Oriented gold ripple-like structures on poly-L-lactic acid

International Nuclear Information System (INIS)

Juřík, Petr; Slepička, Petr; Mistrík, Jan; Janíček, Petr; Rimpelová, Silvie; Kolská, Zdeňka; Švorčík, Václav

2014-01-01

Highlights: • We prepared oriented ripple-like structures on polymer surface with thin gold layer. • These structures show preferential orientation over large areas which is unusual for heat induced wrinkling. • Significant electrical and optical anisotropy was observed. • Zeta-potential, XPS, goniometry and ellipsometry suggest formation of gold lines separated by polymer gaps. • Increase in cell growth in comparison with poly-styrene mock was observed. - Abstract: In this paper chemical, morphological, electrical and biological properties of poly-L-lactic acid thin films with gold nanolayers were studied. These samples were examined as-sputtered and annealed at glass transition temperature. Morphological changes of poly-L-lactic films introduced by annealing were studied by means of atomic force microscopy. This method showed formation of oriented ripple-like structures on the surface of the film. X-ray photoelectron spectroscopy, goniometry, ellipsometry, sheet resistance measurement and electrokinetic analysis were used to determine distribution of gold on the surface. Combined data suggests that these ripple-like structures were formed by gold lines with insulating polymer gaps in between. These lines show preferential orientation over large areas and under proper conditions offer simple way to form electrically anisotropic material on large scale. Also cytocompatibility was studied showing increased cell adhesion and proliferation of mouse embryonic fibroblasts offering another use for these easily formed structures

Natural and non-natural factors influencing Alzheimer´s Aβ

NARCIS (Netherlands)

Luo, Jinghui

2014-01-01

Alzheimer’s disease is manifested in amyloid fibril but caused by protofibril oligomers of Aβ peptide and tau protein. I discovered a molecular mechanism which involves a new globular state of the Aβ peptide formed by protofibril oligomers, and from which fibrils can nucleate. Another striking

Cu(II) promotes amyloid pore formation

International Nuclear Information System (INIS)

Zhang, Hangyu; Rochet, Jean-Christophe; Stanciu, Lia A.

2015-01-01

The aggregation of α-synuclein is associated with dopamine neuron death in Parkinson's disease. There is controversy in the field over the question of which species of the aggregates, fibrils or protofibrils, are toxic. Moreover, compelling evidence suggested the exposure to heavy metals to be a risk of PD. Nevertheless, the mechanism of metal ions in promoting PD remains unclear. In this research, we investigated the structural basis of Cu(II) induced aggregation of α-synuclein. Using transmission electron microscopy experiments, Cu(II) was found to promote in vitro aggregation of α-synuclein by facilitating annular protofibril formation rather than fibril formation. Furthermore, neuroprotective baicalein disaggregated annular protofibrils accompanied by considerable decrease of β-sheet content. These results strongly support the hypothesis that annular protofibrils are the toxic species, rather than fibrils, thereby inspiring us to search novel therapeutic strategies for the suppression of the toxic annular protofibril formation. - Highlights: • Cu(II) promoted the annular protofibril formation of α-synuclein in vitro. • Cu(II) postponed the in vitro fibrillization of α-synuclein. • Neuroprotective baicalein disaggregated annular protofibrils

Cu(II) promotes amyloid pore formation

Energy Technology Data Exchange (ETDEWEB)

Zhang, Hangyu, E-mail: hangyuz@uw.edu [Weldon School of Biomedical Engineering, Purdue University, West Lafayette, IN 47907 (United States); Rochet, Jean-Christophe [Department of Medicinal Chemistry and Molecular Pharmacology, Purdue University, West Lafayette, IN 47907 (United States); Stanciu, Lia A. [Weldon School of Biomedical Engineering, Purdue University, West Lafayette, IN 47907 (United States); School of Materials Engineering, Purdue University, West Lafayette, IN 47907 (United States)

2015-08-14

The aggregation of α-synuclein is associated with dopamine neuron death in Parkinson's disease. There is controversy in the field over the question of which species of the aggregates, fibrils or protofibrils, are toxic. Moreover, compelling evidence suggested the exposure to heavy metals to be a risk of PD. Nevertheless, the mechanism of metal ions in promoting PD remains unclear. In this research, we investigated the structural basis of Cu(II) induced aggregation of α-synuclein. Using transmission electron microscopy experiments, Cu(II) was found to promote in vitro aggregation of α-synuclein by facilitating annular protofibril formation rather than fibril formation. Furthermore, neuroprotective baicalein disaggregated annular protofibrils accompanied by considerable decrease of β-sheet content. These results strongly support the hypothesis that annular protofibrils are the toxic species, rather than fibrils, thereby inspiring us to search novel therapeutic strategies for the suppression of the toxic annular protofibril formation. - Highlights: • Cu(II) promoted the annular protofibril formation of α-synuclein in vitro. • Cu(II) postponed the in vitro fibrillization of α-synuclein. • Neuroprotective baicalein disaggregated annular protofibrils.

The structural evolution of Milky-Way-like star-forming galaxies since z ∼ 1.3

International Nuclear Information System (INIS)

Patel, Shannon G.; Fumagalli, Mattia; Franx, Marijn; Labbé, Ivo; Muzzin, Adam; Van Dokkum, Pieter G.; Leja, Joel; Skelton, Rosalind E.; Momcheva, Ivelina; Nelson, Erica June; Van der Wel, Arjen; Rix, Hans-Walter; Brammer, Gabriel; Whitaker, Katherine E.; Lundgren, Britt; Wake, David A.; Quadri, Ryan F.

2013-01-01

We follow the structural evolution of star-forming galaxies (SFGs) like the Milky Way by selecting progenitors to z ∼ 1.3 based on the stellar mass growth inferred from the evolution of the star-forming sequence. We select our sample from the 3D-HST survey, which utilizes spectroscopy from the HST/WFC3 G141 near-IR grism and enables precise redshift measurements for our sample of SFGs. Structural properties are obtained from Sérsic profile fits to CANDELS WFC3 imaging. The progenitors of z = 0 SFGs with stellar mass M = 10 10.5 M ☉ are typically half as massive at z ∼ 1. This late-time stellar mass growth is consistent with recent studies that employ abundance matching techniques. The descendant SFGs at z ∼ 0 have grown in half-light radius by a factor of ∼1.4 since z ∼ 1. The half-light radius grows with stellar mass as r e ∝M 0.29 . While most of the stellar mass is clearly assembling at large radii, the mass surface density profiles reveal ongoing mass growth also in the central regions where bulges and pseudobulges are common features in present day late-type galaxies. Some portion of this growth in the central regions is due to star formation as recent observations of Hα maps for SFGs at z ∼ 1 are found to be extended but centrally peaked. Connecting our lookback study with galactic archeology, we find the stellar mass surface density at R = 8 kpc to have increased by a factor of ∼2 since z ∼ 1, in good agreement with measurements derived for the solar neighborhood of the Milky Way.

Roles of viroplasm-like structures formed by nonstructural protein NSs in infection with severe fever with thrombocytopenia syndrome virus.

Science.gov (United States)

Wu, Xiaodong; Qi, Xian; Liang, Mifang; Li, Chuan; Cardona, Carol J; Li, Dexin; Xing, Zheng

2014-06-01

Severe fever with thrombocytopenia syndrome (SFTS) virus is an emerging bunyavirus that causes a hemorrhagic fever with a high mortality rate. The virus is likely tick-borne and replicates primarily in hemopoietic cells, which may lead to disregulation of proinflammatory cytokine induction and loss of leukocytes and platelets. The viral genome contains L, M, and S segments encoding a viral RNA polymerase, glycoproteins G(n) and G(c), nucleoprotein (NP), and a nonstructural S segment (NSs) protein. NSs protein is involved in the regulation of host innate immune responses and suppression of IFNβ-promoter activities. In this article, we demonstrate that NSs protein can form viroplasm-like structures (VLSs) in infected and transfected cells. NSs protein molecules interact with one another, interact with NP, and were associated with viral RNA in infected cells, suggesting that NSs protein may be involved in viral replication. Furthermore, we observed that NSs-formed VLS colocalized with lipid droplets and that inhibitors of fatty acid biosynthesis decreased VLS formation or viral replication in transfected and infected cells. Finally, we have demonstrated that viral dsRNAs were also localized in VLS in infected cells, suggesting that NSs-formed VLS may be implicated in the replication of SFTS bunyavirus. These findings identify a novel function of nonstructural NSs in SFTSV-infected cells where it is a scaffolding component in a VLS functioning as a virus replication factory. This function is in addition to the role of NSs protein in modulating host responses that will broaden our understanding of viral pathogenesis of phleboviruses. © FASEB.

Modulation of intra- and inter-sheet interactions in short peptide self-assembly by acetonitrile in aqueous solution

International Nuclear Information System (INIS)

Deng Li; Zhao Yurong; Zhou Peng; Xu Hai; Wang Yanting

2016-01-01

Besides our previous experimental discovery (Zhao Y R, et al . 2015 Langmuir , 31, 12975) that acetonitrile (ACN) can tune the morphological features of nanostructures self-assembled by short peptides KIIIIK (KI4K) in aqueous solution, further experiments reported in this work demonstrate that ACN can also tune the mass of the self-assembled nanostructures. To understand the microscopic mechanism how ACN molecules interfere peptide self-assembly process, we conducted a series of molecular dynamics simulations on a monomer, a cross- β sheet structure, and a proto-fibril of KI4K in pure water, pure ACN, and ACN-water mixtures, respectively. The simulation results indicate that ACN enhances the intra-sheet interaction dominated by the hydrogen bonding (H-bonding) interactions between peptide backbones, but weakens the inter-sheet interaction dominated by the interactions between hydrophobic side chains. Through analyzing the correlations between different groups of solvent and peptides and the solvent behaviors around the proto-fibril, we have found that both the polar and nonpolar groups of ACN play significant roles in causing the opposite effects on intermolecular interactions among peptides. The weaker correlation of the polar group of ACN than water molecule with the peptide backbone enhances H-bonding interactions between peptides in the proto-fibril. The stronger correlation of the nonpolar group of ACN than water molecule with the peptide side chain leads to the accumulation of ACN molecules around the proto-fibril with their hydrophilic groups exposed to water, which in turn allows more water molecules close to the proto-fibril surface and weakens the inter-sheet interactions. The two opposite effects caused by ACN form a microscopic mechanism clearly explaining our experimental observations. (paper)

Crystal Structure of the Oligomeric Form of Lassa Virus Matrix Protein Z.

Science.gov (United States)

Hastie, Kathryn M; Zandonatti, Michelle; Liu, Tong; Li, Sheng; Woods, Virgil L; Saphire, Erica Ollmann

2016-05-01

The arenavirus matrix protein Z is highly multifunctional and occurs in both monomeric and oligomeric forms. The crystal structure of a dodecamer of Z from Lassa virus, presented here, illustrates a ring-like structure with a highly basic center. Mutagenesis demonstrates that the dimeric interface within the dodecamer and a Lys-Trp-Lys triad at the center of the ring are important for oligomerization. This structure provides an additional template to explore the many functions of Z. The arenavirus Lassa virus causes hundreds of thousands of infections each year, many of which develop into fatal hemorrhagic fever. The arenavirus matrix protein Z is multifunctional, with at least four distinct roles. Z exists in both monomeric and oligomeric forms, each of which likely serves a specific function in the viral life cycle. Here we present the dodecameric form of Lassa virus Z and demonstrate that Z forms a "wreath" with a highly basic center. This structure and that of monomeric Z now provide a pair of critical templates by which the multiple roles of Z in the viral life cycle may be interpreted. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

An entropic form for NLFP with coulombic-like potential

International Nuclear Information System (INIS)

Grassi, A.

2012-01-01

Here it is proposed a new entropy form for which it is possible to obtain a stationary solution of the Non-Linear Fokker–Planck equation (NLFP) with coulombic-like potentials. The general properties of this new entropy form are shown and the results are compared with those obtained by other entropy forms. Finally, the behavior of the stationary solution in presence of two point charges is also shown. -- Highlights: ► In this Letter we have proposed a new form of entropy. ► Starting from this new entropy form a Non-Linear Fokker–Planck equation has been derived. ► The stationary solution of the Non-Linear Fokker–Planck equation is obtained by using an external coulombic-like potential. ► A comparison with other forms of entropies has been proposed in the case of a single or two point charges.

A resource-based theory of market structure and organizational form

NARCIS (Netherlands)

van Witteloostuijn, A.; Boone, C.A.J.J.

We argue that combining the insights from both the industrial organization and organizational ecology perspectives is likely to produce value added. We develop a resource-based theory of market structure, where resources pertain to the environmental assets (together forming the resource space)

Cellular structure formed by ion-implantation-induced point defect

International Nuclear Information System (INIS)

Nitta, N.; Taniwaki, M.; Hayashi, Y.; Yoshiie, T.

2006-01-01

The authors have found that a cellular defect structure is formed on the surface of Sn + ion implanted GaSb at a low temperature and proposed its formation mechanism based on the movement of the induced point defects. This research was carried out in order to examine the validity of the mechanism by clarifying the effect of the mobility of the point defects on the defect formation. The defect structure on the GaSb surfaces implanted at cryogenic temperature and room temperature was investigated by scanning electron microscopy (SEM) and cross-sectional transmission electron microscopy (TEM) observation. In the sample implanted at room temperature, the sponge-like structure (a pileup of voids) was formed and the cellular structure, as observed at a low temperature, did not develop. This behavior was explained by the high mobility of the vacancies during implantation at room temperature, and the proposed idea that the defect formation process is dominated by the induced point defects was confirmed

Structure of a fibronectin type III-like module from Clostridium thermocellum

International Nuclear Information System (INIS)

Alahuhta, Markus; Xu, Qi; Brunecky, Roman; Adney, William S.; Ding, Shi-You; Himmel, Michael E.; Lunin, Vladimir V.

2010-01-01

The 1.6 Å resolution structure of a fibronectin type III-like module from Clostridium thermocellum with two molecules in the asymmetric unit is reported. The 1.6 Å resolution structure of a fibronectin type III-like module from Clostridium thermocellum with two molecules in the asymmetric unit is reported. The crystals used for data collection belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 35.43, b = 45.73, c = 107.72 Å, and the structure was refined to an R factor of 0.166. Structural comparisons found over 800 similar structures in the Protein Data Bank. The broad range of different proteins or protein domains with high structural similarity makes it especially demanding to classify these proteins. Previous studies of fibronectin type III-like modules have indicated that they might function as ligand-binding modules, as a compact form of peptide linkers or spacers between other domains, as cellulose-disrupting modules or as proteins that help large enzyme complexes remain soluble

Structural optimization of free-form reciprocal structures

DEFF Research Database (Denmark)

Parigi, Dario

2014-01-01

This paper presents an optimization algorithm for the design of structurally efficient free-form reciprocal structures. Because of the geometric complexity of reciprocal structures, only a few structural studies have been carried out so far, and we have a limited knowledge of the relation between...

Structural and sequence analysis of imelysin-like proteins implicated in bacterial iron uptake.

Directory of Open Access Journals (Sweden)

Qingping Xu

Full Text Available Imelysin-like proteins define a superfamily of bacterial proteins that are likely involved in iron uptake. Members of this superfamily were previously thought to be peptidases and were included in the MEROPS family M75. We determined the first crystal structures of two remotely related, imelysin-like proteins. The Psychrobacter arcticus structure was determined at 2.15 Å resolution and contains the canonical imelysin fold, while higher resolution structures from the gut bacteria Bacteroides ovatus, in two crystal forms (at 1.25 Å and 1.44 Å resolution, have a circularly permuted topology. Both structures are highly similar to each other despite low sequence similarity and circular permutation. The all-helical structure can be divided into two similar four-helix bundle domains. The overall structure and the GxHxxE motif region differ from known HxxE metallopeptidases, suggesting that imelysin-like proteins are not peptidases. A putative functional site is located at the domain interface. We have now organized the known homologous proteins into a superfamily, which can be separated into four families. These families share a similar functional site, but each has family-specific structural and sequence features. These results indicate that imelysin-like proteins have evolved from a common ancestor, and likely have a conserved function.

Crystal structure of the Rasputin NTF2-like domain from Drosophila melanogaster.

Science.gov (United States)

Vognsen, Tina; Kristensen, Ole

2012-03-30

The crystal structure of the NTF2-like domain of the Drosophila homolog of Ras GTPase SH3 Binding Protein (G3BP), Rasputin, was determined at 2.7Å resolution. The overall structure is highly similar to nuclear transport factor 2: It is a homodimer comprised of a β-sheet and three α-helices forming a cone-like shape. However, known binding sites for RanGDP and FxFG containing peptides show electrostatic and steric differences compared to nuclear transport factor 2. A HEPES molecule bound in the structure suggests a new, and possibly physiologically relevant, ligand binding site. Copyright © 2012 Elsevier Inc. All rights reserved.

Crystal structure of the Rasputin NTF2-like domain from Drosophila melanogaster

DEFF Research Database (Denmark)

Vognsen, Tina Reinholdt; Kristensen, Ole

2012-01-01

The crystal structure of the NTF2-like domain of the Drosophila homolog of Ras GTPase SH3 Binding Protein (G3BP), Rasputin, was determined at 2.7Å resolution. The overall structure is highly similar to nuclear transport factor 2: It is a homodimer comprised of a ß-sheet and three a-helices forming...

Crystal structure of the Rasputin NTF2-like domain from Drosophila melanogaster

International Nuclear Information System (INIS)

Vognsen, Tina; Kristensen, Ole

2012-01-01

Highlights: ► The crystal structure of the NTF2-like domain of Rasputin protein is presented. ► Differences to known ligand binding sites of nuclear transport factor 2 are discussed. ► A new ligand binding site for the Rasputin and G3BP proteins is proposed. -- Abstract: The crystal structure of the NTF2-like domain of the Drosophila homolog of Ras GTPase SH3 Binding Protein (G3BP), Rasputin, was determined at 2.7 Å resolution. The overall structure is highly similar to nuclear transport factor 2: It is a homodimer comprised of a β-sheet and three α-helices forming a cone-like shape. However, known binding sites for RanGDP and FxFG containing peptides show electrostatic and steric differences compared to nuclear transport factor 2. A HEPES molecule bound in the structure suggests a new, and possibly physiologically relevant, ligand binding site.

Structure of initial crystals formed during human amelogenesis

Science.gov (United States)

Cuisinier, F. J. G.; Voegel, J. C.; Yacaman, J.; Frank, R. M.

1992-02-01

X-ray diffraction analysis revealed only the existence of carbonated hydroxyapatite (c.HA) during amelogenesis, whereas conventional transmission electron microscopy investigations showed that developing enamel crystals have a ribbon-like habit. The described compositional changes could be an indication for the presence of minerals different from c.HA. However, the absence of identification of such a mineral shows the need of studies by high resolution electron microscopy (HREM) of initial formed human enamel crystals. We demonstrate the existence of two crystal families involved in the early stages of biomineralization: (a) nanometer-size particles which appeared as a precursor phase; (b) ribbon-like crystals, with a structure closely related to c.HA, which by a progressive thickening process tend to attain the mature enamel crystal habit.

Structure of the first representative of Pfam family PF04016 (DUF364) reveals enolase and Rossmann-like folds that combine to form a unique active site with a possible role in heavy-metal chelation

International Nuclear Information System (INIS)

Miller, Mitchell D.; Aravind, L.; Bakolitsa, Constantina; Rife, Christopher L.; Carlton, Dennis; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L.; Chiu, Hsiu-Ju; Clayton, Thomas; Deller, Marc C.; Duan, Lian; Feuerhelm, Julie; Grant, Joanna C.; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K.; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Kumar, Abhinav; Marciano, David; McMullan, Daniel; Morse, Andrew T.; Nigoghossian, Edward; Okach, Linda; Reyes, Ron; Bedem, Henry van den; Weekes, Dana; Xu, Qingping; Hodgson, Keith O.; Wooley, John; Elsliger, Marc-André; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.

2010-01-01

The crystal structure of the first representative of DUF364 family reveals a combination of enolase N-terminal-like and C-terminal Rossmann-like folds. Analysis of the interdomain cleft combined with sequence and genome context conservation among homologs, suggests a unique catalytic site likely involved in the synthesis of a flavin or pterin derivative. The crystal structure of Dhaf4260 from Desulfitobacterium hafniense DCB-2 was determined by single-wavelength anomalous diffraction (SAD) to a resolution of 2.01 Å using the semi-automated high-throughput pipeline of the Joint Center for Structural Genomics (JCSG) as part of the NIGMS Protein Structure Initiative (PSI). This protein structure is the first representative of the PF04016 (DUF364) Pfam family and reveals a novel combination of two well known domains (an enolase N-terminal-like fold followed by a Rossmann-like domain). Structural and bioinformatic analyses reveal partial similarities to Rossmann-like methyltransferases, with residues from the enolase-like fold combining to form a unique active site that is likely to be involved in the condensation or hydrolysis of molecules implicated in the synthesis of flavins, pterins or other siderophores. The genome context of Dhaf4260 and homologs additionally supports a role in heavy-metal chelation

Crystal structure of the Rasputin NTF2-like domain from Drosophila melanogaster

Energy Technology Data Exchange (ETDEWEB)

Vognsen, Tina, E-mail: tv@farma.ku.dk [Biostructural Research, Department of Drug Design and Pharmacology, Faculty of Health Sciences, University of Copenhagen, Universitetsparken 2, DK-2100 Copenhagen (Denmark); Kristensen, Ole, E-mail: ok@farma.ku.dk [Biostructural Research, Department of Drug Design and Pharmacology, Faculty of Health Sciences, University of Copenhagen, Universitetsparken 2, DK-2100 Copenhagen (Denmark)

2012-03-30

Highlights: Black-Right-Pointing-Pointer The crystal structure of the NTF2-like domain of Rasputin protein is presented. Black-Right-Pointing-Pointer Differences to known ligand binding sites of nuclear transport factor 2 are discussed. Black-Right-Pointing-Pointer A new ligand binding site for the Rasputin and G3BP proteins is proposed. -- Abstract: The crystal structure of the NTF2-like domain of the Drosophila homolog of Ras GTPase SH3 Binding Protein (G3BP), Rasputin, was determined at 2.7 A resolution. The overall structure is highly similar to nuclear transport factor 2: It is a homodimer comprised of a {beta}-sheet and three {alpha}-helices forming a cone-like shape. However, known binding sites for RanGDP and FxFG containing peptides show electrostatic and steric differences compared to nuclear transport factor 2. A HEPES molecule bound in the structure suggests a new, and possibly physiologically relevant, ligand binding site.

Reproducible and recyclable SERS substrates: Flower-like Ag structures with concave surfaces formed by electrodeposition

Science.gov (United States)

Bian, Juncao; Shu, Shiwei; Li, Jianfu; Huang, Chao; Li, Yang Yang; Zhang, Rui-Qin

2015-04-01

Direct synthesis of three-dimensional Ag structures on solid substrates for the purposes of producing reproducible and recyclable surface-enhanced Raman scattering (SERS) applications remains challenging. In this work, flower-like Ag structures with concave surfaces (FACS) were successfully electrodeposited onto ITO glass using the double-potentiostatic method. The FACS, with an enhancement factor of the order of 108, exhibited a SERS signal intensity 3.3 times stronger than that measured from Ag nanostructures without concave surfaces. A cleaning procedure involving lengthy immersion of the sample in ethanol and KNO3 was proposed to recycle the substrate and confirmed by using rhodamine 6G, adenine, and 4-aminothiophenol as target molecules. The findings can help to advance the practical applications of Ag nanostructure-based SERS substrates.

Structural Color Tuning: Mixing Melanin-Like Particles with Different Diameters to Create Neutral Colors.

Science.gov (United States)

Kawamura, Ayaka; Kohri, Michinari; Yoshioka, Shinya; Taniguchi, Tatsuo; Kishikawa, Keiki

2017-04-18

We present the ability to tune structural colors by mixing colloidal particles. To produce high-visibility structural colors, melanin-like core-shell particles composed of a polystyrene (PSt) core and a polydopamine (PDA) shell, were used as components. The results indicated that neutral structural colors could be successfully obtained by simply mixing two differently sized melanin-like PSt@PDA core-shell particles. In addition, the arrangements of the particles, which were important factors when forming structural colors, were investigated by mathematical processing using a 2D Fourier transform technique and Voronoi diagrams. These findings provide new insights for the development of structural color-based ink applications.

Structural and optical properties of ZnO rods hydrothermally formed on polyethersulfone substrates

Energy Technology Data Exchange (ETDEWEB)

Shin, Chang Mi; Jang, Jin Tak; Kim, Chang Yong; Ryu, Hyuk Hyun [Inje University, Gimhae (Korea, Republic of); Lee, Won Jae [Dong-Eui University, Busan (Korea, Republic of); Chang, Ji Ho [Korea Maritime University, Busan (Korea, Republic of); Son, Chang Sik [Silla University, Busan (Korea, Republic of); Choi, Hee Lack [Pukyong National University, Busan (Korea, Republic of)

2012-06-15

Various unique ZnO morphologies, such as cigar-like and belt-like structures and microrod and nanorod structures, were formed on flexible polyethersulfone (PES) substrates by using a low temperature hydrothermal route. The structural properties of ZnO depended highly on the precursor concentration. The effect of a thin ZnO seed layer deposited the on PES substrate by using atomic layer deposition on the structural and the optical properties of ZnO hydrothermally grown on the ZnO seed layer/PES substrates was studied. Field emission scanning electron microscopy (FE-SEM), X-ray diffraction (XRD), and photoluminescence (PL) measurements were employed to analyze the characteristics of hydrothermally-grown ZnO. The diameter of the ZnO nanorods grown on the ZnO seed layer/PES substrates increased with increasing precursor concentration from 0.025 to 0.125 M due to the Ostwald ripening process. ZnO hydrothermally-grown on the ZnO seed layer/PES substrates at a low precursor concentration showed better structural properties than ZnO formed without a seed layer. Well-formed ZnO nanorods deposited on the ZnO seed layer/PES substrates showed two PL peaks, one in the ultraviolet and the other in the visible region, whereas horizontally positioned ZnO formed on the PES substrate in the absence of a seed layer emitted only one broad PL peak in the violet region. The ZnO grown on PES substrates in this work can be used as high-quality transparent electrodes for solar cells fabricated on flexible substrates.

Structural and optical properties of ZnO rods hydrothermally formed on polyethersulfone substrates

International Nuclear Information System (INIS)

Shin, Chang Mi; Jang, Jin Tak; Kim, Chang Yong; Ryu, Hyuk Hyun; Lee, Won Jae; Chang, Ji Ho; Son, Chang Sik; Choi, Hee Lack

2012-01-01

Various unique ZnO morphologies, such as cigar-like and belt-like structures and microrod and nanorod structures, were formed on flexible polyethersulfone (PES) substrates by using a low temperature hydrothermal route. The structural properties of ZnO depended highly on the precursor concentration. The effect of a thin ZnO seed layer deposited the on PES substrate by using atomic layer deposition on the structural and the optical properties of ZnO hydrothermally grown on the ZnO seed layer/PES substrates was studied. Field emission scanning electron microscopy (FE-SEM), X-ray diffraction (XRD), and photoluminescence (PL) measurements were employed to analyze the characteristics of hydrothermally-grown ZnO. The diameter of the ZnO nanorods grown on the ZnO seed layer/PES substrates increased with increasing precursor concentration from 0.025 to 0.125 M due to the Ostwald ripening process. ZnO hydrothermally-grown on the ZnO seed layer/PES substrates at a low precursor concentration showed better structural properties than ZnO formed without a seed layer. Well-formed ZnO nanorods deposited on the ZnO seed layer/PES substrates showed two PL peaks, one in the ultraviolet and the other in the visible region, whereas horizontally positioned ZnO formed on the PES substrate in the absence of a seed layer emitted only one broad PL peak in the violet region. The ZnO grown on PES substrates in this work can be used as high-quality transparent electrodes for solar cells fabricated on flexible substrates.

Structural fingerprints and their evolution during oligomeric vs. oligomer-free amyloid fibril growth.

Science.gov (United States)

Foley, Joseph; Hill, Shannon E; Miti, Tatiana; Mulaj, Mentor; Ciesla, Marissa; Robeel, Rhonda; Persichilli, Christopher; Raynes, Rachel; Westerheide, Sandy; Muschol, Martin

2013-09-28

Deposits of fibrils formed by disease-specific proteins are the molecular hallmark of such diverse human disorders as Alzheimer's disease, type II diabetes, or rheumatoid arthritis. Amyloid fibril formation by structurally and functionally unrelated proteins exhibits many generic characteristics, most prominently the cross β-sheet structure of their mature fibrils. At the same time, amyloid formation tends to proceed along one of two separate assembly pathways yielding either stiff monomeric filaments or globular oligomers and curvilinear protofibrils. Given the focus on oligomers as major toxic species, the very existence of an oligomer-free assembly pathway is significant. Little is known, though, about the structure of the various intermediates emerging along different pathways and whether the pathways converge towards a common or distinct fibril structures. Using infrared spectroscopy we probed the structural evolution of intermediates and late-stage fibrils formed during in vitro lysozyme amyloid assembly along an oligomeric and oligomer-free pathway. Infrared spectroscopy confirmed that both pathways produced amyloid-specific β-sheet peaks, but at pathway-specific wavenumbers. We further found that the amyloid-specific dye thioflavin T responded to all intermediates along either pathway. The relative amplitudes of thioflavin T fluorescence responses displayed pathway-specific differences and could be utilized for monitoring the structural evolution of intermediates. Pathway-specific structural features obtained from infrared spectroscopy and Thioflavin T responses were identical for fibrils grown at highly acidic or at physiological pH values and showed no discernible effects of protein hydrolysis. Our results suggest that late-stage fibrils formed along either pathway are amyloidogenic in nature, but have distinguishable structural fingerprints. These pathway-specific fingerprints emerge during the earliest aggregation events and persist throughout the

Structural fingerprints and their evolution during oligomeric vs. oligomer-free amyloid fibril growth

Science.gov (United States)

Foley, Joseph; Hill, Shannon E.; Miti, Tatiana; Mulaj, Mentor; Ciesla, Marissa; Robeel, Rhonda; Persichilli, Christopher; Raynes, Rachel; Westerheide, Sandy; Muschol, Martin

2013-09-01

Deposits of fibrils formed by disease-specific proteins are the molecular hallmark of such diverse human disorders as Alzheimer's disease, type II diabetes, or rheumatoid arthritis. Amyloid fibril formation by structurally and functionally unrelated proteins exhibits many generic characteristics, most prominently the cross β-sheet structure of their mature fibrils. At the same time, amyloid formation tends to proceed along one of two separate assembly pathways yielding either stiff monomeric filaments or globular oligomers and curvilinear protofibrils. Given the focus on oligomers as major toxic species, the very existence of an oligomer-free assembly pathway is significant. Little is known, though, about the structure of the various intermediates emerging along different pathways and whether the pathways converge towards a common or distinct fibril structures. Using infrared spectroscopy we probed the structural evolution of intermediates and late-stage fibrils formed during in vitro lysozyme amyloid assembly along an oligomeric and oligomer-free pathway. Infrared spectroscopy confirmed that both pathways produced amyloid-specific β-sheet peaks, but at pathway-specific wavenumbers. We further found that the amyloid-specific dye thioflavin T responded to all intermediates along either pathway. The relative amplitudes of thioflavin T fluorescence responses displayed pathway-specific differences and could be utilized for monitoring the structural evolution of intermediates. Pathway-specific structural features obtained from infrared spectroscopy and Thioflavin T responses were identical for fibrils grown at highly acidic or at physiological pH values and showed no discernible effects of protein hydrolysis. Our results suggest that late-stage fibrils formed along either pathway are amyloidogenic in nature, but have distinguishable structural fingerprints. These pathway-specific fingerprints emerge during the earliest aggregation events and persist throughout the

STRUCTURES OF LOCAL GALAXIES COMPARED TO HIGH-REDSHIFT STAR-FORMING GALAXIES

International Nuclear Information System (INIS)

Petty, Sara M.; De Mello, DuIlia F.; Gallagher, John S.; Gardner, Jonathan P.; Lotz, Jennifer M.; Matt Mountain, C.; Smith, Linda J.

2009-01-01

The rest-frame far-ultraviolet morphologies of eight nearby interacting and starburst galaxies (Arp 269, M 82, Mrk 8, NGC 520, NGC 1068, NGC 3079, NGC 3310, and NGC 7673) are compared with 54 galaxies at z ∼ 1.5 and 46 galaxies at z ∼ 4 observed in the Great Observatories Origins Deep Survey (GOODS) taken with the Advanced Camera for Surveys onboard the Hubble Space Telescope. The nearby sample is artificially redshifted to z ∼ 1.5 and 4 by applying luminosity and size scaling. We compare the simulated galaxy morphologies to real z ∼ 1.5 and 4 UV-bright galaxy morphologies. We calculate the Gini coefficient (G), the second-order moment of the brightest 20% of the galaxy's flux (M 20 ), and the Sersic index (n). We explore the use of nonparametric methods with two-dimensional profile fitting and find the combination of M 20 with n an efficient method to classify galaxies as having merger, exponential disk, or bulge-like morphologies. When classified according to G and M 20 20/30% of real/simulated galaxies at z ∼ 1.5 and 37/12% at z ∼ 4 have bulge-like morphologies. The rest have merger-like or intermediate distributions. Alternatively, when classified according to the Sersic index, 70% of the z ∼ 1.5 and z ∼ 4 real galaxies are exponential disks or bulge-like with n>0.8, and ∼ 30% of the real galaxies are classified as mergers. The artificially redshifted galaxies have n values with ∼ 35% bulge or exponential at z ∼ 1.5 and 4. Therefore, ∼ 20%-30% of Lyman-break galaxies have structures similar to local starburst mergers, and may be driven by similar processes. We assume merger-like or clumpy star-forming galaxies in the GOODS field have morphological structure with values n 20 > - 1.7. We conclude that Mrk 8, NGC 3079, and NGC 7673 have structures similar to those of merger-like and clumpy star-forming galaxies observed at z ∼ 1.5 and 4.

Structure of filamin A immunoglobulin-like repeat 10 from Homo sapiens

International Nuclear Information System (INIS)

Page, Richard C.; Clark, Jeffrey G.; Misra, Saurav

2011-01-01

The structure of immunoglobulin-like repeat 10 from human filamin A solved at 2.44 Å resolution suggests the potential effects of mutations correlated with otopalatodigital syndrome spectrum disorders. Filamin A (FlnA) plays a critical role in cytoskeletal organization, cell motility and cellular signaling. FlnA utilizes different binding sites on a series of 24 immunoglobulin-like domains (Ig repeats) to interact with diverse cytosolic proteins and with cytoplasmic portions of membrane proteins. Mutations in a specific domain, Ig10 (FlnA-Ig10), are correlated with two severe forms of the otopalatodigital syndrome spectrum disorders Melnick–Needles syndrome and frontometaphyseal dysplasia. The crystal structure of FlnA-Ig10 determined at 2.44 Å resolution provides insight into the perturbations caused by these mutations

Feasibility studies of time-like proton electromagnetic form factors at PANDA-FAIR

Energy Technology Data Exchange (ETDEWEB)

Dbeyssi, Alaa; Capozza, Luigi; Deiseroth, Malte; Froehlich, Bertold; Khaneft, Dmitry; Mora Espi, Maria Carmen; Noll, Oliver; Rodriguez Pineiro, David; Valente, Roserio; Zambrana, Manuel; Zimmermann, Iris [Helmholtz-Institut Mainz, Mainz (Germany); Maas, Frank [Helmholtz-Institut Mainz, Mainz (Germany); Institute of Nuclear Physics, Mainz (Germany); PRISMA Cluster of Excellence, Mainz (Germany); Marchand, Dominique; Tomasi-Gustafsson, Egle; Wang, Ying [Institut de Physique Nucleaire, Orsay (France); Collaboration: PANDA-Collaboration

2015-07-01

Electromagnetic form factors are fundamental quantities which describe the intrinsic electric and magnetic distributions of hadrons. Time-like proton form factors are experimentally accessible through the annihilation processes anti p+p <-> e{sup +}+e{sup -}. Their measurement in the time-like region had been limited by the low statistics achieved by the experiments. This contribution reports on the results of Monte Carlo simulations for future measurements of electromagnetic proton form factors at PANDA (antiProton ANnihilation at DArmstadt). In frame of the PANDARoot software, the statistical precision at which the proton form factors will be determined is estimated. The signal (anti p+p → e{sup +}+e{sup -}) identification and the suppression of the main background process (anti p+p → π{sup +}+π{sup -}) are studied. Different methods have been used and/or developed to generate and analyse the processes of interest. The results show that time-like proton form factors will be measured at PANDA with unprecedented statistical accuracy.

Fragmentation of neck-like structures

International Nuclear Information System (INIS)

Montoya, C.; Bowman, D.R.; Peaslee, G.F.; Michigan State Univ., East Lansing, MI

1994-01-01

Evidence for intermediate mass fragment emission from neck-like structures joining projectile- and target-like residues has been observed for peripheral 129 Xe+ nat Cu collisions at E/A=50 MeV. These framents are emitted primarily at velocities intermediate between those of the projectile and the target. Relative to the charge distribution for fragments evaporated from the projectile-like residue, the distribution for ''neck'' emission shows an enhanced emission for fragments with 4 f < 8. (orig.)

Osteoblasts extracellular matrix induces vessel like structures through glycosylated collagen I

Energy Technology Data Exchange (ETDEWEB)

Palmieri, D. [Genetics, DIBIO, University of Genova, Corso Europa 26, 16132 Genova (Italy); Valli, M.; Viglio, S. [Department of Biochemistry, University of Pavia (Italy); Ferrari, N. [Istituto Nazionale per la ricerca sul Cancro, Genova (Italy); Ledda, B.; Volta, C. [Genetics, DIBIO, University of Genova, Corso Europa 26, 16132 Genova (Italy); Manduca, P., E-mail: man-via@unige.it [Genetics, DIBIO, University of Genova, Corso Europa 26, 16132 Genova (Italy)

2010-03-10

Extracellular matrix (ECM) plays a fundamental role in angiogenesis affecting endothelial cells proliferation, migration and differentiation. Vessels-like network formation in vitro is a reliable test to study the inductive effects of ECM on angiogenesis. Here we utilized matrix deposed by osteoblasts as substrate where the molecular and structural complexity of the endogenous ECM is preserved, to test if it induces vessel-like network formation by endothelial cells in vitro. ECM is more similar to the physiological substrate in vivo than other substrates previously utilized for these studies in vitro. Osteogenic ECM, prepared in vitro from mature osteoblasts at the phase of maximal deposition and glycosylation of collagen I, induces EAhy926, HUVEC, and HDMEC endothelial cells to form vessels-like structures and promotes the activation of metalloproteinase-2 (MMP-2); the functionality of the p-38/MAPK signaling pathway is required. Osteogenic ECM also induces a transient increase of CXCL12 and a decrease of the receptor CXCR4. The induction of vessel-like networks is dependent from proper glycosylation of collagens and does not occur on osteogenic ECMs if deglycosylated by -galactosidase or on less glycosylated ECMs derived from preosteoblasts and normal fibroblasts, while is sustained on ECM from osteogenesis imperfecta fibroblasts only when their mutation is associated with over-glycosylation of collagen type I. These data support that post-translational glycosylation has a role in the induction in endothelial cells in vitro of molecules conductive to self-organization in vessels-like structures.

Osteoblasts extracellular matrix induces vessel like structures through glycosylated collagen I

International Nuclear Information System (INIS)

Palmieri, D.; Valli, M.; Viglio, S.; Ferrari, N.; Ledda, B.; Volta, C.; Manduca, P.

2010-01-01

Extracellular matrix (ECM) plays a fundamental role in angiogenesis affecting endothelial cells proliferation, migration and differentiation. Vessels-like network formation in vitro is a reliable test to study the inductive effects of ECM on angiogenesis. Here we utilized matrix deposed by osteoblasts as substrate where the molecular and structural complexity of the endogenous ECM is preserved, to test if it induces vessel-like network formation by endothelial cells in vitro. ECM is more similar to the physiological substrate in vivo than other substrates previously utilized for these studies in vitro. Osteogenic ECM, prepared in vitro from mature osteoblasts at the phase of maximal deposition and glycosylation of collagen I, induces EAhy926, HUVEC, and HDMEC endothelial cells to form vessels-like structures and promotes the activation of metalloproteinase-2 (MMP-2); the functionality of the p-38/MAPK signaling pathway is required. Osteogenic ECM also induces a transient increase of CXCL12 and a decrease of the receptor CXCR4. The induction of vessel-like networks is dependent from proper glycosylation of collagens and does not occur on osteogenic ECMs if deglycosylated by -galactosidase or on less glycosylated ECMs derived from preosteoblasts and normal fibroblasts, while is sustained on ECM from osteogenesis imperfecta fibroblasts only when their mutation is associated with over-glycosylation of collagen type I. These data support that post-translational glycosylation has a role in the induction in endothelial cells in vitro of molecules conductive to self-organization in vessels-like structures.

MLKL forms disulfide bond-dependent amyloid-like polymers to induce necroptosis.

Science.gov (United States)

Liu, Shuzhen; Liu, Hua; Johnston, Andrea; Hanna-Addams, Sarah; Reynoso, Eduardo; Xiang, Yougui; Wang, Zhigao

2017-09-05

Mixed-lineage kinase domain-like protein (MLKL) is essential for TNF-α-induced necroptosis. How MLKL promotes cell death is still under debate. Here we report that MLKL forms SDS-resistant, disulfide bond-dependent polymers during necroptosis in both human and mouse cells. MLKL polymers are independent of receptor-interacting protein kinase 1 and 3 (RIPK1/RIPK3) fibers. Large MLKL polymers are more than 2 million Da and are resistant to proteinase K digestion. MLKL polymers are fibers 5 nm in diameter under electron microscopy. Furthermore, the recombinant N-terminal domain of MLKL forms amyloid-like fibers and binds Congo red dye. MLKL mutants that cannot form polymers also fail to induce necroptosis efficiently. Finally, the compound necrosulfonamide conjugates cysteine 86 of human MLKL and blocks MLKL polymer formation and subsequent cell death. These results demonstrate that disulfide bond-dependent, amyloid-like MLKL polymers are necessary and sufficient to induce necroptosis.

Novel Au- and Ge-based two-dimensional materials formed through topotactic transitions of AlB2-like structures

Science.gov (United States)

Tsetseris, Leonidas

2016-07-01

The topotactic reaction of a layered compound, for example CaGe2, with HCl solution is a common and facile method to produce two-dimensional (2D) materials. In this work we demonstrate with first-principles calculations that this technique can potentially lead to a whole new family of 2D materials starting from three-dimensional crystals with AlB2-like structures. As representative cases, we show here that the de-intercalation of Sc and Ca atoms from ScAuGe and Ca2AuGe3 crystals is strongly exothermic and produces the stable 2D monolayers AuGeH and AuGe3H3, respectively. Remarkably, both metals (AuGeH) and semiconductors (AuGe3H3) can be prepared by this method. Based on the broad availability of AlB2-like structures with varying stoichiometries, there are several possibilities to prepare novel functional 2D materials with suitable topotactic transitions.

Truncated forms of viral VP2 proteins fused to EGFP assemble into fluorescent parvovirus-like particles

Directory of Open Access Journals (Sweden)

Vuento Matti

2006-12-01

Full Text Available Abstract Fluorescence correlation spectroscopy (FCS monitors random movements of fluorescent molecules in solution, giving information about the number and the size of for example nano-particles. The canine parvovirus VP2 structural protein as well as N-terminal deletion mutants of VP2 (-14, -23, and -40 amino acids were fused to the C-terminus of the enhanced green fluorescent protein (EGFP. The proteins were produced in insect cells, purified, and analyzed by western blotting, confocal and electron microscopy as well as FCS. The non-truncated form, EGFP-VP2, diffused with a hydrodynamic radius of 17 nm, whereas the fluorescent mutants truncated by 14, 23 and 40 amino acids showed hydrodynamic radii of 7, 20 and 14 nm, respectively. These results show that the non-truncated EGFP-VP2 fusion protein and the EGFP-VP2 constructs truncated by 23 and by as much as 40 amino acids were able to form virus-like particles (VLPs. The fluorescent VLP, harbouring VP2 truncated by 23 amino acids, showed a somewhat larger hydrodynamic radius compared to the non-truncated EGFP-VP2. In contrast, the construct containing EGFP-VP2 truncated by 14 amino acids was not able to assemble into VLP-resembling structures. Formation of capsid structures was confirmed by confocal and electron microscopy. The number of fluorescent fusion protein molecules present within the different VLPs was determined by FCS. In conclusion, FCS provides a novel strategy to analyze virus assembly and gives valuable structural information for strategic development of parvovirus-like particles.

A measurement of the space-like pion electromagnetic form factor

International Nuclear Information System (INIS)

Amendolia, S.R.; Badelek, B.; Batignani, G.; Bedeschi, F.; Bertolucci, E.; Bettoni, D.; Bosisio, L.; Bradaschia, C.; Dell'Orso, M.; Fidecaro, F.; Foa, L.; Focardi, E.; Giazotto, A.; Giorgi, M.A.; Marrocchesi, P.S.; Menzione, A.; Ristori, L.; Scribano, A.; Tonelli, G.; Triggiani, G.; Codino, A.; Enorini, M.; Fabbri, F.L.; Laurelli, P.; Satta, L.; Spillantini, P.; Zallo, A.

1986-01-01

The pion form factor has been measured in the space-like q 2 region 0.014 to 0.26 (GeV/c) 2 by scattering 300 GeV pions from the electrons of a liquid hydrogen target. A detailed description is given of the apparatus, data analysis and corrections to the data. The mean square charge radius extracted from the data is model-dependent. We find that a form which includes a realistic description of the form factor phase gives a similar result to the naive pole form, and conclude π 2 >=0.439±0.008 fm 2 . (orig.)

Foam-like structure of the Universe

International Nuclear Information System (INIS)

Kirillov, A.A.; Turaev, D.

2007-01-01

On the quantum stage space-time had the foam-like structure. When the Universe cools, the foam structure tempers and does not disappear. We show that effects caused by the foamed structure mimic very well the observed Dark Matter phenomena. Moreover, we show that in a foamed space photons undergo a chaotic scattering and together with every discrete source of radiation we should observe a diffuse halo. We show that the distribution of the diffuse halo of radiation around a point-like source repeats exactly the distribution of dark matter around the same source, i.e., the DM halos are sources of the diffuse radiation

Foam-like structure of the Universe

Energy Technology Data Exchange (ETDEWEB)

Kirillov, A.A. [Institute for Applied Mathematics and Cybernetics, 10 Ulyanova str., Nizhny Novgorod 603005 (Russian Federation)], E-mail: ka98@mail.ru; Turaev, D. [Ben-Gurion University of the Negev, P.O.B. 653, Beer-Sheva 84105 (Israel)

2007-11-15

On the quantum stage space-time had the foam-like structure. When the Universe cools, the foam structure tempers and does not disappear. We show that effects caused by the foamed structure mimic very well the observed Dark Matter phenomena. Moreover, we show that in a foamed space photons undergo a chaotic scattering and together with every discrete source of radiation we should observe a diffuse halo. We show that the distribution of the diffuse halo of radiation around a point-like source repeats exactly the distribution of dark matter around the same source, i.e., the DM halos are sources of the diffuse radiation.

Amniotic band-like structures | Govender | Obstetrics and ...

African Journals Online (AJOL)

Intra-amniotic band-like structures are seen fairly commonly on routine obstetric scans, especially during the first and second trimesters of pregnancy. It is important to establish the cause for such findings in order to determine their clinical significance and to assess prognosis. The vast majority of band-like structures are ...

Towards Free-Form Kinetic Structures

DEFF Research Database (Denmark)

Parigi, Dario; Kirkegaard, Poul Henning

2012-01-01

of pin-slot paths starting from the local displacements of element [2] [3]. In the design of kinetic structures, in particular when complex three dimensional and non regular configurations are involved, the functionality is frequently related to a global displacement capability of the assembly rather...... for the generation of free-form kinetic structures....

Catanionic mixtures forming gemini-like amphiphiles.

Science.gov (United States)

Sakai, Hideki; Okabe, Yuji; Tsuchiya, Koji; Sakai, Kenichi; Abe, Masahiko

2011-01-01

The properties of aqueous mixtures of cationic species with alkyl dicarboxylic acid compounds have been studied. The cationic compounds used in this study were tertiary amine-type N-methyl-N-(2,3-dioxypropyl)hexadecylamine (C16amine) and quaternary ammonium-type N,N-dimethyl-N-(2,3-dioxypropyl)hexadecylammonium chloride (C16Q). The alkyl dicarboxylic acid compounds used were HOOC(CH(2))(10)COOH (C12H) and its sodium salt (C12Na). Three aqueous mixtures were examined in this study: (System I) C16amine + C12H, (System II) C16Q + C12Na, and (System III) C16Q + C12H. The solution pH was set at 12 for System III. The combination of (1)H-NMR and mass spectroscopy data has suggested that a stoichiometric complex is formed in the aqueous solutions at a mole fraction of C12H (or C12Na) = 0.33. Here, the C12H (or C12Na) molecule added to the system bridges two cationic molecules, like a spacer of gemini surfactants. In fact, the static surface tensiometry has demonstrated that the stoichiometric complex behaves as gemini-like amphiphiles in aqueous solutions. Our current study offers a possible way for easily preparing gemini surfactant systems.

Sulfolobus turreted icosahedral virus c92 protein responsible for the formation of pyramid-like cellular lysis structures.

Science.gov (United States)

Snyder, Jamie C; Brumfield, Susan K; Peng, Nan; She, Qunxin; Young, Mark J

2011-07-01

Host cells infected by Sulfolobus turreted icosahedral virus (STIV) have been shown to produce unusual pyramid-like structures on the cell surface. These structures represent a virus-induced lysis mechanism that is present in Archaea and appears to be distinct from the holin/endolysin system described for DNA bacteriophages. This study investigated the STIV gene products required for pyramid formation in its host Sulfolobus solfataricus. Overexpression of STIV open reading frame (ORF) c92 in S. solfataricus alone is sufficient to produce the pyramid-like lysis structures in cells. Gene disruption of c92 within STIV demonstrates that c92 is an essential protein for virus replication. Immunolocalization of c92 shows that the protein is localized to the cellular membranes forming the pyramid-like structures.

Clustered atom-replaced structure in single-crystal-like metal oxide

Science.gov (United States)

Araki, Takeshi; Hayashi, Mariko; Ishii, Hirotaka; Yokoe, Daisaku; Yoshida, Ryuji; Kato, Takeharu; Nishijima, Gen; Matsumoto, Akiyoshi

2018-06-01

By means of metal organic deposition using trifluoroacetates (TFA-MOD), we replaced and localized two or more atoms in a single-crystalline structure having almost perfect orientation. Thus, we created a new functional structure, namely, clustered atom-replaced structure (CARS), having single-crystal-like metal oxide. We replaced metals in the oxide with Sm and Lu and localized them. Energy dispersive x-ray spectroscopy results, where the Sm signal increases with the Lu signal in the single-crystalline structure, confirm evidence of CARS. We also form other CARS with three additional metals, including Pr. The valence number of Pr might change from 3+ to approximately 4+, thereby reducing the Pr–Ba distance. We directly observed the structure by a high-angle annular dark-field image, which provided further evidence of CARS. The key to establishing CARS is an equilibrium chemical reaction and a combination of additional larger and smaller unit cells to matrix cells. We made a new functional metal oxide with CARS and expect to realize CARS in other metal oxide structures in the future by using the above-mentioned process.

On the structure of path-like trees

OpenAIRE

Muntaner Batle, Francesc Antoni; Rius Font, Miquel

2007-01-01

We study the structure of path-like trees. In order to do this, we introduce a set of trees that we call expandable trees. In this paper we also generalize the concept of path-like trees and we call such generalization generalized path-like trees. As in the case of path-like trees, generalized path-like trees, have very nice labeling properties.

Cooperative structural transitions in amyloid-like aggregation

Science.gov (United States)

Steckmann, Timothy; Bhandari, Yuba R.; Chapagain, Prem P.; Gerstman, Bernard S.

2017-04-01

Amyloid fibril aggregation is associated with several horrific diseases such as Alzheimer's, Creutzfeld-Jacob, diabetes, Parkinson's, and others. Although proteins that undergo aggregation vary widely in their primary structure, they all produce a cross-β motif with the proteins in β-strand conformations perpendicular to the fibril axis. The process of amyloid aggregation involves forming myriad different metastable intermediate aggregates. To better understand the molecular basis of the protein structural transitions and aggregation, we report on molecular dynamics (MD) computational studies on the formation of amyloid protofibrillar structures in the small model protein ccβ, which undergoes many of the structural transitions of the larger, naturally occurring amyloid forming proteins. Two different structural transition processes involving hydrogen bonds are observed for aggregation into fibrils: the breaking of intrachain hydrogen bonds to allow β-hairpin proteins to straighten, and the subsequent formation of interchain H-bonds during aggregation into amyloid fibrils. For our MD simulations, we found that the temperature dependence of these two different structural transition processes results in the existence of a temperature window that the ccβ protein experiences during the process of forming protofibrillar structures. This temperature dependence allows us to investigate the dynamics on a molecular level. We report on the thermodynamics and cooperativity of the transformations. The structural transitions that occurred in a specific temperature window for ccβ in our investigations may also occur in other amyloid forming proteins but with biochemical parameters controlling the dynamics rather than temperature.

Measuring the Thermophysical and Structural Properties of Glass-Forming and Quasicrystal-Forming Liquids

Science.gov (United States)

Hyers, Robert W.; Bradshaw, Richard C.; Rogers, Jan R.; Gangopadhyay, Anup K.; Kelton, Ken F.

2006-01-01

The thermophysical properties of glass-forming and quasicrystal-forming alloys show many interesting features in the undercooled liquid range. Some of the features in the thermophysical property curves are expected to reflect changes in the structure and coordination of the liquid. These measurements require containerless processing such as electrostatic levitation to access the undercooled liquid regime. An overview of the state of the art in measuring the thermophysical properties and structure of undercooled liquid glass-forming and quasicrystal-forming alloys will be presented, along with the status of current measurements.

Sulfolobus Turreted Icosahedral Virus c92 Protein Responsible for the Formation of Pyramid-Like Cellular Lysis Structures

DEFF Research Database (Denmark)

Snyder, Jamie C; Brumfield, Susan K; Peng, Nan

2011-01-01

Host cells infected by Sulfolobus turreted icosahedral virus (STIV) have been shown to produce unusual pyramid-like structures on the cell surface. These structures represent a virus-induced lysis mechanism that is present in Archaea and appears to be distinct from the holin/endolysin system desc...... disruption of c92 within STIV demonstrates that c92 is an essential protein for virus replication. Immunolocalization of c92 shows that the protein is localized to the cellular membranes forming the pyramid-like structures.......Host cells infected by Sulfolobus turreted icosahedral virus (STIV) have been shown to produce unusual pyramid-like structures on the cell surface. These structures represent a virus-induced lysis mechanism that is present in Archaea and appears to be distinct from the holin/endolysin system...... described for DNA bacteriophages. This study investigated the STIV gene products required for pyramid formation in its host Sulfolobus solfataricus. Overexpression of STIV open reading frame (ORF) c92 in S. solfataricus alone is sufficient to produce the pyramid-like lysis structures in cells. Gene...

Helical self-organization and hierarchical self-assembly of an oligoheterocyclic pyridine-pyridazine strand into extended supramolecular fibers.

Science.gov (United States)

Cuccia, Louis A; Ruiz, Eliseo; Lehn, Jean-Marie; Homo, Jean-Claude; Schmutz, Marc

2002-08-02

The synthesis and characterization of an alternating pyridine-pyridazine strand comprising thirteen heterocycles are described. Spontaneous folding into a helical secondary structure is based on a general molecular self-organization process enforced by the conformational information encoded within the primary structure of the molecular strand itself. Conformational control based on heterocyclic "helicity codons" illustrates a strategy for designing folding properties into synthetic oligomers (foldamers). Strong intermolecular interactions of the highly ordered lock-washer subunits of compound 3 results in hierarchical supramolecular self-assembly into protofibrils and fibrils. Compound 3 also forms mechanically stable two-dimensional Langmuir-Blodgett and cast thin films.

Self-selection in size and structure in argon clusters formed on amorphous carbon

Energy Technology Data Exchange (ETDEWEB)

Krainyukova, Nina V.; Waal, Benjamin W. van de

2004-07-01

Argon clusters formed on an amorphous carbon substrate as deposited from the vapor phase were studied by means of transmission high energy electron diffraction using the liquid helium cryostat. Electron diffractograms were analysed on the basis of assumption that there exist a cluster size distribution in samples formed on substrate and multi-shell structures such as icosahedra, decahedra, fcc and hcp were probed for different sizes up to {approx}15 000 atoms. The experimental data were considered as a result of a superposition of diffracted intensities from clusters of different sizes and structures. The comparative analysis was based on the R-factor minimization that was found to be equal to 0.014 for the best fit between experiment and modelling. The total size and structure distribution function shows the presence of 'non-crystallographic' structures such as icosahedra and decahedra with five-fold symmetry that was found to prevail and a smaller amount of fcc and hcp structures. Possible growth mechanisms as well as observed general tendency to self-selection in sizes and structures are presumably governed by confined pore-like geometry in an amorphous carbon substrate.

Detection of amastigote-like forms in the valve of Phlebotomus papatasi infected with Leishmania major

Directory of Open Access Journals (Sweden)

Nestor Añez

2003-06-01

Full Text Available A massive and homogeneous amount of amastigote-like forms was detected in the stomodeal valve (SV and the thoracic mid-gut (TMG of Leishmania major-infected Phlebotomus papatasi, which received a second blood meal 13 to 21 days post-infection on healthy anaesthetized hamsters. After re-feeding, the infected sand flies were dissected out to examine the morphology of the parasite in SV, TMG and the abdominal mid-gut (AMG. Different promastigote forms were seen in the infected flies. Among these included typical promastigotes (nectomonads and haptomonads, paramastigotes, metacyclic promastigotes and, in some samples, the here-reported amastigote-like forms. The Leishmania amastigote-like forms were detected in the SV of sand flies with 14, 18 and 21 days of infection as well as in the TMG at 13 and 18 days post-infection. However, the amastigote-like forms were not detected in the AMG. Factors such as the acidic pH predominating the TMG and the SV, as well as the temperature of the ingested blood, among others, are suggested as contributing to the transformation of the typical promastigotes into the amastigote-like forms. The significance of this finding is discussed and the possible biological advantage for transmission of Leishmania is considered.

An ezrin-rich, rigid uropod-like structure directs movement of amoeboid blebbing cells.

Science.gov (United States)

Lorentzen, Anna; Bamber, Jeffrey; Sadok, Amine; Elson-Schwab, Ilan; Marshall, Christopher J

2011-04-15

Melanoma cells can switch between an elongated mesenchymal-type and a rounded amoeboid-type migration mode. The rounded 'amoeboid' form of cell movement is driven by actomyosin contractility resulting in membrane blebbing. Unlike elongated A375 melanoma cells, rounded A375 cells do not display any obvious morphological front-back polarisation, although polarisation is thought to be a prerequisite for cell movement. We show that blebbing A375 cells are polarised, with ezrin (a linker between the plasma membrane and actin cytoskeleton), F-actin, myosin light chain, plasma membrane, phosphatidylinositol (4,5)-bisphosphate and β1-integrin accumulating at the cell rear in a uropod-like structure. This structure does not have the typical protruding shape of classical leukocyte uropods, but, as for those structures, it is regulated by protein kinase C. We show that the ezrin-rich uropod-like structure (ERULS) is an inherent feature of polarised A375 cells and not a consequence of cell migration, and is necessary for cell invasion. Furthermore, we demonstrate that membrane blebbing is reduced at this site, leading to a model in which the rigid ezrin-containing structure determines the direction of a moving cell through localised inhibition of membrane blebbing.

Contribution of simple saccharides to the stabilization of amyloid structure

International Nuclear Information System (INIS)

Fung, Justin; Darabie, Audrey A.; McLaurin, JoAnne

2005-01-01

The use of osmolytes or chaperones to stabilize proteins/peptides that misfold in neurodegenerative diseases is an attractive concept for drug development. We have investigated the role of a series of small carbohydrates for protection of the natively structured Alzheimer's amyloid-β peptides (Aβ). Using circular dichroism spectroscopy to follow the β-structural transitions and electron microscopy to examine tertiary structural characteristics, we demonstrate that the hydrogen bonding capacity of the carbohydrate determines the inhibition or promotion of fibrillogenesis. Three sugar molecules that vary only in their distribution of potential H-bonding partners promote various structural changes in Aβ. Two of these sugar molecules are excluded from Aβ during aggregation and promote mature fibre growth, while the other binds Aβ promoting nucleation and the accumulation of protofibrils. Our studies suggest that utilization of a combinatorial strategy to alter H-bonding capacity across a simple carbohydrate molecule may represent a novel drug design strategy

Characterisation of a large family of polymorphic collagen-like proteins in the endospore-forming bacterium Pasteuria ramosa.

Science.gov (United States)

McElroy, Kerensa; Mouton, Laurence; Du Pasquier, Louis; Qi, Weihong; Ebert, Dieter

2011-09-01

Collagen-like proteins containing glycine-X-Y repeats have been identified in several pathogenic bacteria potentially involved in virulence. Recently, a collagen-like surface protein, Pcl1a, was identified in Pasteuria ramosa, a spore-forming parasite of Daphnia. Here we characterise 37 novel putative P. ramosa collagen-like protein genes (PCLs). PCR amplification and sequencing across 10 P. ramosa strains showed they were polymorphic, distinguishing genotypes matching known differences in Daphnia/P. ramosa interaction specificity. Thirty PCLs could be divided into four groups based on sequence similarity, conserved N- and C-terminal regions and G-X-Y repeat structure. Group 1, Group 2 and Group 3 PCLs formed triplets within the genome, with one member from each group represented in each triplet. Maximum-likelihood trees suggested that these groups arose through multiple instances of triplet duplication. For Group 1, 2, 3 and 4 PCLs, X was typically proline and Y typically threonine, consistent with other bacterial collagen-like proteins. The amino acid composition of Pcl2 closely resembled Pcl1a, with X typically being glutamic acid or aspartic acid and Y typically being lysine or glutamine. Pcl2 also showed sequence similarity to Pcl1a and contained a predicted signal peptide, cleavage site and transmembrane domain, suggesting that it is a surface protein. Copyright © 2011 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Structure formation in binary mixtures of surfactants: vesicle opening-up to bicelles and octopus-like micelles

Science.gov (United States)

Noguchi, Hiroshi

Micelle formation in binary mixtures of surfactants is studied using a coarse-grained molecular simulation. When a vesicle composed of lipid and detergent types of molecules is ruptured, a disk-shaped micelle, the bicelle, is typically formed. It is found that cup-shaped vesicles and bicelles connected with worm-like micelles are also formed depending on the surfactant ratio and critical micelle concentration. The obtained octopus shape of micelles agree with those observed in the cryo-TEM images reported in [S. Jain and F. S. Bates, Macromol. 37, 1511 (2004).]. Two types of connection structures between the worm-like micelles and the bicelles are revealed.

Turning behaviors of T cells climbing up ramp-like structures are regulated by myosin light chain kinase activity and lamellipodia formation.

Science.gov (United States)

Song, Kwang Hoon; Lee, Jaehyun; Jung, Hong-Ryul; Park, HyoungJun; Doh, Junsang

2017-09-14

T cells navigate diverse microenvironments to perform immune responses. Micro-scale topographical structures within the tissues, which may inherently exist in normal tissues or may be formed by inflammation or injury, can influence T cell migration, but how T cell migration is affected by such topographical structures have not been investigated. In this study, we fabricated ramp-like structures with a 5 μm height and various slopes, and observed T cells climbing up the ramp-like structures. T cells encountering the ramp-like structures exhibited MLC accumulation near head-tail junctions contacting the ramp-like structures, and made turns to the direction perpendicular to the ramp-like structures. Pharmacological study revealed that lamellipodia formation mediated by arp2/3 and contractility regulated by myosin light chain kinase (MLCK) were responsible for the intriguing turning behavior of T cells climbing the ramp-like structures. Arp2/3 or MLCK inhibition substantially reduced probability of T cells climbing sharp-edged ramp-like structures, indicating intriguing turning behavior of T cells mediated by lamellipodia formation and MLCK activity may be important for T cells to access inflamed or injured tissues with abrupt topographical changes.

From Theory to Experiment: Hadron Electromagnetic Form Factors in Space-like and Time-like Regions

International Nuclear Information System (INIS)

Tomasi-Gustafsson, E.; Gakh, G.I.; Rekalo, A.P.

2007-01-01

Hadron electromagnetic form factors contain information on the intrinsic structure of the hadrons. The pioneering work developed at the Kharkov Physical-Technical Institute in the 60's on the relation between the polarized cross section and the proton form factors triggered a number of experiments. Such experiments could be performed only recently due to the progress in accelerator and polarimetry techniques. The principle of these measurements is recalled and surprise and very precise results obtained on proton are presented. The actual status of nucleon electromagnetic form factors is reviewed, with special attention to the basic work done in Kharkov Physical-Technical Institute. This Paper is devoted to the memory of Prof. M.P. Rekalo

Magnetic alginate microfibers as scaffolding elements for the fabrication of microvascular-like structures.

Science.gov (United States)

Sun, Tao; Shi, Qing; Huang, Qiang; Wang, Huaping; Xiong, Xiaolu; Hu, Chengzhi; Fukuda, Toshio

2018-01-15

Traditional cell-encapsulating scaffolds may elicit adverse host responses and inhomogeneity in cellular distribution. Thus, fabrication techniques for cellular self-assembly with micro-scaffold incorporation have been used recently to generate toroidal cellular modules for the bottom-up construction of vascular-like structures. The micro-scaffolds show advantage in promoting tissue formation. However, owing to the lack of annular cell micro-scaffolds, it remains a challenge to engineer micro-scale toroidal cellular modules (micro-TCMs) to fabricate microvascular-like structures. Here, magnetic alginate microfibers (MAMs) are used as scaffolding elements, where a winding strategy enables them to be formed into micro-rings as annular cell micro-scaffolds. These micro-rings were investigated for NIH/3T3 fibroblast growth as a function of surface chemistry and MAM size. Afterwards, micro-TCMs were successfully fabricated with the formation of NIH/3T3 fibroblasts and extracellular matrix layers on the three-dimensional micro-ring surfaces. Simple non-contact magnetic assembly was used to stack the micro-TCMs along a micro-pillar, after which cell fusion rapidly connected the assembled micro-TCMs into a microvascular-like structure. Endothelial cells or drugs encapsulated in the MAMs could be included in the microvascular-like structures as in vitro cellular models for vascular tissue engineering, or as miniaturization platforms for pharmaceutical drug testing in the future. Magnetic alginate microfibers functioned as scaffolding elements for guiding cell growth in micro-scale toroidal cellular modules (micro-TCMs) and provided a magnetic functionality to the micro-TCMs for non-contact 3D assembly in external magnetic fields. By using the liquid/air interface, the non-contact spatial manipulation of the micro-TCMs in the liquid environment was performed with a cost-effective motorized electromagnetic needle. A new biofabrication paradigm of construct of microvascular-like

A Ribbon-like Structure in the Ejective Organelle of the Green Microalga Pyramimonas parkeae (Prasinophyceae) Consists of Core Histones and Polymers Containing N-acetyl-glucosamine.

Science.gov (United States)

Yamagishi, Takahiro; Kurihara, Akira; Kawai, Hiroshi

2015-11-01

The green microalga, Pyramimonas parkeae (Prasinophyceae) has an ejective organelle containing a coiled ribbon structure resembling the ejectisome in Cryptophyta. This structure is discharged from the cell by a stimulus and extends to form a tube-like structure, but the molecular components of the structure have not been identified. Tricine-SDS-PAGE analysis indicated that the ribbon-like structure of P. parkeae contains some proteins and low molecular acidic polymers. Edman degradation, LC/MS/MS analyses and immunological studies demonstrated that their proteins are core histones (H3, H2A, H2B and H4). In addition, monosaccharide composition analysis of the ribbon-like structures and degradation by lysozyme strongly indicated that the ribbon-like structure consist of β (1-4) linked polymers containing N-acetyl-glucosamine. Purified polymers and recombinant histones formed glob-like or filamentous structures. Therefore we conclude that the ribbon-like structure of P. parkeae mainly consists of a complex of core histones (H3, H2A, H2B and H4) and polymers containing N-acetyl-glucosamine, and suggest to name the ejective organelle in P. parkeae the "histrosome" to distinguish it from the ejectisome in Cryptophyta. Copyright © 2015 Elsevier GmbH. All rights reserved.

Structural properties of star-like dendrimers in solution

International Nuclear Information System (INIS)

Rathgeber, S.; Gast, A.P.; Hedrick, J.L.

2002-01-01

We measured the form factor of star-like poly-ε-caprolactone dendrimers under good solvent conditions with small-angle neutron scattering (SANS). The parameters varied in the experiment were the dendrimer generation g=1,2,3 and the number of segments between the branching units n=5,10,15,20. The results are discussed in the frame work of the Beaucage model from which we cannot only derive the radius of gyration R g of the dendrimers but also their fractal dimensions. Decreasing the number of spacer units between the branching points results in a strong stretching of the dendrons. The fractal dimension increases monotonically with increasing generation and spacer number between the limit expected for a low-functionality star P∼5/3 (loose, polymeric structure) and that expected for a high-functionality star P∼3 (compact shape). (orig.)

A possible form of the pion's structure function

International Nuclear Information System (INIS)

Long Ming; Huang Tao

1986-01-01

The pion's structure function behaviour is discussed by using the Fock state expansion of the hadronic wave function in QCD in this paper. As an example, we employ a model wave function of the Fock state in the light-cone and assume a Regge behaviour of a weight function for higher Fock states, and we get a possible form of the pion's structure function. This form is consistent with experimental data of the pion's structure function

FILAMENTARY STRUCTURE OF STAR-FORMING COMPLEXES

International Nuclear Information System (INIS)

Myers, Philip C.

2009-01-01

The nearest young stellar groups are associated with 'hubs' of column density exceeding 10 22 cm -2 , according to recent observations. These hubs radiate multiple 'filaments' of parsec length, having lower column density and fewer stars. Systems with many filaments tend to have parallel filaments with similar spacing. Such 'hub-filament structure' is associated with all of the nine young stellar groups within 300 pc, forming low-mass stars. Similar properties are seen in infrared dark clouds forming more massive stars. In a new model, an initial clump in a uniform medium is compressed into a self-gravitating, modulated layer. The outer layer resembles the modulated equilibrium of Schmid-Burgk with nearly parallel filaments. The filaments converge onto the compressed clump, which collapses to form stars with high efficiency. The initial medium and condensations have densities similar to those in nearby star-forming clouds and clumps. The predicted structures resemble observed hub-filament systems in their size, shape, and column density, and in the appearance of their filaments. These results suggest that HFS associated with young stellar groups may arise from compression of clumpy gas in molecular clouds.

Normal and reversed supramolecular chirality of insulin fibrils probed by vibrational circular dichroism at the protofilament level of fibril structure.

Science.gov (United States)

Kurouski, Dmitry; Dukor, Rina K; Lu, Xuefang; Nafie, Laurence A; Lednev, Igor K

2012-08-08

Fibrils are β-sheet-rich aggregates that are generally composed of several protofibrils and may adopt variable morphologies, such as twisted ribbons or flat-like sheets. This polymorphism is observed for many different amyloid associated proteins and polypeptides. In a previous study we proposed the existence of another level of amyloid polymorphism, namely, that associated with fibril supramolecular chirality. Two chiral polymorphs of insulin, which can be controllably grown by means of small pH variations, exhibit opposite signs of vibrational circular dichroism (VCD) spectra. Herein, using atomic force microscopy (AFM) and scanning electron microscopy (SEM), we demonstrate that indeed VCD supramolecular chirality is correlated not only by the apparent fibril handedness but also by the sense of supramolecular chirality from a deeper level of chiral organization at the protofilament level of fibril structure. Our microscopic examination indicates that normal VCD fibrils have a left-handed twist, whereas reversed VCD fibrils are flat-like aggregates with no obvious helical twist as imaged by atomic force microscopy or scanning electron microscopy. A scheme is proposed consistent with observed data that features a dynamic equilibrium controlled by pH at the protofilament level between left- and right-twist fibril structures with distinctly different aggregation pathways for left- and right-twisted protofilaments. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Somatic embryo-like structures of strawberry regenerated in vitro on media supplemented with 2,4-D and BAP.

Science.gov (United States)

Omar, Genesia F; Mohamed, Fouad H; Haensch, Klaus-Thomas; Sarg, Sawsan H; Morsey, Mohamed M

2013-09-01

Somatic embryo-like structures (SELS) were produced in vitro from leaf disk and petiole explants of two cultivars of strawberry (Fragaria x ananassa Duch) on Murashige and Skoog medium with different concentrations and combinations of 2,4-dichlorophenoxyacetic acid (2,4-D), 6-benzylaminopurine (BAP) and sucrose to check the embryonic nature of these structures histologically. A large number of SELS could be regenerated in both cultivars on media with 2-4 mg L(-1) 2,4-D in combination with 0.5 -1 mg L(-1) BAP and 50 g x L(-1) sucrose. Histological examination of SELS revealed the absence of a root pole. Therefore these structures cannot be strictly classified as somatic embryos. The SELS formed under the tested culture conditions represent malformed shoot-like and leaf-like structures. The importance of these results for the propagation of strawberries via somatic embryogenesis is discussed.

Oriented Attachment Is a Major Control Mechanism To Form Nail-like Mn-Doped ZnO Nanocrystals.

Science.gov (United States)

Patterson, Samuel; Arora, Priyanka; Price, Paige; Dittmar, Jasper W; Das, Vijay Kumar; Pink, Maren; Stein, Barry; Morgan, David Gene; Losovyj, Yaroslav; Koczkur, Kallum M; Skrabalak, Sara E; Bronstein, Lyudmila M

2017-12-26

Here, we present a controlled synthesis of Mn-doped ZnO nanoparticles (NPs) with predominantly nail-like shapes, whose formation occurs via tip-to-base-oriented attachment of initially formed nanopyramids, followed by leveling of sharp edges that lead to smooth single-crystalline "nails". This shape is prevalent in noncoordinating solvents such as octadecene and octadecane. Yet, the double bond in the former promotes oriented attachment. By contrast, Mn-doped ZnO NP synthesis in a weakly coordinating solvent, benzyl ether, results in dendritic structures because of random attachment of initial NPs. Mn-doped ZnO NPs possess a hexagonal wurtzite structure, and in the majority of cases, the NP surface is enriched with Mn, indicating a migration of Mn 2+ ions to the NP surface during the NP formation. When the NP formation is carried out without the addition of octadecyl alcohol, which serves as a surfactant and a reaction initiator, large, concave pyramid dimers are formed whose attachment takes place via basal planes. UV-vis and photoluminescence spectra of these NPs confirm the utility of controlling the NP shape to tune electro-optical properties.

Structure of a Berberine Bridge Enzyme-Like Enzyme with an Active Site Specific to the Plant Family Brassicaceae

DEFF Research Database (Denmark)

Daniel, Bastian; Wallner, Silvia; Steiner, Barbara

2016-01-01

Berberine bridge enzyme-like (BBE-like) proteins form a multigene family (pfam 08031), which is present in plants, fungi and bacteria. They adopt the vanillyl alcohol-oxidase fold and predominantly show bi-covalent tethering of the FAD cofactor to a cysteine and histidine residue, respectively....... The Arabidopsis thaliana genome was recently shown to contain genes coding for 28 BBE-like proteins, while featuring four distinct active site compositions. We determined the structure of a member of the AtBBE-like protein family (termed AtBBE-like 28), which has an active site composition that has not been...... be exploited for catalysis. The structure also indicates a shift of the position of the isoalloxazine ring in comparison to other members of the BBE-like family. The dioxygen surrogate chloride was found near the C(4a) position of the isoalloxazine ring in the oxygen pocket, pointing to a rapid reoxidation...

Transparent form-active system with structural glass

NARCIS (Netherlands)

Nikolaou, M.S.N.; Veer, F.A.; Eigenraam, P.

2015-01-01

Free-form transparent wide-span spatial structures which have being constructed so far, are based on the concept of three sets of components, the structural components, usually steel elements to ensure both compressive and tensional capacity; the glass cladding elements for expressing transparency;

Structure and properties of phosphorene-like IV-VI 2D materials.

Science.gov (United States)

Ma, Zhinan; Wang, Bo; Ou, Liangkai; Zhang, Yan; Zhang, Xu; Zhou, Zhen

2016-10-14

Because of the excellent physical and chemical properties of phosphorene, phosphorene and phosphorene-like materials have attracted extensive attention. Since phosphorus belongs to group V, some group IV-VI compounds could also form phosphorene-like configurations. In this work, GeO, SnO, GeS, and SnS monolayers were constructed to investigate the structural and electronic properties by employing first-principles computations. Phonon spectra suggest that these monolayers are dynamically stable and could be realized in experiments. These monolayers are all semiconductors with the band gaps of 2.26 ∼ 4.13 eV. Based on the monolayers, GeO, SnO, GeS, and SnS bilayers were also constructed. The band gaps of these bilayers are smaller than those of the corresponding monolayers. Moreover, the optical properties of these monolayers and bilayers were calculated, and the results indicate that the SnO, GeS and SnS bilayers exhibit obvious optical absorption in the visible spectrum. All the results suggest that phosphorene-like IV-VI materials are promising candidates for electronic and optical devices.

Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter

Directory of Open Access Journals (Sweden)

Yee Hooi Min

2016-01-01

Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.

Genetic engineering combined with deep UV resonance Raman spectroscopy for structural characterization of amyloid-like fibrils.

Science.gov (United States)

Sikirzhytski, Vitali; Topilina, Natalya I; Higashiya, Seiichiro; Welch, John T; Lednev, Igor K

2008-05-07

Elucidating the structure of the cross-beta core in large amyloid fibrils is a challenging problem in modern structural biology. For the first time, a set of de novo polypeptides was genetically engineered to form amyloid-like fibrils with similar morphology and yet different strand length. Differential ultraviolet Raman spectroscopy allowed for separation of the spectroscopic signatures of the highly ordered beta-sheet strands and turns of the fibril core. The relationship between Raman frequencies and Ramachandran dihedral angles of the polypeptide backbone indicates the nature of the beta-sheet and turn structural elements.

Dynamic stabilities of icosahedral-like clusters and their ability to form quasicrystals

Energy Technology Data Exchange (ETDEWEB)

Liang, Xiaogang; Hamid, Ilyar; Duan, Haiming, E-mail: dhm@xju.edu.cn [College of Physics Science and Technology. Xinjiang University, Urumqi 830046 (China)

2016-06-15

The dynamic stabilities of the icosahedral-like clusters containing up to 2200 atoms are investigated for 15 metal elements. The clusters originate from five different initial structures (icosahedron, truncated decahedron, octahedron, closed-shell fragment of an HCP structure, and non-closed-shell fragment of an HCP structure). The obtained order of the dynamic stabilities of the icosahedral-like clusters can be assigned to three groups, from stronger to weaker, according to the size ranges involved: (Zr, Al, Ti) > (Cu, Fe, Co, Ni, Mg, Ag) > (Pb, Au, Pd, Pt, Rh, Ir), which correspond to the predicted formation ability of the quasicrystals. The differences of the sequences can be explained by analyzing the parameters of the Gupta-type many-body inter-atomic potentials.

In vitro assembly of a prohead-like structure of the Rhodobacter capsulatus gene transfer agent

International Nuclear Information System (INIS)

Spano, Anthony J.; Chen, Frank S.; Goodman, Benjamin E.; Sabat, Agnes E.; Simon, Martha N.; Wall, Joseph S.; Correia, John J.; McIvor, Wilson; Newcomb, William W.; Brown, Jay C.; Schnur, Joel M.; Lebedev, Nikolai

2007-01-01

The gene transfer agent (GTA) is a phage-like particle capable of exchanging double-stranded DNA fragments between cells of the photosynthetic bacterium Rhodobacter capsulatus. Here we show that the major capsid protein of GTA, expressed in E. coli, can be assembled into prohead-like structures in the presence of calcium ions in vitro. Transmission electron microscopy (TEM) of uranyl acetate staining material and thin sections of glutaraldehyde-fixed material demonstrates that these associates have spherical structures with diameters in the range of 27-35 nm. The analysis of scanning TEM images revealed particles of mass ∼ 4.3 MDa, representing 101 ± 11 copies of the monomeric subunit. The establishment of this simple and rapid method to form prohead-like particles permits the GTA system to be used for genome manipulation within the photosynthetic bacterium, for specific targeted drug delivery, and for the construction of biologically based distributed autonomous sensors for environmental monitoring

Nuclear Pore-Like Structures in a Compartmentalized Bacterium.

Directory of Open Access Journals (Sweden)

Evgeny Sagulenko

Full Text Available Planctomycetes are distinguished from other Bacteria by compartmentalization of cells via internal membranes, interpretation of which has been subject to recent debate regarding potential relations to Gram-negative cell structure. In our interpretation of the available data, the planctomycete Gemmata obscuriglobus contains a nuclear body compartment, and thus possesses a type of cell organization with parallels to the eukaryote nucleus. Here we show that pore-like structures occur in internal membranes of G.obscuriglobus and that they have elements structurally similar to eukaryote nuclear pores, including a basket, ring-spoke structure, and eight-fold rotational symmetry. Bioinformatic analysis of proteomic data reveals that some of the G. obscuriglobus proteins associated with pore-containing membranes possess structural domains found in eukaryote nuclear pore complexes. Moreover, immunogold labelling demonstrates localization of one such protein, containing a β-propeller domain, specifically to the G. obscuriglobus pore-like structures. Finding bacterial pores within internal cell membranes and with structural similarities to eukaryote nuclear pore complexes raises the dual possibilities of either hitherto undetected homology or stunning evolutionary convergence.

Nonuniform Internal Structure of Fibrin Fibers: Protein Density and Bond Density Strongly Decrease with Increasing Diameter

Directory of Open Access Journals (Sweden)

Wei Li

2017-01-01

Full Text Available The major structural component of a blood clot is a meshwork of fibrin fibers. It has long been thought that the internal structure of fibrin fibers is homogeneous; that is, the protein density and the bond density between protofibrils are uniform and do not depend on fiber diameter. We performed experiments to investigate the internal structure of fibrin fibers. We formed fibrin fibers with fluorescently labeled fibrinogen and determined the light intensity of a fiber, I, as a function of fiber diameter, D. The intensity and, thus, the total number of fibrin molecules in a cross-section scaled as D1.4. This means that the protein density (fibrin per cross-sectional area, ρp, is not homogeneous but instead strongly decreases with fiber diameter as D-0.6. Thinner fibers are denser than thicker fibers. We also determined Young’s modulus, Y, as a function of fiber diameter. Y decreased strongly with increasing D; Y scaled as D-1.5. This implies that the bond density, ρb, also scales as D-1.5. Thinner fibers are stiffer than thicker fibers. Our data suggest that fibrin fibers have a dense, well-connected core and a sparse, loosely connected periphery. In contrast, electrospun fibrinogen fibers, used as a control, have a homogeneous cross-section.

Nanodiamond particles forming photonic structures

International Nuclear Information System (INIS)

Grichko, Varvara; Tyler, Talmage; Grishko, Victor I; Shenderova, Olga

2008-01-01

Colloid suspensions of irregularly shaped, highly charged detonation nanodiamond particles are found to have unexpected optical properties, similar to those of photonic crystals. This finding is all the more surprising since the particles used in this work are far more polydisperse than those typically forming photonic crystals. Intensely iridescent structures have been fabricated using the centrifugation of aqueous suspensions of nanodiamonds

Nanodiamond particles forming photonic structures

Energy Technology Data Exchange (ETDEWEB)

Grichko, Varvara; Tyler, Talmage; Grishko, Victor I; Shenderova, Olga [International Technology Center, 8100 Brownleigh Drive, Suite 120, Raleigh, NC 27617 (United States)], E-mail: oshenderova@itc-inc.org

2008-06-04

Colloid suspensions of irregularly shaped, highly charged detonation nanodiamond particles are found to have unexpected optical properties, similar to those of photonic crystals. This finding is all the more surprising since the particles used in this work are far more polydisperse than those typically forming photonic crystals. Intensely iridescent structures have been fabricated using the centrifugation of aqueous suspensions of nanodiamonds.

Structural Origin of the Enhanced Glass-Forming Ability Induced by Microalloying Y in the ZrCuAl Alloy

Directory of Open Access Journals (Sweden)

Gu-Qing Guo

2016-03-01

Full Text Available In this work, the structural origin of the enhanced glass-forming ability induced by microalloying Y in a ZrCuAl multicomponent system is studied by performing synchrotron radiation experiments combined with simulations. It is revealed that the addition of Y leads to the optimization of local structures, including: (1 more Zr-centered and Y-centered icosahedral-like clusters occur in the microstructure; (2 the atomic packing efficiency inside clusters and the regularity of clusters are both enhanced. These structural optimizations help to stabilize the amorphous structure in the ZrCuAlY system, and lead to a high glass-forming ability (GFA. The present work provides an understanding of GFAs in multicomponent alloys and will shed light on the development of more metallic glasses with high GFAs.

Structural, optical and photocatalytic properties of flower-like ZnO nanostructures prepared by a facile wet chemical method

Directory of Open Access Journals (Sweden)

Sini Kuriakose

2013-11-01

Full Text Available Flower-like ZnO nanostructures were synthesized by a facile wet chemical method. Structural, optical and photocatalytic properties of these nanostructures have been studied by X-ray diffraction (XRD, scanning electron microscopy (SEM, transmission electron microscopy (TEM, photoluminescence (PL and UV–vis absorption spectroscopy. SEM and TEM studies revealed flower-like structures consisting of nanosheets, formed due to oriented attachment of ZnO nanoparticles. Flower-like ZnO structures showed enhanced photocatalytic activity towards sun-light driven photodegradation of methylene blue dye (MB as compared to ZnO nanoparticles. XRD, UV–vis absorption, PL, FTIR and TEM studies revealed the formation of Zn(OH2 surface layer on ZnO nanostructures upon ageing. We demonstrate that the formation of a passivating Zn(OH2 surface layer on the ZnO nanostructures upon ageing deteriorates their efficiency to photocatalytically degrade of MB.

Blue-emitting photoluminescence of rod-like and needle-like ZnO nanostructures formed by hot-water treatment of sol–gel derived coatings

Energy Technology Data Exchange (ETDEWEB)

Tan, Wai Kian, E-mail: tanwaikian@cie.ignite.tut.ac.jp [Center for International Education, Toyohashi University of Technology, Aichi, Toyohashi 441-8580 (Japan); Kawamura, Go; Muto, Hiroyuki [Department of Electrical and Electronic Information Engineering, Toyohashi University of Technology, Aichi, Toyohashi 441-8580 (Japan); Abdul Razak, Khairunisak; Lockman, Zainovia [School of Materials and Mineral Resources, Universiti Sains Malaysia, Engineering Campus, Nibong Tebal, Pulau Pinang 14300 Malaysia (Malaysia); Matsuda, Atsunori, E-mail: matsuda@tut.ee.ac.jp [Center for International Education, Toyohashi University of Technology, Aichi, Toyohashi 441-8580 (Japan); Department of Electrical and Electronic Information Engineering, Toyohashi University of Technology, Aichi, Toyohashi 441-8580 (Japan)

2015-02-15

The morphological evolution of the zinc oxide (ZnO) nanostructures generated by hot-water treatment (HWT) of sol–gel derived coatings as a function of temperature from 30 to 90 °C was investigated. With increasing HWT temperature, the ZnO crystals evolved from nanoparticles to rod-like and needle-like nanostructures. High-resolution transmission electron microscope observations of rod-like and needle-like nanostructures generated at 60 and 90 °C indicated single crystal ZnO wurtzite structure was obtained. All the hot-water treated samples exhibited blue emission at approximately 440 nm in room temperature. The intensity of blue emission increased with higher HWT temperatures. The unique photoluminescence emission characteristic remained even after heat-treatment at 400 °C for 1 h. As the emission peak obtained in our work is approximately 440 nm (2.82 eV), the emission peak is corresponding to the electron transition from the interstitial Zn to the top of valence band. This facile formation of blue-emitting ZnO nanostructures at low-temperature can be utilized on substrate with low thermal stability for optoelectronic applications such as light emitting devices and biological fluorescence labeling. - Highlights: • Facile and novel formation of ZnO nanostructures by low temperature hot-water treatment. • No catalyst or inhibitor is used. • Evolution of ZnO nanostructures formation as a function of temperature is reported. • Dominant blue emissions are observed from the as-formed and annealed ZnO films. • Ultraviolet and visible emissions are observed for hot-water treated films.

Vibration-based localisation of structural deterioration in frame-like civil engineering structures

DEFF Research Database (Denmark)

Ulriksen, Martin Dalgaard; Damkilde, Lars

2016-01-01

With the existing trend of minimising material use in typical frame-like civil engineering structures, such as buildings, bridges, and offshore platforms, these structures will typically be subjected to substantial wind induced vibrations. Besides being a source of disturbance for the occupants...

Sjögren's syndrome-associated myositis with germinal centre-like structures.

Science.gov (United States)

Espitia-Thibault, Alexandra; Masseau, Agathe; Néel, Antoine; Espitia, Olivier; Toquet, Claire; Mussini, Jean-Marie; Hamidou, Mohamed

2017-02-01

Muscular impairment is a rare systemic manifestation of SS that is rarely described in the literature and classically non-specific, both clinically and histologically. We reviewed the cases of 4 patients with primary SS presenting with myositis and a common histologic pattern on muscular biopsy with germinal centre-like structures resembling that which occurs in salivary glands. We analysed the data files of patients with SS who had muscular manifestations and underwent a muscular biopsy. Among 23 patients with SS who had muscle biopsies, 13 had non-specific myositis and 10 (4 primary and 6 secondary SS) had a common histologic pattern consisting of germinal centre-like structures. We analysed the data files of the 4 patients with primary SS presenting with myositis with muscular germinal-centre like structures. The 4 patients had an unspecific clinical presentation, with myalgias, muscular weakness and normal or elevated values of CPK. In the four patients, SS-associated myositis had common histologic characteristics, with endomysial and perimysial inflammatory infiltrate. The cellular infiltrate was composed predominantly of CD4+ T lymphocytes and B lymphocytes. The B and T CD4+ cells infiltrates may gather into masses, even forming lymphoid follicles. Three patients were treated with corticosteroids and/or hydroxychloroquine with improvement of myositis and 1 patient was lost to follow-up. We describe four patients with a common histologic appearance of myositis with lymphoid follicles associated with primary SS. The clinical presentation was non-specific and non-severe, with favorable outcome with corticosteroids and/or hydroxycholoroquine. The discovery of this particular histologic appearance in a muscle biopsy independent of the final diagnosis should indicate the possibility of SS. Copyright © 2016 Elsevier B.V. All rights reserved.

A test of the Veneziano - like πNN form factor

International Nuclear Information System (INIS)

Cass, A.; Mckellar, H.J.

1978-01-01

Dominguez' Veneziano-like πNN form factor has been investigated by attempting to use it to fit dsigma/dt data for np → pn and (antiproton)p → (antineutron)n at 8 GeV/c and 23.5 GeV/c in the interval 0 2 . With n=5/2 as proposed by Dominguez it is not possible to fit the data. A fit can be obtaine for other values of n

Combustible structural composites and methods of forming combustible structural composites

Science.gov (United States)

Daniels, Michael A.; Heaps, Ronald J.; Steffler, Eric D.; Swank, W. David

2013-04-02

Combustible structural composites and methods of forming same are disclosed. In an embodiment, a combustible structural composite includes combustible material comprising a fuel metal and a metal oxide. The fuel metal is present in the combustible material at a weight ratio from 1:9 to 1:1 of the fuel metal to the metal oxide. The fuel metal and the metal oxide are capable of exothermically reacting upon application of energy at or above a threshold value to support self-sustaining combustion of the combustible material within the combustible structural composite. Structural-reinforcing fibers are present in the composite at a weight ratio from 1:20 to 10:1 of the structural-reinforcing fibers to the combustible material. Other embodiments and aspects are disclosed.

Magnetic topology of Co-based inverse opal-like structures

OpenAIRE

Grigoryeva, N.A.; Mistonov, A.A.; Napolskii, K.S.; Sapoletova, N.A.; Eliseev, A.A.; Bouwman, W.; Byelov, D.; Petukhov, A.V.; Chernyshov, D.Y.; Eckerlebe, H.; Vasilieva, A.V.; Grigoriev, S.V.

2011-01-01

The magnetic and structural properties of a cobalt inverse opal-like crystal have been studied by a combination of complementary techniques ranging from polarized neutron scattering and superconducting quantum interference device (SQUID) magnetometry to x-ray diffraction. Microradian small-angle x-ray diffraction shows that the inverse opal-like structure (OLS) synthesized by the electrochemical method fully duplicates the three-dimensional net of voids of the template artificial opal. The in...

Structural basis of the interaction of MbtH-like proteins, putative regulators of nonribosomal peptide biosynthesis, with adenylating enzymes.

Science.gov (United States)

Herbst, Dominik A; Boll, Björn; Zocher, Georg; Stehle, Thilo; Heide, Lutz

2013-01-18

The biosynthesis of nonribosomally formed peptides (NRPs), which include important antibiotics such as vancomycin, requires the activation of amino acids through adenylate formation. The biosynthetic gene clusters of NRPs frequently contain genes for small, so-called MbtH-like proteins. Recently, it was discovered that these MbtH-like proteins are required for some of the adenylation reactions in NRP biosynthesis, but the mechanism of their interaction with the adenylating enzymes has remained unknown. In this study, we determined the structure of SlgN1, a 3-methylaspartate-adenylating enzyme involved in the biosynthesis of the hybrid polyketide/NRP antibiotic streptolydigin. SlgN1 contains an MbtH-like domain at its N terminus, and our analysis defines the parameters required for an interaction between MbtH-like domains and an adenylating enzyme. Highly conserved tryptophan residues of the MbtH-like domain critically contribute to this interaction. Trp-25 and Trp-35 form a cleft on the surface of the MbtH-like domain, which accommodates the alanine side chain of Ala-433 of the adenylating domain. Mutation of Ala-433 to glutamate abolished the activity of SlgN1. Mutation of Ser-23 of the MbtH-like domain to tyrosine resulted in strongly reduced activity. However, the activity of this S23Y mutant could be completely restored by addition of the intact MbtH-like protein CloY from another organism. This suggests that the interface found in the structure of SlgN1 is the genuine interface between MbtH-like proteins and adenylating enzymes.

On some hypersurfaces with time like normal bundle in pseudo Riemannian space forms

International Nuclear Information System (INIS)

Kashani, S.M.B.

1995-12-01

In this work we classify immersed hypersurfaces with constant sectional curvature in pseudo Riemannian space forms if the normal bundle is time like and the mean curvature is constant. (author). 9 refs

Structural information theory and visual form

NARCIS (Netherlands)

Leeuwenberg, E.L.J.; Kaernbach, C.; Schroeger, E.; Mueller, H.

2003-01-01

The paper attends to basic characteristics of visual form as approached by Structural information theory, or SIT, (Leeuwenberg, Van der Helm and Van Lier). The introduction provides a global survey of this approach. The main part of the paper focuses on three characteristics of SIT. Each one is made

Plasma spraying method for forming diamond and diamond-like coatings

Science.gov (United States)

Holcombe, Cressie E.; Seals, Roland D.; Price, R. Eugene

1997-01-01

A method and composition for the deposition of a thick layer (10) of diamond or diamond-like material. The method includes high temperature processing wherein a selected composition (12) including at least glassy carbon is heated in a direct current plasma arc device to a selected temperature above the softening point, in an inert atmosphere, and is propelled to quickly quenched on a selected substrate (20). The softened or molten composition (18) crystallizes on the substrate (20) to form a thick deposition layer (10) comprising at least a diamond or diamond-like material. The selected composition (12) includes at least glassy carbon as a primary constituent (14) and may include at least one secondary constituent (16). Preferably, the secondary constituents (16) are selected from the group consisting of at least diamond powder, boron carbide (B.sub.4 C) powder and mixtures thereof.

Exploratory Topology Modelling of Form-Active Hybrid Structures

DEFF Research Database (Denmark)

Holden Deleuran, Anders; Pauly, Mark; Tamke, Martin

2016-01-01

The development of novel form-active hybrid structures (FAHS) is impeded by a lack of modelling tools that allow for exploratory topology modelling of shaped assemblies. We present a flexible and real-time computational design modelling pipeline developed for the exploratory modelling of FAHS...... that enables designers and engineers to iteratively construct and manipulate form-active hybrid assembly topology on the fly. The pipeline implements Kangaroo2's projection-based methods for modelling hybrid structures consisting of slender beams and cable networks. A selection of design modelling sketches...

Nanogrids and Beehive-Like Nanostructures Formed by Plasma Etching the Self-Organized SiGe Islands

Science.gov (United States)

Chang, Yuan-Ming; Jian, Sheng-Rui; Juang, Jenh-Yih

2010-09-01

A lithography-free method for fabricating the nanogrids and quasi-beehive nanostructures on Si substrates is developed. It combines sequential treatments of thermal annealing with reactive ion etching (RIE) on SiGe thin films grown on (100)-Si substrates. The SiGe thin films deposited by ultrahigh vacuum chemical vapor deposition form self-assembled nanoislands via the strain-induced surface roughening (Asaro-Tiller-Grinfeld instability) during thermal annealing, which, in turn, serve as patterned sacrifice regions for subsequent RIE process carried out for fabricating nanogrids and beehive-like nanostructures on Si substrates. The scanning electron microscopy and atomic force microscopy observations confirmed that the resultant pattern of the obtained structures can be manipulated by tuning the treatment conditions, suggesting an interesting alternative route of producing self-organized nanostructures.

A closed form for the electrostatic interaction between two rod-like charged objects

International Nuclear Information System (INIS)

Askari, M; Abouie, J

2011-01-01

We have calculated the electrostatic interaction between two rod-like charged objects with arbitrary orientations in three dimensions. We obtained a closed-form formula expressing the interaction energy in terms of the separation distance between the centers of the two rod-like objects, r, their lengths (denoted by 2l 1 and 2l 2 ) and their relative orientations (indicated by θ and φ). When the objects have the same length (2l 1 = 2l 2 = l), for particular values of separations, i.e. for r ≤ 0.8l, two types of minimum appear in the interaction energy with respect to θ. By employing the closed-form formula and introducing a scaled temperature t, we have also studied the thermodynamic properties of a 1D system of rod-like charged objects. For different separation distances, the dependence of the specific heat of the system to the scaled temperature has been studied. It is found that, for r < 0.8l, the specific heat has a maximum.

Solution structure of the cold-shock-like protein from Rickettsia rickettsii

International Nuclear Information System (INIS)

Gerarden, Kyle P.; Fuchs, Andrew M.; Koch, Jonathan M.; Mueller, Melissa M.; Graupner, David R.; O’Rorke, Justin T.; Frost, Caleb D.; Heinen, Heather A.; Lackner, Emily R.; Schoeller, Scott J.; House, Paul G.; Peterson, Francis C.; Veldkamp, Christopher T.

2012-01-01

The solution structure of the cold-shock-like protein from R. rickettsii, the causative agent of Rocky Mountain spotted fever, is reported. Rocky Mountain spotted fever is caused by Rickettsia rickettsii infection. R. rickettsii can be transmitted to mammals, including humans, through the bite of an infected hard-bodied tick of the family Ixodidae. Since the R. rickettsii genome contains only one cold-shock-like protein and given the essential nature of cold-shock proteins in other bacteria, the structure of the cold-shock-like protein from R. rickettsii was investigated. With the exception of a short α-helix found between β-strands 3 and 4, the solution structure of the R. rickettsii cold-shock-like protein has the typical Greek-key five-stranded β-barrel structure found in most cold-shock domains. Additionally, the R. rickettsii cold-shock-like protein, with a ΔG of unfolding of 18.4 kJ mol −1 , has a similar stability when compared with other bacterial cold-shock proteins

Comparative Geometrical Analysis of Leucine-Rich Repeat Structures in the Nod-Like and Toll-Like Receptors in Vertebrate Innate Immunity

Directory of Open Access Journals (Sweden)

Norio Matsushima

2015-08-01

Full Text Available The NOD-like receptors (NLRs and Toll-like receptors (TLRs are pattern recognition receptors that are involved in the innate, pathogen pattern recognition system. The TLR and NLR receptors contain leucine-rich repeats (LRRs that are responsible for ligand interactions. In LRRs short β-strands stack parallel and then the LRRs form a super helical arrangement of repeating structural units (called a coil of solenoids. The structures of the LRR domains of NLRC4, NLRP1, and NLRX1 in NLRs and of TLR1-5, TLR6, TLR8, TLR9 in TLRs have been determined. Here we report nine geometrical parameters that characterize the LRR domains; these include four helical parameters from HELFIT analysis. These nine parameters characterize well the LRR structures in NLRs and TLRs; the LRRs of NLR adopts a right-handed helix. In contrast, the TLR LRRs adopt either a left-handed helix or are nearly flat; RP105 and CD14 also adopt a left-handed helix. This geometrical analysis subdivides TLRs into four groups consisting of TLR3/TLR8/TLR9, TLR1/TLR2/TRR6, TLR4, and TLR5; these correspond to the phylogenetic tree based on amino acid sequences. In the TLRs an ascending lateral surface that consists of loops connecting the β-strand at the C-terminal side is involved in protein, protein/ligand interactions, but not the descending lateral surface on the opposite side.

Magnetic topology of Co-based inverse opal-like structures

Science.gov (United States)

Grigoryeva, N. A.; Mistonov, A. A.; Napolskii, K. S.; Sapoletova, N. A.; Eliseev, A. A.; Bouwman, W.; Byelov, D. V.; Petukhov, A. V.; Chernyshov, D. Yu.; Eckerlebe, H.; Vasilieva, A. V.; Grigoriev, S. V.

2011-08-01

The magnetic and structural properties of a cobalt inverse opal-like crystal have been studied by a combination of complementary techniques ranging from polarized neutron scattering and superconducting quantum interference device (SQUID) magnetometry to x-ray diffraction. Microradian small-angle x-ray diffraction shows that the inverse opal-like structure (OLS) synthesized by the electrochemical method fully duplicates the three-dimensional net of voids of the template artificial opal. The inverse OLS has a face-centered cubic (fcc) structure with a lattice constant of 640±10 nm and with a clear tendency to a random hexagonal close-packed structure along the [111] axes. Wide-angle x-ray powder diffraction shows that the atomic cobalt structure is described by coexistence of 95% hexagonal close-packed and 5% fcc phases. The SQUID measurements demonstrate that the inverse OLS film possesses easy-plane magnetization geometry with a coercive field of 14.0 ± 0.5 mT at room temperature. The detailed picture of the transformation of the magnetic structure under an in-plane applied field was detected with the help of small-angle diffraction of polarized neutrons. In the demagnetized state the magnetic system consists of randomly oriented magnetic domains. A complex magnetic structure appears upon application of the magnetic field, with nonhomogeneous distribution of magnetization density within the unit element of the OLS. This distribution is determined by the combined effect of the easy-plane geometry of the film and the crystallographic geometry of the opal-like structure with respect to the applied field direction.

Notes on the Wess-Zumino-Witten-like structure: L{sub ∞} triplet and NS-NS superstring field theory

Energy Technology Data Exchange (ETDEWEB)

Matsunaga, Hiroaki [Institute of Physics, the Czech Academy of Sciences,Na Slovance 2, Prague 8 (Czech Republic); Yukawa Institute for Theoretical Physics, Kyoto University,Kyoto 606-8502 (Japan)

2017-05-17

In the NS-NS sector of superstring field theory, there potentially exist three nilpotent generators of gauge transformations and two constraint equations: it makes the gauge algebra of type II theory somewhat complicated. In this paper, we show that every NS-NS actions have their WZW-like forms, and that a triplet of mutually commutative L{sub ∞} products completely determines the gauge structure of NS-NS superstring field theory via its WZW-like structure. We give detailed analysis about it and present its characteristic properties by focusing on two NS-NS actions proposed by https://www.doi.org/10.1007/JHEP01(2017)022 and https://www.doi.org/10.1007/JHEP08(2014)158.

Insights into the inhibited form of the redox-sensitive SufE-like sulfur acceptor CsdE.

Directory of Open Access Journals (Sweden)

Esther Peña-Soler

Full Text Available Sulfur trafficking in living organisms relies on transpersulfuration reactions consisting in the enzyme-catalyzed transfer of S atoms via activated persulfidic S across protein-protein interfaces. The recent elucidation of the mechanistic basis for transpersulfuration in the CsdA-CsdE model system has paved the way for a better understanding of its role under oxidative stress. Herein we present the crystal structure of the oxidized, inactivated CsdE dimer at 2.4 Å resolution. The structure sheds light into the activation of the Cys61 nucleophile on its way from a solvent-secluded position in free CsdE to a fully extended conformation in the persulfurated CsdA-CsdE complex. Molecular dynamics simulations of available CsdE structures allow to delineate the sequence of conformational changes underwent by CsdE and to pinpoint the key role played by the deprotonation of the Cys61 thiol. The low-energy subunit orientation in the disulfide-bridged CsdE dimer demonstrates the likely physiologic relevance of this oxidative dead-end form of CsdE, suggesting that CsdE could act as a redox sensor in vivo.

Structural disorder in metallic glass-forming liquids.

Science.gov (United States)

Pan, Shao-Peng; Feng, Shi-Dong; Wang, Li-Min; Qiao, Jun-Wei; Niu, Xiao-Feng; Dong, Bang-Shao; Wang, Wei-Min; Qin, Jing-Yu

2016-06-09

We investigated structural disorder by a new structural parameter, quasi-nearest atom (QNA), in atomistic configurations of eight metallic glass-forming systems generated through molecular dynamics simulations at various temperatures. Structural analysis reveals that the scaled distribution of the number of QNA appears to be an universal property of metallic liquids and the spatial distribution of the number of QNA displays to be clearly heterogeneous. Furthermore, the new parameter can be directly correlated with potential energy and structural relaxation at the atomic level. Some straightforward relationships between QNA and other properties (per-atom potential energy and α-relaxation time) are introduced to reflect structure-property relationship in metallic liquids. We believe that the new structural parameter can well reflect structure disorder in metallic liquids and play an important role in understanding various properties in metallic liquids.

Friction stir method for forming structures and materials

Science.gov (United States)

Feng, Zhili; David, Stan A.; Frederick, David Alan

2011-11-22

Processes for forming an enhanced material or structure are disclosed. The structure typically includes a preform that has a first common surface and a recess below the first common surface. A filler is added to the recess and seams are friction stir welded, and materials may be stir mixed.

QuikForm: Intelligent deformation processing of structural alloys

Energy Technology Data Exchange (ETDEWEB)

Bourcier, R.J.; Wellman, G.W.

1994-09-01

There currently exists a critical need for tools to enhance the industrial competitiveness and agility of US industries involved in deformation processing of structural alloys. In response to this need, Sandia National Laboratories has embarked upon the QuikForm Initiative. The goal of this program is the development of computer-based tools to facilitate the design of deformation processing operations. The authors are currently focusing their efforts on the definition/development of a comprehensive system for the design of sheet metal stamping operations. The overall structure of the proposed QuikForm system is presented, and the focus of their thrust in each technical area is discussed.

Cilia-like structures anchor the amphioxus notochord to its sheath.

Science.gov (United States)

Bočina, Ivana; Ljubešić, Nikola; Saraga-Babić, Mirna

2011-01-01

Body stiffness is important during undulatory locomotion in fish. In amphioxus, the myosepta play an important role in transmission of muscular forces to the notochord. In order to define the specific supporting role of the notochord in amphioxus during locomotion, the ultrastructure of 10 adult amphioxus specimens was analyzed using transmission electron microscopy. Numerous cilia-like structures were found on the surface of each notochordal cell at the sites of their attachment to the notochordal sheath. Ultrastructurally, these structures consisted of the characteristic arrangement of peripheral and central microtubular doublets and were anchored to the inner layer of the notochordal sheath. Immunohistochemically, a positive reaction to applied dynein and β-tubulin antibodies characterized the area of the cilia-like structures. We propose that reduced back-and-forth movements of the cilia-like structures might contribute to the flow of the fluid content inside the notochord, thus modulating the stiffness of the amphioxus body during its undulatory locomotion. Copyright © 2009 Elsevier GmbH. All rights reserved.

Conditions for forming composite carbon nanotube-diamond like carbon material that retain the good properties of both materials

Energy Technology Data Exchange (ETDEWEB)

Ren, Wei, E-mail: wei.ren@helsinki.fi; Avchaciov, Konstantin; Nordlund, Kai [Department of Physics, University of Helsinki, P.O. Box 43, FIN-00014 Helsinki (Finland); Iyer, Ajai; Koskinen, Jari [Department of Materials Science and Engineering, School of Chemical Technology, Aalto University, P.O. Box 16200, 00076 Espoo (Finland); Kaskela, Antti; Kauppinen, Esko I. [NanoMaterials Group, Department of Applied Physics, Aalto University School of Science, P.O. Box 15100, 00076 Aalto (Finland)

2015-11-21

Carbon nanotubes are of wide interest due to their excellent properties such as tensile strength and electrical and thermal conductivity, but are not, when placed alone on a substrate, well resistant to mechanical wear. Diamond-like carbon (DLC), on the other hand, is widely used in applications due to its very good wear resistance. Combining the two materials could provide a very durable pure carbon nanomaterial enabling to benefit from the best properties of both carbon allotropes. However, the synthesis of high-quality diamond-like carbon uses energetic plasmas, which can damage the nanotubes. From previous works it is neither clear whether the quality of the tubes remains good after DLC deposition, nor whether the DLC above the tubes retains the high sp{sup 3} bonding fraction. In this work, we use experiments and classical molecular dynamics simulations to study the mechanisms of DLC formation on various carbon nanotube compositions. The results show that high-sp{sup 3}-content DLC can be formed provided the deposition conditions allow for sidewards pressure to form from a substrate close beneath the tubes. Under optimal DLC formation energies of around 40–70 eV, the top two nanotube atom layers are fully destroyed by the plasma deposition, but layers below this can retain their structural integrity.

Structure of the active form of human origin recognition complex and its ATPase motor module

Energy Technology Data Exchange (ETDEWEB)

Tocilj, Ante; On, Kin Fan; Yuan, Zuanning; Sun, Jingchuan; Elkayam, Elad; Li, Huilin; Stillman, Bruce; Joshua-Tor, Leemor

2017-01-23

Binding of the Origin Recognition Complex (ORC) to origins of replication marks the first step in the initiation of replication of the genome in all eukaryotic cells. Here, we report the structure of the active form of human ORC determined by X-ray crystallography and cryo-electron microscopy. The complex is composed of an ORC1/4/5 motor module lobe in an organization reminiscent of the DNA polymerase clamp loader complexes. A second lobe contains the ORC2/3 subunits. The complex is organized as a double-layered shallow corkscrew, with the AAA+ and AAA+-like domains forming one layer, and the winged-helix domains (WHDs) forming a top layer. CDC6 fits easily between ORC1 and ORC2, completing the ring and the DNA-binding channel, forming an additional ATP hydrolysis site. Analysis of the ATPase activity of the complex provides a basis for understanding ORC activity as well as molecular defects observed in Meier-Gorlin Syndrome mutations.

A novel fungal fruiting structure formed by Aspergillus niger and Aspergillus carbonarius in grape berries.

Science.gov (United States)

Pisani, Cristina; Nguyen, Trang Thoaivan; Gubler, Walter Douglas

2015-09-01

Sour rot, is a pre-harvest disease that affects many grape varieties. Sour rot symptoms include initial berry cracking and breakdown of berry tissue. This is a disease complex with many filamentous fungi and bacteria involved, but is usually initiated by Aspergillus niger or Aspergillus carbonarius. Usually, by the time one sees the rot there are many other organisms involved and it is difficult to attribute the disease to one species. In this study two species of Aspergillus were shown to produce a previously unknown fruiting structure in infected berries. The nodulous morphology, bearing conidia, suggests them to be an 'everted polymorphic stroma'. This structure forms freely inside the berry pulp and assumes multiple shapes and sizes, sometimes sclerotium-like in form. It is composed of a mass of vegetative hyphae with or without tissue of the host containing spores or fruiting bodies bearing spores. Artificially inoculated berries placed in soil in winter showed the possible overwintering function of the fruiting body. Inoculated berry clusters on standing vines produced fruiting structures within 21 d post inoculation when wounds were made at veraison or after (July-September). Histological studies confirmed that the fruiting structure was indeed fungal tissue. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Forming of shape memory composite structures

DEFF Research Database (Denmark)

Santo, Loredana; Quadrini, Fabrizio; De Chiffre, Leonardo

2013-01-01

A new forming procedure was developed to produce shape memory composite structures having structural composite skins over a shape memory polymer core. Core material was obtained by solid state foaming of an epoxy polyester resin with remarkably shape memory properties. The composite skin consisted...... of a two-layer unidirectional thermoplastic composite (glass filled polypropylene). Skins were joined to the foamed core by hot compression without any adhesive: a very good adhesion was obtained as experimental tests confirmed. The structure of the foam core was investigated by means of computer axial...... tomography. Final shape memory composite panels were mechanically tested by three point bending before and after a shape memory step. This step consisted of a compression to reduce the panel thickness up to 60%. At the end of the bending test the panel shape was recovered by heating and a new memory step...

The cytosolic DNA sensor cGAS forms an oligomeric complex with DNA and undergoes switch-like conformational changes in the activation loop.

Science.gov (United States)

Zhang, Xu; Wu, Jiaxi; Du, Fenghe; Xu, Hui; Sun, Lijun; Chen, Zhe; Brautigam, Chad A; Zhang, Xuewu; Chen, Zhijian J

2014-02-13

The presence of DNA in the cytoplasm is a danger signal that triggers immune and inflammatory responses. Cytosolic DNA binds to and activates cyclic GMP-AMP (cGAMP) synthase (cGAS), which produces the second messenger cGAMP. cGAMP binds to the adaptor protein STING and activates a signaling cascade that leads to the production of type I interferons and other cytokines. Here, we report the crystal structures of human cGAS in its apo form, representing its autoinhibited conformation as well as in its cGAMP- and sulfate-bound forms. These structures reveal switch-like conformational changes of an activation loop that result in the rearrangement of the catalytic site. The structure of DNA-bound cGAS reveals a complex composed of dimeric cGAS bound to two molecules of DNA. Functional analyses of cGAS mutants demonstrate that both the protein-protein interface and the two DNA binding surfaces are critical for cGAS activation. These results provide insights into the mechanism of DNA sensing by cGAS. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

The Cytosolic DNA Sensor cGAS Forms an Oligomeric Complex with DNA and Undergoes Switch-like Conformational Changes in the Activation Loop

Directory of Open Access Journals (Sweden)

Xu Zhang

2014-02-01

Full Text Available The presence of DNA in the cytoplasm is a danger signal that triggers immune and inflammatory responses. Cytosolic DNA binds to and activates cyclic GMP-AMP (cGAMP synthase (cGAS, which produces the second messenger cGAMP. cGAMP binds to the adaptor protein STING and activates a signaling cascade that leads to the production of type I interferons and other cytokines. Here, we report the crystal structures of human cGAS in its apo form, representing its autoinhibited conformation as well as in its cGAMP- and sulfate-bound forms. These structures reveal switch-like conformational changes of an activation loop that result in the rearrangement of the catalytic site. The structure of DNA-bound cGAS reveals a complex composed of dimeric cGAS bound to two molecules of DNA. Functional analyses of cGAS mutants demonstrate that both the protein-protein interface and the two DNA binding surfaces are critical for cGAS activation. These results provide insights into the mechanism of DNA sensing by cGAS.

Infill Optimization for Additive Manufacturing - Approaching Bone-like Porous Structures

DEFF Research Database (Denmark)

Wu, Jun; Aage, Niels; Westermann, Ruediger

2018-01-01

Porous structures such as trabecular bone are widely seen in nature. These structures exhibit superior mechanical properties whilst being lightweight. In this paper, we present a method to generate bone-like porous structures asl ightweight infill for additive manufacturing. Our method builds upon...

Linking structure to fragility in bulk metallic glass-forming liquids

International Nuclear Information System (INIS)

Wei, Shuai; Stolpe, Moritz; Gross, Oliver; Gallino, Isabella; Hembree, William; Busch, Ralf; Evenson, Zach; Bednarcik, Jozef; Kruzic, Jamie J.

2015-01-01

Using in-situ synchrotron X-ray scattering, we show that the structural evolution of various bulk metallic glass-forming liquids can be quantitatively connected to their viscosity behavior in the supercooled liquid near T g . The structural signature of fragility is identified as the temperature dependence of local dilatation on distinct key atomic length scales. A more fragile behavior results from a more pronounced thermally induced dilatation of the structure on a length scale of about 3 to 4 atomic diameters, coupled with shallower temperature dependence of structural changes in the nearest neighbor environment. These findings shed light on the structural origin of viscous slowdown during undercooling of bulk metallic glass-forming liquids and demonstrate the promise of predicting the properties of bulk metallic glasses from the atomic scale structure

Linking structure to fragility in bulk metallic glass-forming liquids

Energy Technology Data Exchange (ETDEWEB)

Wei, Shuai, E-mail: shuai.wei@asu.edu, E-mail: m.stolpe@mx.uni-saarland.de [Department of Materials Science and Engineering, Saarland University, Campus C63, 66123 Saarbrücken (Germany); Department of Chemistry and Biochemistry, Arizona State University, Tempe, Arizona 85287 (United States); Stolpe, Moritz, E-mail: shuai.wei@asu.edu, E-mail: m.stolpe@mx.uni-saarland.de; Gross, Oliver; Gallino, Isabella; Hembree, William; Busch, Ralf [Department of Materials Science and Engineering, Saarland University, Campus C63, 66123 Saarbrücken (Germany); Evenson, Zach [Department of Materials Science and Engineering, Saarland University, Campus C63, 66123 Saarbrücken (Germany); Institut für Materialphysik im Weltraum, Deutsches Zentrum für Luft- und Raumfahrt (DLR), 51170 Köln (Germany); Bednarcik, Jozef [Deutsches Elektronen-Synchrotron DESY, Notkestrasse 85, D-22603 Hamburg (Germany); Kruzic, Jamie J. [Material Science, School of Mechanical, Industrial, and Manufacturing Engineering, Oregon State University, Corvallis, Oregon 97331 (United States)

2015-05-04

Using in-situ synchrotron X-ray scattering, we show that the structural evolution of various bulk metallic glass-forming liquids can be quantitatively connected to their viscosity behavior in the supercooled liquid near T{sub g}. The structural signature of fragility is identified as the temperature dependence of local dilatation on distinct key atomic length scales. A more fragile behavior results from a more pronounced thermally induced dilatation of the structure on a length scale of about 3 to 4 atomic diameters, coupled with shallower temperature dependence of structural changes in the nearest neighbor environment. These findings shed light on the structural origin of viscous slowdown during undercooling of bulk metallic glass-forming liquids and demonstrate the promise of predicting the properties of bulk metallic glasses from the atomic scale structure.

Expression, purification and characterization of hepatitis B virus X protein BH3-like motif-linker-Bcl-xL fusion protein for structural studies

Directory of Open Access Journals (Sweden)

Hideki Kusunoki

2017-03-01

Full Text Available Hepatitis B virus X protein (HBx is a multifunctional protein that interacts directly with many host proteins. For example, HBx interacts with anti-apoptotic proteins, Bcl-2 and Bcl-xL, through its BH3-like motif, which leads to elevated cytosolic calcium levels, efficient viral DNA replication and the induction of apoptosis. To facilitate sample preparation and perform detailed structural characterization of the complex between HBx and Bcl-xL, we designed and purified a recombinant HBx BH3-like motif-linker-Bcl-xL fusion protein produced in E. coli. The fusion protein was characterized by size exclusion chromatography, circular dichroism and nuclear magnetic resonance experiments. Our results show that the fusion protein is a monomer in aqueous solution, forms a stable intramolecular complex, and likely retains the native conformation of the complex between Bcl-xL and the HBx BH3-like motif. Furthermore, the HBx BH3-like motif of the intramolecular complex forms an α-helix. These observations indicate that the fusion protein should facilitate structural studies aimed at understanding the interaction between HBx and Bcl-xL at the atomic level.

Form-finding of shell structures generated from physical models

NARCIS (Netherlands)

Li, Q.; Su, Y; Wu, Y; Borgart, A.; Rots, J.G.

2017-01-01

Vector form intrinsic finite element is a recently developed and promising numerical method for the analysis of complicated structural behavior. Taking the cable-link element as example, the framework of the vector form intrinsic finite element is explained first. Based on this, a constant strain

Geometric structures associated with a simple Cartan 3-form

Czech Academy of Sciences Publication Activity Database

Le, Hong-Van

2013-01-01

Roč. 70, August (2013), s. 205-223 ISSN 0393-0440 Institutional support: RVO:67985840 Keywords : Cartan 3-form * multi-symplectic form * G-structure Subject RIV: BA - General Mathematics Impact factor: 0.797, year: 2013 http://www.sciencedirect.com/science/article/pii/S0393044013000740

Nucleon structure functions, resonance form factors, and duality

International Nuclear Information System (INIS)

Davidovsky, V.V.; Struminsky, B.V.

2003-01-01

The behavior of nucleon structure functions in the resonance region is explored. For form factors that describe resonance production, expressions are obtained that are dependent on the photon virtuality Q 2 , which have a correct threshold behavior, and which take into account available experimental data on resonance decay. Resonance contributions to nucleon structure functions are calculated. The resulting expressions are used to investigate quark-hadron duality in electron-nucleon scattering by taking the example of the structure function F 2

Why do alpha-beta parallel proteins, like flavodoxins, form misfolded off-pathway intermediates?

NARCIS (Netherlands)

Nabuurs, S.M.

2009-01-01

The question: “Why do α-β parallel proteins, like flavodoxins, form misfolded off-pathway
intermediates?" is the main subject of this thesis. A. vinelandii apoflavodoxin is chosen as protein
of interest as it is a representative of α-β parallel proteins, which are widely prevalent in

Formation of dish-like holes and a channel structure in electrodeposition of copper under hydrogen co-deposition

International Nuclear Information System (INIS)

Nikolic, N.D.; Pavlovic, Lj.J.; Pavlovic, M.G.; Popov, K.I.

2007-01-01

Copper electrodeposition from acid sulfate solutions at an overpotential of 1000 mV, which is about 250 mV outside the plateau of the limiting diffusion current density, was examined by the determination of the average current efficiency of hydrogen evolution and by the scanning electron microscopic (SEM) analysis of the morphology of the formed copper deposits. Craters or holes formed due to the attachment hydrogen bubbles were the dominant morphological forms of copper deposits obtained at this overpotential. In dependence of the concentration of Cu (II) ions in the plating solution, the two types of holes or craters were formed. One type of holes is obtained by electrodeposition from a solution with a concentration of Cu (II) ions of 0.075 M CuSO 4 in 0.50 M H 2 SO 4 , and a honeycomb-like structure was formed from these holes. The other types of holes are formed from a solution with a higher concentration of Cu (II) ions (0.60 M CuSO 4 in 0.50 M H 2 SO 4 ) and the formed holes were dish-like. A mixture of both types of holes was obtained by electrodeposition from 0.30 M CuSO 4 in 0.50 M H 2 SO 4 . The obtained morphologies of copper deposits are discussed in terms of the effect of hydrogen evolution on the hydrodynamic conditions in the plating solution

Process for forming exoergic structures with the use of a plasma

Science.gov (United States)

Kelly, M.D.

1987-05-29

A method of forming exoergic structures, as well as exoergic structures produced by the method, is provided. The method comprises the steps of passing a plasma-forming gas through a plasma spray gun, forming a plasma spray, introducing exoergic material into the plasma spray and directing the plasma spray toward a substrate, and allowing the exoergic material to become molten in the plasma spray and to thereafter impinge on the substrate to form a solid mass of exoergic material, the shape of which corresponds to the shape of the substrate.

Rice black-streaked dwarf virus P6 self-interacts to form punctate, viroplasm-like structures in the cytoplasm and recruits viroplasm-associated protein P9-1

Directory of Open Access Journals (Sweden)

Yu Jialin

2011-01-01

Full Text Available Abstract Background Rice black-streaked dwarf virus (RBSDV, a member of the genus Fijivirus within the family Reoviridae, can infect several graminaceous plant species including rice, maize and wheat, and is transmitted by planthoppers. Although several RBSDV proteins have been studied in detail, functions of the nonstructural protein P6 are still largely unknown. Results In the current study, we employed yeast two-hybrid assays, bimolecular fluorescence complementation and subcellular localization experiments to show that P6 can self-interact to form punctate, cytoplasmic viroplasm-like structures (VLS when expressed alone in plant cells. The region from residues 395 to 659 is necessary for P6 self-interaction, whereas two polypeptides (residues 580-620 and 615-655 are involved in the subcellular localization of P6. Furthermore, P6 strongly interacts with the viroplasm-associated protein P9-1 and recruits P9-1 to localize in VLS. The P6 395-659 region is also important for the P6-P9-1 interaction, and deleting any region of P9-1 abolishes this heterologous interaction. Conclusions RBSDV P6 protein has an intrinsic ability to self-interact and forms VLS without other RBSDV proteins or RNAs. P6 recruits P9-1 to VLS by direct protein-protein interaction. This is the first report on the functionality of RBSDV P6 protein. P6 may be involved in the process of viroplasm nucleation and virus morphogenesis.

Function and structure of GFP-like proteins in the protein data bank.

Science.gov (United States)

Ong, Wayne J-H; Alvarez, Samuel; Leroux, Ivan E; Shahid, Ramza S; Samma, Alex A; Peshkepija, Paola; Morgan, Alicia L; Mulcahy, Shawn; Zimmer, Marc

2011-04-01

The RCSB protein databank contains 266 crystal structures of green fluorescent proteins (GFP) and GFP-like proteins. This is the first systematic analysis of all the GFP-like structures in the pdb. We have used the pdb to examine the function of fluorescent proteins (FP) in nature, aspects of excited state proton transfer (ESPT) in FPs, deformation from planarity of the chromophore and chromophore maturation. The conclusions reached in this review are that (1) The lid residues are highly conserved, particularly those on the "top" of the β-barrel. They are important to the function of GFP-like proteins, perhaps in protecting the chromophore or in β-barrel formation. (2) The primary/ancestral function of GFP-like proteins may well be to aid in light induced electron transfer. (3) The structural prerequisites for light activated proton pumps exist in many structures and it's possible that like bioluminescence, proton pumps are secondary functions of GFP-like proteins. (4) In most GFP-like proteins the protein matrix exerts a significant strain on planar chromophores forcing most GFP-like proteins to adopt non-planar chromophores. These chromophoric deviations from planarity play an important role in determining the fluorescence quantum yield. (5) The chemospatial characteristics of the chromophore cavity determine the isomerization state of the chromophore. The cavities of highlighter proteins that can undergo cis/trans isomerization have chemospatial properties that are common to both cis and trans GFP-like proteins.

Structures of actin-like ParM filaments show architecture of plasmid-segregating spindles.

Science.gov (United States)

Bharat, Tanmay A M; Murshudov, Garib N; Sachse, Carsten; Löwe, Jan

2015-07-02

Active segregation of Escherichia coli low-copy-number plasmid R1 involves formation of a bipolar spindle made of left-handed double-helical actin-like ParM filaments. ParR links the filaments with centromeric parC plasmid DNA, while facilitating the addition of subunits to ParM filaments. Growing ParMRC spindles push sister plasmids to the cell poles. Here, using modern electron cryomicroscopy methods, we investigate the structures and arrangements of ParM filaments in vitro and in cells, revealing at near-atomic resolution how subunits and filaments come together to produce the simplest known mitotic machinery. To understand the mechanism of dynamic instability, we determine structures of ParM filaments in different nucleotide states. The structure of filaments bound to the ATP analogue AMPPNP is determined at 4.3 Å resolution and refined. The ParM filament structure shows strong longitudinal interfaces and weaker lateral interactions. Also using electron cryomicroscopy, we reconstruct ParM doublets forming antiparallel spindles. Finally, with whole-cell electron cryotomography, we show that doublets are abundant in bacterial cells containing low-copy-number plasmids with the ParMRC locus, leading to an asynchronous model of R1 plasmid segregation.

The effect of mutations on the structure of insulin fibrils studied by Fourier transform infrared (FTIR) spectroscopy and electron microscopy.

Science.gov (United States)

Garriques, Liza Nielsen; Frokjaer, Sven; Carpenter, John F; Brange, Jens

2002-12-01

Fibril formation (aggregation) of human and bovine insulin and six human insulin mutants in hydrochloric acid were investigated by visual inspection, Thioflavin T fluorescence spectroscopy, transmission electron microscopy (TEM), and Fourier transform infrared (FTIR) spectroscopy. The fibrillation tendencies of the wild-type insulins and the insulin mutants were (in order of decreasing fibrillation tendencies): Glu(B1) + Glu(B27) = bovine < human < des-(B1,B2)-insulin < Ser(B2) + Asp(B10) < Glu(A13) + Glu(B10) = Gln(B17) < Asp(B10). Transmission electron micrographs showed that the protofibrils of the mutants were similar to those of wild-type insulins and had a diameter of 5-10 nm and lengths varying from 50 nm to several microns. The fibrils of human insulin mutants exhibited varying degrees of lateral aggregation. The Asp(B10) mutant and human insulin had greater tendency to form laterally aggregated fibrils arranged in parallel bundles, whereas fibrils of the other mutants and bovine insulin were mainly arranged in helical filaments. FTIR spectroscopy showed that the native secondary structure of the wild-type insulins and the human insulin mutants in hydrochloric acid were identical, whereas the secondary structure of the fibrils formed by heating at 50 degrees C depended on the amino acid substitution. FTIR spectra of fibrils of the human insulin mutants exhibited different beta-sheet bands at 1,620-1,640 cm(-1), indicating that the beta-sheet interactions in the fibrils depended on variations in the primary structure of insulin. Copyright 2002 Wiley-Liss, Inc. and the American Pharmaceutical Association J Pharm Sci 91:2473-2480, 2002

MMS observations of guide field reconnection at the interface between colliding reconnection jets inside flux rope-like structures at the magnetopause

Science.gov (United States)

Oieroset, M.; Phan, T.; Haggerty, C. C.; Shay, M.; Eastwood, J. P.; Gershman, D. J.; Drake, J. F.; Fujimoto, M.; Ergun, R.; Mozer, F.; Oka, M.; Torbert, R. B.; Burch, J. L.; Wang, S.; Chen, L. J.; Swisdak, M.; Pollock, C. J.; Dorelli, J.; Fuselier, S. A.; Lavraud, B.; Kacem, I.; Giles, B. L.; Moore, T. E.; Saito, Y.; Avanov, L. A.; Paterson, W. R.; Strangeway, R. J.; Schwartz, S. J.; Khotyaintsev, Y. V.; Lindqvist, P. A.; Malakit, K.

2017-12-01

The formation and evolution of magnetic flux ropes is of critical importance for a number of collisionless plasma phenomena. At the dayside magnetopause flux rope-like structures can form between two X-lines. The two X-lines produce converging plasma jets. At the interface between the colliding jets a compressed current sheet can form, which in turn can undergo reconnection. We present MMS observations of the exhaust and diffusion region of such reconnection.

The Transient Intermediate Plexiform Layer, a Plexiform Layer-like Structure Temporarily Existing in the Inner Nuclear Layer in Developing Rat Retina.

Science.gov (United States)

Park, Hyung Wook; Kim, Hong-Lim; Park, Yong Soo; Kim, In-Beom

2018-02-01

The retina is a highly specialised part of the brain responsible for visual processing. It is well-laminated; three layers containing five different types of neurons are compartmentalised by two synaptic layers. Among the retinal layers, the inner nuclear layer (INL) is composed of horizontal, bipolar, and amacrine cell types. Bipolar cells form one sublayer in the distal half of the IPL, while amacrine cells form another sublayer in the proximal half, without any border-like structure. Here, we report that a plexiform layer-like structure exists temporarily in the border between the bipolar and amacrine sublayers in the INL in the rat retina during retinal development. This transient intermediate plexiform layer (TIPL) appeared at postnatal day (PD) 7 and then disappeared around PD 12. Most apoptotic cells in the INL were found near the TIPL. These results suggest that the TIPL may contribute to the formation of sublayers and the cell number limit in the INL.

Dromion-like structures and stability analysis in the variable coefficients complex Ginzburg–Landau equation

International Nuclear Information System (INIS)

Wong, Pring; Pang, Li-Hui; Huang, Long-Gang; Li, Yan-Qing; Lei, Ming; Liu, Wen-Jun

2015-01-01

The study of the complex Ginzburg–Landau equation, which can describe the fiber laser system, is of significance for ultra-fast laser. In this paper, dromion-like structures for the complex Ginzburg–Landau equation are considered due to their abundant nonlinear dynamics. Via the modified Hirota method and simplified assumption, the analytic dromion-like solution is obtained. The partial asymmetry of structure is particularly discussed, which arises from asymmetry of nonlinear and dispersion terms. Furthermore, the stability of dromion-like structures is analyzed. Oscillation structure emerges to exhibit strong interference when the dispersion loss is perturbed. Through the appropriate modulation of modified exponent parameter, the oscillation structure is transformed into two dromion-like structures. It indicates that the dromion-like structure is unstable, and the coherence intensity is affected by the modified exponent parameter. Results in this paper may be useful in accounting for some nonlinear phenomena in fiber laser systems, and understanding the essential role of modified Hirota method

Assessment of the nature interactions of β-amyloid protein by a nanoprobe method.

Science.gov (United States)

Caballero, Leonardo; Mena, Juan; Morales-Alvarez, Aurora; Kogan, Marcelo J; Melo, Francisco

2015-01-01

We present a method based on atomic force microscopy (AFM) to assess the work of adhesion between the interfaces of gold AFM tips functionalized with three peptides derived from β-sheet breaker LPFFD [CLPFFD-NH2 (i0) and their isomers CDLPFF-NH2 (i1) and CLPDFF-NH2 (i2)], and the beta-amyloid protein (Aβ1-42). β-Amyloid protein was deposited onto a highly oriented graphite (HOPG) surface as protofibrils and fibrils. The presence of the residues Leu (L), Phe (F), and Phe (F), which are also present in the native sequence, confirm that the peptides are able to bind to the aggregates of Aβ1-42 fibrils and protofibrils. Force of adhesion data were directly obtained from the maximum force on retraction, and the work of adhesion was calculated from the Jhonson-Kendall-Roberts model (JKR-Model). Both the polar and dispersive contributions to the surface energy of the peptides i0, i1, and i2, as well as Aβ1-42 fibrils and protofibrils, were determined by means of measuring the contact angle and using the two-fluid method. The macroscopic energies of the functionalized gold surfaces do not differ significantly between isomers, which confirms the similar nature of the peptides i0, i1, and i2 but suggests that the macroscopic measurements are not able to distinguish specific sequences. The nanoprobe reveals a typical adhesion work value associated with the interaction of protofibrils with i0 and i2; this value is three times higher than that of i1. The difference is attributed to the hydrophobic nature of protofibrils, the predominant exposition of hydrophobic residues of the peptides i0 and i2, with respect to i1, and the degree of functionalization. i0 and i2 presented a slight adhesion with Aβ fibrils, which is associated with the exposed hydrophilic groups of these fibrils (onto HOPG) compared to the protofibrils. However, i1 showed interaction with both Aβ fibrils and protofibrils. For this, we propose an explanation based on the fact that the peptide i1 locates

Mach-Like Structure in a Patronic-Hadronic Transport Model at RHIC Energies

International Nuclear Information System (INIS)

Ma, Y.G.; Ma, G.L.; Zhang, S.

2008-01-01

Recent RHIC experimental results indicated an exotic partonic matter may be created in central Au + Au collisions at dollars sqrt (s ( NN))dollars =200 GeV. When a parton with high transverse momentum (jet) passes through the new matter, jet will quench. The lost energy will be redistributed into the medium. Experimentally the soft scattered particles which carry the lost energy have been reconstructed via di-hadron angular correlations of charged particles and a hump structure on away side in di-hadron $ Delta phi$ correlation has been observed in central Au + Au collisions [1,2]. Some interpretations, such as Mach-cone shock wave and gluon Cherenkov-like radiation mechanism etc, have been proposed to explain the splitting behavior of the away side peaks. However, quantitative understanding of the experimental observation has yet to be established. In this work, we use a multi-phase transport (AMPT) model to make a detailed simulation for di-hadron or tri-hadron azimuthal correlation for central Au + Au collisions at dollars sqrt(s ( NN)) dollars =200 GeV. The hump structure on away side (we called Mach-like structure later) in the di-hadron and tri-hadron azimuthal correlations has been observed [3,4,5]. Furthermore, the time evolution of Mach-like structure is presented [6]. With the increasing of the lifetime of partonic matter, Mach-like structure develops by strong parton cascade process. Not only the splitting parameter but also the number of associated hadrons (dollarsN ( h) (assoc)dollars) increases with the lifetime of partonic matter and partonic interaction cross section. Both the explosion of dollarsN ( h) (assoc)dollars following the formation of Mach-like structure and the corresponding results of three-particle correlation support that a partonic Mach-like behavior can be produced by a collective coupling of partons because of the strong parton cascade mechanism. Therefore, the studies about Mach-like structure may give us some critical information

I-motif DNA structures are formed in the nuclei of human cells

Science.gov (United States)

Zeraati, Mahdi; Langley, David B.; Schofield, Peter; Moye, Aaron L.; Rouet, Romain; Hughes, William E.; Bryan, Tracy M.; Dinger, Marcel E.; Christ, Daniel

2018-06-01

Human genome function is underpinned by the primary storage of genetic information in canonical B-form DNA, with a second layer of DNA structure providing regulatory control. I-motif structures are thought to form in cytosine-rich regions of the genome and to have regulatory functions; however, in vivo evidence for the existence of such structures has so far remained elusive. Here we report the generation and characterization of an antibody fragment (iMab) that recognizes i-motif structures with high selectivity and affinity, enabling the detection of i-motifs in the nuclei of human cells. We demonstrate that the in vivo formation of such structures is cell-cycle and pH dependent. Furthermore, we provide evidence that i-motif structures are formed in regulatory regions of the human genome, including promoters and telomeric regions. Our results support the notion that i-motif structures provide key regulatory roles in the genome.

An ontology-driven tool for structured data acquisition using Web forms.

Science.gov (United States)

Gonçalves, Rafael S; Tu, Samson W; Nyulas, Csongor I; Tierney, Michael J; Musen, Mark A

2017-08-01

Structured data acquisition is a common task that is widely performed in biomedicine. However, current solutions for this task are far from providing a means to structure data in such a way that it can be automatically employed in decision making (e.g., in our example application domain of clinical functional assessment, for determining eligibility for disability benefits) based on conclusions derived from acquired data (e.g., assessment of impaired motor function). To use data in these settings, we need it structured in a way that can be exploited by automated reasoning systems, for instance, in the Web Ontology Language (OWL); the de facto ontology language for the Web. We tackle the problem of generating Web-based assessment forms from OWL ontologies, and aggregating input gathered through these forms as an ontology of "semantically-enriched" form data that can be queried using an RDF query language, such as SPARQL. We developed an ontology-based structured data acquisition system, which we present through its specific application to the clinical functional assessment domain. We found that data gathered through our system is highly amenable to automatic analysis using queries. We demonstrated how ontologies can be used to help structuring Web-based forms and to semantically enrich the data elements of the acquired structured data. The ontologies associated with the enriched data elements enable automated inferences and provide a rich vocabulary for performing queries.

Modification of dentin surface to enamel-like structure: A potential strategy for improving dentin bonding durability, desensitizing and self-repairing

Directory of Open Access Journals (Sweden)

Hongye Yang

2014-01-01

Full Text Available Introduction: Current theories of dentin bonding are based on the concept of "hybrid layer". However, the histological complexity of dentin, as well as the vulnerability of the hybrid layer, goes against the long-term effect of dentin bonding. At the same time, post-operative sensitivity is more likely to occur after traditional adhesive restoration. The Hypothesis: Compared to dentin bonding, enamel bonding exhibits a more optimal immediate and long-term performance, owing to its higher degree of mineralization, well-arranged enamel crystals and the porous structure after etching. Moreover, "enamel hypersensitivity" is never going to happen due to the lack of tubules existing in dentin. In light of this phenomenon, we brought up the concept and the proposal method to form an "enamel-like" dentin, simulating enamel structure to achieve satisfying durability of dentin bonding and obtain good performance for preventing post-operative sensitivity. With the application of mesoporous silicon bi-directionally binding to hydroxyapatite of dentin itself and hydroxyapatite nanorods synthetized in vitro, we may be able to form an enamel-like "functional layer" via ion-regulating self-assembly. Evaluation of Hypothesis: This paper explains how to achieve dentin enamel-like modification by chemical methods, especially, details the strategies and possible mechanisms of the hypothesis. Validation of the hypothesis is more likely to eliminate the adverse effect of dentinal fluid, improve long-term performance of dentin bonding, offer strategies for desensitizing treatment and self-repairing carious-affected dentin, and furthermore, provide the possibility to introduce new theories of dentin bonding.

Methods of generalizing and classifying layer structures of a special form

Energy Technology Data Exchange (ETDEWEB)

Viktorova, N P

1981-09-01

An examination is made of the problem of classifying structures represented by weighted multilayer graphs of special form with connections between the vertices of each layer. The classification of structures of such a form is based on the construction of resolving sets of graphs as a result of generalization of the elements of the training sample of each class and the testing of whether an input object is isomorphic (with allowance for the weights) to the structures of the resolving set or not. 4 references.

Effect of calcium ions on structure and stability of the C1q-like domain of otolin-1 from human and zebrafish.

Science.gov (United States)

Hołubowicz, Rafał; Wojtas, Magdalena; Taube, Michał; Kozak, Maciej; Ożyhar, Andrzej; Dobryszycki, Piotr

2017-12-01

Otolin-1 is a collagen-like protein expressed in the inner ear of vertebrates. It provides an organic scaffold for otoliths in fish and otoconia in land vertebrates. In this study, the expression and purification procedure of C1q-like domain of otolin-1 from human and zebrafish was developed. The structure and stability of the proteins were investigated. The results of sedimentation velocity analytical ultracentrifugation and small-angle X-ray scattering indicated that the C1q-like domain of otolin-1 forms stable trimers in solution in the presence of calcium ions. It was also observed that calcium ions influenced the secondary structure of the proteins. C1q-like domains were stabilized by the calcium ions. The human variant was especially affected by the calcium ions. The results indicate the importance of the C1q-like domain for the assembly of the organic matrix of otoliths and otoconia. © 2017 Federation of European Biochemical Societies.

Cop-like operon: Structure and organization in species of the Lactobacillale order

Directory of Open Access Journals (Sweden)

ANGÉLICA REYES

2006-01-01

Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

Creating "hotels" for cells by electrospinning honeycomb-like polymeric structures.

Science.gov (United States)

Liang, T; Mahalingam, S; Edirisinghe, M

2013-10-01

It is well established that three-dimensional honeycomb-like nanofibrous structures enhance cell activity. In this work, we report that electrospun polymer nanofibres self-assemble into three-dimensional honeycomb-like structures. The underlying mechanism is studied by varying the polymer solution concentration, collecting substrates and working distance. The polymer solution concentration has a significant effect on the size of the electrospun nanofibres. The collection substrate and working distance affect the electric field strength, the evaporation of solvent and the discharging of nanofibres and consequently these two had a significant influence on the self-assembly of nanofibres. © 2013.

Pulsating jet-like structures in magnetized plasma

Energy Technology Data Exchange (ETDEWEB)

Goncharov, V. P. [A. M. Obukhov Institute of Atmospheric Physics RAS, 109017 Moscow (Russian Federation); Pavlov, V. I. [UFR des Mathématiques Pures et Appliquées, Univ. Lille, CNRS FRE 3723 - LML, F-59000 Lille (France)

2016-08-15

The formation of pulsating jet-like structures has been studied in the scope of the nonhydrostatic model of a magnetized plasma with horizontally nonuniform density. We discuss two mechanisms which are capable of stopping the gravitational spreading appearing to grace the Rayleigh-Taylor instability and to lead to the formation of stationary or oscillating localized structures. One of them is caused by the Coriolis effect in the rotating frames, and another is connected with the Lorentz effect for magnetized fluids. Magnetized jets/drops with a positive buoyancy must oscillate in transversal size and can manifest themselves as “radio pulsars.” The estimates of their frequencies are made for conditions typical for the neutron star's ocean.

Band structure of superlattice with δ-like potential

International Nuclear Information System (INIS)

Gashimzade, N.F.; Gashimzade, F.M.; Hajiev, A.T.

1993-08-01

Band structure of superlattice with δ-like potential has been calculated taking into account interaction of carriers of different kinds. Superlattices of semiconductors with degenerated valence band and zero-gap semiconductors have been considered. For the latter semimetal-semiconductor transition has been obtained. (author). 8 refs, 1 fig

An activated form of ADAM10 is tumor selective and regulates cancer stem-like cells and tumor growth

Science.gov (United States)

Saha, Nayanendu; Eissman, Moritz F.; Xu, Kai; Llerena, Carmen; Kusebauch, Ulrike; Ding, Bi-Sen; Cao, Zhongwei; Rafii, Shahin; Ernst, Matthias; Scott, Andrew M.; Nikolov, Dimitar B.; Lackmann, Martin

2016-01-01

The transmembrane metalloprotease ADAM10 sheds a range of cell surface proteins, including ligands and receptors of the Notch, Eph, and erbB families, thereby activating signaling pathways critical for tumor initiation and maintenance. ADAM10 is thus a promising therapeutic target. Although widely expressed, its activity is normally tightly regulated. We now report prevalence of an active form of ADAM10 in tumors compared with normal tissues, in mouse models and humans, identified by our conformation-specific antibody mAb 8C7. Structure/function experiments indicate mAb 8C7 binds an active conformation dependent on disulfide isomerization and oxidative conditions, common in tumors. Moreover, this active ADAM10 form marks cancer stem-like cells with active Notch signaling, known to mediate chemoresistance. Importantly, specific targeting of active ADAM10 with 8C7 inhibits Notch activity and tumor growth in mouse models, particularly regrowth after chemotherapy. Our results indicate targeted inhibition of active ADAM10 as a potential therapy for ADAM10-dependent tumor development and drug resistance. PMID:27503072

Structural Encoding of Static Single Assignment Form

DEFF Research Database (Denmark)

Gal, Andreas; Probst, Christian; Franz, Michael

2005-01-01

Static Single Assignment (SSA) form is often used as an intermediate representation during code optimization in Java Virtual Machines. Recently, SSA has successfully been used for bytecode verification. However, constructing SSA at the code consumer is costly. SSAbased mobile code transport formats...... Java bytecode. While the resulting bytecode sequence can still be directly executed by traditional Virtual Machines, our novel VM can infer SSA form and confirm its safety with virtually no overhead....... have been shown to eliminate this cost by shifting SSA creation to the code producer. These new formats, however, are not backward compatible with the established Java class-file format. We propose a novel approach to transport SSA information implicitly through structural code properties of standard...

Bioinformatics analysis of the structural and evolutionary characteristics for toll-like receptor 15

Directory of Open Access Journals (Sweden)

Jinlan Wang

2016-05-01

Full Text Available Toll-like receptors (TLRs play important role in the innate immune system. TLR15 is reported to have a unique role in defense against pathogens, but its structural and evolution characterizations are still poorly understood. In this study, we identified 57 completed TLR15 genes from avian and reptilian genomes. TLR15 clustered into an individual clade and was closely related to family 1 on the phylogenetic tree. Unlike the TLRs in family 1 with the broken asparagine ladders in the middle, TLR15 ectodomain had an intact asparagine ladder that is critical to maintain the overall shape of ectodomain. The conservation analysis found that TLR15 ectodomain had a highly evolutionarily conserved region on the convex surface of LRR11 module, which is probably involved in TLR15 activation process. Furthermore, the protein–protein docking analysis indicated that TLR15 TIR domains have the potential to form homodimers, the predicted interaction interface of TIR dimer was formed mainly by residues from the BB-loops and αC-helixes. Although TLR15 mainly underwent purifying selection, we detected 27 sites under positive selection for TLR15, 24 of which are located on its ectodomain. Our observations suggest the structural features of TLR15 which may be relevant to its function, but which requires further experimental validation.

Multi-Scalar Modelling for Free-form Timber Structures

DEFF Research Database (Denmark)

Poinet, Paul; Nicholas, Paul; Tamke, Martin

2016-01-01

.The research explores the design probe of free-form structures composed of glue-laminated timber beams and looks at the different types of data that need to be shared among each discipline and across multiple scales from which different levels of resolution can be defined. A particular focus lies...... in the segmentation strategy of glue-laminated timber structures that depend on structural requirements and the different types of constraints related to fabrication, transportation and assembly. Where current working practices decouple segmentation processes within a discrete digital workflow, this research aims...... and techniques as a means to work within a continuous design environment in which an abstract network of timber beams is iteratively updated through geometrical and structural optimizations at different levels of resolution....

Septum-like structures in lipoma and liposarcoma: MR imaging and pathologic correlation

International Nuclear Information System (INIS)

Hosono, M.; Kobayashi, H.; Fujimoto, R.; Kotoura, Y.; Tsuboyama, T.; Matsusue, Y.; Nakamura, T.; Itoh, T.; Konishi, J.

1997-01-01

Objective. To investigate the septum-like structures in predominantly lipomatous tumors, by correlating fat-suppressed MR images with histopathologic findings. Design and patients. The MR findings of three cases of well-differentiated liposarcoma (atypical lipoma), one case of lipoma-like component of dedifferentiated liposarcoma, and nine cases of lipoma were analyzed. T1-, T2-, and fat-suppressed T1-weighted images after Gd-DTPA administration were obtained. Surgical specimens from five patients (four with liposarcoma and one with lipoma) were also scanned with a MR unit, and compared with the pathologic findings. Results and conclusions. Enhancement features of lipoma and liposarcoma were well visualized on fat-suppressed T1-weighted images after Gd-DTPA administration. The septum-like structures of liposarcoma are thick and enhanced considerably, while septa of lipoma are thin and enhanced only slightly. Pathologically, the septum-like structures of liposarcoma contained muscle fibers and the septa of lipoma represented fibrous capsule. Identification of well-enhanced septa in a predominantly lipomatous tumor helps to differentiate malignant tumors from lipomas. As the septum-like structures of liposarcoma contain a skeletal muscle component the tumor might need more extensive surgical procedures including resection of adjacent muscles. (orig.). With 4 figs., 1 tab

Hadron Azimuthal Correlations and Mach-like Structures in a Partonic/Hadronic Transport Model

International Nuclear Information System (INIS)

Ma, G.L.; Zhang, S.; Ma, Y.G.; Cai, X.Z.; Chen, J.H.; He, Z.J.; Huang, H.Z.; Long, J.L.; Shen, W.Q.; Shi, X.H.; Zhong, C.; Zuo, J.X.

2007-01-01

With a multi-phase transport model (AMPT) with both partonic and hadronic interactions, two- and three-particle azimuthal correlations in Au + Au collisions at s NN =200 GeV have been studied by the mixing-event technique. A Mach-like structure has been observed in two- and three-particle correlations in central collisions. It has been found that both partonic and hadronic dynamical mechanisms contribute to the Mach-like structure. However, only hadronic rescattering is unable to reproduce experimental amplitude of Mach-like structure, and parton cascade process is indispensable. The results of three-particle correlation indicate a partonic Mach-like shock wave can be produced by strong parton cascade in central Au+Au collisions

Reassembly of adult human testicular cells: can testis cord-like structures be created in vitro?

Science.gov (United States)

Mincheva, M; Sandhowe-Klaverkamp, R; Wistuba, J; Redmann, K; Stukenborg, J-B; Kliesch, S; Schlatt, S

2018-02-01

Can enzymatically dispersed testicular cells from adult men reassemble into seminiferous cord-like structures in vitro? Adult human testicular somatic cells reassembled into testicular cord-like structures via dynamic interactions of Sertoli and peritubular cells. In vitro approaches using dispersed single cell suspensions of human testes to generate seminiferous tubule structures and to initiate their functionality have as yet shown only limited success. Testes from 15 adult gender dysphoria patients (mean ± standard deviation age 35 ± 9.3 years) showing spermatogonial arrest became available for this study after sex-reassignment surgery. In vitro primary testicular somatic cell cultures were generated to explore the self-organizing ability of testicular somatic cells to form testis cords over a 2-week period. Morphological phenotype, protein marker expression and temporal dynamics of cell reassembly were analyzed. Cell suspensions obtained by two-step enzymatic digestion were plated onto glass coverslips in 24-well plates. To obtain adherent somatic cells, the supernatant was discarded on Day 2. The culture of the attached cell population was continued. Reassembly into cord-like structures was analyzed daily by microscopic observations. Endpoints were qualitative changes in morphology. Cell types were characterized by phase-contrast microscopy and immunohistochemistry. Dynamics of cord formation were recorded by time-lapse microscopy. Primary adult human testicular cells underwent sequential morphological changes including compaction and reaggregation resulting in round or elongated cord-like structures. Time-lapse video recordings within the first 4 days of culture revealed highly dynamic processes of migration and coalescence of reaggregated cells. The cellular movements were mediated by peritubular cells. Immunohistochemical analysis showed that both SRY-related high mobility box 9-positive Sertoli and α-smooth muscle actin-positive peritubular myoid cells

Relating structural parameters to leachability in a glass-bonded ceramic waste form

International Nuclear Information System (INIS)

Frank, S. M.; Johnson, S. G.; Moschetti, T. L.

1998-01-01

Lattice parameters for a crystalline material can be obtained by several methods, notably by analyzing x-ray powder diffraction patterns. By utilizing a computer program to fit a pattern, one can follow the evolution or subtle changes in a structure of a crystalline species in different environments. This work involves such a study for an essential component of the ceramic waste form that is under development at Argonne National Laboratory. Zeolite 4A and zeolite 5A are used to produce two different types of waste forms: a glass-bonded sodalite and a glass-bonded zeolite, respectively. Changes in structure during production of the waste forms are discussed. Specific salt-loadings in the sodalite waste form are related to relative peak intensities of certain reflections in the XRD patterns. Structural parameters for the final waste forms will also be given and related to leachability under standard conditions

Raman spectroscopy used for structural investigations of anodically formed ZrO2

International Nuclear Information System (INIS)

Koneska, Zagorka; Arsova, Irena

2003-01-01

The structure of the oxide formed on Zr(99% + Hf) with anodic oxidation at different potentials in 1 mol/dm 3 H 3 PO 4 and 2 mol/dm 3 KOH solutions were investigated using Raman spectroscopy. Normally the anodic oxides of Zr form only crystals. Under certain circumstances, amorphous anodic ZrO 2 can be observed. Amorphous phase is observed for the anodically formed zirconium oxides in H 3 PO 4 . The oxide formed in KOH at potential of 80 V, where sparks appears on the Zr electrode showed crystalline structure. (Original)

Crystal structure of glucagon-like peptide-1 in complex with the extracellular domain of the glucagon-like peptide-1 receptor.

Science.gov (United States)

Underwood, Christina Rye; Garibay, Patrick; Knudsen, Lotte Bjerre; Hastrup, Sven; Peters, Günther H; Rudolph, Rainer; Reedtz-Runge, Steffen

2010-01-01

GLP-1 (glucagon-like peptide-1) is an incretin released from intestinal L-cells in response to food intake. Activation of the GLP-1 receptor potentiates the synthesis and release of insulin from pancreatic beta-cells in a glucose-dependent manner. The GLP-1 receptor belongs to class B of the G-protein-coupled receptors, a subfamily characterized by a large N-terminal extracellular ligand binding domain. Exendin-4 and GLP-1 are 50% identical, and exendin-4 is a full agonist with similar affinity and potency for the GLP-1 receptor. We recently solved the crystal structure of the GLP-1 receptor extracellular domain in complex with the competitive antagonist exendin-4(9-39). Interestingly, the isolated extracellular domain binds exendin-4 with much higher affinity than the endogenous agonist GLP-1. Here, we have solved the crystal structure of the extracellular domain in complex with GLP-1 to 2.1 Aresolution. The structure shows that important hydrophobic ligand-receptor interactions are conserved in agonist- and antagonist-bound forms of the extracellular domain, but certain residues in the ligand-binding site adopt a GLP-1-specific conformation. GLP-1 is a kinked but continuous alpha-helix from Thr(13) to Val(33) when bound to the extracellular domain. We supplemented the crystal structure with site-directed mutagenesis to link the structural information of the isolated extracellular domain with the binding properties of the full-length receptor. The data support the existence of differences in the binding modes of GLP-1 and exendin-4 on the full-length GLP-1 receptor.

Modeling the Alzheimer Abeta17-42 fibril architecture: tight intermolecular sheet-sheet association and intramolecular hydrated cavities.

Science.gov (United States)

Zheng, Jie; Jang, Hyunbum; Ma, Buyong; Tsai, Chung-Jun; Nussinov, Ruth

2007-11-01

We investigate Abeta(17-42) protofibril structures in solution using molecular dynamics simulations. Recently, NMR and computations modeled the Abeta protofibril as a longitudinal stack of U-shaped molecules, creating an in-parallel beta-sheet and loop spine. Here we study the molecular architecture of the fibril formed by spine-spine association. We model in-register intermolecular beta-sheet-beta-sheet associations and study the consequences of Alzheimer's mutations (E22G, E22Q, E22K, and M35A) on the organization. We assess the structural stability and association force of Abeta oligomers with different sheet-sheet interfaces. Double-layered oligomers associating through the C-terminal-C-terminal interface are energetically more favorable than those with the N-terminal-N-terminal interface, although both interfaces exhibit high structural stability. The C-terminal-C-terminal interface is essentially stabilized by hydrophobic and van der Waals (shape complementarity via M35-M35 contacts) intermolecular interactions, whereas the N-terminal-N-terminal interface is stabilized by hydrophobic and electrostatic interactions. Hence, shape complementarity, or the "steric zipper" motif plays an important role in amyloid formation. On the other hand, the intramolecular Abeta beta-strand-loop-beta-strand U-shaped motif creates a hydrophobic cavity with a diameter of 6-7 A, allowing water molecules and ions to conduct through. The hydrated hydrophobic cavities may allow optimization of the sheet association and constitute a typical feature of fibrils, in addition to the tight sheet-sheet association. Thus, we propose that Abeta fiber architecture consists of alternating layers of tight packing and hydrated cavities running along the fibrillar axis, which might be possibly detected by high-resolution imaging.

Effect of glycation on α-crystallin structure and chaperone-like function

Science.gov (United States)

Kumar, P. Anil; Kumar, M. Satish; Reddy, G. Bhanuprakash

2007-01-01

The chaperone-like activity of α-crystallin is considered to play an important role in the maintenance of the transparency of the eye lens. However, in the case of aging and in diabetes, the chaperone function of α-crystallin is compromized, resulting in cataract formation. Several post-translational modifications, including non-enzymatic glycation, have been shown to affect the chaperone function of α-crystallin in aging and in diabetes. A variety of agents have been identified as the predominant sources for the formation of AGEs (advanced glycation end-products) in various tissues, including the lens. Nevertheless, glycation of α-crystallin with various sugars has resulted in divergent results. In the present in vitro study, we have investigated the effect of glucose, fructose, G6P (glucose 6-phosphate) and MGO (methylglyoxal), which represent the major classes of glycating agents, on the structure and chaperone function of α-crystallin. Modification of α-crystallin with all four agents resulted in the formation of glycated protein, increased AGE fluorescence, protein cross-linking and HMM (high-molecular-mass) aggregation. Interestingly, these glycation-related profiles were found to vary with different glycating agents. For instance, CML [Nϵ-(carboxymethyl)lysine] was the predominant AGE formed upon glycation of α-crystallin with these agents. Although fructose and MGO caused significant conformational changes, there were no significant structural perturbations with glucose and G6P. With the exception of MGO modification, glycation with other sugars resulted in decreased chaperone activity in aggregation assays. However, modification with all four sugars led to the loss of chaperone activity as assessed using an enzyme inactivation assay. Glycation-induced loss of α-crystallin chaperone activity was associated with decreased hydrophobicity. Furthermore, α-crystallin isolated from glycated TSP (total lens soluble protein) had also increased AGE

Diversity, assembly and regulation of archaeal type IV pili-like and non-type-IV pili-like surface structures.

Science.gov (United States)

Lassak, Kerstin; Ghosh, Abhrajyoti; Albers, Sonja-Verena

2012-01-01

Archaea have evolved fascinating surface structures allowing rapid adaptation to changing environments. The archaeal surface appendages display such diverse biological roles as motility, adhesion, biofilm formation, exchange of genetic material and species-specific interactions and, in turn, increase fitness of the cells. Intriguingly, despite sharing the same functions with their bacterial counterparts, the assembly mechanism of many archaeal surface structures is rather related to assembly of bacterial type IV pili. This review summarizes our state-of-the-art knowledge about unique structural and biochemical properties of archaeal surface appendages with a particular focus on archaeal type IV pili-like structures. The latter comprise not only widely distributed archaella (formerly known as archaeal flagella), but also different highly specialized archaeal pili, which are often restricted to certain species. Recent findings regarding assembly mechanisms, structural aspects and physiological roles of these type IV pili-like structures will be discussed in detail. Recently, first regulatory proteins involved in transition from both planktonic to sessile lifestyle and in assembly of archaella were identified. To conclude, we provide novel insights into regulatory mechanisms underlying the assembly of archaeal surface structures. Copyright © 2012. Published by Elsevier Masson SAS.

Does a Structured Data Collection Form Improve The Accuracy of ...

African Journals Online (AJOL)

and multiple etiologies for similar presentation. Standardized forms may harmonize the initial assessment, improve accuracy of diagnosis and enhance outcomes. Objectives: To determine the extent to which use of a structured data collection form (SDCF) affected the diagnostic accuracy of AAP. Methodology: A before and ...

Shock-like structures in the tropical cyclone boundary layer

Science.gov (United States)

Williams, Gabriel J.; Taft, Richard K.; McNoldy, Brian D.; Schubert, Wayne H.

2013-06-01

This paper presents high horizontal resolution solutions of an axisymmetric, constant depth, slab boundary layer model designed to simulate the radial inflow and boundary layer pumping of a hurricane. Shock-like structures of increasing intensity appear for category 1-5 hurricanes. For example, in the category 3 case, the u>(∂u/∂r>) term in the radial equation of motion produces a shock-like structure in the radial wind, i.e., near the radius of maximum tangential wind the boundary layer radial inflow decreases from approximately 22 m s-1 to zero over a radial distance of a few kilometers. Associated with this large convergence is a spike in the radial distribution of boundary layer pumping, with updrafts larger than 22 m s-1 at a height of 1000 m. Based on these model results, it is argued that observed hurricane updrafts of this magnitude so close to the ocean surface are attributable to the dry dynamics of the frictional boundary layer rather than moist convective dynamics. The shock-like structure in the boundary layer radial wind also has important consequences for the evolution of the tangential wind and the vertical component of vorticity. On the inner side of the shock the tangential wind tendency is essentially zero, while on the outer side of the shock the tangential wind tendency is large due to the large radial inflow there. The result is the development of a U-shaped tangential wind profile and the development of a thin region of large vorticity. In many respects, the model solutions resemble the remarkable structures observed in the boundary layer of Hurricane Hugo (1989).

G345.45+1.50: an expanding ring-like structure with massive star formation

Science.gov (United States)

López-Calderón, Cristian; Bronfman, Leonardo; Nyman, Lars-Åke; Garay, Guido; de Gregorio-Monsalvo, Itziar; Bergman, Per

2016-11-01

Context. Ring-like structures in the interstellar medium (ISM) are commonly associated with high-mass stars. Kinematic studies of large structures in giant molecular clouds (GMCs) toward these ring-like structures may help us to understand how massive stars form. Aims: The origin and properties of the ring-like structure G345.45+1.50 is investigated through observations of the 13CO(3-2) line. The aim of the observations is to determine the kinematics in the region and to compare physical characteristics estimated from gas emission with those previously determined using dust continuum emission. This area in the sky is well suited for studies like this because the ring is located 1.5° above the Galactic plane at 1.8 kpc from the Sun, thus molecular structures are rarely superposed on our line of sight, which minimizes confusion effects that might hinder identifying of individual molecular condensations. Methods: The 13CO(3-2) line was mapped toward the whole ring using the Atacama Pathfinder Experiment (APEX) telescope. The observations cover 17' × 20' in the sky with a spatial resolution of 0.2 pc and an rms of 1 K at a spectral resolution of 0.1 km s-1. Results: The ring is found to be expanding with a velocity of 1.0 km s-1, containing a total mass of 6.9 × 103M⊙, which agrees well with that determined using 1.2 mm dust continuum emission. An expansion timescale of 3 × 106 yr and a total energy of 7 × 1046 erg are estimated. The origin of the ring might have been a supernova explosion, since a 35.5 cm source, J165920-400424, is located at the center of the ring without an infrared counterpart. The ring is fragmented, and 104 clumps were identified with diameters of between 0.3 and 1.6 pc, masses of between 2.3 and 7.5 × 102M⊙, and densities of between 102 and 104 cm-3. At least 18% of the clumps are forming stars, as is shown in infrared images. Assuming that the clumps can be modeled as Bonnor-Ebert spheres, 13 clumps are collapsing, and the rest of

Preparation of disk-like particles with micro/nano hierarchical structures.

Science.gov (United States)

Meng, Zhen; Yang, Wenbo; Chen, Pengpeng; Wang, Weina; Jia, Xudong; Xi, Kai

2013-10-15

A facile, reproductive method has been successfully developed to produce disk-like microparticles self-assembled from monodispersed hybrid silica nanoparticles under certain circumstance. The disk-like microparticles with micro/nano hierarchical structures could be obtained in large amount under a mild condition and further used to biomimetic design of the superhydrophobic surface of lotus leaf. After traditional surface modification with dodecyltrichlorosiliane, the static contact angle of water on the surface with micro/nano hierarchical structure could reach 168.8°. The method of surface modification could be further simplified by click reaction with the introduction of thiol groups under mild condition. The present strategy for constructing the surface with micro/nano hierarchical structures offers the advantage of simple and large area fabrication, which enables a variety of superhydrophobic applications. Copyright © 2013 Elsevier Inc. All rights reserved.

A Histone-Like Protein Induces Plasmid DNA to Form Liquid Crystals in Vitro and Gene Compaction in Vivo

Directory of Open Access Journals (Sweden)

Shiyong Sun

2013-12-01

Full Text Available The liquid crystalline state is a universal phenomenon involving the formation of an ordered structure via a self-assembly process that has attracted attention from numerous scientists. In this study, the dinoflagellate histone-like protein HCcp3 is shown to induce super-coiled pUC18 plasmid DNA to enter a liquid crystalline state in vitro, and the role of HCcp3 in gene condensation in vivo is also presented. The plasmid DNA (pDNA-HCcp3 complex formed birefringent spherical particles with a semi-crystalline selected area electronic diffraction (SAED pattern. Circular dichroism (CD titrations of pDNA and HCcp3 were performed. Without HCcp3, pUC18 showed the characteristic B conformation. As the HCcp3 concentration increased, the 273 nm band sharply shifted to 282 nm. When the HCcp3 concentration became high, the base pair (bp/dimer ratio fell below 42/1, and the CD spectra of the pDNA-HCcp3 complexes became similar to that of dehydrated A-form DNA. Microscopy results showed that HCcp3 compacted the super-coiled gene into a condensed state and that inclusion bodies were formed. Our results indicated that HCcp3 has significant roles in gene condensation both in vitro and in histone-less eukaryotes in vivo. The present study indicates that HCcp3 has great potential for applications in non-viral gene delivery systems, where HCcp3 may compact genetic material to form liquid crystals.

High resolution crystal structure of PedB: a structural basis for the classification of pediocin-like immunity proteins

Directory of Open Access Journals (Sweden)

Cha Sun-Shin

2007-05-01

Full Text Available Abstract Background Pediocin-like bacteriocins, ribosomally-synthesized antimicrobial peptides, are generally coexpressed with cognate immunity proteins in order to protect the bacteriocin-producer from its own bacteriocin. As a step for understanding the mode of action of immunity proteins, we determined the crystal structure of PedB, a pediocin-like immunity protein conferring immunity to pediocin PP-1. Results The 1.6 Å crystal structure of PedB reveals that PedB consists of an antiparallel four-helix bundle with a flexible C-terminal end. PedB shows structural similarity to an immunity protein against enterocin A (EntA-im but some disparity to an immunity protein against carnobacteriocin B2 (ImB2 in both the C-terminal conformation and the local structure constructed by α3, α4, and their connecting loop. Structure-inspired mutational studies reveal that deletion of the last seven residues of the C-terminus of PedB almost abolished its immunity activity. Conclusion The fact that PedB, EntA-im, and ImB2 share a four-helix bundle structure strongly suggests the structural conservation of this motif in the pediocin-like immunity proteins. The significant difference in the core structure and the C-terminal conformation provides a structural basis for the classification of pediocin-like immunity proteins. Our mutational study using C-terminal-shortened PedBs and the investigation of primary sequence of the C-terminal region, propose that several polar or charged residues in the extreme C-terminus of PedB which is crucial for the immunity are involved in the specific recognition of pediocin PP-1.

Superhydrophobic surface based on a coral-like hierarchical structure of ZnO.

Directory of Open Access Journals (Sweden)

Jun Wu

2010-12-01

Full Text Available Fabrication of superhydrophobic surfaces has attracted much interest in the past decade. The fabrication methods that have been studied are chemical vapour deposition, the sol-gel method, etching technique, electrochemical deposition, the layer-by-layer deposition, and so on. Simple and inexpensive methods for manufacturing environmentally stable superhydrophobic surfaces have also been proposed lately. However, work referring to the influence of special structures on the wettability, such as hierarchical ZnO nanostructures, is rare.This study presents a simple and reproducible method to fabricate a superhydrophobic surface with micro-scale roughness based on zinc oxide (ZnO hierarchical structure, which is grown by the hydrothermal method with an alkaline aqueous solution. Coral-like structures of ZnO were fabricated on a glass substrate with a micro-scale roughness, while the antennas of the coral formed the nano-scale roughness. The fresh ZnO films exhibited excellent superhydrophilicity (the apparent contact angle for water droplet was about 0°, while the ability to be wet could be changed to superhydrophobicity after spin-coating Teflon (the apparent contact angle greater than 168°. The procedure reported here can be applied to substrates consisting of other materials and having various shapes.The new process is convenient and environmentally friendly compared to conventional methods. Furthermore, the hierarchical structure generates the extraordinary solid/gas/liquid three-phase contact interface, which is the essential characteristic for a superhydrophobic surface.

Magnetic topology of Co-based inverse opal-like structures

NARCIS (Netherlands)

Grigoryeva, N.A.; Mistonov, A.A.; Napolskii, K.S.; Sapoletova, N.A.; Eliseev, A.A.; Bouwman, W.; Byelov, D.; Petukhov, A.V.; Chernyshov, D.Y.; Eckerlebe, H.; Vasilieva, A.V.; Grigoriev, S.V.

2011-01-01

Themagnetic and structural properties of a cobalt inverse opal-like crystal have been studied by a combination of complementary techniques ranging from polarized neutron scattering and superconducting quantum interference device (SQUID) magnetometry to x-ray diffraction. Microradian small-angle

Micro-/nano-characterization of the surface structures on the divertor tiles from JET ITER-like wall

Energy Technology Data Exchange (ETDEWEB)

Tokitani, M., E-mail: tokitani.masayuki@LHD.nifs.ac.jp [National Institute for Fusion Science, Oroshi, Toki, Gifu 509-5292 (Japan); Miyamoto, M. [Shimane University, Matsue, Shimane 690-8504 (Japan); Masuzaki, S. [National Institute for Fusion Science, Oroshi, Toki, Gifu 509-5292 (Japan); Fujii, Y. [Shimane University, Matsue, Shimane 690-8504 (Japan); Sakamoto, R. [National Institute for Fusion Science, Oroshi, Toki, Gifu 509-5292 (Japan); Oya, Y. [Shizuoka University, Shizuoka 422-8529 (Japan); Hatano, Y. [University of Toyama, Toyama 930-8555 (Japan); Otsuka, T. [Kindai University, Higashi-Osaka, Osaka, 577-8502 (Japan); Oyaidzu, M.; Kurotaki, H.; Suzuki, T.; Hamaguchi, D.; Isobe, K.; Asakura, N. [National Institute for Quantum and Radiological Science and Technology (QST), Rokkasho Aomori 039-3212 (Japan); Widdowson, A. [EUROfusion Consortium, JET, Culham Science Centre, Abingdon, OX14 3DB (United Kingdom); Rubel, M. [Royal Institute of Technology (KTH), 100 44 Stockholm (Sweden)

2017-03-15

Highlights: • Micro-/nano-characterization of the surface structures on the divertor tiles from JET ITER-like wall were studied. • The stratified mixed-material deposition layer composed by W, C, O, Mo and Be with the thickness of ∼1.5 μm was formed on the apron of Tile 1. • The study revealed the micro- and nano-scale modification of the inner tile surface of the JET ILW. - Abstract: Micro-/nano-characterization of the surface structures on the divertor tiles used in the first campaign (2011–2012) of the JET tokamak with the ITER-like wall (JET ILW) were studied. The analyzed tiles were a single poloidal section of the tile numbers of 1, 3 and 4, i.e., upper, vertical and horizontal targets, respectively. A sample from the apron of Tile 1 was deposition-dominated. Stratified mixed-material layers composed of Be, W, Ni, O and C were deposited on the original W-coating. Their total thickness was ∼1.5 μm. By means of transmission electron microscopy, nano-size bubble-like structures with a size of more than 100 nm were identified in that layer. They could be related to deuterium retention in the layer dominated by Be. The surface microstructure of the sample from Tile 4 also showed deposition: a stratified mixed-material layer with the total thickness of 200–300 nm. The electron diffraction pattern obtained with transmission electron microscope indicated Be was included in the layer. No bubble-like structures have been identified. The surface of Tile 3, originally coated by Mo, was identified as the erosion zone. This is consistent with the fact that the strike point was often located on that tile during the plasma operation. The study revealed the micro- and nano-scale modification of the inner tile surface of the JET ILW. In particular, a complex mixed-material deposition layer could affect hydrogen isotope retention and dust formation.

Complete flexural vibration band gaps in membrane-like lattice structures

International Nuclear Information System (INIS)

Yu Dianlong; Liu Yaozong; Qiu Jing; Wang Gang; Zhao Honggang

2006-01-01

The propagation of flexural vibration in the periodical membrane-like lattice structure is studied. The band structure calculated with the plane wave expansion method indicates the existence of complete gaps. The frequency response function of a finite periodic structure is simulated with finite element method. Frequency ranges with vibration attenuation are in good agreement with the gaps found in the band structure. Much larger attenuations are found in the complete gaps comparing to those directional ones. The existence of complete flexural vibration gaps in such a lattice structure provides a new idea for vibration control of thin plates

ARE TORNADO-LIKE MAGNETIC STRUCTURES ABLE TO SUPPORT SOLAR PROMINENCE PLASMA?

Energy Technology Data Exchange (ETDEWEB)

Luna, M.; Moreno-Insertis, F. [Instituto de Astrofísica de Canarias, E-38200 La Laguna, Tenerife (Spain); Priest, E. [Mathematics Institute, University of St Andrews, St Andrews KY16 9SS (United Kingdom)

2015-07-20

Recent high-resolution and high-cadence observations have surprisingly suggested that prominence barbs exhibit apparent rotating motions suggestive of a tornado-like structure. Additional evidence has been provided by Doppler measurements. The observations reveal opposite velocities for both hot and cool plasma on the two sides of a prominence barb. This motion is persistent for several hours and has been interpreted in terms of rotational motion of prominence feet. Several authors suggest that such barb motions are rotating helical structures around a vertical axis similar to tornadoes on Earth. One of the difficulties of such a proposal is how to support cool prominence plasma in almost-vertical structures against gravity. In this work we model analytically a tornado-like structure and try to determine possible mechanisms to support the prominence plasma. We have found that the Lorentz force can indeed support the barb plasma provided the magnetic structure is sufficiently twisted and/or significant poloidal flows are present.

ARE TORNADO-LIKE MAGNETIC STRUCTURES ABLE TO SUPPORT SOLAR PROMINENCE PLASMA?

International Nuclear Information System (INIS)

Luna, M.; Moreno-Insertis, F.; Priest, E.

2015-01-01

Recent high-resolution and high-cadence observations have surprisingly suggested that prominence barbs exhibit apparent rotating motions suggestive of a tornado-like structure. Additional evidence has been provided by Doppler measurements. The observations reveal opposite velocities for both hot and cool plasma on the two sides of a prominence barb. This motion is persistent for several hours and has been interpreted in terms of rotational motion of prominence feet. Several authors suggest that such barb motions are rotating helical structures around a vertical axis similar to tornadoes on Earth. One of the difficulties of such a proposal is how to support cool prominence plasma in almost-vertical structures against gravity. In this work we model analytically a tornado-like structure and try to determine possible mechanisms to support the prominence plasma. We have found that the Lorentz force can indeed support the barb plasma provided the magnetic structure is sufficiently twisted and/or significant poloidal flows are present

Are Tornado-Like Magnetic Structures Able to Support Solar Prominence Plasma?

Science.gov (United States)

Ogunjo, S. T.; Luna Bennasar, M.; Moreno-Insertis, F.; Priest, E. R.

2015-12-01

Recent high-resolution and high-cadence observations have surprisingly suggested that prominence barbs exhibit apparent rotating motions suggestive of a tornado-like structure. Additional evidence has been provided by Doppler measurements. The observations reveal opposite velocities for both hot and cool plasma on the two sides of a prominence barb. This motion is persistent for several hours and has been interpreted in terms of rotational motion of prominence feet. Several authors suggest that such barb motions are rotating helical structures around a vertical axis similar to tornadoes on Earth. One of the difficulties of such a proposal is how to support cool prominence plasma in almost-vertical structures against gravity. In this work we model analytically a tornado-like structure and try to determine possible mechanisms to support the prominence plasma. We have found that the Lorentz force can indeed support the barb plasma provided the magnetic structure is sufficiently twisted and/or significant poloidal flows are present.

Magnetic topology of Co-based inverse opal-like structures

NARCIS (Netherlands)

Grigoryeva, N.A.; Mistonov, A.A.; Napolskii, K.S.; Sapoletova, N.A.; Eliseev, A.A.; Bouwman, W.G.; Byelov, D.V.; Petukhov, A.V.; Chernyshov, D.Y.; Eckerlebe, H.; Vasilieva, A.V.; Grigoriev, S.V.

2011-01-01

The magnetic and structural properties of a cobalt inverse opal-like crystal have been studied by a combination of complementary techniques ranging from polarized neutron scattering and superconducting quantum interference device (SQUID) magnetometry to x-ray diffraction. Microradian small-angle

Salt-occluded zeolite waste forms: Crystal structures and transformability

International Nuclear Information System (INIS)

Richardson, J.W. Jr.

1996-01-01

Neutron diffraction studies of salt-occluded zeolite and zeolite/glass composite samples, simulating nuclear waste forms loaded with fission products, have revealed complex structures, with cations assuming the dual roles of charge compensation and occlusion (cluster formation). These clusters roughly fill the 6--8 angstrom diameter pores of the zeolites. Samples are prepared by equilibrating zeolite-A with complex molten Li, K, Cs, Sr, Ba, Y chloride salts, with compositions representative of anticipated waste systems. Samples prepared using zeolite 4A (which contains exclusively sodium cations) as starting material are observed to transform to sodalite, a denser aluminosilicate framework structure, while those prepared using zeolite 5A (sodium and calcium ions) more readily retain the zeolite-A structure. Because the sodalite framework pores are much smaller than those of zeolite-A, clusters are smaller and more rigorously confined, with a correspondingly lower capacity for waste containment. Details of the sodalite structures resulting from transformation of zeolite-A depend upon the precise composition of the original mixture. The enhanced resistance of salt-occluded zeolites prepared from zeolite 5A to sodalite transformation is thought to be related to differences in the complex chloride clusters present in these zeolite mixtures. Data relating processing conditions to resulting zeolite composition and structure can be used in the selection of processing parameters which lead to optimal waste forms

Calibrated and Interactive Modelling of Form-Active Hybrid Structures

DEFF Research Database (Denmark)

Quinn, Gregory; Holden Deleuran, Anders; Piker, Daniel

2016-01-01

Form-active hybrid structures (FAHS) couple two or more different structural elements of low self weight and low or negligible bending flexural stiffness (such as slender beams, cables and membranes) into one structural assembly of high global stiffness. They offer high load-bearing capacity...... software packages which introduce interruptions and data exchange issues in the modelling pipeline. The mechanical precision, stability and open software architecture of Kangaroo has facilitated the development of proof-of-concept modelling pipelines which tackle this challenge and enable powerful...... materially-informed sketching. Making use of a projection-based dynamic relaxation solver for structural analysis, explorative design has proven to be highly effective....

Probabilistic Seismic Performance Model for Tunnel Form Concrete Building Structures

Directory of Open Access Journals (Sweden)

S. Bahram Beheshti Aval

2016-12-01

Full Text Available Despite widespread construction of mass-production houses with tunnel form structural system across the world, unfortunately no special seismic code is published for design of this type of construction. Through a literature survey, only a few studies are about the seismic behavior of this type of structural system. Thus based on reasonable numerical results, the seismic performance of structures constructed with this technique considering the effective factors on structural behavior is highly noteworthy in a seismic code development process. In addition, due to newness of this system and observed damages in past earthquakes, and especially random nature of future earthquakes, the importance of probabilistic approach and necessity of developing fragility curves in a next generation Performance Based Earthquake Engineering (PBEE frame work are important. In this study, the seismic behavior of 2, 5 and 10 story tunnel form structures with a regular plan is examined. First, the performance levels of these structures under the design earthquake (return period of 475 years with time history analysis and pushover method are assessed, and then through incremental dynamic analysis, fragility curves are extracted for different levels of damage in walls and spandrels. The results indicated that the case study structures have high capacity and strength and show appropriate seismic performance. Moreover, all three structures subjected were in immediate occupancy performance level.

Cholesky-like Factorization of Symmetric Indefinite Matrices and Orthogonalization with Respect to Bilinear Forms

Czech Academy of Sciences Publication Activity Database

Rozložník, Miroslav; Okulicka-Dłużewska, F.; Smoktunowicz, A.

2015-01-01

Roč. 36, č. 2 (2015), s. 727-751 ISSN 0895-4798 R&D Projects: GA ČR(CZ) GAP108/11/0853 Institutional support: RVO:67985807 Keywords : symmetric indefinite matrices * Cholesky-like factorization * orthogonalization techniques * indefinite bilinear forms * Gram-Schmidt process * rounding error analysis Subject RIV: BA - General Mathematics Impact factor: 1.883, year: 2015

Features of ultrafine-grained structure forming in Zr-1Nb alloy

Energy Technology Data Exchange (ETDEWEB)

Stepanova, Ekaterina N.; Prosolov, Konstantin A. [National Research Tomsk Polytechnic University, Tomsk (Russian Federation); Grabovetskaya, Galina P.; Mishin, Ivan P. [Institute of Strength Physics and Materials Science of Siberian Branch of Russian Academy of Sciences, Tomsk (Russian Federation)

2013-07-01

Ultrafine-grained structure forming by the method combined reversible hydrogenation and hot pressing in Zr-1Nb alloy was investigated. Preliminary hydrogenation to concentrations of (0.14–0.4) % at 873 K is found to lead to yield strength decreasing in Zr-1Nb alloy during hot pressing by 1,5–2 times. During uniaxial compression at (70–72) % under isothermal conditions at a temperature of 873 K in Zr-1Nb alloy, hydrogenated to concentration of 0.22 %, homogeneous ultrafine grained structure with an average grain size of 0,4 P m was formed. Key words: zirconium alloy, ultrafine-grained structure, hydrogen.

Structuring free form verbal descriptions in equipment failure reports

International Nuclear Information System (INIS)

Huzdovich, J.

1983-01-01

Information is encoded for convenience in computer sort/search routines used to manage a large number of records. The codes in use for equipment failure reports are limited due to practical considerations, and this limitation forces the reporter to leave out information to satisfy the coding requirements. The free form verbal descriptions, as found in the Generating Availability Data System (GADS) and the Nuclear Plant Reliability Data System (NPRDS), allow for reporting of this non-codable information. A systematic approach to constructing the verbal description based on rules of grammar, especially syntax, results in a structured narrative suitable for computer data management schemes. In addition, the reporter has a full range of descriptive terminology and does not have to select subjectively from a predetermined, limited vocabulary to describe the event. This paper introduces a concept that places in perspective the integration of structured, formal reporting and free form verbal description. A second benefit of this structured narrative is the systematic development of failure mode/failure cause relationships in the event

Crystal Structure of Glucagon-like Peptide-1 in Complex with the Extracellular Domain of the Glucagon-like Peptide-1 Receptor*

Science.gov (United States)

Underwood, Christina Rye; Garibay, Patrick; Knudsen, Lotte Bjerre; Hastrup, Sven; Peters, Günther H.; Rudolph, Rainer; Reedtz-Runge, Steffen

2010-01-01

GLP-1 (glucagon-like peptide-1) is an incretin released from intestinal L-cells in response to food intake. Activation of the GLP-1 receptor potentiates the synthesis and release of insulin from pancreatic β-cells in a glucose-dependent manner. The GLP-1 receptor belongs to class B of the G-protein-coupled receptors, a subfamily characterized by a large N-terminal extracellular ligand binding domain. Exendin-4 and GLP-1 are 50% identical, and exendin-4 is a full agonist with similar affinity and potency for the GLP-1 receptor. We recently solved the crystal structure of the GLP-1 receptor extracellular domain in complex with the competitive antagonist exendin-4(9–39). Interestingly, the isolated extracellular domain binds exendin-4 with much higher affinity than the endogenous agonist GLP-1. Here, we have solved the crystal structure of the extracellular domain in complex with GLP-1 to 2.1 Åresolution. The structure shows that important hydrophobic ligand-receptor interactions are conserved in agonist- and antagonist-bound forms of the extracellular domain, but certain residues in the ligand-binding site adopt a GLP-1-specific conformation. GLP-1 is a kinked but continuous α-helix from Thr13 to Val33 when bound to the extracellular domain. We supplemented the crystal structure with site-directed mutagenesis to link the structural information of the isolated extracellular domain with the binding properties of the full-length receptor. The data support the existence of differences in the binding modes of GLP-1 and exendin-4 on the full-length GLP-1 receptor. PMID:19861722

Fibrinogen and fibrin.

Science.gov (United States)

Weisel, John W

2005-01-01

Fibrinogen is a large, complex, fibrous glycoprotein with three pairs of polypeptide chains linked together by 29 disulfide bonds. It is 45 nm in length, with globular domains at each end and in the middle connected by alpha-helical coiled-coil rods. Both strongly and weakly bound calcium ions are important for maintenance of fibrinogen's structure and functions. The fibrinopeptides, which are in the central region, are cleaved by thrombin to convert soluble fibrinogen to insoluble fibrin polymer, via intermolecular interactions of the "knobs" exposed by fibrinopeptide removal with "holes" always exposed at the ends of the molecules. Fibrin monomers polymerize via these specific and tightly controlled binding interactions to make half-staggered oligomers that lengthen into protofibrils. The protofibrils aggregate laterally to make fibers, which then branch to yield a three-dimensional network-the fibrin clot-essential for hemostasis. X-ray crystallographic structures of portions of fibrinogen have provided some details on how these interactions occur. Finally, the transglutaminase, Factor XIIIa, covalently binds specific glutamine residues in one fibrin molecule to lysine residues in another via isopeptide bonds, stabilizing the clot against mechanical, chemical, and proteolytic insults. The gene regulation of fibrinogen synthesis and its assembly into multichain complexes proceed via a series of well-defined steps. Alternate splicing of two of the chains yields common variant molecular isoforms. The mechanical properties of clots, which can be quite variable, are essential to fibrin's functions in hemostasis and wound healing. The fibrinolytic system, with the zymogen plasminogen binding to fibrin together with tissue-type plasminogen activator to promote activation to the active enzyme plasmin, results in digestion of fibrin at specific lysine residues. Fibrin(ogen) also specifically binds a variety of other proteins, including fibronectin, albumin

Structure of a second crystal form of Bence-Jones protein Loc: Strikingly different domain associations in two crystal forms of a single protein

International Nuclear Information System (INIS)

Schiffer, M.; Ainsworth, C.; Xu, Z.B.; Carperos, W.; Olsen, K.; Solomon, A.; Stevens, F.J.; Chang, C.H.

1989-01-01

The authors have determined the structure of the immunoglobulin light-chain dimer Loc in a second crystal form that was grown from distilled water. The crystal structure was determined to 2.8-angstrom resolution; the R factor is 0.22. The two variable domains are related by local 2-fold axes and form an antigen binding pocket. The variable domain-variable domain interaction observed in this crystal form differs from the one exhibited by the protein when crystallized from ammonium sulfate in which the two variable domains formed a protrusion. The structure attained in the distilled water crystals is similar to, but not identical with, the one observed for the Mcg light-chain dimer in crystals grown from ammonium sulfate. Thus, two strikingly different structures were attained by this multisubunit protein in crystals grown under two different, commonly used, crystallization techniques. The quaternary interactions exhibited by the protein in the two crystal forms are sufficiently different to suggest fundamentally different interpretations of the structural basis for the function of this protein. This observation may have general implications regarding the use of single crystallographic determinations for detailed identification of structural and functional relationships. On the other hand, proteins whose structures can be altered by manipulation of crystallization conditions may provide useful systems for study of fundamental structural chemistry

New forms of inequality and structures of glam-capitalism

OpenAIRE

IVANOV DMITRY

2016-01-01

The long history of capitalism can be interpreted as an evolution driven by permanently mutating socioeconomic structures. The article is devoted to new forms of inequality that emerged during the postindustrial phase of the capitalism evolution and increase the structural complexity of contemporary societies. The spatial configuration of inequality transforms while globalization has resulted not in the ‘world society’ but rather in a transnational network of the globality enclaves: the large...

Decision structures in franchise systems of the plural form

OpenAIRE

Kranz, Sebastian; Lewin-Solomons, Shira B.

2008-01-01

Many successful franchise chains directly own a positive fraction of stores --- a structure referred to as plural form. We propose that this ownership structure is chosen as a commitment not to expropriate franchisees. The theoretical model is based on an empirical analysis of contract and interview data from the US fast-food sector and well known stylized facts: First, franchisees typically have strong contractual obligations to implement activities selected by the chain. Second, franchisees...

Cavitation structures formed during the rebound of a sphere from a wetted surface

KAUST Repository

Marston, Jeremy; Wang, Yong; Ng, Waikiong; Tan, Reginald; Thoroddsen, Sigurdur T

2010-01-01

We use high-speed imaging to observe the dynamics of cavitation, caused by the impact and subsequent rebound of a sphere from a solid surface covered with a thin layer of highly viscous liquid. We note marked qualitative differences between the cavitation structures with increase in viscosity, as well as between Newtonian and non-Newtonian liquids. The patterns observed are quite unexpected and intricate, appearing in concentric ring formations around the site of impact. In all cases, we identify a distinct radius from which the primary bubbles emanate. This radius is modelled with a modified form of Hertz contact theory. Within this radius, we show that some fine cavitation structure may exist or that it may be one large cavitation bubble. For the non-Newtonian fluids, we observe foam-like structures extending radially with diminishing bubble sizes with increase in radial position. Whereas for the Newtonian fluids, the opposite trend is observed with increasing bubble size for increasing radial position. Finally, we compare our experimental observations of cavitation to the maximum tension criterion proposed by Joseph (J Fluid Mech 366:367-378, 1998) showing that this provides the lower limit for the onset of cavitation in our experiments. © 2010 Springer-Verlag.

Cavitation structures formed during the rebound of a sphere from a wetted surface

KAUST Repository

Marston, Jeremy

2010-09-28

We use high-speed imaging to observe the dynamics of cavitation, caused by the impact and subsequent rebound of a sphere from a solid surface covered with a thin layer of highly viscous liquid. We note marked qualitative differences between the cavitation structures with increase in viscosity, as well as between Newtonian and non-Newtonian liquids. The patterns observed are quite unexpected and intricate, appearing in concentric ring formations around the site of impact. In all cases, we identify a distinct radius from which the primary bubbles emanate. This radius is modelled with a modified form of Hertz contact theory. Within this radius, we show that some fine cavitation structure may exist or that it may be one large cavitation bubble. For the non-Newtonian fluids, we observe foam-like structures extending radially with diminishing bubble sizes with increase in radial position. Whereas for the Newtonian fluids, the opposite trend is observed with increasing bubble size for increasing radial position. Finally, we compare our experimental observations of cavitation to the maximum tension criterion proposed by Joseph (J Fluid Mech 366:367-378, 1998) showing that this provides the lower limit for the onset of cavitation in our experiments. © 2010 Springer-Verlag.

Seismic Failure Mechanism of Reinforced Cold-Formed Steel Shear Wall System Based on Structural Vulnerability Analysis

Directory of Open Access Journals (Sweden)

Jihong Ye

2017-02-01

Full Text Available A series of structural vulnerability analyses are conducted on a reinforced cold-formed steel (RCFS shear wall system and a traditional cold-formed steel (CFS shear wall system subjected to earthquake hazard based on forms in order to investigate their failure mechanisms. The RCFS shear wall adopts rigid beam-column joints and continuous concrete-filled CFS tube end studs rather than coupled-C section end studs that are used in traditional CFS shear walls, to achieve the rigid connections in both beam-column joints and column bases. The results show that: the RCFS and traditional CFS shear wall systems both exhibit the maximum vulnerability index associated with the failure mode in the first story. Therefore, the first story is likely to be a weakness of the CFS shear wall system. Once the wall is damaged, the traditional CFS shear wall system would collapse because the shear wall is the only lateral-resisting component. However, the collapse resistance of the RCFS shear wall system is effectively enhanced by the second defense, which is provided by a framework integrated by rigid beam-column joints and fixed column bases. The predicted collapse mode with maximum vulnerability index that was obtained by structural vulnerability analysis agrees well with the experimental result, and the structural vulnerability method is thereby verified to be reasonable to identify the weaknesses of framed structures and predict their collapse modes. Additionally, the quantitative vulnerability index indicates that the RCFS shear wall system exhibits better robustness compared to the traditional one. Furthermore, the “strong frame weak wallboard” and the “strong column weak beam” are proposed in this study as conceptional designations for the RCFS shear wall systems.

Characterization of lead nanoparticles formed by Shewanella sp. KR-12

Energy Technology Data Exchange (ETDEWEB)

Liu, Chien-Liang; Yen, Jui-Hung, E-mail: sonny@ntu.edu.tw [National Taiwan University, Department of Agricultural Chemistry (China)

2016-01-15

The bacterial strain KR-12 was isolated from river sediment in northeast Taiwan. 16S rRNA gene sequencing revealed that it belongs to the genus Shewanella. The strain can accumulate lead (Pb) and form Pb nanoparticles (PbNPs) on exposure to Pb(NO{sub 3}){sub 2} and sodium formate in HEPES buffer. On transmission electron microscopy (TEM), the KR-12-formed PbNPs were spherical in shape and ranged from 3 to 8 nm. The PbNPs formed a line or curved pattern on bacteria. In addition, one or more pilus-like structures elongated from the bacteria. In contrast, Shewanella oneidensis MR-1 and other bacteria could not form PbNPs pattern or pilus-like structure under the same conditions. High-resolution TEM combined with energy-dispersive X-ray spectroscopy demonstrated that these PbNPs primarily contained Pb and had an amorphous structure. This is the first report of the biosynthesis of PbNPs by a Shewanella species.

What women like: influence of motion and form on esthetic body perception

Directory of Open Access Journals (Sweden)

Valentina eCazzato

2012-07-01

Full Text Available Several studies have shown the distinct contribution of motion and form to the esthetic evaluation of female bodies. Here, we investigated how variations of implied motion and body size interact in the esthetic evaluation of female and male bodies in a sample of young healthy women. Participants provided attractiveness, beauty, and liking ratings for the shape and posture of virtual renderings of human bodies with variable body size and implied motion. The esthetic judgments for both shape and posture of human models were influenced by body size and implied motion, with a preference for thinner and more dynamic stimuli. Implied motion, however, attenuated the impact of extreme body size on the esthetic evaluation of body postures, and body size variations did not affect the preference for more dynamic stimuli. Results show that body form and action cues interact in esthetic perception, but the final esthetic appreciation of human bodies is predicted by a mixture of perceptual and affective evaluative components.

Ring and Volcano Structures Formed by a Metal Dipyrromethene Complex

Energy Technology Data Exchange (ETDEWEB)

Son, Seung Bae; Hahn, Jae Ryang [Chonbuk National Univ., Jeonju (Korea, Republic of); Miao, Qing; Shin, Jiyoung; Dolphin, David [Univ. of British Columbia, Columbia (Canada)

2014-06-15

Dichloromethane liquid droplets containing a cobalt dipyrromethene trimer deposited on a graphite surface were found to form coffee ring, toroid ring, or volcano dot structures due to the redistribution of the solute during solvent evaporation. The shapes and size distributions of the ring structures depended on the drying temperature. The shape differences were attributed to the fact that the solvent evaporation rate controlled the self-assembly process that yielded the coffee stain and pinhole structures.

Properties of complex tungstates, niobates, translated with fluorite-like structure

International Nuclear Information System (INIS)

Vetkina, S.N.; Zolin, V.F.; Sirotinkin, V.P.; Smirnov, S.A.

1989-01-01

Spectra of ternary tungstates, niobates and tantalates (MeLa 2 WO 7 , La 3 TO 7 ; Me=Ba, Sr; T=Ta, Nb) related to the layered fluorite group are analyzed. The laser pumping and time resolved luminescence are used for selecting spectra of unequivalent centers. The symmetry of the first center is near to the distorted cubic one. The vibrational spectra of europium in Eu 3 NbO 7 and SrLa 2 WO 7 are due to the chain-like structure of niobates and to the net-like structure of tantalates. The stimulated emission of Nd 3+ in powders of BaLa 2 WO 7 and La 3 NbO 7 is observed at wavelengths of 1.07 and 1.063 μm, respectively

Catalyst support structure, catalyst including the structure, reactor including a catalyst, and methods of forming same

Science.gov (United States)

Van Norman, Staci A.; Aston, Victoria J.; Weimer, Alan W.

2017-05-09

Structures, catalysts, and reactors suitable for use for a variety of applications, including gas-to-liquid and coal-to-liquid processes and methods of forming the structures, catalysts, and reactors are disclosed. The catalyst material can be deposited onto an inner wall of a microtubular reactor and/or onto porous tungsten support structures using atomic layer deposition techniques.

Crystal structure of the ligand-bound glucagon-like peptide-1 receptor extracellular domain.

Science.gov (United States)

Runge, Steffen; Thøgersen, Henning; Madsen, Kjeld; Lau, Jesper; Rudolph, Rainer

2008-04-25

The glucagon-like peptide-1 receptor (GLP-1R) belongs to Family B1 of the seven-transmembrane G protein-coupled receptors, and its natural agonist ligand is the peptide hormone glucagon-like peptide-1 (GLP-1). GLP-1 is involved in glucose homeostasis, and activation of GLP-1R in the plasma membrane of pancreatic beta-cells potentiates glucose-dependent insulin secretion. The N-terminal extracellular domain (nGLP-1R) is an important ligand binding domain that binds GLP-1 and the homologous peptide Exendin-4 with differential affinity. Exendin-4 has a C-terminal extension of nine amino acid residues known as the "Trp cage", which is absent in GLP-1. The Trp cage was believed to interact with nGLP-1R and thereby explain the superior affinity of Exendin-4. However, the molecular details that govern ligand binding and specificity of nGLP-1R remain undefined. Here we report the crystal structure of human nGLP-1R in complex with the antagonist Exendin-4(9-39) solved by the multiwavelength anomalous dispersion method to 2.2A resolution. The structure reveals that Exendin-4(9-39) is an amphipathic alpha-helix forming both hydrophobic and hydrophilic interactions with nGLP-1R. The Trp cage of Exendin-4 is not involved in binding to nGLP-1R. The hydrophobic binding site of nGLP-1R is defined by discontinuous segments including primarily a well defined alpha-helix in the N terminus of nGLP-1R and a loop between two antiparallel beta-strands. The structure provides for the first time detailed molecular insight into ligand binding of the human GLP-1 receptor, an established target for treatment of type 2 diabetes.

Method for fabricating five-level microelectromechanical structures and microelectromechanical transmission formed

Science.gov (United States)

Rodgers, M. Steven; Sniegowski, Jeffry J.; Miller, Samuel L.; McWhorter, Paul J.

2000-01-01

A process for forming complex microelectromechanical (MEM) devices having five layers or levels of polysilicon, including four structural polysilicon layers wherein mechanical elements can be formed, and an underlying polysilicon layer forming a voltage reference plane. A particular type of MEM device that can be formed with the five-level polysilicon process is a MEM transmission for controlling or interlocking mechanical power transfer between an electrostatic motor and a self-assembling structure (e.g. a hinged pop-up mirror for use with an incident laser beam). The MEM transmission is based on an incomplete gear train and a bridging set of gears that can be moved into place to complete the gear train to enable power transfer. The MEM transmission has particular applications as a safety component for surety, and for this purpose can incorporate a pin-in-maze discriminator responsive to a coded input signal.

Method for fabricating five-level microelectromechanical structures and microelectromechanical transmission formed

Energy Technology Data Exchange (ETDEWEB)

Rodgers, M.S.; Sniegowski, J.J.; Miller, S.L.; McWhorter, P.J.

2000-07-04

A process is disclosed for forming complex microelectromechanical (MEM) devices having five layers or levels of polysilicon, including four structural polysilicon layers wherein mechanical elements can be formed, and an underlying polysilicon layer forming a voltage reference plane. A particular type of MEM device that can be formed with the five-level polysilicon process is a MEM transmission for controlling or interlocking mechanical power transfer between an electrostatic motor and a self-assembling structure (e.g. a hinged pop-up mirror for use with an incident laser beam). The MEM transmission is based on an incomplete gear train and a bridging set of gears that can be moved into place to complete the gear train to enable power transfer. The MEM transmission has particular applications as a safety component for surety, and for this purpose can incorporate a pin-in-maze discriminator responsive to a coded input signal.

Vaccatides: Antifungal Glutamine-Rich Hevein-Like Peptides from Vaccaria hispanica

Directory of Open Access Journals (Sweden)

Ka H. Wong

2017-06-01

Full Text Available Hevein and hevein-like peptides are disulfide-constrained chitin-binding cysteine-rich peptides. They are divided into three subfamilies, 6C-, 8C-, and 10C-hevein-like peptides, based on the number of cysteine residues. In addition, hevein-like peptides can exist in two forms, short and long. The long C-terminal form found in hevein and 10C-hevein-like peptides contain a C-terminal protein cargo. In contrast, the short form without a protein cargo is found in all three subfamilies. Here, we report the discovery and characterization of two novel glutamine-rich and protein cargo-free 8C-hevein-like peptides, vaccatides vH1 and vH2, from Vaccaria hispanica of the Caryophyllaceae family. Proteomic analyses showed that the vaccatides are 40–41 amino acids in length and contain a chitin-binding domain. NMR determination revealed that vaccatide vH2 displays a highly compact structure with a N-terminal cystine knot and an addition C-terminal disulfide bond. Stability studies showed that this compact structure renders vaccatide vH2 resistant to thermal, chemical and proteolytic degradation. The chitin-binding vH2 was shown to inhibit the mycelium growth of four phyto-pathogenic fungal strains with IC50 values in the micromolar range. Our findings show that vaccatides represent a new family of 8C-hevein-like peptides, which are protein cargo-free and glutamine-rich, characteristics that differentiate them from the prototypic hevein and the 10C-hevein-like peptides. In summary, this study enriches the existing library of hevein-like peptides and provides insight into their molecular diversity in sequence, structure and biosynthesis. Additionally, their highly disulfide-constrained structure could be used as a scaffold for developing metabolically and orally active peptidyl therapeutics.

Hierarchical structure graphitic-like/MoS2 film as superlubricity material

Science.gov (United States)

Gong, Zhenbin; Jia, Xiaolong; Ma, Wei; Zhang, Bin; Zhang, Junyan

2017-08-01

Friction and wear result in a great amount of energy loss and the invalidation of mechanical parts, thus it is necessary to minimize friction in practical application. In this study, the graphitic-like/MoS2 films with hierarchical structure were synthesized by the combination of pulse current plasma chemical-vapor deposition and medium frequency unbalanced magnetron sputtering in preheated environment. This hierarchical structure composite with multilayer nano sheets endows the films excellent tribological performance, which easily achieves macro superlubricity (friction coefficient ∼0.004) under humid air. Furthermore, it is expected that hierarchical structure of graphitic-like/MoS2 films could match the requirements of large scale, high bear-capacity and wear-resistance of actual working conditions, which could be widely used in the industrial production as a promising superlubricity material.

Structural origin of fractional Stokes-Einstein relation in glass-forming liquids.

Science.gov (United States)

Pan, Shaopeng; Wu, Z W; Wang, W H; Li, M Z; Xu, Limei

2017-01-06

In many glass-forming liquids, fractional Stokes-Einstein relation (SER) is observed above the glass transition temperature. However, the origin of such phenomenon remains elusive. Using molecular dynamics simulations, we investigate the break- down of SER and the onset of fractional SER in a model of metallic glass-forming liquid. We find that SER breaks down when the size of the largest cluster consisting of trapped atoms starts to increase sharply at which the largest cluster spans half of the simulations box along one direction, and the fractional SER starts to follows when the largest cluster percolates the entire system and forms 3-dimentional network structures. Further analysis based on the percolation theory also confirms that percolation occurs at the onset of the fractional SER. Our results directly link the breakdown of the SER with structure inhomogeneity and onset of the fraction SER with percolation of largest clusters, thus provide a possible picture for the break- down of SER and onset of fractional SER in glass-forming liquids, which is is important for the understanding of the dynamic properties in glass-forming liquids.

Finite-time stabilization of uncertain nonholonomic systems in feedforward-like form by output feedback.

Science.gov (United States)

Gao, Fangzheng; Wu, Yuqiang; Zhang, Zhongcai

2015-11-01

This paper investigates the problem of finite-time stabilization by output feedback for a class of nonholonomic systems in chained form with uncertainties. Comparing with the existing relevant literature, a distinguishing feature of the systems under investigation is that the x-subsystem is a feedforward-like rather than feedback-like system. This renders the existing control methods inapplicable to the control problems of the systems. A constructive design procedure for output feedback control is given. The designed controller renders that the states of closed-loop system are regulated to zero in a finite time. Two simulation examples are provided to illustrate the effectiveness of the proposed approach. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

AFM-based force spectroscopy measurements of mature amyloid fibrils of the peptide glucagon

DEFF Research Database (Denmark)

Dong, M. D.; Hovgaard, M. B.; Mamdouh, W.

2008-01-01

We report on the mechanical characterization of individual mature amyloid fibrils by atomic force microscopy (AFM) and AFM-based single-molecule force spectroscopy (SMFS). These self-assembling materials, formed from the 29-residue amphiphatic peptide hormone glucagon, were found to display...... a reversible elastic behaviour. Based on AFM morphology and SMFS studies, we suggest that the observed elasticity is due to a force-induced conformational transition which is reversible due to the beta-helical conformation of protofibrils, allowing a high degree of extension. The elastic properties...... of such mature fibrils contribute to their high stability, suggesting that the internal hydrophobic interactions of amyloid fibrils are likely to be of fundamental importance in the assembly of amyloid fibrils and therefore for the understanding of the progression of their associated pathogenic disorders...

Spin-ice behavior of three-dimensional inverse opal-like magnetic structures: Micromagnetic simulations

Science.gov (United States)

Dubitskiy, I. S.; Syromyatnikov, A. V.; Grigoryeva, N. A.; Mistonov, A. A.; Sapoletova, N. A.; Grigoriev, S. V.

2017-11-01

We perform micromagnetic simulations of the magnetization distribution in inverse opal-like structures (IOLS) made from ferromagnetic materials (nickel and cobalt). It is shown that the unit cell of these complex structures, whose characteristic length is approximately 700 nm, can be divided into a set of structural elements some of which behave like Ising-like objects. A spin-ice behavior of IOLS is observed in a broad range of external magnetic fields. Numerical results describe successfully the experimental hysteresis curves of the magnetization in Ni- and Co-based IOLS. We conclude that ferromagnetic IOLS can be considered as the first realization of three-dimensional artificial spin ice. The problem is discussed of optimal geometrical properties and material characteristics of IOLS for the spin-ice rule fulfillment.

Research Status on Reinforcement Connection Form of Precast Concrete Shear Wall Structure

Science.gov (United States)

Zhang, Zhuangnan; Zhang, Yan

2018-03-01

With the rapid development of Chinese economy and the speeding up the process of urbanization, housing industrialization has been paid more and more attention. And the fabricated structure has been widely used in China. The key of precast concrete shear wall structure is the connection of precast components. The reinforcement connection can directly affect the entirety performance and seismic behavior of the structure. Different reinforcement connections have a great impact on the overall behavior of the structure. By studying the characteristics of the reinforcement connection forms used in the vertical connection and horizontal connection of precast concrete shear wall, it can provide reference for the research and development of the reinforcement connection forms in the future.

Structural plasticity of Barley yellow dwarf virus-like cap-independent translation elements in four genera of plant viral RNAs.

Science.gov (United States)

Wang, Zhaohui; Kraft, Jelena J; Hui, Alice Y; Miller, W Allen

2010-06-20

The 3' untranslated regions (UTRs) of many plant viral RNAs contain cap-independent translation elements (3' CITEs). Among the 3' CITEs, the Barley yellow dwarf virus (BYDV)-like translation elements (BTEs) form a structurally variable and widely distributed group. Viruses in three genera were known to harbor 3' BTEs, defined by the presence of a 17-nt consensus sequence. To understand BTE function, knowledge of phylogenetically conserved structure is essential, yet the secondary structure has been determined only for the BYDV BTE. Here we show that Rose spring dwarf-associated luteovirus, and two viruses in a fourth genus, Umbravirus, contain functional BTEs, despite deviating in the 17nt consensus sequence. Structure probing by selective 2'-hydroxyl acylation and primer extension (SHAPE) revealed conserved and highly variable structures in BTEs in all four genera. We conclude that BTEs tolerate striking evolutionary plasticity in structure, while retaining the ability to stimulate cap-independent translation. Copyright (c) 2010 Elsevier Inc. All rights reserved.

Proline substitutions in a Mip-like peptidyl-prolyl cis-trans isomerase severely affect its structure, stability, shape and activity

Directory of Open Access Journals (Sweden)

Soumitra Polley

2015-01-01

Full Text Available FKBP22, an Escherichia coli-specific peptidyl-prolyl cis-trans isomerase, shows substantial homology with the Mip-like virulence factors. Mip-like proteins are homodimeric and possess a V-shaped conformation. Their N-terminal domains form dimers, whereas their C-terminal domains bind protein/peptide substrates and distinct inhibitors such as rapamycin and FK506. Interestingly, the two domains of the Mip-like proteins are separated by a lengthy, protease-susceptible α-helix. To delineate the structural requirement of this domain-connecting region in Mip-like proteins, we have investigated a recombinant FKBP22 (rFKBP22 and its three point mutants I65P, V72P and A82P using different probes. Each mutant harbors a Pro substitution mutation at a distinct location in the hinge region. We report that the three mutants are not only different from each other but also different from rFKBP22 in structure and activity. Unlike rFKBP22, the three mutants were unfolded by a non-two state mechanism in the presence of urea. In addition, the stabilities of the mutants, particularly I65P and V72P, differed considerably from that of rFKBP22. Conversely, the rapamycin binding affinity of no mutant was different from that of rFKBP22. Of the mutants, I65P showed the highest levels of structural/functional loss and dissociated partly in solution. Our computational study indicated a severe collapse of the V-shape in I65P due to the anomalous movement of its C-terminal domains. The α-helical nature of the domain-connecting region is, therefore, critical for the Mip-like proteins.

N-terminally truncated forms of human cathepsin F accumulate in aggresome-like inclusions.

Science.gov (United States)

Jerič, Barbara; Dolenc, Iztok; Mihelič, Marko; Klarić, Martina; Zavašnik-Bergant, Tina; Gunčar, Gregor; Turk, Boris; Turk, Vito; Stoka, Veronika

2013-10-01

The contribution of individual cysteine cathepsins as positive mediators of programmed cell death is dependent on several factors, such as the type of stimuli, intensity and duration of the stimulus, and cell type involved. Of the eleven human cysteine cathepsins, cathepsin F is the only cathepsin that exhibits an extended N-terminal proregion, which contains a cystatin-like domain. We predicted that the wild-type human cathepsin F contains three natively disordered regions within the enzyme's propeptide and various amino acid stretches with high fibrillation propensity. Wild-type human cathepsin F and its N-terminally truncated forms, Ala(20)-Asp(484) (Δ(19)CatF), Pro(126)-Asp(484) (Δ(125)CatF), and Met(147)-Asp(484) (Δ(146)CatF) were cloned into the pcDNA3 vector and overexpressed in HEK 293T cells. Wild-type human cathepsin F displayed a clear vesicular labeling and colocalized with the LAMP2 protein, a lysosomal marker. However, all three N-terminally truncated forms of human cathepsin F were recovered as insoluble proteins, suggesting that the deletion of at least the signal peptides (Δ(19)CatF), results in protein aggregation. Noteworthy, they concentrated large perinuclear-juxtanuclear aggregates that accumulated within aggresome-like inclusions. These inclusions showed p62-positive immunoreactivity and were colocalized with the autophagy marker LC3B, but not with the LAMP2 protein. In addition, an approximately 2-3 fold increase in DEVDase activity was not sufficient to induce apoptotic cell death. These results suggested the clearance of the N-terminally truncated forms of human cathepsin F via the autophagy pathway, underlying its protective and prosurvival mechanisms. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

Memristor comprising film with comb-like structure of nanocolumns of metal oxide embedded in a metal oxide matrix

Science.gov (United States)

Driscoll, Judith L; Lee, ShinBuhm; Jia, Quanxi

2015-05-12

Films having a comb-like structure of nanocolumns of Sm.sub.2O.sub.3 embedded in a SrTiO.sub.3 formed spontaneously on a substrate surface by pulsed laser deposition. In an embodiment, the nanocolumns had a width of about 20 nm with spaces between nanocolumns of about 10 nm. The films exhibited memristive behavior, and were extremely uniform and tunable. Oxygen deficiencies were located at vertical interfaces between the nanocolumns and the matrix. The substrates may be single-layered or multilayered.

Heterogeneous Seeding of a Prion Structure by a Generic Amyloid Form of the Fungal Prion-forming Domain HET-s(218-289)

Energy Technology Data Exchange (ETDEWEB)

Wan, William; Bian, Wen; McDonald, Michele; Kijac, Aleksandra; Wemmer, David E.; Stubbs, Gerald [UCB; (Vanderbilt); (LBNL)

2013-11-13

The fungal prion-forming domain HET-s(218–289) forms infectious amyloid fibrils at physiological pH that were shown by solid-state NMR to be assemblies of a two-rung β-solenoid structure. Under acidic conditions, HET-s(218–289) has been shown to form amyloid fibrils that have very low infectivity in vivo, but structural information about these fibrils has been very limited. We show by x-ray fiber diffraction that the HET-s(218–289) fibrils formed under acidic conditions have a stacked β-sheet architecture commonly found in short amyloidogenic peptides and denatured protein aggregates. At physiological pH, stacked β-sheet fibrils nucleate the formation of the infectious β-solenoid prions in a process of heterogeneous seeding, but do so with kinetic profiles distinct from those of spontaneous or homogeneous (seeded with infectious β-solenoid fibrils) fibrillization. Several serial passages of stacked β-sheet-seeded solutions lead to fibrillization kinetics similar to homogeneously seeded solutions. Our results directly show that structural mutation can occur between substantially different amyloid architectures, lending credence to the suggestion that the processes of strain adaptation and crossing species barriers are facilitated by structural mutation.

β-sheet-like formation during the mechanical unfolding of prion protein

Science.gov (United States)

Tao, Weiwei; Yoon, Gwonchan; Cao, Penghui; Eom, Kilho; Park, Harold S.

2015-09-01

Single molecule experiments and simulations have been widely used to characterize the unfolding and folding pathways of different proteins. However, with few exceptions, these tools have not been applied to study prion protein, PrPC, whose misfolded form PrPSc can induce a group of fatal neurodegenerative diseases. Here, we apply novel atomistic modeling based on potential energy surface exploration to study the constant force unfolding of human PrP at time scales inaccessible with standard molecular dynamics. We demonstrate for forces around 100 pN, prion forms a stable, three-stranded β-sheet-like intermediate configuration containing residues 155-214 with a lifetime exceeding hundreds of nanoseconds. A mutant without the disulfide bridge shows lower stability during the unfolding process but still forms the three-stranded structure. The simulations thus not only show the atomistic details of the mechanically induced structural conversion from the native α-helical structure to the β-rich-like form but also lend support to the structural theory that there is a core of the recombinant PrP amyloid, a misfolded form reported to induce transmissible disease, mapping to C-terminal residues ≈160-220.

β-sheet-like formation during the mechanical unfolding of prion protein

Energy Technology Data Exchange (ETDEWEB)

Tao, Weiwei; Cao, Penghui; Park, Harold S., E-mail: parkhs@bu.edu [Department of Mechanical Engineering, Boston University, Boston, Massachusetts 02215 (United States); Yoon, Gwonchan [Department of Mechanical Engineering, Boston University, Boston, Massachusetts 02215 (United States); Department of Mechanical Engineering, Korea University, Seoul 136-701 (Korea, Republic of); Eom, Kilho [Biomechanics Laboratory, College of Sport Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of)

2015-09-28

Single molecule experiments and simulations have been widely used to characterize the unfolding and folding pathways of different proteins. However, with few exceptions, these tools have not been applied to study prion protein, PrP{sup C}, whose misfolded form PrP{sup Sc} can induce a group of fatal neurodegenerative diseases. Here, we apply novel atomistic modeling based on potential energy surface exploration to study the constant force unfolding of human PrP at time scales inaccessible with standard molecular dynamics. We demonstrate for forces around 100 pN, prion forms a stable, three-stranded β-sheet-like intermediate configuration containing residues 155-214 with a lifetime exceeding hundreds of nanoseconds. A mutant without the disulfide bridge shows lower stability during the unfolding process but still forms the three-stranded structure. The simulations thus not only show the atomistic details of the mechanically induced structural conversion from the native α-helical structure to the β-rich-like form but also lend support to the structural theory that there is a core of the recombinant PrP amyloid, a misfolded form reported to induce transmissible disease, mapping to C-terminal residues ≈160-220.

β-sheet-like formation during the mechanical unfolding of prion protein

International Nuclear Information System (INIS)

Tao, Weiwei; Cao, Penghui; Park, Harold S.; Yoon, Gwonchan; Eom, Kilho

2015-01-01

Single molecule experiments and simulations have been widely used to characterize the unfolding and folding pathways of different proteins. However, with few exceptions, these tools have not been applied to study prion protein, PrP C , whose misfolded form PrP Sc can induce a group of fatal neurodegenerative diseases. Here, we apply novel atomistic modeling based on potential energy surface exploration to study the constant force unfolding of human PrP at time scales inaccessible with standard molecular dynamics. We demonstrate for forces around 100 pN, prion forms a stable, three-stranded β-sheet-like intermediate configuration containing residues 155-214 with a lifetime exceeding hundreds of nanoseconds. A mutant without the disulfide bridge shows lower stability during the unfolding process but still forms the three-stranded structure. The simulations thus not only show the atomistic details of the mechanically induced structural conversion from the native α-helical structure to the β-rich-like form but also lend support to the structural theory that there is a core of the recombinant PrP amyloid, a misfolded form reported to induce transmissible disease, mapping to C-terminal residues ≈160-220

Structural and reduced-form modeling and forecasting with application to Armenia

NARCIS (Netherlands)

Poghosyan, K.

2012-01-01

The thesis deals with structural and reduced-form modeling and forecasting of key macroeconomic variables (real growth of GDP, inflation, exchange rate, and policy interest rate). The central part of the thesis (Chapters 2-4) consists of three chapters. Chapter 2 considers the structural DSGE model

Structure of Complex Verb Forms in Meiteilon

Directory of Open Access Journals (Sweden)

Lourembam Surjit Singh

2016-12-01

Full Text Available This piece of work proposes to descriptively investigate the structures of complex verbs in Meiteilon. The categorization of such verbs is based on the nature of semantic and syntactic functions of a lexeme or verbal lexeme. A lexeme or verbal lexeme in Meiteilon may have multifunctional properties in the nature of occurrence. Such lexical items can be co-occurred together in a phrase as single functional word. Specifically, in the co-occurrences of two lexical items, the first component of lexical items has different semantic and syntactic functions in comparison to semantic and syntactic functions of the second component of lexical items. Such co-occurrences of two lexical items are the forms of complex verb that are covered with the term complex predicate in this work. The investigation in constructing complex predicate is thoroughly presenting in this work. Keywords: Structures, complex verb, conjunct verb, compound verb, complex predicate

A novel form of the membrane protein CD147 that contains an extra Ig-like domain and interacts homophilically

Directory of Open Access Journals (Sweden)

Brown Marion H

2003-11-01

Full Text Available Abstract Background CD147 is a broadly distributed integral membrane glycoprotein with two Ig-like domains implicated in a wide range of functions. It is associated at the cell surface with the monocarboxylate transporters MCT1 and 4 but interactions of the extracellular region have not been characterised. Results We report the characterisation of a form of CD147 with an additional membrane-distal Ig-like domain. In contrast to the two domain form, this three domain form of CD147 interacts homophilically. Surface plasmon resonance analysis using recombinant proteins showed that the interaction was of low affinity (KD ~ 40 μM and this is typical of many interactions between membrane proteins. cDNA for the 3 domain form are rare but have been identified in human and mouse retina. Conclusion The finding that the three domain form of CD147 has an extracellular ligand, that is it interacts homophilically, suggests this interaction may be important in aligning lactate transporters in the retina where lactate is an important metabolite.

Transforming growth factor-beta1 promotes the migration and invasion of sphere-forming stem-like cell subpopulations in esophageal cancer

Energy Technology Data Exchange (ETDEWEB)

Yue, Dongli; Zhang, Zhen; Li, Jieyao; Chen, Xinfeng [Biotherapy Center, the First Affiliated Hospital of Zhengzhou University, No. 1 Jianshe Road, Zhengzhou 450052, Henan, PR China (China); Department of Oncology, the First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052 (China); Ping, Yu; Liu, Shasha [Biotherapy Center, the First Affiliated Hospital of Zhengzhou University, No. 1 Jianshe Road, Zhengzhou 450052, Henan, PR China (China); School of Life Sciences, Zhengzhou University, Zhengzhou 450000 (China); Shi, Xiaojuan; Li, Lifeng [Biotherapy Center, the First Affiliated Hospital of Zhengzhou University, No. 1 Jianshe Road, Zhengzhou 450052, Henan, PR China (China); Department of Oncology, the First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052 (China); Wang, Liping [Department of Oncology, the First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052 (China); Huang, Lan [Biotherapy Center, the First Affiliated Hospital of Zhengzhou University, No. 1 Jianshe Road, Zhengzhou 450052, Henan, PR China (China); Zhang, Bin [Biotherapy Center, the First Affiliated Hospital of Zhengzhou University, No. 1 Jianshe Road, Zhengzhou 450052, Henan, PR China (China); Robert H. Lurie Comprehensive Cancer Center, Department of Medicine-Division of Hematology/Oncology, Northwestern University Feinberg School of Medicine, Chicago, IL 60611 (United States); Sun, Yan [Department of Oncology, the First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052 (China); Department of Medical Oncology, Cancer Hospital, Chinese Academy of Medical Sciences (China); and others

2015-08-01

Esophageal cancer is one of the most lethal solid malignancies. Mounting evidence demonstrates that cancer stem cells (CSCs) are able to cause tumor initiation, metastasis and responsible for chemotherapy and radiotherapy failures. As CSCs are thought to be the main reason of therapeutic failure, these cells must be effectively targeted to elicit long-lasting therapeutic responses. We aimed to enrich and identify the esophageal cancer cell subpopulation with stem-like properties and help to develop new target therapy strategies for CSCs. Here, we found esophageal cancer cells KYSE70 and TE1 could form spheres in ultra low attachment surface culture and be serially passaged. Sphere-forming cells could redifferentiate and acquire morphology comparable to parental cells, when return to adherent culture. The sphere-forming cells possessed the key criteria that define CSCs: persistent self-renewal, overexpression of stemness genes (SOX2, ALDH1A1 and KLF4), reduced expression of differentiation marker CK4, chemoresistance, strong invasion and enhanced tumorigenic potential. SB525334, transforming growth factor-beta 1(TGF-β1) inhibitor, significantly inhibited migration and invasion of sphere-forming stem-like cells and had no effect on sphere-forming ability. In conclusion, esophageal cancer sphere-forming cells from KYSE70 and TE1 cultured in ultra low attachment surface possess cancer stem cell properties, providing a model for CSCs targeted therapy. TGF-β1 promotes the migration and invasion of sphere-forming stem-like cells, which may guide future studies on therapeutic strategies targeting these cells. - Highlights: • Esophageal cancer sphere-forming cells possess cancer stem cell properties. • Sphere-forming cells enhance TGF-β1 pathway activity. • TGF-β 1 inhibitor suppresses the migration and invasion of sphere-forming cells.

Transforming growth factor-beta1 promotes the migration and invasion of sphere-forming stem-like cell subpopulations in esophageal cancer

International Nuclear Information System (INIS)

Yue, Dongli; Zhang, Zhen; Li, Jieyao; Chen, Xinfeng; Ping, Yu; Liu, Shasha; Shi, Xiaojuan; Li, Lifeng; Wang, Liping; Huang, Lan; Zhang, Bin; Sun, Yan

2015-01-01

Esophageal cancer is one of the most lethal solid malignancies. Mounting evidence demonstrates that cancer stem cells (CSCs) are able to cause tumor initiation, metastasis and responsible for chemotherapy and radiotherapy failures. As CSCs are thought to be the main reason of therapeutic failure, these cells must be effectively targeted to elicit long-lasting therapeutic responses. We aimed to enrich and identify the esophageal cancer cell subpopulation with stem-like properties and help to develop new target therapy strategies for CSCs. Here, we found esophageal cancer cells KYSE70 and TE1 could form spheres in ultra low attachment surface culture and be serially passaged. Sphere-forming cells could redifferentiate and acquire morphology comparable to parental cells, when return to adherent culture. The sphere-forming cells possessed the key criteria that define CSCs: persistent self-renewal, overexpression of stemness genes (SOX2, ALDH1A1 and KLF4), reduced expression of differentiation marker CK4, chemoresistance, strong invasion and enhanced tumorigenic potential. SB525334, transforming growth factor-beta 1(TGF-β1) inhibitor, significantly inhibited migration and invasion of sphere-forming stem-like cells and had no effect on sphere-forming ability. In conclusion, esophageal cancer sphere-forming cells from KYSE70 and TE1 cultured in ultra low attachment surface possess cancer stem cell properties, providing a model for CSCs targeted therapy. TGF-β1 promotes the migration and invasion of sphere-forming stem-like cells, which may guide future studies on therapeutic strategies targeting these cells. - Highlights: • Esophageal cancer sphere-forming cells possess cancer stem cell properties. • Sphere-forming cells enhance TGF-β1 pathway activity. • TGF-β 1 inhibitor suppresses the migration and invasion of sphere-forming cells

Near-ground tornado-like vortex structure resolved by particle image velocimetry (PIV)

Energy Technology Data Exchange (ETDEWEB)

Zhang, Wei [Iowa State University, Aerospace Engineering Department, Ames, IA (United States); University of Minnesota, Saint Anthony Falls Laboratory, Minneapolis, MN (United States); Sarkar, Partha P. [Iowa State University, Aerospace Engineering Department, Ames, IA (United States)

2012-02-15

The near-ground flow structure of tornadoes is of utmost interest because it determines how and to what extent civil structures could get damaged in tornado events. We simulated tornado-like vortex flow at the swirl ratios of S = 0.03-0.3 (vane angle {theta}{sub v} = 15 -60 ), using a laboratory tornado simulator and investigated the near-ground-vortex structure by particle imaging velocimetry. Complicated near-ground flow was measured in two orthogonal views: horizontal planes at various elevations (z = 11, 26 and 53 mm above the ground) and the meridian plane. We observed two distinct vortex structures: a single-celled vortex at the lowest swirl ratio (S = 0.03, {theta}{sub v} = 15 ) and multiple suction vortices rotating around the primary vortex (two-celled vortex) at higher swirl ratios (S = 0.1-0.3, {theta}{sub v} = 30 -60 ). We quantified the effects of vortex wandering on the mean flow and found that vortex wandering was important and should be taken into account in the low swirl ratio case. The tangential velocity, as the dominant velocity component, has the peak value about three times that of the maximum radial velocity regardless of the swirl ratio. The maximum velocity variance is about twice at the high swirl ratio ({theta}{sub v} = 45 ) that at the low swirl ratio ({theta}{sub v} = 15 ), which is contributed significantly by the multiple small-scale secondary vortices. Here, the results show that not only the intensified mean flow but greatly enhanced turbulence occurs near the surface in the tornado-like vortex flow. The intensified mean flow and enhanced turbulence at the ground level, correlated with the ground-vortex interaction, may cause dramatic damage of the civil structures in tornadoes. This work provides detailed characterization of the tornado-like vortex structure, which has not been fully revealed in previous field studies and laboratory simulations. It would be helpful in improving the understanding of the interaction between the

Structural study of salt forms of amides; paracetamol, benzamide and piperine

Science.gov (United States)

Kennedy, Alan R.; King, Nathan L. C.; Oswald, Iain D. H.; Rollo, David G.; Spiteri, Rebecca; Walls, Aiden

2018-02-01

Single crystal x-ray diffraction has been used to investigate the structures of six complexes containing O-atom protonated cations derived from the pharmaceutically relevant amides benzamide (BEN), paracetamol (PAR) and piperine (PIP). The structures of the salt forms [PAR(H)][SO3C6H4Cl], [BEN(H)][O3SC6H4Cl] and [BEN(H)][Br]·H2O are reported along with those of the hemi-halide salt forms [PAR(H)][I3]. PAR, [PIP(H)][I3]·PIP and [PIP(H)][I3]0·5[I]0.5. PIP. The structure of the cocrystal BEN. HOOCCH2Cl is also presented for comparison. The geometry of the amide group is found to systematically change upon protonation, with the Cdbnd O distance increasing and the Csbnd N distance decreasing. The hemi-halide species all feature strongly hydrogen bonded amide(H)/amide pairs. The amide group Cdbnd O and Csbnd N distances for both elements of each such pair are intermediate between those found for simple neutral amide and protonated amide forms. It was found that crystallising paracetamol from aqueous solutions containing Ba2+ ions gave orthorhombic paracetamol.

Regime of aggregate structures and magneto-rheological characteristics of a magnetic rod-like particle suspension: Monte Carlo and Brownian dynamics simulations

Energy Technology Data Exchange (ETDEWEB)

Okada, Kazuya [School of Akita Prefectural University, Yurihonjo (Japan); Satoh, Akira, E-mail: asatoh@akita-pu.ac.jp [Department of Machine Intelligence and System Engineering, Akita Prefectural University, Yurihonjo (Japan)

2017-09-01

Highlights: • Monte Carlo simulations have been employed for the aggregate structures. • Brownian dynamics simulations have been employed for the magneto-rheology. • Even a weak shear flow induces a significant regime change in the aggregates. • A strong external magnetic field drastically changes the aggregates. • The dependence of the viscosity on these factors is governed in a complex manner. - Abstract: In the present study, we address a suspension composed ferromagnetic rod-like particles to elucidate a regime change in the aggregate structures and the magneto-rheological characteristics. Monte Carlo simulations have been employed for investigating the aggregate structures in thermodynamic equilibrium, and Brownian dynamics simulations for magneto-rheological features in a simple shear flow. The main results obtained here are summarized as follows. For the case of thermodynamic equilibrium, the rod-like particles aggregate to form thick chain-like clusters and the neighboring clusters incline in opposite directions. If the external magnetic field is increased, the thick chain-like clusters in the magnetic field direction grow thicker by adsorbing the neighboring clusters that incline in the opposite direction. Hence, a significant phase change in the particle aggregates is not induced by an increase in the magnetic field strength. For the case of a simple shear flow, even a weak shear flow induces a significant regime change from the thick chain-like clusters of thermodynamic equilibrium into wall-like aggregates composed of short raft-like clusters. A strong external magnetic field drastically changes these aggregates into wall-like aggregates composed of thick chain-like clusters rather than the short raft-like clusters. The internal structure of these aggregates is not strongly influenced by a shear flow, and the formation of the short raft-like clusters is maintained inside the aggregates. The main contribution to the net viscosity is the

Quantitative characterization of the atomic-scale structure of oxyhydroxides in rusts formed on steel surfaces

International Nuclear Information System (INIS)

Saito, M.; Suzuki, S.; Kimura, M.; Suzuki, T.; Kihira, H.; Waseda, Y.

2005-01-01

Quantitative X-ray structural analysis coupled with anomalous X-ray scattering has been used for characterizing the atomic-scale structure of rust formed on steel surfaces. Samples were prepared from rust layers formed on the surfaces of two commercial steels. X-ray scattered intensity profiles of the two samples showed that the rusts consisted mainly of two types of ferric oxyhydroxide, α-FeOOH and γ-FeOOH. The amounts of these rust components and the realistic atomic arrangements in the components were estimated by fitting both the ordinary and the environmental interference functions with a model structure calculated using the reverse Monte Carlo simulation technique. The two rust components were found to be the network structure formed by FeO 6 octahedral units, the network structure itself deviating from the ideal case. The present results also suggest that the structural analysis method using anomalous X-ray scattering and the reverse Monte Carlo technique is very successful in determining the atomic-scale structure of rusts formed on the steel surfaces

Infill Optimization for Additive Manufacturing-Approaching Bone-Like Porous Structures.

Science.gov (United States)

Wu, Jun; Aage, Niels; Westermann, Rudiger; Sigmund, Ole

2018-02-01

Porous structures such as trabecular bone are widely seen in nature. These structures are lightweight and exhibit strong mechanical properties. In this paper, we present a method to generate bone-like porous structures as lightweight infill for additive manufacturing. Our method builds upon and extends voxel-wise topology optimization. In particular, for the purpose of generating sparse yet stable structures distributed in the interior of a given shape, we propose upper bounds on the localized material volume in the proximity of each voxel in the design domain. We then aggregate the local per-voxel constraints by their p-norm into an equivalent global constraint, in order to facilitate an efficient optimization process. Implemented on a high-resolution topology optimization framework, our results demonstrate mechanically optimized, detailed porous structures which mimic those found in nature. We further show variants of the optimized structures subject to different design specifications, and we analyze the optimality and robustness of the obtained structures.

Structure of a putative BenF-like porin from Pseudomonas fluorescens Pf-5 at 2.6 A resolution

Energy Technology Data Exchange (ETDEWEB)

Sampathkumar, P.; Swaminathan, S.; Lu, F.; Zhao, X.; Li, Z.; Gilmore, J.; Bain, K.; Rutter, M. E.; Gheyi, T.; Schwinn, D.; Bonanno, J. B.; Pieper, U.; Fajardo, J. E.; Fiser, A.; Almo, S. C.; Chance, M. R.; Baker, D.; Atwell, S.; Thompson, D. A.; Emtage, J. S.; Wasserman, S. R.; Sali, A.; Sauder, J. M.; Burley, S. K.

2010-11-01

Gram-negative bacteria typically overcome poor permeability of outer membranes through general porins like OmpF and OmpC, which form water-filled transmembrane pores permitting diffusion of hydrophilic molecules with no particular selectivity. Many bacteria lacking such general porins use substrate-specific porins to overcome growth-limiting conditions and facilitate selective transport of metabolites. Exclusive reliance on substrate-specific porins yields lower membrane permeability to small molecules (<600 Da) versus that seen for Escherichia coli. In Pseudomonads, transit of most small molecules across the cell membrane is thought to be mediated by substrate-specific channels of the OprD superfamily. This property explains, at least in part, the high incidence of Pseudomonas aeruginosa antibiotic resistance. High-throughput DNA sequencing of the P. aeruginosa chromosome revealed the presence of 19 genes encoding structurally related, substrate-specific porins (with 30-45% pairwise amino acid sequence identity) that mediate transmembrane passage of small, water-soluble compounds. The OprD superfamily encompasses the eponymous OprD subfamily, which includes 9 P. aeruginosa proteins that convey basic amino acids and carbapenem antibiotics, and the OpdK subfamily, which includes 11 P. aeruginosa proteins that convey aromatic acids and other small aromatic compounds. Genome sequencing of other gram-negative bacteria has revealed additional members of the OprD and OpdK subfamilies in various organisms, including other pseudomonads. Among the many bacteria in which OprD superfamily members have been identified are P. putida, P. fluorescens Pf-5, P. syringae, and Azotobacter vinelandii, all of which share closely related genes that encode the so-called BenF-like porins. In P. putida, benF is part of an operon involved in benzoate catabolism regulated by benR. Within this operon, benK, benE, and benF genes have been suggested to contribute toward either influx or efflux

Elastic nano-structure of diamond-like carbon (DLC)

International Nuclear Information System (INIS)

Ogiso, Hisato; Yoshida, Mikiko; Nakano, Shizuka; Yasui, Haruyuki; Awazu, Kaoru

2006-01-01

This research discusses the elastic nano-structure of diamond-like carbon (DLC) films. Two DLC film samples deposited by plasma based ion implantation (PBII) were prepared. The plasma generated by microwave (MW) was applied to one sample and the plasma by radio frequency (RF) to the other sample. The samples were evaluated for the elastic property image with nanometer resolution using scanning probe microscopy (SPM). The film surface deposited by RF-PBII was very flat and homogeneous in elastic property. In contrast, the film surface by MW-PBII was more uneven than that by RF-PBII and both the locally hard and the locally soft regions were found at the film surface. The size of the structure in elastic property is several tens nanometer. We conclude that the film probably contains nano-scale diamond phase

Elastic nano-structure of diamond-like carbon (DLC)

Energy Technology Data Exchange (ETDEWEB)

Ogiso, Hisato [National Institute of Advanced Industrial Science and Technology (AIST), 1-2-1 Namiki, Tsukuba, Ibaraki 305-8564 (Japan); Yoshida, Mikiko [National Institute of Advanced Industrial Science and Technology (AIST), 1-2-1 Namiki, Tsukuba, Ibaraki 305-8564 (Japan); Nakano, Shizuka [National Institute of Advanced Industrial Science and Technology (AIST), 1-2-1 Namiki, Tsukuba, Ibaraki 305-8564 (Japan); Yasui, Haruyuki [Industrial Research Institute of Ishikawa (IRII), Ro-1, Tomizu-machi, Kanazawa, Ishikawa 920-0233 (Japan); Awazu, Kaoru [Industrial Research Institute of Ishikawa (IRII), Ro-1, Tomizu-machi, Kanazawa, Ishikawa 920-0233 (Japan)

2006-01-15

This research discusses the elastic nano-structure of diamond-like carbon (DLC) films. Two DLC film samples deposited by plasma based ion implantation (PBII) were prepared. The plasma generated by microwave (MW) was applied to one sample and the plasma by radio frequency (RF) to the other sample. The samples were evaluated for the elastic property image with nanometer resolution using scanning probe microscopy (SPM). The film surface deposited by RF-PBII was very flat and homogeneous in elastic property. In contrast, the film surface by MW-PBII was more uneven than that by RF-PBII and both the locally hard and the locally soft regions were found at the film surface. The size of the structure in elastic property is several tens nanometer. We conclude that the film probably contains nano-scale diamond phase.

Integrable couplings of relativistic Toda lattice systems in polynomial form and rational form, their hierarchies and bi-Hamiltonian structures

Energy Technology Data Exchange (ETDEWEB)

Xu Xixiang [College of Science, Shandong University of Science and Technology, Qingdao 266510 (China)], E-mail: xixiang_xu@yahoo.com.cn

2009-10-02

Integrable couplings of relativistic Toda lattice systems in polynomial form and rational form, and their hierarchies, are derived from a four-by-four discrete matrix eigenvalue problem. The bi-Hamiltonian structure for every integrable coupling in the two hierarchies obtained is established by means of the discrete variational identity. Ultimately, Liouvolle integrability of the obtained integrable couplings is demonstrated.

Structure determination of feline calicivirus virus-like particles in the context of a pseudo-octahedral arrangement.

Directory of Open Access Journals (Sweden)

Wim P Burmeister

Full Text Available The vesivirus feline calicivirus (FCV is a positive strand RNA virus encapsidated by an icosahedral T=3 shell formed by the viral VP1 protein. Upon its expression in the insect cell - baculovirus system in the context of vaccine development, two types of virus-like particles (VLPs were formed, a majority built of 60 subunits (T=1 and a minority probably built of 180 subunits (T=3. The structure of the small particles was determined by x-ray crystallography at 0.8 nm resolution helped by cryo-electron microscopy in order to understand their formation. Cubic crystals belonged to space group P213. Their self-rotation function showed the presence of an octahedral pseudo-symmetry similar to the one described previously by Agerbandje and co-workers for human parvovirus VLPs. The crystal structure could be solved starting from the published VP1 structure in the context of the T=3 viral capsid. In contrast to viral capsids, where the capsomers are interlocked by the exchange of the N-terminal arm (NTA domain, this domain is disordered in the T=1 capsid of the VLPs. Furthermore it is prone to proteolytic cleavage. The relative orientation of P (protrusion and S (shell domains is alerted so as to fit VP1 to the smaller T=1 particle whereas the intermolecular contacts around 2-fold, 3-fold and 5-fold axes are conserved. By consequence the surface of the VLP is very similar compared to the viral capsid and suggests a similar antigenicity. The knowledge of the structure of the VLPs will help to improve their stability, in respect to a use for vaccination.

Lotus-leaf-like structured chitosan–polyvinyl pyrrolidone films as an anti-adhesion barrier

Energy Technology Data Exchange (ETDEWEB)

Lim, Jin Ik; Kang, Min Ji; Lee, Woo-Kul, E-mail: leewo@dankook.ac.kr

2014-11-30

Highlights: • Improved mechanical properties by hydrogen bond between chitosan and PVP chains. • Improved anti-adhesion effect by lotus-leaf-like structured chitosan–PVP (L-chitosan–PVP) film. • L-Chitosan–PVP film as a blood/tissue anti-adhesion barrier for post-surgical treatment. - Abstract: For postsurgical anti-adhesion barrier applications, lotus-leaf-like structured chitosan–PVP films were prepared using a solution casting method with dodecyltrichloro-immobilized SiO{sub 2} nanoparticles. We evaluated whether the lotus-leaf-like structured chitosan–PVP films (L-chitosan–PVP) could be applied as postsurgical anti-adhesion barriers. A recovery test using a tensile strength testing machine and measurement of crystallinity using X-ray diffraction indicated that films with 75% PVP were the optimal composition of the chitosan–PVP films. Also, dodecyltrichloro-immobilized SiO{sub 2} nanoparticles were synthesized and sprayed on the film after pretreatment with the instant bio-glue. Analysis of cell adhesion, proliferation, and anti-thrombus efficiency were performed via a WST assay, field emission scanning electron microscopy, and hemacytometry. The contact angle with the lotus-leaf-like surface was of approximately 150°. Furthermore, the L-chitosan–PVP film yielded a lower cell and platelet adhesion rate (around less than 4%) than that yielded by the untreated film. These results indicate that the lotus-leaf-like structure has a unique property and that this novel L-chitosan–PVP film can be applied as a blood/tissue-compatible, biodegradable material for implantable medical devices that need an anti-adhesion barrier.

Lotus-leaf-like structured chitosan–polyvinyl pyrrolidone films as an anti-adhesion barrier

International Nuclear Information System (INIS)

Lim, Jin Ik; Kang, Min Ji; Lee, Woo-Kul

2014-01-01

Highlights: • Improved mechanical properties by hydrogen bond between chitosan and PVP chains. • Improved anti-adhesion effect by lotus-leaf-like structured chitosan–PVP (L-chitosan–PVP) film. • L-Chitosan–PVP film as a blood/tissue anti-adhesion barrier for post-surgical treatment. - Abstract: For postsurgical anti-adhesion barrier applications, lotus-leaf-like structured chitosan–PVP films were prepared using a solution casting method with dodecyltrichloro-immobilized SiO 2 nanoparticles. We evaluated whether the lotus-leaf-like structured chitosan–PVP films (L-chitosan–PVP) could be applied as postsurgical anti-adhesion barriers. A recovery test using a tensile strength testing machine and measurement of crystallinity using X-ray diffraction indicated that films with 75% PVP were the optimal composition of the chitosan–PVP films. Also, dodecyltrichloro-immobilized SiO 2 nanoparticles were synthesized and sprayed on the film after pretreatment with the instant bio-glue. Analysis of cell adhesion, proliferation, and anti-thrombus efficiency were performed via a WST assay, field emission scanning electron microscopy, and hemacytometry. The contact angle with the lotus-leaf-like surface was of approximately 150°. Furthermore, the L-chitosan–PVP film yielded a lower cell and platelet adhesion rate (around less than 4%) than that yielded by the untreated film. These results indicate that the lotus-leaf-like structure has a unique property and that this novel L-chitosan–PVP film can be applied as a blood/tissue-compatible, biodegradable material for implantable medical devices that need an anti-adhesion barrier

Host-derived, pore-forming toxin-like protein and trefoil factor complex protects the host against microbial infection.

Science.gov (United States)

Xiang, Yang; Yan, Chao; Guo, Xiaolong; Zhou, Kaifeng; Li, Sheng'an; Gao, Qian; Wang, Xuan; Zhao, Feng; Liu, Jie; Lee, Wen-Hui; Zhang, Yun

2014-05-06

Aerolysins are virulence factors belonging to the bacterial β-pore-forming toxin superfamily. Surprisingly, numerous aerolysin-like proteins exist in vertebrates, but their biological functions are unknown. βγ-CAT, a complex of an aerolysin-like protein subunit (two βγ-crystallin domains followed by an aerolysin pore-forming domain) and two trefoil factor subunits, has been identified in frogs (Bombina maxima) skin secretions. Here, we report the rich expression of this protein, in the frog blood and immune-related tissues, and the induction of its presence in peritoneal lavage by bacterial challenge. This phenomena raises the possibility of its involvement in antimicrobial infection. When βγ-CAT was administrated in a peritoneal infection model, it greatly accelerated bacterial clearance and increased the survival rate of both frogs and mice. Meanwhile, accelerated Interleukin-1β release and enhanced local leukocyte recruitments were determined, which may partially explain the robust and effective antimicrobial responses observed. The release of interleukin-1β was potently triggered by βγ-CAT from the frog peritoneal cells and murine macrophages in vitro. βγ-CAT was rapidly endocytosed and translocated to lysosomes, where it formed high molecular mass SDS-stable oligomers (>170 kDa). Lysosomal destabilization and cathepsin B release were detected, which may explain the activation of caspase-1 inflammasome and subsequent interleukin-1β maturation and release. To our knowledge, these results provide the first functional evidence of the ability of a host-derived aerolysin-like protein to counter microbial infection by eliciting rapid and effective host innate immune responses. The findings will also largely help to elucidate the possible involvement and action mechanisms of aerolysin-like proteins and/or trefoil factors widely existing in vertebrates in the host defense against pathogens.

Induction of Functional 3D Ciliary Epithelium-Like Structure From Mouse Induced Pluripotent Stem Cells.

Science.gov (United States)

Kinoshita, Hirofumi; Suzuma, Kiyoshi; Kaneko, Jun; Mandai, Michiko; Kitaoka, Takashi; Takahashi, Masayo

2016-01-01

To generate ciliary epithelium (CE) from mouse induced pluripotent stem (iPS) cells. Recently, a protocol for self-organizing optic cup morphogenesis in three-dimensional culture was reported, and it was suggested that ocular tissue derived from neural ectoderm could be differentiated. We demonstrated that a CE-like double-layered structure could be induced in simple culture by using a modified Eiraku differentiation protocol. Differentiation of a CE-like double-layered structure could be promoted by glycogen synthase kinase 3β (GSK-3β) inhibitor. Connexin43 and aquaporin1 were expressed in both thin layers, and induced CE-like cells expressed ciliary marker genes, such as cyclinD2, zic1, tgfb2, aldh1a3, wfdc1, otx1, BMP4, and BMP7. Increases in cytoplasmic and nuclear β-catenin in aggregates of the CE-like double-layered structure were confirmed by Western blot analysis. In addition, tankyrase inhibitor prevented the induction of the CE-like double-layered structure by GSK-3β inhibitor. Dye movement from pigmented cells to nonpigmented cells in the mouse iPS cell-derived CE-like structure was observed in a fluid movement experiment, consistent with the physiological function of CE in vivo. We could differentiate CE from mouse iPS cells in the present study. In the future, we hope that this CE-like complex will become useful as a graft for transplantation therapy in pathologic ocular hypotension due to CE dysfunction, and as a screening tool for the development of drugs for diseases associated with CE function.

Investigation of the fluid flow dynamic parameters for Newtonian and non-Newtonian materials: an approach to understanding the fluid flow-like structures within fault zones

Science.gov (United States)

Tanaka, H.; Shiomi, Y.; Ma, K.-F.

2017-11-01

To understand the fault zone fluid flow-like structure, namely the ductile deformation structure, often observed in the geological field (e.g., Ramsay and Huber The techniques of modern structure geology, vol. 1: strain analysis, Academia Press, London, 1983; Hobbs and Ord Structure geology: the mechanics of deforming metamorphic rocks, Vol. I: principles, Elsevier, Amsterdam, 2015), we applied a theoretical approach to estimate the rate of deformation, the shear stress and the time to form a streak-line pattern in the boundary layer of viscous fluids. We model the dynamics of streak lines in laminar boundary layers for Newtonian and pseudoplastic fluids and compare the results to those obtained via laboratory experiments. The structure of deformed streak lines obtained using our model is consistent with experimental observations, indicating that our model is appropriate for understanding the shear rate, flow time and shear stress based on the profile of deformed streak lines in the boundary layer in Newtonian and pseudoplastic viscous materials. This study improves our understanding of the transportation processes in fluids and of the transformation processes in fluid-like materials. Further application of this model could facilitate understanding the shear stress and time history of the fluid flow-like structure of fault zones observed in the field.[Figure not available: see fulltext.

Homogeneous pancreatic cancer spheroids mimic growth pattern of circulating tumor cell clusters and macrometastases: displaying heterogeneity and crater-like structure on inner layer.

Science.gov (United States)

Feng, Hao; Ou, Bao-Chi; Zhao, Jing-Kun; Yin, Shuai; Lu, Ai-Guo; Oechsle, Eva; Thasler, Wolfgang E

2017-09-01

Pancreatic cancer 3D in vitro models including multicellular tumor spheroid (MCTS), single cell-derived tumor spheroid (SCTS), tissue-derived tumor spheroid, and organotypic models provided powerful platforms to mimic in vivo tumor. Recent work supports that circulating tumor cell (CTC) clusters are more efficient in metastasis seeding than single CTCs. The purpose of this study is to establish 3D culture models which can mimic single CTC, monoclonal CTC clusters, and the expansion of macrometastases. Seven pancreatic ductal adenocarcinoma cell lines were used to establish MCTS and SCTS using hanging drop and ultra-low attachment plates. Spheroid immunofluorescence staining, spheroid formation assay, immunoblotting, and literature review were performed to investigate molecular biomarkers and the morphological characteristics of pancreatic tumor spheroids. Single cells experienced different growth patterns to form SCTS, like signet ring-like cells, blastula-like structures, and solid core spheroids. However, golf ball-like hollow spheroids could also be detected, especially when DanG and Capan-1 cells were cultivated with fibroblast-conditioned medium (p cell lines could also establish tumor spheroid with hanging drop plates by adding methylated cellulose. Tumor spheroids derived from pancreatic cancer cell line DanG possessed asymmetrically distributed proliferation center, immune-checkpoint properties. ß-catenin, Ki-67, and F-actin were active surrounding the crater-like structure distributing on the inner layer of viable rim cover of the spheroids, which was relevant to well-differentiated tumor cells. It is possible to establish 3D CTC cluster models from homogenous PDA cell lines using hanging drop and ultra-low attachment plates. PDA cell line displays its own intrinsic properties or heterogeneity. The mechanism of formation of the crater-like structure as well as golf ball-like structure needs further exploration.

Identification of a moronecidin-like antimicrobial peptide in the venomous fish Pterois volitans: Functional and structural study of pteroicidin-α.

Science.gov (United States)

Houyvet, Baptiste; Bouchon-Navaro, Yolande; Bouchon, Claude; Goux, Didier; Bernay, Benoît; Corre, Erwan; Zatylny-Gaudin, Céline

2018-01-01

The present study characterizes for the first time an antimicrobial peptide in lionfish (Pterois volitans), a venomous fish. Using a peptidomic approach, we identified a mature piscidin in lionfish and called it pteroicidin-α. We detected an amidated form (pteroicidin-α- CONH 2 ) and a non-amidated form (pteroicidin-α-COOH), and then performed their functional and structural study. Interestingly, the two peptides displayed different antibacterial and hemolytic activity levels. Pteroicidin-α-CONH 2 was bactericidal on human pathogens like Staphylococcus aureus or Escherichia coli, as well as on the fish pathogen Aeromonas salmonicida, while pteroicidin-α-COOH only inhibited their growth. Furthermore, the two peptides induced hemolysis of red blood cells from different vertebrates, namely humans, sea bass and lesser-spotted dogfish. Hemolysis occurred with low concentrations of pteroicidin-α-CONH 2 , indicating greater toxicity of the amidated form. Circular dichroism analysis showed that both peptides adopted a helical conformation, yet with a greater α-helix content in pteroicidin-α-CONH 2 . Overall, these results suggest that amidation strongly influences pteroicidin-α by modifying its structure and its physico-chemical characteristics and by increasing its hemolytic activity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Development of embryo-like structures in the suspension cultures of flax coincides with secretion of chitinase-like proteins

Czech Academy of Sciences Publication Activity Database

Petrovská, Beáta; Salaj, T.; Moravčíková, J.; Libantová, J.; Salaj, J.

2010-01-01

Roč. 32, č. 4 (2010), s. 651-656 ISSN 0137-5881 Institutional research plan: CEZ:AV0Z50380511 Keywords : Conditioned media * Embryo-like structures * Linum usitatissimum L Subject RIV: EF - Botanics Impact factor: 1.344, year: 2010

Low-energy D* + (D-bar)10 scattering and the nature of resonance-like structure Z+(4430)

International Nuclear Information System (INIS)

Gong Ming; Meng Guozhan; He Song; Liu Chuan; Niu Zhiyuan; Shen Yuan; Chen Ying; Li Gang; Zhang Yuanjiang; Liu Yubin; Meng Xiangfei; Ma Jianping; Zhang Jianbo; CLQCD collaboration

2010-01-01

Low-energy scattering of D *+ and (D-bar) 1 0 meson is studied using quenched lattice QCD with improved lattice actions on anisotropic lattices. The threshold scattering parameters, namely the scattering length a 0 and the effective range r 0 , for the s-wave scattering in J P = 0 - channel are extracted: a 0 = 2.52(47) fm and r 0 = 0.7(1) fm. It is argued that, albeit the interaction between the two charmed mesons being attractive, it is unlikely that they can form a shallow bound state in this channel. Our calculation provides some useful information on the nature of the newly discovered resonance-like structure Z + (4430) by the Belle Collaboration. (authors)

High-Performance and Simply-Synthesized Ladder-Like Structured Methacrylate Siloxane Hybrid Material for Flexible Hard Coating

Directory of Open Access Journals (Sweden)

Yun Hyeok Kim

2018-04-01

Full Text Available A high performance ladder-like structured methacrylate siloxane hybrid material (LMSH was fabricated via simple hydrolytic sol–gel reaction, followed by free-radical polymerization. A structurally ordered siloxane backbone, the ladder-like structure, which is an essential factor for high performance, could be achieved by a short period of sol–gel reaction in only 4 h. This results in superior optical (Transmittance > 90% at 550 nm, thermal (T5 wt % decomposition > 400 ℃ , mechanical properties(elastic recovery = 0.86, hardness = 0.6 GPa compared to the random- and even commercialized cage-structured silsesquioxane, which also has ordered structure. It was investigated that the fabricated ladder-like structured MSH showed the highest overall density of organic/inorganic co-networks that are originated from highly ordered siloxane network, along with high conversion rate of polymerizable methacrylate groups. Our findings suggest a potential of the ladder-like structured MSH as a powerful alternative for the methacrylate polysilsesquioxane, which can be applied to thermally stable and flexible optical coatings, even with an easier and simpler preparation process.

Crystallization and Characterization of Galdieria sulphuraria RUBISCO in Two Crystal Forms: Structural Phase Transition Observed in P21 Crystal Form

Directory of Open Access Journals (Sweden)

Boguslaw Stec

2007-10-01

Full Text Available We have isolated ribulose-1,5-bisphosphate-carboxylase/oxygenase (RUBISCOfrom the red algae Galdieria Sulphuraria. The protein crystallized in two different crystalforms, the I422 crystal form being obtained from high salt and the P21 crystal form beingobtained from lower concentration of salt and PEG. We report here the crystallization,preliminary stages of structure determination and the detection of the structural phasetransition in the P21 crystal form of G. sulphuraria RUBISCO. This red algae enzymebelongs to the hexadecameric class (L8S8 with an approximate molecular weight 0.6MDa.The phase transition in G. sulphuraria RUBISCO leads from two hexadecamers to a singlehexadecamer per asymmetric unit. The preservation of diffraction power in a phasetransition for such a large macromolecule is rare.

Structure analysis of adsorbed star-like polymers with GISAS and SFM

CERN Document Server

Wolkenhauer, M; Wunnicke, O; Stamm, M; Roovers, J; Krosigk, G V; Cubitt, R

2002-01-01

The lateral structures of dried adsorbed binary mixtures of star polymers were investigated. Blends of protonated and deuterated polybutadiene stars were prepared from cyclohexane solutions and adsorbed onto silicon substrates. The number of arms and the molecular weight of the arms was varied. With grazing incidence small angle scattering techniques (GISAS) and scanning force microscopy (SFM), different dominant in-plane length scales were determined. The morphology of these structures is dominated by blob-like structures created from single stars or agglomerates of star polymers. (orig.)

Personification in discourse: linguistic forms, conceptual structures and communicative functions.

NARCIS (Netherlands)

Dorst, A.G.

2011-01-01

Drawing on examples from a corpus of 14 excerpts from novels, this article aims to present a systematic investigation of the different linguistic forms, conceptual structures and communicative functions of personification in discourse. The Metaphor Identification Procedure (Pragglejaz Group, 2007)

Chemical and structural analyses of subsurface crevices formed during spontaneous deposition of cerium-based conversion coatings

Energy Technology Data Exchange (ETDEWEB)

Heller, Daimon K, E-mail: dkheller@mmm.com; Fahrenholtz, William G., E-mail: billf@mst.edu; O' Keefe, Matthew J., E-mail: mjokeefe@mst.edu

2011-11-15

Subsurface crevices formed during the deposition of cerium-based conversion coatings were analyzed in cross-section to assess the effect of deposition and post-treatment on the structure and chemistry of phases present. An Al-O containing phase, believed to be amorphous Al(OH){sub 3}, was formed in crevices during coating deposition. Analysis by energy dispersive X-ray spectroscopy revealed the presence of up to 1.6 at.% chlorine within the Al-O phase, which was likely a product of soluble chlorides that were present in the coating solution. Cerium was not detected within crevices. After post-treatment in an 85 deg. C aqueous phosphate solution, the chloride concentration was reduced to {<=} 0.30 at.% and electron diffraction of the Al-O phase produced ring patterns, indicating it had crystallized. Some diffraction patterns could be indexed to gibbsite (Al(OH){sub 3}), but others are believed to be a combination of hydrated aluminum hydroxides and/or oxides. Aluminum phosphate was not identified. Separately from its effect on cerium-based conversion coatings, phosphate post-treatment improved the corrosion resistance of Al 2024-T3 substrates by acting to crystallize Al(OH){sub 3} present on interior surfaces of crevices and by reducing the chloride concentration in this phase. - Highlights: {yields} Analysis of subsurface crevices formed during deposition of Ce-based conversion coatings. {yields} Phosphate post-treatment improved corrosion protection in salt spray testing. {yields} Post-treatment affected the composition and structure of regions within crevices. {yields} Crystallized Al(OH){sub 3} within crevices acted as a more effective barrier to chloride ions.

Characterization of dermal plates from armored catfish Pterygoplichthys pardalis reveals sandwich-like nanocomposite structure.

Science.gov (United States)

Ebenstein, Donna; Calderon, Carlos; Troncoso, Omar P; Torres, Fernando G

2015-05-01

Dermal plates from armored catfish are bony structures that cover their body. In this paper we characterized structural, chemical, and nanomechanical properties of the dermal plates from the Amazonian fish Pterygoplichthys pardalis. Analysis of the morphology of the plates using scanning electron microscopy (SEM) revealed that the dermal plates have a sandwich-like structure composed of an inner porous matrix surrounded by two external dense layers. This is different from the plywood-like laminated structure of elasmoid fish scales but similar to the structure of osteoderms found in the dermal armour of some reptiles and mammals. Chemical analysis performed using Fourier transform infrared spectroscopy (FTIR), differential scanning calorimetry (DSC) and X-ray diffraction (XRD) results revealed similarities between the composition of P. pardalis plates and the elasmoid fish scales of Arapaima gigas. Reduced moduli of P. pardalis plates measured using nanoindentation were also consistent with reported values for A. gigas scales, but further revealed that the dermal plate is an anisotropic and heterogeneous material, similar to many other fish scales and osteoderms. It is postulated that the sandwich-like structure of the dermal plates provides a lightweight and tough protective layer. Copyright © 2015 Elsevier Ltd. All rights reserved.

An Extreme-ultraviolet Wave Generating Upward Secondary Waves in a Streamer-like Solar Structure

Science.gov (United States)

Zheng, Ruisheng; Chen, Yao; Feng, Shiwei; Wang, Bing; Song, Hongqiang

2018-05-01

Extreme-ultraviolet (EUV) waves, spectacular horizontally propagating disturbances in the low solar corona, always trigger horizontal secondary waves (SWs) when they encounter the ambient coronal structure. We present the first example of upward SWs in a streamer-like structure after the passing of an EUV wave. This event occurred on 2017 June 1. The EUV wave happened during a typical solar eruption including a filament eruption, a coronal mass ejection (CME), and a C6.6 flare. The EUV wave was associated with quasi-periodic fast propagating (QFP) wave trains and a type II radio burst that represented the existence of a coronal shock. The EUV wave had a fast initial velocity of ∼1000 km s‑1, comparable to high speeds of the shock and the QFP wave trains. Intriguingly, upward SWs rose slowly (∼80 km s‑1) in the streamer-like structure after the sweeping of the EUV wave. The upward SWs seemed to originate from limb brightenings that were caused by the EUV wave. All of the results show that the EUV wave is a fast-mode magnetohydrodynamic (MHD) shock wave, likely triggered by the flare impulses. We suggest that part of the EUV wave was probably trapped in the closed magnetic fields of the streamer-like structure, and upward SWs possibly resulted from the release of slow-mode trapped waves. It is believed that the interplay of the strong compression of the coronal shock and the configuration of the streamer-like structure is crucial for the formation of upward SWs.

Analysis of optical vortices with suppressed sidelobes using modified Bessel-like function and trapezoid annulus modulation structures.

Science.gov (United States)

Guo, Jian; Wei, Zhongchao; Liu, Yuebo; Huang, Aili

2015-02-01

Two amplitude modulation methods, including modified Bessel-like function modulation structure and trapezoid annulus structure, for suppressing sidelobes of optical vortices are studied. In the former approach, we propose that the order of the Bessel-like function can be an additional parameter to modulate diffraction patterns of optical vortices motivated by the idea of conventional annulus structures. Furthermore, new Bessel-like modulation functions are introduced to solve the problem of low diffraction efficiency of the original one. Trapezoid annulus structure is proposed as a compromise structure between the modified Bessel-like modulation structure and the conventional annulus one, and has advantages of both. It is demonstrated that these two approaches can achieve high-quality optical vortices with suppressed sidelobes effectively, and the relative structures behave as more flexible and applicable structures for producing optical vortices with large coverage of topological charges, which suggests great potential in simplifying the structure designing procedure. These reliable and generalized structures for generating high-quality optical vortices will help to promote the development of future optical communication and optical manipulation significantly.

Nuclear reactor structural material forming less radioactive corrosion product

International Nuclear Information System (INIS)

Nakazawa, Hiroshi.

1988-01-01

Purpose: To provide nuclear reactor structural materials forming less radioactive corrosion products. Constitution: Ni-based alloys such as inconel alloy 718, 600 or inconel alloy 750 and 690 having excellent corrosion resistance and mechanical property even in coolants at high temperature and high pressure have generally been used as nuclear reactor structural materials. However, even such materials yield corrosion products being attacked by coolants circulating in the nuclear reactor, which produce by neutron irradiation radioactive corrosion products, that are deposited in primary circuit pipeways to constitute exposure sources. The present invention dissolves dissolves this problems by providing less activating nuclear reactor structural materials. That is, taking notice on the fact that Ni-58 contained generally by 68 % in Ni changes into Co-58 under irradiation of neutron thereby causing activation, the surface of nuclear reactor structural materials is applied with Ni plating by using Ni with a reduced content of Ni-58 isotopes. Accordingly, increase in the radiation level of the nuclear reactor structural materials can be inhibited. (K.M.)

Single site porphyrine-like structures advantages over metals for selective electrochemical CO2 reduction

DEFF Research Database (Denmark)

Bagger, Alexander; Ju, Wen; Varela, Ana Sofia

2017-01-01

Currently, no catalysts are completely selective for the electrochemical CO2 Reduction Reaction (CO2RR). Based on trends in density functional theory calculations of reaction intermediates we find that the single metal site in a porphyrine-like structure has a simple advantage of limiting...... the competing Hydrogen Evolution Reaction (HER). The single metal site in a porphyrine-like structure requires an ontop site binding of hydrogen, compared to the hollow site binding of hydrogen on a metal catalyst surface. The difference in binding site structure gives a fundamental energy-shift in the scaling...... relation of ∼0.3eV between the COOH* vs. H* intermediate (CO2RR vs. HER). As a result, porphyrine-like catalysts have the advantage over metal catalyst of suppressing HER and enhancing CO2RR selectivity....

NaAuS chicken-wire-like semiconductor: Electronic structure and optical properties

International Nuclear Information System (INIS)

Reshak, A.H.; Khan, Saleem Ayaz; Kamarudin, H.; Bila, Jiri

2014-01-01

Highlights: • Chicken wire like semiconductor NaAuS was investigated. • Good agreement with experimental data was found. • Electronic charge density of chicken wire like semiconductor NaAuS was obtained. • The calculated uniaxial anisotropy is −0.0005, indicating the strong anisotropy. -- Abstract: The electronic structure, charge density and optical properties of NaAuS a chicken-wire-like semiconductor was calculated using full potential linear augmented plane wave based on density functional theory. The Ceperley-Alder local density approximation, Perdew Becke Ernzerhof Generalized gradient approximation and Engel Voskov Generalized Gradient Approximation were applied to solve the exchange correlation potential. The investigation of band structures and density of states elucidates that Engle Vasko Generalized Gradient Approximation shows close agreement to the experimental data. The calculated valence charge density shows pure ionic nature of Au–Au bond. It becomes partially covalent when Au is connected with two Na atoms. The linear optical susceptibilities of chicken-wire-like NaAuS semiconductor are calculated so as to obtain further insight into the electronic properties. The uniaxial anisotropy is −0.0005, indicating the strong anisotropy of the dielectric function in the NaAuS a chicken-wire-like semiconductor

NaAuS chicken-wire-like semiconductor: Electronic structure and optical properties

Energy Technology Data Exchange (ETDEWEB)

Reshak, A.H. [Institute of Complex Systems, FFPW, CENAKVA, University of South Bohemia in CB, Nove Hrady 37333 (Czech Republic); Center of Excellence Geopolymer and Green Technology, School of Material Engineering, University Malaysia Perlis, 01007 Kangar, Perlis (Malaysia); Khan, Saleem Ayaz, E-mail: sayaz_usb@yahoo.com [Institute of Complex Systems, FFPW, CENAKVA, University of South Bohemia in CB, Nove Hrady 37333 (Czech Republic); Kamarudin, H. [Center of Excellence Geopolymer and Green Technology, School of Material Engineering, University Malaysia Perlis, 01007 Kangar, Perlis (Malaysia); Bila, Jiri [Department of Instrumentation and Control Engineering, Faculty of Mechanical Engineering, CTU in Prague, Technicka 4, 166 07 Prague 6 (Czech Republic)

2014-01-05

Highlights: • Chicken wire like semiconductor NaAuS was investigated. • Good agreement with experimental data was found. • Electronic charge density of chicken wire like semiconductor NaAuS was obtained. • The calculated uniaxial anisotropy is −0.0005, indicating the strong anisotropy. -- Abstract: The electronic structure, charge density and optical properties of NaAuS a chicken-wire-like semiconductor was calculated using full potential linear augmented plane wave based on density functional theory. The Ceperley-Alder local density approximation, Perdew Becke Ernzerhof Generalized gradient approximation and Engel Voskov Generalized Gradient Approximation were applied to solve the exchange correlation potential. The investigation of band structures and density of states elucidates that Engle Vasko Generalized Gradient Approximation shows close agreement to the experimental data. The calculated valence charge density shows pure ionic nature of Au–Au bond. It becomes partially covalent when Au is connected with two Na atoms. The linear optical susceptibilities of chicken-wire-like NaAuS semiconductor are calculated so as to obtain further insight into the electronic properties. The uniaxial anisotropy is −0.0005, indicating the strong anisotropy of the dielectric function in the NaAuS a chicken-wire-like semiconductor.

The induction of dentin bridge-like structures by constructs of subcultured dental pulp-derived cells and porous HA/TCP in porcine teeth.

Science.gov (United States)

Ando, Yusuke; Honda, Masaki J; Ohshima, Hayato; Tonomura, Akiko; Ohara, Takayuki; Itaya, Toshimitsu; Kagami, Hideaki; Ueda, Minoru

2009-02-01

The purpose of this study was to investigate dentin-bridge formation in teeth following the transplantation of dental pulp-derived cells seeded on hydroxyapatite/tricalcium phosphate (HA/TCP) scaffolds. The dental pulp tissues were removed from the extracted first molar teeth of miniature pigs and single cell populations were subcultured. Second-passage cells that had alkaline phosphatase activity were combined with scaffolds. Cell-scaffold constructs were placed in contact with the exposed pulp tissue. The dimensions of the exposed pulp site were approximately 1-2.5 mm in diameter and 2-3 mm in depth from the tooth surface. After placing the constructs, the tooth was restored with composite resin. Six weeks after transplantation, hard tissue formation was observed on the pulp tissue in histology. Dentinal tubule-like structures were observed in most of the hard tissue generated, and columnar cells, which showed positive immunoreactions with dentin sialoprotein (DSP) and heat shock protein (HSP)-25, were aligned beneath the hard tissues. When only scaffolds were placed on the pulp tissues, particles of hard tissue were formed, however dentinal tubule-like structures and odontoblasts were not observed despite the formation of hard tissue. In conclusion, the implantation of dental pulp constructs into pulp exposed stimulates the formation of calcified dentin-like structures.

Phase transitions of antibiotic clarithromycin forms I, IV and new form VII crystals.

Science.gov (United States)

Ito, Masataka; Shiba, Rika; Watanabe, Miteki; Iwao, Yasunori; Itai, Shigeru; Noguchi, Shuji

2018-06-01

Metastable crystal form I of the antibiotic clarithromycin has a pharmaceutically valuable characteristic that its crystalline phase transition can be applied for its sustained release from tablets. The phase transition of form I was investigated in detail by single crystal and powder X-ray analyses, dynamic vapor sorption analysis and thermal analysis. The single crystal structure of form I revealed that form I was not an anhydrate crystal but contained a partially occupied water molecule in the channel-like void space. Dynamic vapor sorption (DVS) analysis demonstrated that form I crystals reversibly sorbed water molecules in two steps when the relative humidity (RH) increased and finally transited to hydrate form IV at 95% RH. DVS analysis also showed that when the RH decreased form IV crystals lost water molecules at 40% RH and transited to the newly identified anhydrate crystal form VII. Form VII reversibly transited to form IV at lower RH than form I, suggesting that form I is more suitable for manufacturing a sustained-release tablet of CAM utilizing the crystalline phase transition. Copyright © 2018 Elsevier B.V. All rights reserved.

Fibrin structural and diffusional analysis suggests that fibers are permeable to solute transport.

Science.gov (United States)

Leonidakis, Kimon Alexandros; Bhattacharya, Pinaki; Patterson, Jennifer; Vos, Bart E; Koenderink, Gijsje H; Vermant, Jan; Lambrechts, Dennis; Roeffaers, Maarten; Van Oosterwyck, Hans

2017-01-01

Fibrin hydrogels are promising carrier materials in tissue engineering. They are biocompatible and easy to prepare, they can bind growth factors and they can be prepared from a patient's own blood. While fibrin structure and mechanics have been extensively studied, not much is known about the relation between structure and diffusivity of solutes within the network. This is particularly relevant for solutes with a size similar to that of growth factors. A novel methodological approach has been used in this study to retrieve quantitative structural characteristics of fibrin hydrogels, by combining two complementary techniques, namely confocal fluorescence microscopy with a fiber extraction algorithm and turbidity measurements. Bulk rheological measurements were conducted to determine the impact of fibrin hydrogel structure on mechanical properties. From these measurements it can be concluded that variations in the fibrin hydrogel structure have a large impact on the rheological response of the hydrogels (up to two orders of magnitude difference in storage modulus) but only a moderate influence on the diffusivity of dextran solutes (up to 25% difference). By analyzing the diffusivity measurements by means of the Ogston diffusion model we further provide evidence that individual fibrin fibers can be semi-permeable to solute transport, depending on the average distance between individual protofibrils. This can be important for reducing mass transport limitations, for modulating fibrinolysis and for growth factor binding, which are all relevant for tissue engineering. Fibrin is a natural biopolymer that has drawn much interest as a biomimetic carrier in tissue engineering applications. We hereby use a novel combined approach for the structural characterization of fibrin networks based on optical microscopy and light scattering methods that can also be applied to other fibrillar hydrogels, like collagen. Furthermore, our findings on the relation between solute transport

Comparative structure-function characterization of the saposin-like domains from potato, barley, cardoon and Arabidopsis aspartic proteases.

Science.gov (United States)

Bryksa, Brian C; Grahame, Douglas A; Yada, Rickey Y

2017-05-01

The present study characterized the aspartic protease saposin-like domains of four plant species, Solanum tuberosum (potato), Hordeum vulgare L. (barley), Cynara cardunculus L. (cardoon; artichoke thistle) and Arabidopsis thaliana, in terms of bilayer disruption and fusion, and structure pH-dependence. Comparison of the recombinant saposin-like domains revealed that each induced leakage of bilayer vesicles composed of a simple phospholipid mixture with relative rates Arabidopsis>barley>cardoon>potato. When compared for leakage of bilayer composed of a vacuole-like phospholipid mixture, leakage was approximately five times higher for potato saposin-like domain compared to the others. In terms of fusogenic activity, distinctions between particle size profiles were noted among the four proteins, particularly for potato saposin-like domain. Bilayer fusion assays in reducing conditions resulted in altered fusion profiles except in the case of cardoon saposin-like domain which was virtually unchanged. Secondary structure profiles were similar across all four proteins under different pH conditions, although cardoon saposin-like domain appeared to have higher overall helix structure. Furthermore, increases in Trp emission upon protein-bilayer interactions suggested that protein structure rearrangements equilibrated with half-times ranging from 52 to 120s, with cardoon saposin-like domain significantly slower than the other three species. Overall, the present findings serve as a foundation for future studies seeking to delineate protein structural features and motifs in protein-bilayer interactions based upon variability in plant aspartic protease saposin-like domain structures. Copyright © 2017 Elsevier B.V. All rights reserved.

Liquid Crystal Enabled Early Stage Detection of Beta Amyloid Formation on Lipid Monolayers

Energy Technology Data Exchange (ETDEWEB)

Sadati, Monirosadat [Institute for Molecular Engineering, University of Chicago, Chicago IL 60637 USA; Apik, Aslin Izmitli [Chemical and Biological Engineering, University of Wisconsin, Madison WI 53706 USA; Armas-Perez, Julio C. [Institute for Molecular Engineering, University of Chicago, Chicago IL 60637 USA; Martinez-Gonzalez, Jose [Institute for Molecular Engineering, University of Chicago, Chicago IL 60637 USA; Hernandez-Ortiz, Juan P. [Institute for Molecular Engineering, University of Chicago, Chicago IL 60637 USA; Departamento de Materiales y Minerales, Facultad de Minas, Universidad Nacional de Colombia, Sede Medellín, Calle 75 # 79A-51, Bloque M17 Medellín Colombia; Abbott, Nicholas L. [Chemical and Biological Engineering, University of Wisconsin, Madison WI 53706 USA; de Pablo, Juan J. [Institute for Molecular Engineering, University of Chicago, Chicago IL 60637 USA; Argonne National Laboratory, Argonne IL 60439 USA

2015-09-09

Liquid crystals (LCs) can serve as sensitive reporters of interfacial events, and this property has been used for sensing of synthetic or biological toxins. Here it is demonstrated that LCs can distinguish distinct molecular motifs and exhibit a specific response to beta-sheet structures. That property is used to detect the formation of highly toxic protofibrils involved in neurodegenerative diseases, where it is crucial to develop methods that probe the early-stage aggregation of amyloidogenic peptides in the vicinity of biological membranes. In the proposed method, the amyloid fibrils formed at the lipid-decorated LC interface can change the orientation of LCs and form elongated and branched structures that are amplified by the mesogenic medium; however, nonamyloidogenic peptides form ellipsoidal domains of tilted LCs. Moreover, a theoretical and computational analysis is used to reveal the underlying structure of the LC, thereby providing a detailed molecular-level view of the interactions and mechanisms responsible for such motifs. The corresponding signatures can be detected at nanomolar concentrations of peptide by polarized light microscopy and much earlier than the ones that can be identified by fluorescence-based techniques. As such, it offers the potential for early diagnoses of neurodegenerative diseases and for facile testing of inhibitors of amyloid formation.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Structure and Biological Activity of Pathogen-like Synthetic Nanomedicines

Science.gov (United States)

Lőrincz, Orsolya; Tőke, Enikő R.; Somogyi, Eszter; Horkay, Ferenc; Chandran, Preethi; Douglas, Jack F.; Szebeni, János; Lisziewicz, Julianna

2011-01-01

Here we characterize the structure, stability and intracellular mode-of-action of DermaVir nanomedicine that is under clinical development for the treatment of HIV/AIDS. This nanomedicine is comprised of pathogen-like pDNA/PEIm nanoparticles (NPs) having the structure and function resembling spherical viruses that naturally evolved to deliver nucleic acids to the cells. Atomic force microscopy demonstrated spherical 100–200nm NPs with a smooth polymer surface protecting the pDNA in the core. Optical-absorption determined both the NP structural stability and biological activity relevant to their ability to escape from the endosome and release the pDNA at the nucleus. Salt, pH and temperature influence the nanomedicine shelf-life and intracellular stability. This approach facilitates the development of diverse polyplex nanomedicines where the delivered pDNA-expressed antigens induce immune responses to kill infected cells. PMID:21839051

Structure and Calcium Binding Properties of a Neuronal Calcium-Myristoyl Switch Protein, Visinin-Like Protein 3.

Science.gov (United States)

Li, Congmin; Lim, Sunghyuk; Braunewell, Karl H; Ames, James B

2016-01-01

Visinin-like protein 3 (VILIP-3) belongs to a family of Ca2+-myristoyl switch proteins that regulate signal transduction in the brain and retina. Here we analyze Ca2+ binding, characterize Ca2+-induced conformational changes, and determine the NMR structure of myristoylated VILIP-3. Three Ca2+ bind cooperatively to VILIP-3 at EF2, EF3 and EF4 (KD = 0.52 μM and Hill slope of 1.8). NMR assignments, mutagenesis and structural analysis indicate that the covalently attached myristoyl group is solvent exposed in Ca2+-bound VILIP-3, whereas Ca2+-free VILIP-3 contains a sequestered myristoyl group that interacts with protein residues (E26, Y64, V68), which are distinct from myristate contacts seen in other Ca2+-myristoyl switch proteins. The myristoyl group in VILIP-3 forms an unusual L-shaped structure that places the C14 methyl group inside a shallow protein groove, in contrast to the much deeper myristoyl binding pockets observed for recoverin, NCS-1 and GCAP1. Thus, the myristoylated VILIP-3 protein structure determined in this study is quite different from those of other known myristoyl switch proteins (recoverin, NCS-1, and GCAP1). We propose that myristoylation serves to fine tune the three-dimensional structures of neuronal calcium sensor proteins as a means of generating functional diversity.

Structure and Dynamics of the tRNA-like Structure Domain of Brome Mosaic Virus

Science.gov (United States)

Vieweger, Mario; Nesbitt, David

2014-03-01

Conformational switching is widely accepted as regulatory mechanism in gene expression in bacterial systems. More recently, similar regulation mechanisms are emerging for viral systems. One of the most abundant and best studied systems is the tRNA-like structure domain that is found in a number of plant viruses across eight genera. In this work, the folding dynamics of the tRNA-like structure domain of Brome Mosaic Virus are investigated using single-molecule Fluorescence Resonance Energy Transfer techniques. In particular, Burst fluorescence is applied to observe metal-ion induced folding in freely diffusing RNA constructs resembling the 3'-terminal 169nt of BMV RNA3. Histograms of EFRET probabilities reveal a complex equilibrium of three distinct populations. A step-wise kinetic model for TLS folding is developed in accord with the evolution of conformational populations and structural information in the literature. In this mechanism, formation of functional TLS domains from unfolded RNAs requires two consecutive steps; 1) hybridization of a long-range stem interaction followed by 2) formation of a 3' pseudoknot. This three-state equilibrium is well described by step-wise dissociation constants K1(328(30) μM) and K2(1092(183) μM) for [Mg2+] and K1(74(6) mM) and K2(243(52) mM) for [Na+]-induced folding. The kinetic model is validated by oligo competition with the STEM interaction. Implications of this conformational folding mechanism are discussed in regards to regulation of virus replication.

METHODS OF FORMING THE STRUCTURE OF KNOWLEDGE

Directory of Open Access Journals (Sweden)

Tatyana A. Snegiryova

2015-01-01

Full Text Available The aim of the study is to describe the method of forming thestructure of knowledge of students on the basis of an integrated approach (expert, taxonomy and thesaurus and the presentation of the results of its use in the study of medical and biological physics at the Izhevsk State Medical Academy.Methods. The methods used in the work involve: an integrated approach that includes group expert method, developed by V. S. Cherepanov; taxonomy and thesaurus approach when creating a model of taxonomic structure of knowledge, as well as models of the formation of the knowledge structure.Results. The algorithm, stages and procedures of knowledge structure formation of trainees are considered in detail; the model of the given process is created; the technology of content selection of a teaching material due to the fixed time that has been released on studying of concrete discipline is shown.Scientific novelty and practical significance. Advantage of the proposed method and model of students’ knowledge structure formation consists in their flexibility: at certain adaptation they can be used while training to any discipline apart of its specificity and educational institution. Observance of all stages of the presented technology of content selection of a teaching material on the basis of an expert estimation will promote substantial increase of quality of training; make it possible to develop the unified method uniting the various points of view of teachers on knowledge formation of trainees.

Discrete-time Calogero-Moser system and Lagrangian 1-form structure

International Nuclear Information System (INIS)

Yoo-Kong, Sikarin; Lobb, Sarah; Nijhoff, Frank

2011-01-01

We study the Lagrange formalism of the (rational) Calogero-Moser (CM) system, both in discrete time and continuous time, as a first example of a Lagrangian 1-form structure in the sense of the recent paper (Lobb and Nijhoff 2009 J. Phys. A: Math. Theor.42 454013). The discrete-time model of the CM system was established some time ago arising as a pole reduction of a semi-discrete version of the Kadomtsev-Petviashvili (KP) equation, and was shown to lead to an exactly integrable correspondence (multivalued map). In this paper, we present the full KP solution based on the commutativity of the discrete-time flows in the two discrete KP variables. The compatibility of the corresponding Lax matrices is shown to lead directly to the relevant closure relation on the level of the Lagrangians. Performing successive continuum limits on both the level of the KP equation and the level of the CM system, we establish the proper Lagrangian 1-form structure for the continuum case of the CM model. We use the example of the three-particle case to elucidate the implementation of the novel least-action principle, which was presented in Lobb and Nijhoff (2009), for the simpler case of Lagrangian 1-forms. (paper)

Organizational form, local market structure and corporate social performance in retail

OpenAIRE

Utgård, Jakob

2015-01-01

I study how organizational form and local market structure influence retail firms' corporate social performance (CSP). The theoretical model is based on agency theory, which in its origin focuses on the dyad between the principal and the agent. I extend this perspective and examine how characteristics of the environment outside the dyad influence the outcomes. Retail stores vary in their organizational form and thereby in their incentives to maximize profits. I hypothesize that the different ...

IIB backgrounds with five-form flux

International Nuclear Information System (INIS)

Gran, U.; Gutowski, J.; Papadopoulos, G.

2008-01-01

We investigate all N=2 supersymmetric IIB supergravity backgrounds with non-vanishing five-form flux. The Killing spinors have stability subgroups Spin(7) x R 8 , SU(4) x R 8 and G 2 . In the SU(4) x R 8 case, two different types of geometry arise depending on whether the Killing spinors are generic or pure. In both cases, the backgrounds admit a null Killing vector field which leaves invariant the SU(4) x R 8 structure, and an almost complex structure in the directions transverse to the lightcone. In the generic case, the twist of the vector field is trivial but the almost complex structure is non-integrable, while in the pure case the twist is non-trivial but the almost complex structure is integrable and associated with a relatively balanced Hermitian structure. The G 2 backgrounds admit a time-like Killing vector field and two spacelike closed one-forms, and the seven directions transverse to these admit a co-symplectic G 2 structure. The Spin(7) x R 8 backgrounds are pp-waves propagating in an eight-dimensional manifold with holonomy Spin(7). In addition we show that all the supersymmetric solutions of simple five-dimensional supergravity with a time-like Killing vector field, which include the AdS 5 black holes, lift to SU(4) x R 8 pure Killing spinor IIB backgrounds. We also show that the LLM solution is associated with a co-symplectic co-homogeneity one G 2 manifold which has principal orbit S 3 xS 3

The Open Form Inducer Approach for Structure-Based Drug Design.

Directory of Open Access Journals (Sweden)

Daniel Ken Inaoka

Full Text Available Many open form (OF structures of drug targets were obtained a posteriori by analysis of co-crystals with inhibitors. Therefore, obtaining the OF structure of a drug target a priori will accelerate development of potent inhibitors. In addition to its small active site, Trypanosoma cruzi dihydroorotate dehydrogenase (TcDHODH is fully functional in its monomeric form, making drug design approaches targeting the active site and protein-protein interactions unrealistic. Therefore, a novel a priori approach was developed to determination the TcDHODH active site in OF. This approach consists of generating an "OF inducer" (predicted in silico to bind the target and cause steric repulsion with flexible regions proximal to the active site that force it open. We provide the first proof-of-concept of this approach by predicting and crystallizing TcDHODH in complex with an OF inducer, thereby obtaining the OF a priori with its subsequent use in designing potent and selective inhibitors. Fourteen co-crystal structures of TcDHODH with the designed inhibitors are presented herein. This approach has potential to encourage drug design against diseases where the molecular targets are such difficult proteins possessing small AS volume. This approach can be extended to study open/close conformation of proteins in general, the identification of allosteric pockets and inhibitors for other drug targets where conventional drug design approaches are not applicable, as well as the effective exploitation of the increasing number of protein structures deposited in Protein Data Bank.

Covariant description of Hamiltonian form for field dynamics

International Nuclear Information System (INIS)

Ozaki, Hiroshi

2005-01-01

Hamiltonian form of field dynamics is developed on a space-like hypersurface in space-time. A covariant Poisson bracket on the space-like hypersurface is defined and it plays a key role to describe every algebraic relation into a covariant form. It is shown that the Poisson bracket has the same symplectic structure that was brought in the covariant symplectic approach. An identity invariant under the canonical transformations is obtained. The identity follows a canonical equation in which the interaction Hamiltonian density generates a deformation of the space-like hypersurface. The equation just corresponds to the Yang-Feldman equation in the Heisenberg pictures in quantum field theory. By converting the covariant Poisson bracket on the space-like hypersurface to four-dimensional commutator, we can pass over to quantum field theory in the Heisenberg picture without spoiling the explicit relativistic covariance. As an example the canonical QCD is displayed in a covariant way on a space-like hypersurface

Microtunneling techniques to form an insitu barrier around existing structures

International Nuclear Information System (INIS)

Coller, P.J.; Abbott, D.G.

1994-01-01

The use of microtunneling techniques to construct underground structures has been available for many years. The technique, typically termed pipe roofing, is well proven and, to date, has been used principally to form underground access under existing structures where the use of cut and cover or conventional tunneling techniques was either impossible or too expensive. The first project involving the use of Iseki equipment, the first use of the pipe roofing technique as far as we are aware, was in 1971. This was followed by a number of projects in Japan, together with projects in Singapore and Hong Kong, totaling 12 projects. More recently, projects have been completed in Singapore and Japan and are currently in progress in Japan and Malaysia. This paper will briefly describe the use of the technique and the use of the new Iseki Unclemole for hard rock excavation to construct the largest pipe roof project ever undertaken in the world, together with other projects. The pipe roofing technique allows the construction of underground structures, in a variety of shapes and forms, by the use of remotely operated microtunnel machines. The paper will describe the potential application of this technique in the areas of hazardous and nuclear waste management

Amyloid–β peptides time-dependent structural modifications: AFM and voltammetric characterization

Energy Technology Data Exchange (ETDEWEB)

Enache, Teodor Adrian; Chiorcea-Paquim, Ana-Maria; Oliveira-Brett, Ana Maria, E-mail: brett@ci.uc.pt

2016-07-05

The human amyloid beta (Aβ) peptides, Aβ{sub 1-40} and Aβ{sub 1-42}, structural modifications, from soluble monomers to fully formed fibrils through intermediate structures, were investigated, and the results were compared with those obtained for the inverse Aβ{sub 40-1} and Aβ{sub 42-1}, mutant Aβ{sub 1-40}Phe{sup 10} and Aβ{sub 1-40}Nle{sup 35}, and rat Aβ{sub 1-40}Rat peptide sequences. The aggregation was followed at a slow rate, in chloride free media and room temperature, and revealed to be a sequence-structure process, dependent on the physicochemical properties of each Aβ peptide isoforms, and occurring at different rates and by different pathways. The fibrilization process was investigated by atomic force microscopy (AFM), via changes in the adsorption morphology from: (i) initially random coiled structures of ∼0.6 nm height, corresponding to the Aβ peptide monomers in random coil or in α-helix conformations, to (ii) aggregates and protofibrils of 1.5–6.0 nm height and (iii) two types of fibrils, corresponding to the Aβ peptide in a β-sheet configuration. The reactivity of the carbon electrode surface was considered. The hydrophobic surface induced rapid changes of the Aβ peptide conformations, and differences between the adsorbed fibrils, formed at the carbon surface (beaded, thin, <2.0 nm height) or in solution (long, smooth, thick, >2.0 nm height), were detected. Differential pulse voltammetry showed that, according to their primary structure, the Aβ peptides undergo oxidation in one or two steps, the first step corresponding to the tyrosine amino acids oxidation, and the second one to the histidine and methionine amino acids oxidation. The fibrilization process was electrochemically detected via the decrease of the Aβ peptide oxidation peak currents that occurred in a time dependent manner. - Highlights: • The Aβ peptide fibrilization process was followed by AFM and DP voltammetry. • The human Aβ{sub 1-40} and Aβ{sub 1

USAGE OF MONOCLONAL ANTIBODIES FOR DETERMINATION OF LOCALIZATION OF ANTIGENIC DETERMINANTS AND FIBRIN POLYMERIZATION SITES WITHIN FIBRINOGEN AND FIBRIN MOLECULES AND THEIR APPLICATION IN TEST--SYSTEMS FOR DIAGNOSTICS AND THE THREAT OF THROMBUS FORMATION

Directory of Open Access Journals (Sweden)

E. V. Lugovskoi

2013-08-01

Full Text Available It was shown by monoclonal antibodies that B?N-region of fibrin desA molecule (B?1-53 comprises the polymerization site including the peptide bond B?14-15. This site participates in the second stage of fibrin polymerization — lateral association of protofibrils. In the B?15-53 fragment was also found the site called «C», which together with the site «A» participate in the first stage of polymerization — the protofibrils formation. The model of the primary intermolecular interaction of fibrin was designed. It was found by monoclonal antibodies II-4d the site («c» in the N-terminal half of ? chain of the fibrin D-region. This site participates in the protofibrils formation and is complement to site «C» as we assume. We have discovered two neoantigenic determinants. One of these determinants exposes within the coiledcoil fragment B?126-135 of fibrin as a result of fibrinopeptide A splitting off from fibrinogen by thrombin. The structural rearrangements discovered in this site of the fibrin molecule are necessary for the following protofibrils lateral association. The second neoantigenic determinant is localized in the fragment B?134-190 of D-dimer formed after plasmin degradation of fibrin stabilized by FXIIIa. We have obtained the fibrin-specific monoclonal antibodie FnI-3C to the first determinant and D-dimer-specific mAb III-3b to the second one. Three monoclonal antibodies were obtained against the ?C-region of fibrin(ogen molecule. It has been experimentally shown by of one of them that ?C-domains is connected with the fibrinopeptides B in fibrinogen and fibrin desA molecules, but removes from the core of the molecules after fibrinopeptides B splitting off by thrombin. Two other monoclonal antibodies specifically inhibit the fibrin polymerization by blocking two unknown polymerization sites within the ?C-region. The test-systems for the soluble fibrin and D-dimer quantification in human blood plasma were designed on the basis of

Regge-like initial input and evolution of non-singlet structure ...

Indian Academy of Sciences (India)

Regge-like initial input and evolution of non-singlet structure functions from DGLAP equation up to next-next-to-leading order at low x and low Q. 2. NAYAN MANI NATH1,2,∗, MRINAL KUMAR DAS1 and JAYANTA KUMAR SARMA1. 1Department of Physics, Tezpur University, Tezpur 784 028, India. 2Department of Physics ...

Effects of coupling and asymmetries on load resilience of IC ITER-like structures

International Nuclear Information System (INIS)

Bosia, G.; Bremond, S.; Colas, L.

2005-01-01

ITER-like structures feature an intrinsic resilience to load variations, which is related to the symmetry of the currents in the two branches of the structure. It has been suggested that the effects of coupling between the array elements would significantly impair the load resilience of the structure. In this paper the effect of inter strap coupling and of however induced electrical array asymmetries on the structure load resilience are quantitatively examined

Form factors and structure functions of hadrons in parton model

International Nuclear Information System (INIS)

Volkonskij, N.Yu.

1979-01-01

The hadron charge form factors and their relation to the deep-inelastic lepton-production structure functions in the regions of asymptotically high and small momentum transfer Q 2 are studied. The nucleon and pion charge radii are calculated. The results of calculations are in good agreement with the experimental data. The K- and D-meson charge radii are estimated. In the region of asymptotically high Q 2 the possibility of Drell-Yan-West relation violation is analyzed. It is shown, that for pseudoscalar mesons this relation is violated. The relation between the proton and neutron form factor asymptotics is obtained

Generating Free-Form Grid Truss Structures from 3D Scanned Point Clouds

Directory of Open Access Journals (Sweden)

Hui Ding

2017-01-01

Full Text Available Reconstruction, according to physical shape, is a novel way to generate free-form grid truss structures. 3D scanning is an effective means of acquiring physical form information and it generates dense point clouds on surfaces of objects. However, generating grid truss structures from point clouds is still a challenge. Based on the advancing front technique (AFT which is widely used in Finite Element Method (FEM, a scheme for generating grid truss structures from 3D scanned point clouds is proposed in this paper. Based on the characteristics of point cloud data, the search box is adopted to reduce the search space in grid generating. A front advancing procedure suit for point clouds is established. Delaunay method and Laplacian method are used to improve the quality of the generated grids, and an adjustment strategy that locates grid nodes at appointed places is proposed. Several examples of generating grid truss structures from 3D scanned point clouds of seashells are carried out to verify the proposed scheme. Physical models of the grid truss structures generated in the examples are manufactured by 3D print, which solidifies the feasibility of the scheme.

Unusual “Knob-Like Chimney” Growth Forms on Acropora Species in the Caribbean

Directory of Open Access Journals (Sweden)

Andrea Rivera-Sosa

2018-02-01

Full Text Available This manuscript provides new insights on an unusual morphological plasticity growth form on Acropora spp. in the Caribbean. This abnormal knob-shaped growth is thought to be a progression from the damselfish “chimneys” that are commonly seen in coral-algal farms. However, the diameters of the observed knobs tend to be much larger on Acropora palmata, where they range from 1.37 to 5.44 cm in diameter, and they tend to be slightly smaller on A. prolifera, where they range from 1.1 to 2.72 cm in diameter. These knob-like chimney growths can affect entire colonies. The knobs are mostly covered with live tissue, while some knobs compete with turf algae. We hypothesize that these growths may be linked to stress from multiple predation and environmental conditions. Local stressors could synergistically influence the regeneration of scarred tissue and skeleton that result from predatory lesions, possibly leading to the formation of the knobs. Therefore, we provide preliminary data from a shallow reef site in coastal Honduras located within the Mesoamerican region where we found the knobs. To the best of our knowledge, the conditions that drive the occurrence of these unusual “knob-like chimneys” on Acropora spp. have not been previously assessed. Thus, we propose a series of guidelines to research the coral morphological plasticity that may be linked to this knob-like chimney phenomenon.

Three-dimensional visualization of forming Hepatitis C virus-like particles by electron-tomography

Energy Technology Data Exchange (ETDEWEB)

Badia-Martinez, Daniel; Peralta, Bibiana [Structural Biology Unit, CIC bioGUNE, CIBERehd, 48160 Derio (Spain); Andres, German; Guerra, Milagros [Electron Microscopy Unit, Centro de Biologia Molecular Severo Ochoa, CSIC-UAM, Campus Cantoblanco, 28049 Madrid (Spain); Gil-Carton, David [Structural Biology Unit, CIC bioGUNE, CIBERehd, 48160 Derio (Spain); Abrescia, Nicola G.A., E-mail: nabrescia@cicbiogune.es [Structural Biology Unit, CIC bioGUNE, CIBERehd, 48160 Derio (Spain); IKERBASQUE, Basque Foundation for Science, 48011 Bilbao (Spain)

2012-09-01

Hepatitis C virus infects almost 170 million people per year but its assembly pathway, architecture and the structures of its envelope proteins are poorly understood. Using electron tomography of plastic-embedded sections of insect cells, we have visualized the morphogenesis of recombinant Hepatitis C virus-like particles. Our data provide a three-dimensional sketch of viral assembly at the endoplasmic reticulum showing different budding stages and contiguity of buds. This latter phenomenon could play an important role during the assembly of wt-HCV and explain the size-heterogeneity of its particles.

Three-dimensional visualization of forming Hepatitis C virus-like particles by electron-tomography

International Nuclear Information System (INIS)

Badia-Martinez, Daniel; Peralta, Bibiana; Andrés, German; Guerra, Milagros; Gil-Carton, David; Abrescia, Nicola G.A.

2012-01-01

Hepatitis C virus infects almost 170 million people per year but its assembly pathway, architecture and the structures of its envelope proteins are poorly understood. Using electron tomography of plastic-embedded sections of insect cells, we have visualized the morphogenesis of recombinant Hepatitis C virus-like particles. Our data provide a three-dimensional sketch of viral assembly at the endoplasmic reticulum showing different budding stages and contiguity of buds. This latter phenomenon could play an important role during the assembly of wt-HCV and explain the size-heterogeneity of its particles.

Co thin film with metastable bcc structure formed on GaAs(111 substrate

Directory of Open Access Journals (Sweden)

Minakawa Shigeyuki

2014-07-01

Full Text Available Co thin films are prepared on GaAs(111 substrates at temperatures ranging from room temperature to 600 ºC by radio-frequency magnetron sputtering. The growth behavior and the detailed resulting film structure are investigated by in-situ reflection high-energy electron diffraction and X-ray diffraction. In early stages of film growth at temperatures lower than 200 ºC, Co crystals with metastable A2 (bcc structure are formed, where the crystal structure is stabilized through hetero-epitaxial growth. With increasing the film thickness beyond 2 nm, the metastable structure starts to transform into more stable A1 (fcc structure through atomic displacements parallel to the A2{110} close-packed planes. The crystallographic orientation relationship between the A2 and the transformed A1 crystals is A1{111} || A2{110}. When the substrate temperature is higher than 400 ºC, Ga atoms of substrate diffuse into the Co films and a Co-Ga alloy with bcc-based ordered structure of B2 is formed.

Mechanical properties of amyloid-like fibrils defined by secondary structures

Science.gov (United States)

Bortolini, C.; Jones, N. C.; Hoffmann, S. V.; Wang, C.; Besenbacher, F.; Dong, M.

2015-04-01

Amyloid and amyloid-like fibrils represent a generic class of highly ordered nanostructures that are implicated in some of the most fatal neurodegenerative diseases. On the other hand, amyloids, by possessing outstanding mechanical robustness, have also been successfully employed as functional biomaterials. For these reasons, physical and chemical factors driving fibril self-assembly and morphology are extensively studied - among these parameters, the secondary structures and the pH have been revealed to be crucial, since a variation in pH changes the fibril morphology and net chirality during protein aggregation. It is important to quantify the mechanical properties of these fibrils in order to help the design of effective strategies for treating diseases related to the presence of amyloid fibrils. In this work, we show that by changing pH the mechanical properties of amyloid-like fibrils vary as well. In particular, we reveal that these mechanical properties are strongly related to the content of secondary structures. We analysed and estimated the Young's modulus (E) by comparing the persistence length (Lp) - measured from the observation of TEM images by using statistical mechanics arguments - with the mechanical information provided by peak force quantitative nanomechanical property mapping (PF-QNM). The secondary structure content and the chirality are investigated by means of synchrotron radiation circular dichroism (SR-CD). Results arising from this study could be fruitfully used as a protocol to investigate other medical or engineering relevant peptide fibrils.Amyloid and amyloid-like fibrils represent a generic class of highly ordered nanostructures that are implicated in some of the most fatal neurodegenerative diseases. On the other hand, amyloids, by possessing outstanding mechanical robustness, have also been successfully employed as functional biomaterials. For these reasons, physical and chemical factors driving fibril self-assembly and morphology

In Vitro Generation of Functional Liver Organoid-Like Structures Using Adult Human Cells.

Science.gov (United States)

Ramachandran, Sarada Devi; Schirmer, Katharina; Münst, Bernhard; Heinz, Stefan; Ghafoory, Shahrouz; Wölfl, Stefan; Simon-Keller, Katja; Marx, Alexander; Øie, Cristina Ionica; Ebert, Matthias P; Walles, Heike; Braspenning, Joris; Breitkopf-Heinlein, Katja

2015-01-01

In this study we used differentiated adult human upcyte® cells for the in vitro generation of liver organoids. Upcyte® cells are genetically engineered cell strains derived from primary human cells by lenti-viral transduction of genes or gene combinations inducing transient proliferation capacity (upcyte® process). Proliferating upcyte® cells undergo a finite number of cell divisions, i.e., 20 to 40 population doublings, but upon withdrawal of proliferation stimulating factors, they regain most of the cell specific characteristics of primary cells. When a defined mixture of differentiated human upcyte® cells (hepatocytes, liver sinusoidal endothelial cells (LSECs) and mesenchymal stem cells (MSCs)) was cultured in vitro on a thick layer of Matrigel™, they self-organized to form liver organoid-like structures within 24 hours. When further cultured for 10 days in a bioreactor, these liver organoids show typical functional characteristics of liver parenchyma including activity of cytochromes P450, CYP3A4, CYP2B6 and CYP2C9 as well as mRNA expression of several marker genes and other enzymes. In summary, we hereby describe that 3D functional hepatic structures composed of primary human cell strains can be generated in vitro. They can be cultured for a prolonged period of time and are potentially useful ex vivo models to study liver functions.

Polymorphism in phenobarbital: discovery of a new polymorph and crystal structure of elusive form V.

Science.gov (United States)

Roy, Saikat; Goud, N Rajesh; Matzger, Adam J

2016-03-21

This report highlights the discovery of a new polymorph of the anticonvulsant drug phenobarbital (PB) using polymer-induced heteronucleation (PIHn) and unravelling the crystal structure of the elusive form V. Both forms are characterized by structural, thermal and VT-Raman spectroscopy methods to elucidate phase transformation behavior and shed light on stability relationships.

High density liquid structure enhancement in glass forming aqueous solution of LiCl

Science.gov (United States)

Camisasca, G.; De Marzio, M.; Rovere, M.; Gallo, P.

2018-06-01

We investigate using molecular dynamics simulations the dynamical and structural properties of LiCl:6H2O aqueous solution upon supercooling. This ionic solution is a glass forming liquid of relevant interest in connection with the study of the anomalies of supercooled water. The LiCl:6H2O solution is easily supercooled and the liquid state can be maintained over a large decreasing temperature range. We performed simulations from ambient to 200 K in order to investigate how the presence of the salt modifies the behavior of supercooled water. The study of the relaxation time of the self-density correlation function shows that the system follows the prediction of the mode coupling theory and behaves like a fragile liquid in all the range explored. The analysis of the changes in the water structure induced by the salt shows that while the salt preserves the water hydrogen bonds in the system, it strongly affects the tetrahedral hydrogen bond network. Following the interpretation of the anomalies of water in terms of a two-state model, the modifications of the oxygen radial distribution function and the angular distribution function of the hydrogen bonds in water indicate that LiCl has the role of enhancing the high density liquid component of water with respect to the low density component. This is in agreement with recent experiments on aqueous ionic solutions.

The Generation of Turnip Crinkle Virus-Like Particles in Plants by the Transient Expression of Wild-Type and Modified Forms of Its Coat Protein.

Science.gov (United States)

Saunders, Keith; Lomonossoff, George P

2015-01-01

Turnip crinkle virus (TCV), a member of the genus carmovirus of the Tombusviridae family, has a genome consisting of a single positive-sense RNA molecule that is encapsidated in an icosahedral particle composed of 180 copies of a single type of coat protein. We have employed the CPMV-HT transient expression system to investigate the formation of TCV-like particles following the expression of the wild-type coat protein or modified forms of it that contain either deletions and/or additions. Transient expression of the coat protein in plants results in the formation of capsid structures that morphologically resemble TCV virions (T = 3 structure) but encapsidate heterogeneous cellular RNAs, rather than the specific TCV coat protein messenger RNA. Expression of an amino-terminal deleted form of the coat protein resulted in the formation of smaller T = 1 structures that are free of RNA. The possibility of utilizing TCV as a carrier for the presentation of foreign proteins on the particle surface was also explored by fusing the sequence of GFP to the C-terminus of the coat protein. The expression of coat protein-GFP hybrids permitted the formation of VLPs but the yield of particles is diminished compared to the yield obtained with unmodified coat protein. Our results confirm the importance of the N-terminus of the coat protein for the encapsidation of RNA and show that the coat protein's exterior P domain plays a key role in particle formation.

Structure-function correlations of pulmonary surfactant protein SP-B and the saposin-like family of proteins.

Science.gov (United States)

Olmeda, Bárbara; García-Álvarez, Begoña; Pérez-Gil, Jesús

2013-03-01

Pulmonary surfactant is a lipid-protein complex secreted by the respiratory epithelium of mammalian lungs, which plays an essential role in stabilising the alveolar surface and so reducing the work of breathing. The surfactant protein SP-B is part of this complex, and is strictly required for the assembly of pulmonary surfactant and its extracellular development to form stable surface-active films at the air-liquid alveolar interface, making the lack of SP-B incompatible with life. In spite of its physiological importance, a model for the structure and the mechanism of action of SP-B is still needed. The sequence of SP-B is homologous to that of the saposin-like family of proteins, which are membrane-interacting polypeptides with apparently diverging activities, from the co-lipase action of saposins to facilitate the degradation of sphingolipids in the lysosomes to the cytolytic actions of some antibiotic proteins, such as NK-lysin and granulysin or the amoebapore of Entamoeba histolytica. Numerous studies on the interactions of these proteins with membranes have still not explained how a similar sequence and a potentially related fold can sustain such apparently different activities. In the present review, we have summarised the most relevant features of the structure, lipid-protein and protein-protein interactions of SP-B and the saposin-like family of proteins, as a basis to propose an integrated model and a common mechanistic framework of the apparent functional versatility of the saposin fold.

Synthesis and Visible-Light Photocatalytic Property of Bi2WO6Hierarchical Octahedron-Like Structures

Directory of Open Access Journals (Sweden)

Li Yuanyuan

2008-01-01

Full Text Available Abstract A novel octahedron-like hierarchical structure of Bi2WO6has been fabricated by a facile hydrothermal method in high quantity. XRD, SEM, TEM, and HRTEM were used to characterize the product. The results indicated that this kind of Bi2WO6crystals had an average size of ~4 μm, constructed by quasi-square single-crystal nanosheets assembled in a special fashion. The formation of octahedron-like hierarchical structure of Bi2WO6depended crucially on the pH value of the precursor suspensions. The photocatalytic activity of the hierarchical Bi2WO6structures toward RhB degradation under visible light was investigated, and it was found to be significantly better than that of the sample fabricated by SSR. The better photocatalytic property should be strongly associated with the high specific surface area and the abundant pore structure of the hierarchical octahedron-like Bi2WO6.

Continuum modeling of three-dimensional truss-like space structures

Science.gov (United States)

Nayfeh, A. H.; Hefzy, M. S.

1978-01-01

A mathematical and computational analysis capability has been developed for calculating the effective mechanical properties of three-dimensional periodic truss-like structures. Two models are studied in detail. The first, called the octetruss model, is a three-dimensional extension of a two-dimensional model, and the second is a cubic model. Symmetry considerations are employed as a first step to show that the specific octetruss model has four independent constants and that the cubic model has two. The actual values of these constants are determined by averaging the contributions of each rod element to the overall structure stiffness. The individual rod member contribution to the overall stiffness is obtained by a three-dimensional coordinate transformation. The analysis shows that the effective three-dimensional elastic properties of both models are relatively close to each other.

Newton`s iteration for inversion of Cauchy-like and other structured matrices

Energy Technology Data Exchange (ETDEWEB)

Pan, V.Y. [Lehman College, Bronx, NY (United States); Zheng, Ailong; Huang, Xiaohan; Dias, O. [CUNY, New York, NY (United States)

1996-12-31

We specify some initial assumptions that guarantee rapid refinement of a rough initial approximation to the inverse of a Cauchy-like matrix, by mean of our new modification of Newton`s iteration, where the input, output, and all the auxiliary matrices are represented with their short generators defined by the associated scaling operators. The computations are performed fast since they are confined to operations with short generators of the given and computed matrices. Because of the known correlations among various structured matrices, the algorithm is immediately extended to rapid refinement of rough initial approximations to the inverses of Vandermonde-like, Chebyshev-Vandermonde-like and Toeplitz-like matrices, where again, the computations are confined to operations with short generators of the involved matrices.

A Biomimetic Structural Form: Developing a Paradigm to Attain Vital Sustainability in Tall Architecture

OpenAIRE

Osama Al-Sehail

2017-01-01

This paper argues for sustainability as a necessity in the evolution of tall architecture. It provides a different mode for dealing with sustainability in tall architecture, taking into consideration the speciality of its typology. To this end, the article develops a Biomimetic Structural Form as a paradigm to attain Vital Sustainability. A Biomimetic Structural Form, which is derived from the amalgamation of biomimicry as an approach for sustainability defining nature as source of knowledge ...

Form-finding with polyhedral meshes made simple

KAUST Repository

Tang, Chengcheng

2015-08-09

We solve the form-finding problem for polyhedral meshes in a way which combines form, function and fabrication; taking care of user-specified constraints like boundary interpolation, planarity of faces, statics, panel size and shape, enclosed volume, and cost. Our main application is the interactive modeling of meshes for architectural and industrial design. Our approach can be described as guided exploration of the constraint space whose algebraic structure is simplified by introducing auxiliary variables and ensuring that constraints are at most quadratic.

Form-finding with polyhedral meshes made simple

KAUST Repository

Tang, Chengcheng; Sun, Xiang; Gomes, Alexandra; Wallner, Johannes; Pottmann, Helmut

2015-01-01

We solve the form-finding problem for polyhedral meshes in a way which combines form, function and fabrication; taking care of user-specified constraints like boundary interpolation, planarity of faces, statics, panel size and shape, enclosed volume, and cost. Our main application is the interactive modeling of meshes for architectural and industrial design. Our approach can be described as guided exploration of the constraint space whose algebraic structure is simplified by introducing auxiliary variables and ensuring that constraints are at most quadratic.

Structure and fertilizer properties of byproducts formed in the synthesis of EDDHA.

Science.gov (United States)

Hernández-Apaolaza, Lourdes; García-Marco, Sonia; Nadal, Paloma; Lucena, Juan J; Sierra, Miguel A; Gómez-Gallego, Mar; Ramírez-López, Pedro; Escudero, Rosa

2006-06-14

The synthesis of commercial EDDHA produces o,o-EDDHA as the main reaction product, together with a mixture of regioisomers (o,p-EDDHA and p,p-EDDHA) and other unknown byproducts also able to complex Fe3+. These compounds have been obtained by direct synthesis, and their structures have been determined by ESI-MS analysis as oligomeric EDDHA-like products, formed by polysubstitution in the phenolic rings. Short-term experiments show that the iron complexes of samples enriched in these oligomeric byproducts have adequate stability in solution, but a significant amount of them is lost after interaction with soils and soil materials. Mildly chlorotic cucumber plants are able to reduce iron better from o,p-EDDHA/Fe3+ than from the iron complexes of the oligomeric byproducts. In hydroponics, the chlorotic soybean susceptible plants have a lower potential for Fe absorption from these byproducts than from o,o-EDDHA/Fe3+ and from o,p-EDDHA/Fe3+. In the studied conditions, the iron chelates of EDDHA byproducts do not have the long-lasting effect shown by o,o-EDDHA/Fe3+ and present a less efficient fast-action effect than the o,p-EDDHA/Fe3+.

Controlled self-assembly of PbS nanoparticles into macrostar-like hierarchical structures

International Nuclear Information System (INIS)

Li, Guowei; Li, Changsheng; Tang, Hua; Cao, Kesheng; Chen, Juan

2011-01-01

Graphical abstract: The aggregation and rotation of nanoparticles to adopt parallel orientations in three dimensions was indirectly illustrated by TEM and HRTEM images. Highlights: → Macrostar-like PbS hierarchical structures was successfully synthesized by a simple hydrothermal method and mesostars were assembled from the PbS nanocube building blocks with edge lengths of about 100 nm. → Ostwald-ripening-assisted oriented attachment is believed to play a key role in the growth behavior of novel 3D structures. → Optical properties indicating few defects on the surface of the PbS structure and exhibit large blue-shifts compared to bulk PbS. -- Abstract: The synthesis of macrostar-like PbS hierarchical structures by a simple hydrothermal method at 180 o C for 24 h is proven successful with the assistance of a new surfactant called tetrabutylammonium bromide (TBAB). The as-obtained product is characterized by means of X-ray powder diffraction, field emission scanning electron microscopy, energy dispersive spectrometry, high resolution transmission electron microscopy, and selected area electron diffraction. The presence of TBAB and NaF plays an important role in the formation of PbS macrostructures. Ostwald-ripening-assisted oriented attachment is believed to play a key role in the growth behavior of novel 3D structures. As such, a possible self-assembly mechanism is proposed to explain the formation of the said structures. The present study aims to introduce new insights into understanding the formation process of such unique hierarchical superstructures.

[Structure and evolution of the eukaryotic FANCJ-like proteins].

Science.gov (United States)

Wuhe, Jike; Zefeng, Wu; Sanhong, Fan; Xuguang, Xi

2015-02-01

The FANCJ-like protein family is a class of ATP-dependent helicases that can catalytically unwind duplex DNA along the 5'-3' direction. It is involved in the processes of DNA damage repair, homologous recombination and G-quadruplex DNA unwinding, and plays a critical role in maintaining genome integrity. In this study, we systemically analyzed FNACJ-like proteins from 47 eukaryotic species and discussed their sequences diversity, origin and evolution, motif organization patterns and spatial structure differences. Four members of FNACJ-like proteins, including XPD, CHL1, RTEL1 and FANCJ, were found in eukaryotes, but some of them were seriously deficient in most fungi and some insects. For example, the Zygomycota fungi lost RTEL1, Basidiomycota and Ascomycota fungi lost RTEL1 and FANCJ, and Diptera insect lost FANCJ. FANCJ-like proteins contain canonical motor domains HD1 and HD2, and the HD1 domain further integrates with three unique domains Fe-S, Arch and Extra-D. Fe-S and Arch domains are relatively conservative in all members of the family, but the Extra-D domain is lost in XPD and differs from one another in rest members. There are 7, 10 and 2 specific motifs found from the three unique domains respectively, while 5 and 12 specific motifs are found from HD1 and HD2 domains except the conserved motifs reported previously. By analyzing the arrangement pattern of these specific motifs, we found that RTEL1 and FANCJ are more closer and share two specific motifs Vb2 and Vc in HD2 domain, which are likely related with their G-quadruplex DNA unwinding activity. The evidence of evolution showed that FACNJ-like proteins were originated from a helicase, which has a HD1 domain inserted by extra Fe-S domain and Arch domain. By three continuous gene duplication events and followed specialization, eukaryotes finally possessed the current four members of FANCJ-like proteins.

Occurrence and structural characterization of versican-like proteoglycan in human vitreous.

Science.gov (United States)

Theocharis, Achilleas D; Papageorgakopoulou, Nickoletta; Feretis, Elias; Theocharis, Dimitrios A

2002-12-01

Human vitreous gel is a special type of extracellular matrix, in which interpenetrating networks of collagen fibrils and hyaluronan are found. In this study, we report that apart from significant amounts of collagen, hyaluronan and sialylated glycoproteins, it was found that the human vitreous gel also contained low amounts of versican-like proteoglycan. The concentration of versican-like proteoglycan in the whole vitreous is 0.06 mg protein/ml of vitreous gel and represents a small percentage (about 5%) of the total protein content. The versican-like proteoglycan has a molecular mass of 380 kDa, as estimated by gel chromatography. Its core protein is substituted by chondroitin sulphate side chains (average molecular weight 37 kDa), in which 6-sulphated disaccharides predominated. According to the physicochemical data, the number of chondroitin sulphate chains is likely to be 5-7 per molecule. These proteoglycan monomers form large aggregates with endogenous hyaluronan. Versican, which is able to bind lectins via its C-terminal region, may bridge or interconnect various constituents of the extracellular matrix via its terminal domains in order to stabilize large supramolecular complexes at the vitreous, contributing towards the integrity and specific properties of the tissue.

The structure of pyogenecin immunity protein, a novel bacteriocin-like immunity protein from streptococcus pyogenes.

Energy Technology Data Exchange (ETDEWEB)

Chang, C.; Coggill, P.; Bateman, A.; Finn, R.; Cymborowski, M.; Otwinowski, Z.; Minor, W.; Volkart, L.; Joachimiak, A.; Wellcome Trust Sanger Inst.; Univ. of Virginia; UT Southwestern Medical Center

2009-12-17

Many Gram-positive lactic acid bacteria (LAB) produce anti-bacterial peptides and small proteins called bacteriocins, which enable them to compete against other bacteria in the environment. These peptides fall structurally into three different classes, I, II, III, with class IIa being pediocin-like single entities and class IIb being two-peptide bacteriocins. Self-protective cognate immunity proteins are usually co-transcribed with these toxins. Several examples of cognates for IIa have already been solved structurally. Streptococcus pyogenes, closely related to LAB, is one of the most common human pathogens, so knowledge of how it competes against other LAB species is likely to prove invaluable. We have solved the crystal structure of the gene-product of locus Spy-2152 from S. pyogenes, (PDB: 2fu2), and found it to comprise an anti-parallel four-helix bundle that is structurally similar to other bacteriocin immunity proteins. Sequence analyses indicate this protein to be a possible immunity protein protective against class IIa or IIb bacteriocins. However, given that S. pyogenes appears to lack any IIa pediocin-like proteins but does possess class IIb bacteriocins, we suggest this protein confers immunity to IIb-like peptides. Combined structural, genomic and proteomic analyses have allowed the identification and in silico characterization of a new putative immunity protein from S. pyogenes, possibly the first structure of an immunity protein protective against potential class IIb two-peptide bacteriocins. We have named the two pairs of putative bacteriocins found in S. pyogenes pyogenecin 1, 2, 3 and 4.

The structural basis for endotoxin-induced allosteric regulation of the Toll-like receptor 4 (TLR4) innate immune receptor.

Science.gov (United States)

Paramo, Teresa; Piggot, Thomas J; Bryant, Clare E; Bond, Peter J

2013-12-20

As part of the innate immune system, Toll-like receptor 4 (TLR4) recognizes bacterial cell surface lipopolysaccharide (LPS) by forming a complex with a lipid-binding co-receptor, MD-2. In the presence of agonist, TLR4·MD-2 dimerizes to form an active receptor complex, leading to initiation of intracellular inflammatory signals. TLR4 is of great biomedical interest, but its pharmacological manipulation is complicated because even subtle variations in the structure of LPS can profoundly impact the resultant immunological response. Here, we use atomically detailed molecular simulations to gain insights into the nature of the molecular signaling mechanism. We first demonstrate that MD-2 is extraordinarily flexible. The "clamshell-like" motions of its β-cup fold enable it to sensitively match the volume of its hydrophobic cavity to the size and shape of the bound lipid moiety. We show that MD-2 allosterically transmits this conformational plasticity, in a ligand-dependent manner, to a phenylalanine residue (Phe-126) at the cavity mouth previously implicated in TLR4 activation. Remarkably, within the receptor complex, we observe spontaneous transitions between active and inactive signaling states of Phe-126, and we confirm that Phe-126 is indeed the "molecular switch" in endotoxic signaling.

Experiences of Social and Structural Forms of Stigma Among Chinese Immigrant Consumers with Psychosis.

Science.gov (United States)

Cheng, Zhen Hadassah; Tu, Ming-Che; Li, Vanessa A; Chang, Rachel W; Yang, Lawrence Hsin

2015-12-01

Chinese immigrants tend to rely on family and close community for support given their vulnerable societal position. Yet stigma, especially from structural and familial sources, may have a particularly harmful impact upon Chinese immigrants with psychosis. Using a descriptive analysis based upon grounded theory, we examined stigma experiences of 50 Chinese immigrant consumers with psychosis, paying particular attention to frequency, sources, and themes of social and structural stigma. Although past research indicates that family is a recipient of stigma, we found instead that family members were common perpetuators of social forms of stigma. We also found that perceptions of work deficit underlie many forms of stigma, suggesting this is "what matters most" in this community. Lack of financial resources and language barriers comprised most frequent forms of structural stigma. Anti-stigma efforts should aim to improve consumer's actual and perceived employability to target what is most meaningful in Chinese immigrant communities.

Surface Structures Formed by a Copper(II Complex of Alkyl-Derivatized Indigo

Directory of Open Access Journals (Sweden)

Akinori Honda

2016-10-01

Full Text Available Assembled structures of dyes have great influence on their coloring function. For example, metal ions added in the dyeing process are known to prevent fading of color. Thus, we have investigated the influence of an addition of copper(II ion on the surface structure of alkyl-derivatized indigo. Scanning tunneling microscope (STM analysis revealed that the copper(II complexes of indigo formed orderly lamellar structures on a HOPG substrate. These lamellar structures of the complexes are found to be more stable than those of alkyl-derivatized indigos alone. Furthermore, 2D chirality was observed.

Structure of the orthorhombic form of human inosine triphosphate pyrophosphatase

International Nuclear Information System (INIS)

Porta, Jason; Kolar, Carol; Kozmin, Stanislav G.; Pavlov, Youri I.; Borgstahl, Gloria E. O.

2006-01-01

X-ray crystallographic analysis of human inosine triphosphate pyrophosphohydrolase provided the secondary structure and active-site structure at 1.6 Å resolution in an orthorhombic crystal form. The structure gives a framework for future structure–function studies employing site-directed mutagenesis and for the identification of substrate/product-binding sites. The structure of human inosine triphosphate pyrophosphohydrolase (ITPA) has been determined using diffraction data to 1.6 Å resolution. ITPA contributes to the accurate replication of DNA by cleansing cellular dNTP pools of mutagenic nucleotide purine analogs such as dITP or dXTP. A similar high-resolution unpublished structure has been deposited in the Protein Data Bank from a monoclinic and pseudo-merohedrally twinned crystal. Here, cocrystallization of ITPA with a molar ratio of XTP appears to have improved the crystals by eliminating twinning and resulted in an orthorhombic space group. However, there was no evidence for bound XTP in the structure. Comparison with substrate-bound NTPase from a thermophilic organism predicts the movement of residues within helix α1, the loop before α6 and helix α7 to cap off the active site when substrate is bound

Ultrastructure of the dikaryotic form of Cyathus bulleri Brodie.

Science.gov (United States)

Kozar, F; MacDonald, B R; Weijer, J

1977-01-01

The fine structure of the dikaryotic form of Cyathus bulleri Brodie was generally found to be similar to that of other hyphal forms of the Basidiomycetes. The nuclear walls were doubled, porous and in some cases connected to the endoplasmic reticulum. The presence of typical as well as filamentous and U-shaped mitochondria was confirmed. Other cellular structures and organelles, among them vacuoles, vesicular and myelinoid-like bodies, often associated with the cell membranes, glycogen and ribosomes were also observed in the cytoplasm. The presence of the dolipore/parenthesome apparatus and clamp connections typical of the Basidiomycetes was established.

Diamond-like nanoparticles influence on flavonoids transport: molecular modelling

Science.gov (United States)

Plastun, Inna L.; Agandeeva, Ksenia E.; Bokarev, Andrey N.; Zenkin, Nikita S.

2017-03-01

Intermolecular interaction of diamond-like nanoparticles and flavonoids is investigated by numerical simulation. Using molecular modelling by the density functional theory method, we analyze hydrogen bonds formation and their influence on IR - spectra and structure of molecular complex which is formed due to interaction between flavonoids and nanodiamonds surrounded with carboxylic groups. Enriched adamantane (1,3,5,7 - adamantanetetracarboxylic acid) is used as an example of diamond-like nanoparticles. Intermolecular forces and structure of hydrogen bonds are investigated. IR - spectra and structure parameters of quercetin - adamantanetetracarboxylic acid molecular complex are obtained by numerical simulation using the Gaussian software complex. Received data coincide well with experimental results. Intermolecular interactions and hydrogen bonding structure in the obtained molecular complex are examined. Possibilities of flavonoids interaction with DNA at the molecular level are also considered.

A Facile Method for Synthesizing TiO2 Sea-Urchin-Like Structures and Their Applications in Solar Energy Harvesting

International Nuclear Information System (INIS)

Wang Wen-Hui; Xu Hong-Xing; Wang Wen-Zhong

2011-01-01

We present a new method to prepare TiO 2 sea-urchin-like structures, which involves the initial formation of tubular nanostructures and subsequent self-assembly of the nanotubes into micrometer-scale sea-urchin-like structures. We also investigate the important role of alkali aqueous conditions in the preparation of TiO 2 sea-urchin-like structures. This facile and cost-effective approach provides a new route for the preparation of self-assembled TiO 2 structures. In addition, the performance of the as-synthesized TiO 2 sea-urchin-like structures as the active layer of an efficient solar energy harvester is also studied and discussed. (cross-disciplinary physics and related areas of science and technology)

New Cyt-like δ-endotoxins from Dickeya dadantii: structure and aphicidal activity.

Science.gov (United States)

Loth, Karine; Costechareyre, Denis; Effantin, Géraldine; Rahbé, Yvan; Condemine, Guy; Landon, Céline; da Silva, Pedro

2015-03-05

In the track of new biopesticides, four genes namely cytA, cytB, cytC and cytD encoding proteins homologous to Bacillus thuringiensis (Bt) Cyt toxins have been identified in the plant pathogenic bacteria Dickeya dadantii genome. Here we show that three Cyt-like δ-endotoxins from D. dadantii (CytA, CytB and CytC) are toxic to the pathogen of the pea aphid Acyrthosiphon pisum in terms of both mortality and growth rate. The phylogenetic analysis of the comprehensive set of Cyt toxins available in genomic databases shows that the whole family is of limited taxonomic occurrence, though in quite diverse microbial taxa. From a structure-function perspective the 3D structure of CytC and its backbone dynamics in solution have been determined by NMR. CytC adopts a cytolysin fold, structurally classified as a Cyt2-like protein. Moreover, the identification of a putative lipid binding pocket in CytC structure, which has been probably maintained in most members of the Cyt-toxin family, could support the importance of this lipid binding cavity for the mechanism of action of the whole family. This integrative approach provided significant insights into the evolutionary and functional history of D. dadantii Cyt toxins, which appears to be interesting leads for biopesticides.

Peri-Elastodynamic Simulations of Guided Ultrasonic Waves in Plate-Like Structure with Surface Mounted PZT

Directory of Open Access Journals (Sweden)

Subir Patra

2018-01-01

Full Text Available Peridynamic based elastodynamic computation tool named Peri-elastodynamics is proposed herein to simulate the three-dimensional (3D Lamb wave modes in materials for the first time. Peri-elastodynamics is a nonlocal meshless approach which is a scale-independent generalized technique to visualize the acoustic and ultrasonic waves in plate-like structure, micro-electro-mechanical systems (MEMS and nanodevices for their respective characterization. In this article, the characteristics of the fundamental Lamb wave modes are simulated in a sample plate-like structure. Lamb wave modes are generated using a surface mounted piezoelectric (PZT transducer which is actuated from the top surface. The proposed generalized Peri-elastodynamics method is not only capable of simulating two dimensional (2D in plane wave under plane strain condition formulated previously but also capable of accurately simulating the out of plane Symmetric and Antisymmetric Lamb wave modes in plate like structures in 3D. For structural health monitoring (SHM of plate-like structures and nondestructive evaluation (NDE of MEMS devices, it is necessary to simulate the 3D wave-damage interaction scenarios and visualize the different wave features due to damages. Hence, in addition, to simulating the guided ultrasonic wave modes in pristine material, Lamb waves were also simulated in a damaged plate. The accuracy of the proposed technique is verified by comparing the modes generated in the plate and the mode shapes across the thickness of the plate with theoretical wave analysis.

Peri-Elastodynamic Simulations of Guided Ultrasonic Waves in Plate-Like Structure with Surface Mounted PZT.

Science.gov (United States)

Patra, Subir; Ahmed, Hossain; Banerjee, Sourav

2018-01-18

Peridynamic based elastodynamic computation tool named Peri-elastodynamics is proposed herein to simulate the three-dimensional (3D) Lamb wave modes in materials for the first time. Peri-elastodynamics is a nonlocal meshless approach which is a scale-independent generalized technique to visualize the acoustic and ultrasonic waves in plate-like structure, micro-electro-mechanical systems (MEMS) and nanodevices for their respective characterization. In this article, the characteristics of the fundamental Lamb wave modes are simulated in a sample plate-like structure. Lamb wave modes are generated using a surface mounted piezoelectric (PZT) transducer which is actuated from the top surface. The proposed generalized Peri-elastodynamics method is not only capable of simulating two dimensional (2D) in plane wave under plane strain condition formulated previously but also capable of accurately simulating the out of plane Symmetric and Antisymmetric Lamb wave modes in plate like structures in 3D. For structural health monitoring (SHM) of plate-like structures and nondestructive evaluation (NDE) of MEMS devices, it is necessary to simulate the 3D wave-damage interaction scenarios and visualize the different wave features due to damages. Hence, in addition, to simulating the guided ultrasonic wave modes in pristine material, Lamb waves were also simulated in a damaged plate. The accuracy of the proposed technique is verified by comparing the modes generated in the plate and the mode shapes across the thickness of the plate with theoretical wave analysis.

Structure of the cleavage-activated prefusion form of the parainfluenza virus 5 fusion protein.

Science.gov (United States)

Welch, Brett D; Liu, Yuanyuan; Kors, Christopher A; Leser, George P; Jardetzky, Theodore S; Lamb, Robert A

2012-10-09

The paramyxovirus parainfluenza virus 5 (PIV5) enters cells by fusion of the viral envelope with the plasma membrane through the concerted action of the fusion (F) protein and the receptor binding protein hemagglutinin-neuraminidase. The F protein folds initially to form a trimeric metastable prefusion form that is triggered to undergo large-scale irreversible conformational changes to form the trimeric postfusion conformation. It is thought that F refolding couples the energy released with membrane fusion. The F protein is synthesized as a precursor (F0) that must be cleaved by a host protease to form a biologically active molecule, F1,F2. Cleavage of F protein is a prerequisite for fusion and virus infectivity. Cleavage creates a new N terminus on F1 that contains a hydrophobic region, known as the FP, which intercalates target membranes during F protein refolding. The crystal structure of the soluble ectodomain of the uncleaved form of PIV5 F is known; here we report the crystal structure of the cleavage-activated prefusion form of PIV5 F. The structure shows minimal movement of the residues adjacent to the protease cleavage site. Most of the hydrophobic FP residues are buried in the uncleaved F protein, and only F103 at the newly created N terminus becomes more solvent-accessible after cleavage. The conformational freedom of the charged arginine residues that compose the protease recognition site increases on cleavage of F protein.

Note on Symplectic SVD-Like Decomposition

Directory of Open Access Journals (Sweden)

AGOUJIL Said

2016-02-01

Full Text Available The aim of this study was to introduce a constructive method to compute a symplectic singular value decomposition (SVD-like decomposition of a 2n-by-m rectangular real matrix A, based on symplectic refectors.This approach used a canonical Schur form of skew-symmetric matrix and it allowed us to compute eigenvalues for the structured matrices as Hamiltonian matrix JAA^T.

Resilin and chitinous cuticle form a composite structure for energy storage in jumping by froghopper insects

Directory of Open Access Journals (Sweden)

Shaw Stephen R

2008-09-01

Full Text Available Abstract Background Many insects jump by storing and releasing energy in elastic structures within their bodies. This allows them to release large amounts of energy in a very short time to jump at very high speeds. The fastest of the insect jumpers, the froghopper, uses a catapult-like elastic mechanism to achieve their jumping prowess in which energy, generated by the slow contraction of muscles, is released suddenly to power rapid and synchronous movements of the hind legs. How is this energy stored? Results The hind coxae of the froghopper are linked to the hinges of the ipsilateral hind wings by pleural arches, complex bow-shaped internal skeletal structures. They are built of chitinous cuticle and the rubber-like protein, resilin, which fluoresces bright blue when illuminated with ultra-violet light. The ventral and posterior end of this fluorescent region forms the thoracic part of the pivot with a hind coxa. No other structures in the thorax or hind legs show this blue fluorescence and it is not found in larvae which do not jump. Stimulating one trochanteral depressor muscle in a pattern that simulates its normal action, results in a distortion and forward movement of the posterior part of a pleural arch by 40 μm, but in natural jumping, the movement is at least 100 μm. Conclusion Calculations showed that the resilin itself could only store 1% to 2% of the energy required for jumping. The stiffer cuticular parts of the pleural arches could, however, easily meet all the energy storage needs. The composite structure therefore, combines the stiffness of the chitinous cuticle with the elasticity of resilin. Muscle contractions bend the chitinous cuticle with little deformation and therefore, store the energy needed for jumping, while the resilin rapidly returns its stored energy and thus restores the body to its original shape after a jump and allows repeated jumping.

The quadratic-form identity for constructing the Hamiltonian structure of integrable systems

International Nuclear Information System (INIS)

Guo Fukui; Zhang Yufeng

2005-01-01

A usual loop algebra, not necessarily the matrix form of the loop algebra A-tilde n-1 , is also made use of for constructing linear isospectral problems, whose compatibility conditions exhibit a zero-curvature equation from which integrable systems are derived. In order to look for the Hamiltonian structure of such integrable systems, a quadratic-form identity is created in the present paper whose special case is just the trace identity; that is, when taking the loop algebra A-tilde 1 , the quadratic-form identity presented in this paper is completely consistent with the trace identity

A rare polyglycine type II-like helix motif in naturally occurring proteins.

Science.gov (United States)

Warkentin, Eberhard; Weidenweber, Sina; Schühle, Karola; Demmer, Ulrike; Heider, Johann; Ermler, Ulrich

2017-11-01

Common structural elements in proteins such as α-helices or β-sheets are characterized by uniformly repeating, energetically favorable main chain conformations which additionally exhibit a completely saturated hydrogen-bonding network of the main chain NH and CO groups. Although polyproline or polyglycine type II helices (PP II or PG II ) are frequently found in proteins, they are not considered as equivalent secondary structure elements because they do not form a similar self-contained hydrogen-bonding network of the main chain atoms. In this context our finding of an unusual motif of glycine-rich PG II -like helices in the structure of the acetophenone carboxylase core complex is of relevance. These PG II -like helices form hexagonal bundles which appear to fulfill the criterion of a (largely) saturated hydrogen-bonding network of the main-chain groups and therefore may be regarded in this sense as a new secondary structure element. It consists of a central PG II -like helix surrounded by six nearly parallel PG II -like helices in a hexagonal array, plus an additional PG II -like helix extending the array outwards. Very related structural elements have previously been found in synthetic polyglycine fibers. In both cases, all main chain NH and CO groups of the central PG II -helix are saturated by either intra- or intermolecular hydrogen-bonds, resulting in a self-contained hydrogen-bonding network. Similar, but incomplete PG II -helix patterns were also previously identified in a GTP-binding protein and an antifreeze protein. © 2017 Wiley Periodicals, Inc.

Preparation and Photoluminescence of ZnO Comb-Like Structure and Nanorod Arrays

Science.gov (United States)

Yin, Song; Chen, Yi-qing; Su, Yong; Zhou, Qing-tao

2007-06-01

A large quantity of Zinc oxide (ZnO) comb-like structure and high-density well-aligned ZnO nanorod arrays were prepared on silicon substrate via thermal evaporation process without any catalyst. The morphology, growth mechanism, and optical properties of the both structures were investigated using XRD, SEM, TEM and PL. The resulting comb-teeth, with a diameter about 20 nm, growing along the [0001] direction have a well-defined epitaxial relationship with the comb ribbon. The ZnO nanorod arrays have a diameter about 200 nm and length up to several micrometers growing approximately vertical to the Si substrate. A ZnO film was obtained before the nanorods growth. A growth model is proposed for interpreting the growth mechanism of comb-like zigzag-notch nanostructure. Room temperature photoluminescence measurements under excitation wavelength of 325 nm showed that the ZnO comb-like nanostructure has a weak UV emission at around 384 nm and a strong green emission around 491 nm, which correspond to a near band-edge transition and the singly ionized oxygen vacancy, respectively. In contrast, a strong and sharp UV peak and a weak green peak was obtained from the ZnO nanorod arrays.

Structure of the thioredoxin-fold domain of human phosducin-like protein 2

International Nuclear Information System (INIS)

Lou, Xiaochu; Bao, Rui; Zhou, Cong-Zhao; Chen, Yuxing

2009-01-01

The X-ray crystal structure of the Trx-fold domain of hPDCL2 was solved at 2.70 Å resolution and resembled the Trx-fold domain of rat phosducin. Human phosducin-like protein 2 (hPDCL2) has been identified as belonging to subgroup II of the phosducin (Pdc) family. The members of this family share an N-terminal helix domain and a C-terminal thioredoxin-fold (Trx-fold) domain. The X-ray crystal structure of the Trx-fold domain of hPDCL2 was solved at 2.70 Å resolution and resembled the Trx-fold domain of rat phosducin. Comparative structural analysis revealed the structural basis of their putative functional divergence

Infrared spectroscopy study of structural changes in glass-forming salol.

Science.gov (United States)

Baran, J; Davydova, N A

2010-03-01

We report the investigation of glass-forming salol upon different courses of the temperature changes from liquid to glass state and back using FT-IR spectroscopy measurements in the wide spectral and temperature ranges. The formation of the ordered clusters in supercooled liquid salol has been observed at 250 K. When the temperature is decreased further to 11 K these ordered clusters become an element of the glass structure. With increasing temperature to 270 K through the glass transition noticeable evolutions of the IR spectrum occurs up till the ordered clusters are developed into crystal. So produced crystal melts in the temperature range 300-310 K, that corresponds to the melting temperature of the metastable phase (Tmelt=302 K) . Thus, the crystalline structure of the ordered clusters corresponds to the structure of metastable phase and is monoclinic.

Forming the organizational structure for activities

Directory of Open Access Journals (Sweden)

U. S. Barash

2013-04-01

Full Text Available Purpose. Development of theoretical and methodological foundations of efficiency of freight cars operating companies in railway reform through improved management structure them. Methodology. A theoretical and methodological approach for building effective management structure of freight wagons operating companies of different ownership forms is proposed, its introduction will significantly reduce detention of cars on technical stations under loading operations and maintenance, and thereby to improve the quality parameters of rolling stock usage in reform conditions of Ukraine railway transport. Findings. An improved control mechanism of cargo transportation is developed, it is different from the existing by its adaptation to the conditions of the reformed sector and the organization of management companies which together with the Ukrainian Transport and Logistics Center (UTLC centralize management of all freight cars of domestic and foreign operating companies. Originality. It is proposed for management of cargo transportation in wagons operating companies of different ownership to organize a series of management companies that would have the right to dispose of universal cars of other domestic operating companies, being on leasehold basis, and to direct them to current and scheduled repairs by themselves; to organize the cargo transportation in wagons of domestic and foreign operating companies on a contractual terms, depending on the type and content of the contract, on the basis of additional contracts for a separate fee to perform current and scheduled repair of freight cars; the management company organizational structure is developed, it includes simultaneously two directions of activity: commercial and repair, it will reduce the stay time of rolling stock on the engineering stations during loading and in a non-operating park as far as this company will manage a significant part of the production cycle of the transportation process

String-like cooperative motion in homogeneous melting.

Science.gov (United States)

Zhang, Hao; Khalkhali, Mohammad; Liu, Qingxia; Douglas, Jack F

2013-03-28

Despite the fundamental nature and practical importance of melting, there is still no generally accepted theory of this ubiquitous phenomenon. Even the earliest simulations of melting of hard discs by Alder and Wainwright indicated the active role of collective atomic motion in melting and here we utilize molecular dynamics simulation to determine whether these correlated motions are similar to those found in recent studies of glass-forming (GF) liquids and other condensed, strongly interacting, particle systems. We indeed find string-like collective atomic motion in our simulations of "superheated" Ni crystals, but other observations indicate significant differences from GF liquids. For example, we observe neither stretched exponential structural relaxation, nor any decoupling phenomenon, while we do find a boson peak, findings that have strong implications for understanding the physical origin of these universal properties of GF liquids. Our simulations also provide a novel view of "homogeneous" melting in which a small concentration of interstitial defects exerts a powerful effect on the crystal stability through their initiation and propagation of collective atomic motion. These relatively rare point defects are found to propagate down the strings like solitons, driving the collective motion. Crystal integrity remains preserved when the permutational atomic motions take the form of ring-like atomic exchanges, but a topological transition occurs at higher temperatures where the rings open to form linear chains similar in geometrical form and length distribution to the strings of GF liquids. The local symmetry breaking effect of the open strings apparently destabilizes the local lattice structure and precipitates crystal melting. The crystal defects are thus not static entities under dynamic conditions, such as elevated temperatures or material loading, but rather are active agents exhibiting a rich nonlinear dynamics that is not addressed in conventional "static

Gestational stress induces persistent depressive-like behavior and structural modifications within the postpartum nucleus accumbens

Science.gov (United States)

Haim, Achikam; Sherer, Morgan; Leuner, Benedetta

2015-01-01

Postpartum depression (PPD) is a common complication following childbirth experienced by one in every five new mothers. Pregnancy stress enhances vulnerability to PPD and has also been shown to increase depressive-like behavior in postpartum rats. Thus, gestational stress may be an important translational risk factor that can be used to investigate the neurobiological mechanisms underlying PPD. Here we examined the effects of gestational stress on depressive-like behavior during the early/mid and late postpartum periods and evaluated whether this was accompanied by altered structural plasticity in the nucleus accumbens (NAc), a brain region that has been linked to PPD. We show that early/mid (PD8) postpartum female rats exhibited more depressive-like behavior in the forced swim test as compared to late postpartum females (PD22). However, two weeks of restraint stress during pregnancy increased depressive-like behavior regardless of postpartum timepoint. In addition, dendritic length, branching, and spine density on medium spiny neurons in the NAc shell were diminished in postpartum rats that experienced gestational stress although stress-induced reductions in spine density were evident only in early/mid postpartum females. In the NAc core, structural plasticity was not affected by gestational stress but late postpartum females exhibited lower spine density and reduced dendritic length. Overall, these data not only demonstrate structural changes in the NAc across the postpartum period, they also show that postpartum depressive-like behavior following exposure to gestational stress is associated with compromised structural plasticity in the NAc and thus may provide insight into the neural changes that could contribute to PPD. PMID:25359225

New Soliton-like Solutions and Multi-soliton Structures for Broer-Kaup System with Variable Coefficients

International Nuclear Information System (INIS)

Ji Mingjun; Lue Zhuosheng

2005-01-01

By using the further extended tanh method [Phys. Lett. A 307 (2003) 269; Chaos, Solitons and Fractals 17 (2003) 669] to the Broer-Kaup system with variable coefficients, abundant new soliton-like solutions and multi-soliton-like solutions are derived. Based on the derived multi-soliton-like solutions which contain arbitrary functions, some interesting multi-soliton structures are revealed.

Exploiting Fluorescent Polymers To Probe the Self-Assembly of Virus-like Particles

DEFF Research Database (Denmark)

Caden-Nava, Ruben D.; Hu, Yufang; Garmann, Rees F.

2011-01-01

, for example, poly(styrene sulfonate) (PSS), forming virus-like particles (VLPs). We have demonstrated recently that the VLPs formed from cowpea chlorotic mottle virus (CCMV) capsid protein increase in size (from T = 2 to T = 3 structures) upon increase in PSS molecular weight (from 400 kDa to 3.4MDa...

The crystal structures of the tri-functional Chloroflexus aurantiacus and bi-functional Rhodobacter sphaeroides malyl-CoA lyases and comparison with CitE-like superfamily enzymes and malate synthases.

Science.gov (United States)

Zarzycki, Jan; Kerfeld, Cheryl A

2013-11-09

Malyl-CoA lyase (MCL) is a promiscuous carbon-carbon bond lyase that catalyzes the reversible cleavage of structurally related Coenzyme A (CoA) thioesters. This enzyme plays a crucial, multifunctional role in the 3-hydroxypropionate bi-cycle for autotrophic CO2 fixation in Chloroflexus aurantiacus. A second, phylogenetically distinct MCL from Rhodobacter sphaeroides is involved in the ethylmalonyl-CoA pathway for acetate assimilation. Both MCLs belong to the large superfamily of CitE-like enzymes, which includes the name-giving β-subunit of citrate lyase (CitE), malyl-CoA thioesterases and other enzymes of unknown physiological function. The CitE-like enzyme superfamily also bears sequence and structural resemblance to the malate synthases. All of these different enzymes share highly conserved catalytic residues, although they catalyze distinctly different reactions: C-C bond formation and cleavage, thioester hydrolysis, or both (the malate synthases). Here we report the first crystal structures of MCLs from two different phylogenetic subgroups in apo- and substrate-bound forms. Both the C. aurantiacus and the R. sphaeroides MCL contain elaborations on the canonical β8/α8 TIM barrel fold and form hexameric assemblies. Upon ligand binding, changes in the C-terminal domains of the MCLs result in closing of the active site, with the C-terminal domain of one monomer forming a lid over and contributing side chains to the active site of the adjacent monomer. The distinctive features of the two MCL subgroups were compared to known structures of other CitE-like superfamily enzymes and to malate synthases, providing insight into the structural subtleties that underlie the functional versatility of these enzymes. Although the C. aurantiacus and the R. sphaeroides MCLs have divergent primary structures (~37% identical), their tertiary and quaternary structures are very similar. It can be assumed that the C-C bond formation catalyzed by the MCLs occurs as proposed for

Structures of a Nonribosomal Peptide Synthetase Module Bound to MbtH-like Proteins Support a Highly Dynamic Domain Architecture

Energy Technology Data Exchange (ETDEWEB)

Miller, Bradley R.; Drake, Eric J.; Shi, Ce; Aldrich, Courtney C.; Gulick, Andrew M. (UMM); (HWMRI)

2016-09-05

Nonribosomal peptide synthetases (NRPSs) produce a wide variety of peptide natural products. During synthesis, the multidomain NRPSs act as an assembly line, passing the growing product from one module to the next. Each module generally consists of an integrated peptidyl carrier protein, an amino acid-loading adenylation domain, and a condensation domain that catalyzes peptide bond formation. Some adenylation domains interact with small partner proteins called MbtH-like proteins (MLPs) that enhance solubility or activity. A structure of an MLP bound to an adenylation domain has been previously reported using a truncated adenylation domain, precluding any insight that might be derived from understanding the influence of the MLP on the intact adenylation domain or on the dynamics of the entire NRPS module. Here, we present the structures of the full-length NRPS EntF bound to the MLPs from Escherichia coli and Pseudomonas aeruginosa. These new structures, along with biochemical and bioinformatics support, further elaborate the residues that define the MLP-adenylation domain interface. Additionally, the structures highlight the dynamic behavior of NRPS modules, including the module core formed by the adenylation and condensation domains as well as the orientation of the mobile thioesterase domain.

Structural studies of disordered Mg2NiH4 formed by mechanical grinding

DEFF Research Database (Denmark)

Rönnebro, Ewa; Jensen, Jens Oluf; Noréus, Dag

1999-01-01

The low temperature phase of Mg2NiH4 was mechanically ground in argon atmosphere. The ordered monoclinic structure was destroyed to form the disordered cubic structure, previously only found above 510 K. With a Guinier-Hagg X-ray camera the cell parameter was determined to be a=6.492(3) Angstrom....

Atomic Force Microscopy and MD Simulations Reveal Pore-Like Structures of All-D-Enantiomer of Alzheimer’s β-Amyloid Peptide: Relevance to the Ion Channel Mechanism of AD Pathology

Science.gov (United States)

Connelly, Laura; Arce, Fernando Teran; Jang, Hyunbum; Capone, Ricardo; Kotler, Samuel A.; Ramachandran, Srinivasan; Kagan, Bruce L.; Nussinov, Ruth; Lal, Ratnesh

2012-01-01

Alzheimer’s disease (AD) is a protein misfolding disease characterized by a build-up of β-amyloid (Aβ) peptide as senile plaques, uncontrolled neurodegeneration, and memory loss. AD pathology is linked to the destabilization of cellular ionic homeostasis and involves Aβ peptide-plasma membrane interactions. In principle, there are two possible ways through which disturbance of the ionic homeostasis can take place: directly, where the Aβ peptide either inserts into the membrane and creates ion-conductive pores or destabilizes the membrane organization; or, indirectly, where the Aβ peptide interacts with existing cell membrane receptors. To distinguish between these two possible types of Aβ-membrane interactions, we took advantage of the biochemical tenet that ligand-receptor interactions are stereospecific; L-amino acid peptides, but not their D-counterparts, bind to cell membrane receptors. However, with respect to the ion channel-mediated mechanism, like L-amino acids, D-amino acid peptides will also form ion channel-like structures. Using atomic force microscopy (AFM) we imaged the structures of both D- and L-enantiomers of the full length Aβ1-42 when reconstituted in lipid bilayers. AFM imaging shows that both L- and D-Aβ isomers form similar channel-like structures. Molecular dynamics (MD) simulations support the AFM imaged 3D structures. Earlier we have shown that D-Aβ1-42 channels conduct ions similarly to their L-counter parts. Taken together, our results support the direct mechanism of Aβ ion channel-mediated destabilization of ionic homeostasis rather than the indirect mechanism through Aβ interaction with membrane receptors. PMID:22217000

[The mechanism of vasculogenesis: the critical role of transforming growth factor-beta 1 in the formation of vessel-like structures during the differentiation in vitro of murine embryonic stem cells].

Science.gov (United States)

Tsung, H C; Yao, Z

1996-09-01

When ES-5 cells were transfected with an exogenous porcine TGF-beta 1 gene, one can obtain clones of genetically modified ES cells with over-expression of the transfected gene. We called the genetically modified ES-5 cells as ES-T cells. When ES-T cells were used to study their differentiation in vitro by all trans-retinoic acid (RA), it was soon noticed that embryoid bodies of ES-T cells can exclusively differentiate into endothelial cells and vessel-like structures, but not in their parent ES-5 cells. The above result is the first indication that the differentiation of tubular structures in embryoid bodies of ES-T cells may somehow be related to TGF-beta 1. To demonstrate further the role of TGF-beta 1 in the formation of vessel-like structures, the cultured ES-5 cells in the presence of added rhTGF-beta 1 were closely followed in the course of their differentiation. We have, thus, demonstrated the promoting effects of exogenous rhTGF-beta 1 in the formation of vessel-like structures, morphologically similar to those structures derived from ES-T6 cells, during the differentiation of ES-5 cells, both in monolayer culture, in three dimensional collagen gel and in embryoid bodies cultured on gelatin-coated tissue culture wells. Addition of suitable amount of anti-TGF-beta 1 monoclonal antibody IgG (TB21) to the culture medium of embryoid bodies of ES-T6 cells could effectively abolish the formation of vessel-like structures induced by retinoic acid. The percentage of the inhibition was very high, giving a figure comparable to that of atypical vessel-like structures formed in the control embryoid bodies from their parent ES-5 cells. The flat epithelial-like cells and round cells differentiated from embryoid bodies of ES-T6 cells were stained rather strongly for laminin and type IV collagen by immunofluorescent procedure. The above results indicate clearly that TGF-beta 1 is a crucial factor in organizing the differentiated derivatives (endothelial-like cells and

Nest-like structures of Sr doped Bi2WO6: Synthesis and enhanced photocatalytic properties

International Nuclear Information System (INIS)

Liu Ying; Wang Weimin; Fu Zhengyi; Wang Hao; Wang Yucheng; Zhang Jinyong

2011-01-01

Highlights: → Bi 2 WO 6 with 3D nest-like structures was obtained without the presence of templates but after Sr-doping, which represents a marked improvement over previous reports. → The products showed enhanced photocatalytic properties over pure Bi 2 WO 6 . → Samples subsequently thermal treated at 500 deg. C show better photocatalytic activities. - Abstract: A series of Sr-doped Bi 2 WO 6 with three-dimensional (3D) nest-like structures were synthesized through simple hydrothermal route and characterized by XRD, FESEM, TEM, XPS, UV-vis DRS, etc. Morphology observation revealed that the as-synthesized Bi 2 WO 6 were self-assembled three-dimensional (3D) nest-like structures, which were constructed from nanoplates. UV-vis diffuse reflectance spectra indicated that the samples had absorption in both UV and visible light areas. Their photocatalytic activities were evaluated by photodegradation of rhodamine B (RhB) under UV and visible light irradiation (λ > 420 nm). The photocatalytic properties were enhanced after Sr doping. Samples subsequently thermal treated at 500 deg. C showed higher photocatalytic activities. The reasons for the differences in the photocatalytic activities of these nest-like Bi 2 WO 6 microstructures were further investigated.

On the structure of the space of geometric product-form models

NARCIS (Netherlands)

Bayer, Nimrod; Boucherie, Richardus J.

2002-01-01

This article deals with Markovian models defined on a finite-dimensional discrete state space and possess a stationary state distribution of a product-form. We view the space of such models as a mathematical object and explore its structure. We focus on models on an orthant [script Z]+n, which are

The Structure of the Poxvirus A33 Protein Reveals a Dimer of Unique C-Type Lectin-Like Domains

Energy Technology Data Exchange (ETDEWEB)

Su, Hua-Poo; Singh, Kavita; Gittis, Apostolos G.; Garboczi, David N. (NIH)

2010-11-03

The current vaccine against smallpox is an infectious form of vaccinia virus that has significant side effects. Alternative vaccine approaches using recombinant viral proteins are being developed. A target of subunit vaccine strategies is the poxvirus protein A33, a conserved protein in the Chordopoxvirinae subfamily of Poxviridae that is expressed on the outer viral envelope. Here we have determined the structure of the A33 ectodomain of vaccinia virus. The structure revealed C-type lectin-like domains (CTLDs) that occur as dimers in A33 crystals with five different crystal lattices. Comparison of the A33 dimer models shows that the A33 monomers have a degree of flexibility in position within the dimer. Structural comparisons show that the A33 monomer is a close match to the Link module class of CTLDs but that the A33 dimer is most similar to the natural killer (NK)-cell receptor class of CTLDs. Structural data on Link modules and NK-cell receptor-ligand complexes suggest a surface of A33 that could interact with viral or host ligands. The dimer interface is well conserved in all known A33 sequences, indicating an important role for the A33 dimer. The structure indicates how previously described A33 mutations disrupt protein folding and locates the positions of N-linked glycosylations and the epitope of a protective antibody.

Scaffold with a natural mesh-like architecture: isolation, structural, and in vitro characterization.

LENUS (Irish Health Repository)

Burugapalli, Krishna

2007-03-01

An intact extracellular matrix (ECM) with a mesh-like architecture has been identified in the peri-muscular sub-serosal connective tissue (PSCT) of cholecyst (gallbladder). The PSCT layer of cholecyst wall is isolated by mechanical delamination of other layers and decellularized with a treatment with peracetic acid and ethanol solution (PES) in water to obtain the final matrix, which is referred to as cholecyst-derived ECM (CEM). CEM is cross-linked with different concentrations of glutaraldehyde (GA) to demonstrate that the susceptibility of CEM to degradation can be controlled. Quantitative and qualitative macromolecular composition assessments revealed that collagen is the primary structural component of CEM. Elastin is also present. In addition, the ultra-structural studies on CEM reveal the presence of a three-dimensional fibrous mesh-like network structure with similar nanoscale architecture on both mucosal and serosal surfaces. In vitro cell culture studies show that CEM provides a supporting structure for the attachment and proliferation of murine fibroblasts (3T3) and human umbilical vein endothelial cells (HUVEC). CEM is also shown to support the attachment and differentiation of rat adrenal pheochromocytoma cells (PC12).

Crystal Structure of a Monomeric Form of Severe Acute Respiratory Syndrome Coronavirus Endonuclease Nsp15 Suggests a Role for Hexamerization As An Allosteric Switch

Energy Technology Data Exchange (ETDEWEB)

Joseph, J.S.; Saikatendu, K.S.; Subramanian, V.; Neuman, B.W.; Buchmeier, M.J.; Stevens, R.C.; Kuhn, P.; /Scripps Res. Inst.

2007-07-09

Mature nonstructural protein-15 (nsp15) from the severe acute respiratory syndrome coronavirus (SARS-CoV) contains a novel uridylate-specific Mn{sup 2+}-dependent endoribonuclease (NendoU). Structure studies of the full-length form of the obligate hexameric enzyme from two CoVs, SARS-CoV and murine hepatitis virus, and its monomeric homologue, XendoU from Xenopus laevis, combined with mutagenesis studies have implicated several residues in enzymatic activity and the N-terminal domain as the major determinant of hexamerization. However, the tight link between hexamerization and enzyme activity in NendoUs has remained an enigma. Here, we report the structure of a trimmed, monomeric form of SARS-CoV nsp15 (residues 28 to 335) determined to a resolution of 2.9 Angstroms. The catalytic loop (residues 234 to 249) with its two reactive histidines (His 234 and His 249) is dramatically flipped by {approx}120 degrees into the active site cleft. Furthermore, the catalytic nucleophile Lys 289 points in a diametrically opposite direction, a consequence of an outward displacement of the supporting loop (residues 276 to 295). In the full-length hexameric forms, these two loops are packed against each other and are stabilized by intimate intersubunit interactions. Our results support the hypothesis that absence of an adjacent monomer due to deletion of the hexamerization domain is the most likely cause for disruption of the active site, offering a structural basis for why only the hexameric form of this enzyme is active.

Deforming black hole and cosmological solutions by quasiperiodic and/or pattern forming structures in modified and Einstein gravity

Science.gov (United States)

Bubuianu, Laurenţiu; Vacaru, Sergiu I.

2018-05-01

We elaborate on the anholonomic frame deformation method, AFDM, for constructing exact solutions with quasiperiodic structure in modified gravity theories, MGTs, and general relativity, GR. Such solutions are described by generic off-diagonal metrics, nonlinear and linear connections and (effective) matter sources with coefficients depending on all spacetime coordinates via corresponding classes of generation and integration functions and (effective) matter sources. There are studied effective free energy functionals and nonlinear evolution equations for generating off-diagonal quasiperiodic deformations of black hole and/or homogeneous cosmological metrics. The physical data for such functionals are stated by different values of constants and prescribed symmetries for defining quasiperiodic structures at cosmological scales, or astrophysical objects in nontrivial gravitational backgrounds some similar forms as in condensed matter physics. It is shown how quasiperiodic structures determined by general nonlinear, or additive, functionals for generating functions and (effective) sources may transform black hole like configurations into cosmological metrics and inversely. We speculate on possible implications of quasiperiodic solutions in dark energy and dark matter physics. Finally, it is concluded that geometric methods for constructing exact solutions consist an important alternative tool to numerical relativity for investigating nonlinear effects in astrophysics and cosmology.

Honeycomb-like thin films of polystyrene-block-poly(2-vinylpyridine) embedded with gold or silver nanoparticles formed at the planer liquid/liquid interface.

Science.gov (United States)

Wang, Di; Ma, Huihui; Chu, Chunxiao; Hao, Jingcheng; Liu, Hong-Guo

2013-07-15

Composite thin films of polystyrene-block-poly(2-vinylpyridine) (PS-b-P2VP) decorated with Au or Ag nanoclusters and nanoparticles were fabricated at the interfaces of chloroform solution of PS-b-P2VP and aqueous solutions of HAuCl4 or AgNO3. Transmission electron microscopy (TEM) investigations indicated that large area of a single-layer honeycomb structure was formed, which is composed of polygons (most of them are hexagons) whose walls look like spindles with the length of several hundreds of nanometers. Large amount of Au or Ag nanoparticles are embedded in the walls and the undersides of the honeycomb structures. The formation of these novel composite structures was attributed to the adsorption of block copolymer molecules and inorganic species of AuCl4(-) and Ag(+) ions at the liquid-liquid interface, the combination of the polymer molecules and the inorganic ions, and the self-assembly of the composite molecules. After UV-light irradiation and KBH4 aqueous solution treatment, the inorganic species were reduced completely, as confirmed by UV-vis spectra and X-ray photoelectron spectra. These composite films exhibited high catalytic activities for the reduction of 4-nitrophenol (4-NP) by KBH4 in aqueous solutions. Copyright © 2013 Elsevier Inc. All rights reserved.

Structural complementarity of Toll/interleukin-1 receptor domains in Toll-like receptors and the adaptors Mal and MyD88.

Science.gov (United States)

Dunne, Aisling; Ejdeback, Mikael; Ludidi, Phumzile L; O'Neill, Luke A J; Gay, Nicholas J

2003-10-17

The Toll/interleukin 1 receptor (TIR) domain is a region found in the cytoplasmic tails of members of the Toll-like receptor/interleukin-1 receptor superfamily. The domain is essential for signaling and is also found in the adaptor proteins Mal (MyD88 adaptor-like) and MyD88, which function to couple activation of the receptor to downstream signaling components. Experimental structures of two Toll/interleukin 1 receptor domains reveal a alpha-beta-fold similar to that of the bacterial chemotaxis protein CheY, and other evidence suggests that the adaptors can make heterotypic interactions with both the receptors and themselves. Here we show that the purified TIR domains of Mal and MyD88 can form stable heterodimers and also that Mal homodimers and oligomers are dissociated in the presence of ATP. To identify structural features that may contribute to the formation of signaling complexes, we produced models of the TIR domains from human Toll-like receptor 4 (TLR4), Mal, and MyD88. We found that although the overall fold is conserved the electrostatic surface potentials are quite distinct. Docking studies of the models suggest that Mal and MyD88 bind to different regions in TLRs 2 and 4, a finding consistent with a cooperative role of the two adaptors in signaling. Mal and MyD88 are predicted to interact at a third non-overlapping site, suggesting that the receptor and adaptors may form heterotetrameric complexes. The theoretical model of the interactions is supported by experimental data from glutathione S-transferase pull-downs and co-immunoprecipitations. Neither theoretical nor experimental data suggest a direct role for the conserved proline in the BB-loop in the association of TLR4, Mal, and MyD88. Finally we show a sequence relationship between the Drosophila protein Tube and Mal that may indicate a functional equivalence of these two adaptors in the Drosophila and vertebrate Toll pathways.

High-density lipoprotein-like particle formation of Synuclein variants.

Science.gov (United States)

Eichmann, Cédric; Kumari, Pratibha; Riek, Roland

2017-01-01

α-Synuclein (α-Syn) is an intrinsically disordered protein in solution whose fibrillar aggregates are the hallmark of Parkinson's disease (PD). Although the specific function of α-Syn is still unclear, its high structural plasticity is key for the interactions of α-Syn with biological membranes. Recently, it has been observed that α-Syn is able to form high-density lipoprotein-like (HDL-like) particles that are reminiscent of self-assembling phospholipid bilayer nanodiscs. Here, we extended our preparation method for the production of α-Syn lipoprotein particles to the β- and γ-Syn variants, and the PD-related familial α-Syn mutants. We show that all human Syns can form stable and homogeneous populations of HDL-like particles with distinct morphologies. Our results characterize the impact of the individual Syns on the formation capacity of these particles and indicate that Syn HDL-like particles are neither causing toxicity nor a toxicity-related loss of α-Syn in PD. © 2016 Federation of European Biochemical Societies.

Simple Theory for the Dynamics of Mean-Field-Like Models of Glass-Forming Fluids

Science.gov (United States)

Szamel, Grzegorz

2017-10-01

We propose a simple theory for the dynamics of model glass-forming fluids, which should be solvable using a mean-field-like approach. The theory is based on transparent physical assumptions, which can be tested in computer simulations. The theory predicts an ergodicity-breaking transition that is identical to the so-called dynamic transition predicted within the replica approach. Thus, it can provide the missing dynamic component of the random first order transition framework. In the large-dimensional limit the theory reproduces the result of a recent exact calculation of Maimbourg et al. [Phys. Rev. Lett. 116, 015902 (2016), 10.1103/PhysRevLett.116.015902]. Our approach provides an alternative, physically motivated derivation of this result.

Are the soft, liquid-like structures detected around bacteria by ambient dynamic atomic force microscopy capsules?

Science.gov (United States)

Méndez-Vilas, A; Labajos-Broncano, L; Perera-Núñez, J; González-Martín, M L

2011-05-01

High-resolution imaging of bacterial capsules by microscopy is of paramount importance in microbiology due to their role in pathogenesis. This is, however, quite a challenging task due to their delicate nature. In this context, recent reports have claimed successful exploitation of the capacity of atomic force microscopy (AFM) for imaging of extremely deformable (even liquid) surfaces under ambient conditions to detect bacterial capsules in the form of tiny amounts of liquid-like substances around bacteria. In order to further explore this supposed capacity of AFM, in this work, three staphylococcal strains have been scrutinized for the presence of capsules using such an AFM-based approach with a phosphate buffer and water as the suspending liquids. Similar results were obtained with the three strains. AFM showed the presence of liquid-like substances identical to those attributed to bacterial capsules in the previous literature. Extensive imaging and chemical analysis point out the central role of the suspending liquid (buffer) in the formation of these substances. The phenomenon has been reproduced even by using nonliving particles, a finding that refutes the biological origin of the liquid-like substances visualized around the cells. Deliquescence of major components of biological buffers, such as K(2)HPO(4), CaCl(2), or HEPES, is proposed as the fundamental mechanism of the formation of these ultrasmall liquid-like structures. Such an origin could explain the high similarity of our results obtained with three very different strains and also the high similarity of these results to others reported in the literature based on other bacteria and suspending liquids. Finally, possible biological/biomedical implications of the presence of these ultrasmall amounts of liquids wrapping microorganisms are discussed.

The Widespread Prevalence and Functional Significance of Silk-Like Structural Proteins in Metazoan Biological Materials.

Directory of Open Access Journals (Sweden)

Carmel McDougall

Full Text Available In nature, numerous mechanisms have evolved by which organisms fabricate biological structures with an impressive array of physical characteristics. Some examples of metazoan biological materials include the highly elastic byssal threads by which bivalves attach themselves to rocks, biomineralized structures that form the skeletons of various animals, and spider silks that are renowned for their exceptional strength and elasticity. The remarkable properties of silks, which are perhaps the best studied biological materials, are the result of the highly repetitive, modular, and biased amino acid composition of the proteins that compose them. Interestingly, similar levels of modularity/repetitiveness and similar bias in amino acid compositions have been reported in proteins that are components of structural materials in other organisms, however the exact nature and extent of this similarity, and its functional and evolutionary relevance, is unknown. Here, we investigate this similarity and use sequence features common to silks and other known structural proteins to develop a bioinformatics-based method to identify similar proteins from large-scale transcriptome and whole-genome datasets. We show that a large number of proteins identified using this method have roles in biological material formation throughout the animal kingdom. Despite the similarity in sequence characteristics, most of the silk-like structural proteins (SLSPs identified in this study appear to have evolved independently and are restricted to a particular animal lineage. Although the exact function of many of these SLSPs is unknown, the apparent independent evolution of proteins with similar sequence characteristics in divergent lineages suggests that these features are important for the assembly of biological materials. The identification of these characteristics enable the generation of testable hypotheses regarding the mechanisms by which these proteins assemble and direct the

Spherical cauliflower-like carbon dust formed by interaction between deuterium plasma and graphite target and its internal structure

Energy Technology Data Exchange (ETDEWEB)

Ohno, N. [Department of Energy Engineering and Science, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan)], E-mail: ohno@ees.nagoya-u.ac.jp; Yoshimi, M. [Department of Energy Engineering and Science, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Tokitani, M. [National Institute for Fusion Science, Oroshi 322-6, Toki 509-5292 (Japan); Takamura, S. [Department of Electronics, Aichi Institute of Technology, Yakusa-cho, Toyota 470-0392 (Japan); Tokunaga, K.; Yoshida, N. [Research Institute for Applied Mechanics, Kyushu University, Kasuga, Fukuoka 816-8580 (Japan)

2009-06-15

Simulated experiments to produce carbon dust particles with cauliflower structure have been performed in a liner plasma device, NAGDIS-II by exposing high density deuterium plasma to a graphite sample (IG-430U). Formation of carbon dust depends on the surface temperature and the incident ion energy. At a surface temperature 600-700 K, a lot of isolated spherical dust particles are observed on the graphite target. The internal structure of an isolated dust particle was observed with Focused Ion Beam (FIB) system and Transmission Electron Microscope (TEM) in detail. FIB analysis clearly shows there exist honey-combed cell structure with thin carbon walls in the dust particle and the dust particle grows from the graphite surface. TEM image also shows that the dust particle is made of amorphous carbon with crystallized grains with diameters of 10-50 nm.

A Poisson-like closed-form expression for the steady-state wealth distribution in a kinetic model of gambling

Science.gov (United States)

Garcia, Jane Bernadette Denise M.; Esguerra, Jose Perico H.

2017-08-01

An approximate but closed-form expression for a Poisson-like steady state wealth distribution in a kinetic model of gambling was formulated from a finite number of its moments, which were generated from a βa,b(x) exchange distribution. The obtained steady-state wealth distributions have tails which are qualitatively similar to those observed in actual wealth distributions.

Structural predictor for nonlinear sheared dynamics in simple glass-forming liquids.

Science.gov (United States)

Ingebrigtsen, Trond S; Tanaka, Hajime

2018-01-02

Glass-forming liquids subjected to sufficiently strong shear universally exhibit striking nonlinear behavior; for example, a power-law decrease of the viscosity with increasing shear rate. This phenomenon has attracted considerable attention over the years from both fundamental and applicational viewpoints. However, the out-of-equilibrium and nonlinear nature of sheared fluids have made theoretical understanding of this phenomenon very challenging and thus slower to progress. We find here that the structural relaxation time as a function of the two-body excess entropy, calculated for the extensional axis of the shear flow, collapses onto the corresponding equilibrium curve for a wide range of pair potentials ranging from harsh repulsive to soft and finite. This two-body excess entropy collapse provides a powerful approach to predicting the dynamics of nonequilibrium liquids from their equilibrium counterparts. Furthermore, the two-body excess entropy scaling suggests that sheared dynamics is controlled purely by the liquid structure captured in the form of the two-body excess entropy along the extensional direction, shedding light on the perplexing mechanism behind shear thinning.

Structural predictor for nonlinear sheared dynamics in simple glass-forming liquids

Science.gov (United States)

Ingebrigtsen, Trond S.; Tanaka, Hajime

2018-01-01

Glass-forming liquids subjected to sufficiently strong shear universally exhibit striking nonlinear behavior; for example, a power-law decrease of the viscosity with increasing shear rate. This phenomenon has attracted considerable attention over the years from both fundamental and applicational viewpoints. However, the out-of-equilibrium and nonlinear nature of sheared fluids have made theoretical understanding of this phenomenon very challenging and thus slower to progress. We find here that the structural relaxation time as a function of the two-body excess entropy, calculated for the extensional axis of the shear flow, collapses onto the corresponding equilibrium curve for a wide range of pair potentials ranging from harsh repulsive to soft and finite. This two-body excess entropy collapse provides a powerful approach to predicting the dynamics of nonequilibrium liquids from their equilibrium counterparts. Furthermore, the two-body excess entropy scaling suggests that sheared dynamics is controlled purely by the liquid structure captured in the form of the two-body excess entropy along the extensional direction, shedding light on the perplexing mechanism behind shear thinning.

Unique sail-like structure of cor triatriatum dexter in three-dimensional echocardiogram.

Science.gov (United States)

Low, Ting Ting; Uy, Celia Catherine C; Wong, Raymond Ching Chiew

2014-08-01

Cor triatriatum dexter (CTD) is an extremely rare congenital condition arising from the persistence of the right valve of the sinus venosus. It divides the right atrium (RA) into 2 separate chambers. We report a case of a 50-year-old man who had an incidental finding of CTD on transesophageal echocardiogram. An incomplete membrane of the RA was seen, and three-dimensional echocardiogram delineated the structure clearly as a triangular sail-like structure with multiple orifices and a fenestration. © 2013, Wiley Periodicals, Inc.

On frame properties for Fourier-like systems

DEFF Research Database (Denmark)

Christensen, Ole; Osgooei, Elnaz

2013-01-01

Fourier-like systems are formed by multiplying a class of exponentials with a set of window functions. Via the Fourier transform they are equivalent to shift-invariant systems. We present sufficient and easily verifiable conditions for such systems to form a frame with a dual frame having the same...... structure. An attractive class of frames is formed by letting the window functions be trigonometric polynomials, restricted to compact intervals. We prove, under weak conditions, that such systems generate a frame with a dual that is also generated by a trigonometric polynomial. For polynomial windows......, a result of this type does not hold. Throughout the paper the results are related to the well established theory for Gabor systems....

Synthesis and structural transformations of hydrotalcite-like materials Mg-Al and Zn-Al

NARCIS (Netherlands)

Prihod'ko, R.V.; Sychev, M.V.; Astrelin, I.M.; Erdmann, K.; Mangel, A.; Santen, van R.A.

2001-01-01

Mg-Al and Zn-Al hydrotalcite-like layered double hydroxides of various compositions were synthesized and characterized. A detailed comparative analysis of the structure and composition of starting and reconstructed layered double hydroxides was made

Structure of a new crystal form of human Hsp70 ATPase domain.

Science.gov (United States)

Osipiuk, J; Walsh, M A; Freeman, B C; Morimoto, R I; Joachimiak, A

1999-05-01

Hsp70 proteins are highly conserved proteins induced by heat shock and other stress conditions. An ATP-binding domain of human Hsp70 protein has been crystallized in two major morphological forms at pH 7.0 in the presence of PEG 8000 and CaCl2. Both crystal forms belong to the orthorhombic space group P212121, but show no resemblance in unit-cell parameters. Analysis of the crystal structures for both forms shows a 1-2 A shift of one of the subdomains of the protein. This conformational change could reflect a 'natural' flexibility of the protein which might be relevant to ATP binding and may facilitate the interaction of other proteins with Hsp70 protein.

Amyloid-like protein inclusions in tobacco transgenic plants.

Directory of Open Access Journals (Sweden)

Anna Villar-Piqué

Full Text Available The formation of insoluble protein deposits in human tissues is linked to the onset of more than 40 different disorders, ranging from dementia to diabetes. In these diseases, the proteins usually self-assemble into ordered β-sheet enriched aggregates known as amyloid fibrils. Here we study the structure of the inclusions formed by maize transglutaminase (TGZ in the chloroplasts of tobacco transplastomic plants and demonstrate that they have an amyloid-like nature. Together with the evidence of amyloid structures in bacteria and fungi our data argue that amyloid formation is likely a ubiquitous process occurring across the different kingdoms of life. The discovery of amyloid conformations inside inclusions of genetically modified plants might have implications regarding their use for human applications.

Proton Form Factors And Related Processes in BaBar by ISR

Energy Technology Data Exchange (ETDEWEB)

Ferroli, R.B.; /Enrico Fermi Ctr., Rome /INFN, Rome

2007-02-12

BaBar has measured with unprecedented accuracy e{sup +}e{sup -} {yields} p{bar p} from the threshold up to Q{sub p{bar p}}{sup 2} {approx} 20 GeV{sup 2}/c{sup 4}, finding out an unexpected cross section, with plateaux and drops. In particular it is well established a sharp drop near threshold, where evidence for structures in multihadronic channels has also been found. Other unexpected and spectacular features of the Nucleon form factors are reminded, the behavior of space-like G{sub E}{sup p}/G{sub M}{sup p} and the neutron time-like form factors.

Cylindric-like algebras and algebraic logic

CERN Document Server

Ferenczi, Miklós; Németi, István

2013-01-01

Algebraic logic is a subject in the interface between logic, algebra and geometry, it has strong connections with category theory and combinatorics. Tarski’s quest for finding structure in logic leads to cylindric-like algebras as studied in this book, they are among the main players in Tarskian algebraic logic. Cylindric algebra theory can be viewed in many ways:  as an algebraic form of definability theory, as a study of higher-dimensional relations, as an enrichment of Boolean Algebra theory, or, as logic in geometric form (“cylindric” in the name refers to geometric aspects). Cylindric-like algebras have a wide range of applications, in, e.g., natural language theory, data-base theory, stochastics, and even in relativity theory. The present volume, consisting of 18 survey papers, intends to give an overview of the main achievements and new research directions in the past 30 years, since the publication of the Henkin-Monk-Tarski monographs. It is dedicated to the memory of Leon Henkin.

Thermal Analysis, Structural Studies and Morphology of Spider Silk-like Block Copolymers

Science.gov (United States)

Huang, Wenwen

both the bound water removal induced conformational change and the hydrophobicity of the protein sequences, while the high temperature glass transition, Tg( 2), above 130 °C is the now dry protein glass transition. Real-time Fourier transform infrared spectroscopy (FTIR) confirmed that conformational change occurred during the two glass transition, with a random coils to beta turns transition during Tg(1) and alpha helices to beta turns transition during Tg( 2). Due to the hydrophobic and hydrophilic nature of the blocks, the spider silk block copolymers tend to self-assemble into various microstructures. To study the morphological features, the spider silk-like block copolymers were treated with hexafluoroisopropanol or methanol, or subjected to thermal treatment. Using scanning electron microscopies, micelles were observed in thermally treated films. Fibrillar networks and hollow vesicles were observed in methanol-cast samples, while no micro-structures were formed in HFIP-cast films, indicating that morphology and crystallinity can be tuned by thermal treatments. Results indicate when we increase the number of repeating unit of A-block in the protein, sample films crystallize more easily and are more thermally stable. Moreover, when samples crystallize, the secondary structure of A-block and B-block become different, thus it will be easier to form bilayer structures which could fold into vesicles or tube structures during drying.

The Morphology of Intermediate Structures Formed During Bainite Transformation in HSLA Steels

Science.gov (United States)

Seidurov, Mikhail N.; Kovalev, Sergey V.; Zubkov, Alexander S.

2017-10-01

The paper deals with the structure of bainite formed under the influence of thermal deformation cycles of welding in low-carbon bainitic class steels. Morphology features associated with the formation of mesoferrite and granular bainite determines the high cold resistance of welded joints.

Structure of massive star forming clumps from the Red MSX Source Survey

Science.gov (United States)

Figura, Charles C.; Urquhart, J. S.; Morgan, L.

2014-01-01

We present ammonia (1,1) and (2,2) emission maps of 61 high-mass star forming regions drawn from the Red MSX Source (RMS) Survey and observed with the Green Bank Telescope's K-Band Focal Plane Array. We use these observations to investigate the spatial distribution of the environmental conditions associated with this sample of embedded massive young stellar objects (MYSOs). Ammonia is an excellent high-density tracer of star-forming regions as its hyperfine structure allows relatively simple characterisation of the molecular environment. These maps are used to measure the column density, kinetic gas temperature distributions and velocity structure across these regions. We compare the distribution of these properties to that of the associated dust and mid-infrared emission traced by the ATLASGAL 870 micron emission maps and the Spitzer GLIMPSE IRAC images. We present a summary of these results and highlight some of more interesting finds.

The effect of form pressure on the air void structure of SCC

DEFF Research Database (Denmark)

Jensen, Mikkel Vibæk; Hasholt, Marianne Tange; Geiker, Mette Rica

2005-01-01

The high workability of self-compacting concrete (SCC) invites to high casting rates. However, casting walls at high rate may result in large pressure at the bottom of the form and subsequently compression of the air voids. This paper deals with the influence of hydrostatic pressure during setting...... on the air void structure of hardened, air entrained SCC. The subject was examined through laboratory investigations of SCC with two different amounts of air entrainment. The condition in the form was simulated by using containers making it possible to cure concrete under various pressures corresponding...... to the bottom of castings of 0, 2, 4, and 6 meters height. The laboratory investigations were supplemented with data from two full-scale wall castings. The air void structure of the hardened concretes was determined on plane sections. The results indicate that the pressure related changes of the air void...

Observations of resonance-like structures for positron-atom scattering at intermediate energies

International Nuclear Information System (INIS)

Dou, L.

1993-01-01

Absolute values of elastic differential cross sections (DCS's) are measured for position (e + ) scattering by argon (8.7-300 eV) krypton (6.7-400 eV) and also neon (13.6-400 eV) using a crossed-beam experimental setup. When the DCS's are plotted at fixed scattering angles of 30 degrees, 60 degrees, 90 degrees and 120 degrees versus energy it has been found that well-defined resonance-like structures are found at an energy of 55-60 eV for argon and at 25 and 200 eV for krypton, with a broader structure found between 100-200 eV for neon. These observed resonance-like structures are unusual because they occur at energies well above the known inelastic thresholds for these atoms. They may represent examples of open-quotes coupled channel shape resonancesclose quotes, first predicted by Higgins and Burke [1] for e + -H scattering in the vicinity of 36 eV (width ∼ 4 eV), which occurs only when both the elastic and positronium formation scattering channels are considered together. A more recent e + -H calculation by Hewitt et al. [2] supports the Higgins and Burke prediction. These predictions and the present observations suggest the existence of a new type of atomic scattering resonance

Crystal structure of Helicobacter pylori neutrophil-activating protein with a di-nuclear ferroxidase center in a zinc or cadmium-bound form

Energy Technology Data Exchange (ETDEWEB)

Yokoyama, Hideshi, E-mail: h-yokoya@u-shizuoka-ken.ac.jp [School of Pharmaceutical Sciences, University of Shizuoka, 52-1 Yada, Suruga-ku, Shizuoka 422-8526 (Japan); Tsuruta, Osamu; Akao, Naoya; Fujii, Satoshi [School of Pharmaceutical Sciences, University of Shizuoka, 52-1 Yada, Suruga-ku, Shizuoka 422-8526 (Japan)

2012-06-15

Highlights: Black-Right-Pointing-Pointer Structures of a metal-bound Helicobacter pylori neutrophil-activating protein were determined. Black-Right-Pointing-Pointer Two zinc ions were tetrahedrally coordinated by ferroxidase center (FOC) residues. Black-Right-Pointing-Pointer Two cadmium ions were coordinated in a trigonal-bipyramidal and octahedral manner. Black-Right-Pointing-Pointer The second metal ion was more weakly coordinated than the first at the FOC. Black-Right-Pointing-Pointer A zinc ion was found in one negatively-charged pore suitable as an ion path. -- Abstract: Helicobacter pylori neutrophil-activating protein (HP-NAP) is a Dps-like iron storage protein forming a dodecameric shell, and promotes adhesion of neutrophils to endothelial cells. The crystal structure of HP-NAP in a Zn{sup 2+}- or Cd{sup 2+}-bound form reveals the binding of two zinc or two cadmium ions and their bridged water molecule at the ferroxidase center (FOC). The two zinc ions are coordinated in a tetrahedral manner to the conserved residues among HP-NAP and Dps proteins. The two cadmium ions are coordinated in a trigonal-bipyramidal and distorted octahedral manner. In both structures, the second ion is more weakly coordinated than the first. Another zinc ion is found inside of the negatively-charged threefold-related pore, which is suitable for metal ions to pass through.

TORNADO-LIKE EVOLUTION OF A KINK-UNSTABLE SOLAR PROMINENCE

Energy Technology Data Exchange (ETDEWEB)

Wang, Wensi; Liu, Rui; Wang, Yuming, E-mail: rliu@ustc.edu.cn [CAS Key Laboratory of Geospace Environment, Department of Geophysics and Planetary Sciences, University of Science and Technology of China, Hefei 230026 (China)

2017-01-01

We report on the tornado-like evolution of a quiescent prominence on 2014 November 1. The eastern section of the prominence first rose slowly, transforming into an arch-shaped structure as high as ∼150 Mm above the limb; the arch then writhed moderately in a left-handed sense, while the original dark prominence material emitted in the Fe ix 171 Å passband, and a braided structure appeared at the eastern edge of the warped arch. The unraveling of the braided structure was associated with a transient brightening in the EUV and apparently contributed to the formation of a curtain-like structure (CLS). The CLS consisted of myriad thread-like loops rotating counterclockwise about the vertical if viewed from above. Heated prominence material was observed to slide along these loops and land outside the filament channel. The tornado eventually disintegrated and the remaining material flew along a left-handed helical path constituting approximately a full turn, as corroborated through stereoscopic reconstruction, into the cavity of the stable, western section of the prominence. We suggest that the tornado-like evolution of the prominence was governed by the helical kink instability, and that the CLS formed through magnetic reconnections between the prominence field and the overlying coronal field.

The structural properties of flower-like ZnO nanostructures on porous silicon

Science.gov (United States)

Eswar, Kevin Alvin; Suhaimi, Mohd Husairi Fadzillah; Guliling, Muliyadi; Mohamad, Maryam; Khusaimi, Zuraida; Rusop, M.; Abdullah, Saifollah

2018-05-01

The flower-like zinc oxide (ZnO) were successfully synthesized on porous silicon (PSi) via hydrothermal method. The characteristic of ZnO nanostructures was investigated using field emission scanning microscopy (FESEM) and X-ray diffraction (X-Ray). The FESEM images show the flower-like ZnO nanostructures composed ZnO nanoparticles. The X-ray diffraction shows that strong intensity of (100), (002) and (101) peaks. The structural analysis revealed that the peaks angles were shifted due to the stress or imperfection of the crystalline of ZnO nanostructures. The crystalline sizes in range of 42.60 to 54.09 nm were produced.

GFP-like proteins as ubiquitous metazoan superfamily: evolution of functional features and structural complexity.

Science.gov (United States)

Shagin, Dmitry A; Barsova, Ekaterina V; Yanushevich, Yurii G; Fradkov, Arkady F; Lukyanov, Konstantin A; Labas, Yulii A; Semenova, Tatiana N; Ugalde, Juan A; Meyers, Ann; Nunez, Jose M; Widder, Edith A; Lukyanov, Sergey A; Matz, Mikhail V

2004-05-01

Homologs of the green fluorescent protein (GFP), including the recently described GFP-like domains of certain extracellular matrix proteins in Bilaterian organisms, are remarkably similar at the protein structure level, yet they often perform totally unrelated functions, thereby warranting recognition as a superfamily. Here we describe diverse GFP-like proteins from previously undersampled and completely new sources, including hydromedusae and planktonic Copepoda. In hydromedusae, yellow and nonfluorescent purple proteins were found in addition to greens. Notably, the new yellow protein seems to follow exactly the same structural solution to achieving the yellow color of fluorescence as YFP, an engineered yellow-emitting mutant variant of GFP. The addition of these new sequences made it possible to resolve deep-level phylogenetic relationships within the superfamily. Fluorescence (most likely green) must have already existed in the common ancestor of Cnidaria and Bilateria, and therefore GFP-like proteins may be responsible for fluorescence and/or coloration in virtually any animal. At least 15 color diversification events can be inferred following the maximum parsimony principle in Cnidaria. Origination of red fluorescence and nonfluorescent purple-blue colors on several independent occasions provides a remarkable example of convergent evolution of complex features at the molecular level.

Crystal structure of the fluorescent protein from Dendronephthya sp. in both green and photoconverted red forms

Energy Technology Data Exchange (ETDEWEB)

Pletneva, Nadya V.; Pletnev, Sergei; Pakhomov, Alexey A.; Chertkova, Rita V.; Martynov, Vladimir I.; Muslinkina, Liya; Dauter, Zbigniew; Pletnev, Vladimir Z.

2016-07-13

The fluorescent protein fromDendronephthyasp. (DendFP) is a member of the Kaede-like group of photoconvertible fluorescent proteins with a His62-Tyr63-Gly64 chromophore-forming sequence. Upon irradiation with UV and blue light, the fluorescence of DendFP irreversibly changes from green (506 nm) to red (578 nm). The photoconversion is accompanied by cleavage of the peptide backbone at the C^α—N bond of His62 and the formation of a terminal carboxamide group at the preceding Leu61. The resulting double C^α=C^βbond in His62 extends the conjugation of the chromophore π system to include imidazole, providing the red fluorescence. Here, the three-dimensional structures of native green and photoconverted red forms of DendFP determined at 1.81 and 2.14 Å resolution, respectively, are reported. This is the first structure of photoconverted red DendFP to be reported to date. The structure-based mutagenesis of DendFP revealed an important role of positions 142 and 193: replacement of the original Ser142 and His193 caused a moderate red shift in the fluorescence and a considerable increase in the photoconversion rate. It was demonstrated that hydrogen bonding of the chromophore to the Gln116 and Ser105 cluster is crucial for variation of the photoconversion rate. The single replacement Gln116Asn disrupts the hydrogen bonding of Gln116 to the chromophore, resulting in a 30-fold decrease in the photoconversion rate, which was partially restored by a further Ser105Asn replacement.

Local laser-strengthening: Customizing the forming behavior of car body steel sheets

Science.gov (United States)

Wagner, M.; Jahn, A.; Beyer, E.; Balzani, D.

2018-05-01

Future trends in designing lightweight components especially for automotive applications increasingly require complex and delicate structures with highest possible level of capacity [1]. The manufacturing of metallic car body components is primarily realized by deep or stretch drawing. The forming process of especially cold rolled and large-sized components is typically characterized by inhomogeneous stress and strain distributions. As a result, the avoidance of undesirable deep drawing effects like earing and local necking is among the greatest challenges in forming complex car body structures [2]. Hence, a novel local laser-treatment approach with the objective of customizing the forming behavior of car body steel sheets is currently explored.

Advances in Design and Fabrication of Free-Form Reciprocal Structures

DEFF Research Database (Denmark)

Parigi, Dario

2016-01-01

The paper presents the advances in design and fabrication of free-form Reciprocal Structures, and their application a during a one-week long workshop with the students of the 1st semester of the Master of Science in Architecture and Design, fall 2015, at Aalborg University. Two new factors were...... introduced and tested: a new version of the software Reciprocalizer, and an evolution of the Reciprocalizer Robot. The workshop didactic framework Performance Aided/Assisted Design (PAD) is presented....

Characterization of Danio rerio Mn2+-dependent ADP-ribose/CDP-alcohol diphosphatase, the structural prototype of the ADPRibase-Mn-like protein family.

Directory of Open Access Journals (Sweden)

Joaquim Rui Rodrigues

Full Text Available The ADPRibase-Mn-like protein family, that belongs to the metallo-dependent phosphatase superfamily, has different functional and structural prototypes. The functional one is the Mn(2+-dependent ADP-ribose/CDP-alcohol diphosphatase from Rattus norvegicus, which is essentially inactive with Mg(2+ and active with low micromolar Mn(2+ in the hydrolysis of the phosphoanhydride linkages of ADP-ribose, CDP-alcohols and cyclic ADP-ribose (cADPR in order of decreasing efficiency. The structural prototype of the family is a Danio rerio protein with a known crystallographic structure but functionally uncharacterized. To estimate the structure-function correlation with the same protein, the activities of zebrafish ADPRibase-Mn were studied. Differences between zebrafish and rat enzymes are highlighted. The former showed a complex activity dependence on Mn(2+, significant (≈25% Mg(2+-dependent activity, but was almost inactive on cADPR (150-fold less efficient than the rat counterpart. The low cADPR hydrolase activity agreed with the zebrafish genome lacking genes coding for proteins with significant homology with cADPR-forming enzymes. Substrate-docking to zebrafish wild-type protein, and characterization of the ADPRibase-Mn H97A mutant pointed to a role of His-97 in catalysis by orientation, and to a bidentate water bridging the dinuclear metal center as the potential nucleophile. Finally, three structural elements that delimit the active site entrance in the zebrafish protein were identified as unique to the ADPRibase-Mn-like family within the metallo-dependent phosphatase superfamily.

Bioinspired onion epithelium-like structure promotes the maturation of cardiomyocytes derived from human pluripotent stem cells.

Science.gov (United States)

Xu, Cong; Wang, Li; Yu, Yue; Yin, Fangchao; Zhang, Xiaoqing; Jiang, Lei; Qin, Jianhua

2017-08-22

Organized cardiomyocyte alignment is critical to maintain the mechanical properties of the heart. In this study, we present a new and simple strategy to fabricate a biomimetic microchip designed with an onion epithelium-like structure and investigate the guided behavior of human induced pluripotent stem cell derived cardiomyocytes (hiPSC-CMs) on the substrate. The hiPSC-CMs were observed to be confined by the three dimensional surficial features morphologically, analogous to the in vivo microenvironment, and exhibited an organized anisotropic alignment on the onion epithelium-like structure with good beating function. The calcium imaging of hiPSC-CMs demonstrated a more mature Ca 2+ spark pattern as well. Furthermore, the expression of sarcomere genes (TNNI3, MYH6 and MYH7), potassium channel genes (KCNE1 and KCNH2), and calcium channel genes (RYR2) was significantly up-regulated on the substrate with an onion epithelium-like structure instead of the surface without the structure, indicating a more matured status of cardiomyocytes induced by this structure. It appears that the biomimetic micropatterned structure, analogous to in vivo cellular organization, is an important factor that might promote the maturation of hiPSC-CMs, providing new biological insights to guide hiPSC-CM maturation by biophysical factors. The established approach may offer an effective in vitro model for investigating cardiomyocyte differentiation, maturation and tissue engineering applications.

Di-hadron azimuthal correlation and Mach-like cone structure in a parton/hadron transport model

International Nuclear Information System (INIS)

Ma, G.L.; Zhang, S.; Ma, Y.G.; Huang, H.Z.; Cai, X.Z.; Chen, J.H.; He, Z.J.; Long, J.L.; Shen, W.Q.; Shi, X.H.; Zuo, J.X.

2006-01-01

In the framework of a multi-phase transport model (AMPT) with both partonic and hadronic interactions, azimuthal correlations between trigger particles and associated scattering particles have been studied by the mixing-event technique. The momentum ranges of these particles are 3 T trig T assoc T trig T assoc NN =200 GeV. A Mach-like structure has been observed in correlation functions for central collisions. By comparing scenarios with and without parton cascade and hadronic rescattering, we show that both partonic and hadronic dynamical mechanisms contribute to the Mach-like structure of the associated particle azimuthal correlations. The contribution of hadronic dynamical process cannot be ignored in the emergence of Mach-like correlations of the soft scattered associated hadrons. However, hadronic rescattering alone cannot reproduce experimental amplitude of Mach-like cone on away-side, and the parton cascade process is essential to describe experimental amplitude of Mach-like cone on away-side. In addition, both the associated multiplicity and the sum of p T decrease, while the T > increases, with the impact parameter in the AMPT model including partonic dynamics from string melting scenario

Extracting energy and structure properties of glass-forming liquids from structural relaxation time.

Science.gov (United States)

Wang, Lianwen

2012-04-18

A comprehensive examination of the kinetic liquid model (Wang et al 2010 J. Phys.: Condens. Matter 22 455104) is carried out by fitting the structural relaxation time of 26 different glass-forming liquids in a wide temperature range, including most of the well-studied materials. Careful analysis of the compiled reported data reveals that experimental inaccuracies should not be overlooked in any 'benchmark test' of relating theories or models (e.g. in Lunkenheimer et al 2010 Phys. Rev. E 81 051504). The procedure, accuracy, ability, and efficiency of the kinetic liquid model are discussed in detail and in comparison with other available fitting methods. In general, the kinetic liquid model could be verified by 17 of the 26 compiled data sets and can serve as a meaningful approximative method for analyzing these liquids. Nonetheless, further experimental examinations in a wide temperature range are needed and are called for. Through fitting, the microscopic details of these liquids are extracted, namely, the enthalpy, entropy, and cooperativity in structural relaxation, which may facilitate further quantitative analysis to both the liquidus and glassy states of these materials.

Crystal Structure of the Extracellular Cholinesterase-Like Domain from Neuroligin-2

Energy Technology Data Exchange (ETDEWEB)

Koehnke,J.; Jin, X.; Budreck, E.; Posy, S.; Scheiffele, P.; Hnoig, B.; Shapiro, L.

2008-01-01

Neuroligins (NLs) are catalytically inactive members of a family of cholinesterase-like transmembrane proteins that mediate cell adhesion at neuronal synapses. Postsynaptic neuroligins engage in Ca2+-dependent transsynaptic interactions via their extracellular cholinesterase domain with presynaptic neurexins (NRXs). These interactions may be regulated by two short splice insertions (termed A and B) in the NL cholinesterase domain. Here, we present the 3.3- Angstroms crystal structure of the ectodomain from NL2 containing splice insertion A (NL2A). The overall structure of NL2A resembles that of cholinesterases, but several structural features are unique to the NL proteins. First, structural elements surrounding the esterase active-site region differ significantly between active esterases and NL2A. On the opposite surface of the NL2A molecule, the positions of the A and B splice insertions identify a candidate NRX interaction site of the NL protein. Finally, sequence comparisons of NL isoforms allow for mapping the location of residues of previously identified mutations in NL3 and NL4 found in patients with autism spectrum disorders. Overall, the NL2 structure promises to provide a valuable model for dissecting NL isoform- and synapse-specific functions.

The structure environment, rock-magma system, mineral-forming series and pattern of volcanic mineral-forming of uranium deposit in southeast of China

International Nuclear Information System (INIS)

Yu Dagan

1992-01-01

The Volcanic uranium deposit of rock-magma belt-the Mid-Cz Volcano in the Southeast of China mainly formed around 120 ∼ 130 Ma and 90 ∼ 100 Ma Which is in harmony with the two rock magma activities of k within the region. The rock-magma system of this period formed around the turning period from pressure to tension in the continent margin of southeast China, which is mainly characterized by the appearance of A-type granite and alkaline, sub-alkaline rocks (trachyte, trachyandensite, trachybasalt, basic rock alkaline basalt). The uranium deposit is controlled by the base rift of dissection to the mantle, the volcanic basin is of the double characteristics of transversal rift valley basin (early period) ad tension rift valley basin (laster period). The leading role of the deep source is stressed in terms of internal-forming series of volcanic uranium deposits is considered to exist; and also in terms of internal-forming series of volcanic uranium deposits is considered to exist; and also in terms of mineral-forming patterns, the multi-pattern led by the deep-source is stressed, including the mineral-forming pattern of uranium deposit of continental thermos, repeated periphery mineral-forming pattern of uranium deposit and the mineral-forming pattern of uranium deposit of rising pole-like thermos. Ten suggestions are put forward to the next mineral-search according to the above thoughts

Superplastic Forming/Adhesive Bonding of Aluminum (SPF/AB) Multi-Sheet Structures

Science.gov (United States)

Wagner, John A. (Technical Monitor); Will, Jeff D.; Cotton, James D.

2003-01-01

A significant fraction of airframe structure consists of stiffened panels that are costly and difficult to fabricate. This program explored a potentially lower-cost processing route for producing such panels. The alternative process sought to apply concurrent superplastic forming and adhesive bonding of aluminum alloy sheets. Processing conditions were chosen to balance adequate superplasticity of the alloy with thermal stability of the adhesive. As a first objective, an air-quenchable, superplastic aluminum-lithium alloy and a low-volatile content, low-viscosity adhesive with compatible forming/curing cycles were identified. A four-sheet forming pack was assembled which consisted of a welded two-sheet core separated from the face sheets by a layer of adhesive. Despite some preliminary success, of over 30 forming trials none was completely successful. The main problem was inadequate superplasticity in the heat-affected zones of the rib welds, which generally fractured prior to completion of the forming cycle. The welds are a necessary component in producing internal ribs by the 'four-sheet' process. Other challenges, such as surface preparation and adhesive bonding, were adequately solved. But without the larger issue of tearing at the weld locations, complex panel fabrication by SPF/AB does not appear viable.

Structural Determinants of Photoreactivity of Triplex Forming Oligonucleotides Conjugated to Psoralens

Science.gov (United States)

Krishnan, Rajagopal; Oh, Dennis H.

2010-01-01

Triplex-forming oligonucleotides (TFOs) with both DNA and 2′-O-methyl RNA backbones can direct psoralen photoadducts to specific DNA sequences. However, the functional consequences of these differing structures on psoralen photoreactivity are unknown. We designed TFO sequences with DNA and 2′-O-methyl RNA backbones conjugated to psoralen by 2-carbon linkers and examined their ability to bind and target damage to model DNA duplexes corresponding to sequences within the human HPRT gene. While TFO binding affinity was not dramatically affected by the type of backbone, psoralen photoreactivity was completely abrogated by the 2′-O-methyl RNA backbone. Photoreactivity was restored when the psoralen was conjugated to the RNA TFO via a 6-carbon linker. In contrast to the B-form DNA of triplexes formed by DNA TFOs, the CD spectra of triplexes formed with 2′-O-methyl RNA TFOs exhibited features of A-form DNA. These results indicate that 2′-O-methyl RNA TFOs induce a partial B-to-A transition in their target DNA sequences which may impair the photoreactivity of a conjugated psoralen and suggest that optimal design of TFOs to target DNA damage may require a balance between binding ability and drug reactivity. PMID:20725628

Structure, diversity and evolution of protein toxins from spore-forming entomopathogenic bacteria

NARCIS (Netherlands)

Maagd, de R.A.; Bravo, A.; Berry, C.; Crickmore, N.; Schnepf, H.E.

2003-01-01

Gram-positive spore-forming entomopathogenic bacteria can utilize a large variety of protein toxins to help them invade, infect, and finally kill their hosts, through their action on the insect midgut. These toxins belong to a number of homology groups containing a diversity of protein structures

Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

Science.gov (United States)

Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2014-02-24

The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

L-form transformation phenomenon in Mycobacterium tuberculosis associated with drug tolerance to ethambutol

Directory of Open Access Journals (Sweden)

Georgi Slavchev

2016-01-01

Full Text Available Objective/background: Cell wall-deficient bacterial forms (L-forms may occur along with resistance to factors that trigger their appearance. It is of interest to study the relationship between the L-form transformation of Mycobacterium tuberculosis and the exhibition of drug tolerance to ethambutol (EMB, an inhibitor of cell wall synthesis. Methods: L-form variant was produced from a sensitive EMB strain of M. Tuberculosis through a cryogenic stress treatment protocol and was subsequently cultivated in Middlebrook 7H9 semisolid medium, containing EMB in a minimal inhibitory concentration of 2 mg/L. Susceptibility to EMB of the parental strain and its L-form variant was evaluated phenotypically and using polymerase chain reaction-restriction fragment length polymorphism assay targeting a mutation in the embB306 gene fragment. Results: In contrast to the sensitivity to EMB of the parental strain, its L-form variant showed phenotypic resistance to high concentrations of EMB (16 mg/L, but the mutation in embB306 was not found. Electron microscopy observation of the L-form variant showed a heterogenic population of bacteria, with different degrees of cell wall deficiency, as well as cells of protoplastic type without cell walls. Of special interest were the observed capsule-like structures around the L-form cells and the biofilm-like matrix produced by the L-form population. Conclusion: We suggest that the expression of phenotypic resistance to EMB in M. Tuberculosis can be associated with alterations or loss of cell walls in L-form bacteria, respectively, which results in a lack of a specific target for EMB action. In addition, production of capsule-like structures and biofilm matrix by L-forms could contribute to their resistance and survival in the presence of antibacterial agents.

Detection of G-Quadruplex Structures Formed by G-Rich Sequences from Rice Genome and Transcriptome Using Combined Probes.

Science.gov (United States)

Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua

2017-08-01

Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.

Myroides odoratimimus Forms Structurally Complex and Inherently Antibiotic-Resistant Biofilm in a Wound-Like in vitro Model

Directory of Open Access Journals (Sweden)

Arianna Pompilio

2017-12-01

Full Text Available Myroides odoratimimus is an aerobic, non-fermenting Gram-negative multidrug-resistant bacterium widely distributed in nature that rarely causes infections in immunocompromised patients. We recently described in a diabetic patient a case of recurrent calcaneal ulcer infection caused by a M. odoratimimus strain showing potential for biofilm formation. For the first time, we therefore evaluated the ability of M. odoratimimus to form biofilm under different pH values and glucose concentrations using an in vitro “skin-like” model, and its susceptibility to levofloxacin, meropenem, and tigecycline. The expression of some antibiotic-resistance related genes was also monitored by RT-PCR during planktonic-to-biofilm transition. Our results indicated that M. odoratimimus can produce relevant amounts of biofilm biomass, in a time-dependent manner, especially at acidic pH and regardless of glucose concentration tested. The comparative analysis of MIC and MBC values between planktonic and sessile cells showed that resistance to antibiotics increased during the planktonic-to-biofilm transition. Viable cell count indicated that none of the tested antibiotics were able to completely eradicate preformed biofilms, although meropenem and levofloxacin were the most active causing a significant, dose-independent, reduction of biofilm's viability, as also confirmed by microscopic analysis. RT-PCR showed that antibiotic-resistance related gyrA and acrB genes are over-expressed during the transition from planktonic to sessile (biofilm lifestyle. Overall, our findings showed that M. odoratimimus can form relevant amounts of inherently antibiotic-resistant biofilm under conditions relevant to wound site, therefore suggesting a role in the pathogenesis of chronic ulcer infections.

A slow-forming isopeptide bond in the structure of the major pilin SpaD from Corynebacterium diphtheriae has implications for pilus assembly

Energy Technology Data Exchange (ETDEWEB)

Kang, Hae Joo; Paterson, Neil G. [University of Auckland, Private Bag 92019, Auckland 1142 (New Zealand); Kim, Chae Un [Cornell University, Ithaca, NY 14853 (United States); Middleditch, Martin [University of Auckland, Private Bag 92019, Auckland 1142 (New Zealand); Chang, Chungyu; Ton-That, Hung [University of Texas–Houston Medical School, Houston, TX 77030 (United States); Baker, Edward N., E-mail: ted.baker@auckland.ac.nz [University of Auckland, Private Bag 92019, Auckland 1142 (New Zealand)

2014-05-01

Two crystal structures of the major pilin SpaD from C. diphtheriae have been determined at 1.87 and 2.5 Å resolution. The N-terminal domain is found to contain an isopeptide bond that forms slowly over time in the recombinant protein. Given its structural context, this provides insight into the relationship between internal isopeptide-bond formation and pilus assembly. The Gram-positive organism Corynebacterium diphtheriae, the cause of diphtheria in humans, expresses pili on its surface which it uses for adhesion and colonization of its host. These pili are covalent protein polymers composed of three types of pilin subunit that are assembled by specific sortase enzymes. A structural analysis of the major pilin SpaD, which forms the polymeric backbone of one of the three types of pilus expressed by C. diphtheriae, is reported. Mass-spectral and crystallographic analysis shows that SpaD contains three internal Lys–Asn isopeptide bonds. One of these, shown by mass spectrometry to be located in the N-terminal D1 domain of the protein, only forms slowly, implying an energy barrier to bond formation. Two crystal structures, of the full-length three-domain protein at 2.5 Å resolution and of a two-domain (D2-D3) construct at 1.87 Å resolution, show that each of the three Ig-like domains contains a single Lys–Asn isopeptide-bond cross-link, assumed to give mechanical stability as in other such pili. Additional stabilizing features include a disulfide bond in the D3 domain and a calcium-binding loop in D2. The N-terminal D1 domain is more flexible than the others and, by analogy with other major pilins of this type, the slow formation of its isopeptide bond can be attributed to its location adjacent to the lysine used in sortase-mediated polymerization during pilus assembly.

Structural properties of films and rheology of film-forming solutions of chitosan gallate for food packaging.

Science.gov (United States)

Wu, Chunhua; Tian, Jinhu; Li, Shan; Wu, Tiantian; Hu, Yaqin; Chen, Shiguo; Sugawara, Tatsuya; Ye, Xingqian

2016-08-01

The chitosan gallates (CG) were obtained by free-radical-initiated grafting of gallic acid (GA) onto chitosan (CS) in this work. The chemical structures of the CG were corroborated by UV-vis, GPC and (1)H NMR analysis. The grafting reaction was accompanied with a degradation of the CS molecule. The shear-thinning flow behavior of CG film-forming solutions (CG FFS) decreased with the grafting amount of GA into CS chain, while the CG FFS grafted at a lower GA value behaved like a networks containing entangled or cross-linked polymer chains with a more elastic behavior. The increasing of GA grafting onto the CS chain led to a reduction of tensile strength, elongation at break and water resistance in the corresponding films, but increases in the antioxidant and antimicrobial activities were observed. The microstructure of the film was investigated using scanning electron and atomic force microscope, and the results were closely related to the observed film properties. Copyright © 2016 Elsevier Ltd. All rights reserved.

Novel dextran derivatives with unconventional structure formed in an efficient one-pot reaction.

Science.gov (United States)

Hotzel, Konrad; Heinze, Thomas

2016-11-03

An efficient one-pot synthesis of new dextran derivatives is described. The functional groups of β-alanine, i.e., the carboxyl- and amine group, are converted independently in one-step by iminium chloride to form products with a single substituent. The dextran N-[(dimethylamino)methylene]-β-alanine ester is formed selectively. The structure of the resulting polymers is unambiguously determined by means of NMR- and FTIR-spectroscopy and elemental analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

STAT3 signaling pathway is necessary for cell survival and tumorsphere forming capacity in ALDH+/CD133+ stem cell-like human colon cancer cells

International Nuclear Information System (INIS)

Lin, Li; Fuchs, James; Li, Chenglong; Olson, Veronica; Bekaii-Saab, Tanios; Lin, Jiayuh

2011-01-01

Highlights: ► The phosphorylated or activated form of STAT3 was expressed in colon cancer stem-like cells. ► STAT3 inhibitor, FLLL32 inhibits P-STAT3 and STAT3 target genes in colon cancer stem-like cells. ► Inhibition of STAT3 resulted in decreased cell viability and reduced numbers of tumorspheres. ► STAT3 is required for survival and tumorsphere forming capacity in colon cancer stem-like cells. ► Targeting STAT3 in cancer stem-like cells may offer a novel treatment approach for colon cancer. -- Abstract: Persistent activation of Signal Transducers and Activators of Transcription 3 (STAT3) is frequently detected in colon cancer. Increasing evidence suggests the existence of a small population of colon cancer stem or cancer-initiating cells may be responsible for tumor initiation, metastasis, and resistance to chemotherapy and radiation. Whether STAT3 plays a role in colon cancer-initiating cells and the effect of STAT3 inhibition is still unknown. Flow cytometry was used to isolate colon cancer stem-like cells from three independent human colon cancer cell lines characterized by both aldehyde dehydrogenase (ALDH)-positive and CD133-positive subpopulation (ALDH + /CD133 + ). The effects of STAT3 inhibition in colon cancer stem-like cells were examined. The phosphorylated or activated form of STAT3 was expressed in colon cancer stem-like cells and was reduced by a STAT3-selective small molecular inhibitor, FLLL32. FLLL32 also inhibited the expression of potential STAT3 downstream target genes in colon cancer stem-like cells including survivin, Bcl-XL, as well as Notch-1, -3, and -4, which may be involved in stem cell function. Furthermore, FLLL32 inhibited cell viability and tumorsphere formation as well as induced cleaved caspase-3 in colon cancer stem-like cells. FLLL32 is more potent than curcumin as evidenced with lower IC50 in colon cancer stem-like cells. In summary, our results indicate that STAT3 is a novel therapeutic target in colon cancer stem-like

Testing the Hypothesis of Biofilm as a Source for Soft Tissue and Cell-Like Structures Preserved in Dinosaur Bone

Science.gov (United States)

2016-01-01

Recovery of still-soft tissue structures, including blood vessels and osteocytes, from dinosaur bone after demineralization was reported in 2005 and in subsequent publications. Despite multiple lines of evidence supporting an endogenous source, it was proposed that these structures arose from contamination from biofilm-forming organisms. To test the hypothesis that soft tissue structures result from microbial invasion of the fossil bone, we used two different biofilm-forming microorganisms to inoculate modern bone fragments from which organic components had been removed. We show fundamental morphological, chemical and textural differences between the resultant biofilm structures and those derived from dinosaur bone. The data do not support the hypothesis that biofilm-forming microorganisms are the source of these structures. PMID:26926069

Structure and Potential Cellular Targets of HAMLET-like Anti-Cancer Compounds made from Milk Components.

Science.gov (United States)

Rath, Emma M; Duff, Anthony P; Håkansson, Anders P; Vacher, Catherine S; Liu, Guo Jun; Knott, Robert B; Church, William Bret

2015-01-01

The HAMLET family of compounds (Human Alpha-lactalbumin Made Lethal to Tumours) was discovered during studies on the properties of human milk, and is a class of protein-lipid complexes having broad spectrum anti-cancer, and some specific anti-bacterial properties. The structure of HAMLET-like compounds consists of an aggregation of partially unfolded protein making up the majority of the compound's mass, with fatty acid molecules bound in the hydrophobic core. This is a novel protein-lipid structure and has only recently been derived by small-angle X-ray scattering analysis. The structure is the basis of a novel cytotoxicity mechanism responsible for anti-cancer activity to all of the around 50 different cancer cell types for which the HAMLET family has been trialled. Multiple cytotoxic mechanisms have been hypothesised for the HAMLET-like compounds, but it is not yet clear which of those are the initiating cytotoxic mechanism(s) and which are subsequent activities triggered by the initiating mechanism(s). In addition to the studies into the structure of these compounds, this review presents the state of knowledge of the anti-cancer aspects of HAMLET-like compounds, the HAMLET-induced cytotoxic activities to cancer and non-cancer cells, and the several prospective cell membrane and intracellular targets of the HAMLET family. The emerging picture is that HAMLET-like compounds initiate their cytotoxic effects on what may be a cancer-specific target in the cell membrane that has yet to be identified. This article is open to POST-PUBLICATION REVIEW. Registered readers (see "For Readers") may comment by clicking on ABSTRACT on the issue's contents page.

Nuclear reactor fuel structure containing uranium alloy wires embedded in a metallic matrix plate

International Nuclear Information System (INIS)

Travelli, A.

1988-01-01

A nuclear fuel-containing plate structure for a nuclear reactor is described; such structure comprising a pair of malleable metallic non-fissionable matrix plates having confronting surfaces which are pressure bonded together and fully united to form a bonded surface, and elongated malleable wire-like fissionable fuel members separately confined and fully enclosed between the matrix plates along the interface to afford a high fuel density as well as structural integrity and effective retention of fission products. The plates have separate recesses formed in the confronting surfaces for closely receiving the wire-like fissionable fuel members. The wire-like fissionable fuel members are made of a maleable uranium alloy capable of being formed into elongated wire-like members and capable of withstanding pressure bonding. The wire-like fissionable fuel members are completely separated and isolated by fully united portions of the interface

Application of Modal Parameter Estimation Methods for Continuous Wavelet Transform-Based Damage Detection for Beam-Like Structures

Directory of Open Access Journals (Sweden)

Zhi Qiu

2015-02-01

Full Text Available This paper presents a hybrid damage detection method based on continuous wavelet transform (CWT and modal parameter identification techniques for beam-like structures. First, two kinds of mode shape estimation methods, herein referred to as the quadrature peaks picking (QPP and rational fraction polynomial (RFP methods, are used to identify the first four mode shapes of an intact beam-like structure based on the hammer/accelerometer modal experiment. The results are compared and validated using a numerical simulation with ABAQUS software. In order to determine the damage detection effectiveness between the QPP-based method and the RFP-based method when applying the CWT technique, the first two mode shapes calculated by the QPP and RFP methods are analyzed using CWT. The experiment, performed on different damage scenarios involving beam-like structures, shows that, due to the outstanding advantage of the denoising characteristic of the RFP-based (RFP-CWT technique, the RFP-CWT method gives a clearer indication of the damage location than the conventionally used QPP-based (QPP-CWT method. Finally, an overall evaluation of the damage detection is outlined, as the identification results suggest that the newly proposed RFP-CWT method is accurate and reliable in terms of detection of damage locations on beam-like structures.

P-odd effects in the e-d scattering in the vector-like theories

International Nuclear Information System (INIS)

Gakh, G.I.

1979-01-01

P-odd effects in elastic electron-deuteron scattering, due to the weak neutral currents, are analyzed in the framework of the vector-like theories. Considered is the case of the most general form of the P-invariance breaking in the elastic e - d scattering amplitude in both the leptonic and hadronic vertices. It is found that in the vector-like theories the parity violation in the electro-deuteron elastic scattering is confined in the hadronic vertex, while in the Weinberg-Salam model it is confined in the leptonic vertex. In the vector-like theories the asymmetry in the scattering of longitudinally polarized electrons by nonpolarized deuterons depends on the electromagnetic and weak form factors of a deuteron, whereas in the Weinberg-Salam model it does not depend on the structure of the deuteron. In the Weinberg-Salam model the asymmetry is independent on the T-violating form factors of the deuteron, whereas such a dependence is present in the vector-like theories

The retro-GCN4 leucine zipper sequence forms a stable three-dimensional structure

Science.gov (United States)

Mittl, Peer R. E.; Deillon, Christine; Sargent, David; Liu, Niankun; Klauser, Stephan; Thomas, Richard M.; Gutte, Bernd; Grütter, Markus G.

2000-01-01

The question of whether a protein whose natural sequence is inverted adopts a stable fold is still under debate. We have determined the 2.1-Å crystal structure of the retro-GCN4 leucine zipper. In contrast to the two-stranded helical coiled-coil GCN4 leucine zipper, the retro-leucine zipper formed a very stable, parallel four-helix bundle, which now lends itself to further structural and functional studies. PMID:10716989

Structural analysis of a 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase with an N-terminal chorismate mutase-like regulatory domain

Energy Technology Data Exchange (ETDEWEB)

Light, Samuel H.; Halavaty, Andrei S.; Minasov, George; Shuvalova, Ludmilla; Anderson, Wayne F. (NWU)

2012-06-27

3-Deoxy-D-arabino-heptulosonate 7-phosphate synthase (DAHPS) catalyzes the first step in the biosynthesis of a number of aromatic metabolites. Likely because this reaction is situated at a pivotal biosynthetic gateway, several DAHPS classes distinguished by distinct mechanisms of allosteric regulation have independently evolved. One class of DAHPSs contains a regulatory domain with sequence homology to chorismate mutase - an enzyme further downstream of DAHPS that catalyzes the first committed step in tyrosine/phenylalanine biosynthesis - and is inhibited by chorismate mutase substrate (chorismate) and product (prephenate). Described in this work, structures of the Listeria monocytogenes chorismate/prephenate regulated DAHPS in complex with Mn{sup 2+} and Mn{sup 2+} + phosphoenolpyruvate reveal an unusual quaternary architecture: DAHPS domains assemble as a tetramer, from either side of which chorismate mutase-like (CML) regulatory domains asymmetrically emerge to form a pair of dimers. This domain organization suggests that chorismate/prephenate binding promotes a stable interaction between the discrete regulatory and catalytic domains and supports a mechanism of allosteric inhibition similar to tyrosine/phenylalanine control of a related DAHPS class. We argue that the structural similarity of chorismate mutase enzyme and CML regulatory domain provides a unique opportunity for the design of a multitarget antibacterial.

Ag nanoparticles formed by femtosecond pulse laser ablation in water: self-assembled fractal structures

Energy Technology Data Exchange (ETDEWEB)

Santillán, Jesica M. J. [CONICET La Plata-CIC, Centro de Investigaciones Ópticas (CIOp) (Argentina); Fernández van Raap, Marcela B., E-mail: raap@fisica.unlp.edu.ar; Mendoza Zélis, Pedro; Coral, Diego [CONICET, Instituto de Física La Plata (IFLP) (Argentina); Muraca, Diego [Universidade Estadual de Campinas, Instituto de Física “Gleb Wataghin” (IFGW) (Brazil); Schinca, Daniel C.; Scaffardi, Lucía B., E-mail: lucias@ciop.unlp.edu.ar [CONICET La Plata-CIC, Centro de Investigaciones Ópticas (CIOp) (Argentina)

2015-02-15

We report for the first time on the formation of self-assembled fractals of spherical Ag nanoparticles (Nps) fabricated by femtosecond pulse laser ablation of a solid silver target in water. Fractal structures grew both in two and three Euclidean dimensions (d). Ramified-fractal assemblies of 2 nm height and 5–14 μm large, decorated with Ag Nps of 3 nm size, were obtained in a 2d geometry when highly diluted drops of colloidal suspension were dried at a fast heating rate over a mica substrate. When less-diluted drops were dried at slow heating rate, isolated single Nps or rosette-like structures were formed. Fractal aggregates about 31 nm size in 3d geometry were observed in the as-prepared colloidal suspension. Electron diffraction and optical extinction spectroscopy (OES) analyses performed on the samples confirmed the presence of Ag and Ag{sub 2}O. The analysis of the optical extinction spectrum, using the electrostatic approximation of Mie theory for small spheres, showed the existence of Ag bare core, Ag–Ag{sub 2}O and air–Ag core–shell Nps, Ag–Ag{sub 2}O being the most frequent type [69 % relative abundance (r.a.)]. Core-size and shell-thickness distribution was derived from OES. In situ scattering measurements of the Ag colloidal suspension, carried out by small-angle X-ray scattering, indicate a mass fractal composed of packaged 〈D{sub SAXS}〉 = (5 ± 1) nm particles and fractal dimension d{sub f} = 2.5. Ex situ atomic force microscopy imaging displayed well-ramified structures, which, analyzed with box-counting method, yield a fractal dimension d{sub f} = 1.67. The growing behavior of these 2d and 3d self-assembled fractals is consistent with the diffusion-limited aggregation model.

Turbine airfoil with dual wall formed from inner and outer layers separated by a compliant structure

Science.gov (United States)

Campbell,; Christian X. , Morrison; Jay, A [Oviedo, FL

2011-12-20

A turbine airfoil usable in a turbine engine with a cooling system and a compliant dual wall configuration configured to enable thermal expansion between inner and outer layers while eliminating stress formation is disclosed. The compliant dual wall configuration may be formed a dual wall formed from inner and outer layers separated by a compliant structure. The compliant structure may be configured such that the outer layer may thermally expand without limitation by the inner layer. The compliant structure may be formed from a plurality of pedestals positioned generally parallel with each other. The pedestals may include a first foot attached to a first end of the pedestal and extending in a first direction aligned with the outer layer, and may include a second foot attached to a second end of the pedestal and extending in a second direction aligned with the inner layer.

Sediment concentration and bed form structures of Gulf of Cambay from remote sensing

Digital Repository Service at National Institute of Oceanography (India)

Kunte, P.D.

period, the bottom currents pull sediment (sand) particles supplied by major and minor rivers, rolling along the Gulf bed. These sediments perhaps participate in the formation of bed form structures. The topography of the Gulf bottom comprises of numerous...

Atomic Scale Investigation of Structural Properties and Glass Forming Ability of Ti100- x Al x Metallic Glasses

Science.gov (United States)

Tahiri, M.; Hasnaoui, A.; Sbiaai, K.

2018-06-01

In this work, we employed molecular dynamics (MD) simulations to study Ti-Al metallic glasses (MGs) using the embedded atom method (EAM) potential to model the atomic interaction with different compositions. The results showed evidence of the metallic glass formation induced by the split occurring in the second peak of the radial distribution function (RDF) curves implying both Ti and Al atoms. The common neighbor analysis (CNA) method confirmed the presence of the icosahedral clusters with a maximum amount observed for an alloy with 75 pct of Al. Analysis of coordination numbers (CNs) indicated that the total CNs are nearly unchanged in these systems. Finally, Voronoi tessellation analyses (VTA) showed a higher value of the number of icosahedral units at Ti25Al75 composition. This specific composition represents a nearby peritectic point localized at a low melting point in the Ti-Al binary phase diagram. The glass forming ability (GFA) becomes important when the fraction of Al increases by forming and connecting "icosahedral-like" clusters (12-coordinated and 13-coordinated ) and by playing a main role in the structure stability of the Ti-Al MGs.

Atomic Scale Investigation of Structural Properties and Glass Forming Ability of Ti100-x Al x Metallic Glasses

Science.gov (United States)

Tahiri, M.; Hasnaoui, A.; Sbiaai, K.

2018-03-01

In this work, we employed molecular dynamics (MD) simulations to study Ti-Al metallic glasses (MGs) using the embedded atom method (EAM) potential to model the atomic interaction with different compositions. The results showed evidence of the metallic glass formation induced by the split occurring in the second peak of the radial distribution function (RDF) curves implying both Ti and Al atoms. The common neighbor analysis (CNA) method confirmed the presence of the icosahedral clusters with a maximum amount observed for an alloy with 75 pct of Al. Analysis of coordination numbers (CNs) indicated that the total CNs are nearly unchanged in these systems. Finally, Voronoi tessellation analyses (VTA) showed a higher value of the number of icosahedral units at Ti25Al75 composition. This specific composition represents a nearby peritectic point localized at a low melting point in the Ti-Al binary phase diagram. The glass forming ability (GFA) becomes important when the fraction of Al increases by forming and connecting "icosahedral-like" clusters (12-coordinated and 13-coordinated ) and by playing a main role in the structure stability of the Ti-Al MGs.

Conformational Ensembles of α-Synuclein Derived Peptide with Different Osmolytes from Temperature Replica Exchange Sampling

Directory of Open Access Journals (Sweden)

Salma Jamal

2017-12-01

Full Text Available Intrinsically disordered proteins (IDP are a class of proteins that do not have a stable three-dimensional structure and can adopt a range of conformations playing various vital functional role. Alpha-synuclein is one such IDP which can aggregate into toxic protofibrils and has been associated largely with Parkinson's disease (PD along with other neurodegenerative diseases. Osmolytes are small organic compounds that can alter the environment around the proteins by acting as denaturants or protectants for the proteins. In the present study, we have conducted a series of replica exchange molecular dynamics simulations to explore the role of osmolytes, urea which is a denaturant and TMAO (trimethylamine N-oxide, a protecting osmolyte, in aggregation and conformations of the synuclein peptide. We observed that both the osmolytes have significantly distinct impacts on the peptide and led to transitions of the conformations of the peptide from one state to other. Our findings highlighted that urea attenuated peptide aggregation and resulted in the formation of extended peptide structures whereas TMAO led to compact and folded forms of the peptide.

Testing the Hypothesis of Biofilm as a Source for Soft Tissue and Cell-Like Structures Preserved in Dinosaur Bone.

Directory of Open Access Journals (Sweden)

Mary Higby Schweitzer

Full Text Available Recovery of still-soft tissue structures, including blood vessels and osteocytes, from dinosaur bone after demineralization was reported in 2005 and in subsequent publications. Despite multiple lines of evidence supporting an endogenous source, it was proposed that these structures arose from contamination from biofilm-forming organisms. To test the hypothesis that soft tissue structures result from microbial invasion of the fossil bone, we used two different biofilm-forming microorganisms to inoculate modern bone fragments from which organic components had been removed. We show fundamental morphological, chemical and textural differences between the resultant biofilm structures and those derived from dinosaur bone. The data do not support the hypothesis that biofilm-forming microorganisms are the source of these structures.

Form and function: Perspectives on structural biology and resources for the future

International Nuclear Information System (INIS)

Vaughan, D.

1990-12-01

The purpose of this study is largely to explore and expand on the thesis that biological structures and their functions are suited to. Form indeed follows function and if we are to understand the workings of a living system, with all that such an understanding promises, we must first seek to describe the structure of its parts. Descriptions of a few achievements of structural biology lay the groundwork, but the substance of this booklet is a discussion of important questions yet unanswered and opportunities just beyond our grasp. The concluding pages then outline a course of action in which the Department of Energy would exercise its responsibility to develop the major resources needed to extend our reach and to answer some of those unanswered questions. 22 figs

Form and function: Perspectives on structural biology and resources for the future

Energy Technology Data Exchange (ETDEWEB)

Vaughan, D. (ed.)

1990-12-01

The purpose of this study is largely to explore and expand on the thesis that biological structures and their functions are suited to. Form indeed follows function and if we are to understand the workings of a living system, with all that such an understanding promises, we must first seek to describe the structure of its parts. Descriptions of a few achievements of structural biology lay the groundwork, but the substance of this booklet is a discussion of important questions yet unanswered and opportunities just beyond our grasp. The concluding pages then outline a course of action in which the Department of Energy would exercise its responsibility to develop the major resources needed to extend our reach and to answer some of those unanswered questions. 22 figs.

Preparation of flower-like CdS with SDBS as surfactant by hydrothermal method and its optical properties

Energy Technology Data Exchange (ETDEWEB)

Wang, Yongqian, E-mail: cugwyq@126.com [Faculty of Material Science and Chemistry, China University of Geosciences, Wuhan 430074 (China); Yang, Xiande; Ma, Qun; Kong, Junhan; Jia, Hanxiang; Wang, Zhengshu [Faculty of Material Science and Chemistry, China University of Geosciences, Wuhan 430074 (China); Yu, Meihua [School of Materials Science and Engineering, Guangxi University, Nanning 530004 (China)

2015-06-15

Graphical abstract: FESEM image of the CdS obtained by 0.01 mol Cd(NO{sub 3}){sub 2}·4H{sub 2}O, 0.03 mol thiourea and 0.5 g SDBS at 160 °C for 24 h. - Highlights: • The role of SDBS is to assemble CdS crystals together to form flower-like structures. • Both reaction time and temperature affect the morphology of flower-like structures. • The growth mechanism of flower-like structures is reasonable, clear and concise. • Its optical energy band gap is 2.50 eV, and it has absorption in visible region. • PL result of flower-like structures shows the max emission wavelength is 508.6 nm. - Abstract: In this article, the flower-like CdS have been prepared by hydrothermal method with thiourea as sulfur source and SDBS as surfactant. The effects of different experimental conditions on the morphology of CdS have been investigated. The performances of CdS have been analyzed by X-ray diffraction (XRD), field emission scanning electron microscopy (FE-SEM), room temperature photoluminescence (PL) and UV–vis. The result of XRD indicates that CdS we prepared are highly crystallized, which are of hexagonal phase. The FE-SEM results indicate that the main role of SDBS is to make the CdS crystals assemble together to form the flower-like structures, and the reaction time affects the morphology of CdS, and the suitable reaction temperature is 160 °C. Its optical energy band gap is observed at 2.50 eV. The fluorescence spectrum shows that the flower-like CdS have a broad absorption peak and the max emission wavelength is 508.6 nm. The growth mechanism for the formation of CdS with flower-like structures is also described.

Form-finding with polyhedral meshes made simple

KAUST Repository

Tang, Chengcheng

2014-07-27

We solve the form-finding problem for polyhedral meshes in a way which combines form, function and fabrication; taking care of user-specified constraints like boundary interpolation, planarity of faces, statics, panel size and shape, enclosed volume, and last, but not least, cost. Our main application is the interactive modeling of meshes for architectural and industrial design. Our approach can be described as guided exploration of the constraint space whose algebraic structure is simplified by introducing auxiliary variables and ensuring that constraints are at most quadratic. Computationally, we perform a projection onto the constraint space which is biased towards low values of an energy which expresses desirable "soft" properties like fairness. We have created a tool which elegantly handles difficult tasks, such as taking boundary-alignment of polyhedral meshes into account, planarization, fairing under planarity side conditions, handling hybrid meshes, and extending the treatment of static equilibrium to shapes which possess overhanging parts.

Form-finding with polyhedral meshes made simple

KAUST Repository

Tang, Chengcheng; Sun, Xiang; Gomes, Maria Alexandra; Wallner, Johannes; Pottmann, Helmut

2014-01-01

We solve the form-finding problem for polyhedral meshes in a way which combines form, function and fabrication; taking care of user-specified constraints like boundary interpolation, planarity of faces, statics, panel size and shape, enclosed volume, and last, but not least, cost. Our main application is the interactive modeling of meshes for architectural and industrial design. Our approach can be described as guided exploration of the constraint space whose algebraic structure is simplified by introducing auxiliary variables and ensuring that constraints are at most quadratic. Computationally, we perform a projection onto the constraint space which is biased towards low values of an energy which expresses desirable "soft" properties like fairness. We have created a tool which elegantly handles difficult tasks, such as taking boundary-alignment of polyhedral meshes into account, planarization, fairing under planarity side conditions, handling hybrid meshes, and extending the treatment of static equilibrium to shapes which possess overhanging parts.

Fine Structure in Helium-like Fluorine by Fast-Beam Laser Spectroscopy

Science.gov (United States)

Myers, E. G.; Thompson, J. K.; Silver, J. D.

1998-05-01

With the aim of providing an additional precise test of higher-order corrections to high precision calculations of fine structure in helium and helium-like ions(T. Zhang, Z.-C. Yan and G.W.F. Drake, Phys. Rev. Lett. 77), 1715 (1996)., a measurement of the 2^3P_2,F - 2^3P_1,F' fine structure in ^19F^7+ is in progress. The method involves doppler-tuned laser spectroscopy using a CO2 laser on a foil-stripped fluorine ion beam. We aim to achieve a higher precision, compared to an earlier measurement(E.G. Myers, P. Kuske, H.J. Andrae, I.A. Armour, H.A. Klein, J.D. Silver, and E. Traebert, Phys. Rev. Lett. 47), 87 (1981)., by using laser beams parallel and anti-parallel to the ion beam, to obtain partial cancellation of the doppler shift(J.K. Thompson, D.J.H. Howie and E.G. Myers, Phys. Rev. A 57), 180 (1998).. A calculation of the hyperfine structure, allowing for relativistic, QED and nuclear size effects, will be required to obtain the ``hyperfine-free'' fine structure interval from the measurements.

FEATURES OF ISLET-LIKE CLUSTERS GENERATION IN PANCREATIC DUCTAL CELL MOLOLAYER CULTURING

Directory of Open Access Journals (Sweden)

L. A. Kirsanova

2012-01-01

Full Text Available Newborn rabbit pancreatic cell monolayer was obtained as we described earlier.The cultivated epithelial cells were shown by immunofluorescence to express special ductal marker CK19 and were insulin-and glucagon- negative for 10–15 days. A few fusiforms of nestin-positive cells were found in monolayer. Over 2 weeks in serum-free medium the plaques of epithelial cells became crowded and formed 3-dimentional structures – islet- like clusters. Islet-like clusters contain some insulin- and glucagon-positive cells recognized by immunohysto- chemistry staining. Pancreatic endocrine cell generation in 3-dimentional structures is discussed. 

Onion-like microspheres with tricomponent from gelable triblock copolymers.

Science.gov (United States)

Zhang, Ke; Gao, Lei; Chen, Yongming; Yang, Zhenzhong

2010-06-01

Onion-like functional microspheres with three alternate layers were obtained by aerosol-assisted self-assembly of a functional block copolymer, poly(3-(triethoxysilyl)propyl methacrylate)-block-polystyrene-block-poly(2-vinylpyridine) (PTEPM-b-PS-b-P2VP). Through self-gelation reaction occurred in the PTEPM layers, organic/inorganic hybrid functional spheres with highly ordered concentric curved lamellar structure were prepared. Using these hybrid onion-like microspheres as templates, gold ions were entrapped into the P2VP layers and then gold nanoparticles located in each P2VP layers were formed by a reduction. By dispersing in acidic water, the onion-like polymeric spheres were broken and, as a result, sandwich-like nanoplates with curved morphology were obtained. Copyright © 2010 Elsevier Inc. All rights reserved.

The structural bases of long-term anabiosis in non-spore-forming bacteria

Science.gov (United States)

Suzina, Natalia E.; Mulyukin, Andrey L.; Dmitriev, Vladimir V.; Nikolaev, Yury A.; Shorokhova, Anna P.; Bobkova, Yulia S.; Barinova, Ekaterina S.; Plakunov, Vladimir K.; El-Registan, Galina I.; Duda, Vitalii I.

2006-01-01

Peculiarities of the structural organization in non-spore-forming bacteria associated with long-term anabiosis were revealed both in laboratory cultures and in natural populations isolated from 1 3-Myr-old Eastern Siberian permafrost and tundra soil. Different advanced methods were used, including (a) high-resolution electron microscopy; (b) simulation of in situ conditions in the laboratory by varying the composition of growth medium and cultivation conditions; (c) low-temperature fractionation to isolate and concentrate microbial cells from natural soils; (d) comparative morphological analysis of microbial cells in model cultures and natural soils (in situ). Under laboratory conditions, the intense formation of resting cells by representatives of various taxa of eubacteria and halophilic archaea occurred in 2 9-month-old cultures grown in carbon-, nitrogen-, or phosphorus-limited media, in starved cell suspensions in the presence of sodium silicate, or on soil agar. Among resting cells, we revealed cystlike forms having a complicated structure and common features. These included a thick capsule; a thickened and multiprofile cell wall; the presence of large intramembrane particles on PF- and EF-fracture surfaces; fine-grained or lumpy cytoplasm; and a condensed nucleoid. The general morphological properties, ultrastructural organization, physiological features of cystlike cells, and their ability to germinate under the appropriate conditions suggest the existence of constitutive dormancy in non-spore-forming bacteria. It was found that the majority of microorganisms in permafrost and tundra soil are cystlike cells, very similar to those in laboratory cultures. Anabiotic (resting) cystlike cells are responsible for the survival of non-spore-formers in extreme Earth habitats and may be regarded as possible analogs of extraterrestrial forms of microbial life.

Structure reveals regulatory mechanisms of a MaoC-like hydratase from Phytophthora capsici involved in biosynthesis of polyhydroxyalkanoates (PHAs).

Science.gov (United States)

Wang, Huizheng; Zhang, Kai; Zhu, Jie; Song, Weiwei; Zhao, Li; Zhang, Xiuguo

2013-01-01

Polyhydroxyalkanoates (PHAs) have attracted increasing attention as "green plastic" due to their biodegradable, biocompatible, thermoplastic, and mechanical properties, and considerable research has been undertaken to develop low cost/high efficiency processes for the production of PHAs. MaoC-like hydratase (MaoC), which belongs to (R)-hydratase involved in linking the β-oxidation and the PHA biosynthetic pathways, has been identified recently. Understanding the regulatory mechanisms of (R)-hydratase catalysis is critical for efficient production of PHAs that promise synthesis an environment-friendly plastic. We have determined the crystal structure of a new MaoC recognized from Phytophthora capsici. The crystal structure of the enzyme was solved at 2.00 Å resolution. The structure shows that MaoC has a canonical (R)-hydratase fold with an N-domain and a C-domain. Supporting its dimerization observed in structure, MaoC forms a stable homodimer in solution. Mutations that disrupt the dimeric MaoC result in a complete loss of activity toward crotonyl-CoA, indicating that dimerization is required for the enzymatic activity of MaoC. Importantly, structure comparison reveals that a loop unique to MaoC interacts with an α-helix that harbors the catalytic residues of MaoC. Deletion of the loop enhances the enzymatic activity of MaoC, suggesting its inhibitory role in regulating the activity of MaoC. The data in our study reveal the regulatory mechanism of an (R)-hydratase, providing information on enzyme engineering to produce low cost PHAs.

Au functionalized ZnO rose-like hierarchical structures and their enhanced NO2 sensing performance

Science.gov (United States)

Shingange, K.; Swart, H. C.; Mhlongo, G. H.

2018-04-01

Herein, we present ZnO rose-like hierarchical nanostructures employed as support to Au nanoparticles to produce Au functionalized three dimensional (3D) ZnO hierarchical nanostructures (Au/ZnO) for NO2 detection using a microwave-assisted method. Comparative analysis of NO2 sensing performance between the pristine ZnO and Au/ZnO rose-like structures at 300 °C revealed improved NO2 response and rapid response-recovery times with Au incorporation owing to a combination of high surface accessibility induced by hierarchical nanostructure design and catalytic activity of the small Au nanoparticles. Structural and optical analyses acquired from X-ray diffraction, scanning electron microscopy, transmission electron microscope and photoluminescence spectroscopy were also performed.

Observations of resonance-like structures for positron-atom elastic scattering at intermediate energies

International Nuclear Information System (INIS)

Dou, L.; Kauppila, W.E.; Kwan, C.K.; Stein, T.S.

1993-01-01

We have measured absolute values of elastic differential cross sections (DCS's) for positron (e + ) scattering by argon (8.7-300 eV), krypton (6.7-400 eV), and also neon (13.6-400 eV) using a crossed-beam experimental setup. When the DCS's are plotted at fixed scattering angles of 30 degrees, 60 degrees, 90 degrees, and 120 degrees versus energy it has been found that well-defined resonance-like structures were found at an energy of 55-60 eV for argon and at 25 and 200 eV for krypton, with a broader structure found between 100-200 eV for neon. These observed resonance-like structures are unusual because they occur at energies well above the known inelastic thresholds for these atoms. They may represent examples of open-quotes coupled channel shape resonancesclose quotes, first predicted by Higgins and Burke for e + -H scattering in the vicinity of 36 eV (width ∼ 4 eV), which occurs only when both the elastic and positronium formation scattering channels are considered together. A more recent e + -H calculation by Hewitt et al. supports the Higgins and Burke prediction. These predictions and the present observations suggest the existence of a new type of atomic scattering resonance

Structures of the Apo and FAD-bound forms of 2-hydroxybiphenyl 3-monooxygenase (HbpA) locate activity hotspots identified by using directed evolution.

Science.gov (United States)

Jensen, Chantel N; Mielke, Tamara; Farrugia, Joseph E; Frank, Annika; Man, Henry; Hart, Sam; Turkenburg, Johan P; Grogan, Gideon

2015-04-13

The FAD-dependent monooxygenase HbpA from Pseudomonas azelaica HBP1 catalyses the hydroxylation of 2-hydroxybiphenyl (2HBP) to 2,3-dihydroxybiphenyl (23DHBP). HbpA has been used extensively as a model for studying flavoprotein hydroxylases under process conditions, and has also been subjected to directed-evolution experiments that altered its catalytic properties. The structure of HbpA has been determined in its apo and FAD-complex forms to resolutions of 2.76 and 2.03 Å, respectively. Comparisons of the HbpA structure with those of homologues, in conjunction with a model of the reaction product in the active site, reveal His48 as the most likely acid/base residue to be involved in the hydroxylation mechanism. Mutation of His48 to Ala resulted in an inactive enzyme. The structures of HbpA also provide evidence that mutants achieved by directed evolution that altered activity are comparatively remote from the substrate-binding site. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Structure of the Unbound Form of HIV-1 Subtype A Protease: Comparison with Unbound Forms of Proteases from other HIV Subtypes

Energy Technology Data Exchange (ETDEWEB)

Robbins, Arthur H.; Coman, Roxana M.; Bracho-Sanchez, Edith; Fernandez, Marty A.; Gilliland, C.Taylor; Li, Mi; Agbandje-McKenna, Mavis; Wlodawer, Alexander; Dunn, Ben M.; McKenna, Robert (NCI); (Florida)

2010-03-12

The crystal structure of the unbound form of HIV-1 subtype A protease (PR) has been determined to 1.7 {angstrom} resolution and refined as a homodimer in the hexagonal space group P6{sub 1} to an R{sub cryst} of 20.5%. The structure is similar in overall shape and fold to the previously determined subtype B, C and F PRs. The major differences lie in the conformation of the flap region. The flaps in the crystal structures of the unbound subtype B and C PRs, which were crystallized in tetragonal space groups, are either semi-open or wide open. In the present structure of subtype A PR the flaps are found in the closed position, a conformation that would be more anticipated in the structure of HIV protease complexed with an inhibitor. The amino-acid differences between the subtypes and their respective crystal space groups are discussed in terms of the differences in the flap conformations.

Higher order Stark effect and transition probabilities on hyperfine structure components of hydrogen like atoms

Energy Technology Data Exchange (ETDEWEB)

Pal' chikov, V.G. [National Research Institute for Physical-Technical and Radiotechnical Measurements - VNIIFTRI (Russian Federation)], E-mail: vitpal@mail.ru

2000-08-15

A quantum-electrodynamical (QED) perturbation theory is developed for hydrogen and hydrogen-like atomic systems with interaction between bound electrons and radiative field being treated as the perturbation. The dependence of the perturbed energy of levels on hyperfine structure (hfs) effects and on the higher-order Stark effect is investigated. Numerical results have been obtained for the transition probability between the hfs components of hydrogen-like bismuth.

Nucleon Structure and Hyperon Form Factors from Lattice QCD.

Energy Technology Data Exchange (ETDEWEB)

Lin,H.W.

2007-06-11

In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point. to be 1.23(5), consistent with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(2G), consistent with the Adelaide-JLab Collaboration's result. The hyperon {Sigma} and {Xi} axial coupling constants are also performed for the first time in a lattice calculation, g{sub {Sigma}{Sigma}} = 0.441(14) and g{sub {Xi}{Xi}} = -0.277(11).

Nucleon Structure and hyperon form factors from lattice QCD

Energy Technology Data Exchange (ETDEWEB)

Lin, Huey-Wen

2007-06-11

In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point to be 1.23(5), consistant with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(26), consistent with the Adelaide-JLab Collaboration's result. The hyperon Sigma and Xi axial coupling constants are also performed for the first time in a lattice calculation, g_SigmaSigma = 0.441(14) and g_XiXi = -0.277(11).

Multiple Fano-Like MIM Plasmonic Structure Based on Triangular Resonator for Refractive Index Sensing

OpenAIRE

Jankovic, Nikolina; Cselyuszka, Norbert

2018-01-01

In this paper, we present a Fano metal-insulator-metal (MIM) structure based on an isosceles triangular cavity resonator for refractive index sensing applications. Due to the specific feeding scheme and asymmetry introduced in the triangular cavity, the resonator exhibits four sharp Fano-like resonances. The behavior of the structure is analyzed in detail and its sensing capabilities demonstrated through the responses for various refractive indices. The results show that the sensor has very g...

Controllable synthesis of periodic flower-like ZnO nanostructures on Si subwavelength grating structures

International Nuclear Information System (INIS)

Ko, Yeong Hwan; Leem, Jung Woo; Yu, Jae Su

2011-01-01

We report on the periodic well-defined flower-like zinc oxide (ZnO) nanostructures (NSs) self-assembled through a simple hydrothermal method using silicon (Si) subwavelength grating (SWG) structures. The Si SWGs serve as building blocks for constructing a two-dimensional (2D) periodic architecture to integrate the one-dimensional (1D) ZnO NSs. Various controlled morphologies of ZnO NSs with high crystallinity are obtained by changing the growth conditions. For 1D ZnO NSs integrated on periodic hexagonal Si SWG structures, the reflection characteristics are investigated in comparison with the conventional ZnO nanorod (NR) arrays. For a three-dimensional (3D) flower-like ZnO NS on Si SWGs, a relatively low total reflectance of < 8% at wavelengths of 300-1050 nm is achieved compared to the ZnO NRs on Si substrate.

Fortuitous structure determination of ‘as-isolated’ Escherichia coli bacterioferritin in a novel crystal form

International Nuclear Information System (INIS)

Eerde, André van; Wolterink-van Loo, Suzanne; Oost, John van der; Dijkstra, Bauke W.

2006-01-01

E. coli bacterioferritin was crystallized in a novel crystal form from different conditions and the structure was solved. The crystals belonged to space group P2 1 3 and diffracted to a resolution of 2.5 Å. Escherichia coli bacterioferritin was serendipitously crystallized in a novel cubic crystal form and its structure could be determined to 2.5 Å resolution despite a high degree of merohedral twinning. This is the first report of crystallographic data on ‘as-isolated’ E. coli bacterioferritin. The ferroxidase active site contains positive difference density consistent with two metal ions that had co-purified with the protein. X-ray fluorescence studies suggest that the metal composition is different from that of previous structures and is a mix of zinc and native iron ions. The ferroxidase-centre configuration displays a similar flexibility as previously noted for other bacterioferritins

Characterization of nephelium mutabile blume-like structure of carbon nanotubes prepared from palm oil by CVD method

Science.gov (United States)

Maryam, M.; Shamsudin, M. S.; Rusop, M.

2017-09-01

A new structure of carbon nanotube was produced from the Single furnace Aerosol-assisted Catalytic CVD (SFAACVD) method using Palm Oil (PO) as the precursor and Ferrocene (Fe) as the catalyst. A nephelium mutabile blume (rambutan)-like structure of CNTs was found from the black substance collected from the Alumina boat substrate placed inside the furnace. Temperature of furnace which was heated at 600 °C - 800 °C plays an important role in determining the formation of structure. The formation rambutan-like structure of CNTs was optimized at 700 °C and the samples collected were characterized by Field Emission Scanning Electron Microscope (FE-SEM) to obtain the surface morphologies. Raman Spectroscopy (RS) and Thermogravimetric Analysis (TGA) were then used to further study the Raman Spectra and purity of samples.

Studies of nanostructures formed in T-10 tokamak

Energy Technology Data Exchange (ETDEWEB)

Kolbasov, B N; Stankevich, V G; Svechnikov, N Yu; Lebedev, A M; Menshikov, K A; Somenkov, V A; Trunova, V A; Veligzhanin, A A; Zubavichus, Y V [Kurchatov Institute, Kurchatov square 1, Moscow 123182 (Russian Federation); Rajarathnam, D, E-mail: kolbasov@nfi.kiae.ru [CERAR, University of South Australia, 5095 (Australia)

2011-06-23

According to the X-ray diffraction (XRD) studies, hydrocarbon films and flakes formed under deuterium plasma discharges in T-10 tokamak are amorphous with graphene-like sheets. They have atomic ratio (D + H)/C about 1 and higher. The XRD peak positions revealed the presence of structural defects with interplane distances of 0.12, 0.24 and 0.66 nm. The peak widths gave the in-plane sizes of the scattering structures equal to about 1 nm. The properties of such films were studied with application of small-angle and wide-angle X-ray scattering measurements, neutron diffraction and other techniques. These experiments have shown that the films contain about 63% of sp{sup 3} and {approx}37% of sp{sup 2} states. X-ray fluorescence spectroscopy employing synchrotron radiation revealed that the films contain at least 12 impurities of Fe, Mo, Cr, Ni, Nb and other transition metals. Difference between film properties on its opposite sides was revealed using Fourier-transform infrared spectroscopy and analysis of current-voltage characteristics (CVC). On the wall facing side of the film, graphite-like Csp{sup 2} structures dominate. On the plasma facing side, diamond-like Csp{sup 3} structures prevail. Deuterium retention can be monitored by two groups of vibrational sp{sup 3} modes with different oscillator strengths, depending on the amount of deuterium in films.

Investigation of the atomic interface structure of mesotaxial Si/CoSi2(100) layers formed by high-dose implantation

International Nuclear Information System (INIS)

Bulle-Lieuwma, C.W.T.; Jong, A.F. de; Vandenhoudt, D.E.W.

1991-01-01

Aligned mesotaxial films of CoSi 2 in monocrystalline (100) oriented Si substrates have been formed by high-dose ion implantation of Co, followed by a high temperature treatment. The atomic structures of both the lower and upper Si/CoSi 2 (100) interfaces of the buried CoSi 2 layer have been investigated by high-resolution electron microscopy (HREM) combined with image simulations. A domain-like structure is observed consisting of areas with different interfaces. In order to derive the atomic configuration, image simulations of different proposed models are presented. By comparing simulated images and HREM images, two different atomic structure models for the Si/CoSi 2 (100) interface have been found. In the first model the interfacial Co atoms are six-fold coordinated and the tetrahedral coordination and bond lengths of silicon atoms are everywhere maintained. In the second model we found evidence for a 2 x 1 interface reconstruction, involving a difference in composition. The interfacial Co atoms are seven-fold coordinated. It is shown that the boundaries between the domains are associated with interfacial dislocations of edge-type with Burgers vectors b a/4 inclined and b = a/2 parallel to the interfacial plane. (author)

Electronic structure, morphology and emission polarization of enhanced symmetry InAs quantum-dot-like structures grown on InP substrates by molecular beam epitaxy

Energy Technology Data Exchange (ETDEWEB)

Maryński, A.; Sĕk, G.; Musiał, A.; Andrzejewski, J.; Misiewicz, J. [Institute of Physics, Wrocław University of Technology, Wybrzeże Wyspiańskiego 27, 50-370 Wrocław (Poland); Gilfert, C.; Reithmaier, J. P. [Technische Physik, Institute of Nanostructure Technology and Analytics, CINSaT, University of Kassel, Heinrich Plett-Str. 40, D-34132 Kassel (Germany); Capua, A.; Karni, O.; Gready, D.; Eisenstein, G. [Department of Electrical Engineering, Technion, Haifa 32000 (Israel); Atiya, G.; Kaplan, W. D. [Department of Materials Science and Engineering, Technion, Haifa 32000 (Israel); Kölling, S. [Fraunhofer Institute for Photonic Microsystems, Center for Nanoelectronic Technologies, Königsbrücker Straße 180, D-01099 Dresden (Germany)

2013-09-07

The optical and structural properties of a new kind of InAs/InGaAlAs/InP quantum dot (QD)-like objects grown by molecular beam epitaxy have been investigated. These nanostructures were found to have significantly more symmetrical shapes compared to the commonly obtained dash-like geometries typical of this material system. The enhanced symmetry has been achieved due to the use of an As{sub 2} source and the consequent shorter migration length of the indium atoms. Structural studies based on a combination of scanning transmission electron microscopy (STEM) and atom probe tomography (APT) provided detailed information on both the structure and composition distribution within an individual nanostructure. However, it was not possible to determine the lateral aspect ratio from STEM or APT. To verify the in-plane geometry, electronic structure calculations, including the energy levels and transition oscillator strength for the QDs have been performed using an eight-band k·p model and realistic system parameters. The results of calculations were compared to measured polarization-resolved photoluminescence data. On the basis of measured degree of linear polarization of the surface emission, the in-plane shape of the QDs has been assessed proving a substantial increase in lateral symmetry. This results in quantum-dot rather than quantum-dash like properties, consistent with expectations based on the growth conditions and the structural data.

Working Memory Training in the Form of Structured Games in Children with Attention Deficit Hyperactivity Disorder.

Science.gov (United States)

Khalili Kermani, Fatemeh; Mohammadi, Mohammad Reza; Yadegari, Fariba; Haresabadi, Fatemeh; Sadeghi, Seyed Mehdi

2016-10-01

Objective: In this study, a new training method of working memory (WM) was used in the form of structured games, and the effect of training was evaluated with a controlled design. The training method of WM in the form of structured games includes 20 sets of structured games that can improve WM and performance of executive functions. Method: Sixty children with attention deficit hyperactivity disorder (ADHD) aged 8.5 to 11.2 years (35 boys), using no stimulant medication were selected. We randomly assigned 30 participants to the experimental group and provided them with WM training. The training was in the form of structured games and was offered to the participants in two 60-minute sessions weekly for 12 weeks. Other participants were assigned to the control group, receiving no treatment. All the participants were also evaluated at follow-up 6 months later. The main measures were the Child Behavior Checklist (CBCL), the Digit Span and Symbol Search B subscale of the Wechsler Intelligence Scale for Children (WISC-IV); and scores of dictation and mathematics were used in terms of pre and post-test. Results: The results of the t-test revealed a significant improvement in the post-test measures as well as a significant reduction of parents' reports of inattentiveness, and improvement in academic performance in the experimental group. However, no significant changes were found in the control group. Conclusion : The academic and working memory improvements were primarily due to the training method of WM. Our findings suggest that the training method of WM in the form of structured games may be a practical method for treating children with ADHD, but it needs to be further investigated.