach, we examined changes in the mitochondrial DNA (mtDNA) control region (526 base pairs) of the endangered California Condor (Gymnogyps californianus). Results showed a >80% reduction in unique haplotypes over the past 2 centuries. We found no spatial sorting of haplotypes in the historical population; the periphery of the range contained haplotypes that were common throughout the historical range. Direct examination of mtDNA from California Condor museum specimens provided a new window into historical population connectivity and genetic diversity showing: (1) a substantial loss of haplotypes, which is consistent with the hypothesis that condors were relatively abundant in the nineteenth century, but declined rapidly as a result of human-caused mortality; and (2) no evidence of historical population segregation, meaning that the available genetic data offer no cause to avoid releasing condors in unoccupied portions of their historical range.

  7. Unravelling fears of genetic discrimination: an exploratory study of Dutch HCM families in an era of genetic non-discrimination acts

    NARCIS (Netherlands)

    Geelen, E.; Horstman, K.; Marcelis, C.L.; Doevendans, P.A.; Van Hoyweghen, I.

    2012-01-01

    Since the 1990s, many countries in Europe and the United States have enacted genetic non-discrimination legislation to prevent people from deferring genetic tests for fear that insurers or employers would discriminate against them based on that information. Although evidence for genetic

  8. Genetic architecture and the evolution of sex.

    Science.gov (United States)

    Lohaus, Rolf; Burch, Christina L; Azevedo, Ricardo B R

    2010-01-01

    Theoretical investigations of the advantages of sex have tended to treat the genetic architecture of organisms as static and have not considered that genetic architecture might coevolve with reproductive mode. As a result, some potential advantages of sex may have been missed. Using a gene network model, we recently showed that recombination imposes selection for robustness to mutation and that negative epistasis can evolve as a by-product of this selection. These results motivated a detailed exploration of the mutational deterministic hypothesis, a hypothesis in which the advantage of sex depends critically on epistasis. We found that sexual populations do evolve higher mean fitness and lower genetic load than asexual populations at equilibrium, and, under moderate stabilizing selection and large population size, these equilibrium sexual populations resist invasion by asexuals. However, we found no evidence that these long- and short-term advantages to sex were explained by the negative epistasis that evolved in our experiments. The long-term advantage of sex was that sexual populations evolved a lower deleterious mutation rate, but this property was not sufficient to account for the ability of sexual populations to resist invasion by asexuals. The ability to resist asexual invasion was acquired simultaneously with an increase in recombinational robustness that minimized the cost of sex. These observations provide the first direct evidence that sexual reproduction does indeed select for conditions that favor its own maintenance. Furthermore, our results highlight the importance of considering a dynamic view of the genetic architecture to understand the evolution of sex and recombination.

  9. Genetic and linguistic coevolution in Northern Island Melanesia.

    Science.gov (United States)

    Hunley, Keith; Dunn, Michael; Lindström, Eva; Reesink, Ger; Terrill, Angela; Healy, Meghan E; Koki, George; Friedlaender, Françoise R; Friedlaender, Jonathan S

    2008-10-01

    Recent studies have detailed a remarkable degree of genetic and linguistic diversity in Northern Island Melanesia. Here we utilize that diversity to examine two models of genetic and linguistic coevolution. The first model predicts that genetic and linguistic correspondences formed following population splits and isolation at the time of early range expansions into the region. The second is analogous to the genetic model of isolation by distance, and it predicts that genetic and linguistic correspondences formed through continuing genetic and linguistic exchange between neighboring populations. We tested the predictions of the two models by comparing observed and simulated patterns of genetic variation, genetic and linguistic trees, and matrices of genetic, linguistic, and geographic distances. The data consist of 751 autosomal microsatellites and 108 structural linguistic features collected from 33 Northern Island Melanesian populations. The results of the tests indicate that linguistic and genetic exchange have erased any evidence of a splitting and isolation process that might have occurred early in the settlement history of the region. The correlation patterns are also inconsistent with the predictions of the isolation by distance coevolutionary process in the larger Northern Island Melanesian region, but there is strong evidence for the process in the rugged interior of the largest island in the region (New Britain). There we found some of the strongest recorded correlations between genetic, linguistic, and geographic distances. We also found that, throughout the region, linguistic features have generally been less likely to diffuse across population boundaries than genes. The results from our study, based on exceptionally fine-grained data, show that local genetic and linguistic exchange are likely to obscure evidence of the early history of a region, and that language barriers do not particularly hinder genetic exchange. In contrast, global patterns may

  10. Genetic and linguistic coevolution in Northern Island Melanesia.

    Directory of Open Access Journals (Sweden)

    Keith Hunley

    2008-10-01

    Full Text Available Recent studies have detailed a remarkable degree of genetic and linguistic diversity in Northern Island Melanesia. Here we utilize that diversity to examine two models of genetic and linguistic coevolution. The first model predicts that genetic and linguistic correspondences formed following population splits and isolation at the time of early range expansions into the region. The second is analogous to the genetic model of isolation by distance, and it predicts that genetic and linguistic correspondences formed through continuing genetic and linguistic exchange between neighboring populations. We tested the predictions of the two models by comparing observed and simulated patterns of genetic variation, genetic and linguistic trees, and matrices of genetic, linguistic, and geographic distances. The data consist of 751 autosomal microsatellites and 108 structural linguistic features collected from 33 Northern Island Melanesian populations. The results of the tests indicate that linguistic and genetic exchange have erased any evidence of a splitting and isolation process that might have occurred early in the settlement history of the region. The correlation patterns are also inconsistent with the predictions of the isolation by distance coevolutionary process in the larger Northern Island Melanesian region, but there is strong evidence for the process in the rugged interior of the largest island in the region (New Britain. There we found some of the strongest recorded correlations between genetic, linguistic, and geographic distances. We also found that, throughout the region, linguistic features have generally been less likely to diffuse across population boundaries than genes. The results from our study, based on exceptionally fine-grained data, show that local genetic and linguistic exchange are likely to obscure evidence of the early history of a region, and that language barriers do not particularly hinder genetic exchange. In contrast

  11. Genetic architecture of circulating lipid levels

    DEFF Research Database (Denmark)

    Demirkan, Ayşe; Amin, Najaf; Isaacs, Aaron

    2011-01-01

    Serum concentrations of low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), triglycerides (TGs) and total cholesterol (TC) are important heritable risk factors for cardiovascular disease. Although genome-wide association studies (GWASs) of circulating lipid...... the ENGAGE Consortium GWAS on serum lipids, were applied to predict lipid levels in an independent population-based study, the Rotterdam Study-II (RS-II). We additionally tested for evidence of a shared genetic basis for different lipid phenotypes. Finally, the polygenic score approach was used to identify...... an alternative genome-wide significance threshold before pathway analysis and those results were compared with those based on the classical genome-wide significance threshold. Our study provides evidence suggesting that many loci influencing circulating lipid levels remain undiscovered. Cross-prediction models...

  12. Symmetries in Genetic Systems and the Concept of Geno-Logical Coding

    Directory of Open Access Journals (Sweden)

    Sergey V. Petoukhov

    2016-12-01

    Full Text Available The genetic code of amino acid sequences in proteins does not allow understanding and modeling of inherited processes such as inborn coordinated motions of living bodies, innate principles of sensory information processing, quasi-holographic properties, etc. To be able to model these phenomena, the concept of geno-logical coding, which is connected with logical functions and Boolean algebra, is put forward. The article describes basic pieces of evidence in favor of the existence of the geno-logical code, which exists in p­arallel with the known genetic code of amino acid sequences but which serves for transferring inherited processes along chains of generations. These pieces of evidence have been received due to the analysis of symmetries in structures of molecular-genetic systems. The analysis has revealed a close connection of the genetic system with dyadic groups of binary numbers and with other mathematical objects, which are related with dyadic groups: Walsh functions (which are algebraic characters of dyadic groups, bit-reversal permutations, logical holography, etc. These results provide a new approach for mathematical modeling of genetic structures, which uses known mathematical formalisms from technological fields of noise-immunity coding of information, binary analysis, logical holography, and digital devices of artificial intellect. Some opportunities for a development of algebraic-logical biology are opened.

  13. Population Expansion and Genetic Structure in Carcharhinus brevipinna in the Southern Indo-Pacific

    Science.gov (United States)

    Geraghty, Pascal T.; Williamson, Jane E.; Macbeth, William G.; Wintner, Sabine P.; Harry, Alastair V.; Ovenden, Jennifer R.; Gillings, Michael R.

    2013-01-01

    Background Quantifying genetic diversity and metapopulation structure provides insights into the evolutionary history of a species and helps develop appropriate management strategies. We provide the first assessment of genetic structure in spinner sharks (Carcharhinus brevipinna), a large cosmopolitan carcharhinid, sampled from eastern and northern Australia and South Africa. Methods and Findings Sequencing of the mitochondrial DNA NADH dehydrogenase subunit 4 gene for 430 individuals revealed 37 haplotypes and moderately high haplotype diversity (h = 0.6770 ±0.025). While two metrics of genetic divergence (ΦST and F ST) revealed somewhat different results, subdivision was detected between South Africa and all Australian locations (pairwise ΦST, range 0.02717–0.03508, p values ≤ 0.0013; pairwise F ST South Africa vs New South Wales = 0.04056, p = 0.0008). Evidence for fine-scale genetic structuring was also detected along Australia’s east coast (pairwise ΦST = 0.01328, p Indo-Pacific. PMID:24086462

  14. Application of plant DNA markers in forensic botany: genetic comparison of Quercus evidence leaves to crime scene trees using microsatellites.

    Science.gov (United States)

    Craft, Kathleen J; Owens, Jeffrey D; Ashley, Mary V

    2007-01-05

    As highly polymorphic DNA markers become increasingly available for a wide range of plant and animal species, there will be increasing opportunities for applications to forensic investigations. To date, however, relatively few studies have reported using DNA profiles of non-human species to place suspects at or near crime scenes. Here we describe an investigation of a double homicide of a female and her near-term fetus. Leaf material taken from a suspect's vehicle was identified to be that of sand live oak, Quercus geminata, the same tree species that occurred near a shallow grave where the victims were found. Quercus-specific DNA microsatellites were used to genotype both dried and fresh material from trees located near the burial site and from the material taken from the suspect's car. Samples from the local population of Q. geminata were also collected and genotyped in order to demonstrate that genetic variation at four microsatellite loci was sufficient to assign leaves to an individual tree with high statistical certainty. The cumulative average probability of identity for these four loci was 2.06x10(-6). DNA was successfully obtained from the dried leaf material although PCR amplification was more difficult than amplification of DNA from fresh leaves. The DNA profiles of the dried leaves from the suspect's car did not match those of the trees near the crime scene. Although this investigation did not provide evidence that could be used against the suspect, it does demonstrate the potential for plant microsatellite markers providing physical evidence that links plant materials to live plants at or near crime scenes.

  15. Population Genetics of Nosema apis and Nosema ceranae: One Host (Apis mellifera) and Two Different Histories

    Science.gov (United States)

    Maside, Xulio; Gómez-Moracho, Tamara; Jara, Laura; Martín-Hernández, Raquel; De la Rúa, Pilar; Higes, Mariano; Bartolomé, Carolina

    2015-01-01

    Two microsporidians are known to infect honey bees: Nosema apis and Nosema ceranae. Whereas population genetics data for the latter have been released in the last few years, such information is still missing for N. apis. Here we analyze the patterns of nucleotide polymorphism at three single-copy loci (PTP2, PTP3 and RPB1) in a collection of Apis mellifera isolates from all over the world, naturally infected either with N. apis (N = 22) or N. ceranae (N = 23), to provide new insights into the genetic diversity, demography and evolution of N. apis, as well as to compare them with evidence from N. ceranae. Neutral variation in N. apis and N. ceranae is of the order of 1%. This amount of diversity suggests that there is no substantial differentiation between the genetic content of the two nuclei present in these parasites, and evidence for genetic recombination provides a putative mechanism for the flow of genetic information between chromosomes. The analysis of the frequency spectrum of neutral variants reveals a significant surplus of low frequency variants, particularly in N. ceranae, and suggests that the populations of the two pathogens are not in mutation-drift equilibrium and that they have experienced a population expansion. Most of the variation in both species occurs within honey bee colonies (between 62%-90% of the total genetic variance), although in N. apis there is evidence for differentiation between parasites isolated from distinct A. mellifera lineages (20%-34% of the total variance), specifically between those collected from lineages A and C (or M). This scenario is consistent with a long-term host-parasite relationship and contrasts with the lack of differentiation observed among host-lineages in N. ceranae (mellifera worldwide population is a recent event. PMID:26720131

  16. Integrating paleoecology and genetics of bird populations in two sky island archipelagos.

    Science.gov (United States)

    McCormack, John E; Bowen, Bonnie S; Smith, Thomas B

    2008-06-27

    Genetic tests of paleoecological hypotheses have been rare, partly because recent genetic divergence is difficult to detect and time. According to fossil plant data, continuous woodland in the southwestern USA and northern Mexico became fragmented during the last 10,000 years, as warming caused cool-adapted species to retreat to high elevations. Most genetic studies of resulting 'sky islands' have either failed to detect recent divergence or have found discordant evidence for ancient divergence. We test this paleoecological hypothesis for the region with intraspecific mitochondrial DNA and microsatellite data from sky-island populations of a sedentary bird, the Mexican jay (Aphelocoma ultramarina). We predicted that populations on different sky islands would share common, ancestral alleles that existed during the last glaciation, but that populations on each sky island, owing to their isolation, would contain unique variants of postglacial origin. We also predicted that divergence times estimated from corrected genetic distance and a coalescence model would post-date the last glacial maximum. Our results provide multiple independent lines of support for postglacial divergence, with the predicted pattern of shared and unique mitochondrial DNA haplotypes appearing in two independent sky-island archipelagos, and most estimates of divergence time based on corrected genetic distance post-dating the last glacial maximum. Likewise, an isolation model based on multilocus gene coalescence indicated postglacial divergence of five pairs of sky islands. In contrast to their similar recent histories, the two archipelagos had dissimilar historical patterns in that sky islands in Arizona showed evidence for older divergence, suggesting different responses to the last glaciation. This study is one of the first to provide explicit support from genetic data for a postglacial divergence scenario predicted by one of the best paleoecological records in the world. Our results

  17. Contemporary Genetics for Gender Researchers: Not Your Grandma's Genetics Anymore

    Science.gov (United States)

    Salk, Rachel H.; Hyde, Janet S.

    2012-01-01

    Over the past century, much of genetics was deterministic, and feminist researchers framed justified criticisms of genetics research. However, over the past two decades, genetics research has evolved remarkably and has moved far from earlier deterministic approaches. Our article provides a brief primer on modern genetics, emphasizing contemporary…

  18. Strong genetic overlap between executive functions and intelligence.

    Science.gov (United States)

    Engelhardt, Laura E; Mann, Frank D; Briley, Daniel A; Church, Jessica A; Harden, K Paige; Tucker-Drob, Elliot M

    2016-09-01

    Executive functions (EFs) are cognitive processes that control, monitor, and coordinate more basic cognitive processes. EFs play instrumental roles in models of complex reasoning, learning, and decision making, and individual differences in EFs have been consistently linked with individual differences in intelligence. By middle childhood, genetic factors account for a moderate proportion of the variance in intelligence, and these effects increase in magnitude through adolescence. Genetic influences on EFs are very high, even in middle childhood, but the extent to which these genetic influences overlap with those on intelligence is unclear. We examined genetic and environmental overlap between EFs and intelligence in a racially and socioeconomically diverse sample of 811 twins ages 7 to 15 years (M = 10.91, SD = 1.74) from the Texas Twin Project. A general EF factor representing variance common to inhibition, switching, working memory, and updating domains accounted for substantial proportions of variance in intelligence, primarily via a genetic pathway. General EF continued to have a strong, genetically mediated association with intelligence even after controlling for processing speed. Residual variation in general intelligence was influenced only by shared and nonshared environmental factors, and there remained no genetic variance in general intelligence that was unique of EF. Genetic variance independent of EF did remain, however, in a more specific perceptual reasoning ability. These results provide evidence that genetic influences on general intelligence are highly overlapping with those on EF. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  19. Molecular marker systems for Oenothera genetics.

    Science.gov (United States)

    Rauwolf, Uwe; Golczyk, Hieronim; Meurer, Jörg; Herrmann, Reinhold G; Greiner, Stephan

    2008-11-01

    The genus Oenothera has an outstanding scientific tradition. It has been a model for studying aspects of chromosome evolution and speciation, including the impact of plastid nuclear co-evolution. A large collection of strains analyzed during a century of experimental work and unique genetic possibilities allow the exchange of genetically definable plastids, individual or multiple chromosomes, and/or entire haploid genomes (Renner complexes) between species. However, molecular genetic approaches for the genus are largely lacking. In this study, we describe the development of efficient PCR-based marker systems for both the nuclear genome and the plastome. They allow distinguishing individual chromosomes, Renner complexes, plastomes, and subplastomes. We demonstrate their application by monitoring interspecific exchanges of genomes, chromosome pairs, and/or plastids during crossing programs, e.g., to produce plastome-genome incompatible hybrids. Using an appropriate partial permanent translocation heterozygous hybrid, linkage group 7 of the molecular map could be assigned to chromosome 9.8 of the classical Oenothera map. Finally, we provide the first direct molecular evidence that homologous recombination and free segregation of chromosomes in permanent translocation heterozygous strains is suppressed.

  20. Genetic diversity of a Daugava basin brown trout (Salmo trutta brood stock

    Directory of Open Access Journals (Sweden)

    Schmidt Thomas

    2017-01-01

    Full Text Available Genetics play an increasingly important role in the conservation of threatened fish populations. We have examined twelve microsatellite markers to determine the genetic diversity of a brood stock of brown trout from the Latvian Daugava river basin, used in a local supportive breeding program and compared diversity values to other Baltic populations. Allelic data was further inspected for indications of increased inbreeding. Additionally, we have analyzed the mitochondrial control region to classify the population within a broader phylogenetic framework. We found that the genetic diversity was comparatively low, but there was no strong evidence of high inbreeding. A newly detected mitochondrial haplotype indicates unnoticed genetic diversity of “Atlantic lineage” brown trout in the Daugava basin region. Our study provides first genetic details on resident brown trout from the Baltic Daugava river basin to improve the regional conservation management of this valuable genetic resource and contributes phylogeographically useful information.

  1. Scientific imperatives, clinical implications, and theoretical underpinnings for the investigation of the relationship between genetic variables and patient-reported quality-of-life outcomes

    NARCIS (Netherlands)

    Sprangers, Mirjam A. G.; Sloan, Jeff A.; Barsevick, Andrea; Chauhan, Cynthia; Dueck, Amylou C.; Raat, Hein; Shi, Quiling; van Noorden, Cornelis J. F.; Abernethy, Amy P.; Baas, Frank; Barsevick, Andrea M.; Bartels, Meike; Boomsma, Dorret I.; Bottomley, Andrew; Brundage, Michael; Cella, David; Cleeland, Charles S.; Coens, Corneel; Frost, Marlene H.; Hall, Per; Halyard, Michele Y.; Klepstad, Pål; Martin, Nicholas G.; Miaskowski, Christine; Mosing, Miriam; Movsas, Benjamin; Oliveira, Joao R.; Ordoñana, Juan; Patrick, Donald L.; Pedersen, Nancy L.; Reeve, Bryce; Ropka, Mary E.; Shinozaki, Gen; Singh, Jasvinder A.; Swaab, Dick; Veenhoven, Ruut; Wagner, Gert; Yang, Ping; Zwinderman, Ailko H.

    2010-01-01

    Objectives There is emerging evidence for a genetic basis of patient-reported quality-of-life (QOL) outcomes that can ultimately be incorporated into clinical research and practice. Objectives are (1) to provide arguments for the timeliness of investigating the genetic basis of QOL given the

  2. Preferences of newborn mice for odours indicating closer genetic relatedness: is experience necessary?

    Science.gov (United States)

    Todrank, Josephine; Busquet, Nicolas; Baudoin, Claude; Heth, Giora

    2005-10-07

    Evidence from studies with adult rodents indicates that individual recognition enables distinctions between familiar individuals irrespective of relatedness (but including close kin) and a separate mechanism enables discriminations based on genetic relatedness without prior familiarity. For example, adult mice could assess the extent of their genetic relatedness to unfamiliar individuals using perceptual similarities between their individual odours. The ontogeny of this genetic relatedness assessment mechanism, however, had not been investigated. Here, in two-choice tests, newborn mice differentially preferred odours of more genetically similar lactating females (paternal aunts to unrelated conspecific and conspecific to heterospecific) even without prior direct exposure to adults with the tested genotypes. The results provide a direct demonstration of genetic relatedness assessment abilities in newborns and show that experience with parental odours is not necessary for genetic relatedness distinctions. Future studies will be necessary to determine whether exposure to odours of other foetuses in the womb or littermates shortly after birth affects this genetic relatedness assessment process.

  3. Parent-offspring conflict and the genetic trade-offs shaping parental investment.

    Science.gov (United States)

    Kölliker, Mathias; Boos, Stefan; Wong, Janine W Y; Röllin, Lilian; Stucki, Dimitri; Raveh, Shirley; Wu, Min; Meunier, Joël

    2015-04-16

    The genetic conflict between parents and their offspring is a cornerstone of kin selection theory and the gene-centred view of evolution, but whether it actually occurs in natural systems remains an open question. Conflict operates only if parenting is driven by genetic trade-offs between offspring performance and the parent's ability to raise additional offspring, and its expression critically depends on the shape of these trade-offs. Here we investigate the occurrence and nature of genetic conflict in an insect with maternal care, the earwig Forficula auricularia. Specifically, we test for a direct response to experimental selection on female future reproduction and correlated responses in current offspring survival, developmental rate and growth. The results demonstrate genetic trade-offs that differ in shape before and after hatching. Our study not only provides direct evidence for parent-offspring conflict but also highlights that conflict is not inevitable and critically depends on the genetic trade-offs shaping parental investment.

  4. Population expansion and genetic structure in Carcharhinus brevipinna in the southern Indo-Pacific.

    Directory of Open Access Journals (Sweden)

    Pascal T Geraghty

    Full Text Available Quantifying genetic diversity and metapopulation structure provides insights into the evolutionary history of a species and helps develop appropriate management strategies. We provide the first assessment of genetic structure in spinner sharks (Carcharhinus brevipinna, a large cosmopolitan carcharhinid, sampled from eastern and northern Australia and South Africa.Sequencing of the mitochondrial DNA NADH dehydrogenase subunit 4 gene for 430 individuals revealed 37 haplotypes and moderately high haplotype diversity (h = 0.6770 ±0.025. While two metrics of genetic divergence (ΦST and F ST revealed somewhat different results, subdivision was detected between South Africa and all Australian locations (pairwise ΦST, range 0.02717-0.03508, p values ≤ 0.0013; pairwise F ST South Africa vs New South Wales = 0.04056, p = 0.0008. Evidence for fine-scale genetic structuring was also detected along Australia's east coast (pairwise ΦST = 0.01328, p < 0.015, and between south-eastern and northern locations (pairwise ΦST = 0.00669, p < 0.04.The Indian Ocean represents a robust barrier to contemporary gene flow in C. brevipinna between Australia and South Africa. Gene flow also appears restricted along a continuous continental margin in this species, with data tentatively suggesting the delineation of two management units within Australian waters. Further sampling, however, is required for a more robust evaluation of the latter finding. Evidence indicates that all sampled populations were shaped by a substantial demographic expansion event, with the resultant high genetic diversity being cause for optimism when considering conservation of this commercially-targeted species in the southern Indo-Pacific.

  5. Little Evidence Exists To Support The Expectation That Providers Would Consolidate To Enter New Payment Models.

    Science.gov (United States)

    Neprash, Hannah T; Chernew, Michael E; McWilliams, J Michael

    2017-02-01

    Provider consolidation has been associated with higher health care prices and spending. The prevailing wisdom is that payment reform will accelerate consolidation, especially between physicians and hospitals and among physician groups, as providers position themselves to bear financial risk for the full continuum of patient care. Drawing on data from a number of sources from 2008 onward, we examined the relationship between Medicare's accountable care organization (ACO) programs and provider consolidation. We found that consolidation was under way in the period 2008-10, before the Affordable Care Act (ACA) established the ACO programs. While the number of hospital mergers and the size of specialty-oriented physician groups increased after the ACA was passed, we found minimal evidence that consolidation was associated with ACO penetration at the market level or with physicians' participation in ACOs within markets. We conclude that payment reform has been associated with little acceleration in consolidation in addition to trends already under way, but there is evidence of potential defensive consolidation in response to new payment models. Project HOPE—The People-to-People Health Foundation, Inc.

  6. Genetic evidence of subaortic stenosis in the Newfoundland dog.

    Science.gov (United States)

    Reist-Marti, S B; Dolf, G; Leeb, T; Kottmann, S; Kietzmann, S; Butenhoff, K; Rieder, S

    2012-06-09

    Subaortic stenosis (SAS) is a cardiac disorder with a narrowing of the descending aorta below the left ventricular outflow tract of the heart. It occurs in several species and breeds. The Newfoundland is one of the dog breeds where it is more common and usually leads to death at early adulthood. It is still discussed to which extent SAS has a genetic background and what its mode of inheritance could be. Extensive pedigree data comprising more than 230,000 Newfoundland dogs from the European and North American population reaching back to the 19th century including 6023 dogs with a SAS diagnosis were analysed for genetic factors influencing SAS affection. The incidence and prevalence of SAS in the analysed Newfoundland population sample were much higher than those reported in previous studies on smaller population samples. Assuming that some SAS-affected dogs remained undiscovered or were not reported, these figures may even be underestimated. SAS-affected Newfoundland dogs were more often inbred and closer related to each other than unaffected dogs, which is an indicator for a genetic background of SAS. The sex had no significant impact on SAS affectedness, pointing at an autosomal inheritance. The only simple mode of inheritance that fitted the data well was autosomal codominant with lethal homozygosity and a penetrance of 1/3 in the heterozygotes.

  7. The Genetic Activity Profile database.

    Science.gov (United States)

    Waters, M D; Stack, H F; Garrett, N E; Jackson, M A

    1991-12-01

    A graphic approach termed a Genetic Activity Profile (GAP) has been developed to display a matrix of data on the genetic and related effects of selected chemical agents. The profiles provide a visual overview of the quantitative (doses) and qualitative (test results) data for each chemical. Either the lowest effective dose (LED) or highest ineffective dose (HID) is recorded for each agent and bioassay. Up to 200 different test systems are represented across the GAP. Bioassay systems are organized according to the phylogeny of the test organisms and the end points of genetic activity. The methodology for the production and evaluation of GAPs has been developed in collaboration with the International Agency for Research on Cancer. Data on individual chemicals have been compiled by IARC and by the U.S. Environmental Protection Agency. Data are available on 299 compounds selected from volumes 1-50 of the IARC Monographs and on 115 compounds identified as Superfund Priority Substances. Software to display the GAPs on an IBM-compatible personal computer is available from the authors. Structurally similar compounds frequently display qualitatively and quantitatively similar GAPs. By examining the patterns of GAPs of pairs and groups of chemicals, it is possible to make more informed decisions regarding the selection of test batteries to be used in evaluating chemical analogs. GAPs have provided useful data for the development of weight-of-evidence hazard ranking schemes. Also, some knowledge of the potential genetic activity of complex environmental mixtures may be gained from assessing the GAPs of component chemicals. The fundamental techniques and computer programs devised for the GAP database may be used to develop similar databases in other disciplines.

  8. Vantage Sensitivity: Environmental Sensitivity to Positive Experiences as a Function of Genetic Differences.

    Science.gov (United States)

    Pluess, Michael

    2017-02-01

    A large number of gene-environment interaction studies provide evidence that some people are more likely to be negatively affected by adverse experiences as a function of specific genetic variants. However, such "risk" variants are surprisingly frequent in the population. Evolutionary analysis suggests that genetic variants associated with increased risk for maladaptive development under adverse environmental conditions are maintained in the population because they are also associated with advantages in response to different contextual conditions. These advantages may include (a) coexisting genetic resilience pertaining to other adverse influences, (b) a general genetic susceptibility to both low and high environmental quality, and (c) a coexisting propensity to benefit disproportionately from positive and supportive exposures, as reflected in the recent framework of vantage sensitivity. After introducing the basic properties of vantage sensitivity and highlighting conceptual similarities and differences with diathesis-stress and differential susceptibility patterns of gene-environment interaction, selected and recent empirical evidence for the notion of vantage sensitivity as a function of genetic differences is reviewed. The unique contribution that the new perspective of vantage sensitivity may make to our understanding of social inequality will be discussed after suggesting neurocognitive and molecular mechanisms hypothesized to underlie the propensity to benefit disproportionately from benevolent experiences. © 2015 Wiley Periodicals, Inc.

  9. Adults' perceptions of genetic counseling and genetic testing.

    Science.gov (United States)

    Houfek, Julia Fisco; Soltis-Vaughan, Brigette S; Atwood, Jan R; Reiser, Gwendolyn M; Schaefer, G Bradley

    2015-02-01

    This study described the perceptions of genetic counseling and testing of adults (N = 116) attending a genetic education program. Understanding perceptions of genetic counseling, including the importance of counseling topics, will contribute to patient-focused care as clinical genetic applications for common, complex disorders evolve. Participants completed a survey addressing: the importance of genetic counseling topics, benefits and negative effects of genetic testing, and sharing test results. Topics addressing practical information about genetic conditions were rated most important; topics involving conceptual genetic/genomic principles were rated least important. The most frequently identified benefit and negative effect of testing were prevention/early detection/treatment and psychological distress. Participants perceived that they were more likely to share test results with first-degree than other relatives. Findings suggest providing patients with practical information about genetic testing and genetic contributions to disease, while also determining whether their self-care abilities would be enhanced by teaching genetic/genomic principles. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Genetic variation in lipid desaturases and its impact on the development of human disease.

    Science.gov (United States)

    Merino, Diana M; Ma, David W L; Mutch, David M

    2010-06-18

    Perturbations in lipid metabolism characterize many of the chronic diseases currently plaguing our society, such as obesity, diabetes, and cardiovascular disease. Thus interventions that target plasma lipid levels remain a primary goal to manage these diseases. The determinants of plasma lipid levels are multi-factorial, consisting of both genetic and lifestyle components. Recent evidence indicates that fatty acid desaturases have an important role in defining plasma and tissue lipid profiles. This review will highlight the current state-of-knowledge regarding three desaturases (Scd-1, Fads1 and Fads2) and their potential roles in disease onset and development. Although research in rodent models has provided invaluable insight into the regulation and functions of these desaturases, the extent to which murine research can be translated to humans remains unclear. Evidence emerging from human-based research demonstrates that genetic variation in human desaturase genes affects enzyme activity and, consequently, disease risk factors. Moreover, this genetic variation may have a trans-generational effect via breastfeeding. Therefore inter-individual variation in desaturase function is attributed to both genetic and lifestyle components. As such, population-based research regarding the role of desaturases on disease risk is challenged by this complex gene-lifestyle paradigm. Unravelling the contribution of each component is paramount for understanding the inter-individual variation that exists in plasma lipid profiles, and will provide crucial information to develop personalized strategies to improve health management.

  11. Evidence for a genetic overlap between body dysmorphic concerns and obsessive-compulsive symptoms in an adult female community twin sample.

    Science.gov (United States)

    Monzani, Benedetta; Rijsdijk, Fruhling; Iervolino, Alessandra C; Anson, Martin; Cherkas, Lynn; Mataix-Cols, David

    2012-06-01

    Body dysmorphic disorder (BDD) is thought to be etiologically related to obsessive-compulsive disorder (OCD) but the available evidence is incomplete. The current study examined the genetic and environmental sources of covariance between body dysmorphic and obsessive-compulsive symptoms in a community sample of adult twins. A total of 2,148 female twins (1,074 pairs) completed valid and reliable measures of body dysmorphic concerns and obsessive-compulsive symptoms. The data were analyzed using bivariate twin modeling methods and the statistical programme Mx. In the best-fitting model, the covariation between body dysmorphic and obsessive-compulsive traits was largely accounted for by genetic influences common to both phenotypes (64%; 95% CI: 0.50-0.80). This genetic overlap was even higher when specific obsessive-compulsive symptom dimensions were considered, with up to 82% of the phenotypic correlation between the obsessing and symmetry/ordering symptom dimensions and dysmorphic concerns being attributable to common genetic factors. Unique environmental factors, although influencing these traits individually, did not substantially contribute to their covariation. The results remained unchanged when excluding individuals reporting an objective medical condition/injury accounting for their concern in physical appearance. The association between body dysmorphic concerns and obsessive-compulsive symptoms is largely explained by shared genetic factors. Environmental risk factors were largely unique to each phenotype. These results support current recommendations to group BDD together with OCD in the same DSM-5 chapter, although comparison with other phenotypes such as somatoform disorders and social phobia is needed. Copyright © 2012 Wiley Periodicals, Inc.

  12. Human genetics of diabetic vascular complications

    Indian Academy of Sciences (India)

    Diabetic vascular complications (DVC) affecting several important organ systems of human body such as the cardiovascular system constitute a major public health problem. There is evidence demonstrating that genetic factors contribute to the risk of DVC genetic variants, structural variants, and epigenetic changes play ...

  13. Cancer Genetics Services Directory

    Science.gov (United States)

    ... Services Directory Cancer Prevention Overview Research NCI Cancer Genetics Services Directory This directory lists professionals who provide services related to cancer genetics (cancer risk assessment, genetic counseling, genetic susceptibility testing, ...

  14. Genetics of dietary habits and obesity - a twin study

    DEFF Research Database (Denmark)

    Hasselbalch, Ann Louise

    2010-01-01

    residual genetic influence existed. Based on information about habitual diet from the FFQ the genetic influence on total energy intake, macronutrient intake, as well as intake of energy from 20 food groups, was estimated. The proportion of variation in dietary intake explained by variation in genes...... exposures as well as genetic differences between individuals, resulting in differentiated susceptibility to environmental exposures. The evidence for genetic influence on anthropometry has previously been established and has been estimated to be 60-70% based on twin studies. These inter...... mass, but only limited evidence for associations between habitual dietary intake and anthropometry exists. Differences in habitual dietary intake are also partly determined by differences in genes influencing smell and taste preferences. But, so far, only few studies have investigated genetic...

  15. Studies in genetic discrimination. Final progress report

    Energy Technology Data Exchange (ETDEWEB)

    1994-06-01

    We have screened 1006 respondents in a study of genetic discrimination. Analysis of these responses has produced evidence of the range of institutions engaged in genetic discrimination and demonstrates the impact of this discrimination on the respondents to the study. We have found that both ignorance and policy underlie genetic discrimination and that anti-discrimination laws are being violated.

  16. Full-Genome Characterization and Genetic Evolution of West African Isolates of Bagaza Virus

    Directory of Open Access Journals (Sweden)

    Martin Faye

    2018-04-01

    Full Text Available Bagaza virus is a mosquito-borne flavivirus, first isolated in 1966 in Central African Republic. It has currently been identified in mosquito pools collected in the field in West and Central Africa. Emergence in wild birds in Europe and serological evidence in encephalitis patients in India raise questions on its genetic evolution and the diversity of isolates circulating in Africa. To better understand genetic diversity and evolution of Bagaza virus, we describe the full-genome characterization of 11 West African isolates, sampled from 1988 to 2014. Parameters such as genetic distances, N-glycosylation patterns, recombination events, selective pressures, and its codon adaptation to human genes are assessed. Our study is noteworthy for the observation of N-glycosylation and recombination in Bagaza virus and provides insight into its Indian origin from the 13th century. Interestingly, evidence of Bagaza virus codon adaptation to human house-keeping genes is also observed to be higher than those of other flaviviruses well known in human infections. Genetic variations on genome of West African Bagaza virus could play an important role in generating diversity and may promote Bagaza virus adaptation to other vertebrates and become an important threat in human health.

  17. Dengue viruses in Papua New Guinea: evidence of endemicity and phylogenetic variation, including the evolution of new genetic lineages.

    Science.gov (United States)

    Moore, Peter R; van den Hurk, Andrew F; Mackenzie, John S; Pyke, Alyssa T

    2017-12-20

    Dengue is the most common cause of mosquito-borne viral disease in humans, and is endemic in more than 100 tropical and subtropical countries. Periodic outbreaks of dengue have been reported in Papua New Guinea (PNG), but there is only limited knowledge of its endemicity and disease burden. To help elucidate the status of the dengue viruses (DENVs) in PNG, we performed envelope (E) gene sequencing of DENV serotypes 1-4 (DENV 1-4) obtained from infected patients who traveled to Australia or from patients diagnosed during local DENV transmission events between 2001 and 2016. Phylogenetic analysis and comparison with globally available DENV sequences revealed new endemic PNG lineages for DENV 1-3 which have emerged within the last decade. We also identified another possible PNG lineage for DENV-4 from 2016. The DENV-1 and 3 PNG lineages were most closely related to recent lineages circulating on Pacific island nations while the DENV-2 lineage and putative DENV-4 PNG lineage were most similar to Indonesian sequences. This study has demonstrated for the first time the co-circulation of DENV 1-4 strains in PNG and provided molecular evidence of endemic DENV transmission. Our results provide an important platform for improved surveillance and monitoring of DENVs in PNG and broaden the global understanding of DENV genetic diversity.

  18. Harbor porpoise Phocoena phocoena strandings on the Dutch coast: No genetic structure, but evidence of inbreeding

    Science.gov (United States)

    van der Plas-Duivesteijn, Suzanne J.; Smit, Femmie J. L.; van Alphen, Jacques J. M.; Kraaijeveld, Ken

    2015-03-01

    Conservation management in the North Sea is often motivated by the population size of marine mammals, like harbor porpoises Phocoena phocoena. In the Dutch part of the North Sea, sighting and stranding data are used to estimate population sizes, but these data give little insight into genetic structuring of the population. In this study we investigated genetic structure among animals stranded at different locations and times of year. We also tested whether there is a link between stranding and necropsy data, and genetic diversity. We made use of both mitochondrial (mtDNA) and microsatellite DNA analysis of samples from dead stranded porpoises along the Dutch coast during 2007. mtDNA analysis showed 6 variable positions in the control region, defining 3 different haplotypes. mtDNA haplotypes were not randomly distributed along the Dutch coastline. However, microsatellite analysis showed that these mtDNA haplotypes did not represent separate groups on a nuclear level. Furthermore, microsatellite analysis revealed no genotypic differences between seasons, locations or genders. The results of this study indicate that the Dutch population is panmictic. In contrast, heterozygosity levels were low, indicating some level of inbreeding in this population. However, this was not corroborated by other indices of inbreeding. This research provided insight into genetic structuring of stranded porpoises in 2007, but data from multiple years should be included to be able to help estimate population sizes.

  19. Plasticity and genetic adaptation mediate amphibian and reptile responses to climate change

    Science.gov (United States)

    Urban, Mark C; Richardson, Jonathan L; Freidenfelds, Nicole A

    2014-01-01

    Phenotypic plasticity and genetic adaptation are predicted to mitigate some of the negative biotic consequences of climate change. Here, we evaluate evidence for plastic and evolutionary responses to climate variation in amphibians and reptiles via a literature review and meta-analysis. We included studies that either document phenotypic changes through time or space. Plasticity had a clear and ubiquitous role in promoting phenotypic changes in response to climate variation. For adaptive evolution, we found no direct evidence for evolution of amphibians or reptiles in response to climate change over time. However, we found many studies that documented adaptive responses to climate along spatial gradients. Plasticity provided a mixture of adaptive and maladaptive responses to climate change, highlighting that plasticity frequently, but not always, could ameliorate climate change. Based on our review, we advocate for more experiments that survey genetic changes through time in response to climate change. Overall, plastic and genetic variation in amphibians and reptiles could buffer some of the formidable threats from climate change, but large uncertainties remain owing to limited data. PMID:24454550

  20. Adding 'epi-' to behaviour genetics: implications for animal domestication.

    Science.gov (United States)

    Jensen, Per

    2015-01-01

    In this review, it is argued that greatly improved understanding of domestication may be gained from extending the field of behaviour genetics to also include epigenetics. Domestication offers an interesting framework of rapid evolutionary changes caused by well-defined selection pressures. Behaviour is an important phenotype in this context, as it represents the primary means of response to environmental challenges. An overview is provided of the evidence for genetic involvement in behavioural control and the presently used methods for finding so-called behaviour genes. This shows that evolutionary changes in behaviour are to a large extent correlated to changes in patterns of gene expression, which brings epigenetics into the focus. This area is concerned with the mechanisms controlling the timing and extent of gene expression, and a lot of focus has been placed on methylation of cytosine in promoter regions, usually associated with genetic downregulation. The review considers the available evidence that environmental input, for example stress, can modify methylation and other epigenetic marks and subsequently affect behaviour. Furthermore, several studies are reviewed, demonstrating that acquired epigenetic modifications can be inherited and cause trans-generational behaviour changes. In conclusion, epigenetics may signify a new paradigm in this respect, as it shows that genomic modifications can be caused by environmental signals, and random mutations in DNA sequence are therefore not the only sources of heritable genetic variation. © 2015. Published by The Company of Biologists Ltd.

  1. Genome-Wide Analysis Provides Evidence on the Genetic Relatedness of the Emergent Xylella fastidiosa Genotype in Italy to Isolates from Central America.

    Science.gov (United States)

    Giampetruzzi, Annalisa; Saponari, Maria; Loconsole, Giuliana; Boscia, Donato; Savino, Vito Nicola; Almeida, Rodrigo P P; Zicca, Stefania; Landa, Blanca B; Chacón-Diaz, Carlos; Saldarelli, Pasquale

    2017-07-01

    Xylella fastidiosa is a plant-pathogenic bacterium recently introduced in Europe that is causing decline in olive trees in the South of Italy. Genetic studies have consistently shown that the bacterial genotype recovered from infected olive trees belongs to the sequence type ST53 within subspecies pauca. This genotype, ST53, has also been reported to occur in Costa Rica. The ancestry of ST53 was recently clarified, showing it contains alleles that are monophyletic with those of subsp. pauca in South America. To more robustly determine the phylogenetic placement of ST53 within X. fastidiosa, we performed a comparative analysis based on single nucleotide polymorphisms (SNPs) and the study of the pan-genome of the 27 currently public available whole genome sequences of X. fastidiosa. The resulting maximum-parsimony and maximum likelihood trees constructed using the SNPs and the pan-genome analysis are consistent with previously described X. fastidiosa taxonomy, distinguishing the subsp. fastidiosa, multiplex, pauca, sandyi, and morus. Within the subsp. pauca, the Italian and three Costa Rican isolates, all belonging to ST53, formed a compact phylotype in a clade divergent from the South American pauca isolates, also distinct from the recently described coffee isolate CFBP8072 imported into Europe from Ecuador. These findings were also supported by the gene characterization of a conjugative plasmid shared by all the four ST53 isolates. Furthermore, isolates of the ST53 clade possess an exclusive locus encoding a putative ATP-binding protein belonging to the family of histidine kinase-like ATPase gene, which is not present in isolates from the subspecies multiplex, sandyi, and pauca, but was detected in ST21 isolates of the subspecies fastidiosa from Costa Rica. The clustering and distinctiveness of the ST53 isolates supports the hypothesis of their common origin, and the limited genetic diversity among these isolates suggests this is an emerging clade within subsp

  2. Effective number of breeders provides a link between interannual variation in stream flow and individual reproductive contribution in a stream salmonid.

    Science.gov (United States)

    Whiteley, Andrew R; Coombs, Jason A; Cembrola, Matthew; O'Donnell, Matthew J; Hudy, Mark; Nislow, Keith H; Letcher, Benjamin H

    2015-07-01

    The effective number of breeders that give rise to a cohort (N(b)) is a promising metric for genetic monitoring of species with overlapping generations; however, more work is needed to understand factors that contribute to variation in this measure in natural populations. We tested hypotheses related to interannual variation in N(b) in two long-term studies of brook trout populations. We found no supporting evidence for our initial hypothesis that N^(b) reflects N^(c) (defined as the number of adults in a population at the time of reproduction). N^(b) was stable relative to N^(C) and did not follow trends in abundance (one stream negative, the other positive). We used stream flow estimates to test the alternative hypothesis that environmental factors constrain N(b). We observed an intermediate optimum autumn stream flow for both N^(b) (R(2) = 0.73, P = 0.02) and full-sibling family evenness (R(2) = 0.77, P = 0.01) in one population and a negative correlation between autumn stream flow and full-sib family evenness in the other population (r = -0.95, P = 0.02). Evidence for greater reproductive skew at the lowest and highest autumn flow was consistent with suboptimal conditions at flow extremes. A series of additional tests provided no supporting evidence for a related hypothesis that density-dependent reproductive success was responsible for the lack of relationship between N(b) and N(C) (so-called genetic compensation). This work provides evidence that N(b) is a useful metric of population-specific individual reproductive contribution for genetic monitoring across populations and the link we provide between stream flow and N(b) could be used to help predict population resilience to environmental change. © 2015 John Wiley & Sons Ltd.

  3. Broad-Scale Genetic Diversity of Cannabis for Forensic Applications.

    Directory of Open Access Journals (Sweden)

    Christophe Dufresnes

    Full Text Available Cannabis (hemp and marijuana is an iconic yet controversial crop. On the one hand, it represents a growing market for pharmaceutical and agricultural sectors. On the other hand, plants synthesizing the psychoactive THC produce the most widespread illicit drug in the world. Yet, the difficulty to reliably distinguish between Cannabis varieties based on morphological or biochemical criteria impedes the development of promising industrial programs and hinders the fight against narcotrafficking. Genetics offers an appropriate alternative to characterize drug vs. non-drug Cannabis. However, forensic applications require rapid and affordable genotyping of informative and reliable molecular markers for which a broad-scale reference database, representing both intra- and inter-variety variation, is available. Here we provide such a resource for Cannabis, by genotyping 13 microsatellite loci (STRs in 1 324 samples selected specifically for fibre (24 hemp varieties and drug (15 marijuana varieties production. We showed that these loci are sufficient to capture most of the genome-wide diversity patterns recently revealed by NGS data. We recovered strong genetic structure between marijuana and hemp and demonstrated that anonymous samples can be confidently assigned to either plant types. Fibres appear genetically homogeneous whereas drugs show low (often clonal diversity within varieties, but very high genetic differentiation between them, likely resulting from breeding practices. Based on an additional test dataset including samples from 41 local police seizures, we showed that the genetic signature of marijuana cultivars could be used to trace crime scene evidence. To date, our study provides the most comprehensive genetic resource for Cannabis forensics worldwide.

  4. Broad-Scale Genetic Diversity of Cannabis for Forensic Applications.

    Science.gov (United States)

    Dufresnes, Christophe; Jan, Catherine; Bienert, Friederike; Goudet, Jérôme; Fumagalli, Luca

    2017-01-01

    Cannabis (hemp and marijuana) is an iconic yet controversial crop. On the one hand, it represents a growing market for pharmaceutical and agricultural sectors. On the other hand, plants synthesizing the psychoactive THC produce the most widespread illicit drug in the world. Yet, the difficulty to reliably distinguish between Cannabis varieties based on morphological or biochemical criteria impedes the development of promising industrial programs and hinders the fight against narcotrafficking. Genetics offers an appropriate alternative to characterize drug vs. non-drug Cannabis. However, forensic applications require rapid and affordable genotyping of informative and reliable molecular markers for which a broad-scale reference database, representing both intra- and inter-variety variation, is available. Here we provide such a resource for Cannabis, by genotyping 13 microsatellite loci (STRs) in 1 324 samples selected specifically for fibre (24 hemp varieties) and drug (15 marijuana varieties) production. We showed that these loci are sufficient to capture most of the genome-wide diversity patterns recently revealed by NGS data. We recovered strong genetic structure between marijuana and hemp and demonstrated that anonymous samples can be confidently assigned to either plant types. Fibres appear genetically homogeneous whereas drugs show low (often clonal) diversity within varieties, but very high genetic differentiation between them, likely resulting from breeding practices. Based on an additional test dataset including samples from 41 local police seizures, we showed that the genetic signature of marijuana cultivars could be used to trace crime scene evidence. To date, our study provides the most comprehensive genetic resource for Cannabis forensics worldwide.

  5. Genetics of nonsyndromic obesity.

    Science.gov (United States)

    Lee, Yung Seng

    2013-12-01

    Common obesity is widely regarded as a complex, multifactorial trait influenced by the 'obesogenic' environment, sedentary behavior, and genetic susceptibility contributed by common and rare genetic variants. This review describes the recent advances in understanding the role of genetics in obesity. New susceptibility loci and genetic variants are being uncovered, but the collective effect is relatively small and could not explain most of the BMI heritability. Yet-to-be identified common and rare variants, epistasis, and heritable epigenetic changes may account for part of the 'missing heritability'. Evidence is emerging about the role of epigenetics in determining obesity susceptibility, mediating developmental plasticity, which confers obesity risk from early life experiences. Genetic prediction scores derived from selected genetic variants, and also differential DNA methylation levels and methylation scores, have been shown to correlate with measures of obesity and response to weight loss intervention. Genetic variants, which confer susceptibility to obesity-related morbidities like nonalcoholic fatty liver disease, were also discovered recently. We can expect discovery of more rare genetic variants with the advent of whole exome and genome sequencing, and also greater understanding of epigenetic mechanisms by which environment influences genetic expression and which mediate the gene-environment interaction.

  6. Chemical-genetic profile analysis of five inhibitory compounds in yeast.

    Science.gov (United States)

    Alamgir, Md; Erukova, Veronika; Jessulat, Matthew; Azizi, Ali; Golshani, Ashkan

    2010-08-06

    Chemical-genetic profiling of inhibitory compounds can lead to identification of their modes of action. These profiles can help elucidate the complex interactions between small bioactive compounds and the cell machinery, and explain putative gene function(s). Colony size reduction was used to investigate the chemical-genetic profile of cycloheximide, 3-amino-1,2,4-triazole, paromomycin, streptomycin and neomycin in the yeast Saccharomyces cerevisiae. These compounds target the process of protein biosynthesis. More than 70,000 strains were analyzed from the array of gene deletion mutant yeast strains. As expected, the overall profiles of the tested compounds were similar, with deletions for genes involved in protein biosynthesis being the major category followed by metabolism. This implies that novel genes involved in protein biosynthesis could be identified from these profiles. Further investigations were carried out to assess the activity of three profiled genes in the process of protein biosynthesis using relative fitness of double mutants and other genetic assays. Chemical-genetic profiles provide insight into the molecular mechanism(s) of the examined compounds by elucidating their potential primary and secondary cellular target sites. Our follow-up investigations into the activity of three profiled genes in the process of protein biosynthesis provided further evidence concerning the usefulness of chemical-genetic analyses for annotating gene functions. We termed these genes TAE2, TAE3 and TAE4 for translation associated elements 2-4.

  7. Genotator: A disease-agnostic tool for genetic annotation of disease

    Directory of Open Access Journals (Sweden)

    Jung Jae-Yoon

    2010-10-01

    Full Text Available Abstract Background Disease-specific genetic information has been increasing at rapid rates as a consequence of recent improvements and massive cost reductions in sequencing technologies. Numerous systems designed to capture and organize this mounting sea of genetic data have emerged, but these resources differ dramatically in their disease coverage and genetic depth. With few exceptions, researchers must manually search a variety of sites to assemble a complete set of genetic evidence for a particular disease of interest, a process that is both time-consuming and error-prone. Methods We designed a real-time aggregation tool that provides both comprehensive coverage and reliable gene-to-disease rankings for any disease. Our tool, called Genotator, automatically integrates data from 11 externally accessible clinical genetics resources and uses these data in a straightforward formula to rank genes in order of disease relevance. We tested the accuracy of coverage of Genotator in three separate diseases for which there exist specialty curated databases, Autism Spectrum Disorder, Parkinson's Disease, and Alzheimer Disease. Genotator is freely available at http://genotator.hms.harvard.edu. Results Genotator demonstrated that most of the 11 selected databases contain unique information about the genetic composition of disease, with 2514 genes found in only one of the 11 databases. These findings confirm that the integration of these databases provides a more complete picture than would be possible from any one database alone. Genotator successfully identified at least 75% of the top ranked genes for all three of our use cases, including a 90% concordance with the top 40 ranked candidates for Alzheimer Disease. Conclusions As a meta-query engine, Genotator provides high coverage of both historical genetic research as well as recent advances in the genetic understanding of specific diseases. As such, Genotator provides a real-time aggregation of ranked

  8. Genotator: a disease-agnostic tool for genetic annotation of disease.

    Science.gov (United States)

    Wall, Dennis P; Pivovarov, Rimma; Tong, Mark; Jung, Jae-Yoon; Fusaro, Vincent A; DeLuca, Todd F; Tonellato, Peter J

    2010-10-29

    Disease-specific genetic information has been increasing at rapid rates as a consequence of recent improvements and massive cost reductions in sequencing technologies. Numerous systems designed to capture and organize this mounting sea of genetic data have emerged, but these resources differ dramatically in their disease coverage and genetic depth. With few exceptions, researchers must manually search a variety of sites to assemble a complete set of genetic evidence for a particular disease of interest, a process that is both time-consuming and error-prone. We designed a real-time aggregation tool that provides both comprehensive coverage and reliable gene-to-disease rankings for any disease. Our tool, called Genotator, automatically integrates data from 11 externally accessible clinical genetics resources and uses these data in a straightforward formula to rank genes in order of disease relevance. We tested the accuracy of coverage of Genotator in three separate diseases for which there exist specialty curated databases, Autism Spectrum Disorder, Parkinson's Disease, and Alzheimer Disease. Genotator is freely available at http://genotator.hms.harvard.edu. Genotator demonstrated that most of the 11 selected databases contain unique information about the genetic composition of disease, with 2514 genes found in only one of the 11 databases. These findings confirm that the integration of these databases provides a more complete picture than would be possible from any one database alone. Genotator successfully identified at least 75% of the top ranked genes for all three of our use cases, including a 90% concordance with the top 40 ranked candidates for Alzheimer Disease. As a meta-query engine, Genotator provides high coverage of both historical genetic research as well as recent advances in the genetic understanding of specific diseases. As such, Genotator provides a real-time aggregation of ranked data that remains current with the pace of research in the disease

  9. Technical Update: Preimplantation Genetic Diagnosis and Screening.

    Science.gov (United States)

    Dahdouh, Elias M; Balayla, Jacques; Audibert, François; Wilson, R Douglas; Audibert, François; Brock, Jo-Ann; Campagnolo, Carla; Carroll, June; Chong, Karen; Gagnon, Alain; Johnson, Jo-Ann; MacDonald, William; Okun, Nanette; Pastuck, Melanie; Vallée-Pouliot, Karine

    2015-05-01

    technologies. Preimplantation genetic diagnosis is an alternative to prenatal diagnosis for the detection of genetic disorders in couples at risk of transmitting a genetic condition to their offspring. Preimplantation genetic screening is being proposed to improve the effectiveness of in vitro fertilization by screening for embryonic aneuploidy. Though FISH-based PGS showed adverse effects on IVF success, emerging evidence from new studies using comprehensive chromosome screening technology appears promising. Recommendations 1. Before preimplantation genetic diagnosis is performed, genetic counselling must be provided by a certified genetic counsellor to ensure that patients fully understand the risk of having an affected child, the impact of the disease on an affected child, and the benefits and limitations of all available options for preimplantation and prenatal diagnosis. (III-A) 2. Couples should be informed that preimplantation genetic diagnosis can reduce the risk of conceiving a child with a genetic abnormality carried by one or both parents if that abnormality can be identified with tests performed on a single cell or on multiple trophectoderm cells. (II-2B) 3. Invasive prenatal or postnatal testing to confirm the results of preimplantation genetic diagnosis is encouraged because the methods used for preimplantation genetic diagnosis have technical limitations that include the possibility of a false result. (II-2B) 4. Trophectoderm biopsy has no measurable impact on embryo development, as opposed to blastomere biopsy. Therefore, whenever possible, trophectoderm biopsy should be the method of choice in embryo biopsy and should be performed by experienced hands. (I-B) 5. Preimplantation genetic diagnosis of single-gene disorders should ideally be performed with multiplex polymerase chain reaction coupled with trophectoderm biopsy whenever available. (II-2B) 6. The use of comprehensive chromosome screening technology coupled with trophectoderm biopsy in preimplantation

  10. [Genetic expertise and the penal process].

    Science.gov (United States)

    Choclán Montalvo, J A

    1998-01-01

    The author reflects on the major forensic biology issues related to human genome analysis. He also discusses, from the comparative law perspective, the extent to which genetic test evidence is binding on judges. He concludes with a discussion of the influence of genetic research on people's fundamental rights.

  11. BAD knockout provides metabolic seizure resistance in a genetic model of epilepsy with sudden unexplained death in epilepsy.

    Science.gov (United States)

    Foley, Jeannine; Burnham, Veronica; Tedoldi, Meghan; Danial, Nika N; Yellen, Gary

    2018-01-01

    Metabolic alteration, either through the ketogenic diet (KD) or by genetic alteration of the BAD protein, can produce seizure protection in acute chemoconvulsant models of epilepsy. To assess the seizure-protective role of knocking out (KO) the Bad gene in a chronic epilepsy model, we used the Kcna1 -/- model of epilepsy, which displays progressively increased seizure severity and recapitulates the early death seen in sudden unexplained death in epilepsy (SUDEP). Beginning on postnatal day 24 (P24), we continuously video monitored Kcna1 -/- and Kcna1 -/- Bad -/- double knockout mice to assess survival and seizure severity. We found that Kcna1 -/- Bad -/- mice outlived Kcna1 -/- mice by approximately 2 weeks. Kcna1 -/- Bad -/- mice also spent significantly less time in seizure than Kcna1 -/- mice on P24 and the day of death, showing that BadKO provides seizure resistance in a genetic model of chronic epilepsy. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

  12. Evidence, temperature, and the laws of thermodynamics.

    Science.gov (United States)

    Vieland, Veronica J

    2014-01-01

    A primary purpose of statistical analysis in genetics is the measurement of the strength of evidence for or against hypotheses. As with any type of measurement, a properly calibrated measurement scale is necessary if we want to be able to meaningfully compare degrees of evidence across genetic data sets, across different types of genetic studies and/or across distinct experimental modalities. In previous papers in this journal and elsewhere, my colleagues and I have argued that geneticists ought to care about the scale on which statistical evidence is measured, and we have proposed the Kelvin temperature scale as a template for a context-independent measurement scale for statistical evidence. Moreover, we have claimed that, mathematically speaking, evidence and temperature may be one and the same thing. On first blush, this might seem absurd. Temperature is a property of systems following certain laws of nature (in particular, the 1st and 2nd Law of Thermodynamics) involving very physical quantities (e.g., energy) and processes (e.g., mechanical work). But what do the laws of thermodynamics have to do with statistical systems? Here I address that question. © 2014 S. Karger AG, Basel.

  13. Twins as a tool for evaluating the influence of genetic susceptibility in thyroid autoimmunity

    DEFF Research Database (Denmark)

    Brix, T H; Hegedüs, L

    2011-01-01

    irrefutable evidence of a genetic component in the aetiology of both Graves' disease and Hashimoto's thyroiditis, as well as for harbouring thyroid autoantibodies. Biometric modelling shows that approximately 75% of the total phenotypic variance in autoimmune thyroid disease is due to genetic effects. Despite......By means of large twin cohorts, it has been possible to provide relatively valid and unbiased data regarding the influence of genetic and to some extent epigenetic factors in the aetiology of thyroid autoimmunity. The comparison of concordance rates between monozygotic and dizygotic twins provides...... the well known gender difference in the prevalence of autoimmune thyroid disease, the analyzes suggest that it is the same set of genes that operate in males and females. The lack of complete phenotypic concordance in monozygotic twin pairs indicates that also environmental and/or epigenetic factors...

  14. Genetics Home Reference

    Science.gov (United States)

    ... Page Search Home Health Conditions Genes Chromosomes & mtDNA Resources Help Me Understand Genetics Share: Email Facebook Twitter Genetics Home Reference provides consumer-friendly information about the effects of genetic variation on human health. Health Conditions More than 1,200 health ...

  15. Genetic susceptibility to bilateral tinnitus in a Swedish twin cohort.

    Science.gov (United States)

    Maas, Iris Lianne; Brüggemann, Petra; Requena, Teresa; Bulla, Jan; Edvall, Niklas K; Hjelmborg, Jacob V B; Szczepek, Agnieszka J; Canlon, Barbara; Mazurek, Birgit; Lopez-Escamez, Jose A; Cederroth, Christopher R

    2017-09-01

    Genetic contributions to tinnitus have been difficult to determine due to the heterogeneity of the condition and its broad etiology. Here, we evaluated the genetic and nongenetic influences on self-reported tinnitus from the Swedish Twin Registry (STR). Cross-sectional data from the STR was obtained. Casewise concordance rates (the risk of one twin being affected given that his/her twin partner has tinnitus) were compared for monozygotic (MZ) and dizygotic (DZ) twin pairs (N = 10,464 concordant and discordant twin pairs) and heritability coefficients (the proportion of the total variance attributable to genetic factors) were calculated using biometrical model fitting procedures. Stratification of tinnitus cases into subtypes according to laterality (unilateral versus bilateral) revealed that heritability of bilateral tinnitus was 0.56; however, it was 0.27 for unilateral tinnitus. Heritability was greater in men (0.68) than in women (0.41). However, when female pairs younger than 40 years of age were selected, heritability of 0.62 was achieved with negligible effects of shared environment. Unlike unilateral tinnitus, bilateral tinnitus is influenced by genetic factors and might constitute a genetic subtype. Overall, our study provides the initial evidence for a tinnitus phenotype with a genetic influence.Genet Med advance online publication 23 March 2017.

  16. Evidence of stable genetic structure across a remote island archipelago through self-recruitment in a widely dispersed coral reef fish

    KAUST Repository

    Priest, Mark

    2012-11-19

    We used microsatellite markers to assess the population genetic structure of the scribbled rabbitfish Siganus spinus in the western Pacific. This species is a culturally important food fish in the Mariana Archipelago and subject to high fishing pressure. Our primary hypothesis was to test whether the individuals resident in the southern Mariana Island chain were genetically distinct and hence should be managed as discrete stocks. In addition to spatial sampling of adults, newly-settled individuals were sampled on Guam over four recruitment events to assess the temporal stability of the observed spatial patterns, and evidence of self-recruitment. We found significant genetic structure in S. spinus across the western Pacific, with Bayesian analyses revealing three genetically distinct clusters: the southernMariana Islands, east Micronesia, and the west Pacific; with the southern Mariana Islands beingmore strongly differentiated fromthe rest of the region. Analyses of temporal samples from Guam indicated the southern Mariana cluster was stable over time, with no genetic differentiation between adults versus recruits, or between samples collected across four separate recruitment events spanning 11 months. Subsequent assignment tests indicated seven recruits had self-recruited from within the Southern Mariana Islands population. Our results confirm the relative isolation of the southern Mariana Islands population and highlight how local processes can act to isolate populations that, by virtue of their broad-scale distribution, have been subject to traditionally high gene flows. Our results add to a growing consensus that self-recruitment is a highly significant influence on the population dynamics of tropical reef fish. 2012 The Authors. Ecology and Evolution published by Blackwell Publishing Ltd.

  17. Coexistence of two different genotypes of Sarcoptes scabiei derived from companion dogs and wild raccoon dogs in Gifu, Japan: The genetic evidence for transmission between domestic and wild canids.

    Science.gov (United States)

    Matsuyama, Ryota; Yabusaki, Toshihiro; Kuninaga, Naotoshi; Morimoto, Tomoya; Okano, Tsukasa; Suzuki, Masatsugu; Asano, Makoto

    2015-09-15

    Sarcoptes scabiei is the causal agent of sarcoptic mange in domestic/companion dogs (Canis lupus familiaris) and raccoon dogs (Nyctereutes procyonoides). Although there have been successful cases of experimental transmission of S. scabiei from mangy wild Canidae hosts to healthy dogs, and suspected cases of transmission between raccoon dogs and companion dogs, no clear-cut evidence has been obtained. In the present study, the genetic relationships between Sarcoptes mites from raccoon dogs and companion dogs living in the same region were elucidated.One hundred and thirty Sarcoptes mites from 22 raccoon dogs and 5 companion dogs were collected from the Gifu area in Japan. Using 9 microsatellite markers, the genotypes were compared, and the genetic structure of these mites was analyzed. In 6 pairs of companion dog- and raccoon dog-derived mites, 17 out of the 18 alleles analyzed were identical. Using a Bayesian approach, these 130 mites were separated into at least two groups, and companion dog- and raccoon dog-derived mites were segregated into both groups. In addition, comparatively large numbers of alleles at these loci were revealed by comparison with data from past studies. These results demonstrated that the host specificity at the 9 microsatellite-level could not be confirmed, strongly suggesting the transmission of Sarcoptes mites between raccoon dogs and companion dogs. This is the first report to provide a genetic evidence of Sarcoptes transmission between domestic and wild mammals in the natural environment. The possibility of a prior introduction of mites with novel genotypes (e.g., spillover of sarcoptic mange from domestic/companion dogs to raccoon dogs) could not be eliminated when considering the cause of the large number of alleles, and the coexistence of 2 mite groups in sympatric raccoon dogs and companion dogs in this local area. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Outlier SNP markers reveal fine-scale genetic structuring across European hake populations (Merluccius merluccius)

    DEFF Research Database (Denmark)

    Milano, I.; Babbucci, M.; Cariani, A.

    2014-01-01

    fishery. Analysis of 850 individuals from 19 locations across the entire distribution range showed evidence for several outlier loci, with significantly higher resolving power. While 299 putatively neutral SNPs confirmed the genetic break between basins (FCT = 0.016) and weak differentiation within basins...... even when neutral markers provide genetic homogeneity across populations. Here, 381 SNPs located in transcribed regions were used to assess largeand fine-scale population structure in the European hake (Merluccius merluccius), a widely distributed demersal species of high priority for the European...

  19. Possible genetic damage from diagnostic x irradiation. A review

    International Nuclear Information System (INIS)

    Withrow, T.J.; Andersen, F.A.; Yao, K.T.S.; Stratmeyer, M.E.

    1980-08-01

    Although it is known that x irradiation is capable of producing mutations and chromosomal abnormalities in experimental systems, there is little or no direct evidence of such phenomena in humans. This report reviews some human genetic diseases and chromosomal abnormalities as well as the evidence for x-ray induced mutations and chromosomal abnormalities in experimental systems. The examination of these areas reveals that spontaneous chromosomal abnormalities and genetic diseases are associated with the same type of DNA damage that x irradiation produces in experimental systems. Therefore, it is concluded that genetic radiation damage in humans may mainfest itself as an increase in the spontaneous genetic diseases rather than as any unique disease

  20. No evidence of genetic mediation in the association between birthweight and academic performance in 2,413 danish adolescent twin pairs

    DEFF Research Database (Denmark)

    Petersen, Inge; Jensen, Vibeke Myrup; McGue, Matt

    2009-01-01

    Abstract Evidence of a positive association between birthweight and IQ has been established in several studies. Analyses of within twin pair differences in birthweight and IQ have been used to shed light on the basis of the association. The strength of this approach is the possibility of controll...... and school achievements at age 16. For both sexes we observed a monotonic increase in academic performance with increasing percentiles of birthweight. However, we did not find that this association is due to genetic mediation....... twin studies find no evidence of such mediation. In the present study we use a large population-based national register study of 2,413 Danish twin-pairs from birth cohorts 1986-1990, of which we have zygosity information on 74%. We perform individual level as well as intra-pair analyses of birthweight...

  1. No Evidence of Genetic Mediation in the Association Between Birthweight and Academic Performance in 2,413 Danish Adolescent Twin Pairs

    DEFF Research Database (Denmark)

    Petersen, Inge; Jensen, Vibeke Myrup; McGue, Matt K.

    2009-01-01

    Abstract Evidence of a positive association between birthweight and IQ has been established in several studies. Analyses of within twin pair differences in birthweight and IQ have been used to shed light on the basis of the association. The strength of this approach is the possibility of controll...... and school achievements at age 16. For both sexes we observed a monotonic increase in academic performance with increasing percentiles of birthweight. However, we did not find that this association is due to genetic mediation....... twin studies find no evidence of such mediation. In the present study we use a large population-based national register study of 2,413 Danish twin-pairs from birth cohorts 1986-1990, of which we have zygosity information on 74%. We perform individual level as well as intra-pair analyses of birthweight...

  2. Attitudes Towards Prenatal Genetic Counseling, Prenatal Genetic Testing, and Termination of Pregnancy among Southeast and East Asian Women in the United States.

    Science.gov (United States)

    Tsai, Ginger J; Cameron, Carrie A; Czerwinski, Jennifer L; Mendez-Figueroa, Hector; Peterson, Susan K; Noblin, Sarah Jane

    2017-10-01

    Recognizing the heterogeneity of the Asian population with regards to acculturation, education, health awareness, and cultural values is vital for tailoring culturally sensitive and appropriate care. Prior studies show that cultural values influence perceptions of genetics within Asian populations. The reputation of the family unit factors into decisions such as pregnancy termination and disclosure of family medical history, and the nondirective model of American genetic counseling may conflict with the historical Asian model of paternalistic health care. Previous studies also provide conflicting evidence regarding correlations between education, acculturation, age, and awareness and perceptions of genetic testing. The aims of this study were to describe attitudes towards prenatal genetics among Southeast and East Asian women living in the United States for varying amounts of time and to explore sociocultural factors influencing those attitudes. Twenty-three Asian women who were members of Asian cultural organizations in the United States were interviewed via telephone about their attitudes towards prenatal genetic counseling, prenatal genetic testing, and termination of pregnancy. Responses were transcribed and coded for common themes using a thematic analysis approach. Four major themes emerged. In general, participants: (1) had diverse expectations for genetic counselors; (2) tended to weigh risks and benefits with regards to genetic testing decisions; (3) had mixed views on termination for lethal and non-lethal genetic conditions; and (4) identified cultural factors which influenced testing and termination such as lack of available resources, societal shame and stigma, and family pressure. These findings may allow prenatal genetic counselors to gain a richer, more nuanced understanding of their Asian patients and to offer culturally tailored prenatal genetic counseling.

  3. Genetic surveillance detects both clonal and epidemic transmission of malaria following enhanced intervention in Senegal.

    Directory of Open Access Journals (Sweden)

    Rachel Daniels

    Full Text Available Using parasite genotyping tools, we screened patients with mild uncomplicated malaria seeking treatment at a clinic in Thiès, Senegal, from 2006 to 2011. We identified a growing frequency of infections caused by genetically identical parasite strains, coincident with increased deployment of malaria control interventions and decreased malaria deaths. Parasite genotypes in some cases persisted clonally across dry seasons. The increase in frequency of genetically identical parasite strains corresponded with decrease in the probability of multiple infections. Further, these observations support evidence of both clonal and epidemic population structures. These data provide the first evidence of a temporal correlation between the appearance of identical parasite types and increased malaria control efforts in Africa, which here included distribution of insecticide treated nets (ITNs, use of rapid diagnostic tests (RDTs for malaria detection, and deployment of artemisinin combination therapy (ACT. Our results imply that genetic surveillance can be used to evaluate the effectiveness of disease control strategies and assist a rational global malaria eradication campaign.

  4. A High-Density Genetic Map of Wild Emmer Wheat from the Karaca Dağ Region Provides New Evidence on the Structure and Evolution of Wheat Chromosomes

    Directory of Open Access Journals (Sweden)

    Chad Jorgensen

    2017-10-01

    Full Text Available Wild emmer (Triticum turgidum ssp. dicoccoides is a progenitor of all cultivated wheat grown today. It has been hypothesized that emmer was domesticated in the Karaca Dağ region in southeastern Turkey. A total of 445 recombinant inbred lines of T. turgidum ssp. durum cv. ‘Langdon’ x wild emmer accession PI 428082 from this region was developed and genotyped with the Illumina 90K single nucleotide polymorphism Infinium assay. A genetic map comprising 2,650 segregating markers was constructed. The order of the segregating markers and an additional 8,264 co-segregating markers in the Aegilops tauschii reference genome sequence was used to compare synteny of the tetraploid wheat with the Brachypodium distachyon, rice, and sorghum. These comparisons revealed the presence of 15 structural chromosome rearrangements, in addition to the already known 4A-5A-7B rearrangements. The most common type was an intra-chromosomal translocation in which the translocated segment was short and was translocated only a short distance along the chromosome. A large reciprocal translocation, one small non-reciprocal translocation, and three large and one small paracentric inversions were also discovered. The use of inversions for a phylogeny reconstruction in the Triticum–Aegilops alliance was illustrated. The genetic map was inconsistent with the current model of evolution of the rearranged chromosomes 4A-5A-7B. Genetic diversity in the rearranged chromosome 4A showed that the rearrangements might have been contemporary with wild emmer speciation. A selective sweep was found in the centromeric region of chromosome 4A in Karaca Dağ wild emmer but not in 4A of T. aestivum. The absence of diversity from a large portion of chromosome 4A of wild emmer, believed to be ancestral to all domesticated wheat, is puzzling.

  5. Genetic evaluations for growth heat tolerance in Angus cattle.

    Science.gov (United States)

    Bradford, H L; Fragomeni, B O; Bertrand, J K; Lourenco, D A L; Misztal, I

    2016-10-01

    The objectives were to assess the impact of heat stress and to develop a model for genetic evaluation of growth heat tolerance in Angus cattle. The American Angus Association provided weaning weight (WW) and yearling weight (YW) data, and records from the Upper South region were used because of the hot climatic conditions. Heat stress was characterized by a weaning (yearling) heat load function defined as the mean temperature-humidity index (THI) units greater than 75 (70) for 30 (150) d prior to the weigh date. Therefore, a weaning (yearling) heat load of 5 units corresponded to 80 (75) for the corresponding period prior to the weigh date. For all analyses, 82,669 WW and 69,040 YW were used with 3 ancestral generations in the pedigree. Univariate models were a proxy for the Angus growth evaluation, and reaction norms using 2 B-splines for heat load were fit separately for weaning and yearling heat loads. For both models, random effects included direct genetic, maternal genetic, maternal permanent environment (WW only), and residual. Fixed effects included a linear age covariate, age-of-dam class (WW only), and contemporary group for both models and fixed regressions on the B-splines in the reaction norm. Direct genetic correlations for WW were strong for modest heat load differences but decreased to less than 0.50 for large differences. Reranking of proven sires occurred for only WW direct effects for the reaction norms with extreme heat load differences. Conversely, YW results indicated little effect of heat stress on genetic merit. Therefore, weaning heat tolerance was a better candidate for developing selection tools. Maternal heritabilities were consistent across heat loads, and maternal genetic correlations were greater than 0.90 for nearly all heat load combinations. No evidence existed for a genotype × environment interaction for the maternal component of growth. Overall, some evidence exists for phenotypic plasticity for the direct genetic effects of WW

  6. What Is Genetic Ancestry Testing?

    Science.gov (United States)

    ... What is genetic ancestry testing? What is genetic ancestry testing? Genetic ancestry testing, or genetic genealogy, is ... with other groups. For more information about genetic ancestry testing: The University of Utah provides video tutorials ...

  7. Genetic Evidence for Recent Population Mixture in India

    OpenAIRE

    Moorjani, Priya; Thangaraj, Kumarasamy; Patterson, Nick; Lipson, Mark; Loh, Po-Ru; Govindaraj, Periyasamy; Berger, Bonnie; Reich, David; Singh, Lalji

    2013-01-01

    Most Indian groups descend from a mixture of two genetically divergent populations: Ancestral North Indians (ANI) related to Central Asians, Middle Easterners, Caucasians, and Europeans; and Ancestral South Indians (ASI) not closely related to groups outside the subcontinent. The date of mixture is unknown but has implications for understanding Indian history. We report genome-wide data from 73 groups from the Indian subcontinent and analyze linkage disequilibrium to estimate ANI-ASI mixture ...

  8. A longitudinal cline characterizes the genetic structure of human populations in the Tibetan plateau

    Science.gov (United States)

    Peter, Benjamin M.; Basnyat, Buddha; Neupane, Maniraj; Beall, Cynthia M.; Childs, Geoff; Craig, Sienna R.; Novembre, John; Di Rienzo, Anna

    2017-01-01

    Indigenous populations of the Tibetan plateau have attracted much attention for their good performance at extreme high altitude. Most genetic studies of Tibetan adaptations have used genetic variation data at the genome scale, while genetic inferences about their demography and population structure are largely based on uniparental markers. To provide genome-wide information on population structure, we analyzed new and published data of 338 individuals from indigenous populations across the plateau in conjunction with worldwide genetic variation data. We found a clear signal of genetic stratification across the east-west axis within Tibetan samples. Samples from more eastern locations tend to have higher genetic affinity with lowland East Asians, which can be explained by more gene flow from lowland East Asia onto the plateau. Our findings corroborate a previous report of admixture signals in Tibetans, which were based on a subset of the samples analyzed here, but add evidence for isolation by distance in a broader geospatial context. PMID:28448508

  9. [Evolutionary process unveiled by the maximum genetic diversity hypothesis].

    Science.gov (United States)

    Huang, Yi-Min; Xia, Meng-Ying; Huang, Shi

    2013-05-01

    As two major popular theories to explain evolutionary facts, the neutral theory and Neo-Darwinism, despite their proven virtues in certain areas, still fail to offer comprehensive explanations to such fundamental evolutionary phenomena as the genetic equidistance result, abundant overlap sites, increase in complexity over time, incomplete understanding of genetic diversity, and inconsistencies with fossil and archaeological records. Maximum genetic diversity hypothesis (MGD), however, constructs a more complete evolutionary genetics theory that incorporates all of the proven virtues of existing theories and adds to them the novel concept of a maximum or optimum limit on genetic distance or diversity. It has yet to meet a contradiction and explained for the first time the half-century old Genetic Equidistance phenomenon as well as most other major evolutionary facts. It provides practical and quantitative ways of studying complexity. Molecular interpretation using MGD-based methods reveal novel insights on the origins of humans and other primates that are consistent with fossil evidence and common sense, and reestablished the important role of China in the evolution of humans. MGD theory has also uncovered an important genetic mechanism in the construction of complex traits and the pathogenesis of complex diseases. We here made a series of sequence comparisons among yeasts, fishes and primates to illustrate the concept of limit on genetic distance. The idea of limit or optimum is in line with the yin-yang paradigm in the traditional Chinese view of the universal creative law in nature.

  10. Genetically meaningful phenotypic subgroups in autism spectrum disorders.

    Science.gov (United States)

    Veatch, O J; Veenstra-Vanderweele, J; Potter, M; Pericak-Vance, M A; Haines, J L

    2014-03-01

    Autism spectrum disorder (ASD) is a complex neurodevelopmental disorder with strong evidence for genetic susceptibility. However, the effect sizes for implicated chromosomal loci are small, hard to replicate and current evidence does not explain the majority of the estimated heritability. Phenotypic heterogeneity could be one phenomenon complicating identification of genetic factors. We used data from the Autism Diagnostic Interview-Revised, Autism Diagnostic Observation Schedule, Vineland Adaptive Behavior Scales, head circumferences, and ages at exams as classifying variables to identify more clinically similar subgroups of individuals with ASD. We identified two distinct subgroups of cases within the Autism Genetic Resource Exchange dataset, primarily defined by the overall severity of evaluated traits. In addition, there was significant familial clustering within subgroups (odds ratio, OR ≈ 1.38-1.42, P definition that should increase power to detect genetic factors influencing risk for ASD. © 2013 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  11. The Human Salivary Microbiome Is Shaped by Shared Environment Rather than Genetics: Evidence from a Large Family of Closely Related Individuals.

    Science.gov (United States)

    Shaw, Liam; Ribeiro, Andre L R; Levine, Adam P; Pontikos, Nikolas; Balloux, Francois; Segal, Anthony W; Roberts, Adam P; Smith, Andrew M

    2017-09-12

    The human microbiome is affected by multiple factors, including the environment and host genetics. In this study, we analyzed the salivary microbiomes of an extended family of Ashkenazi Jewish individuals living in several cities and investigated associations with both shared household and host genetic similarities. We found that environmental effects dominated over genetic effects. While there was weak evidence of geographical structuring at the level of cities, we observed a large and significant effect of shared household on microbiome composition, supporting the role of the immediate shared environment in dictating the presence or absence of taxa. This effect was also seen when including adults who had grown up in the same household but moved out prior to the time of sampling, suggesting that the establishment of the salivary microbiome earlier in life may affect its long-term composition. We found weak associations between host genetic relatedness and microbiome dissimilarity when using family pedigrees as proxies for genetic similarity. However, this association disappeared when using more-accurate measures of kinship based on genome-wide genetic markers, indicating that the environment rather than host genetics is the dominant factor affecting the composition of the salivary microbiome in closely related individuals. Our results support the concept that there is a consistent core microbiome conserved across global scales but that small-scale effects due to a shared living environment significantly affect microbial community composition. IMPORTANCE Previous research shows that the salivary microbiomes of relatives are more similar than those of nonrelatives, but it remains difficult to distinguish the effects of relatedness and shared household environment. Furthermore, pedigree measures may not accurately measure host genetic similarity. In this study, we include genetic relatedness based on genome-wide single nucleotide polymorphisms (SNPs) (rather than

  12. The genetics of obstructive sleep apnoea.

    LENUS (Irish Health Repository)

    Kent, Brian D

    2012-02-01

    PURPOSE OF REVIEW: Obstructive sleep apnoea syndrome (OSAS) is a highly prevalent disorder associated with reduced quality of life and adverse cardiovascular and metabolic sequelae. Recent years have seen an intensification of the research effort to establish the genetic contribution to the development of OSAS and its sequelae. This review explores emerging evidence in this field. RECENT FINDINGS: A genetic basis for sleep-disordered breathing has been demonstrated for discrete disorders such as Treacher-Collins and Down syndromes, but the picture is less clear in so-called idiopathic OSAS. A degree of heritability appears likely in some of the intermediate phenotypes that lead to OSAS, particularly craniofacial morphology. However, only sparse and often contradictory evidence exists regarding the role of specific polymorphisms in causing OSAS in the general population. Similarly, investigations of the cardiovascular sequelae of OSAS have in general failed to consistently find single causative genetic mutations. Nonetheless, evidence suggests a role for tumour necrosis factor-alpha polymorphisms in particular, and large-scale family studies have suggested shared pathogenetic pathways for the development of obesity and OSAS. SUMMARY: As with other common disorders, OSAS is likely to result from multiple gene-gene interactions occurring in a suitable environment. The application of modern genetic investigative techniques, such as genome-wide association studies, may facilitate new discoveries in this field.

  13. Characterization of early follicular cDNA library suggests evidence for genetic polymorphisms in the inbred strain C108 of Bombyx mori.

    Science.gov (United States)

    Mills, D R; Goldsmith, M R

    2000-04-01

    Recent work towards the completion of a saturated molecular genetic linkage map for the lepidopteran silkworm, Bombyx mori (n = 28), has provided evidence for existing polymorphisms in the inbred strain C108. Two inbred parental strains, p50 and C108, were crossed to produce the F1 (P/C) hybrid offspring. The populations used in this project were comprised of a combination of 29 F2 (F1 x F1) and 31 reciprocal backcross (P/C x C/C, P/C x P/P) progeny. All restriction fragment length polymorphisms (RFLPs) for the initial analysis were hybridized with anonymous probes derived from a random early follicular cDNA (Rcf) library from Bombyx. A total of 19 Rcf probes were selected as showing scorable codominant polymorphic patterns when screened against F2 and backcross DNAs digested with the restriction enzymes EcoRI, HindIII, or PstI, and Southern blotted to nylon membranes for hybridization. Of the newly reported Rcf probes, 7 (37%) were characterized as producing 'simple' polymorphic patterns, while 12 (63%) were characterized as producing 'complex' polymorphic patterns. Further characterization of the complex patterns subdivided this group into two general classes: polymorphisms that contained an additional allele, and multiple bands that contained an easily scored two banded polymorphism. Because the extra allele class was limited to the (P/C x C/C) backcross progeny, it is suggested that the inbred parental strain C108 harbors polymorphic loci that are inherited in a simple Mendelian fashion. A genetic analysis discussing plausible origins and maintenance of these polymorphisms is presented.

  14. Genetics education for non-genetic health care professionals in the Netherlands

    NARCIS (Netherlands)

    Plass, Anne Marie C.; Baars, Marieke J. H.; Beemer, Frits A.; ten Kate, Leo P.

    2006-01-01

    OBJECTIVE: The aim of the present study was to investigate whether medical care providers in the Netherlands are adequately educated in genetics by collecting information about the current state of genetics education of non-genetics health care professionals. METHOD: The curricula of the 8

  15. The Tourette International Collaborative Genetics (TIC Genetics) study, finding the genes causing Tourette syndrome: objectives and methods.

    Science.gov (United States)

    Dietrich, Andrea; Fernandez, Thomas V; King, Robert A; State, Matthew W; Tischfield, Jay A; Hoekstra, Pieter J; Heiman, Gary A

    2015-02-01

    Tourette syndrome (TS) is a neuropsychiatric disorder characterized by recurrent motor and vocal tics, often accompanied by obsessive-compulsive disorder and/or attention-deficit/hyperactivity disorder. While the evidence for a genetic contribution is strong, its exact nature has yet to be clarified fully. There is now mounting evidence that the genetic risks for TS include both common and rare variants and may involve complex multigenic inheritance or, in rare cases, a single major gene. Based on recent progress in many other common disorders with apparently similar genetic architectures, it is clear that large patient cohorts and open-access repositories will be essential to further advance the field. To that end, the large multicenter Tourette International Collaborative Genetics (TIC Genetics) study was established. The goal of the TIC Genetics study is to undertake a comprehensive gene discovery effort, focusing both on familial genetic variants with large effects within multiply affected pedigrees and on de novo mutations ascertained through the analysis of apparently simplex parent-child trios with non-familial tics. The clinical data and biomaterials (DNA, transformed cell lines, RNA) are part of a sharing repository located within the National Institute for Mental Health Center for Collaborative Genomics Research on Mental Disorders, USA, and will be made available to the broad scientific community. This resource will ultimately facilitate better understanding of the pathophysiology of TS and related disorders and the development of novel therapies. Here, we describe the objectives and methods of the TIC Genetics study as a reference for future studies from our group and to facilitate collaboration between genetics consortia in the field of TS.

  16. A cat's tale: the impact of genetic restoration on Florida panther population dynamics and persistence.

    Science.gov (United States)

    Hostetler, Jeffrey A; Onorato, David P; Jansen, Deborah; Oli, Madan K

    2013-05-01

    1. Genetic restoration has been suggested as a management tool for mitigating detrimental effects of inbreeding depression in small, inbred populations, but the demographic mechanisms underlying population-level responses to genetic restoration remain poorly understood. 2. We studied the dynamics and persistence of the endangered Florida panther Puma concolor coryi population and evaluated the potential influence of genetic restoration on population growth and persistence parameters. As part of the genetic restoration programme, eight female Texas pumas P. c. stanleyana were released into Florida panther habitat in southern Florida in 1995. 3. The overall asymptotic population growth rate (λ) was 1.04 (5th and 95th percentiles: 0.95-1.14), suggesting an increase in the panther population of approximately 4% per year. Considering the effects of environmental and demographic stochasticities and density-dependence, the probability that the population will fall below 10 panthers within 100 years was 0.072 (0-0.606). 4. Our results suggest that the population would have declined at 5% per year (λ = 0.95; 0.83-1.08) in the absence of genetic restoration. Retrospective life table response experiment analysis revealed that the positive effect of genetic restoration on survival of kittens was primarily responsible for the substantial growth of the panther population that would otherwise have been declining. 5. For comparative purposes, we also estimated probability of quasi-extinction under two scenarios - implementation of genetic restoration and no genetic restoration initiative - using the estimated abundance of panthers in 1995, the year genetic restoration was initiated. Assuming no density-dependence, the probability that the panther population would fall below 10 panthers by 2010 was 0.098 (0.002-0.332) for the restoration scenario and 0.445 (0.032-0.944) for the no restoration scenario, providing further evidence that the panther population would have faced a

  17. Population genetics and cryptic species

    International Nuclear Information System (INIS)

    McPheron, Bruce A.

    2000-01-01

    Does the definition of a species matter for pest management purposes? Taxonomists provide us with tools - usually morphological characters - to identify a group of organisms that we call a species. The implication of this identification is that all of the individuals that fit the provided description are members of the species in question. The taxonomists have considered the range of variation among individuals in defining the species, but this variation is often forgotten when we take the concept of species to the level of management. Just as there is morphological variation among individuals, there is also variation in practically any character we might imagine, which has implications for the short and long term success of our management tactics. The rich literature on insecticide resistance should be a constant reminder of the fact that the pressure on pest survival and reproduction applied by our management approaches frequently leads to evolutionary changes within the pest species. The degree of variation within a particular species is a defining characteristic of that species. This level of variability may have very important implications for successful management, so it is very important to measure variation and, whenever possible, the genetic basis of that variation, in a target species. Population genetic approaches can provide evidence of genetic structure (or lack thereof) among populations of a species. These types of data can be used to discuss the movement of pest populations on a local or global scale. In other cases, we may have a complex of species that share some, but not all, characteristics. Species complexes that share morphological characters (i.e., cannot be easily distinguished) but not biological characters are referred to as sibling or cryptic species

  18. ESTIMATION OF RECURRENCE RISK AND GENETIC COUNSELLING OF FAMILIES WITH EVIDENCE OF ISOLATED (UNSYNDROMIC CLEFT LIP AND PALATE IN SUCEAVA COUNTY, ROMANIA

    Directory of Open Access Journals (Sweden)

    Crsitian Tudose

    2007-08-01

    Full Text Available : Cleft lip and/or palate are the most frequent facial congenital malformations and represent a dramatic situation at birth, which involves important functional, aesthetic, psychological and social impairment that motivates the necessity of a thorough genetic study in the view of genetic counselling. We have studied the families of 100 children with clefts born during the years 1985-1996 in Suceava county and selected from the evidences of the Children Hospital Suceava. The recurrence risk was determined in accordance with the rules of calculation for multifactorial inheritance; it varied between 2 – 5% for the majority of cases (77% which corresponds to a small risk degree; only in 23% of cases the risk varied between 6 – 15% which corresponds to a medium risk degree

  19. Deciphering the genomes of 16 Acanthamoeba species does not provide evidence of integration of known giant virus-associated mobile genetic elements.

    Science.gov (United States)

    Chelkha, Nisrine; Colson, Philippe; Levasseur, Anthony; La Scola, Bernard

    2018-06-02

    Giant viruses infect protozoa, especially amoebae of the genus Acanthamoeba. These viruses possess genetic elements named Mobilome. So far, this mobilome comprises provirophages which are integrated into the genome of their hosts, transpovirons, and Maverick/Polintons. Virophages replicate inside virus factories within Acanthamoeba and can decrease the infectivity of giant viruses. The virophage infecting CroV was found to be integrated in the host of CroV, Cafeteria roenbergensis, thus protecting C. roenbergensis by reduction of CroV multiplication. Because of this unique property, assessment of the mechanisms of replication of virophages and their relationship with giant viruses is a key element of this investigation. This work aimed at evaluating the presence and the dynamic of these mobile elements in sixteen Acanthamoeba genomes. No significant traces of the integration of genomes or sequences from known virophages were identified in all the available Acanthamoeba genomes. These results brought us to hypothesize that the interactions between mimiviruses and their virophages might occur through different mechanisms, or at low frequency. An additional explanation could be that our knowledge of the diversity of virophages is still very limited. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Fractured genetic connectivity threatens a southern california puma (Puma concolor population.

    Directory of Open Access Journals (Sweden)

    Holly B Ernest

    Full Text Available Pumas (Puma concolor; also known as mountain lions and cougars in southern California live among a burgeoning human population of roughly 20 million people. Yet little is known of the consequences of attendant habitat loss and fragmentation, and human-caused puma mortality to puma population viability and genetic diversity. We examined genetic status of pumas in coastal mountains within the Peninsular Ranges south of Los Angeles, in San Diego, Riverside, and Orange counties. The Santa Ana Mountains are bounded by urbanization to the west, north, and east, and are separated from the eastern Peninsular Ranges to the southeast by a ten lane interstate highway (I-15. We analyzed DNA samples from 97 pumas sampled between 2001 and 2012. Genotypic data for forty-six microsatellite loci revealed that pumas sampled in the Santa Ana Mountains (n = 42 displayed lower genetic diversity than pumas from nearly every other region in California tested (n = 257, including those living in the Peninsular Ranges immediately to the east across I-15 (n = 55. Santa Ana Mountains pumas had high average pairwise relatedness, high individual internal relatedness, a low estimated effective population size, and strong evidence of a bottleneck and isolation from other populations in California. These and ecological findings provide clear evidence that Santa Ana Mountains pumas have been experiencing genetic impacts related to barriers to gene flow, and are a warning signal to wildlife managers and land use planners that mitigation efforts will be needed to stem further genetic and demographic decay in the Santa Ana Mountains puma population.

  1. The 5-HT2A receptor binding pattern in the human brain is strongly genetically determined

    DEFF Research Database (Denmark)

    Pinborg, Lars H; Arfan, Haroon; Haugbol, Steven

    2007-01-01

    With the appropriate radiolabeled tracers, positron emission tomography (PET) enables in vivo human brain imaging of markers for neurotransmission, including neurotransmitter synthesis, receptors, and transporters. Whereas structural imaging studies have provided compelling evidence that the human...... brain anatomy is largely genetically determined, it is currently unknown to what degree neuromodulatory markers are subjected to genetic and environmental influence. Changes in serotonin 2A (5-HT(2A)) receptors have been reported to occur in various neuropsychiatric disorders and an association between...

  2. Chemical-genetic profile analysis of five inhibitory compounds in yeast

    Directory of Open Access Journals (Sweden)

    Alamgir Md

    2010-08-01

    Full Text Available Abstract Background Chemical-genetic profiling of inhibitory compounds can lead to identification of their modes of action. These profiles can help elucidate the complex interactions between small bioactive compounds and the cell machinery, and explain putative gene function(s. Results Colony size reduction was used to investigate the chemical-genetic profile of cycloheximide, 3-amino-1,2,4-triazole, paromomycin, streptomycin and neomycin in the yeast Saccharomyces cerevisiae. These compounds target the process of protein biosynthesis. More than 70,000 strains were analyzed from the array of gene deletion mutant yeast strains. As expected, the overall profiles of the tested compounds were similar, with deletions for genes involved in protein biosynthesis being the major category followed by metabolism. This implies that novel genes involved in protein biosynthesis could be identified from these profiles. Further investigations were carried out to assess the activity of three profiled genes in the process of protein biosynthesis using relative fitness of double mutants and other genetic assays. Conclusion Chemical-genetic profiles provide insight into the molecular mechanism(s of the examined compounds by elucidating their potential primary and secondary cellular target sites. Our follow-up investigations into the activity of three profiled genes in the process of protein biosynthesis provided further evidence concerning the usefulness of chemical-genetic analyses for annotating gene functions. We termed these genes TAE2, TAE3 and TAE4 for translation associated elements 2-4.

  3. A genetic deconstruction of neurocognitive traits in schizophrenia and bipolar disorder.

    Directory of Open Access Journals (Sweden)

    Carla P D Fernandes

    Full Text Available Impairments in cognitive functions are common in patients suffering from psychiatric disorders, such as schizophrenia and bipolar disorder. Cognitive traits have been proposed as useful for understanding the biological and genetic mechanisms implicated in cognitive function in healthy individuals and in the dysfunction observed in psychiatric disorders.Sets of genes associated with a range of cognitive functions often impaired in schizophrenia and bipolar disorder were generated from a genome-wide association study (GWAS on a sample comprising 670 healthy Norwegian adults who were phenotyped for a broad battery of cognitive tests. These gene sets were then tested for enrichment of association in GWASs of schizophrenia and bipolar disorder. The GWAS data was derived from three independent single-centre schizophrenia samples, three independent single-centre bipolar disorder samples, and the multi-centre schizophrenia and bipolar disorder samples from the Psychiatric Genomics Consortium.The strongest enrichments were observed for visuospatial attention and verbal abilities sets in bipolar disorder. Delayed verbal memory was also enriched in one sample of bipolar disorder. For schizophrenia, the strongest evidence of enrichment was observed for the sets of genes associated with performance in a colour-word interference test and for sets associated with memory learning slope.Our results are consistent with the increasing evidence that cognitive functions share genetic factors with schizophrenia and bipolar disorder. Our data provides evidence that genetic studies using polygenic and pleiotropic models can be used to link specific cognitive functions with psychiatric disorders.

  4. From the genome to the phenome and back: linking genes with human brain function and structure using genetically informed neuroimaging

    DEFF Research Database (Denmark)

    Siebner, H R; Callicott, J H; Sommer, T

    2009-01-01

    In recent years, an array of brain mapping techniques has been successfully employed to link individual differences in circuit function or structure in the living human brain with individual variations in the human genome. Several proof-of-principle studies provided converging evidence that brain...... imaging can establish important links between genes and behaviour. The overarching goal is to use genetically informed brain imaging to pinpoint neurobiological mechanisms that contribute to behavioural intermediate phenotypes or disease states. This special issue on "Linking Genes to Brain Function...... in Health and Disease" provides an overview over how the "imaging genetics" approach is currently applied in the various fields of systems neuroscience to reveal the genetic underpinnings of complex behaviours and brain diseases. While the rapidly emerging field of imaging genetics holds great promise...

  5. Genetic consequences of trumpeter swan (Cygnus buccinator) reintroductions

    Science.gov (United States)

    Ransler, F.A.; Quinn, T.W.; Oyler-McCance, S.J.

    2011-01-01

    Relocation programs are often initiated to restore threatened species to previously occupied portions of their range. A primary challenge of restoration efforts is to translocate individuals in a way that prevents loss of genetic diversity and decreases differentiation relative to source populations-a challenge that becomes increasingly difficult when remnant populations of the species are already genetically depauperate. Trumpeter swans were previously extirpated in the entire eastern half of their range. Physical translocations of birds over the last 70 years have restored the species to portions of its historical range. Despite the long history of management, there has been little monitoring of the genetic outcomes of these restoration attempts. We assessed the consequences of this reintroduction program by comparing patterns of genetic variation at 17 microsatellite loci across four restoration flocks (three wild-released, one captive) and their source populations. We found that a wild-released population established from a single source displayed a trend toward reduced genetic diversity relative to and significant genetic differentiation from its source population, though small founder population effects may also explain this pattern. Wild-released flocks restored from multiple populations maintained source levels of genetic variation and lacked significant differentiation from at least one of their sources. Further, the flock originating from a single source revealed significantly lower levels of genetic variation than those established from multiple sources. The distribution of genetic variation in the captive flock was similar to its source. While the case of trumpeter swans provides evidence that restorations from multiple versus single source populations may better preserve natural levels of genetic diversity, more studies are needed to understand the general applicability of this management strategy. ?? 2010 Springer Science+Business Media B.V. (outside

  6. STrengthening the REporting of Genetic Association Studies (STREGA – An Extension of the STROBE Statement

    Directory of Open Access Journals (Sweden)

    Julian Little

    2009-09-01

    Full Text Available Making sense of rapidly evolving evidence on genetic associations is crucial to making genuine advances in human genomics and the eventual integration of this information in the practice of medicine and public health. Assessment of the strengths and weaknesses of this evidence, and hence the ability to synthesize it, has been limited by inadequate reporting of results. The STrengthening the REporting of Genetic Association studies (STREGA initiative builds on the Strengthening the Reporting of Observational Studies in Epidemiology (STROBE Statement and provides additions to 12 of the 22 items on the STROBE checklist. The additions concern population stratification, genotyping errors, modelling haplotype variation, Hardy-Weinberg equilibrium, replication, selection of participants, rationale for choice of genes and variants, treatment effects in studying quantitative traits, statistical methods, relatedness, reporting of descriptive and outcome data, and the volume of data issues that are important to consider in genetic association studies. The STREGA recommendations do not prescribe or dictate how a genetic association study should be designed but seek to enhance the transparency of its reporting, regardless of choices made during design, conduct, or analysis.

  7. Genetic variation in threshold reaction norms for alternative reproductive tactics in male Atlantic salmon, Salmo salar.

    Science.gov (United States)

    Piché, Jacinthe; Hutchings, Jeffrey A; Blanchard, Wade

    2008-07-07

    Alternative reproductive tactics may be a product of adaptive phenotypic plasticity, such that discontinuous variation in life history depends on both the genotype and the environment. Phenotypes that fall below a genetically determined threshold adopt one tactic, while those exceeding the threshold adopt the alternative tactic. We report evidence of genetic variability in maturation thresholds for male Atlantic salmon (Salmo salar) that mature either as large (more than 1 kg) anadromous males or as small (10-150 g) parr. Using a common-garden experimental protocol, we find that the growth rate at which the sneaker parr phenotype is expressed differs among pure- and mixed-population crosses. Maturation thresholds of hybrids were intermediate to those of pure crosses, consistent with the hypothesis that the life-history switch points are heritable. Our work provides evidence, for a vertebrate, that thresholds for alternative reproductive tactics differ genetically among populations and can be modelled as discontinuous reaction norms for age and size at maturity.

  8. Genetic and nutrition development of indigenous chicken in Africa

    DEFF Research Database (Denmark)

    Khobondo, J O; Muasya, T K; Miyumo, S

    2015-01-01

    This review gives insights into genetic and feeding regime development for indigenous chicken genetic resources. We highlight and combine confirming evidence of genetic diversity and variability using morphological and molecular techniques. We further discuss previous past and current genetic...... requirement for indigenous chicken and report nutritive contents of various local feedstuffs under various production systems. Various conservation strategies for sustainable utilization are hereby reviewed...

  9. Magnetic resonance imaging provides evidence of glymphatic drainage from human brain to cervical lymph nodes.

    Science.gov (United States)

    Eide, Per Kristian; Vatnehol, Svein Are Sirirud; Emblem, Kyrre Eeg; Ringstad, Geir

    2018-05-08

    Pre-clinical research in rodents provides evidence that the central nervous system (CNS) has functional lymphatic vessels. In-vivo observations in humans, however, are not demonstrated. We here show data on CNS lymphatic drainage to cervical lymph nodes in-vivo by magnetic resonance imaging (MRI) enhanced with an intrathecal contrast agent as a cerebrospinal fluid (CSF) tracer. Standardized MRI of the intracranial compartment and the neck were acquired before and up to 24-48 hours following intrathecal contrast agent administration in 19 individuals. Contrast enhancement was radiologically confirmed by signal changes in CSF nearby inferior frontal gyrus, brain parenchyma of inferior frontal gyrus, parahippocampal gyrus, thalamus and pons, and parenchyma of cervical lymph node, and with sagittal sinus and neck muscle serving as reference tissue for cranial and neck MRI acquisitions, respectively. Time series of changes in signal intensity shows that contrast enhancement within CSF precedes glymphatic enhancement and peaks at 4-6 hours following intrathecal injection. Cervical lymph node enhancement coincides in time with peak glymphatic enhancement, with peak after 24 hours. Our findings provide in-vivo evidence of CSF tracer drainage to cervical lymph nodes in humans. The time course of lymph node enhancement coincided with brain glymphatic enhancement rather than with CSF enhancement.

  10. Improvement of beef cattle genetics provided increasing sustainability of beef cattle production and protein consumption in Thailand

    Energy Technology Data Exchange (ETDEWEB)

    Boonyanuwat, K. [Beef Cattle Research and Development Group, Division of Animal Husbandry, Department of Livestock Development, Bangkok (Thailand)], E-mail: kalayabo@yahoo.com; Sirisom, P [Tak Livestock Breeding and Research Center, Meung (Thailand); Putharatanung, A [Nongkwang Livestock Research and Breeding Center, Photharam (Thailand)

    2009-07-01

    .00%. They were the smallest size. Farmers raised them by main of grass-fed and some added with concentrate. Meat quality from this group was the lowest. The meat texture of this group is the most firm. It was suitable for Thai food cooking. Meat from this group was used to make meatball and Thai food. The second group was around 38.50%. They were fattening 3-6 month. Meat from this group was medium quality. Farmers fed them with grass, agricultural by product, and concentrate. Meat from this group was used for general Thai food and steak cooking. The third and forth group were around 20.00%. In this group, it was added with other beef cattle: Kampangsaen and Ponyangkhum beef cattle. They were fed higher concentrate, up to 90% of concentrate in the last month of fattening. They were fattening 6-12 month. Farmers fed them following feeding plan of cooperative, so they had the greatest ADG and % carcass. Quality of meat from this group was the best, most tender. Meat from this group was used for steak and shabushabu. Meat from this group had quality the same as import meat. Some of them were better than import meat. It was tenderer. The fifth group was less than 0.5%. They were on experiment to establish new breed by DLD. This group was optimized for Thai farmers, small size and low mature age. Meat from this group had the most tenderness and marbling. Meat from this group had more quality than import meat. It was used for steak and shabushabu. Farmers could earn money from beef cattle raising occupation. Beef cattle genetic improvement provided sustainable productivity, profitability, quality of products, and sustained economic growth in rural Thailand. Beef meat production would be the mainly red meat production and provided protein sources for consumer in Thailand. (author)

  11. Genetic evidence for gonochoristic reproduction in gynogenetic silver crucian carp (Carassius auratus gibelio bloch) as revealed by RAPD assays.

    Science.gov (United States)

    Zhou, L; Wang, Y; Gui, J F

    2000-11-01

    Sex evolution has been a debating focus in evolutionary genetics. In lower vertebrates of reptiles, amphibians, and fish, a species or a bioform reproduces either sexually or asexually but never both. A few species were found to consist of all females in fish. These all-female species can propagate by asexual reproduction modes, such as gynogenesis and hybridogenesis. However, the coexistence of sexuality and asexuality in a single species was recently noted only in a cyprinid fish silver crucian carp, Carassius auratus gibelio. This fish had been demonstrated to be capable of gynogenesis stimulated by sperm from other related species. Surprisingly, natural populations of this fish consist of a minor but significant portion (approx. 20%) of males. As different clones with specific phenotypic and genetic characteristics have been found, and RAPD markers specific to each clone have recently been identified, this fish offers many advantages for analyzing whether or not genetic recombination occurs between different clones. In this study, artificial propagation was performed in clone F and clone D. Ovulated eggs from clone F were divided into two parts and respectively inseminated with sperm from a clone D male and from a red common carp (Cyprinus carpio) male. The control clone D individuals were selected from gynogenetic offspring of clone D activated by sperm of red common carp. The phenotype and sex ratio in the experimental groups were also observed. Using RAPD molecular markers, which allow for reliable discrimination and genetic analysis of different clones, we have revealed direct molecular evidence for gonochoristic reproduction in the gynogenetic silver crucian carp and confirmed a previous hypothesis that the silver crucian carp might reproduce both gynogenetically and gonochoristically. Therefore, we conclude that the silver crucian carp possesses two reproductive modes, i.e., gynogenetic and gonochoristic reproduction. The response mechanism of two

  12. Coping with genetic diversity: the contribution of pathogen and human genomics to modern vaccinology

    International Nuclear Information System (INIS)

    Lemaire, D.; Barbosa, T.; Rihet, P.

    2011-01-01

    Vaccine development faces major difficulties partly because of genetic variation in both infectious organisms and humans. This causes antigenic variation in infectious agents and a high interindividual variability in the human response to the vaccine. The exponential growth of genome sequence information has induced a shift from conventional culture-based to genome-based vaccinology, and allows the tackling of challenges in vaccine development due to pathogen genetic variability. Additionally, recent advances in immunogenetics and genomics should help in the understanding of the influence of genetic factors on the interindividual and interpopulation variations in immune responses to vaccines, and could be useful for developing new vaccine strategies. Accumulating results provide evidence for the existence of a number of genes involved in protective immune responses that are induced either by natural infections or vaccines. Variation in immune responses could be viewed as the result of a perturbation of gene networks; this should help in understanding how a particular polymorphism or a combination thereof could affect protective immune responses. Here we will present: i) the first genome-based vaccines that served as proof of concept, and that provided new critical insights into vaccine development strategies; ii) an overview of genetic predisposition in infectious diseases and genetic control in responses to vaccines; iii) population genetic differences that are a rationale behind group-targeted vaccines; iv) an outlook for genetic control in infectious diseases, with special emphasis on the concept of molecular networks that will provide a structure to the huge amount of genomic data

  13. Nonmotor symptoms in genetic Parkinson disease

    DEFF Research Database (Denmark)

    Kasten, Meike; Kertelge, Lena; Brüggemann, Norbert

    2010-01-01

    To review current knowledge on nonmotor symptoms (NMS), particularly psychiatric features, in genetic Parkinson disease (PD) and to provide original data for genetic and idiopathic PD.......To review current knowledge on nonmotor symptoms (NMS), particularly psychiatric features, in genetic Parkinson disease (PD) and to provide original data for genetic and idiopathic PD....

  14. [Genetics and epigenetics in autism].

    Science.gov (United States)

    Nakayama, Atsuo; Masaki, Shiego; Aoki, Eiko

    2006-11-01

    Autism is a behaviorally defined syndrome characterized by impaired social interaction and communication, and restricted, stereotyped interests and behaviors. Several lines of evidence support the contention that genetic factors are a large component to autism etiology. However, in spite of vigorous genetic studies, no single causative or susceptibility gene common in autism has been identified. Thus multiple susceptibility genes in interaction are considered to account for the disorder. Furthermore, environmental risk factors can accelerate the autism development of. Recent advances in understanding the epigenetic regulation may shed light on the interaction among multiple genetic factors and environmental factors.

  15. Genetic Engineering

    Science.gov (United States)

    Phillips, John

    1973-01-01

    Presents a review of genetic engineering, in which the genotypes of plants and animals (including human genotypes) may be manipulated for the benefit of the human species. Discusses associated problems and solutions and provides an extensive bibliography of literature relating to genetic engineering. (JR)

  16. The PERSIAN Cohort: Providing the Evidence Needed for Healthcare Reform.

    Science.gov (United States)

    Eghtesad, Sareh; Mohammadi, Zahra; Shayanrad, Amaneh; Faramarzi, Elnaz; Joukar, Farahnaz; Hamzeh, Behrooz; Farjam, Mojtaba; Zare Sakhvidi, Mohammad Javad; Miri-Monjar, Mohammadreza; Moosazadeh, Mahmood; Hakimi, Hamid; Rahimi Kazerooni, Salar; Cheraghian, Bahman; Ahmadi, Ali; Nejatizadeh, Azim; Mohebbi, Iraj; Pourfarzi, Farhad; Roozafzai, Farzin; Motamed-Gorji, Nazgol; Montazeri, Seyed Ali; Masoudi, Sahar; Amin-Esmaeili, Masoumeh; Danaie, Navid; Mirhafez, Seyed Reza; Hashemi, Hasan; Poustchi, Hossein; Malekzadeh, Reza

    2017-11-01

    In the past, communicable diseases caused the highest mortality in Iran. Improvements in socioeconomic status and living standards including access to safe drinking water, along with the inception of Health Houses in the 1980s, have changed disease patterns, decreasing the spread of and deaths from infectious and communicable diseases. The incidence and prevalence of non-communicable diseases (NCD), however, have now increased in Iran, accounting for nearly 80% of deaths and disabilities. Without interventions, NCD are predicted to impose a substantial human and economic burden in the next 2 decades. However, Iran's health system is not equipped with the necessary policies to combat this growth and must refocus and reform. Therefore, in the year 2013, the Ministry of Health and Medical Education funded a well-designed nationwide cohort study-Prospective Epidemiological Research Studies in IrAN (PERSIAN)-in order to assess the burden of NCD and investigate the risk factors associated with them in the different ethnicities and geographical areas of Iran. The PERSIAN Cohort, which aims to include 200000 participants, has 4 components: Adult (main), Birth, Youth and Elderly, which are being carried out in 22 different regions of Iran. Having an enormous dataset along with a biobank of blood, urine, hair and nail samples, the PERSIAN Cohort will serve as an important infrastructure for future implementation research and will provide the evidence needed for new healthcare policies in order to better control, manage and prevent NCD. Copyright © 2017 The Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

  17. Molecular genetic features of polyploidization and aneuploidization reveal unique patterns for genome duplication in diploid Malus.

    Directory of Open Access Journals (Sweden)

    Michael J Considine

    Full Text Available Polyploidization results in genome duplication and is an important step in evolution and speciation. The Malus genome confirmed that this genus was derived through auto-polyploidization, yet the genetic and meiotic mechanisms for polyploidization, particularly for aneuploidization, are unclear in this genus or other woody perennials. In fact the contribution of aneuploidization remains poorly understood throughout Plantae. We add to this knowledge by characterization of eupolyploidization and aneuploidization in 27,542 F₁ seedlings from seven diploid Malus populations using cytology and microsatellite markers. We provide the first evidence that aneuploidy exceeds eupolyploidy in the diploid crosses, suggesting aneuploidization is a leading cause of genome duplication. Gametes from diploid Malus had a unique combinational pattern; ova preserved euploidy exclusively, while spermatozoa presented both euploidy and aneuploidy. All non-reduced gametes were genetically heterozygous, indicating first-division restitution was the exclusive mode for Malus eupolyploidization and aneuploidization. Chromosome segregation pattern among aneuploids was non-uniform, however, certain chromosomes were associated for aneuploidization. This study is the first to provide molecular evidence for the contribution of heterozygous non-reduced gametes to fitness in polyploids and aneuploids. Aneuploidization can increase, while eupolyploidization may decrease genetic diversity in their newly established populations. Auto-triploidization is important for speciation in the extant Malus. The features of Malus polyploidization confer genetic stability and diversity, and present heterozygosity, heterosis and adaptability for evolutionary selection. A protocol using co-dominant markers was proposed for accelerating apple triploid breeding program. A path was postulated for evolution of numerically odd basic chromosomes. The model for Malus derivation was considerably revised

  18. Molecular genetic features of polyploidization and aneuploidization reveal unique patterns for genome duplication in diploid Malus.

    Science.gov (United States)

    Considine, Michael J; Wan, Yizhen; D'Antuono, Mario F; Zhou, Qian; Han, Mingyu; Gao, Hua; Wang, Man

    2012-01-01

    Polyploidization results in genome duplication and is an important step in evolution and speciation. The Malus genome confirmed that this genus was derived through auto-polyploidization, yet the genetic and meiotic mechanisms for polyploidization, particularly for aneuploidization, are unclear in this genus or other woody perennials. In fact the contribution of aneuploidization remains poorly understood throughout Plantae. We add to this knowledge by characterization of eupolyploidization and aneuploidization in 27,542 F₁ seedlings from seven diploid Malus populations using cytology and microsatellite markers. We provide the first evidence that aneuploidy exceeds eupolyploidy in the diploid crosses, suggesting aneuploidization is a leading cause of genome duplication. Gametes from diploid Malus had a unique combinational pattern; ova preserved euploidy exclusively, while spermatozoa presented both euploidy and aneuploidy. All non-reduced gametes were genetically heterozygous, indicating first-division restitution was the exclusive mode for Malus eupolyploidization and aneuploidization. Chromosome segregation pattern among aneuploids was non-uniform, however, certain chromosomes were associated for aneuploidization. This study is the first to provide molecular evidence for the contribution of heterozygous non-reduced gametes to fitness in polyploids and aneuploids. Aneuploidization can increase, while eupolyploidization may decrease genetic diversity in their newly established populations. Auto-triploidization is important for speciation in the extant Malus. The features of Malus polyploidization confer genetic stability and diversity, and present heterozygosity, heterosis and adaptability for evolutionary selection. A protocol using co-dominant markers was proposed for accelerating apple triploid breeding program. A path was postulated for evolution of numerically odd basic chromosomes. The model for Malus derivation was considerably revised. Impacts of

  19. Genetic influences on alcohol-related hangover.

    Science.gov (United States)

    Slutske, Wendy S; Piasecki, Thomas M; Nathanson, Lisa; Statham, Dixie J; Martin, Nicholas G

    2014-12-01

    To quantify the relative contributions of genetic and environmental factors to alcohol hangover. Biometric models were used to partition the variance in hangover phenotypes. A community-based sample of Australian twins. Members of the Australian Twin Registry, Cohort II who reported consuming alcohol in the past year when surveyed in 2004-07 (n = 4496). Telephone interviews assessed participants' frequency of drinking to intoxication and frequency of hangover the day after drinking. Analyses examined three phenotypes: hangover frequency, hangover susceptibility (i.e. residual variance in hangover frequency after accounting for intoxication frequency) and hangover resistance (a dichotomous variable defined as having been intoxicated at least once in the past year with no reported hangovers). Genetic factors accounted for 45% [95% confidence interval (CI) = 37-53%] and 40% (95% CI = 33-48%) of the variation in hangover frequency in men and women, respectively. Most of the genetic variation in hangover frequency overlapped with genetic contributions to intoxication frequency. Genetic influences accounted for 24% (95% CI = 14-35%) and 16% (95% CI = 8-25%) of the residual hangover susceptibility variance in men and women, respectively. Forty-three per cent (95% CI = 22-63%) of the variation in hangover resistance was explained by genetic influences, with no evidence for significant sex differences. There was no evidence for shared environmental influences for any of the hangover phenotypes. Individual differences in the propensity to experience a hangover and of being resistant to hangover at a given level of alcohol use are genetically influenced. © 2014 Society for the Study of Addiction.

  20. Campora: a young genetic isolate in South Italy.

    Science.gov (United States)

    Colonna, Vincenza; Nutile, Teresa; Astore, Maria; Guardiola, Ombretta; Antoniol, Giuliano; Ciullo, Marina; Persico, M Graziella

    2007-01-01

    Genetic isolates have been successfully used in the study of complex traits, mainly because due to their features, they allow a reduction in the complexity of the genetic models underlying the trait. The aim of the present study is to describe the population of Campora, a village in the South of Italy, highlighting its properties of a genetic isolate. Both historical evidence and multi-locus genetic data (genomic and mitochondrial DNA polymorphisms) have been taken into account in the analyses. The extension of linkage disequilibrium (LD) regions has been evaluated on autosomes and on a region of the X chromosome. We defined a study sample population on the basis of the genealogy and exogamy data. We found in this population a few different mitochondrial and Y chromosome haplotypes and we ascertained that, similarly to other isolated populations, in Campora LD extends over wider region compared to large and genetically heterogeneous populations. These findings indicate a conspicuous genetic homogeneity in the genome. Finally, we found evidence for a recent population bottleneck that we propose to interpret as a demographic crisis determined by the plague of the 17th century. Overall our findings demonstrate that Campora displays the genetic characteristics of a young isolate. Copyright (c) 2007 S. Karger AG, Basel.

  1. Genetic diversity among brazilian isolates of beauveria bassiana: comparisons with non-brazilian isolates and other beauveria species

    Science.gov (United States)

    Fernandes, E.K.K.; Moraes, A.M.L.; Pacheco, R.S.; Rangel, D.E.N.; Miller, M.P.; Bittencourt, V.R.E.P.; Roberts, D.W.

    2009-01-01

    Aims: The genetic diversity of Beauveria bassiana was investigated by comparing isolates of this species to each other (49 from different geographical regions of Brazil and 4 from USA) and to other Beauveria spp. Methods and Results: The isolates were examined by multilocus enzyme electrophoresis (MLEE), amplified fragment length polymorphism (AFLP), and rDNA sequencing. MLEE and AFLP revealed considerable genetic variability among B. bassiana isolates. Several isolates from South and Southeast Brazil had high similarity coefficients, providing evidence of at least one population with clonal structure. There were clear genomic differences between most Brazilian and USA B. bassiana isolates. A Mantel test using data generated by AFLP provided evidence that greater geographical distances were associated with higher genetic distances. AFLP and rDNA sequencing demonstrated notable genotypic variation between B. bassiana and other Beauveria spp. Conclusion: Geographical distance between populations apparently is an important factor influencing genotypic variability among B. bassiana populations in Brazil. Significance and Impact of the Study: This study characterized many B. bassiana isolates. The results indicate that certain Brazilian isolates are considerably different from others and possibly should be regarded as separate species from B. bassiana sensu latu. The information on genetic variation among the Brazilian isolates, therefore, will be important to comprehending the population structure of B. bassiana in Brazil. ?? 2009 The Society for Applied Microbiology.

  2. Human genetics of infectious diseases: between proof of principle and paradigm

    OpenAIRE

    Alcaïs, Alexandre; Abel, Laurent; Casanova, Jean-Laurent

    2009-01-01

    The observation that only a fraction of individuals infected by infectious agents develop clinical disease raises fundamental questions about the actual pathogenesis of infectious diseases. Epidemiological and experimental evidence is accumulating to suggest that human genetics plays a major role in this process. As we discuss here, human predisposition to infectious diseases seems to cover a continuous spectrum from monogenic to polygenic inheritance. Although many studies have provided proo...

  3. Resistance to hepatitis C virus: potential genetic and immunological determinants.

    Science.gov (United States)

    Mina, Michael M; Luciani, Fabio; Cameron, Barbara; Bull, Rowena A; Beard, Michael R; Booth, David; Lloyd, Andrew R

    2015-04-01

    Studies of individuals who were highly exposed but seronegative (HESN) for HIV infection led to the discovery that homozygosity for the Δ32 deletion mutation in the CCR5 gene prevents viral entry into target cells, and is associated with resistance to infection. Additionally, evidence for protective immunity has been noted in some HESN groups, such as sex workers in The Gambia. Population studies of individuals at high risk for hepatitis C virus infection suggest that an HESN phenotype exists. The body of evidence, which suggests that protective immunity allows clearance of hepatitis C virus without seroconversion is growing. Furthermore, proof-of-principle evidence from in-vitro studies shows that genetic polymorphisms can confer resistance to establishment of infection. This Review discusses the possibility that genetic mutations confer resistance against hepatitis C virus, and also explores evidence for protective immunity, including via genetically programmed variations in host responses. The data generally strengthens the notion that investigations of naturally arising polymorphisms within the hepatitis C virus interactome, and genetic association studies of well characterised HESN individuals, could identify potential targets for vaccine design and inform novel therapies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Unravelling the genetic history of Negritos and indigenous populations of Southeast Asia.

    Science.gov (United States)

    Aghakhanian, Farhang; Yunus, Yushima; Naidu, Rakesh; Jinam, Timothy; Manica, Andrea; Hoh, Boon Peng; Phipps, Maude E

    2015-04-14

    Indigenous populations of Malaysia known as Orang Asli (OA) show huge morphological, anthropological, and linguistic diversity. However, the genetic history of these populations remained obscure. We performed a high-density array genotyping using over 2 million single nucleotide polymorphisms in three major groups of Negrito, Senoi, and Proto-Malay. Structural analyses indicated that although all OA groups are genetically closest to East Asian (EA) populations, they are substantially distinct. We identified a genetic affinity between Andamanese and Malaysian Negritos which may suggest an ancient link between these two groups. We also showed that Senoi and Proto-Malay may be admixtures between Negrito and EA populations. Formal admixture tests provided evidence of gene flow between Austro-Asiatic-speaking OAs and populations from Southeast Asia (SEA) and South China which suggest a widespread presence of these people in SEA before Austronesian expansion. Elevated linkage disequilibrium (LD) and enriched homozygosity found in OAs reflect isolation and bottlenecks experienced. Estimates based on Ne and LD indicated that these populations diverged from East Asians during the late Pleistocene (14.5 to 8 KYA). The continuum in divergence time from Negritos to Senoi and Proto-Malay in combination with ancestral markers provides evidences of multiple waves of migration into SEA starting with the first Out-of-Africa dispersals followed by Early Train and subsequent Austronesian expansions. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Fossil and Genetic Evidence for the Polyphyletic Nature of the Planktonic Foraminifera "Globigerinoides", and Description of the New Genus Trilobatus

    Science.gov (United States)

    Spezzaferri, Silvia; Kucera, Michal; Pearson, Paul Nicholas; Wade, Bridget Susan; Rappo, Sacha; Poole, Christopher Robert; Morard, Raphaël; Stalder, Claudio

    2015-01-01

    Planktonic foraminifera are one of the most abundant and diverse protists in the oceans. Their utility as paleo proxies requires rigorous taxonomy and comparison with living and genetically related counterparts. We merge genetic and fossil evidence of “Globigerinoides”, characterized by supplementary apertures on spiral side, in a new approach to trace their “total evidence phylogeny” since their first appearance in the latest Paleogene. Combined fossil and molecular genetic data indicate that this genus, as traditionally understood, is polyphyletic. Both datasets indicate the existence of two distinct lineages that evolved independently. One group includes “Globigerinoides” trilobus and its descendants, the extant “Globigerinoides” sacculifer, Orbulina universa and Sphaeroidinella dehiscens. The second group includes the Globigerinoides ruber clade with the extant G. conglobatus and G. elongatus and ancestors. In molecular phylogenies, the trilobus group is not the sister taxon of the ruber group. The ruber group clusters consistently together with the modern Globoturborotalita rubescens as a sister taxon. The re-analysis of the fossil record indicates that the first “Globigerinoides” in the late Oligocene are ancestral to the trilobus group, whereas the ruber group first appeared at the base of the Miocene with representatives distinct from the trilobus group. Therefore, polyphyly of the genus "Globigerinoides" as currently defined can only be avoided either by broadening the genus concept to include G. rubescens and a large number of fossil species without supplementary apertures, or if the trilobus group is assigned to a separate genus. Since the former is not feasible due to the lack of a clear diagnosis for such a broad genus, we erect a new genus Trilobatus for the trilobus group (type species Globigerina triloba Reuss) and amend Globoturborotalita and Globigerinoides to clarify morphology and wall textures of these genera. In the new

  6. Bacterial Population Genetics in a Forensic Context

    Energy Technology Data Exchange (ETDEWEB)

    Velsko, S P

    2009-11-02

    This report addresses the recent Department of Homeland Security (DHS) call for a Phase I study to (1) assess gaps in the forensically relevant knowledge about the population genetics of eight bacterial agents of concern, (2) formulate a technical roadmap to address those gaps, and (3) identify new bioinformatics tools that would be necessary to analyze and interpret population genetic data in a forensic context. The eight organisms that were studied are B. anthracis, Y. pestis, F. tularensis, Brucella spp., E. coli O157/H7, Burkholderia mallei, Burkholderia pseudomallei, and C. botulinum. Our study focused on the use of bacterial population genetics by forensic investigators to test hypotheses about the possible provenance of an agent that was used in a crime or act of terrorism. Just as human population genetics underpins the calculations of match probabilities for human DNA evidence, bacterial population genetics determines the level of support that microbial DNA evidence provides for or against certain well-defined hypotheses about the origins of an infecting strain. Our key findings are: (1) Bacterial population genetics is critical for answering certain types of questions in a probabilistic manner, akin (but not identical) to 'match probabilities' in DNA forensics. (2) A basic theoretical framework for calculating likelihood ratios or posterior probabilities for forensic hypotheses based on microbial genetic comparisons has been formulated. This 'inference-on-networks' framework has deep but simple connections to the population genetics of mtDNA and Y-STRs in human DNA forensics. (3) The 'phylogeographic' approach to identifying microbial sources is not an adequate basis for understanding bacterial population genetics in a forensic context, and has limited utility, even for generating 'leads' with respect to strain origin. (4) A collection of genotyped isolates obtained opportunistically from international locations

  7. Conservation genetics of the endangered Shenandoah salamander (Plethodon shenandoah, Plethodontidae)

    Science.gov (United States)

    Carpenter, D.W.; Jung, R.E.; Sites, J.W.

    2001-01-01

    The Shenandoah salamander (Plethodon shenandoah) is restricted to three isolated talus outcrops in Shenandoah National Park, VA, USA and has one of the smallest ranges of any tetrapod vertebrate. This species was listed as endangered under the US Endangered Species Act in 1989 over concern that direct competition with the red-backed salamander (Plethodon cinereus), successional habitat changes, and human impacts may cause its decline and possible extinction. We address two issues herein: (1) whether extensive introgression (through long-term hybridization) is present between the two species and threatens the survival of P. shenandoah, and (2) the level of population structure within P. shenandoah. We provide evidence from mtDNA haplotypes that shows no genetic differentiation among the three isolates of P. shenandoah, suggesting that their fragmentation is a geologically recent event, and/or that the isolates are still connected by occasional gene flow. There is also no evidence for extensive introgression of alleles in either direction between P. cinereus and P. shenandoah, which suggests that P. shenandoah may not be in danger of being genetically swamped out through hybridization with P. cinereus.

  8. Population genetics provides an efficient tool to quantify fragmentation impact in forest ecosystems

    Directory of Open Access Journals (Sweden)

    2005-01-01

    Full Text Available A method in population genetics (Dutech et al., Am. J. Bot. 92 (2, 252-261, February 2005 is described and discussed as an interesting tool for investigating the effects of fragmentation in forest ecosystems.

  9. Genetic Evidence for Contrasting Wetland and Savannah Habitat Specializations in Different Populations of Lions (Panthera leo).

    Science.gov (United States)

    Moore, Andy E; Cotterill, Fenton P D Woody; Winterbach, Christiaan W; Winterbach, Hanlie E K; Antunes, Agostinho; O'Brien, Stephen J

    2016-03-01

    South-central Africa is characterized by an archipelago of wetlands, which has evolved in time and space since at least the Miocene, providing refugia for animal species during Pleistocene arid episodes. Their importance for biodiversity in the region is reflected in the evolution of a variety of specialist mammal and bird species, adapted to exploit these wetland habitats. Populations of lions (Panthera leo) across south-central and east Africa have contrasting signatures of mitochondrial DNA haplotypes and biparental nuclear DNA in wetland and savannah habitats, respectively, pointing to the evolution of distinct habitat preferences. This explains the absence of genetic admixture of populations from the Kalahari savannah of southwest Botswana and the Okavango wetland of northern Botswana, despite separation by only 500 km. We postulate that ancestral lions were wetland specialists and that the savannah lions evolved from populations that were isolated during arid Pleistocene episodes. Expansion of grasslands and the resultant increase in herbivore populations during mesic Pleistocene climatic episodes provided the stimulus for the rapid population expansion and diversification of the highly successful savannah lion specialists. Our model has important implications for lion conservation. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. A Chromosome-Scale Assembly of the Bactrocera cucurbitae Genome Provides Insight to the Genetic Basis of white pupae

    Directory of Open Access Journals (Sweden)

    Sheina B. Sim

    2017-06-01

    Full Text Available Genetic sexing strains (GSS used in sterile insect technique (SIT programs are textbook examples of how classical Mendelian genetics can be directly implemented in the management of agricultural insect pests. Although the foundation of traditionally developed GSS are single locus, autosomal recessive traits, their genetic basis are largely unknown. With the advent of modern genomic techniques, the genetic basis of sexing traits in GSS can now be further investigated. This study is the first of its kind to integrate traditional genetic techniques with emerging genomics to characterize a GSS using the tephritid fruit fly pest Bactrocera cucurbitae as a model. These techniques include whole-genome sequencing, the development of a mapping population and linkage map, and quantitative trait analysis. The experiment designed to map the genetic sexing trait in B. cucurbitae, white pupae (wp, also enabled the generation of a chromosome-scale genome assembly by integrating the linkage map with the assembly. Quantitative trait loci analysis revealed SNP loci near position 42 MB on chromosome 3 to be tightly linked to wp. Gene annotation and synteny analysis show a near perfect relationship between chromosomes in B. cucurbitae and Muller elements A–E in Drosophila melanogaster. This chromosome-scale genome assembly is complete, has high contiguity, was generated using a minimal input DNA, and will be used to further characterize the genetic mechanisms underlying wp. Knowledge of the genetic basis of genetic sexing traits can be used to improve SIT in this species and expand it to other economically important Diptera.

  11. Genetic determinants of heart failure: facts and numbers.

    Science.gov (United States)

    Czepluch, Frauke S; Wollnik, Bernd; Hasenfuß, Gerd

    2018-06-01

    The relevance of gene mutations leading to heart diseases and hence heart failure has become evident. The risk for and the course of heart failure depends on genomic variants and mutations underlying the so-called genetic predisposition. Genetic contribution to heart failure is highly heterogenous and complex. For any patient with a likely inherited heart failure syndrome, genetic counselling is recommended and important. In the last few years, novel sequencing technologies (named next-generation sequencing - NGS) have dramatically improved the availability of molecular testing, the efficiency of genetic analyses, and moreover reduced the cost for genetic testing. Due to this development, genetic testing has become increasingly accessible and NGS-based sequencing is now applied in clinical routine diagnostics. One of the most common reasons of heart failure are cardiomyopathies such as the dilated or the hypertrophic cardiomyopathy. Nearly 100 disease-associated genes have been identified for cardiomyopathies. The knowledge of a pathogenic mutation can be used for genetic counselling, risk and prognosis determination, therapy guidance and hence for a more effective treatment. Besides, family cascade screening for a known familial, pathogenic mutation can lead to an early diagnosis in affected individuals. At that timepoint, a preventative intervention could be used to avoid or delay disease onset or delay disease progression. Understanding the cellular basis of genetic heart failure syndromes in more detail may provide new insights into the molecular biology of physiological and impaired cardiac (cell) function. As our understanding of the molecular and genetic pathophysiology of heart failure will increase, this might help to identify novel therapeutic targets and may lead to the development of new and specific treatment options in patients with heart failure. © 2018 The Authors. ESC Heart Failure published by John Wiley & Sons Ltd on behalf of the European

  12. Characterization of Population Genetic Structure of red swamp crayfish, Procambarus clarkii, in China.

    Science.gov (United States)

    Yi, Shaokui; Li, Yanhe; Shi, Linlin; Zhang, Long; Li, Qingbin; Chen, Jing

    2018-04-03

    The red swamp crayfish (Procambarus clarkii) is one of the most economically important farmed aquatic species in China. However, it is also a famous invasive species in the world. This invasive species was dispersed most via human activities including intentional or unintentional carry in China. Thus, P. clarkii naturally distributed in China provides us a desirable mode to investigate the genetic structure of an invasive species dispersed mainly by human-mediated factors. To reveal the impact of human-mediated dispersal on genetic structure of P. clarkii in China, a total of 22,043 genome-wide SNPs were obtained from approximately 7.4 billion raw reads using 2b-RAD technique in this study. An evident pattern of population genetic structure and the asymmetrical migrational rates between different regions were observed with 22 populations based on these SNPs. This study provide a better understanding of the population genetic structure and demographic history of P. clarkii populations in China, inferring that anthropogenic factors (aquaculture or by accident) and ecological factors (e.g., complicated topography and climatic environment), as well as its special biological traits could account for the current population structure pattern and dispersal history of P. clarkii.

  13. A Semantic Web-based System for Mining Genetic Mutations in Cancer Clinical Trials.

    Science.gov (United States)

    Priya, Sambhawa; Jiang, Guoqian; Dasari, Surendra; Zimmermann, Michael T; Wang, Chen; Heflin, Jeff; Chute, Christopher G

    2015-01-01

    Textual eligibility criteria in clinical trial protocols contain important information about potential clinically relevant pharmacogenomic events. Manual curation for harvesting this evidence is intractable as it is error prone and time consuming. In this paper, we develop and evaluate a Semantic Web-based system that captures and manages mutation evidences and related contextual information from cancer clinical trials. The system has 2 main components: an NLP-based annotator and a Semantic Web ontology-based annotation manager. We evaluated the performance of the annotator in terms of precision and recall. We demonstrated the usefulness of the system by conducting case studies in retrieving relevant clinical trials using a collection of mutations identified from TCGA Leukemia patients and Atlas of Genetics and Cytogenetics in Oncology and Haematology. In conclusion, our system using Semantic Web technologies provides an effective framework for extraction, annotation, standardization and management of genetic mutations in cancer clinical trials.

  14. Points to consider for prioritizing clinical genetic testing services

    DEFF Research Database (Denmark)

    Severin, Franziska; Borry, Pascal; Cornel, Martina C

    2015-01-01

    Given the cost constraints of the European health-care systems, criteria are needed to decide which genetic services to fund from the public budgets, if not all can be covered. To ensure that high-priority services are available equitably within and across the European countries, a shared set...... testing services available in the next decade. Ethically and economically reflected prioritization criteria are needed. Prioritization should be based on considerations of medical benefit, health need and costs. Medical benefit includes evidence of benefit in terms of clinical benefit, benefit......, following the principles of accountability for reasonableness. We provide points to consider to stimulate this debate across the EU and to serve as a reference for improving patient management.European Journal of Human Genetics advance online publication, 24 September 2014; doi:10.1038/ejhg.2014.190....

  15. The Genetic Structure of Marijuana and Hemp.

    Science.gov (United States)

    Sawler, Jason; Stout, Jake M; Gardner, Kyle M; Hudson, Darryl; Vidmar, John; Butler, Laura; Page, Jonathan E; Myles, Sean

    2015-01-01

    Despite its cultivation as a source of food, fibre and medicine, and its global status as the most used illicit drug, the genus Cannabis has an inconclusive taxonomic organization and evolutionary history. Drug types of Cannabis (marijuana), which contain high amounts of the psychoactive cannabinoid Δ9-tetrahydrocannabinol (THC), are used for medical purposes and as a recreational drug. Hemp types are grown for the production of seed and fibre, and contain low amounts of THC. Two species or gene pools (C. sativa and C. indica) are widely used in describing the pedigree or appearance of cultivated Cannabis plants. Using 14,031 single-nucleotide polymorphisms (SNPs) genotyped in 81 marijuana and 43 hemp samples, we show that marijuana and hemp are significantly differentiated at a genome-wide level, demonstrating that the distinction between these populations is not limited to genes underlying THC production. We find a moderate correlation between the genetic structure of marijuana strains and their reported C. sativa and C. indica ancestry and show that marijuana strain names often do not reflect a meaningful genetic identity. We also provide evidence that hemp is genetically more similar to C. indica type marijuana than to C. sativa strains.

  16. Biochemical genetic variation between four populations of ...

    African Journals Online (AJOL)

    system) to 0.093 in the Spekboom River population (Limpopo River system). The genetic distance, FST and NEM values, as well as pair-wise contingency c2 analyses indicate a lack of gene flow between populations, as expected for isolated fish. Evidence of foreign genetic material in one population was also observed.

  17. Quantitative genetic activity graphical profiles for use in chemical evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Waters, M.D. [Environmental Protection Agency, Washington, DC (United States); Stack, H.F.; Garrett, N.E.; Jackson, M.A. [Environmental Health Research and Testing, Inc., Research Triangle Park, NC (United States)

    1990-12-31

    A graphic approach, terms a Genetic Activity Profile (GAP), was developed to display a matrix of data on the genetic and related effects of selected chemical agents. The profiles provide a visual overview of the quantitative (doses) and qualitative (test results) data for each chemical. Either the lowest effective dose or highest ineffective dose is recorded for each agent and bioassay. Up to 200 different test systems are represented across the GAP. Bioassay systems are organized according to the phylogeny of the test organisms and the end points of genetic activity. The methodology for producing and evaluating genetic activity profile was developed in collaboration with the International Agency for Research on Cancer (IARC). Data on individual chemicals were compiles by IARC and by the US Environmental Protection Agency (EPA). Data are available on 343 compounds selected from volumes 1-53 of the IARC Monographs and on 115 compounds identified as Superfund Priority Substances. Software to display the GAPs on an IBM-compatible personal computer is available from the authors. Structurally similar compounds frequently display qualitatively and quantitatively similar profiles of genetic activity. Through examination of the patterns of GAPs of pairs and groups of chemicals, it is possible to make more informed decisions regarding the selection of test batteries to be used in evaluation of chemical analogs. GAPs provided useful data for development of weight-of-evidence hazard ranking schemes. Also, some knowledge of the potential genetic activity of complex environmental mixtures may be gained from an assessment of the genetic activity profiles of component chemicals. The fundamental techniques and computer programs devised for the GAP database may be used to develop similar databases in other disciplines. 36 refs., 2 figs.

  18. Autosomal genetic diversity in non-breed horses from eastern Eurasia provides insights into historical population movements.

    Science.gov (United States)

    Warmuth, Vera; Manica, Andrea; Eriksson, Anders; Barker, Graeme; Bower, Mim

    2013-02-01

    Many events in the history of eastern Eurasia, including the process of domestication itself, the initial spread of domestic horses and subsequent movements, are believed to have affected the genetic structure of domestic horse populations in this area. We investigated levels of within- and between-population genetic diversity in 'non-breed horses' (working horses sampled in remote areas) from 17 locations in Asia and parts of Eastern Europe, using 26 autosomal microsatellite loci. Non-breed horses have not been subject to the same intensity of artificial selection and closed breeding as have most breed animals and are thus expected to better reflect the population history of domestic horses. Despite geographic distances of between 300 and 7000 km between sampling locations, pairwise F (ST) was very low (range: <0.001 to -0.033), suggesting historically high levels of gene flow. Our analyses of non-breed horses revealed a pattern of isolation by distance and a significant decline in genetic diversity (expected heterozygosity and allelic richness) from east to west, consistent with a westward expansion of horses out of East Asia. Although the timing of this putative expansion is unclear, our results highlight the benefit of studying animals that do not belong to particular breeds when investigating aspects of a population's history. © 2012 The Authors, Animal Genetics © 2012 Stichting International Foundation for Animal Genetics.

  19. Shared Genetic Control of Brain Activity During Sleep and Insulin Secretion: A Laboratory-Based Family Study.

    Science.gov (United States)

    Morselli, Lisa L; Gamazon, Eric R; Tasali, Esra; Cox, Nancy J; Van Cauter, Eve; Davis, Lea K

    2018-01-01

    Over the past 20 years, a large body of experimental and epidemiologic evidence has linked sleep duration and quality to glucose homeostasis, although the mechanistic pathways remain unclear. The aim of the current study was to determine whether genetic variation influencing both sleep and glucose regulation could underlie their functional relationship. We hypothesized that the genetic regulation of electroencephalographic (EEG) activity during non-rapid eye movement sleep, a highly heritable trait with fingerprint reproducibility, is correlated with the genetic control of metabolic traits including insulin sensitivity and β-cell function. We tested our hypotheses through univariate and bivariate heritability analyses in a three-generation pedigree with in-depth phenotyping of both sleep EEG and metabolic traits in 48 family members. Our analyses accounted for age, sex, adiposity, and the use of psychoactive medications. In univariate analyses, we found significant heritability for measures of fasting insulin sensitivity and β-cell function, for time spent in slow-wave sleep, and for EEG spectral power in the delta, theta, and sigma ranges. Bivariate heritability analyses provided the first evidence for a shared genetic control of brain activity during deep sleep and fasting insulin secretion rate. © 2017 by the American Diabetes Association.

  20. The correlation of fecundability among twins: Evidence of a genetic effect on fertility?

    DEFF Research Database (Denmark)

    Christensen, Kaare; Kohler, Hans-Peter; Basso, Olga

    2003-01-01

    BACKGROUND: Numerous rare genetic conditions are known to influence fecundability in both males and females. It is less clear to what extent more subtle genetic differences influence fecundability on a population level. METHODS: In 1994 a population-based survey was conducted among Danish twins b...

  1. Patterns of Cancer Genetic Testing: A Randomized Survey of Oregon Clinicians

    International Nuclear Information System (INIS)

    Cox, S. L.; Zlot, A. I.; Silvey, S. K.; Silvey, S. K.

    2012-01-01

    Introduction. Appropriate use of genetic tests for population-based cancer screening, diagnosis of inherited cancers, and guidance of cancer treatment can improve health outcomes. We investigated clinicians’ use and knowledge of eight breast, ovarian, and colorectal cancer genetic tests. Methods. We conducted a randomized survey of 2,191 Oregon providers, asking about their experience with fecal DNA, OncoVue, BRCA, MMR, CYP2D6, tumor gene expression profiling, UGT1A1, and KRAS. Results. Clinicians reported low confidence in their knowledge of medical genetics; most confident were OB-GYNs and specialists. Clinicians were more likely to have ordered/recommended BRCA and MMR than the other tests, and OB-GYNs were twice as likely to have ordered/recommended BRCA testing than primary care providers. Less than 10% of providers ordered/recommended OncoVue, fecal DNA, CYP2D6, or UGT1A1; less than 30% ordered/recommended tumor gene expression profiles or KRAS. The most common reason for not ordering/recommending these tests was lack of familiarity. Conclusions. Use of appropriate, evidence-based testing can help reduce incidence and mortality of certain cancers, but these tests need to be better integrated into clinical practice. Continued evaluation of emerging technologies, dissemination of findings, and an increase in provider confidence and knowledge are necessary to achieve this end.

  2. A systematic approach to assessing the clinical significance of genetic variants.

    Science.gov (United States)

    Duzkale, H; Shen, J; McLaughlin, H; Alfares, A; Kelly, M A; Pugh, T J; Funke, B H; Rehm, H L; Lebo, M S

    2013-11-01

    Molecular genetic testing informs diagnosis, prognosis, and risk assessment for patients and their family members. Recent advances in low-cost, high-throughput DNA sequencing and computing technologies have enabled the rapid expansion of genetic test content, resulting in dramatically increased numbers of DNA variants identified per test. To address this challenge, our laboratory has developed a systematic approach to thorough and efficient assessments of variants for pathogenicity determination. We first search for existing data in publications and databases including internal, collaborative and public resources. We then perform full evidence-based assessments through statistical analyses of observations in the general population and disease cohorts, evaluation of experimental data from in vivo or in vitro studies, and computational predictions of potential impacts of each variant. Finally, we weigh all evidence to reach an overall conclusion on the potential for each variant to be disease causing. In this report, we highlight the principles of variant assessment, address the caveats and pitfalls, and provide examples to illustrate the process. By sharing our experience and providing a framework for variant assessment, including access to a freely available customizable tool, we hope to help move towards standardized and consistent approaches to variant assessment. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Contracting with private providers for primary care services: evidence from urban China.

    Science.gov (United States)

    Wang, Yan; Eggleston, Karen; Yu, Zhenjie; Zhang, Qiong

    2013-01-17

    Controversy surrounds the role of the private sector in health service delivery, including primary care and population health services. China's recent health reforms call for non-discrimination against private providers and emphasize strengthening primary care, but formal contracting-out initiatives remain few, and the associated empirical evidence is very limited. This paper presents a case study of contracting with private providers for urban primary and preventive health services in Shandong Province, China. The case study draws on three primary sources of data: administrative records; a household survey of over 1600 community residents in Weifang and City Y; and a provider survey of over 1000 staff at community health stations (CHS) in both Weifang and City Y. We supplement the quantitative data with one-on-one, in-depth interviews with key informants, including local officials in charge of public health and government finance.We find significant differences in patient mix: Residents in the communities served by private community health stations are of lower socioeconomic status (more likely to be uninsured and to report poor health), compared to residents in communities served by a government-owned CHS. Analysis of a household survey of 1013 residents shows that they are more willing to do a routine health exam at their neighborhood CHS if they are of low socioeconomic status (as measured either by education or income). Government and private community health stations in Weifang did not statistically differ in their performance on contracted dimensions, after controlling for size and other CHS characteristics. In contrast, the comparison City Y had lower performance and a large gap between public and private providers. We discuss why these patterns arose and what policymakers and residents considered to be the main issues and concerns regarding primary care services.

  4. Contracting with private providers for primary care services: evidence from urban China

    Science.gov (United States)

    2013-01-01

    Controversy surrounds the role of the private sector in health service delivery, including primary care and population health services. China’s recent health reforms call for non-discrimination against private providers and emphasize strengthening primary care, but formal contracting-out initiatives remain few, and the associated empirical evidence is very limited. This paper presents a case study of contracting with private providers for urban primary and preventive health services in Shandong Province, China. The case study draws on three primary sources of data: administrative records; a household survey of over 1600 community residents in Weifang and City Y; and a provider survey of over 1000 staff at community health stations (CHS) in both Weifang and City Y. We supplement the quantitative data with one-on-one, in-depth interviews with key informants, including local officials in charge of public health and government finance. We find significant differences in patient mix: Residents in the communities served by private community health stations are of lower socioeconomic status (more likely to be uninsured and to report poor health), compared to residents in communities served by a government-owned CHS. Analysis of a household survey of 1013 residents shows that they are more willing to do a routine health exam at their neighborhood CHS if they are of low socioeconomic status (as measured either by education or income). Government and private community health stations in Weifang did not statistically differ in their performance on contracted dimensions, after controlling for size and other CHS characteristics. In contrast, the comparison City Y had lower performance and a large gap between public and private providers. We discuss why these patterns arose and what policymakers and residents considered to be the main issues and concerns regarding primary care services. PMID:23327666

  5. Evidence for genetic differentiation at the microgeographic scale in Phlebotomus papatasi populations from Sudan

    Directory of Open Access Journals (Sweden)

    Khalid Noteila M

    2012-11-01

    Full Text Available Abstract Background Cutaneous Leishmaniasis (CL is endemic in Sudan. It is caused by Leishmania major parasites and transmitted by Phlebotomus papatasi sandflies. Recently, uncommon clinical manifestations of CL have been reported. Moreover, L. donovani parasites that cause Visceral Leishmaniasis (VL have been isolated from CL lesions of some patients who contracted the disease in Khartoum State, Central Sudan with no history of travelling to VL endemic sites on south-eastern Sudan. Because different clinical manifestations and the parasite behaviour could be related to genetic differentiation, or even sub-structuring within sandfly vector populations, a population genetic study was conducted on P. papatasi populations collected from different localities in Khartoum State known for their uncommon CL cases and characterized by contrasting environmental conditions. Methods A set of seven microsatellite loci was used to investigate the population structure of P. papatasi samples collected from different localities in Khartoum State, Central Sudan. Populations from Kassala State, Eastern Sudan and Egypt were also included in the analyses as outgroups. The level of genetic diversity and genetic differentiation among natural populations of P. papatasi was determined using FST statistics and Bayesian assignments. Results Genetic analyses revealed significant genetic differentiation (FST between the Sudanese and the Egyptian populations. Within the Sudanese P. papatasi populations, one population from Gerif West, Khartoum State, exhibited significant genetic differentiation from all other populations including those collected as near as 22 km. Conclusion The significant genetic differentiation of Gerif West P. papatasi population from other Sudanese populations may have important implication for the epidemiology of leishmaniasis in Khartoum State and needs to be further investigated. Primarily, it could be linked to the unique location of Gerif West

  6. sGD: software for estimating spatially explicit indices of genetic diversity.

    Science.gov (United States)

    Shirk, A J; Cushman, S A

    2011-09-01

    Anthropogenic landscape changes have greatly reduced the population size, range and migration rates of many terrestrial species. The small local effective population size of remnant populations favours loss of genetic diversity leading to reduced fitness and adaptive potential, and thus ultimately greater extinction risk. Accurately quantifying genetic diversity is therefore crucial to assessing the viability of small populations. Diversity indices are typically calculated from the multilocus genotypes of all individuals sampled within discretely defined habitat patches or larger regional extents. Importantly, discrete population approaches do not capture the clinal nature of populations genetically isolated by distance or landscape resistance. Here, we introduce spatial Genetic Diversity (sGD), a new spatially explicit tool to estimate genetic diversity based on grouping individuals into potentially overlapping genetic neighbourhoods that match the population structure, whether discrete or clinal. We compared the estimates and patterns of genetic diversity using patch or regional sampling and sGD on both simulated and empirical populations. When the population did not meet the assumptions of an island model, we found that patch and regional sampling generally overestimated local heterozygosity, inbreeding and allelic diversity. Moreover, sGD revealed fine-scale spatial heterogeneity in genetic diversity that was not evident with patch or regional sampling. These advantages should provide a more robust means to evaluate the potential for genetic factors to influence the viability of clinal populations and guide appropriate conservation plans. © 2011 Blackwell Publishing Ltd.

  7. Providing reviews of evidence to COPD patients: controlled prospective 12-month trial.

    Science.gov (United States)

    Harris, M; Smith, B J; Veale, A J; Esterman, A; Frith, P A; Selim, P

    2009-01-01

    The aim of this study was to evaluate a novel patient-held manual designed to reduce the evidence-practice gap in chronic obstructive pulmonary disease (COPD). The intervention manual contained summaries of research evidence. It was developed using current best practice for patient information materials and designed to cause discussion of evidence between patient and doctor. A controlled before-and-after study was employed in two similar but geographically separate regions of metropolitan Adelaide, South Australia. Participants had moderate to severe COPD, with 249 included at baseline and 201 completing the study. Evidence-based COPD management was measured using an indicator with three components: rates of influenza vaccination, bone density testing, and pulmonary rehabilitation. A survey of behavioral steps leading to practice change was conducted with the trial. Analysis, by median split of socioeconomic disadvantage, showed significant difference between study arms for only one component of the indicator of evidence-based practice, enrollment in pulmonary rehabilitation and only for the most socioeconomically disadvantaged stratum. For both socioeconomic strata, more intervention participants than control participants reported remembering being given the information material, reading part or all, and finding it very or quite helpful. Other significant differences were restricted to the stratum of greatest socioeconomic disadvantage: reading all of the material, learning from it, referring back, and talking to a doctor about a topic from the material. Above 90% of all participants who received the manual reported reading from it, 42% reported discussing topics with a doctor, but only 10% reported treatment change attributable to the manual. We have found that people with COPD will read an evidence manual developed using current best practice. However, the study demonstrated improvement for only one of the three components of an indicator of evidence

  8. The analysis of APOL1 genetic variation and haplotype diversity provided by 1000 Genomes project.

    Science.gov (United States)

    Peng, Ting; Wang, Li; Li, Guisen

    2017-08-11

    The APOL1 gene variants has been shown to be associated with an increased risk of multiple kinds of diseases, particularly in African Americans, but not in Caucasians and Asians. In this study, we explored the single nucleotide polymorphism (SNP) and haplotype diversity of APOL1 gene in different races provided by 1000 Genomes project. Variants of APOL1 gene in 1000 Genome Project were obtained and SNPs located in the regulatory region or coding region were selected for genetic variation analysis. Total 2504 individuals from 26 populations were classified as four groups that included Africa, Europe, Asia and Admixed populations. Tag SNPs were selected to evaluate the haplotype diversities in the four populations by HaploStats software. APOL1 gene was surrounded by some of the most polymorphic genes in the human genome, variation of APOL1 gene was common, with up to 613 SNP (1000 Genome Project reported) and 99 of them (16.2%) with MAF ≥ 1%. There were 79 SNPs in the URR and 92 SNPs in 3'UTR. Total 12 SNPs in URR and 24 SNPs in 3'UTR were considered as common variants with MAF ≥ 1%. It is worth noting that URR-1 was presents lower frequencies in European populations, while other three haplotypes taken an opposite pattern; 3'UTR presents several high-frequency variation sites in a short segment, and the differences of its haplotypes among different population were significant (P < 0.01), UTR-1 and UTR-5 presented much higher frequency in African population, while UTR-2, UTR-3 and UTR-4 were much lower. APOL1 coding region showed that two SNP of G1 with higher frequency are actually pull down the haplotype H-1 frequency when considering all populations pooled together, and the diversity among the four populations be widen by the G1 two mutation (P 1  = 3.33E-4 vs P 2  = 3.61E-30). The distributions of APOL1 gene variants and haplotypes were significantly different among the different populations, in either regulatory or coding regions. It could provide

  9. An investigation of the genetic toxicology of irradiated food-stuffs using short-term test systems

    International Nuclear Information System (INIS)

    Renner, H.W.; Altmann, H.; Asquith, J.C.; Elias, P.S.

    1982-01-01

    Six in vivo genetic toxicity tests were carried out on irradiated or unirradiated cooked chicken, dried dates and cooked fish. The tests were as follows: sex-linked recessive lethal mutations in Drosophila melanogaster (dried dates only), chromosome aberrations in bone marrow of Chinese hamsters, micronucleus test in rats, mice and Chinese hamsters, sister-chromatid exchange in bone marrow of mice and Chinese hamsters and in spermatogonia of mice, and DNA metabolism in spleen cells of Chinese hamsters. None of the tests provided any evidence of genetic toxicity induced by irradiation. However, dried dates, whether irradiated or not, showed evidence of some genetic toxicity in their effect on DNA metabolism in spleen cells and SCE induction in bone marrow. Feeding irradiated fish affected DNA metabolism in the spleen cells of Chinese hamsters. This effect could be interpreted as an induction of an immunoactive compound, although it could also be explained by the persistence of an immunoactive compound due to the removal by irradiation of spoilage organisms that would normally degrade it. (author)

  10. Genetics and Insurance in Australia: Concerns around a Self-Regulated Industry.

    Science.gov (United States)

    Newson, Ainsley J; Tiller, Jane; Keogh, Louise A; Otlowski, Margaret; Lacaze, Paul

    2017-01-01

    Regulating the use of genetic information in insurance is an issue of ongoing international debate. In Australia, providers of life and other mutually rated insurance products can request applicants to disclose all results from any genetic test. Insurers can then use this information to adjust premiums and make policy decisions. The Australian Financial Services Council (FSC; an industry body) developed and maintains the relevant industry standard, which was updated in late 2016. Aims/Objective: To review the 2016 FSC Standard in light of relevant research and determine the legitimacy of the Australian regulatory environment regarding use of genetic information by insurers. We identified five concerns arising from the 2016 FSC Standard: (1) use of results obtained from research; (2) the requirement for an applicant to disclose whether they are "considering" a genetic test; (3) failure to account for genome sequencing and other technology developments; (4) limited evidence regarding adverse selection; and (5) the inappropriateness of industry self-regulation. Industry self-regulation of the use of genetic information by life insurers, combined with a lack of government oversight, is inappropriate and threatens to impede the progress of genomic medicine in Australia. At this critical time, Australia requires closer government oversight of the use of genetic information in insurance. © 2017 S. Karger AG, Basel.

  11. Genetics of ischemic stroke: future clinical applications.

    Science.gov (United States)

    Wang, Michael M

    2006-11-01

    Ischemic stroke has long been thought to have a genetic component that is independent of conventional vascular risk factors. It has been estimated that over one half of stroke risk is determined by inherited genes. However, until recently, strong evidence of genetic influence on ischemic stroke has been subject to criticism because the risk factors for stroke are also inherited and because previous studies suffered from limitations imposed by this highly heterogeneous neurological disorder. Recent advances in molecular genetics have led to the identification of specific genetic loci that impart susceptibility to ischemic stroke. We review the studies of these genes and discuss the future potential applications of genetic markers on the management of ischemic stroke patients.

  12. Low Genetic Quality Alters Key Dimensions of the Mutational Spectrum.

    Directory of Open Access Journals (Sweden)

    Nathaniel P Sharp

    2016-03-01

    Full Text Available Mutations affect individual health, population persistence, adaptation, diversification, and genome evolution. There is evidence that the mutation rate varies among genotypes, but the causes of this variation are poorly understood. Here, we link differences in genetic quality with variation in spontaneous mutation in a Drosophila mutation accumulation experiment. We find that chromosomes maintained in low-quality genetic backgrounds experience a higher rate of indel mutation and a lower rate of gene conversion in a manner consistent with condition-based differences in the mechanisms used to repair DNA double strand breaks. These aspects of the mutational spectrum were also associated with body mass, suggesting that the effect of genetic quality on DNA repair was mediated by overall condition, and providing a mechanistic explanation for the differences in mutational fitness decline among these genotypes. The rate and spectrum of substitutions was unaffected by genetic quality, but we find variation in the probability of substitutions and indels with respect to several aspects of local sequence context, particularly GC content, with implications for models of molecular evolution and genome scans for signs of selection. Our finding that the chances of mutation depend on genetic context and overall condition has important implications for how sequences evolve, the risk of extinction, and human health.

  13. Exploring dispositional tendencies to seek online information about direct-to-consumer genetic testing.

    Science.gov (United States)

    Paquin, Ryan S; Richards, Adam S; Koehly, Laura M; McBride, Colleen M

    2012-12-01

    Varying perspectives exist regarding the implications of genetic susceptibility testing for common disease, with some anticipating adverse effects and others expecting positive outcomes; however, little is known about the characteristics of people who are most likely to be interested in direct-to-consumer genetic testing. To that end, this study examines the association of individual dispositional differences with health risk perceptions and online information seeking related to a free genetic susceptibility test. Healthy adults enrolled in a large health maintenance organization were surveyed by telephone. Eligible participants (N = 1,959) were given access to a secure website that provided risk and benefit information about a genetic susceptibility test and given the option to be tested. Neuroticism was associated with increased perceptions of disease risk but not with logging on. Those scoring high in conscientiousness were more likely to log on. We found no evidence that neuroticism, a dispositional characteristic commonly linked to adverse emotional response, was predictive of online genetic information seeking in this sample of healthy adults.

  14. How scary! An analysis of visual communication concerning genetically modified organisms in Italy.

    Science.gov (United States)

    Ventura, Vera; Frisio, Dario G; Ferrazzi, Giovanni; Siletti, Elena

    2017-07-01

    Several studies provide evidence of the role of written communication in influencing public perception towards genetically modified organisms, whereas visual communication has been sparsely investigated. This article aims to evaluate the exposure of the Italian population to scary genetically modified organism-related images. A set of 517 images collected through Google are classified considering fearful attributes, and an index that accounts for the scary impact of these images is built. Then, through an ordinary least-squares regression, we estimate the relationship between the Scary Impact Index and a set of variables that describes the context in which the images appear. The results reveal that the first (and most viewed) Google result images contain the most frightful contents. In addition, the agri-food sector in Italy is strongly oriented towards offering a negative representation of genetically modified organisms. Exposure to scary images could be a factor that affects the negative perception of genetically modified organisms in Italy.

  15. Problems in Psychiatric Genetic Research: A Reply to Faraone and Biederman.

    Science.gov (United States)

    Joseph, Jay

    2000-01-01

    Answers the most important criticisms by Faraone and Biederman in their critique of Joseph's analysis of evidence supporting a genetic basis of attention deficit hyperactivity disorder. Argues that possible genetic and environmental influences in ADHD twin studies are confounded, obscuring inferences about genetic factors. (JPB)

  16. Large-scale association analysis provides insights into the genetic architecture and pathophysiology of type 2 diabetes

    DEFF Research Database (Denmark)

    Morris, Andrew P; Voight, Benjamin F; Teslovich, Tanya M

    2012-01-01

    To extend understanding of the genetic architecture and molecular basis of type 2 diabetes (T2D), we conducted a meta-analysis of genetic variants on the Metabochip, including 34,840 cases and 114,981 controls, overwhelmingly of European descent. We identified ten previously unreported T2D...... processes, including CREBBP-related transcription, adipocytokine signaling and cell cycle regulation, in diabetes pathogenesis....

  17. Morphological, physiological, and genetic variation between metallicolous and nonmetallicolous populations of Dianthus carthusianorum.

    Science.gov (United States)

    Wójcik, Małgorzata; Dresler, Sławomir; Jawor, Emilia; Kowalczyk, Krzysztof; Tukiendorf, Anna

    2013-01-01

    Waste deposits produced by metal mining and smelting activities provide extremely difficult habitats for plant colonization and growth. Therefore, plants spontaneously colonizing such areas represent a very interesting system for studying evolution of plant adaptation and population differentiation between contaminated and noncontaminated environments. In this study, two populations of Dianthus carthusianorum, one originating from Zn-Pb waste deposit (a metallicolous population, M) and the other from unpolluted soil (a nonmetallicolous population, NM), were analyzed in respect of their morphological and physiological traits as well as genetic markers. It was found that the plants inhabiting the waste heap differed significantly from the NM plants in terms of leaf size and shape, and these differences were persistent between the first generation of the plants of both populations cultivated under uniform, controlled laboratory conditions. In contrast with the evident morphological differences, no significant differentiation between the populations regarding the physiological traits measured (accumulation of proline, anthocyanins, chlorophyll, carotenoids) was found. These traits can be regarded as neither population specific nor stress markers. The genetic variability was analyzed using 17 random amplified polymorphic DNA (RAPD) and four inter simple sequence repeat (ISSR) markers; this proved that the differentiation between the M and NM populations exists also at the genetic level. Analysis of molecular variance (AMOVA) showed that 24% of the total genetic diversity resided among populations, while 76% - within the populations. However, no significant differences in intrapopulation genetic diversity (Hj) between the M and NM populations of D. carthusianorum was found, which contradicts the theory that acquisition of adaptation mechanisms to adverse, isolated growth habitats is related to reduction in genetic diversity. Distinct genetic differences between the two

  18. Genetic studies on the South African Mutton Merino: growth traits

    African Journals Online (AJOL)

    Unknown

    breed has undergone such a metamorphosis that it no longer bears much, if any, resemblance to its European ancestor. The need for a separate genetic characterization of this distinct South African strain is therefore evident. The aim of this study was to determine the applicable non-genetic factors and to estimate genetic ...

  19. Wasted research when systematic reviews fail to provide a complete and up-to-date evidence synthesis: the example of lung cancer

    OpenAIRE

    Cr?quit, Perrine; Trinquart, Ludovic; Yavchitz, Am?lie; Ravaud, Philippe

    2016-01-01

    Background Multiple treatments are frequently available for a given condition, and clinicians and patients need a comprehensive, up-to-date synthesis of evidence for all competing treatments. We aimed to quantify the waste of research related to the failure of systematic reviews to provide a complete and up-to-date evidence synthesis over time. Methods We performed a series of systematic overviews and networks of randomized trials assessing the gap between evidence covered by systematic revie...

  20. Education and certification of genetic counselors.

    Science.gov (United States)

    Katsichti, L; Hadzipetros-Bardanis, M; Bartsocas, C S

    1999-01-01

    Genetic counseling is defined by the American Society of Human Genetics as a communication process which deals with the human problems associated with the occurrence, or risk of occurrence, of a genetic disorder in a family. The first graduate program (Master's degree) in genetic counseling started in 1969 at Sarah Lawrence College, NY, USA, while in 1979 the National Society of Genetic Counseling (NSGC) was established. Today, there are 29 programs in U.S.A. offering a Master's degree in Genetic Counseling, five programs in Canada, one in Mexico, one in England and one in S. Africa. Most of these graduate programs offer two year training, consisting of graduate courses, seminars, research and practical training. Emphasis is given in human physiology, biochemistry, clinical genetics, cytogenetics, molecular and biochemical genetics, population genetics and statistics, prenatal diagnosis, teratology and genetic counseling in relation to psychosocial and ethical issues. Certification for eligible candidates is available through the American Board of Medical Genetics (ABMG). Requirements for certification include a master's degree in human genetics, training at sites accredited by the ABMG, documentation of genetic counseling experience, evidence of continuing education and successful completion of a comprehensive ABMG certification examination. As professionals, genetic counselors should maintain expertise, should insure mechanisms for professional advancement and should always maintain the ability to approach their patients.

  1. Impact of Genetic Counseling and Connexin-26 and Connexin-30 Testing on Deaf Identity and Comprehension of Genetic Test Results in a Sample of Deaf Adults: A Prospective, Longitudinal Study

    Science.gov (United States)

    Palmer, Christina G. S.; Boudreault, Patrick; Baldwin, Erin E.; Sinsheimer, Janet S.

    2014-01-01

    Using a prospective, longitudinal study design, this paper addresses the impact of genetic counseling and testing for deafness on deaf adults and the Deaf community. This study specifically evaluated the effect of genetic counseling and Connexin-26 and Connexin-30 genetic test results on participants' deaf identity and understanding of their genetic test results. Connexin-26 and Connexin-30 genetic testing was offered to participants in the context of linguistically and culturally appropriate genetic counseling. Questionnaire data collected from 209 deaf adults at four time points (baseline, immediately following pre-test genetic counseling, 1-month following genetic test result disclosure, and 6-months after result disclosure) were analyzed. Four deaf identity orientations (hearing, marginal, immersion, bicultural) were evaluated using subscales of the Deaf Identity Development Scale-Revised. We found evidence that participants understood their specific genetic test results following genetic counseling, but found no evidence of change in deaf identity based on genetic counseling or their genetic test results. This study demonstrated that culturally and linguistically appropriate genetic counseling can improve deaf clients' understanding of genetic test results, and the formation of deaf identity was not directly related to genetic counseling or Connexin-26 and Connexin-30 genetic test results. PMID:25375116

  2. Strong evidence for a genetic contribution to late-onset Alzheimer's disease mortality: a population-based study.

    Directory of Open Access Journals (Sweden)

    John S K Kauwe

    Full Text Available Alzheimer's disease (AD is an international health concern that has a devastating effect on patients and families. While several genetic risk factors for AD have been identified much of the genetic variance in AD remains unexplained. There are limited published assessments of the familiality of Alzheimer's disease. Here we present the largest genealogy-based analysis of AD to date.We assessed the familiality of AD in The Utah Population Database (UPDB, a population-based resource linking electronic health data repositories for the state with the computerized genealogy of the Utah settlers and their descendants. We searched UPDB for significant familial clustering of AD to evaluate the genetic contribution to disease. We compared the Genealogical Index of Familiality (GIF between AD individuals and randomly selected controls and estimated the Relative Risk (RR for a range of family relationships. Finally, we identified pedigrees with a significant excess of AD deaths.The GIF analysis showed that pairs of individuals dying from AD were significantly more related than expected. This excess of relatedness was observed for both close and distant relationships. RRs for death from AD among relatives of individuals dying from AD were significantly increased for both close and more distant relatives. Multiple pedigrees had a significant excess of AD deaths.These data strongly support a genetic contribution to the observed clustering of individuals dying from AD. This report is the first large population-based assessment of the familiality of AD mortality and provides the only reported estimates of relative risk of AD mortality in extended relatives to date. The high-risk pedigrees identified show a true excess of AD mortality (not just multiple cases and are greater in depth and width than published AD pedigrees. The presence of these high-risk pedigrees strongly supports the possibility of rare predisposition variants not yet identified.

  3. Results of an intervention for individuals and families with BRCA mutations: a model for providing medical updates and psychosocial support following genetic testing.

    Science.gov (United States)

    McKinnon, Wendy; Naud, Shelly; Ashikaga, Taka; Colletti, Rose; Wood, Marie

    2007-08-01

    : Providing medical management updates and long-term support to families with hereditary cancer syndromes in rural areas is a challenge. To address this, we designed a one-day retreat for BRCA1/2 carriers in our region. The retreat included educational updates about medical management, genetic privacy and discrimination, and addressed psychological and family issues. Evaluations completed at the conclusion of the retreat were overwhelmingly positive with requests for a similar event in the future. The impact of this retreat on a variety of health behaviors was assessed. Eligible participants completed questionnaires before and 6 months after the retreat. Questionnaires focused on lifestyle, cancer screening and prevention practices, psychological history and distress, decision-making regarding genetic testing, and family communication issues. For individuals who completed both the pre and post retreat questionnaires, one-half made lifestyle changes and nearly two-thirds increased cancer screening, initiated chemoprevention, completed or planned to complete preventative surgery in the future. We conclude that this type of forum provides a valuable opportunity for BRCA carriers and their families to receive updated medical information, share personal experiences, provide and receive support, as well as change health behaviors.

  4. Evidence that periweaning failure-to-thrive syndrome (PFTS) has a genetic predisposition.

    Science.gov (United States)

    Ramis, G; Marco, E; Magaña, V; González-Contreras, P; Swierczynski, G; Abellaneda, J M; Sáez-Acosta, A; Mrowiec, A; Pallarés, F J

    2015-06-06

    Genetic susceptibility or resistance to diseases is currently drawing increasing attention. This work describes two different breeding herds showing signs of periweaning failure-to-thrive syndrome (PFTS), an emergent swine disease. The disease was diagnosed based on clinical picture and confirmed by histopathology. The possibility of main infectious pathogens was ruled out by immunohistochemistry and PCR. In a simple approach, sires of the affected piglets have been determined using microsatellite paternity analysis, including a healthy group in each case. In each of the two farms, a single boar was found to have sired 45-50 per cent sick animals. Removal of this sire from two farms resulted in a significant decrease in the prevalence of the disease among the offspring, in accordance with other two cases diagnosed, although without including a control group. Since the analysed animals belonged to three different genetic lines, these findings point to the existence of individual genetic susceptibility to this syndrome. British Veterinary Association.

  5. Genetic evidence of paleolithic colonization and neolithic expansion of modern humans on the tibetan plateau.

    Science.gov (United States)

    Qi, Xuebin; Cui, Chaoying; Peng, Yi; Zhang, Xiaoming; Yang, Zhaohui; Zhong, Hua; Zhang, Hui; Xiang, Kun; Cao, Xiangyu; Wang, Yi; Ouzhuluobu; Basang; Ciwangsangbu; Bianba; Gonggalanzi; Wu, Tianyi; Chen, Hua; Shi, Hong; Su, Bing

    2013-08-01

    Tibetans live on the highest plateau in the world, their current population size is approximately 5 million, and most of them live at an altitude exceeding 3,500 m. Therefore, the Tibetan Plateau is a remarkable area for cultural and biological studies of human population history. However, the chronological profile of the Tibetan Plateau's colonization remains an unsolved question of human prehistory. To reconstruct the prehistoric colonization and demographic history of modern humans on the Tibetan Plateau, we systematically sampled 6,109 Tibetan individuals from 41 geographic populations across the entire region of the Tibetan Plateau and analyzed the phylogeographic patterns of both paternal (n = 2,354) and maternal (n = 6,109) lineages as well as genome-wide single nucleotide polymorphism markers (n = 50) in Tibetan populations. We found that there have been two distinct, major prehistoric migrations of modern humans into the Tibetan Plateau. The first migration was marked by ancient Tibetan genetic signatures dated to approximately 30,000 years ago, indicating that the initial peopling of the Tibetan Plateau by modern humans occurred during the Upper Paleolithic rather than Neolithic. We also found evidences for relatively young (only 7-10 thousand years old) shared Y chromosome and mitochondrial DNA haplotypes between Tibetans and Han Chinese, suggesting a second wave of migration during the early Neolithic. Collectively, the genetic data indicate that Tibetans have been adapted to a high altitude environment since initial colonization of the Tibetan Plateau in the early Upper Paleolithic, before the last glacial maximum, followed by a rapid population expansion that coincided with the establishment of farming and yak pastoralism on the Plateau in the early Neolithic.

  6. Genetic complexity underlying hybrid male sterility in Drosophila.

    OpenAIRE

    Sawamura, Kyoichi; Roote, John; Wu, Chung-I; Yamamoto, Masa-Toshi

    2004-01-01

    Recent genetic analyses of closely related species of Drosophila have indicated that hybrid male sterility is the consequence of highly complex synergistic effects among multiple genes, both conspecific and heterospecific. On the contrary, much evidence suggests the presence of major genes causing hybrid female sterility and inviability in the less-related species, D. melanogaster and D. simulans. Does this contrast reflect the genetic distance between species? Or, generally, is the genetic b...

  7. Genetic diversity and variation of mitochondrial DNA in native and introduced bighead carp

    Science.gov (United States)

    Li, Si-Fa; Yang, Qin-Ling; Xu, Jia-Wei; Wang, Cheng-Hui; Chapman, Duane C.; Lu, Guoping

    2010-01-01

    The bighead carp Hypophthalmichthys nobilis is native to China but has been introduced to over 70 countries and is established in many large river systems. Genetic diversity and variation in introduced bighead carp have not previously been evaluated, and a systematic comparison among fish from different river systems was unavailable. In this study, 190 bighead carp specimens were sampled from five river systems in three countries (Yangtze, Pearl, and Amur rivers, China; Danube River, Hungary; Mississippi River basin, USA) and their mitochondrial 16S ribosomal RNA gene and D-loop region were sequenced (around 1,345 base pairs). Moderate genetic diversity was found in bighead carp, ranging from 0.0014 to 0.0043 for nucleotide diversity and from 0.6879 to 0.9333 for haplotype diversity. Haplotype analysis provided evidence that (1) multiple haplotype groups might be present among bighead carp, (2) bighead carp probably originated from the Yangtze River, and (3) bighead carp in the Mississippi River basin may have some genetic ancestry in the Danube River. The analysis of molecular variance showed significant genetic differentiation among these five populations but also revealed limited differentiation between the Yangtze and Amur River bighead carp. This large-scale study of bighead carp genetic diversity and variation provides the first global perspective of bighead carp in the context of biodiversity conservation as well as invasive species control and management.

  8. Mapping allied health evidence-based practice: providing a basis for organisational realignment.

    Science.gov (United States)

    Ziviani, Jenny; Wilkinson, Shelley A; Hinchliffe, Fiona; Feeney, Rachel

    2015-06-01

    Ahead of the convergence of two major paediatric services, we examined evidence-based practice (EBP) self-efficacy, outcome expectance, knowledge and use among allied health (AH) staff in two major Queensland (Qld) paediatric services. This was to determine whether any differences existed based on organisational affiliation, profession and any previous training to inform a strategy to enhance AH EBP within the new organisational setting. All AH staff from the two Brisbane (Qld) tertiary paedritic hospitals were invited to participate in the survey. Using a cross-sectional design EBP self-efficacy, outcome expectancy, knowledge and use, as well as previous EBP training, were assessed with an online survey. Background demographic information obtained included professional discipline and hospital. One hundreD and thirty-eight health practitioners completed the survey (37% respone rate). Most practioners had accessed EBP training. Mean scores for EBP attitudes (self-efficacy and outcome expectancy) and knowledge were higher than for EBP use scores. Greater variation was observed across professional disciplines than organisations. Training impacted positively on EBP measures but explained a small proportion of total variance in regression models. The results underscore the need to provide organisational supports to AH staff ro EBP implementation. Strategies other than training are requred to maximally enhance EBP attitudes. The new organisational structure provides an oppotunity for this cultural shift to occur.

  9. Benefits of cooperation with genetic kin in a subsocial spider

    DEFF Research Database (Denmark)

    Schneider, J.M.; Bilde, T.

    2008-01-01

    also promote helping behavior in many cooperatively breeding taxa. Investigating transitional systems is therefore particularly suitable for understanding the influence of kin selection on the initial spread of cooperative behaviors. Here we investigated the role of kinship in cooperative feeding. We...... in prey capture and feed communally. We provide clear experimental evidence for net benefits of cooperating with kin. Genetic relatedness within groups and not association with familiar individuals directly improved feeding efficiency and growth rates, demonstrating a positive effect of kin cooperation...

  10. Population Genetics and Natural Selection in Rheumatic Disease.

    Science.gov (United States)

    Ramos, Paula S

    2017-08-01

    Human genetic diversity is the result of population genetic forces. This genetic variation influences disease risk and contributes to health disparities. Natural selection is an important influence on human genetic variation. Because immune and inflammatory function genes are enriched for signals of positive selection, the prevalence of rheumatic disease-risk alleles seen in different populations is partially the result of differing selective pressures (eg, due to pathogens). This review summarizes the genetic regions associated with susceptibility to different rheumatic diseases and concomitant evidence for natural selection, including known agents of selection exerting selective pressure in these regions. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Mitochondrial DNA provides evidence of a double origin for the stone crayfish Austropotamobius torrentium in the Elbe basin

    Czech Academy of Sciences Publication Activity Database

    Petrusek, A.; Pešek, P.; Leština, Dan; Martin, P.; Fischer, D.; Kozák, P.; Vlach, P.

    2017-01-01

    Roč. 62, JAN 01 (2017), s. 77-83 ISSN 0075-9511 Institutional support: RVO:60077344 Keywords : stone crayfish * Austropotamobius torrentium * Elbe basin Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 1.427, year: 2016 https://www.sciencedirect.com/science/article/pii/S0075951116300901

  12. Wasted research when systematic reviews fail to provide a complete and up-to-date evidence synthesis: the example of lung cancer.

    Science.gov (United States)

    Créquit, Perrine; Trinquart, Ludovic; Yavchitz, Amélie; Ravaud, Philippe

    2016-01-20

    Multiple treatments are frequently available for a given condition, and clinicians and patients need a comprehensive, up-to-date synthesis of evidence for all competing treatments. We aimed to quantify the waste of research related to the failure of systematic reviews to provide a complete and up-to-date evidence synthesis over time. We performed a series of systematic overviews and networks of randomized trials assessing the gap between evidence covered by systematic reviews and available trials of second-line treatments for advanced non-small cell lung cancer. We searched the Cochrane Database of Systematic Reviews, Database of Abstracts of Reviews of Effects, MEDLINE, EMBASE, and other resources sequentially by year from 2009 to March 2, 2015. We sequentially compared the amount of evidence missing from systematic reviews to the randomized evidence available for inclusion each year. We constructed cumulative networks of randomized evidence over time and evaluated the proportion of trials, patients, treatments, and treatment comparisons not covered by systematic reviews on December 31 each year from 2009 to 2015. We identified 77 trials (28,636 patients) assessing 47 treatments with 54 comparisons and 29 systematic reviews (13 published after 2013). From 2009 to 2015, the evidence covered by existing systematic reviews was consistently incomplete: 45 % to 70 % of trials; 30 % to 58 % of patients; 40 % to 66 % of treatments; and 38 % to 71 % of comparisons were missing. In the cumulative networks of randomized evidence, 10 % to 17 % of treatment comparisons were partially covered by systematic reviews and 55 % to 85 % were partially or not covered. We illustrate how systematic reviews of a given condition provide a fragmented, out-of-date panorama of the evidence for all treatments. This waste of research might be reduced by the development of live cumulative network meta-analyses.

  13. Genetic dissection of mammalian ERAD through comparative haploid and CRISPR forward genetic screens

    DEFF Research Database (Denmark)

    Timms, Richard T.; Menzies, Sam A.; Tchasovnikarova, Iva A.

    2016-01-01

    The application of forward genetic screens to cultured human cells represents a powerful method to study gene function. The repurposing of the bacterial CRISPR/Cas9 system provides an effective method to disrupt gene function in mammalian cells, and has been applied to genome-wide screens. Here, we...... compare the efficacy of genome-wide CRISPR/Cas9-mediated forward genetic screens versus gene-trap mutagenesis screens in haploid human cells, which represent the existing ‘gold standard’ method. This head-to-head comparison aimed to identify genes required for the endoplasmic reticulum....../3-associated disulphide reductase. Genome-wide CRISPR/Cas9-mediated screens together with haploid genetic screens provide a powerful addition to the forward genetic toolbox....

  14. Implications of the circumpolar genetic structure of polar bears for their conservation in a rapidly warming Arctic.

    Directory of Open Access Journals (Sweden)

    Elizabeth Peacock

    Full Text Available We provide an expansive analysis of polar bear (Ursus maritimus circumpolar genetic variation during the last two decades of decline in their sea-ice habitat. We sought to evaluate whether their genetic diversity and structure have changed over this period of habitat decline, how their current genetic patterns compare with past patterns, and how genetic demography changed with ancient fluctuations in climate. Characterizing their circumpolar genetic structure using microsatellite data, we defined four clusters that largely correspond to current ecological and oceanographic factors: Eastern Polar Basin, Western Polar Basin, Canadian Archipelago and Southern Canada. We document evidence for recent (ca. last 1-3 generations directional gene flow from Southern Canada and the Eastern Polar Basin towards the Canadian Archipelago, an area hypothesized to be a future refugium for polar bears as climate-induced habitat decline continues. Our data provide empirical evidence in support of this hypothesis. The direction of current gene flow differs from earlier patterns of gene flow in the Holocene. From analyses of mitochondrial DNA, the Canadian Archipelago cluster and the Barents Sea subpopulation within the Eastern Polar Basin cluster did not show signals of population expansion, suggesting these areas may have served also as past interglacial refugia. Mismatch analyses of mitochondrial DNA data from polar and the paraphyletic brown bear (U. arctos uncovered offset signals in timing of population expansion between the two species, that are attributed to differential demographic responses to past climate cycling. Mitogenomic structure of polar bears was shallow and developed recently, in contrast to the multiple clades of brown bears. We found no genetic signatures of recent hybridization between the species in our large, circumpolar sample, suggesting that recently observed hybrids represent localized events. Documenting changes in subpopulation

  15. Implications of the circumpolar genetic structure of polar bears for their conservation in a rapidly warming Arctic.

    Science.gov (United States)

    Peacock, Elizabeth; Sonsthagen, Sarah A; Obbard, Martyn E; Boltunov, Andrei; Regehr, Eric V; Ovsyanikov, Nikita; Aars, Jon; Atkinson, Stephen N; Sage, George K; Hope, Andrew G; Zeyl, Eve; Bachmann, Lutz; Ehrich, Dorothee; Scribner, Kim T; Amstrup, Steven C; Belikov, Stanislav; Born, Erik W; Derocher, Andrew E; Stirling, Ian; Taylor, Mitchell K; Wiig, Øystein; Paetkau, David; Talbot, Sandra L

    2015-01-01

    We provide an expansive analysis of polar bear (Ursus maritimus) circumpolar genetic variation during the last two decades of decline in their sea-ice habitat. We sought to evaluate whether their genetic diversity and structure have changed over this period of habitat decline, how their current genetic patterns compare with past patterns, and how genetic demography changed with ancient fluctuations in climate. Characterizing their circumpolar genetic structure using microsatellite data, we defined four clusters that largely correspond to current ecological and oceanographic factors: Eastern Polar Basin, Western Polar Basin, Canadian Archipelago and Southern Canada. We document evidence for recent (ca. last 1-3 generations) directional gene flow from Southern Canada and the Eastern Polar Basin towards the Canadian Archipelago, an area hypothesized to be a future refugium for polar bears as climate-induced habitat decline continues. Our data provide empirical evidence in support of this hypothesis. The direction of current gene flow differs from earlier patterns of gene flow in the Holocene. From analyses of mitochondrial DNA, the Canadian Archipelago cluster and the Barents Sea subpopulation within the Eastern Polar Basin cluster did not show signals of population expansion, suggesting these areas may have served also as past interglacial refugia. Mismatch analyses of mitochondrial DNA data from polar and the paraphyletic brown bear (U. arctos) uncovered offset signals in timing of population expansion between the two species, that are attributed to differential demographic responses to past climate cycling. Mitogenomic structure of polar bears was shallow and developed recently, in contrast to the multiple clades of brown bears. We found no genetic signatures of recent hybridization between the species in our large, circumpolar sample, suggesting that recently observed hybrids represent localized events. Documenting changes in subpopulation connectivity will allow

  16. Implications of the circumpolar genetic structure of polar bears for their conservation in a rapidly warming Arctic

    Science.gov (United States)

    Peacock, Elizabeth; Sonsthagen, Sarah A.; Obbard, Martyn E.; Boltunov, Andrei N.; Regehr, Eric V.; Ovsyanikov, Nikita; Aars, Jon; Atkinson, Stephen N.; Sage, George K.; Hope, Andrew G.; Zeyl, Eve; Bachmann, Lutz; Ehrich, Dorothee; Scribner, Kim T.; Amstrup, Steven C.; Belikov, Stanislav; Born, Erik W.; Derocher, Andrew E.; Stirling, Ian; Taylor, Mitchell K.; Wiig, Øystein; Paetkau, David; Talbot, Sandra L.

    2015-01-01

    We provide an expansive analysis of polar bear (Ursus maritimus) circumpolar genetic variation during the last two decades of decline in their sea-ice habitat. We sought to evaluate whether their genetic diversity and structure have changed over this period of habitat decline, how their current genetic patterns compare with past patterns, and how genetic demography changed with ancient fluctuations in climate. Characterizing their circumpolar genetic structure using microsatellite data, we defined four clusters that largely correspond to current ecological and oceanographic factors: Eastern Polar Basin, Western Polar Basin, Canadian Archipelago and Southern Canada. We document evidence for recent (ca. last 1–3 generations) directional gene flow from Southern Canada and the Eastern Polar Basin towards the Canadian Archipelago, an area hypothesized to be a future refugium for polar bears as climate-induced habitat decline continues. Our data provide empirical evidence in support of this hypothesis. The direction of current gene flow differs from earlier patterns of gene flow in the Holocene. From analyses of mitochondrial DNA, the Canadian Archipelago cluster and the Barents Sea subpopulation within the Eastern Polar Basin cluster did not show signals of population expansion, suggesting these areas may have served also as past interglacial refugia. Mismatch analyses of mitochondrial DNA data from polar and the paraphyletic brown bear (U. arctos) uncovered offset signals in timing of population expansion between the two species, that are attributed to differential demographic responses to past climate cycling. Mitogenomic structure of polar bears was shallow and developed recently, in contrast to the multiple clades of brown bears. We found no genetic signatures of recent hybridization between the species in our large, circumpolar sample, suggesting that recently observed hybrids represent localized events. Documenting changes in subpopulation connectivity will

  17. Genetic parameters and estimated genetic gains in young rubber tree progenies

    Directory of Open Access Journals (Sweden)

    Cecília Khusala Verardi

    2013-04-01

    Full Text Available The objective of this work was to assess the genetic parameters and to estimate genetic gains in young rubber tree progenies. The experiments were carried out during three years, in a randomized block design, with six replicates and ten plants per plot, in three representative Hevea crop regions of the state of São Paulo, Brazil. Twenty-two progenies were evaluated, from three to five years old, for rubber yield and annual girth growth. Genetic gain was estimated with the multi-effect index (MEI. Selection by progenies means provided greater estimated genetic gain than selection based on individuals, since heritability values of progeny means were greater than the ones of individual heritability, for both evaluated variables, in all the assessment years. The selection of the three best progenies for rubber yield provided a selection gain of 1.28 g per plant. The genetic gains estimated with MEI using data from early assessments (from 3 to 5-year-old were generally high for annual girth growth and rubber yield. The high genetic gains for annual girth growth in the first year of assessment indicate that progenies can be selected at the beginning of the breeding program. Population effective size was consistent with the three progenies selected, showing that they were not related and that the population genetic variability is ensured. Early selection with the genetic gains estimated by MEI can be made on rubber tree progenies.

  18. The impact of translocations on neutral and functional genetic diversity within and among populations of the Seychelles warbler.

    Science.gov (United States)

    Wright, David J; Spurgin, Lewis G; Collar, Nigel J; Komdeur, Jan; Burke, Terry; Richardson, David S

    2014-05-01

    Translocations are an increasingly common tool in conservation. The maintenance of genetic diversity through translocation is critical for both the short- and long-term persistence of populations and species. However, the relative spatio-temporal impacts of translocations on neutral and functional genetic diversity, and how this affects genetic structure among the conserved populations overall, have received little investigation. We compared the impact of translocating different numbers of founders on both microsatellite and major histocompatibility complex (MHC) class I diversity over a 23-year period in the Seychelles warbler (Acrocephalus sechellensis). We found low and stable microsatellite and MHC diversity in the source population and evidence for only a limited loss of either type of diversity in the four new populations. However, we found evidence of significant, but low to moderate, genetic differentiation between populations, with those populations established with fewer founders clustering separately. Stochastic genetic capture (as opposed to subsequent drift) was the main determinant of translocated population diversity. Furthermore, a strong correlation between microsatellite and MHC differentiation suggested that neutral processes outweighed selection in shaping MHC diversity in the new populations. These data provide important insights into how to optimize the use of translocation as a conservation tool. © 2014 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

  19. The genetics of radiation-induced and sporadic osteosarcoma: a unifying theory?

    International Nuclear Information System (INIS)

    Rosemann, Michael; Kuosaite, Virginija; Nathrath, Michaela; Atkinson, Michael J.

    2002-01-01

    Cancer is a disease of the genome, with the neoplastic phenotype being passed from one cell generation to the other. Radiation-induced cancer has often been considered to represent a unique entity amongst neoplasia, with the energy deposition being held responsible for both direct (gene mutations) and indirect (bystander effects, induced instability etc) alterations to the cellular genome. However, radiogenic tumours in man and experimental animals appear to be physiologically and genetically indistinguishable from their sporadic counterparts, suggesting that the aetiologies of these two tumour types are in fact closely related. We have conducted a general screen of the genetic alterations in radiation-induced mouse osteosarcoma, a tumour that is histopathologically indistinguishable from human sporadic osteosarcoma. Comparison of the two tumour types indicates the existence of a common set of genetic changes, providing additional evidence to support the concept that the molecular pathology of radiation-induced malignancy is no different to that of sporadic cancers. (author)

  20. Genetic predictors of obesity development

    Directory of Open Access Journals (Sweden)

    Svetlana V. Borodina

    2016-05-01

    Full Text Available The most common reasons that cause obesity are eating disorders (overeating, genetic predisposition, sedentary lifestyle (lack of exercise, disorders of the endocrine system, and environmental factors. There is evidence of an obvious relationship of high consumption of sugary drinks and weight gain. Since 1990, there has been considerable growth in the number of obese people in the first place associated with the promotion of soft drinks. According to a study in Finnish diabetes prevention average physical activity and change of diet (1200-1800 kcal of total fat intake with less than 30% saturated fat, including less than 10%, leading to long-term loss of excess weight (within 4 years. Many studies have demonstrated the impossibility of a single template approach to the determination of optimal diets for patients with overweight and obesity which has been shown in various studies on gene polymorphisms are associated with obesity, and their interaction. This article provides an overview of current data on the genetics of obesity covering the main provisions of the study of candidate genes, such as PPARG, FABP2, ADRB 2, ADRB3. The role nutrigenetics in the creation of individual programs of weight control and weight loss. But the question of the direct role of genetic factors in the development of obesity remains controversial, since one can not ignore the impact of environmental factors, such as lifestyle, diet, physical activity, stress, and harmful habits. To understand the mechanism of the relationship between genetic factors, environmental factors, and obesity, one needs to carry out research not only on the population level, but also in certain groups of people (ethnic, racial, age.

  1. Species delimitation and conservation genetics of the Canarian endemic Bethencourtia (Asteraceae).

    Science.gov (United States)

    Rodríguez-Rodríguez, Priscila; Pérez de Paz, Pedro Luis; Sosa, Pedro A

    2018-04-01

    Bethencourtia Choisy ex Link is an endemic genus of the Canary Islands and comprises three species. Bethencourtia hermosae and Bethencourtia rupicola are restricted to La Gomera, while Bethencourtia palmensis is present in Tenerife and La Palma. Despite the morphological differences previously found between the species, there are still taxonomic incongruities in the group, with evident consequences for its monitoring and conservation. The objectives of this study were to define the species differentiation, perform population genetic analysis and propose conservation strategies for Bethencourtia. To achieve these objectives, we characterized 10 polymorphic SSR markers. Eleven natural populations (276 individuals) were analyzed (three for B. hermosae, five for B. rupicola and three for B. palmensis). The results obtained by AMOVA, PCoA and Bayesian analysis on STRUCTURE confirmed the evidence of well-structured groups corresponding to the three species. At the intra-specific level, B. hermosae and B. rupicola did not show a clear population structure, while B. palmensis was aggregated according to island of origin. This is consistent with self-incompatibility in the group and high gene flow within species. Overall, the genetic diversity of the three species was low, with expected heterozygosity values of 0.302 (B. hermosae), 0.382 (B. rupicola) and 0.454 (B. palmensis). Recent bottleneck events and a low number of individuals per population are probably the causes of the low genetic diversity. We consider that they are naturally rare species associated with specific habitats. The results given in this article will provide useful information to assist in conservation genetics programs for this endemic genus.

  2. Genetics of zinc tolerance in Anthoxanthum odoratum and Agrostis tenuis

    Energy Technology Data Exchange (ETDEWEB)

    Gartside, D W; McNeilly, T

    1974-01-01

    The genetic control of zinc tolerance in the grass Anthoxanthum odoratum and Agrostis tenuis has been examined using both the pair cross technique and the diallele analysis procedure used by others. Evidence is presented that the genetic control of zinc tolerance in both species is dominant and directional with a high degree of additive genetic variance.

  3. Tree rings provide a new class of phenotypes for genetic associations that foster insights into adaptation of conifers to climate change.

    Science.gov (United States)

    Housset, Johann M; Nadeau, Simon; Isabel, Nathalie; Depardieu, Claire; Duchesne, Isabelle; Lenz, Patrick; Girardin, Martin P

    2018-04-01

    Local adaptation in tree species has been documented through a long history of common garden experiments where functional traits (height, bud phenology) are used as proxies for fitness. However, the ability to identify genes or genomic regions related to adaptation to climate requires the evaluation of traits that precisely reflect how and when climate exerts selective constraints. We combine dendroecology with association genetics to establish a link between genotypes, phenotypes and interannual climatic fluctuations. We illustrate this approach by examining individual tree responses embedded in the annual rings of 233 Pinus strobus trees growing in a common garden experiment representing 38 populations from the majority of its range. We found that interannual variability in growth was affected by low temperatures during spring and autumn, and by summer heat and drought. Among-population variation in climatic sensitivity was significantly correlated with the mean annual temperature of the provenance, suggesting local adaptation. Genotype-phenotype associations using these new tree-ring phenotypes validated nine candidate genes identified in a previous genetic-environment association study. Combining dendroecology with association genetics allowed us to assess tree vulnerability to past climate at fine temporal scales and provides avenues for future genomic studies on functional adaptation in forest trees. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.

  4. Mapping DNA damage-dependent genetic interactions in yeast via party mating and barcode fusion genetics.

    Science.gov (United States)

    Díaz-Mejía, J Javier; Celaj, Albi; Mellor, Joseph C; Coté, Atina; Balint, Attila; Ho, Brandon; Bansal, Pritpal; Shaeri, Fatemeh; Gebbia, Marinella; Weile, Jochen; Verby, Marta; Karkhanina, Anna; Zhang, YiFan; Wong, Cassandra; Rich, Justin; Prendergast, D'Arcy; Gupta, Gaurav; Öztürk, Sedide; Durocher, Daniel; Brown, Grant W; Roth, Frederick P

    2018-05-28

    Condition-dependent genetic interactions can reveal functional relationships between genes that are not evident under standard culture conditions. State-of-the-art yeast genetic interaction mapping, which relies on robotic manipulation of arrays of double-mutant strains, does not scale readily to multi-condition studies. Here, we describe barcode fusion genetics to map genetic interactions (BFG-GI), by which double-mutant strains generated via en masse "party" mating can also be monitored en masse for growth to detect genetic interactions. By using site-specific recombination to fuse two DNA barcodes, each representing a specific gene deletion, BFG-GI enables multiplexed quantitative tracking of double mutants via next-generation sequencing. We applied BFG-GI to a matrix of DNA repair genes under nine different conditions, including methyl methanesulfonate (MMS), 4-nitroquinoline 1-oxide (4NQO), bleomycin, zeocin, and three other DNA-damaging environments. BFG-GI recapitulated known genetic interactions and yielded new condition-dependent genetic interactions. We validated and further explored a subnetwork of condition-dependent genetic interactions involving MAG1 , SLX4, and genes encoding the Shu complex, and inferred that loss of the Shu complex leads to an increase in the activation of the checkpoint protein kinase Rad53. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.

  5. Genetic secrets: Protecting privacy and confidentiality in the genetic era

    Energy Technology Data Exchange (ETDEWEB)

    Rothstein, M.A. [ed.

    1998-07-01

    Few developments are likely to affect human beings more profoundly in the long run than the discoveries resulting from advances in modern genetics. Although the developments in genetic technology promise to provide many additional benefits, their application to genetic screening poses ethical, social, and legal questions, many of which are rooted in issues of privacy and confidentiality. The ethical, practical, and legal ramifications of these and related questions are explored in depth. The broad range of topics includes: the privacy and confidentiality of genetic information; the challenges to privacy and confidentiality that may be projected to result from the emerging genetic technologies; the role of informed consent in protecting the confidentiality of genetic information in the clinical setting; the potential uses of genetic information by third parties; the implications of changes in the health care delivery system for privacy and confidentiality; relevant national and international developments in public policies, professional standards, and laws; recommendations; and the identification of research needs.

  6. Genetic disorders from an endogamous population

    African Journals Online (AJOL)

    Abdulbari Bener

    b Dept. of Evidence for Population Health Unit, School of Epidemiology and Health Sciences, University of Manchester, Manchester, UK ... genetics counseling and screening for the hereditary diseases programme. Results: The ..... Elementary.

  7. Published GMO studies find no evidence of harm when corrected for multiple comparisons.

    Science.gov (United States)

    Panchin, Alexander Y; Tuzhikov, Alexander I

    2017-03-01

    A number of widely debated research articles claiming possible technology-related health concerns have influenced the public opinion on genetically modified food safety. We performed a statistical reanalysis and review of experimental data presented in some of these studies and found that quite often in contradiction with the authors' conclusions the data actually provides weak evidence of harm that cannot be differentiated from chance. In our opinion the problem of statistically unaccounted multiple comparisons has led to some of the most cited anti-genetically modified organism health claims in history. We hope this analysis puts the original results of these studies into proper context.

  8. Complete genome sequences of two avian infectious bronchitis viruses isolated in Egypt: Evidence for genetic drift and genetic recombination in the circulating viruses.

    Science.gov (United States)

    Abozeid, Hassanein H; Paldurai, Anandan; Khattar, Sunil K; Afifi, Manal A; El-Kady, Magdy F; El-Deeb, Ayman H; Samal, Siba K

    2017-09-01

    Avian infectious bronchitis virus (IBV) is highly prevalent in chicken populations and is responsible for severe economic losses to poultry industry worldwide. In this study, we report the complete genome sequences of two IBV field strains, CU/1/2014 and CU/4/2014, isolated from vaccinated chickens in Egypt in 2014. The genome lengths of the strains CU/1/2014 and CU/4/2014 were 27,615 and 27,637 nucleotides, respectively. Both strains have a common genome organization in the order of 5'-UTR-1a-1b-S-3a-3b-E-M-4b-4c-5a-5b-N-6b-UTR-poly(A) tail-3'. Interestingly, strain CU/1/2014 showed a novel 15-nt deletion in the 4b-4c gene junction region. Phylogenetic analysis of the full S1 genes showed that the strains CU/1/2014 and CU/4/2014 belonged to IBV genotypes GI-1 lineage and GI-23 lineage, respectively. The genome of strain CU/1/2014 is closely related to vaccine strain H120 but showed genome-wide point mutations that lead to 27, 14, 11, 1, 1, 2, 2, and 2 amino acid differences between the two strains in 1a, 1b, S, 3a, M, 4b, 4c, and N proteins, respectively, suggesting that strain CU/1/2014 is probably a revertant of the vaccine strain H120 and evolved by accumulation of point mutations. Recombination analysis of strain CU/4/2014 showed evidence for recombination from at least three different IBV strains, namely, the Italian strain 90254/2005 (QX-like strain), 4/91, and H120. These results indicate the continuing evolution of IBV field strains by genetic drift and by genetic recombination leading to outbreaks in the vaccinated chicken populations in Egypt. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Stroke genetics: prospects for personalized medicine

    Directory of Open Access Journals (Sweden)

    Markus Hugh S

    2012-09-01

    Full Text Available Abstract Epidemiologic evidence supports a genetic predisposition to stroke. Recent advances, primarily using the genome-wide association study approach, are transforming what we know about the genetics of multifactorial stroke, and are identifying novel stroke genes. The current findings are consistent with different stroke subtypes having different genetic architecture. These discoveries may identify novel pathways involved in stroke pathogenesis, and suggest new treatment approaches. However, the already identified genetic variants explain only a small proportion of overall stroke risk, and therefore are not currently useful in predicting risk for the individual patient. Such risk prediction may become a reality as identification of a greater number of stroke risk variants that explain the majority of genetic risk proceeds, and perhaps when information on rare variants, identified by whole-genome sequencing, is also incorporated into risk algorithms. Pharmacogenomics may offer the potential for earlier implementation of 'personalized genetic' medicine. Genetic variants affecting clopidogrel and warfarin metabolism may identify non-responders and reduce side-effects, but these approaches have not yet been widely adopted in clinical practice.

  10. Genetic effects from internally deposited radionuclides

    International Nuclear Information System (INIS)

    Anon.

    1987-01-01

    It was learned in the late 1920's that ionizing radiation could produce genetic effects such as gene mutations and chromosome aberrations. However, at least until 1945, the focus on interest in radiation protection was primarily on somatic effects manifested in the individual exposed. Studies of the genetic effects of radiation using drosophila, however, refocused attention on effects transmitted to the exposed individuals offspring and concern over fallout in the 1950's resulted in efforts to estimate the genetic effects from exposure of human populations to internally deposited radionuclides. No human populations have been identified with burdens of internally deposited radioactive materials which have been shown to produce evidence of transmissible genetic damage. As a result, the research approach has been one in which macromolecular, cellular, and whole animal genetic studies have been combined to estimate genetic effects on humans following the deposition of radioactive materials in the body. The purpose of this report is to update the information available from animal and cellular experiments that relates genetic effects to deposited activity and dose from internally deposited radioactive materials

  11. Evidence-based obstetrics in four hospitals in China: An observational study to explore clinical practice, women's preferences and provider's views

    Directory of Open Access Journals (Sweden)

    Liang Ji

    2001-05-01

    Full Text Available Abstract Background Evidence-based obstetric care is widely promoted in developing countries, but the success of implementation is not known. Using selected childbirth care procedures in four hospitals in Shanghai, we compared practice against evidence-based information, and explored user and provider views about each procedure. Methods Observational study. Using the Cochrane Library, we identified six procedures that should be avoided as routine and two that should be encouraged. Procedure rate determined by exit interviews with women, verified using hospital notes. Views of women and providers explored with in depth interviews. The study sites were three hospitals in Shanghai and one in neighbouring province of Jiangsu. 150 women at each centre for procedure rate, and 48 in-depth interviews with women and providers. Results Vaginal births were 50% (303/599 of the total. Of the six practices where evidence suggests they should be avoided as routine, three were performed with rates above 70%: pubic shaving (3 hospitals, rectal examination (3 hospitals, and episiotomy (3 hospitals. Most women delivered lying down, pain relief was rarely given, and only in the urban district hospital did women routinely have a companion. Most women wanted support or companionship during labour and to be given pain relief; but current practice is insufficient to meet women's needs. Conclusion Obstetric practice is not following best available evidence in the hospitals studied. There is a need to adjust hospital policy to support the use of interventions proven to be of benefit to women during childbirth, and develop approaches that ensure clinical practice changes.

  12. Genetic diversity of neotropical Myotis (chiroptera: vespertilionidae with an emphasis on South American species.

    Directory of Open Access Journals (Sweden)

    Roxanne J Larsen

    Full Text Available BACKGROUND: Cryptic morphological variation in the Chiropteran genus Myotis limits the understanding of species boundaries and species richness within the genus. Several authors have suggested that it is likely there are unrecognized species-level lineages of Myotis in the Neotropics. This study provides an assessment of the diversity in New World Myotis by analyzing cytochrome-b gene variation from an expansive sample ranging throughout North, Central, and South America. We provide baseline genetic data for researchers investigating phylogeographic and phylogenetic patterns of Myotis in these regions, with an emphasis on South America. METHODOLOGY AND PRINCIPAL FINDINGS: Cytochrome-b sequences were generated and phylogenetically analyzed from 215 specimens, providing DNA sequence data for the most species of New World Myotis to date. Based on genetic data in our sample, and on comparisons with available DNA sequence data from GenBank, we estimate the number of species-level genetic lineages in South America alone to be at least 18, rather than the 15 species currently recognized. CONCLUSIONS: Our findings provide evidence that the perception of lower species richness in South American Myotis is largely due to a combination of cryptic morphological variation and insufficient sampling coverage in genetic-based systematic studies. A more accurate assessment of the level of diversity and species richness in New World Myotis is not only helpful for delimiting species boundaries, but also for understanding evolutionary processes within this globally distributed bat genus.

  13. Current clinical evidence on pioglitazone pharmacogenomics

    Directory of Open Access Journals (Sweden)

    Marina eKawaguchi-Suzuki

    2013-11-01

    Full Text Available Pioglitazone is the most widely used thiazolidinedione and acts as an insulin-sensitizer through activation of the Peroxisome Proliferator-Activated Receptor-γ (PPARγ. Pioglitazone is approved for use in the management of type 2 diabetes mellitus, but its use in other therapeutic areas is increasing due to pleiotropic effects. In this hypothesis article, the current clinical evidence on pioglitazone pharmacogenomics is summarized and related to variability in pioglitazone response. How genetic variation in the human genome affects the pharmacokinetics and pharmacodynamics of pioglitazone was examined. For pharmacodynamic effects, hypoglycemic and anti-atherosclerotic effects, risks of fracture or edema, and the increase in body mass index in response to pioglitazone based on genotype were examined. The genes CYP2C8 and PPARG are the most extensively studied to date and selected polymorphisms contribute to respective variability in pioglitazone pharmacokinetics and pharmacodynamics. We hypothesized that genetic variation in pioglitazone pathway genes contributes meaningfully to the clinically observed variability in drug response. To test the hypothesis that genetic variation in PPARG associates with variability in pioglitazone response, we conducted a meta-analysis to synthesize the currently available data on the PPARG p.Pro12Ala polymorphism. The results showed that PPARG 12Ala carriers had a more favorable change in fasting blood glucose from baseline as compared to patients with the wild-type Pro12Pro genotype (p=0.018. Unfortunately, findings for many other genes lack replication in independent cohorts to confirm association; further studies are needed. Also, the biological functionality of these polymorphisms is unknown. Based on current evidence, we propose that pharmacogenomics may provide an important tool to individualize pioglitazone therapy and better optimize therapy in patients with T2DM or other conditions for which pioglitazone

  14. Genetic Pathways to Insomnia

    OpenAIRE

    Mackenzie J. Lind; Philip R. Gehrman

    2016-01-01

    This review summarizes current research on the genetics of insomnia, as genetic contributions are thought to be important for insomnia etiology. We begin by providing an overview of genetic methods (both quantitative and measured gene), followed by a discussion of the insomnia genetics literature with regard to each of the following common methodologies: twin and family studies, candidate gene studies, and genome-wide association studies (GWAS). Next, we summarize the most recent gene identif...

  15. Inter individual variations of the fish skin microbiota: host genetics basis of mutualism?

    Science.gov (United States)

    Boutin, Sébastien; Sauvage, Christopher; Bernatchez, Louis; Audet, Céline; Derome, Nicolas

    2014-01-01

    The commensal microbiota of fish skin is suspected to provide a protection against opportunist infections. The skin of fish harbors a complex and diverse microbiota that closely interacts with the surrounding water microbial communities. Up to now there is no clear evidence as to whether the host regulates the recruitment of environmental bacteria to build a specific skin microbiota. To address this question, we detected Quantitative Trait Loci (QTL) associated with the abundance of specific skin microbiota bacterial strains in brook charr (Salvelinus fontinalis), combining 16S RNA tagged-amplicon 454 pyrosequencing with genetic linkage analysis. Skin microbiota analysis revealed high inter-individual variation among 86 F2 fish progeny based upon the relative abundance of bacterial operational taxonomic units (OTUs). Out of those OTUs, the pathogenic strain Flavobacterium psychrophilum and the non-pathogenic strain Methylobacterium rhodesianum explained the majority of inter-individual distances. Furthermore, a strong negative correlation was found between Flavobacterium and Methylobacterium, suggesting a mutually competitive relationship. Finally, after considering a total of 266 markers, genetic linkage analysis highlighted three major QTL associated with the abundance of Lysobacter, Rheinheimera and Methylobacterium. All these three genera are known for their beneficial antibacterial activity. Overall, our results provide evidence that host genotype may regulate the abundance of specific genera among their surface microbiota. They also indicate that Lysobacter, Rheinheimera and Methylobacterium are potentially important genera in providing protection against pathogens.

  16. Historical Processes and Contemporary Anthropogenic Activities Influence Genetic Population Dynamics of Nassau Grouper (Epinephelus striatus within The Bahamas

    Directory of Open Access Journals (Sweden)

    Krista D. Sherman

    2017-12-01

    Full Text Available Severe declines of endangered Nassau grouper (Epinephelus striatus across The Bahamas and Caribbean have spurred efforts to improve their fisheries management and population conservation. The Bahamas is reported to hold the majority of fish spawning aggregations for Nassau grouper, however, the status and genetic population structure of fish within the country is largely unknown, presenting a major knowledge gap for their sustainable management. Between August 2014–February 2017, 464 individual Nassau grouper sampled from The Bahamas were genotyped using 15 polymorphic microsatellite loci to establish measures of population structure, genetic diversity and effective population size (Ne. Nassau grouper were characterized by mostly high levels of genetic diversity, but we found no evidence for geographic population structure. Microsatellite analyses revealed weak, but significant genetic differentiation of Nassau grouper throughout the Bahamian archipelago (Global FST 0.00236, p = 0.0001. Temporal analyses of changes in Ne over the last 1,000 generations provide evidence in support of a pronounced historic decline in Bahamian Nassau grouper that appears to pre-date anthropogenic fishing activities. M-ratio results corroborate significant reductions in Ne throughout The Bahamas, with evidence for population bottlenecks in three islands and an active fish spawning aggregation along with apparent signs of inbreeding at two islands. Current estimates of Ne for Nassau grouper are considerably lower compared with historic levels. These findings represent important new contributions to our understanding of the evolutionary history, demographics and genetic connectivity of this endangered species, which are of critical importance for advancing their sustainable management.

  17. The Genetic Structure of Marijuana and Hemp.

    Directory of Open Access Journals (Sweden)

    Jason Sawler

    Full Text Available Despite its cultivation as a source of food, fibre and medicine, and its global status as the most used illicit drug, the genus Cannabis has an inconclusive taxonomic organization and evolutionary history. Drug types of Cannabis (marijuana, which contain high amounts of the psychoactive cannabinoid Δ9-tetrahydrocannabinol (THC, are used for medical purposes and as a recreational drug. Hemp types are grown for the production of seed and fibre, and contain low amounts of THC. Two species or gene pools (C. sativa and C. indica are widely used in describing the pedigree or appearance of cultivated Cannabis plants. Using 14,031 single-nucleotide polymorphisms (SNPs genotyped in 81 marijuana and 43 hemp samples, we show that marijuana and hemp are significantly differentiated at a genome-wide level, demonstrating that the distinction between these populations is not limited to genes underlying THC production. We find a moderate correlation between the genetic structure of marijuana strains and their reported C. sativa and C. indica ancestry and show that marijuana strain names often do not reflect a meaningful genetic identity. We also provide evidence that hemp is genetically more similar to C. indica type marijuana than to C. sativa strains.

  18. The Genetic Structure of Marijuana and Hemp

    Science.gov (United States)

    Sawler, Jason; Stout, Jake M.; Gardner, Kyle M.; Hudson, Darryl; Vidmar, John; Butler, Laura; Page, Jonathan E.; Myles, Sean

    2015-01-01

    Despite its cultivation as a source of food, fibre and medicine, and its global status as the most used illicit drug, the genus Cannabis has an inconclusive taxonomic organization and evolutionary history. Drug types of Cannabis (marijuana), which contain high amounts of the psychoactive cannabinoid Δ 9-tetrahydrocannabinol (THC), are used for medical purposes and as a recreational drug. Hemp types are grown for the production of seed and fibre, and contain low amounts of THC. Two species or gene pools (C. sativa and C. indica) are widely used in describing the pedigree or appearance of cultivated Cannabis plants. Using 14,031 single-nucleotide polymorphisms (SNPs) genotyped in 81 marijuana and 43 hemp samples, we show that marijuana and hemp are significantly differentiated at a genome-wide level, demonstrating that the distinction between these populations is not limited to genes underlying THC production. We find a moderate correlation between the genetic structure of marijuana strains and their reported C. sativa and C. indica ancestry and show that marijuana strain names often do not reflect a meaningful genetic identity. We also provide evidence that hemp is genetically more similar to C. indica type marijuana than to C. sativa strains. PMID:26308334

  19. A roadmap for the genetic analysis of renal aging

    NARCIS (Netherlands)

    Noordmans, Gerda A.; van Goor, Harry; Hillebrands, Jan-Luuk; Korstanje, Ron

    2015-01-01

    Several studies show evidence for the genetic basis of renal disease, which renders some individuals more prone than others to accelerated renal aging. Studying the genetics of renal aging can help us to identify genes involved in this process and to unravel the underlying pathways. First, this

  20. Genetic factors in Threatened Species Recovery Plans on three continents

    Science.gov (United States)

    Threatened species' recovery planning is applied globally to stem the current species extinction crisis. Evidence supports a key role of genetic processes, such as inbreeding depression, in determining species viability. We examined whether genetic factors are considered in threa...

  1. Genetic connectivity of the moth pollinated tree Glionnetia sericea in a highly fragmented habitat.

    Science.gov (United States)

    Finger, Aline; Kaiser-Bunbury, Christopher N; Kettle, Chris J; Valentin, Terence; Ghazoul, Jaboury

    2014-01-01

    Long-distance gene flow is thought to be one prerequisite for the persistence of plant species in fragmented environments. Human influences have led to severe fragmentation of native habitats in the Seychelles islands, with many species surviving only in small and isolated populations. The endangered Seychelles endemic tree Glionnetia sericea is restricted to altitudes between 450 m and 900 m where the native forest vegetation has been largely lost and replaced with exotic invasives over the last 200 years. This study explores the genetic and ecological consequences of population fragmentation in this species by analysing patterns of genetic diversity in a sample of adults, juveniles and seeds, and by using controlled pollination experiments. Our results show no decrease in genetic diversity and no increase in genetic structuring from adult to juvenile cohorts. Despite significant inbreeding in some populations, there is no evidence of higher inbreeding in juvenile cohorts relative to adults. A Bayesian structure analysis and a tentative paternity analysis indicate extensive historical and contemporary gene flow among remnant populations. Pollination experiments and a paternity analysis show that Glionnetia sericea is self-compatible. Nevertheless, outcrossing is present with 7% of mating events resulting from pollen transfer between populations. Artificial pollination provided no evidence for pollen limitation in isolated populations. The highly mobile and specialized hawkmoth pollinators (Agrius convolvuli and Cenophodes tamsi; Sphingidae) appear to promote extensive gene flow, thus mitigating the potential negative ecological and genetic effects of habitat fragmentation in this species. We conclude that contemporary gene flow is sufficient to maintain genetic connectivity in this rare and restricted Seychelles endemic, in contrast to other island endemic tree species with limited contemporary gene flow.

  2. Genetic connectivity of the moth pollinated tree Glionnetia sericea in a highly fragmented habitat.

    Directory of Open Access Journals (Sweden)

    Aline Finger

    Full Text Available Long-distance gene flow is thought to be one prerequisite for the persistence of plant species in fragmented environments. Human influences have led to severe fragmentation of native habitats in the Seychelles islands, with many species surviving only in small and isolated populations. The endangered Seychelles endemic tree Glionnetia sericea is restricted to altitudes between 450 m and 900 m where the native forest vegetation has been largely lost and replaced with exotic invasives over the last 200 years. This study explores the genetic and ecological consequences of population fragmentation in this species by analysing patterns of genetic diversity in a sample of adults, juveniles and seeds, and by using controlled pollination experiments. Our results show no decrease in genetic diversity and no increase in genetic structuring from adult to juvenile cohorts. Despite significant inbreeding in some populations, there is no evidence of higher inbreeding in juvenile cohorts relative to adults. A Bayesian structure analysis and a tentative paternity analysis indicate extensive historical and contemporary gene flow among remnant populations. Pollination experiments and a paternity analysis show that Glionnetia sericea is self-compatible. Nevertheless, outcrossing is present with 7% of mating events resulting from pollen transfer between populations. Artificial pollination provided no evidence for pollen limitation in isolated populations. The highly mobile and specialized hawkmoth pollinators (Agrius convolvuli and Cenophodes tamsi; Sphingidae appear to promote extensive gene flow, thus mitigating the potential negative ecological and genetic effects of habitat fragmentation in this species. We conclude that contemporary gene flow is sufficient to maintain genetic connectivity in this rare and restricted Seychelles endemic, in contrast to other island endemic tree species with limited contemporary gene flow.

  3. Physiologic and genetic evidence links hemopexin to triglycerides in mice and humans.

    Science.gov (United States)

    Lawson, H A; Zayed, M; Wayhart, J P; Fabbrini, E; Love-Gregory, L; Klein, S; Semenkovich, C F

    2017-04-01

    Elevated triglycerides predict insulin resistance and vascular disease in obesity, but how the inert triglyceride molecule is related to development of metabolic disease is unknown. To pursue novel potential mediators of triglyceride-associated metabolic disease, we used a forward genetics approach involving inbred mice and translated our findings to human subjects. Hemopexin (HPX) was identified as a differentially expressed gene within a quantitative trait locus associated with serum triglycerides in an F 16 advanced intercross between the LG/J and SM/J strains of mice. Hpx expression was evaluated in both the reproductive fat pads and livers of mice representing three strains, LG/J (n=25), SM/J (n=27) and C57Bl/6J (n=19), on high- and low-fat diets. The effect of altered Hpx expression on adipogenesis was studied in 3T3-L1 cells. Circulating HPX protein along with HPX expression were characterized in subcutaneous white adipose tissue samples obtained from a cohort of metabolically abnormal (n=18) and of metabolically normal (n=24) obese human subjects. We further examined the relationship between HPX and triglycerides in human atherosclerotic plaques (n=18). HPX expression in mouse adipose tissue, but not in liver, was regulated by dietary fat regardless of genetic background. HPX increased in concert with adipogenesis in 3T3-L1 cells, and disruption of its expression impaired adipocyte differentiation. RNAseq data from the adipose tissue of obese humans showed differential expression of HPX based on metabolic disease status (Ptriglycerides in these subjects (r=0.33; P=0.03). HPX was also found in an unbiased proteomic screen of human atherosclerotic plaques and shown to display differential abundance based on the extent of disease and triglyceride content (Ptriglycerides and provide a framework for understanding mechanisms underlying lipid metabolism and metabolic disease.

  4. Marshes as "Mountain Tops": Genetic Analyses of the Critically Endangered São Paulo Marsh Antwren (Aves: Thamnophilidae).

    Science.gov (United States)

    de Camargo, Crisley; Gibbs, H Lisle; Costa, Mariellen C; Del-Rio, Glaucia; Silveira, Luís F; Wasko, Adriane P; Francisco, Mercival R

    2015-01-01

    Small populations of endangered species can be impacted by genetic processes such as drift and inbreeding that reduce population viability. As such, conservation genetic analyses that assess population levels of genetic variation and levels of gene flow can provide important information for managing threatened species. The São Paulo Marsh Antwren (Formicivora paludicola) is a recently-described and critically endangered bird from São Paulo State (Brazil) whose total estimated population is around 250-300 individuals, distributed in only 15 isolated marshes around São Paulo metropolitan region. We used microsatellite DNA markers to estimate the population genetic characteristics of the three largest remaining populations of this species all within 60 km of each other. We detected a high and significant genetic structure between all populations (overall FST = 0.103) which is comparable to the highest levels of differentiation ever documented for birds, (e.g., endangered birds found in isolated populations on the tops of African mountains), but also evidence for first-generation immigrants, likely from small local unsampled populations. Effective population sizes were small (between 28.8-99.9 individuals) yet there are high levels of genetic variability within populations and no evidence for inbreeding. Conservation implications of this work are that the high levels of genetic structure suggests that translocations between populations need to be carefully considered in light of possible local adaptation and that remaining populations of these birds should be managed as conservation units that contain both main populations studied here but also small outlying populations which may be a source of immigrants.

  5. A new genetic linkage map of the zygomycete fungus Phycomyces blakesleeanus.

    Directory of Open Access Journals (Sweden)

    Suman Chaudhary

    Full Text Available Phycomyces blakesleeanus is a member of the subphylum Mucoromycotina. A genetic map was constructed from 121 progeny of a cross between two wild type isolates of P. blakesleeanus with 134 markers. The markers were mostly PCR-RFLPs. Markers were located on 46 scaffolds of the genome sequence, covering more than 97% of the genome. Analysis of the alleles in the progeny revealed nine or 12 linkage groups, depending on the log of the odds (LOD score, across 1583.4 cM at LOD 5. The linkage groups were overlaid on previous mapping data from crosses between mutants, aided by new identification of the mutations in primary metabolism mutant strains. The molecular marker map, the phenotype map and the genome sequence are overall congruent, with some exceptions. The new genetic map provides a genome-wide estimate for recombination, with the average of 33.2 kb per cM. This frequency is one piece of evidence for meiosis during zygospore development in Mucoromycotina species. At the same time as meiosis, transmission of non-recombinant chromosomes is also evident in the mating process in Phycomyces. The new map provides scaffold ordering for the genome sequence and a platform upon which to identify the genes in mutants that are affected in traits of interest, such as carotene biosynthesis, phototropism or gravitropism, using positional cloning.

  6. EvolQG - An R package for evolutionary quantitative genetics [version 2; referees: 1 approved, 2 approved with reservations

    Directory of Open Access Journals (Sweden)

    Diogo Melo

    2016-06-01

    Full Text Available We present an open source package for performing evolutionary quantitative genetics analyses in the R environment for statistical computing. Evolutionary theory shows that evolution depends critically on the available variation in a given population. When dealing with many quantitative traits this variation is expressed in the form of a covariance matrix, particularly the additive genetic covariance matrix or sometimes the phenotypic matrix, when the genetic matrix is unavailable and there is evidence the phenotypic matrix is sufficiently similar to the genetic matrix. Given this mathematical representation of available variation, the EvolQG package provides functions for calculation of relevant evolutionary statistics; estimation of sampling error; corrections for this error; matrix comparison via correlations, distances and matrix decomposition; analysis of modularity patterns; and functions for testing evolutionary hypotheses on taxa diversification.

  7. Red blood cell distribution width: Genetic evidence for aging pathways in 116,666 volunteers.

    Directory of Open Access Journals (Sweden)

    Luke C Pilling

    Full Text Available Variability in red blood cell volumes (distribution width, RDW increases with age and is strongly predictive of mortality, incident coronary heart disease and cancer. We investigated inherited genetic variation associated with RDW in 116,666 UK Biobank human volunteers.A large proportion RDW is explained by genetic variants (29%, especially in the older group (60+ year olds, 33.8%, <50 year olds, 28.4%. RDW was associated with 194 independent genetic signals; 71 are known for conditions including autoimmune disease, certain cancers, BMI, Alzheimer's disease, longevity, age at menopause, bone density, myositis, Parkinson's disease, and age-related macular degeneration. Exclusion of anemic participants did not affect the overall findings. Pathways analysis showed enrichment for telomere maintenance, ribosomal RNA, and apoptosis. The majority of RDW-associated signals were intronic (119 of 194, including SNP rs6602909 located in an intron of oncogene GAS6, an eQTL in whole blood.Although increased RDW is predictive of cardiovascular outcomes, this was not explained by known CVD or related lipid genetic risks, and a RDW genetic score was not predictive of incident disease. The predictive value of RDW for a range of negative health outcomes may in part be due to variants influencing fundamental pathways of aging.

  8. Limited Pollen Dispersal Contributes to Population Genetic Structure but Not Local Adaptation in Quercus oleoides Forests of Costa Rica.

    Directory of Open Access Journals (Sweden)

    Nicholas John Deacon

    Full Text Available Quercus oleoides Cham. and Schlect., tropical live oak, is a species of conservation importance in its southern range limit of northwestern Costa Rica. It occurs in high-density stands across a fragmented landscape spanning a contrasting elevation and precipitation gradient. We examined genetic diversity and spatial genetic structure in this geographically isolated and genetically distinct population. We characterized population genetic diversity at 11 nuclear microsatellite loci in 260 individuals from 13 sites. We monitored flowering time at 10 sites, and characterized the local environment in order to compare observed spatial genetic structure to hypotheses of isolation-by-distance and isolation-by-environment. Finally, we quantified pollen dispersal distances and tested for local adaptation through a reciprocal transplant experiment in order to experimentally address these hypotheses.High genetic diversity is maintained in the population and the genetic variation is significantly structured among sampled sites. We identified 5 distinct genetic clusters and average pollen dispersal predominately occurred over short distances. Differences among sites in flowering phenology and environmental factors, however, were not strictly associated with genetic differentiation. Growth and survival of upland and lowland progeny in their native and foreign environments was expected to exhibit evidence of local adaptation due to the more extreme dry season in the lowlands. Seedlings planted in the lowland garden experienced much higher mortality than seedlings in the upland garden, but we did not identify evidence for local adaptation.Overall, this study indicates that the Costa Rican Q. oleoides population has a rich population genetic history. Despite environmental heterogeneity and habitat fragmentation, isolation-by-distance and isolation-by-environment alone do not explain spatial genetic structure. These results add to studies of genetic structure by

  9. Limited Pollen Dispersal Contributes to Population Genetic Structure but Not Local Adaptation in Quercus oleoides Forests of Costa Rica.

    Science.gov (United States)

    Deacon, Nicholas John; Cavender-Bares, Jeannine

    2015-01-01

    Quercus oleoides Cham. and Schlect., tropical live oak, is a species of conservation importance in its southern range limit of northwestern Costa Rica. It occurs in high-density stands across a fragmented landscape spanning a contrasting elevation and precipitation gradient. We examined genetic diversity and spatial genetic structure in this geographically isolated and genetically distinct population. We characterized population genetic diversity at 11 nuclear microsatellite loci in 260 individuals from 13 sites. We monitored flowering time at 10 sites, and characterized the local environment in order to compare observed spatial genetic structure to hypotheses of isolation-by-distance and isolation-by-environment. Finally, we quantified pollen dispersal distances and tested for local adaptation through a reciprocal transplant experiment in order to experimentally address these hypotheses. High genetic diversity is maintained in the population and the genetic variation is significantly structured among sampled sites. We identified 5 distinct genetic clusters and average pollen dispersal predominately occurred over short distances. Differences among sites in flowering phenology and environmental factors, however, were not strictly associated with genetic differentiation. Growth and survival of upland and lowland progeny in their native and foreign environments was expected to exhibit evidence of local adaptation due to the more extreme dry season in the lowlands. Seedlings planted in the lowland garden experienced much higher mortality than seedlings in the upland garden, but we did not identify evidence for local adaptation. Overall, this study indicates that the Costa Rican Q. oleoides population has a rich population genetic history. Despite environmental heterogeneity and habitat fragmentation, isolation-by-distance and isolation-by-environment alone do not explain spatial genetic structure. These results add to studies of genetic structure by examining a common

  10. Do species conservation assessments capture genetic diversity?

    Directory of Open Access Journals (Sweden)

    Malin C. Rivers

    2014-12-01

    Full Text Available The best known system for classifying threat status of species, the IUCN Red List, currently lacks explicit considerations of genetic diversity, and consequently may not account for potential adaptation of species to future environmental change. To address this gap, we integrate range-wide genetic analysis with IUCN Red List assessments.We calculated the loss of genetic diversity under simulated range loss for species of Delonix (Leguminosae. Simulated range loss involved random loss of populations and was intended to model ongoing habitat destruction. We found a strong relationship between loss of genetic diversity and range. Moreover, we found correspondence between levels of genetic diversity and thresholds for ‘non-threatened’ versus ‘threatened’ IUCN Red List categories.Our results support the view that current threat thresholds of the IUCN Red List criteria reflect genetic diversity, and hence evolutionary potential; although the genetic diversity distinction between threatened categories was less evident. Thus, by supplementing conventional conservation assessments with genetic data, new insights into the biological robustness of IUCN Red List assessments for targeted conservation initiatives can be achieved. Keywords: Conservation assessment, Conservation genetics, Extinction risk, Genetic diversity, IUCN Red List, Range

  11. A roadmap for the genetic analysis of renal aging.

    Science.gov (United States)

    Noordmans, Gerda A; Hillebrands, Jan-Luuk; van Goor, Harry; Korstanje, Ron

    2015-10-01

    Several studies show evidence for the genetic basis of renal disease, which renders some individuals more prone than others to accelerated renal aging. Studying the genetics of renal aging can help us to identify genes involved in this process and to unravel the underlying pathways. First, this opinion article will give an overview of the phenotypes that can be observed in age-related kidney disease. Accurate phenotyping is essential in performing genetic analysis. For kidney aging, this could include both functional and structural changes. Subsequently, this article reviews the studies that report on candidate genes associated with renal aging in humans and mice. Several loci or candidate genes have been found associated with kidney disease, but identification of the specific genetic variants involved has proven to be difficult. CUBN, UMOD, and SHROOM3 were identified by human GWAS as being associated with albuminuria, kidney function, and chronic kidney disease (CKD). These are promising examples of genes that could be involved in renal aging, and were further mechanistically evaluated in animal models. Eventually, we will provide approaches for performing genetic analysis. We should leverage the power of mouse models, as testing in humans is limited. Mouse and other animal models can be used to explain the underlying biological mechanisms of genes and loci identified by human GWAS. Furthermore, mouse models can be used to identify genetic variants associated with age-associated histological changes, of which Far2, Wisp2, and Esrrg are examples. A new outbred mouse population with high genetic diversity will facilitate the identification of genes associated with renal aging by enabling high-resolution genetic mapping while also allowing the control of environmental factors, and by enabling access to renal tissues at specific time points for histology, proteomics, and gene expression. © 2015 The Authors. Aging Cell published by the Anatomical Society and John

  12. A roadmap for the genetic analysis of renal aging

    Science.gov (United States)

    Noordmans, Gerda A; Hillebrands, Jan-Luuk; van Goor, Harry; Korstanje, Ron

    2015-01-01

    Several studies show evidence for the genetic basis of renal disease, which renders some individuals more prone than others to accelerated renal aging. Studying the genetics of renal aging can help us to identify genes involved in this process and to unravel the underlying pathways. First, this opinion article will give an overview of the phenotypes that can be observed in age-related kidney disease. Accurate phenotyping is essential in performing genetic analysis. For kidney aging, this could include both functional and structural changes. Subsequently, this article reviews the studies that report on candidate genes associated with renal aging in humans and mice. Several loci or candidate genes have been found associated with kidney disease, but identification of the specific genetic variants involved has proven to be difficult. CUBN, UMOD, and SHROOM3 were identified by human GWAS as being associated with albuminuria, kidney function, and chronic kidney disease (CKD). These are promising examples of genes that could be involved in renal aging, and were further mechanistically evaluated in animal models. Eventually, we will provide approaches for performing genetic analysis. We should leverage the power of mouse models, as testing in humans is limited. Mouse and other animal models can be used to explain the underlying biological mechanisms of genes and loci identified by human GWAS. Furthermore, mouse models can be used to identify genetic variants associated with age-associated histological changes, of which Far2, Wisp2, and Esrrg are examples. A new outbred mouse population with high genetic diversity will facilitate the identification of genes associated with renal aging by enabling high-resolution genetic mapping while also allowing the control of environmental factors, and by enabling access to renal tissues at specific time points for histology, proteomics, and gene expression. PMID:26219736

  13. Genetic Data Provide Evidence for Wind-Mediated Transmission of Highly Pathogenic Avian Influenza

    NARCIS (Netherlands)

    Ypma, R.J.F.; Jonges, M.; Bataille, A.M.A.; Stegeman, J.A.; Koch, G.; van Boven, R.M.; Koopmans, M.; van Ballegooijen, W.M.; Wallinga, J.

    2013-01-01

    Outbreaks of highly pathogenic avian influenza in poultry can cause severe economic damage and represent a public health threat. Development of efficient containment measures requires an understanding of how these influenza viruses are transmitted between farms. However, the actual mechanisms of

  14. Philosophy of race meets population genetics.

    Science.gov (United States)

    Spencer, Quayshawn

    2015-08-01

    In this paper, I respond to four common semantic and metaphysical objections that philosophers of race have launched at scholars who interpret recent human genetic clustering results in population genetics as evidence for biological racial realism. I call these objections 'the discreteness objection', 'the visibility objection', 'the very important objection', and 'the objectively real objection.' After motivating each objection, I show that each one stems from implausible philosophical assumptions about the relevant meaning of 'race' or the nature of biological racial realism. In order to be constructive, I end by offering some advice for how we can productively critique attempts to defend biological racial realism based on recent human genetic clustering results. I also offer a clarification of the relevant human-population genetic research. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Cryptic Genetic Variation in Evolutionary Developmental Genetics

    Directory of Open Access Journals (Sweden)

    Annalise B. Paaby

    2016-06-01

    Full Text Available Evolutionary developmental genetics has traditionally been conducted by two groups: Molecular evolutionists who emphasize divergence between species or higher taxa, and quantitative geneticists who study variation within species. Neither approach really comes to grips with the complexities of evolutionary transitions, particularly in light of the realization from genome-wide association studies that most complex traits fit an infinitesimal architecture, being influenced by thousands of loci. This paper discusses robustness, plasticity and lability, phenomena that we argue potentiate major evolutionary changes and provide a bridge between the conceptual treatments of macro- and micro-evolution. We offer cryptic genetic variation and conditional neutrality as mechanisms by which standing genetic variation can lead to developmental system drift and, sheltered within canalized processes, may facilitate developmental transitions and the evolution of novelty. Synthesis of the two dominant perspectives will require recognition that adaptation, divergence, drift and stability all depend on similar underlying quantitative genetic processes—processes that cannot be fully observed in continuously varying visible traits.

  16. Genet-specific spawning patterns in Acropora palmata

    Science.gov (United States)

    Miller, M. W.; Williams, D. E.; Fisch, J.

    2016-12-01

    The broadcast spawning elkhorn coral, Acropora palmata, requires outcrossing among different genets for effective fertilization. Hence, a low density of genets in parts of its range emphasizes the need for precise synchrony among neighboring genets as sperm concentration dilutes rapidly in open-ocean conditions. We documented the genet-specific nightly occurrence of spawning of A. palmata over 8 yr in a depauperate population in the Florida Keys to better understand this potential reproductive hurdle. The observed population failed to spawn within the predicted monthly window (nights 2-6 after the full moon in August) in three of the 8 yr of observation; negligible spawning was observed in a fourth year. Moreover, genet-specific patterns are evident in that (1) certain genets have significantly greater odds of spawning overall and (2) certain genets predictably spawn on the earlier and others on the later lunar nights within the predicted window. Given the already low genet density in this population, this pattern implies a substantial degree of wasted reproductive effort and supports the hypothesis that depensatory factors are impairing recovery in this species.

  17. Genetics Home Reference: homocystinuria

    Science.gov (United States)

    ... an increased risk of abnormal blood clotting, and brittle bones that are prone to fracture ( osteoporosis ) or other ... information about a genetic condition can statistics provide? Why are some genetic conditions more common in particular ...

  18. Exploring geovisualization symbology for landscape genetics

    DEFF Research Database (Denmark)

    Aoidh, Eoin Mac; Martinsohn, Jann Th.; Maes, Gregory E.

    2013-01-01

    or genetic expertise. While specialist applications exist, alternative accessible solutions do not provide adequate support for the visualization of multi‐attribute spatially referenced genetic population structure information. As a solution, we document our exploration for an appropriate symbology...... to communicate landscape genetic information through an accessible, web‐based interface. A full problem description, review of available technologies, development rationale, and discussion of the symbology exploration are provided.......Landscape genetics, which considers genetic population structure in the context of spatially referenced parameters in the surrounding landscape, has been shown to be extremely useful for wildlife management. Unfortunately its widespread uptake beyond the research community is hampered due to a lack...

  19. The Genetic Landscape of Renal Complications in Type 1 Diabetes

    DEFF Research Database (Denmark)

    Sandholm, Niina; Van Zuydam, Natalie; Ahlqvist, Emma

    2017-01-01

    Diabetes is the leading cause of ESRD. Despite evidence for a substantial heritability of diabetic kidney disease, efforts to identify genetic susceptibility variants have had limited success. We extended previous efforts in three dimensions, examining a more comprehensive set of genetic variants...

  20. [Genetic aspects of genealogy].

    Science.gov (United States)

    Tetushkin, E Iu

    2011-11-01

    The supplementary historical discipline genealogy is also a supplementary genetic discipline. In its formation, genetics borrowed from genealogy some methods of pedigree analysis. In the 21th century, it started receiving contribution from computer-aided genealogy and genetic (molecular) genealogy. The former provides novel tools for genetics, while the latter, which employing genetic methods, enriches genetics with new evidence. Genealogists formulated three main laws ofgenealogy: the law of three generations, the law of doubling the ancestry number, and the law of declining ancestry. The significance and meaning of these laws can be fully understood only in light of genetics. For instance, a controversy between the exponential growth of the number of ancestors of an individual, i.e., the law of doubling the ancestry number, and the limited number of the humankind is explained by the presence of weak inbreeding because of sibs' interference; the latter causes the pedigrees' collapse, i.e., explains also the law of diminishing ancestry number. Mathematic modeling of pedigrees' collapse presented in a number of studies showed that the number of ancestors of each individual attains maximum in a particular generation termed ancestry saturated generation. All representatives of this and preceding generation that left progeny are common ancestors of all current members of the population. In subdivided populations, these generations are more ancient than in panmictic ones, whereas in small isolates and social strata with limited numbers of partners, they are younger. The genealogical law of three generations, according to which each hundred years contain on average three generation intervals, holds for generation lengths for Y-chromosomal DNA, typically equal to 31-32 years; for autosomal and mtDNA, this time is somewhat shorter. Moving along ascending lineas, the number of genetically effective ancestors transmitting their DNA fragment to descendants increases far

  1. Aural exostoses (surfer's ear) provide vital fossil evidence of an aquatic phase in Man's early evolution.

    Science.gov (United States)

    Rhys Evans, P H; Cameron, M

    2017-11-01

    For over a century, otolaryngologists have recognised the condition of aural exostoses, but their significance and aetiology remains obscure, although they tend to be associated with frequent swimming and cold water immersion of the auditory canal. The fact that this condition is usually bilateral is predictable since both ears are immersed in water. However, why do exostoses only grow in swimmers and why do they grow in the deep bony meatus at two or three constant sites? Furthermore, from an evolutionary point of view, what is or was the purpose and function of these rather incongruous protrusions? In recent decades, paleoanthropological evidence has challenged ideas about early hominid evolution. In 1992 the senior author suggested that aural exostoses were evolved in early hominid Man for protection of the delicate tympanic membrane during swimming and diving by narrowing the ear canal in a similar fashion to other semiaquatic species. We now provide evidence for this theory and propose an aetiological explanation for the formation of exostoses.

  2. Genetic diversity and population structure of Sitodiplosis mosellana in Northern China.

    Directory of Open Access Journals (Sweden)

    Yun Duan

    Full Text Available The wheat midge, Sitodiplosis mosellana, is an important pest in Northern China. We tested the hypothesis that the population structure of this species arises during a range expansion over the past 30 years. This study used microsatellite and mitochondrial loci to conduct population genetic analysis of S. mosellana across its distribution range in China. We found strong genetic structure among the 16 studied populations, including two genetically distinct groups (the eastern and western groups, broadly consistent with the geography and habitat fragmentation. These results underline the importance of natural barriers in impeding dispersal and gene flow of S. mosellana populations. Low to moderate genetic diversity among the populations and moderate genetic differentiation (F ST = 0.117 between the two groups were also found. The populations in the western group had lower genetic diversity, higher genetic differentiation and lower gene flow (F ST = 0.116, Nm = 1.89 than those in the eastern group (F ST = 0.049, Nm = 4.91. Genetic distance between populations was positively and significantly correlated with geographic distance (r = 0.56, P<0.001. The population history of this species provided no evidence for population expansion or bottlenecks in any of these populations. Our data suggest that the distribution of genetic diversity, genetic differentiation and population structure of S. mosellana have resulted from a historical event, reflecting its adaptation to diverse habitats and forming two different gene pools. These results may be the outcome of a combination of restricted gene flow due to geographical and environmental factors, population history, random processes of genetic drift and individual dispersal patterns. Given the current risk status of this species in China, this study can offer useful information for forecasting outbreaks and designing effective pest management programs.

  3. How American Nurses Association Code of Ethics informs genetic/genomic nursing.

    Science.gov (United States)

    Tluczek, Audrey; Twal, Marie E; Beamer, Laura Curr; Burton, Candace W; Darmofal, Leslie; Kracun, Mary; Zanni, Karen L; Turner, Martha

    2018-01-01

    Members of the Ethics and Public Policy Committee of the International Society of Nurses in Genetics prepared this article to assist nurses in interpreting the American Nurses Association (2015) Code of Ethics for Nurses with Interpretive Statements (Code) within the context of genetics/genomics. The Code explicates the nursing profession's norms and responsibilities in managing ethical issues. The nearly ubiquitous application of genetic/genomic technologies in healthcare poses unique ethical challenges for nursing. Therefore, authors conducted literature searches that drew from various professional resources to elucidate implications of the code in genetic/genomic nursing practice, education, research, and public policy. We contend that the revised Code coupled with the application of genomic technologies to healthcare creates moral obligations for nurses to continually refresh their knowledge and capacities to translate genetic/genomic research into evidence-based practice, assure the ethical conduct of scientific inquiry, and continually develop or revise national/international guidelines that protect the rights of individuals and populations within the context of genetics/genomics. Thus, nurses have an ethical responsibility to remain knowledgeable about advances in genetics/genomics and incorporate emergent evidence into their work.

  4. Genetic Risk by Experience Interaction for Childhood Internalizing Problems: Converging Evidence across Multiple Methods

    Science.gov (United States)

    Vendlinski, Matthew K.; Lemery-Chalfant, Kathryn; Essex, Marilyn J.; Goldsmith, H. Hill

    2011-01-01

    Background: Identifying how genetic risk interacts with experience to predict psychopathology is an important step toward understanding the etiology of mental health problems. Few studies have examined genetic risk by experience interaction (GxE) in the development of childhood psychopathology. Methods: We used both co-twin and parent mental…

  5. Genetic structure and domestication history of the grape

    Science.gov (United States)

    Myles, Sean; Boyko, Adam R.; Owens, Christopher L.; Brown, Patrick J.; Grassi, Fabrizio; Aradhya, Mallikarjuna K.; Prins, Bernard; Reynolds, Andy; Chia, Jer-Ming; Ware, Doreen; Bustamante, Carlos D.; Buckler, Edward S.

    2011-01-01

    The grape is one of the earliest domesticated fruit crops and, since antiquity, it has been widely cultivated and prized for its fruit and wine. Here, we characterize genome-wide patterns of genetic variation in over 1,000 samples of the domesticated grape, Vitis vinifera subsp. vinifera, and its wild relative, V. vinifera subsp. sylvestris from the US Department of Agriculture grape germplasm collection. We find support for a Near East origin of vinifera and present evidence of introgression from local sylvestris as the grape moved into Europe. High levels of genetic diversity and rapid linkage disequilibrium (LD) decay have been maintained in vinifera, which is consistent with a weak domestication bottleneck followed by thousands of years of widespread vegetative propagation. The considerable genetic diversity within vinifera, however, is contained within a complex network of close pedigree relationships that has been generated by crosses among elite cultivars. We show that first-degree relationships are rare between wine and table grapes and among grapes from geographically distant regions. Our results suggest that although substantial genetic diversity has been maintained in the grape subsequent to domestication, there has been a limited exploration of this diversity. We propose that the adoption of vegetative propagation was a double-edged sword: Although it provided a benefit by ensuring true breeding cultivars, it also discouraged the generation of unique cultivars through crosses. The grape currently faces severe pathogen pressures, and the long-term sustainability of the grape and wine industries will rely on the exploitation of the grape's tremendous natural genetic diversity. PMID:21245334

  6. Radiation induced mutants in elite genetic background for the augmentation of genetic diversity

    International Nuclear Information System (INIS)

    Kumar, V.; Bhagwat, S.G.

    2011-01-01

    Rice (Oryza sativa L.), an important food crop for India, shows large genetic diversity. However, despite the large genetic resource, high genetic similarity is reported in cultivated varieties indicating genetic erosion. Radiation induced mutations provide genetic variability in elite background. In the present study, twenty gamma ray induced mutants of rice variety WL112 (carrying sd-1 semi-dwarfing gene) were analysed for genetic diversity using microsatellite markers. The high range of genetic diversity among mutants indicated that the mutants possess potential for enhancing variability in rice. Cluster analysis showed presence of five clusters having small sub-clusters. Earliness, semi-dwarf stature or resistance to blast disease observed among the mutants showed that these will be useful in breeding programmes. (author)

  7. Genetics in endocrinology: genetic variation in deiodinases: a systematic review of potential clinical effects in humans.

    Science.gov (United States)

    Verloop, Herman; Dekkers, Olaf M; Peeters, Robin P; Schoones, Jan W; Smit, Johannes W A

    2014-09-01

    Iodothyronine deiodinases represent a family of selenoproteins involved in peripheral and local homeostasis of thyroid hormone action. Deiodinases are expressed in multiple organs and thyroid hormone affects numerous biological systems, thus genetic variation in deiodinases may affect multiple clinical endpoints. Interest in clinical effects of genetic variation in deiodinases has clearly increased. We aimed to provide an overview for the role of deiodinase polymorphisms in human physiology and morbidity. In this systematic review, studies evaluating the relationship between deiodinase polymorphisms and clinical parameters in humans were eligible. No restrictions on publication date were imposed. The following databases were searched up to August 2013: Pubmed, EMBASE (OVID-version), Web of Science, COCHRANE Library, CINAHL (EbscoHOST-version), Academic Search Premier (EbscoHOST-version), and ScienceDirect. Deiodinase physiology at molecular and tissue level is described, and finally the role of these polymorphisms in pathophysiological conditions is reviewed. Deiodinase type 1 (D1) polymorphisms particularly show moderate-to-strong relationships with thyroid hormone parameters, IGF1 production, and risk for depression. D2 variants correlate with thyroid hormone levels, insulin resistance, bipolar mood disorder, psychological well-being, mental retardation, hypertension, and risk for osteoarthritis. D3 polymorphisms showed no relationship with inter-individual variation in serum thyroid hormone parameters. One D3 polymorphism was associated with risk for osteoarthritis. Genetic deiodinase profiles only explain a small proportion of inter-individual variations in serum thyroid hormone levels. Evidence suggests a role of genetic deiodinase variants in certain pathophysiological conditions. The value for determination of deiodinase polymorphism in clinical practice needs further investigation. © 2014 European Society of Endocrinology.

  8. Genetic evidence of multiple loci in dystocia - difficult labour

    Directory of Open Access Journals (Sweden)

    Westgren Magnus

    2010-06-01

    Full Text Available Abstract Background Dystocia, difficult labour, is a common but also complex problem during childbirth. It can be attributed to either weak contractions of the uterus, a large infant, reduced capacity of the pelvis or combinations of these. Previous studies have indicated that there is a genetic component in the susceptibility of experiencing dystocia. The purpose of this study was to identify susceptibility genes in dystocia. Methods A total of 104 women in 47 families were included where at least two sisters had undergone caesarean section at a gestational length of 286 days or more at their first delivery. Study of medical records and a telephone interview was performed to identify subjects with dystocia. Whole-genome scanning using Affymetrix genotyping-arrays and non-parametric linkage (NPL analysis was made in 39 women exhibiting the phenotype of dystocia from 19 families. In 68 women re-sequencing was performed of candidate genes showing suggestive linkage: oxytocin (OXT on chromosome 20 and oxytocin-receptor (OXTR on chromosome 3. Results We found a trend towards linkage with suggestive NPL-score (3.15 on chromosome 12p12. Suggestive linkage peaks were observed on chromosomes 3, 4, 6, 10, 20. Re-sequencing of OXT and OXTR did not reveal any causal variants. Conclusions Dystocia is likely to have a genetic component with variations in multiple genes affecting the patient outcome. We found 6 loci that could be re-evaluated in larger patient cohorts.

  9. Genetic evidence of multiple loci in dystocia - difficult labour

    Science.gov (United States)

    2010-01-01

    Background Dystocia, difficult labour, is a common but also complex problem during childbirth. It can be attributed to either weak contractions of the uterus, a large infant, reduced capacity of the pelvis or combinations of these. Previous studies have indicated that there is a genetic component in the susceptibility of experiencing dystocia. The purpose of this study was to identify susceptibility genes in dystocia. Methods A total of 104 women in 47 families were included where at least two sisters had undergone caesarean section at a gestational length of 286 days or more at their first delivery. Study of medical records and a telephone interview was performed to identify subjects with dystocia. Whole-genome scanning using Affymetrix genotyping-arrays and non-parametric linkage (NPL) analysis was made in 39 women exhibiting the phenotype of dystocia from 19 families. In 68 women re-sequencing was performed of candidate genes showing suggestive linkage: oxytocin (OXT) on chromosome 20 and oxytocin-receptor (OXTR) on chromosome 3. Results We found a trend towards linkage with suggestive NPL-score (3.15) on chromosome 12p12. Suggestive linkage peaks were observed on chromosomes 3, 4, 6, 10, 20. Re-sequencing of OXT and OXTR did not reveal any causal variants. Conclusions Dystocia is likely to have a genetic component with variations in multiple genes affecting the patient outcome. We found 6 loci that could be re-evaluated in larger patient cohorts. PMID:20587075

  10. Smoking and caffeine consumption: a genetic analysis of their association.

    Science.gov (United States)

    Treur, Jorien L; Taylor, Amy E; Ware, Jennifer J; Nivard, Michel G; Neale, Michael C; McMahon, George; Hottenga, Jouke-Jan; Baselmans, Bart M L; Boomsma, Dorret I; Munafò, Marcus R; Vink, Jacqueline M

    2017-07-01

    Smoking and caffeine consumption show a strong positive correlation, but the mechanism underlying this association is unclear. Explanations include shared genetic/environmental factors or causal effects. This study employed three methods to investigate the association between smoking and caffeine. First, bivariate genetic models were applied to data of 10 368 twins from the Netherlands Twin Register in order to estimate genetic and environmental correlations between smoking and caffeine use. Second, from the summary statistics of meta-analyses of genome-wide association studies on smoking and caffeine, the genetic correlation was calculated by LD-score regression. Third, causal effects were tested using Mendelian randomization analysis in 6605 Netherlands Twin Register participants and 5714 women from the Avon Longitudinal Study of Parents and Children. Through twin modelling, a genetic correlation of r0.47 and an environmental correlation of r0.30 were estimated between current smoking (yes/no) and coffee use (high/low). Between current smoking and total caffeine use, this was r0.44 and r0.00, respectively. LD-score regression also indicated sizeable genetic correlations between smoking and coffee use (r0.44 between smoking heaviness and cups of coffee per day, r0.28 between smoking initiation and coffee use and r0.25 between smoking persistence and coffee use). Consistent with the relatively high genetic correlations and lower environmental correlations, Mendelian randomization provided no evidence for causal effects of smoking on caffeine or vice versa. Genetic factors thus explain most of the association between smoking and caffeine consumption. These findings suggest that quitting smoking may be more difficult for heavy caffeine consumers, given their genetic susceptibility. © 2016 The Authors.Addiction Biology published by John Wiley & Sons Ltd on behalf of Society for the Study of Addiction.

  11. Genetic Determinants of Cardio-Metabolic Risk: A Proposed Model for Phenotype Association and Interaction

    Science.gov (United States)

    Blackett, Piers R; Sanghera, Dharambir K

    2012-01-01

    This review provides a translational and unifying summary of metabolic syndrome genetics and highlights evidence that genetic studies are starting to unravel and untangle origins of the complex and challenging cluster of disease phenotypes. The associated genes effectively express in the brain, liver, kidney, arterial endothelium, adipocytes, myocytes and β cells. Progression of syndrome traits has been associated with ectopic lipid accumulation in the arterial wall, visceral adipocytes, myocytes, and liver. Thus it follows that the genetics of dyslipidemia, obesity, and non-alcoholic fatty liver (NAFLD) disease are central in triggering progression of the syndrome to overt expression of disease traits, and have become a key focus of interest for early detection and for designing prevention and treatments. To support the “birds’ eye view” approach we provide a road-map depicting commonality and interrelationships between the traits and their genetic and environmental determinants based on known risk factors, metabolic pathways, pharmacological targets, treatment responses, gene networks, pleiotropy, and association with circadian rhythm. Although only a small portion of the known heritability is accounted for and there is insufficient support for clinical application of gene-based prediction models, there is direction and encouraging progress in a rapidly moving field that is beginning to show clinical relevance. PMID:23351585

  12. Woman's Pre-Conception Evaluation: Genetic and Fetal Risk Considerations for Counselling and Informed Choice.

    Science.gov (United States)

    Wilson, R Douglas

    2017-10-11

    To inform reproductive and other health care providers about genetic and fetal risk information to consider during a woman/couples' pre-conception evaluation, including considerations for genetic risk assessment, genetic screening, or testing to allow for improved counselling and informed choice. This genetic information can be used for patient education, planning, and possible pre-conception and/or prenatal testing. This information may allow improved risk assessment for pre-conception counselling for individual patients and their families. PubMed or Medline and the Cochrane Database were searched in May 2017 using appropriate key words ("pre-conception," "genetic disease," "maternal," "family history," "genetic," "health risk," "genetic health surveillance," "prenatal screening," "prenatal diagnosis," "birth defects," and "teratogen"). Grey (unpublished) literature was identified through searching the websites of health technology assessment and health technology assessment-related agencies, clinical practice guideline collections, and national and international medical specialty societies. The benefits for the patient and her family include an increased understanding of relevant genetic risk pre-conception and in early pregnancy, and better pregnancy outcomes as a result of use of the information. The harm includes potential increased anxiety or psychological stress associated with the possibility of identifying genetic risks. The evidence obtained was peer-reviewed by the Genetics Committee of The Society of Obstetricians and Gynaecologists of Canada. Consideration for Care Statements For this review article, the Consideration for Care Statements use the GRADE strength and quality as it is comparable for the clinician and the patient/public user. [GRADE from the Canadian Task Force on Preventive Health Care (www.canadiantaskforce.ca). For clinicians, Strong = The recommendation would apply to most individuals. Formal discussion aids are not likely to be

  13. Weight of the evidence of genetic investigations of ancestry informative markers

    DEFF Research Database (Denmark)

    Tvedebrink, Torben; Eriksen, Poul Svante; Mogensen, Helle Smidt

    2018-01-01

    Ancestry-informative markers (AIMs) are markers that give information about the ancestry of individuals. They are used in forensic genetics for predicting the geographic origin of the investigated individual in crime and identification cases. In the exploration of the genogeographic origin...

  14. Advances in genetics and immunology: the importance of basic research to prevention of occupational diseases

    International Nuclear Information System (INIS)

    Omenn, G.S.

    1984-01-01

    Differences among workers in susceptibility to workplace exposures to environmental agents such as metals, ultraviolet radiation, and x-radiation are discussed. The distinction is made between the need for (1) monitoring for effects on the genetic material (genetic toxicology) and (2) screening for predisposing inherited traits (eco-genetics). Genetically-determined differences in susceptibility are discussed in relation to mechanisms of metabolism and of target sites. While there is not enough evidence to support routine genetic screening at this time there is common agreement that several promising areas for research on potential genetic predispositions warrant careful study. There is also reassuring evidence that productive relationships for research can be established among unions, management, and universities. 56 references, 3 figures, 7 tables

  15. Low interbasin connectivity in a facultatively diadromous fish: evidence from genetics and otolith chemistry.

    Science.gov (United States)

    Hughes, Jane M; Schmidt, Daniel J; Macdonald, Jed I; Huey, Joel A; Crook, David A

    2014-03-01

    Southern smelts (Retropinna spp.) in coastal rivers of Australia are facultatively diadromous, with populations potentially containing individuals with diadromous or wholly freshwater life histories. The presence of diadromous individuals is expected to reduce genetic structuring between river basins due to larval dispersal via the sea. We use otolith chemistry to distinguish between diadromous and nondiadromous life histories and population genetics to examine interbasin connectivity resulting from diadromy. Otolith strontium isotope ((87) Sr:(86) Sr) transects identified three main life history patterns: amphidromy, freshwater residency and estuarine/marine residency. Despite the potential for interbasin connectivity via larval mixing in the marine environment, we found unprecedented levels of genetic structure for an amphidromous species. Strong hierarchical structure along putative taxonomic boundaries was detected, along with highly structured populations within groups using microsatellites (FST  = 0.046-0.181), and mtDNA (ΦST  = 0.498-0.816). The presence of strong genetic subdivision, despite the fact that many individuals reside in saline water during their early life history, appears incongruous. However, analysis of multielemental signatures in the otolith cores of diadromous fish revealed strong discrimination between river basins, suggesting that diadromous fish spend their early lives within chemically distinct estuaries rather than the more homogenous marine environment, thus avoiding dispersal and maintaining genetic structure. © 2014 John Wiley & Sons Ltd.

  16. Genetic variation in DNA repair pathways and risk of non-Hodgkin's lymphoma.

    Directory of Open Access Journals (Sweden)

    Justin Rendleman

    Full Text Available Molecular and genetic evidence suggests that DNA repair pathways may contribute to lymphoma susceptibility. Several studies have examined the association of DNA repair genes with lymphoma risk, but the findings from these reports have been inconsistent. Here we provide the results of a focused analysis of genetic variation in DNA repair genes and their association with the risk of non-Hodgkin's lymphoma (NHL. With a population of 1,297 NHL cases and 1,946 controls, we have performed a two-stage case/control association analysis of 446 single nucleotide polymorphisms (SNPs tagging the genetic variation in 81 DNA repair genes. We found the most significant association with NHL risk in the ATM locus for rs227060 (OR = 1.27, 95% CI: 1.13-1.43, p = 6.77×10(-5, which remained significant after adjustment for multiple testing. In a subtype-specific analysis, associations were also observed for the ATM locus among both diffuse large B-cell lymphomas (DLBCL and small lymphocytic lymphomas (SLL, however there was no association observed among follicular lymphomas (FL. In addition, our study provides suggestive evidence of an interaction between SNPs in MRE11A and NBS1 associated with NHL risk (OR = 0.51, 95% CI: 0.34-0.77, p = 0.0002. Finally, an imputation analysis using the 1,000 Genomes Project data combined with a functional prediction analysis revealed the presence of biologically relevant variants that correlate with the observed association signals. While the findings generated here warrant independent validation, the results of our large study suggest that ATM may be a novel locus associated with the risk of multiple subtypes of NHL.

  17. Genetic variation of Lymnaea stagnalis tolerance to copper: A test of selection hypotheses and its relevance for ecological risk assessment

    International Nuclear Information System (INIS)

    Côte, Jessica; Bouétard, Anthony; Pronost, Yannick; Besnard, Anne-Laure; Coke, Maïra; Piquet, Fabien; Caquet, Thierry; Coutellec, Marie-Agnès

    2015-01-01

    The use of standardized monospecific testing to assess the ecological risk of chemicals implicitly relies on the strong assumption that intraspecific variation in sensitivity is negligible or irrelevant in this context. In this study, we investigated genetic variation in copper sensitivity of the freshwater snail Lymnaea stagnalis, using lineages stemming from eight natural populations or strains found to be genetically differentiated at neutral markers. Copper-induced mortality varied widely among populations, as did the estimated daily death rate and time to 50% mortality (LT50). Population genetic divergence in copper sensitivity was compared to neutral differentiation using the Q ST -F ST approach. No evidence for homogenizing selection could be detected. This result demonstrates that species-level extrapolations from single population studies are highly unreliable. The study provides a simple example of how evolutionary principles could be incorporated into ecotoxicity testing in order to refine ecological risk assessment. - Highlights: • Genetic variation in copper tolerance occurs between Lymnaea stagnalis populations. • We used the Q ST -F ST approach to test evolutionary patterns in copper tolerance. • No evidence for uniform selection was found. • Results suggest that extrapolations to the species level are not safe. • A method is proposed to refine ecological risk assessment using genetic parameters. - Genetic variation in copper tolerance occurs in Lymnaea stagnalis. A method is proposed for considering evolutionary parameters in ecological risk assessment

  18. Contribution of genetics to ecological restoration.

    Science.gov (United States)

    Mijangos, Jose Luis; Pacioni, Carlo; Spencer, Peter B S; Craig, Michael D

    2015-01-01

    Ecological restoration of degraded ecosystems has emerged as a critical tool in the fight to reverse and ameliorate the current loss of biodiversity and ecosystem services. Approaches derived from different genetic disciplines are extending the theoretical and applied frameworks on which ecological restoration is based. We performed a search of scientific articles and identified 160 articles that employed a genetic approach within a restoration context to shed light on the links between genetics and restoration. These articles were then classified on whether they examined association between genetics and fitness or the application of genetics in demographic studies, and on the way the studies informed restoration practice. Although genetic research in restoration is rapidly growing, we found that studies could make better use of the extensive toolbox developed by applied fields in genetics. Overall, 41% of reviewed studies used genetic information to evaluate or monitor restoration, and 59% provided genetic information to guide prerestoration decision-making processes. Reviewed studies suggest that restoration practitioners often overlook the importance of including genetic aspects within their restoration goals. Even though there is a genetic basis influencing the provision of ecosystem services, few studies explored this relationship. We provide a view of research gaps, future directions and challenges in the genetics of restoration. © 2014 John Wiley & Sons Ltd.

  19. Genomic hotspots for adaptation: the population genetics of Müllerian mimicry in Heliconius erato.

    Directory of Open Access Journals (Sweden)

    Brian A Counterman

    2010-02-01

    Full Text Available Wing pattern evolution in Heliconius butterflies provides some of the most striking examples of adaptation by natural selection. The genes controlling pattern variation are classic examples of Mendelian loci of large effect, where allelic variation causes large and discrete phenotypic changes and is responsible for both convergent and highly divergent wing pattern evolution across the genus. We characterize nucleotide variation, genotype-by-phenotype associations, linkage disequilibrium (LD, and candidate gene expression patterns across two unlinked genomic intervals that control yellow and red wing pattern variation among mimetic forms of Heliconius erato. Despite very strong natural selection on color pattern, we see neither a strong reduction in genetic diversity nor evidence for extended LD across either patterning interval. This observation highlights the extent that recombination can erase the signature of selection in natural populations and is consistent with the hypothesis that either the adaptive radiation or the alleles controlling it are quite old. However, across both patterning intervals we identified SNPs clustered in several coding regions that were strongly associated with color pattern phenotype. Interestingly, coding regions with associated SNPs were widely separated, suggesting that color pattern alleles may be composed of multiple functional sites, conforming to previous descriptions of these loci as "supergenes." Examination of gene expression levels of genes flanking these regions in both H. erato and its co-mimic, H. melpomene, implicate a gene with high sequence similarity to a kinesin as playing a key role in modulating pattern and provides convincing evidence for parallel changes in gene regulation across co-mimetic lineages. The complex genetic architecture at these color pattern loci stands in marked contrast to the single casual mutations often identified in genetic studies of adaptation, but may be more indicative

  20. Expert opinion vs. empirical evidence

    Science.gov (United States)

    Herman, Rod A; Raybould, Alan

    2014-01-01

    Expert opinion is often sought by government regulatory agencies when there is insufficient empirical evidence to judge the safety implications of a course of action. However, it can be reckless to continue following expert opinion when a preponderance of evidence is amassed that conflicts with this opinion. Factual evidence should always trump opinion in prioritizing the information that is used to guide regulatory policy. Evidence-based medicine has seen a dramatic upturn in recent years spurred by examples where evidence indicated that certain treatments recommended by expert opinions increased death rates. We suggest that scientific evidence should also take priority over expert opinion in the regulation of genetically modified crops (GM). Examples of regulatory data requirements that are not justified based on the mass of evidence are described, and it is suggested that expertise in risk assessment should guide evidence-based regulation of GM crops. PMID:24637724

  1. Searching for speciation genes: molecular evidence for selection associated with colour morphotypes in the Caribbean reef fish genus Hypoplectrus.

    Directory of Open Access Journals (Sweden)

    Ben G Holt

    Full Text Available Closely related species that show clear phenotypic divergence, but without obvious geographic barriers, can provide opportunities to study how diversification can occur when opportunities for allopatric speciation are limited. We examined genetic divergence in the coral reef fish genus Hypoplectrus (family: Serranidae, which comprises of 10-14 morphotypes that are distinguished solely by their distinct colour patterns, but which show little genetic differentiation. Our goal was to detect loci that show clear disequilibrium between morphotypes and across geographical locations. We conducted Amplified Fragment Length Polymorphism molecular analysis to quantify genetic differentiation among, and selection between, morphotypes. Three loci were consistently divergent beyond neutral expectations in repeated pair-wise morphotype comparisons using two different methods. These loci provide the first evidence for genes that may be associated with colour morphotype in the genus Hypoplectrus.

  2. Contrasting Medical and Legal Standards of Evidence: A Precision Medicine Case Study.

    Science.gov (United States)

    Marchant, Gary E; Scheckel, Kathryn; Campos-Outcalt, Doug

    2016-03-01

    As the health care system transitions to a precision medicine approach that tailors clinical care to the genetic profile of the individual patient, there is a potential tension between the clinical uptake of new technologies by providers and the legal system's expectation of the standard of care in applying such technologies. We examine this tension by comparing the type of evidence that physicians and courts are likely to rely on in determining a duty to recommend pharmacogenetic testing of patients prescribed the oral anti-coagulant drug warfarin. There is a large body of inconsistent evidence and factors for and against such testing, but physicians and courts are likely to weigh this evidence differently. The potential implications for medical malpractice risk are evaluated and discussed. © 2016 American Society of Law, Medicine & Ethics.

  3. Forensic DNA methylation profiling from evidence material for investigative leads

    Science.gov (United States)

    Lee, Hwan Young; Lee, Soong Deok; Shin, Kyoung-Jin

    2016-01-01

    DNA methylation is emerging as an attractive marker providing investigative leads to solve crimes in forensic genetics. The identification of body fluids that utilizes tissue-specific DNA methylation can contribute to solving crimes by predicting activity related to the evidence material. The age estimation based on DNA methylation is expected to reduce the number of potential suspects, when the DNA profile from the evidence does not match with any known person, including those stored in the forensic database. Moreover, the variation in DNA implicates environmental exposure, such as cigarette smoking and alcohol consumption, thereby suggesting the possibility to be used as a marker for predicting the lifestyle of potential suspect. In this review, we describe recent advances in our understanding of DNA methylation variations and the utility of DNA methylation as a forensic marker for advanced investigative leads from evidence materials. [BMB Reports 2016; 49(7): 359-369] PMID:27099236

  4. Genetic variation in the extended major histocompatibility complex and susceptibility to childhood acute lymphoblastic leukemia: a review of the evidence

    Directory of Open Access Journals (Sweden)

    Kevin Y Urayama

    2013-12-01

    Full Text Available The enduring suspicion that infections and immunologic response may play a role in the etiology of childhood leukemia, particularly acute lymphoblastic leukemia (ALL, is now supported, albeit still indirectly, by numerous epidemiological studies. The cumulative evidence includes, for example, descriptive observations of a peculiar peak incidence at age 2-5 years for ALL in economically developed countries, clustering of cases in situations of population mixing associated with unusual patterns of personal contacts, associations with various proxy measures for immune modulatory exposures early in life, and genetic susceptibility conferred by variation in genes involved in the immune system. In this review, our focus is the extended major histocompatibility complex (xMHC, an approximately 7.6 megabase region that is well-known for its high density of expressed genes, extensive polymorphisms exhibiting complex linkage disequilibrium patterns, and its disproportionately large number of immune-related genes, including human leukocyte antigen (HLA. First discovered through the role they play in transplant rejection, the classical HLA class I (HLA-A, -B, and -C and class II (HLA-DR, HLA-DQ, and HLA-DP molecules reside at the epicenter of the immune response pathways and are now the targets of many disease susceptibility studies, including those for childhood leukemia. The genes encoding the HLA molecules are only a minority of the over 250 expressed genes in the xMHC, and a growing number of studies are beginning to evaluate other loci through targeted investigations or utilizing a mapping approach with a comprehensive screen of the entire region. Here, we review the current epidemiologic evidence available to date regarding genetic variation contained within this highly unique region of the genome and its relationship with childhood ALL risk.

  5. Toward Evidence-Based Genetic Research on Lifelong Premature Ejaculation: A Critical Evaluation of Methodology

    Science.gov (United States)

    2011-01-01

    Recently, four premature ejaculation (PE) subtypes have been distinguished on the basis of the duration of the intravaginal ejaculation latency time (IELT). These four PE subtypes have different etiologies and pathogeneses. Genetic research on PE should consider the existence of these PE subtypes and the accurate measurement of the IELT with a stopwatch. Currently, three methods of genetic research on PE have been used. They differ in the investigated population, tool of measurement, study design, and variables of PE. From animal and human research, it is derived that the central serotonergic system "modulates" ejaculation, whereas the ejaculation (reflex) itself is probably not under direct influence of the serotonergic system, but rather under the influence of other neurotransmitter systems in the spinal cord. For genetic research on PE, it is important to take into account that the (serotonergic) modulation of the IELT is variable among men and may even be absent. This means that serotonergic genetic polymorphisms may only be found in men with PE who respond with an ejaculation delay treatment with a selective serotonin reuptake inhibitor. PMID:21344023

  6. Impact of an online medical internet site on knowledge and practice of health care providers: a mixed methods study of the Spinal Cord Injury Rehabilitation Evidence project.

    Science.gov (United States)

    Eng, Janice J; Noonan, Vanessa K; Townson, Andrea F; Higgins, Caroline E; Rogers, Jess; Wolfe, Dalton L

    2014-12-23

    It is not known whether ongoing access to a broad-based Internet knowledge resource can influence the practice of health care providers. We undertook a study to evaluate the impact of a Web-based knowledge resource on increasing access to evidence and facilitating best practice of health care providers. The objective of this study was to evaluate (1) the impact of the Spinal Cord Injury Rehabilitation Evidence (SCIRE) project on access to information for health care providers and researchers and (2) how SCIRE influenced health care providers' management of clients. A 4-part mixed methods evaluation was undertaken: (1) monitoring website traffic and utilization using Google Analytics, (2) online survey of users who accessed the SCIRE website, (3) online survey of targeted end-users, that is, rehabilitation health care providers known to work with spinal cord injury (SCI) clients, as well as researchers, and (4) focus groups with health care providers who had previously accessed SCIRE. The online format allowed the content for a relatively specialized field to have far reach (eg, 26 countries and over 6500 users per month). The website survey and targeted end-user survey confirmed that health care providers, as well as researchers perceived that the website increased their access to SCI evidence. Access to SCIRE not only improved knowledge of SCI evidence but helped inform changes to the health providers' clinical practice and improved their confidence in treating SCI clients. The SCIRE information directly influenced the health providers' clinical decision making, in terms of choice of intervention, equipment needs, or assessment tool. A Web-based knowledge resource may be a relatively inexpensive method to increase access to evidence-based information, increase knowledge of the evidence, inform changes to the health providers' practice, and influence their clinical decision making.

  7. Behavioral and genetic evidence for a novel animal model of Attention-Deficit/Hyperactivity Disorder Predominantly Inattentive Subtype

    Directory of Open Access Journals (Sweden)

    Zhang-James Y

    2008-12-01

    genomic differences between the WKY/NCrl and WKY/NHsd rats for eight short tandem repeat loci and 2625 SNPs. About 33.5 percent of the genome differs between the two WKY rat substrains, with large stretches of divergence on each chromosome. Discussion These data provide solid behavioral and genetic evidence that the WKY/NCrl and WKY/NHsd rats should be considered as separate substrains. Moreover, the behavioral features of the WKY/NCrl rat indicate that it should be a useful model for ADHD-PI, the primarily inattentive subtype of ADHD. The SD/NTac and the WH/HanTac rats show significant genetic and/or behavioral differences from WKY/NHsd rats and appear not to be appropriate controls in studies using the SHR/NCrl. The present results support the conclusion that SHR/NCrl is the best validated animal model of ADHD-C. The overactivity, impulsiveness and deficient sustained attention of the SHR/NCrl strain are independent behaviors. Thus, overactivity does not account for this strain's impulsiveness and deficient sustained attention. Finally, the present study shows that great care has to be exercised to select the model and comparison groups.

  8. Genetic and environmental overlap between borderline personality disorder traits and psychopathy: evidence for promotive effects of factor 2 and protective effects of factor 1.

    Science.gov (United States)

    Hunt, E; Bornovalova, M A; Patrick, C J

    2015-05-01

    Previous studies have reported strong genetic and environmental overlap between antisocial-externalizing (factor 2; F2) features of psychopathy and borderline personality disorder (BPD) tendencies. However, this line of research has yet to examine etiological associations of affective-interpersonal (factor 1, F1) features of psychopathy with BPD tendencies. The current study investigated differential phenotypic and genetic overlap of psychopathy factors 1 and 2 with BPD tendencies in a sample of over 250 male and female community-recruited adult twin pairs. Consistent with previous research, biometric analyses revealed strong genetic and non-shared environmental correlations of F2 with BPD tendencies, suggesting that common genetic and non-shared environmental factors contribute to both phenotypes. In contrast, negative genetic and non-shared environmental correlations were observed between F1 and BPD tendencies, indicating that the genetic factors underlying F1 serve as protective factors against BPD. No gender differences emerged in the analyses. These findings provide further insight into associations of psychopathic features - F1 as well as F2 - and BPD tendencies. Implications for treatment and intervention are discussed, along with how psychopathic traits may differentially influence the manifestation of BPD tendencies.

  9. Reconstruction of the feeding apparatus in Postgaardi mariagerensis provides evidence for character evolution within the Symbiontida (Euglenozoa).

    Science.gov (United States)

    Yubuki, Naoji; Simpson, Alastair G B; Leander, Brian S

    2013-01-01

    Microbial eukaryotes living in low oxygen environments often have novel physiological and morphological features that facilitate symbiotic relationships with bacteria and other means for acquiring nutrients. Comparative studies of these features provide evidence for phylogenetic relationships and evolutionary history. Postgaardi mariagerensis, for instance, is a euglenozoan that lives in low oxygen environments and is enveloped by episymbiotic bacteria. The general ultrastructure of P. mariagerensis was described more than a decade ago and no further studies have been carried out since, mainly because these cells are difficult to obtain. Postgaardi lacks the diagnostic features found in other major euglenozoan lineages (e.g., pellicle strips and kinetoplast-like mitochondrial inclusions) and no molecular data are available, so the phylogenetic position of this genus within the Euglenozoa remains unclear. We re-examined and reconstructed the ultrastructural organization of the feeding apparatus in Postgaardi by serial sectioning an existing block of resin-embedded cells. Postgaardi possesses distinctive finger-like projections within the feeding apparatus; this system has only been found in one other highly distinctive flagellate, namely the symbiontid Calkinsia. Detailed comparisons of the cytoskeleton in Postgaardi and in two symbiontids, Calkinsia and Bihospites, provided new evidence for phylogenetic relationships and character evolution in all three genera. Copyright © 2012 Elsevier GmbH. All rights reserved.

  10. Mapping determinants of gene expression plasticity by genetical genomics in C. elegans.

    Directory of Open Access Journals (Sweden)

    Yang Li

    2006-12-01

    Full Text Available Recent genetical genomics studies have provided intimate views on gene regulatory networks. Gene expression variations between genetically different individuals have been mapped to the causal regulatory regions, termed expression quantitative trait loci. Whether the environment-induced plastic response of gene expression also shows heritable difference has not yet been studied. Here we show that differential expression induced by temperatures of 16 degrees C and 24 degrees C has a strong genetic component in Caenorhabditis elegans recombinant inbred strains derived from a cross between strains CB4856 (Hawaii and N2 (Bristol. No less than 59% of 308 trans-acting genes showed a significant eQTL-by-environment interaction, here termed plasticity quantitative trait loci. In contrast, only 8% of an estimated 188 cis-acting genes showed such interaction. This indicates that heritable differences in plastic responses of gene expression are largely regulated in trans. This regulation is spread over many different regulators. However, for one group of trans-genes we found prominent evidence for a common master regulator: a transband of 66 coregulated genes appeared at 24 degrees C. Our results suggest widespread genetic variation of differential expression responses to environmental impacts and demonstrate the potential of genetical genomics for mapping the molecular determinants of phenotypic plasticity.

  11. An ancestral human genetic variant linked to an ancient disease: A novel association of FMO2 polymorphisms with tuberculosis (TB in Ethiopian populations provides new insight into the differential ethno-geographic distribution of FMO2*1.

    Directory of Open Access Journals (Sweden)

    Ephrem Mekonnen

    with distinct genetic variants underlying the TB-progression pathway. The results were robust for population stratification. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC" explaining the overall association (haplotype-specific-p = 0.000103. Strikingly, not only was FMO2*1 nominally associated with reduced risk to "Active TB" (p = 0.0118, OR = 0.496 but it also does not co-segregate with the 5'-3' flanking top high-TB-risk alleles. The study provides an evidence for the existence of an evolutionary adaptation to an ancient disease based on an ancestral genetic variant acting in a haplotypic framework in Ethiopian populations.

  12. Biological underpinnings of trauma and post-traumatic stress disorder: focusing on genetics and epigenetics.

    Science.gov (United States)

    Ryan, Joanne; Chaudieu, Isabelle; Ancelin, Marie-Laure; Saffery, Richard

    2016-11-01

    Certain individuals are more susceptible to stress and trauma, as well as the physical and mental health consequences following such exposure, including risk for post-traumatic stress disorder (PTSD). This differing vulnerability is likely to be influenced by genetic predisposition and specific characteristics of the stress itself (nature, intensity and duration), as well as epigenetic mechanisms. In this review we provide an overview of research findings in this field. We highlight some of the key genetic risk factors identified for PTSD, and the evidence that epigenetic processes might play a role in the biological response to trauma, as well as being potential biomarkers of PTSD risk. We also discuss important considerations for future research in this area.

  13. Basic Genetics: A Human Approach.

    Science.gov (United States)

    Biological Sciences Curriculum Study, Colorado Springs, CO. Center for Education in Human and Medical Genetics.

    This document (which has the form of a magazine) provides a variety of articles, stories, editorials, letters, interviews, and other types of magazine features (such as book reviews) which focus on human genetics. In addition to providing information about the principles of genetics, nearly all of the sections in the "magazine" address moral,…

  14. Remediating Viking Origins: Genetic Code as Archival Memory of the Remote Past.

    Science.gov (United States)

    Scully, Marc; King, Turi; Brown, Steven D

    2013-10-01

    This article introduces some early data from the Leverhulme Trust-funded research programme, 'The Impact of the Diasporas on the Making of Britain: evidence, memories, inventions'. One of the interdisciplinary foci of the programme, which incorporates insights from genetics, history, archaeology, linguistics and social psychology, is to investigate how genetic evidence of ancestry is incorporated into identity narratives. In particular, we investigate how 'applied genetic history' shapes individual and familial narratives, which are then situated within macro-narratives of the nation and collective memories of immigration and indigenism. It is argued that the construction of genetic evidence as a 'gold standard' about 'where you really come from' involves a remediation of cultural and archival memory, in the construction of a 'usable past'. This article is based on initial questionnaire data from a preliminary study of those attending DNA collection sessions in northern England. It presents some early indicators of the perceived importance of being of Viking descent among participants, notes some emerging patterns and considers the implications for contemporary debates on migration, belonging and local and national identity.

  15. Genetic bases of the nutritional approach to migraine.

    Science.gov (United States)

    De Marchis, Maria Laura; Guadagni, Fiorella; Silvestris, Erica; Lovero, Domenica; Della-Morte, David; Ferroni, Patrizia; Barbanti, Piero; Palmirotta, Raffaele

    2018-03-08

    Migraine is a common multifactorial and polygenic neurological disabling disorder characterized by a genetic background and associated to environmental, hormonal and food stimulations. A large series of evidence suggest a strong correlation between nutrition and migraine and indicates several commonly foods, food additives and beverages that may be involved in the mechanisms triggering the headache attack in migraine-susceptible persons. There are foods and drinks, or ingredients of the same, that can trigger the migraine crisis as well as some foods play a protective function depending on the specific genetic sensitivity of the subject. The recent biotechnological advances have enhanced the identification of some genetic factors involved in onset diseases and the identification of sequence variants of genes responsible for the individual sensitivity to migraine trigger-foods. Therefore many studies are aimed at the analysis of polymorphisms of genes coding for the enzymes involved in the metabolism of food factors in order to clarify the different ways in which people respond to foods based on their genetic constitution. This review discusses the latest knowledge and scientific evidence of the role of gene variants and nutrients, food additives and nutraceuticals interactions in migraine.

  16. Local Climate Heterogeneity Shapes Population Genetic Structure of Two Undifferentiated Insular Scutellaria Species.

    Science.gov (United States)

    Hsiung, Huan-Yi; Huang, Bing-Hong; Chang, Jui-Tse; Huang, Yao-Moan; Huang, Chih-Wei; Liao, Pei-Chun

    2017-01-01

    Spatial climate heterogeneity may not only affect adaptive gene frequencies but could also indirectly shape the genetic structure of neutral loci by impacting demographic dynamics. In this study, the effect of local climate on population genetic variation was tested in two phylogenetically close Scutellaria species in Taiwan. Scutellaria taipeiensis , which was originally assumed to be an endemic species of Taiwan Island, is shown to be part of the widespread species S. barbata based on the overlapping ranges of genetic variation and climatic niches as well as their morphological similarity. Rejection of the scenario of "early divergence with secondary contact" and the support for multiple origins of populations of S. taipeiensis from S. barbata provide strong evolutionary evidence for a taxonomic revision of the species combination. Further tests of a climatic effect on genetic variation were conducted. Regression analyses show nonlinear correlations among any pair of geographic, climatic, and genetic distances. However, significantly, the bioclimatic variables that represent the precipitation from late summer to early autumn explain roughly 13% of the genetic variation of our sampled populations. These results indicate that spatial differences of precipitation in the typhoon season may influence the regeneration rate and colonization rate of local populations. The periodic typhoon episodes explain the significant but nonlinear influence of climatic variables on population genetic differentiation. Although, the climatic difference does not lead to species divergence, the local climate variability indeed impacts the spatial genetic distribution at the population level.

  17. Statistical and population genetics issues of two Hungarian datasets from the aspect of DNA evidence interpretation.

    Science.gov (United States)

    Szabolcsi, Zoltán; Farkas, Zsuzsa; Borbély, Andrea; Bárány, Gusztáv; Varga, Dániel; Heinrich, Attila; Völgyi, Antónia; Pamjav, Horolma

    2015-11-01

    When the DNA profile from a crime-scene matches that of a suspect, the weight of DNA evidence depends on the unbiased estimation of the match probability of the profiles. For this reason, it is required to establish and expand the databases that reflect the actual allele frequencies in the population applied. 21,473 complete DNA profiles from Databank samples were used to establish the allele frequency database to represent the population of Hungarian suspects. We used fifteen STR loci (PowerPlex ESI16) including five, new ESS loci. The aim was to calculate the statistical, forensic efficiency parameters for the Databank samples and compare the newly detected data to the earlier report. The population substructure caused by relatedness may influence the frequency of profiles estimated. As our Databank profiles were considered non-random samples, possible relationships between the suspects can be assumed. Therefore, population inbreeding effect was estimated using the FIS calculation. The overall inbreeding parameter was found to be 0.0106. Furthermore, we tested the impact of the two allele frequency datasets on 101 randomly chosen STR profiles, including full and partial profiles. The 95% confidence interval estimates for the profile frequencies (pM) resulted in a tighter range when we used the new dataset compared to the previously published ones. We found that the FIS had less effect on frequency values in the 21,473 samples than the application of minimum allele frequency. No genetic substructure was detected by STRUCTURE analysis. Due to the low level of inbreeding effect and the high number of samples, the new dataset provides unbiased and precise estimates of LR for statistical interpretation of forensic casework and allows us to use lower allele frequencies. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  18. Nepotistic patterns of violent psychopathy: evidence for adaptation?

    Directory of Open Access Journals (Sweden)

    Daniel Brian Krupp

    2012-08-01

    Full Text Available Psychopaths routinely disregard social norms by engaging in selfish, antisocial, often violent behavior. Commonly characterized as mentally disordered, recent evidence suggests that psychopaths are executing a well-functioning, if unscrupulous strategy that historically increased reproductive success at the expense of others. Natural selection ought to have favored strategies that spared close kin from harm, however, because actions affecting the fitness of genetic relatives contribute to an individual’s inclusive fitness. Conversely, there is evidence that mental disorders can disrupt psychological mechanisms designed to protect relatives. Thus, mental disorder and adaptation accounts of psychopathy generate opposing hypotheses: psychopathy should be associated with an increase in the victimization of kin in the former account but not in the latter. Contrary to the mental disorder hypothesis, we show here in a sample of 289 violent offenders that variation in psychopathy predicts a decrease in the genetic relatedness of victims to offenders; that is, psychopathy predicts an increased likelihood of harming nonrelatives. Because nepotistic inhibition in violence may be caused by dispersal or kin discrimination, we examined the effects of psychopathy on (1 the dispersal of offenders and their kin and (2 sexual assault frequency (as a window on kin discrimination. Although psychopathy was negatively associated with coresidence with kin and positively associated with the commission of sexual assault, it remained negatively associated with the genetic relatedness of victims to offenders after removing cases of offenders who had coresided with kin and cases of sexual assault from the analyses. These results stand in contrast to models positing psychopathy as a pathology, and provide support for the hypothesis that psychopathy reflects an evolutionary strategy largely favoring the exploitation of nonrelatives.

  19. Genetic determinants of cardiometabolic risk: a proposed model for phenotype association and interaction.

    Science.gov (United States)

    Blackett, Piers R; Sanghera, Dharambir K

    2013-01-01

    This review provides a translational and unifying summary of metabolic syndrome genetics and highlights evidence that genetic studies are starting to unravel and untangle origins of the complex and challenging cluster of disease phenotypes. The associated genes effectively express in the brain, liver, kidney, arterial endothelium, adipocytes, myocytes, and β cells. Progression of syndrome traits has been associated with ectopic lipid accumulation in the arterial wall, visceral adipocytes, myocytes, and liver. Thus, it follows that the genetics of dyslipidemia, obesity, and nonalcoholic fatty liver disease are central in triggering progression of the syndrome to overt expression of disease traits and have become a key focus of interest for early detection and for designing prevention and treatments. To support the "birds' eye view" approach, we provide a road-map depicting commonality and interrelationships between the traits and their genetic and environmental determinants based on known risk factors, metabolic pathways, pharmacologic targets, treatment responses, gene networks, pleiotropy, and association with circadian rhythm. Although only a small portion of the known heritability is accounted for and there is insufficient support for clinical application of gene-based prediction models, there is direction and encouraging progress in a rapidly moving field that is beginning to show clinical relevance. Copyright © 2013 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  20. [Prenatal genetic counseling and instruction for deaf families by genetic test].

    Science.gov (United States)

    Han, Ming-yu; Huang, Sha-sha; Wang, Guo-jian; Yuan, Yong-yi; Kang, Dong-yang; Zhang, Xin; Dai, Pu

    2011-11-01

    Analyzed the molecular pathogenesis of probands by means of genetic test and assisted the local Family Planning Institute by providing prenatal genetic counseling and instruction for deaf families who eager to have more baby. Total of forty-three deaf families were recruited by two institutes for family planning from Guangzhou and Weifang. Forty-two families had one deaf child with normal hearing parents. One family was that parents and their child were all deaf. Genetic testing of GJB2, SLC26A4 and mitochondrial DNA (mtDNA) 12SrRNA were firstly performed in probands and their parents, following medical history, physical examination, auditory test and CT scan of temporal bone were completed. And then the genetic information and instruction were provided to each deaf family. Fifteen of these 43 families had positive results of genetic test. In fifteen families, one family was confirmed that the parents and their child all carried homozygous GJB2 mutations and the recurrence risk was 100%. Twelve families were confirmed that the probands carried homozygous/compound GJB2 or SLC26A4 mutations while their parents were GJB2 or SLC26A4 carriers, and the recurrence risk was 25%. One family was confirmed that the proband, diagnosed with enlarged vestibular aqueduct syndrome (EVAS) by CT scan, carried heterozygous SLC26A4 mutation from the mother, and the recurrence risk was still 25% based on the hereditary pattern of EVAS although another SLC26A4 mutation from the father was not found. One family was confirmed that the proband carried a heterozygous GJB2 mutation from the mother and the possibility to be GJB2 carrier for offsprings was 50%. The rest 28 families were that all probands and their parents did not carry GJB2, SLC26A4 and mtDNA 12SrRNA pathological mutation. Genetic testing can provide more accurate and useful prenatal genetic counseling and instruction to deaf families. Meanwhile, it is an ideal way to develop a cooperative relationship with the institute for

  1. Genetics and epigenetics of obesity.

    Science.gov (United States)

    Herrera, Blanca M; Keildson, Sarah; Lindgren, Cecilia M

    2011-05-01

    Obesity results from interactions between environmental and genetic factors. Despite a relatively high heritability of common, non-syndromic obesity (40-70%), the search for genetic variants contributing to susceptibility has been a challenging task. Genome wide association (GWA) studies have dramatically changed the pace of detection of common genetic susceptibility variants. To date, more than 40 genetic variants have been associated with obesity and fat distribution. However, since these variants do not fully explain the heritability of obesity, other forms of variation, such as epigenetics marks, must be considered. Epigenetic marks, or "imprinting", affect gene expression without actually changing the DNA sequence. Failures in imprinting are known to cause extreme forms of obesity (e.g. Prader-Willi syndrome), but have also been convincingly associated with susceptibility to obesity. Furthermore, environmental exposures during critical developmental periods can affect the profile of epigenetic marks and result in obesity. We review the most recent evidence for genetic and epigenetic mechanisms involved in the susceptibility and development of obesity. Only a comprehensive understanding of the underlying genetic and epigenetic mechanisms, and the metabolic processes they govern, will allow us to manage, and eventually prevent, obesity. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  2. Companied P16 genetic and protein status together providing useful information on the clinical outcome of urinary bladder cancer.

    Science.gov (United States)

    Pu, Xiaohong; Zhu, Liya; Fu, Yao; Fan, Zhiwen; Zheng, Jinyu; Zhang, Biao; Yang, Jun; Guan, Wenyan; Wu, Hongyan; Ye, Qing; Huang, Qing

    2018-04-01

    SPEC P16/CEN3/7/17 Probe fluorescence-in-situ-hybridization (FISH) has become the most sensitive method in indentifying the urothelial tumors and loss of P16 has often been identified in low-grade urothelial lesions; however, little is known about the significations of other P16 genetic status (normal and amplification) in bladder cancer.We detected P16 gene status by FISH in 259 urine samples and divided these samples into 3 groups: 1, normal P16; 2, loss of P16; and 3, amplified P16. Meanwhile, p16 protein expression was measured by immunocytochemistry and we characterized the clinicopathologic features of cases with P16 gene status.Loss of P16 occurred in 26.2%, P16 amplification occurred in 41.3% and P16 gene normal occurred in 32.4% of all cases. P16 genetic status was significantly associated with tumor grade and primary tumor status (P = .008 and .017), but not with pathological tumor stage, overall survival, and p16 protein expression. However, P16 gene amplification accompanied protein high-expression has shorter overall survival compared with the overall patients (P = .023), and P16 gene loss accompanied loss of protein also had the tendency to predict bad prognosis (P = .067).Studies show that the genetic status of P16 has a close relation with the stages of bladder cancer. Loss of P16 is associated with low-grade urothelial malignancy while amplified P16 donotes high-grade. Neither P16 gene status nor p16 protein expression alone is an independent predictor of urothelial bladder carcinoma, but combine gene and protein status together providing useful information on the clinical outcome of these patients.

  3. New and emerging technologies for genetic toxicity testing.

    Science.gov (United States)

    Lynch, Anthony M; Sasaki, Jennifer C; Elespuru, Rosalie; Jacobson-Kram, David; Thybaud, Véronique; De Boeck, Marlies; Aardema, Marilyn J; Aubrecht, Jiri; Benz, R Daniel; Dertinger, Stephen D; Douglas, George R; White, Paul A; Escobar, Patricia A; Fornace, Albert; Honma, Masamitsu; Naven, Russell T; Rusling, James F; Schiestl, Robert H; Walmsley, Richard M; Yamamura, Eiji; van Benthem, Jan; Kim, James H

    2011-04-01

    The International Life Sciences Institute (ILSI) Health and Environmental Sciences Institute (HESI) Project Committee on the Relevance and Follow-up of Positive Results in In Vitro Genetic Toxicity (IVGT) Testing established an Emerging Technologies and New Strategies Workgroup to review the current State of the Art in genetic toxicology testing. The aim of the workgroup was to identify promising technologies that will improve genotoxicity testing and assessment of in vivo hazard and risk, and that have the potential to help meet the objectives of the IVGT. As part of this initiative, HESI convened a workshop in Washington, DC in May 2008 to discuss mature, maturing, and emerging technologies in genetic toxicology. This article collates the abstracts of the New and Emerging Technologies Workshop together with some additional technologies subsequently considered by the workgroup. Each abstract (available in the online version of the article) includes a section addressed specifically to the strengths, weaknesses, opportunities, and threats associated with the respective technology. Importantly, an overview of the technologies and an indication of how their use might be aligned with the objectives of IVGT are presented. In particular, consideration was given with regard to follow-up testing of positive results in the standard IVGT tests (i.e., Salmonella Ames test, chromosome aberration assay, and mouse lymphoma assay) to add weight of evidence and/or provide mechanism of action for improved genetic toxicity risk assessments in humans. Copyright © 2010 Wiley-Liss, Inc.

  4. Internet-Based Direct-to-Consumer Genetic Testing: A Systematic Review.

    Science.gov (United States)

    Covolo, Loredana; Rubinelli, Sara; Ceretti, Elisabetta; Gelatti, Umberto

    2015-12-14

    Direct-to-consumer genetic tests (DTC-GT) are easily purchased through the Internet, independent of a physician referral or approval for testing, allowing the retrieval of genetic information outside the clinical context. There is a broad debate about the testing validity, their impact on individuals, and what people know and perceive about them. The aim of this review was to collect evidence on DTC-GT from a comprehensive perspective that unravels the complexity of the phenomenon. A systematic search was carried out through PubMed, Web of Knowledge, and Embase, in addition to Google Scholar according to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) checklist with the key term "Direct-to-consumer genetic test." In the final sample, 118 articles were identified. Articles were summarized in five categories according to their focus on (1) knowledge of, attitude toward use of, and perception of DTC-GT (n=37), (2) the impact of genetic risk information on users (n=37), (3) the opinion of health professionals (n=20), (4) the content of websites selling DTC-GT (n=16), and (5) the scientific evidence and clinical utility of the tests (n=14). Most of the articles analyzed the attitude, knowledge, and perception of DTC-GT, highlighting an interest in using DTC-GT, along with the need for a health care professional to help interpret the results. The articles investigating the content analysis of the websites selling these tests are in agreement that the information provided by the companies about genetic testing is not completely comprehensive for the consumer. Given that risk information can modify consumers' health behavior, there are surprisingly few studies carried out on actual consumers and they do not confirm the overall concerns on the possible impact of DTC-GT. Data from studies that investigate the quality of the tests offered confirm that they are not informative, have little predictive power, and do not measure genetic risk

  5. Placoderm Assemblage from the Tetrapod-Bearing Locality of Strud (Belgium, Upper Famennian) Provides Evidence for a Fish Nursery

    Science.gov (United States)

    Clément, Gaël; Daeschler, Edward B.; Dupret, Vincent

    2016-01-01

    The placoderm fauna of the upper Famennian tetrapod-bearing locality of Strud, Belgium, includes the antiarch Grossilepis rikiki, the arthrodire groenlandaspidid Turrisaspis strudensis and the phyllolepidid Phyllolepis undulata. Based on morphological and morphometric evidence, the placoderm specimens from Strud are predominantly recognised as immature specimens and this locality as representing a placoderm nursery. The Strud depositional environment corresponds to a channel in an alluvial plain, and the presence of a nursery in such environment could have provided nutrients and protection to the placoderm offspring. This represents one of the earliest pieces of evidence for this sort of habitat partitioning in vertebrate history, with adults living more distantly from the nursery and using the nursery only to spawn or give live birth. PMID:27552196

  6. Inter individual variations of the fish skin microbiota: host genetics basis of mutualism?

    Directory of Open Access Journals (Sweden)

    Sébastien Boutin

    Full Text Available The commensal microbiota of fish skin is suspected to provide a protection against opportunist infections. The skin of fish harbors a complex and diverse microbiota that closely interacts with the surrounding water microbial communities. Up to now there is no clear evidence as to whether the host regulates the recruitment of environmental bacteria to build a specific skin microbiota. To address this question, we detected Quantitative Trait Loci (QTL associated with the abundance of specific skin microbiota bacterial strains in brook charr (Salvelinus fontinalis, combining 16S RNA tagged-amplicon 454 pyrosequencing with genetic linkage analysis. Skin microbiota analysis revealed high inter-individual variation among 86 F2 fish progeny based upon the relative abundance of bacterial operational taxonomic units (OTUs. Out of those OTUs, the pathogenic strain Flavobacterium psychrophilum and the non-pathogenic strain Methylobacterium rhodesianum explained the majority of inter-individual distances. Furthermore, a strong negative correlation was found between Flavobacterium and Methylobacterium, suggesting a mutually competitive relationship. Finally, after considering a total of 266 markers, genetic linkage analysis highlighted three major QTL associated with the abundance of Lysobacter, Rheinheimera and Methylobacterium. All these three genera are known for their beneficial antibacterial activity. Overall, our results provide evidence that host genotype may regulate the abundance of specific genera among their surface microbiota. They also indicate that Lysobacter, Rheinheimera and Methylobacterium are potentially important genera in providing protection against pathogens.

  7. Heritable influences on behavioural problems from early childhood to mid-adolescence: evidence for genetic stability and innovation.

    Science.gov (United States)

    Lewis, G J; Plomin, R

    2015-07-01

    Although behavioural problems (e.g., anxiety, conduct, hyperactivity, peer problems) are known to be heritable both in early childhood and in adolescence, limited work has examined prediction across these ages, and none using a genetically informative sample. We examined, first, whether parental ratings of behavioural problems (indexed by the Strengths and Difficulties questionnaire) at ages 4, 7, 9, 12, and 16 years were stable across these ages. Second, we examined the extent to which stability reflected genetic or environmental effects through multivariate quantitative genetic analysis on data from a large (n > 3000) population (UK) sample of monozygotic and dizygotic twins. Behavioural problems in early childhood (age 4 years) showed significant associations with the corresponding behavioural problem at all subsequent ages. Moreover, stable genetic influences were observed across ages, indicating that biological bases underlying behavioural problems in adolescence are underpinned by genetic influences expressed as early as age 4 years. However, genetic and environmental innovations were also observed at each age. These observations indicate that genetic factors are important for understanding stable individual differences in behavioural problems across childhood and adolescence, although novel genetic influences also facilitate change in such behaviours.

  8. Genetic determinants of HDL metabolism.

    Science.gov (United States)

    Ossoli, A; Gomaraschi, M; Franceschini, G; Calabresi, L

    2014-01-01

    Plasma high density lipoproteins (HDL) comprise a highly heterogeneous family of lipoprotein particles, with subclasses that can be separated and identified according to density, size, surface charge as well as shape and protein composition. There is evidence that these subclasses may differ in their functional properties. The individual plasma HDL cholesterol (HDL-C) level is generally taken as a snapshot of the steady-state concentration of all circulating HDL subclasses together, but this is insufficient to capture the structural and functional variation in HDL particles. HDL are continuously remodeled and metabolized in plasma and interstitial fluids, through the interaction with a large number of factors, including structural proteins, membrane transporters, enzymes, transfer proteins and receptors. Genetic variation in these factors can lead to essential changes in plasma HDL levels, and to remarkable changes in HDL particle density, size, surface charge, shape, and composition in lipids and apolipoproteins. This review discusses the impact of rare mutations and common variants in genes encoding factors involved in HDL remodeling and metabolism on plasma HDL-C levels and particle distribution. The study of the effects of human genetic variation in major players in HDL metabolism provides important clues on how individual factors modulate the formation, maturation, remodeling and catabolism of HDL.

  9. Tracing the Trans-Pacific Evolutionary History of a Domesticated Seaweed (Gracilaria chilensis) with Archaeological and Genetic Data

    Science.gov (United States)

    Guillemin, Marie-Laure; Valero, Myriam; Faugeron, Sylvain; Nelson, Wendy; Destombe, Christophe

    2014-01-01

    The history of a domesticated marine macroalga is studied using archaeological, phylogeographic and population genetic tools. Phylogeographic and population genetic analyses demonstrated that the cultivated red alga Gracilaria chilensis colonised the Chilean coast from New Zealand. Combining archaeological observations with phylogeographic data provided evidence that exchanges between New Zealand and Chile have occurred at least before the Holocene, likely at the end of the Last Glacial Maximum (LGM) and we suggest that migration probably occurred via rafting. Furthermore, the remarkably low microsatellite diversity found in the Chilean populations compared to those in New Zealand is consistent with a recent genetic bottleneck as a result of over-exploitation of natural populations and/or the process of domestication. Therefore, the aquaculture of this seaweed, based essentially on clonal propagation, is occurring from genetically depressed populations and may be driving the species to an extinction vortex in Chile. PMID:25501717

  10. Broad-scale Population Genetics of the Host Sea Anemone, Heteractis magnifica

    KAUST Repository

    Emms, Madeleine

    2015-12-01

    Broad-scale population genetics can reveal population structure across an organism’s entire range, which can enable us to determine the most efficient population-wide management strategy depending on levels of connectivity. Genetic variation and differences in genetic diversity on small-scales have been reported in anemones, but nothing is known about their broad-scale population structure, including that of “host” anemone species, which are increasingly being targeted in the aquarium trade. In this study, microsatellite markers were used as a tool to determine the population structure of a sessile, host anemone species, Heteractis magnifica, across the Indo-Pacific region. In addition, two rDNA markers were used to identify Symbiodinium from the samples, and phylogenetic analyses were used to measure diversity and geographic distribution of Symbiodinium across the region. Significant population structure was identified in H. magnifica across the Indo-Pacific, with at least three genetic breaks, possibly the result of factors such as geographic distance, geographic isolation and environmental variation. Symbiodinium associations were also affected by environmental variation and supported the geographic isolation of some regions. These results suggests that management of H. magnifica must be implemented on a local scale, due to the lack of connectivity between clusters. This study also provides further evidence for the combined effects of geographic distance and environmental distance in explaining genetic variance.

  11. Genetically Engineered Cyanobacteria

    Science.gov (United States)

    Zhou, Ruanbao (Inventor); Gibbons, William (Inventor)

    2015-01-01

    The disclosed embodiments provide cyanobacteria spp. that have been genetically engineered to have increased production of carbon-based products of interest. These genetically engineered hosts efficiently convert carbon dioxide and light into carbon-based products of interest such as long chained hydrocarbons. Several constructs containing polynucleotides encoding enzymes active in the metabolic pathways of cyanobacteria are disclosed. In many instances, the cyanobacteria strains have been further genetically modified to optimize production of the carbon-based products of interest. The optimization includes both up-regulation and down-regulation of particular genes.

  12. Dietary differentiation and the evolution of population genetic structure in a highly mobile carnivore.

    Directory of Open Access Journals (Sweden)

    Małgorzata Pilot

    Full Text Available Recent studies on highly mobile carnivores revealed cryptic population genetic structures correlated to transitions in habitat types and prey species composition. This led to the hypothesis that natal-habitat-biased dispersal may be responsible for generating population genetic structure. However, direct evidence for the concordant ecological and genetic differentiation between populations of highly mobile mammals is rare. To address this we analyzed stable isotope profiles (δ(13C and δ(15N values for Eastern European wolves (Canis lupus as a quantifiable proxy measure of diet for individuals that had been genotyped in an earlier study (showing cryptic genetic structure, to provide a quantitative assessment of the relationship between individual foraging behavior and genotype. We found a significant correlation between genetic distances and dietary differentiation (explaining 46% of the variation in both the marginal test and crucially, when geographic distance was accounted for as a co-variable. These results, interpreted in the context of other possible mechanisms such as allopatry and isolation by distance, reinforce earlier studies suggesting that diet and associated habitat choice are influencing the structuring of populations in highly mobile carnivores.

  13. Molecular Population Genetics.

    Science.gov (United States)

    Casillas, Sònia; Barbadilla, Antonio

    2017-03-01

    Molecular population genetics aims to explain genetic variation and molecular evolution from population genetics principles. The field was born 50 years ago with the first measures of genetic variation in allozyme loci, continued with the nucleotide sequencing era, and is currently in the era of population genomics. During this period, molecular population genetics has been revolutionized by progress in data acquisition and theoretical developments. The conceptual elegance of the neutral theory of molecular evolution or the footprint carved by natural selection on the patterns of genetic variation are two examples of the vast number of inspiring findings of population genetics research. Since the inception of the field, Drosophila has been the prominent model species: molecular variation in populations was first described in Drosophila and most of the population genetics hypotheses were tested in Drosophila species. In this review, we describe the main concepts, methods, and landmarks of molecular population genetics, using the Drosophila model as a reference. We describe the different genetic data sets made available by advances in molecular technologies, and the theoretical developments fostered by these data. Finally, we review the results and new insights provided by the population genomics approach, and conclude by enumerating challenges and new lines of inquiry posed by increasingly large population scale sequence data. Copyright © 2017 Casillas and Barbadilla.

  14. Spontaneous chromosome aberrations in cancer cells. Evidence of existence of hidden genetic lesions in genetic structures

    International Nuclear Information System (INIS)

    Poryadkova-Luchnik, N.A.; Kuz'mina, E.G.

    1996-01-01

    Chromosome aberrations spontaneously observed in cancer cells were quantitively studied under the effect of non-mutagenic (suboptimal temperature, low content of propilgallate and caffeine) and mutagenic (ionizing radiation) factors. Human larynx cancer cells during several years or gamma-irradiation were used to carry out experiments. The experiments linked with cloning of the initial population and investigation into chromosome aberrations in 22 clones demonstrated persuasively the occurrence of latent genetic lesions in cancer cells

  15. The personalised medicine: a paradigm of evidence-based medicine

    Directory of Open Access Journals (Sweden)

    Dhavendra Kumar

    2011-01-01

    Full Text Available The practice of "evidence-based medicine" aims at the conscientious, explicit and judicious use of the current best evidence in making decisions about the individualised patient care. The clinical genetics evolved from translational genetics research and contributes to the clinical care of patients and families through evidence-based health care in managing inherited disorders through accurate diagnosis, molecular pathology and assessing phenotypic correlations. Translational genetics and genomics research has led to the development of powerful tools for clinical diagnosis, assessing individual's genomic profile for disease prediction/prevention, high-throughput genome-wide screening for predisposition and/or protection to complex medical conditions, and discovery and development of new drugs and vaccines. Gene mapping and deciphering pathogenic mutations have helped in unravelling the basic biological mechanisms leading to new drug discovery and development. Targeted pharmacotherapy is now possible for managing the highly penetrant multi-system dominantly inherited conditions. Notable examples include rapamycin (sirolimus in suppressing the mTOR pathway associated hamartomas in dominantly inherited cancer family syndromes and angiotensin converting enzyme receptor blockers (ACE-RB in preventing aortic dilatation in Marfan syndrome and related familial arteriopathies. The translational genomic research is the essential prerequisite for developing sound evidence-based diagnostic, therapeutic and prognostic clinical protocols for the practice of personalised clinical medicine.

  16. Confirmation of linkage of Best`s macular dystrophy to 11q13, and evidence for genetic heterogeneity

    Energy Technology Data Exchange (ETDEWEB)

    Mansergh, F.C.; Kenna, P.F.; Farrar, G.J. [Trinity College, Dublin (United Kingdom)] [and others

    1994-09-01

    Best`s macular dystrophy, also known as vitelliform macular degeneration, is an autosomal dominant, early onset form of macular degeneration. The disease is characterized by a roughly circular deposit of lipofuscin beneath the pigment epithelium of the retinal macula. Linkage studies were performed in two families, one Irish and one German, segregating typical Best`s macular dystrophy. In the Irish family (BTMD1), linkage analysis mapped the disease causing gene to chromosome 11q13, in a 10 cM region between the microsatellite markers PYGM and D11S871. Both markers showed different recombinants with the disease phenotype. This is a region that has previously shown linkage in families affected with Best`s macular dystrophy. Lod scores of 9.63, 9.12, 6.92, and 6.83 at zero recombination, were obtained with markers D11S1344, D11S1361, D11S1357 and D11S903, respectively. This data places the disease locus definitvely within the region between PYGM and D11S871. Linkage has been significantly excluded in this region in the German family (FamE), thereby providing evidence for genetic heterogeneity in this disease. The retinal specific gene, rod outer membrane protein 1 (ROM1), which maps to this region, has been screened for mutations in family BTMD1 by SSCPE analysis and by direct sequencing. Some of the promoter region, the three exons, and both introns have been sequenced; however, no mutations were found. It is likely that a gene other than ROM1 within this region may be responsible for causing the disease phenotype.

  17. Shared Genetic Architecture in the Relationship between Adult Stature and Subclinical Coronary Artery Atherosclerosis

    Science.gov (United States)

    Cassidy-Bushrow, Andrea E.; Bielak, Lawrence F.; Sheedy, Patrick F.; Turner, Stephen T.; Chu, Julia S.; Peyser, Patricia A.

    2011-01-01

    Background Short stature is associated with increased risk of coronary heart disease (CHD); although the mechanisms for this relationship are unknown, shared genetic factors have been proposed. Subclinical atherosclerosis, measured by coronary artery calcification (CAC), is associated with CHD events and represents part of the biological continuum to overt CHD. Many molecular mechanisms of CAC development are shared with bone growth. Thus, we examined whether there was evidence of shared genes (pleiotropy) between adult stature and CAC. Methods 877 asymptomatic white adults (46% men) from 625 families in a community-based sample had computed tomography measures of CAC. Pleiotropy between height and CAC was determined using maximum-likelihood estimation implemented in SOLAR. Results Adult height was significantly and inversely associated with CAC score (P=0.01). After adjusting for age, sex, and CHD risk factors, the estimated genetic correlation between height and CAC score was -0.37 and was significantly different than 0 (P=0.001) and -1 (P<0.001). The environmental correlation between height and CAC score was 0.60 and was significantly different than 0 (P=0.024). Conclusions Further studies of shared genetic factors between height and CAC may provide important insight into the complex genetic architecture of CHD, in part through increased understanding of the molecular pathways underlying the process of both normal growth and disease development. Bivariate genetic linkage analysis may provide a powerful mechanism for identifying specific genomic regions associated with both height and CAC. PMID:21937044

  18. Genetic secrets: Protecting privacy and confidentiality in the genetic era. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Rothstein, M.A. [ed.

    1998-09-01

    Few developments are likely to affect human beings more profoundly in the long run than the discoveries resulting from advances in modern genetics. Although the developments in genetic technology promise to provide many additional benefits, their application to genetic screening poses ethical, social, and legal questions, many of which are rooted in issues of privacy and confidentiality. The ethical, practical, and legal ramifications of these and related questions are explored in depth. The broad range of topics includes: the privacy and confidentiality of genetic information; the challenges to privacy and confidentiality that may be projected to result from the emerging genetic technologies; the role of informed consent in protecting the confidentiality of genetic information in the clinical setting; the potential uses of genetic information by third parties; the implications of changes in the health care delivery system for privacy and confidentiality; relevant national and international developments in public policies, professional standards, and laws; recommendations; and the identification of research needs.

  19. Genetic variants in periodontal health and disease

    Energy Technology Data Exchange (ETDEWEB)

    Dumitrescu, Alexandrina L [Tromsoe Univ. (Norway). Inst. of Clinical Dentistry; Kobayashi, Junya [Kyoto Univ. (Japan). Dept. of Genome Repair Dynamics

    2010-07-01

    Periodontitis is a complex, multifactorial disease and its susceptibility is genetically determined. The present book systematically reviews the evidence of the association between the genetic variants and periodontitis progression and/or treatment outcomes. Genetic syndromes known to be associated with periodontal disease, the candidate gene polymorphisms investigated in relation to periodontitis, the heritability of chronic and aggressive periodontitis, as well as common guidelines for association studies are described. This growing understanding of the role of genetic variation in inflammation and periodontal chronic disease presents opportunities to identify healthy persons who are at increased risk of disease and to potentially modify the trajectory of disease to prolong healthy aging. The book represents a new concept in periodontology with its pronounced focus on understanding through knowledge rather than presenting the presently valid answers. Connections between genetics and periodontology are systematically reviewed and covered in detail. (orig.)

  20. Can genetic estimators provide robust estimates of the effective number of breeders in small populations?

    Directory of Open Access Journals (Sweden)

    Marion Hoehn

    Full Text Available The effective population size (N(e is proportional to the loss of genetic diversity and the rate of inbreeding, and its accurate estimation is crucial for the monitoring of small populations. Here, we integrate temporal studies of the gecko Oedura reticulata, to compare genetic and demographic estimators of N(e. Because geckos have overlapping generations, our goal was to demographically estimate N(bI, the inbreeding effective number of breeders and to calculate the N(bI/N(a ratio (N(a =number of adults for four populations. Demographically estimated N(bI ranged from 1 to 65 individuals. The mean reduction in the effective number of breeders relative to census size (N(bI/N(a was 0.1 to 1.1. We identified the variance in reproductive success as the most important variable contributing to reduction of this ratio. We used four methods to estimate the genetic based inbreeding effective number of breeders N(bI(gen and the variance effective populations size N(eV(gen estimates from the genotype data. Two of these methods - a temporal moment-based (MBT and a likelihood-based approach (TM3 require at least two samples in time, while the other two were single-sample estimators - the linkage disequilibrium method with bias correction LDNe and the program ONeSAMP. The genetic based estimates were fairly similar across methods and also similar to the demographic estimates excluding those estimates, in which upper confidence interval boundaries were uninformative. For example, LDNe and ONeSAMP estimates ranged from 14-55 and 24-48 individuals, respectively. However, temporal methods suffered from a large variation in confidence intervals and concerns about the prior information. We conclude that the single-sample estimators are an acceptable short-cut to estimate N(bI for species such as geckos and will be of great importance for the monitoring of species in fragmented landscapes.

  1. Next generation DNA sequencing technology delivers valuable genetic markers for the genomic orphan legume species, Bituminaria bituminosa

    Directory of Open Access Journals (Sweden)

    Pazos-Navarro María

    2011-12-01

    Full Text Available Abstract Background Bituminaria bituminosa is a perennial legume species from the Canary Islands and Mediterranean region that has potential as a drought-tolerant pasture species and as a source of pharmaceutical compounds. Three botanical varieties have previously been identified in this species: albomarginata, bituminosa and crassiuscula. B. bituminosa can be considered a genomic 'orphan' species with very few genomic resources available. New DNA sequencing technologies provide an opportunity to develop high quality molecular markers for such orphan species. Results 432,306 mRNA molecules were sampled from a leaf transcriptome of a single B. bituminosa plant using Roche 454 pyrosequencing, resulting in an average read length of 345 bp (149.1 Mbp in total. Sequences were assembled into 3,838 isotigs/contigs representing putatively unique gene transcripts. Gene ontology descriptors were identified for 3,419 sequences. Raw sequence reads containing simple sequence repeat (SSR motifs were identified, and 240 primer pairs flanking these motifs were designed. Of 87 primer pairs developed this way, 75 (86.2% successfully amplified primarily single fragments by PCR. Fragment analysis using 20 primer pairs in 79 accessions of B. bituminosa detected 130 alleles at 21 SSR loci. Genetic diversity analyses confirmed that variation at these SSR loci accurately reflected known taxonomic relationships in original collections of B. bituminosa and provided additional evidence that a division of the botanical variety bituminosa into two according to geographical origin (Mediterranean region and Canary Islands may be appropriate. Evidence of cross-pollination was also found between botanical varieties within a B. bituminosa breeding programme. Conclusions B. bituminosa can no longer be considered a genomic orphan species, having now a large (albeit incomplete repertoire of expressed gene sequences that can serve as a resource for future genetic studies. This

  2. Environmental Noise, Genetic Diversity and the Evolution of Evolvability and Robustness in Model Gene Networks

    Science.gov (United States)

    Steiner, Christopher F.

    2012-01-01

    The ability of organisms to adapt and persist in the face of environmental change is accepted as a fundamental feature of natural systems. More contentious is whether the capacity of organisms to adapt (or “evolvability”) can itself evolve and the mechanisms underlying such responses. Using model gene networks, I provide evidence that evolvability emerges more readily when populations experience positively autocorrelated environmental noise (red noise) compared to populations in stable or randomly varying (white noise) environments. Evolvability was correlated with increasing genetic robustness to effects on network viability and decreasing robustness to effects on phenotypic expression; populations whose networks displayed greater viability robustness and lower phenotypic robustness produced more additive genetic variation and adapted more rapidly in novel environments. Patterns of selection for robustness varied antagonistically with epistatic effects of mutations on viability and phenotypic expression, suggesting that trade-offs between these properties may constrain their evolutionary responses. Evolution of evolvability and robustness was stronger in sexual populations compared to asexual populations indicating that enhanced genetic variation under fluctuating selection combined with recombination load is a primary driver of the emergence of evolvability. These results provide insight into the mechanisms potentially underlying rapid adaptation as well as the environmental conditions that drive the evolution of genetic interactions. PMID:23284934

  3. Evidence for Genetic Similarity of Vegetative Compatibility Groupings in Sclerotinia homoeocarpa

    Directory of Open Access Journals (Sweden)

    Seog Won Chang

    2014-12-01

    Full Text Available Vegetative compatibility groups (VCGs are determined for many fungi to test for the ability of fungal isolates to undergo heterokaryon formation. In several fungal plant pathogens, isolates belonging to a VCG have been shown to share significantly higher genetic similarity than those of different VCGs. In this study we sought to examine the relationship between VCG and genetic similarity of an important cool season turfgrass pathogen, Sclerotinia homoeocarpa. Twenty-two S. homoeocarpa isolates from the Midwest and Eastern US, which were previously characterized in several studies, were all evaluated for VCG using an improved nit mutant assay. These isolates were also genotyped using 19 microsatellites developed from partial genome sequence of S. homoeocarpa. Additionally, partial sequences of mitochondrial genes cytochrome oxidase II and mitochondrial small subunit (mtSSU rRNA, and the atp6-rns intergenic spacer, were generated for isolates from each nit mutant VCG to determine if mitochondrial haplotypes differed among VCGs. Of the 22 isolates screened, 15 were amenable to the nit mutant VCG assay and were grouped into six VCGs. The 19 microsatellites gave 57 alleles for this set. Unweighted pair group methods with arithmetic mean (UPGMA tree of binary microsatellite data were used to produce a dendrogram of the isolate genotypes based on microsatellite alleles, which showed high genetic similarity of nit mutant VCGs. Analysis of molecular variance of microsatellite data demonstrates that the current nit mutant VCGs explain the microsatellite genotypic variation among isolates better than the previous nit mutant VCGs or the conventionally determined VCGs. Mitochondrial sequences were identical among all isolates, suggesting that this marker type may not be informative for US populations of S. homoeocarpa.

  4. Explaining individual differences in alcohol intake in adults: evidence for genetic and cultural transmission?

    Science.gov (United States)

    van Beek, Jenny H D A; de Moor, Marleen H M; Geels, Lot M; Willemsen, Gonneke; Boomsma, Dorret I

    2014-03-01

    The current study aimed to describe what proportion of variation in adult alcohol intake is attributable to genetic differences among individuals and what proportion to differences in environmental experiences individuals have been exposed to. Effects of age, gender, spousal resemblance, and cultural transmission of alcohol intake from parents to offspring were taken into account. In a twin-family design, the effects of genetic and cultural transmission and shared and nonshared environment on alcohol intake were estimated with genetic structural equation models. Data originated from adult twins, their siblings, parents (n = 12,587), and spouses (n = 429) registered with the population-based Netherlands Twin Register (63.5% female; ages 18-97 years). Alcohol intake (grams per day) was higher among men than women and increased with age. Broad-sense heritability estimates were similar across sex and age (53%). Spousal resemblance was observed (r = .39) but did not significantly affect the heritability estimates. No effects of cultural transmission were detected. In total, 23% of the variation in alcohol intake was explained by additive genetic effects, 30% by dominant (nonadditive) gene action, and 47% by environmental effects that were not shared among family members. Individual differences in adult alcohol intake are explained by genetic and individual-specific environmental effects. The same genes are expressed in males and females and in younger and older participants. A substantial part of the heritability of alcohol intake is attributable to nonadditive gene action. Effects of cultural transmission that have been reported in adolescence are not present in adulthood.

  5. Recent genetic discoveries in osteoporosis, sarcopenia and obesity.

    Science.gov (United States)

    Urano, Tomohiko; Inoue, Satoshi

    2015-01-01

    Osteoporosis is a skeletal disorder characterized by low bone mineral density (BMD) and an increased susceptibility to fractures. Evidence from genetic studies indicates that BMD, a complex quantitative trait with a normal distribution, is genetically controlled. Genome-wide association studies (GWAS) as well as studies using candidate gene approaches have identified single-nucleotide polymorphisms (SNPs) that are associated with BMD, osteoporosis and osteoporotic fractures. These SNPs have been mapped close to or within genes including those encoding WNT/β-catenin signaling proteins. Understanding the genetics of osteoporosis will help to identify novel candidates for diagnostic and therapeutic targets. Genetic factors are also important for the development of sarcopenia, which is characterized by a loss of lean body mass, and obesity, which is characterized by high fat mass. Hence, in this review, we discuss the genetic factors, identified by genetic studies, which regulate the body components related to osteoporosis, sarcopenia, and obesity.

  6. Fischer 344 and Lewis rat strains as a model of genetic vulnerability to drug addiction

    Directory of Open Access Journals (Sweden)

    Cristina eCadoni

    2016-02-01

    Full Text Available Today it is well acknowledged that both nature and nurture play important roles in the genesis of psychopathologies, including drug addiction. Increasing evidence suggests that genetic factors contribute for at least 40-60 % of the variation in liability to drug dependence. Human genetic studies suggest that multiple genes of small effect, rather than single genes, contribute to the genesis of behavioral psychopathologies. Therefore the use of inbred rat strains might provide a valuable tool to identify differences, linked to genotype, important in liability to addiction and related disorders. In this regard, Lewis and Fischer 344 inbred rats have been proposed as a model of genetic vulnerability to drug addiction, given their innate differences in sensitivity to the reinforcing and rewarding effects of drugs of abuse, as well their different responsiveness to stressful stimuli. This review will provide evidence in support of this model for the study of the genetic influence on addiction vulnerability, with particular emphasis to differences in mesolimbic dopamine (DA transmission, rewarding and emotional function. It will be highlighted that Lewis and Fischer 344 rats differ not only in several indices of DA transmission and adaptive changes following repeated drug exposure, but also in hypothalamic-pituitary-adrenal (HPA axis responsiveness, influencing not only the ability of the individual to cope with stressful events, but also interfering with rewarding and motivational processes, given the influence of corticosteroids on dopamine neurons functionality.Further differences between the two strains, as impulsivity or anxiousness, might contribute to their different proneness to addiction, and likely these features might be linked to their different DA neurotransmission plasticity. Although differences in other neurotransmitter systems might deserve further investigations, results from the reviewed studies might open new vistas in

  7. Fischer 344 and Lewis Rat Strains as a Model of Genetic Vulnerability to Drug Addiction.

    Science.gov (United States)

    Cadoni, Cristina

    2016-01-01

    Today it is well acknowledged that both nature and nurture play important roles in the genesis of psychopathologies, including drug addiction. Increasing evidence suggests that genetic factors contribute for at least 40-60% of the variation in liability to drug dependence. Human genetic studies suggest that multiple genes of small effect, rather than single genes, contribute to the genesis of behavioral psychopathologies. Therefore, the use of inbred rat strains might provide a valuable tool to identify differences, linked to genotype, important in liability to addiction and related disorders. In this regard, Lewis and Fischer 344 inbred rats have been proposed as a model of genetic vulnerability to drug addiction, given their innate differences in sensitivity to the reinforcing and rewarding effects of drugs of abuse, as well their different responsiveness to stressful stimuli. This review will provide evidence in support of this model for the study of the genetic influence on addiction vulnerability, with particular emphasis on differences in mesolimbic dopamine (DA) transmission, rewarding and emotional function. It will be highlighted that Lewis and Fischer 344 rats differ not only in several indices of DA transmission and adaptive changes following repeated drug exposure, but also in hypothalamic-pituitary-adrenal (HPA) axis responsiveness, influencing not only the ability of the individual to cope with stressful events, but also interfering with rewarding and motivational processes, given the influence of corticosteroids on dopamine neuron functionality. Further differences between the two strains, as impulsivity or anxiousness, might contribute to their different proneness to addiction, and likely these features might be linked to their different DA neurotransmission plasticity. Although differences in other neurotransmitter systems might deserve further investigation, results from the reviewed studies might open new vistas in understanding aberrant

  8. Cotton genetic resources and crop vulnerability

    Science.gov (United States)

    A report on the genetic vulnerability of cotton was provided to the National Genetic Resources Advisory Council. The report discussed crop vulnerabilities associated with emerging diseases, emerging pests, and a narrowing genetic base. To address these crop vulnerabilities, the report discussed the ...

  9. The genetic difference principle.

    Science.gov (United States)

    Farrelly, Colin

    2004-01-01

    In the newly emerging debates about genetics and justice three distinct principles have begun to emerge concerning what the distributive aim of genetic interventions should be. These principles are: genetic equality, a genetic decent minimum, and the genetic difference principle. In this paper, I examine the rationale of each of these principles and argue that genetic equality and a genetic decent minimum are ill-equipped to tackle what I call the currency problem and the problem of weight. The genetic difference principle is the most promising of the three principles and I develop this principle so that it takes seriously the concerns of just health care and distributive justice in general. Given the strains on public funds for other important social programmes, the costs of pursuing genetic interventions and the nature of genetic interventions, I conclude that a more lax interpretation of the genetic difference principle is appropriate. This interpretation stipulates that genetic inequalities should be arranged so that they are to the greatest reasonable benefit of the least advantaged. Such a proposal is consistent with prioritarianism and provides some practical guidance for non-ideal societies--that is, societies that do not have the endless amount of resources needed to satisfy every requirement of justice.

  10. Neuroplasticity of selective attention: Research foundations and preliminary evidence for a gene by intervention interaction

    Science.gov (United States)

    Stevens, Courtney; Pakulak, Eric; Hampton Wray, Amanda; Bell, Theodore A.; Neville, Helen J.

    2017-01-01

    This article reviews the trajectory of our research program on selective attention, which has moved from basic research on the neural processes underlying selective attention to translational studies using selective attention as a neurobiological target for evidence-based interventions. We use this background to present a promising preliminary investigation of how genetic and experiential factors interact during development (i.e., gene × intervention interactions). Our findings provide evidence on how exposure to a family-based training can modify the associations between genotype (5-HTTLPR) and the neural mechanisms of selective attention in preschool children from lower socioeconomic status backgrounds. PMID:28819066

  11. Neuroplasticity of selective attention: Research foundations and preliminary evidence for a gene by intervention interaction.

    Science.gov (United States)

    Isbell, Elif; Stevens, Courtney; Pakulak, Eric; Hampton Wray, Amanda; Bell, Theodore A; Neville, Helen J

    2017-08-29

    This article reviews the trajectory of our research program on selective attention, which has moved from basic research on the neural processes underlying selective attention to translational studies using selective attention as a neurobiological target for evidence-based interventions. We use this background to present a promising preliminary investigation of how genetic and experiential factors interact during development (i.e., gene × intervention interactions). Our findings provide evidence on how exposure to a family-based training can modify the associations between genotype (5-HTTLPR) and the neural mechanisms of selective attention in preschool children from lower socioeconomic status backgrounds.

  12. Genetic screening and testing in an episode-based payment model: preserving patient autonomy.

    Science.gov (United States)

    Sutherland, Sharon; Farrell, Ruth M; Lockwood, Charles

    2014-11-01

    The State of Ohio is implementing an episode-based payment model for perinatal care. All costs of care will be tabulated for each live birth and assigned to the delivering provider, creating a three-tiered model for reimbursement for care. Providers will be reimbursed as usual for care that is average in cost and quality, while instituting rewards or penalties for those outside the expected range in either domain. There are few exclusions, and all methods of genetic screening and diagnostic testing are included in the episode cost calculation as proposed. Prenatal ultrasonography, genetic screening, and diagnostic testing are critical components of the delivery of high-quality, evidence-based prenatal care. These tests provide pregnant women with key information about the pregnancy, which, in turn, allows them to work closely with their health care provider to determine optimal prenatal care. The concepts of informed consent and decision-making, cornerstones of the ethical practice of medicine, are founded on the principles of autonomy and respect for persons. These principles recognize that patients' rights to make choices and take actions are based on their personal beliefs and values. Given the personal nature of such decisions, it is critical that patients have unbarred access to prenatal genetic tests if they elect to use them as part of their prenatal care. The proposed restructuring of reimbursement creates a clear conflict between patient autonomy and physician financial incentives.

  13. Reward circuitry dysfunction in psychiatric and neurodevelopmental disorders and genetic syndromes: animal models and clinical findings.

    Science.gov (United States)

    Dichter, Gabriel S; Damiano, Cara A; Allen, John A

    2012-07-06

    This review summarizes evidence of dysregulated reward circuitry function in a range of neurodevelopmental and psychiatric disorders and genetic syndromes. First, the contribution of identifying a core mechanistic process across disparate disorders to disease classification is discussed, followed by a review of the neurobiology of reward circuitry. We next consider preclinical animal models and clinical evidence of reward-pathway dysfunction in a range of disorders, including psychiatric disorders (i.e., substance-use disorders, affective disorders, eating disorders, and obsessive compulsive disorders), neurodevelopmental disorders (i.e., schizophrenia, attention-deficit/hyperactivity disorder, autism spectrum disorders, Tourette's syndrome, conduct disorder/oppositional defiant disorder), and genetic syndromes (i.e., Fragile X syndrome, Prader-Willi syndrome, Williams syndrome, Angelman syndrome, and Rett syndrome). We also provide brief overviews of effective psychopharmacologic agents that have an effect on the dopamine system in these disorders. This review concludes with methodological considerations for future research designed to more clearly probe reward-circuitry dysfunction, with the ultimate goal of improved intervention strategies.

  14. Provider cost analysis supports results-based contracting out of maternal and newborn health services: an evidence-based policy perspective.

    Science.gov (United States)

    Hatcher, Peter; Shaikh, Shiraz; Fazli, Hassan; Zaidi, Shehla; Riaz, Atif

    2014-11-13

    There is dearth of evidence on provider cost of contracted out services particularly for Maternal and Newborn Health (MNH). The evidence base is weak for policy makers to estimate resources required for scaling up contracting. This paper ascertains provider unit costs and expenditure distribution at contracted out government primary health centers to inform the development of optimal resource envelopes for contracting out MNH services. This is a case study of provider costs of MNH services at two government Rural Health Centers (RHCs) contracted out to a non-governmental organization in Pakistan. It reports on four selected Basic Emergency Obstetrical and Newborn Care (BEmONC) services provided in one RHC and six Comprehensive Emergency Obstetrical and Newborn Care (CEmONC) services in the other. Data were collected using staff interviews and record review to compile resource inputs and service volumes, and analyzed using the CORE Plus tool. Unit costs are based on actual costs of MNH services and are calculated for actual volumes in 2011 and for volumes projected to meet need with optimal resource inputs. The unit costs per service for actual 2011 volumes at the BEmONC RHC were antenatal care (ANC) visit USD$ 18.78, normal delivery US$ 84.61, newborn care US$ 16.86 and a postnatal care (PNC) visit US$ 13.86; and at the CEmONC RHC were ANC visit US$ 45.50, Normal Delivery US$ 148.43, assisted delivery US$ 167.43, C-section US$ 183.34, Newborn Care US$ 41.07, and PNC visit US$ 27.34. The unit costs for the projected volumes needed were lower due to optimal utilization of resources. The percentage distribution of expenditures at both RHCs was largest for salaries of technical staff, followed by salaries of administrative staff, and then operating costs, medicines, medical and diagnostic supplies. The unit costs of MNH services at the two contracted out government rural facilities remain higher than is optimal, primarily due to underutilization. Provider cost analysis

  15. Genetic Determinants of Macrovascular Complications and Mortality in Type 2 Diabetes

    NARCIS (Netherlands)

    M. Yazdanpanah (Mojgan)

    2006-01-01

    textabstractEvidence is accumulating that there is a genetic predisposition for the development of vascular complications of type 2 diabetes. There is a large variation in the risk and onset of complication in patients, which may partly be explained by genetic susceptibility. Most likely

  16. Genetically based population divergence in overwintering energy mobilization in brook charr (Salvelinus fontinalis).

    Science.gov (United States)

    Crespel, Amélie; Bernatchez, Louis; Garant, Dany; Audet, Céline

    2013-03-01

    Investigating the nature of physiological traits potentially related to fitness is important towards a better understanding of how species and/or populations may respond to selective pressures imposed by contrasting environments. In northern species in particular, the ability to mobilize energy reserves to compensate for the low external energy intake during winter is crucial. However, the phenotypic and genetic bases of energy reserve accumulation and mobilization have rarely been investigated, especially pertaining to variation in strategy adopted by different populations. In the present study, we documented variation in several energy reserve variables and estimated their quantitative genetic basis to test the null hypothesis of no difference in variation at those traits among three strains of brook charr (Salvelinus fontinalis) and their reciprocal hybrids. Our results indicate that the strategy of winter energy preparation and mobilization was specific to each strain, whereby (1) domestic fish accumulated a higher amount of energy reserves before winter and kept accumulating liver glycogen during winter despite lower feeding; (2) Laval fish used liver glycogen and lipids during winter and experienced a significant decrease in condition factor; (3) Rupert fish had relatively little energy reserves accumulated at the end of fall and preferentially mobilized visceral fat during winter. Significant heritability for traits related to the accumulation and use of energy reserves was found in the domestic and Laval but not in the Rupert strain. Genetic and phenotypic correlations also varied among strains, which suggested population-specific genetic architecture underlying the expression of these traits. Hybrids showed limited evidence of non-additive effects. Overall, this study provides the first evidence of a genetically based-and likely adaptive-population-specific strategy for energy mobilization related to overwinter survival.

  17. Knowledge of Genetics and Attitudes toward Genetic Testing among College Students in Saudi Arabia.

    Science.gov (United States)

    Olwi, Duaa; Merdad, Leena; Ramadan, Eman

    2016-01-01

    Genetic testing has been gradually permeating the practice of medicine. Health-care providers may be confronted with new genetic approaches that require genetically informed decisions which will be influenced by patients' knowledge of genetics and their attitudes toward genetic testing. This study assesses the knowledge of genetics and attitudes toward genetic testing among college students. A cross-sectional study was conducted using a multistage stratified sample of 920 senior college students enrolled at King Abdulaziz University, Saudi Arabia. Information regarding knowledge of genetics, attitudes toward genetic testing, and sociodemographic data were collected using a self-administered questionnaire. In general, students had a good knowledge of genetics but lacked some fundamentals of genetics. The majority of students showed positive attitudes toward genetic testing, but some students showed negative attitudes toward certain aspects of genetic testing such as resorting to abortion in the case of an untreatable major genetic defect in an unborn fetus. The main significant predictors of knowledge were faculty, gender, academic year, and some prior awareness of 'genetic testing'. The main significant predictors of attitudes were gender, academic year, grade point average, and some prior awareness of 'genetic testing'. The knowledge of genetics among college students was higher than has been reported in other studies, and the attitudes toward genetic testing were fairly positive. Genetics educational programs that target youths may improve knowledge of genetics and create a public perception that further supports genetic testing. © 2016 S. Karger AG, Basel.

  18. Genetic ancestry, social classification, and racial inequalities in blood pressure in Southeastern Puerto Rico.

    Directory of Open Access Journals (Sweden)

    Clarence C Gravlee

    2009-09-01

    Full Text Available The role of race in human genetics and biomedical research is among the most contested issues in science. Much debate centers on the relative importance of genetic versus sociocultural factors in explaining racial inequalities in health. However, few studies integrate genetic and sociocultural data to test competing explanations directly.We draw on ethnographic, epidemiologic, and genetic data collected in Southeastern Puerto Rico to isolate two distinct variables for which race is often used as a proxy: genetic ancestry versus social classification. We show that color, an aspect of social classification based on the culturally defined meaning of race in Puerto Rico, better predicts blood pressure than does a genetic-based estimate of continental ancestry. We also find that incorporating sociocultural variables reveals a new and significant association between a candidate gene polymorphism for hypertension (alpha(2C adrenergic receptor deletion and blood pressure.This study addresses the recognized need to measure both genetic and sociocultural factors in research on racial inequalities in health. Our preliminary results provide the most direct evidence to date that previously reported associations between genetic ancestry and health may be attributable to sociocultural factors related to race and racism, rather than to functional genetic differences between racially defined groups. Our results also imply that including sociocultural variables in future research may improve our ability to detect significant allele-phenotype associations. Thus, measuring sociocultural factors related to race may both empower future genetic association studies and help to clarify the biological consequences of social inequalities.

  19. Mitochondrial DNA variability among eight Tikúna villages: evidence for an intratribal genetic heterogeneity pattern.

    Science.gov (United States)

    Mendes-Junior, Celso Teixeira; Simões, Aguinaldo Luiz

    2009-11-01

    To study the genetic structure of the Tikúna tribe, four major Native American mitochondrial DNA (mtDNA) founder haplogroups were analyzed in 187 Amerindians from eight Tikúna villages located in the Brazilian Amazon. The central position of these villages in the continent makes them relevant for attempts to reconstruct population movements in South America. In this geographic region, there is particular concern regarding the genetic structure of the Tikúna tribe, formerly designated "enigmatic" due to its remarkable degree of intratribal homogeneity and the scarcity of private protein variants. In spite of its large population size and geographic distribution, the Tikúna tribe presents marked genetic and linguistic isolation. All individuals presented indigenous mtDNA haplogroups. An intratribal genetic heterogeneity pattern characterized by two highly homogeneous Tikúna groups that differ considerably from each other was observed. Such a finding was unexpected, since the Tikúna tribe is characterized by a social system that favors intratribal exogamy and patrilocality that would lead to a higher female migration rate and homogenization of the mtDNA gene pool. Demographic explosions and religious events, which significantly changed the sizes and compositions of many Tikúna villages, may be reflected in the genetic results presented here.

  20. Diversification in continental island archipelagos: new evidence on the roles of fragmentation, colonization and gene flow on the genetic divergence of Aegean Nigella (Ranunculaceae).

    Science.gov (United States)

    Jaros, Ursula; Tribsch, Andreas; Comes, Hans Peter

    2018-02-12

    Disentangling the relative roles of past fragmentation (vicariance), colonization (dispersal) and post-divergence gene flow in the genetic divergence of continental island organisms remains a formidable challenge. Amplified fragment length polymorphisms (AFLPs) were used to (1) gain further insights into the biogeographical processes underlying the Pleistocene diversification of the Aegean Nigella arvensis complex; (2) evaluate the role of potential key factors driving patterns of population genetic variability (mating system, geographical isolation and historical contingencies); and (3) test the robustness of conclusions previously drawn from chloroplast (cp) DNA. Genetic diversity was analysed for 235 AFLP markers from 48 populations (497 individuals) representing 11 taxa of the complex using population genetic methods and Bayesian assignment tests. Most designated taxa are identifiable as genetically distinct units. Both fragmentation and dispersal-driven diversification processes occurred at different geological time scales, from Early to Late Pleistocene, specifically (1) sea barrier-induced vicariant speciation in the Cyclades, the Western Cretan Strait and Ikaria; and (2) bi-regional colonizations of the 'Southern Aegean Island Arc' from the Western vs. Eastern Aegean mainland, followed by allopatric divergences in Crete vs. Rhodos and Karpathos/Kasos. Outcrossing island taxa experienced drift-related demographic processes that are magnified in the two insular selfing species. Population genetic differentiation on the mainland seems largely driven by dispersal limitation, while in the Central Aegean it may still be influenced by historical events (island fragmentation and sporadic long-distance colonization). The biogeographical history of Aegean Nigella is more complex than expected for a strictly allopatric vicariant model of divergence. Nonetheless, the major phylogeographical boundaries of this radiation are largely congruent with the geography and