WorldWideScience

Sample records for protein-small molecule binding

  1. Detection of protein-small molecule binding using a self-referencing external cavity laser biosensor.

    Science.gov (United States)

    Meng Zhang; Peh, Jessie; Hergenrother, Paul J; Cunningham, Brian T

    2014-01-01

    High throughput screening of protein-small molecule binding interactions using label-free optical biosensors is challenging, as the detected signals are often similar in magnitude to experimental noise. Here, we describe a novel self-referencing external cavity laser (ECL) biosensor approach that achieves high resolution and high sensitivity, while eliminating thermal noise with sub-picometer wavelength accuracy. Using the self-referencing ECL biosensor, we demonstrate detection of binding between small molecules and a variety of immobilized protein targets with binding affinities or inhibition constants in the sub-nanomolar to low micromolar range. The demonstrated ability to perform detection in the presence of several interfering compounds opens the potential for increasing the throughput of the approach. As an example application, we performed a "needle-in-the-haystack" screen for inhibitors against carbonic anhydrase isozyme II (CA II), in which known inhibitors are clearly differentiated from inactive molecules within a compound library.

  2. Antidiabetic effects of glucokinase regulatory protein small-molecule disruptors

    Science.gov (United States)

    Lloyd, David J.; St Jean, David J.; Kurzeja, Robert J. M.; Wahl, Robert C.; Michelsen, Klaus; Cupples, Rod; Chen, Michelle; Wu, John; Sivits, Glenn; Helmering, Joan; Komorowski, Renée; Ashton, Kate S.; Pennington, Lewis D.; Fotsch, Christopher; Vazir, Mukta; Chen, Kui; Chmait, Samer; Zhang, Jiandong; Liu, Longbin; Norman, Mark H.; Andrews, Kristin L.; Bartberger, Michael D.; van, Gwyneth; Galbreath, Elizabeth J.; Vonderfecht, Steven L.; Wang, Minghan; Jordan, Steven R.; Véniant, Murielle M.; Hale, Clarence

    2013-12-01

    Glucose homeostasis is a vital and complex process, and its disruption can cause hyperglycaemia and type II diabetes mellitus. Glucokinase (GK), a key enzyme that regulates glucose homeostasis, converts glucose to glucose-6-phosphate in pancreatic β-cells, liver hepatocytes, specific hypothalamic neurons, and gut enterocytes. In hepatocytes, GK regulates glucose uptake and glycogen synthesis, suppresses glucose production, and is subject to the endogenous inhibitor GK regulatory protein (GKRP). During fasting, GKRP binds, inactivates and sequesters GK in the nucleus, which removes GK from the gluconeogenic process and prevents a futile cycle of glucose phosphorylation. Compounds that directly hyperactivate GK (GK activators) lower blood glucose levels and are being evaluated clinically as potential therapeutics for the treatment of type II diabetes mellitus. However, initial reports indicate that an increased risk of hypoglycaemia is associated with some GK activators. To mitigate the risk of hypoglycaemia, we sought to increase GK activity by blocking GKRP. Here we describe the identification of two potent small-molecule GK-GKRP disruptors (AMG-1694 and AMG-3969) that normalized blood glucose levels in several rodent models of diabetes. These compounds potently reversed the inhibitory effect of GKRP on GK activity and promoted GK translocation both in vitro (isolated hepatocytes) and in vivo (liver). A co-crystal structure of full-length human GKRP in complex with AMG-1694 revealed a previously unknown binding pocket in GKRP distinct from that of the phosphofructose-binding site. Furthermore, with AMG-1694 and AMG-3969 (but not GK activators), blood glucose lowering was restricted to diabetic and not normoglycaemic animals. These findings exploit a new cellular mechanism for lowering blood glucose levels with reduced potential for hypoglycaemic risk in patients with type II diabetes mellitus.

  3. Using the multi-objective optimization replica exchange Monte Carlo enhanced sampling method for protein-small molecule docking.

    Science.gov (United States)

    Wang, Hongrui; Liu, Hongwei; Cai, Leixin; Wang, Caixia; Lv, Qiang

    2017-07-10

    In this study, we extended the replica exchange Monte Carlo (REMC) sampling method to protein-small molecule docking conformational prediction using RosettaLigand. In contrast to the traditional Monte Carlo (MC) and REMC sampling methods, these methods use multi-objective optimization Pareto front information to facilitate the selection of replicas for exchange. The Pareto front information generated to select lower energy conformations as representative conformation structure replicas can facilitate the convergence of the available conformational space, including available near-native structures. Furthermore, our approach directly provides min-min scenario Pareto optimal solutions, as well as a hybrid of the min-min and max-min scenario Pareto optimal solutions with lower energy conformations for use as structure templates in the REMC sampling method. These methods were validated based on a thorough analysis of a benchmark data set containing 16 benchmark test cases. An in-depth comparison between MC, REMC, multi-objective optimization-REMC (MO-REMC), and hybrid MO-REMC (HMO-REMC) sampling methods was performed to illustrate the differences between the four conformational search strategies. Our findings demonstrate that the MO-REMC and HMO-REMC conformational sampling methods are powerful approaches for obtaining protein-small molecule docking conformational predictions based on the binding energy of complexes in RosettaLigand.

  4. Domain-based small molecule binding site annotation

    Directory of Open Access Journals (Sweden)

    Dumontier Michel

    2006-03-01

    Full Text Available Abstract Background Accurate small molecule binding site information for a protein can facilitate studies in drug docking, drug discovery and function prediction, but small molecule binding site protein sequence annotation is sparse. The Small Molecule Interaction Database (SMID, a database of protein domain-small molecule interactions, was created using structural data from the Protein Data Bank (PDB. More importantly it provides a means to predict small molecule binding sites on proteins with a known or unknown structure and unlike prior approaches, removes large numbers of false positive hits arising from transitive alignment errors, non-biologically significant small molecules and crystallographic conditions that overpredict ion binding sites. Description Using a set of co-crystallized protein-small molecule structures as a starting point, SMID interactions were generated by identifying protein domains that bind to small molecules, using NCBI's Reverse Position Specific BLAST (RPS-BLAST algorithm. SMID records are available for viewing at http://smid.blueprint.org. The SMID-BLAST tool provides accurate transitive annotation of small-molecule binding sites for proteins not found in the PDB. Given a protein sequence, SMID-BLAST identifies domains using RPS-BLAST and then lists potential small molecule ligands based on SMID records, as well as their aligned binding sites. A heuristic ligand score is calculated based on E-value, ligand residue identity and domain entropy to assign a level of confidence to hits found. SMID-BLAST predictions were validated against a set of 793 experimental small molecule interactions from the PDB, of which 472 (60% of predicted interactions identically matched the experimental small molecule and of these, 344 had greater than 80% of the binding site residues correctly identified. Further, we estimate that 45% of predictions which were not observed in the PDB validation set may be true positives. Conclusion By

  5. Analysis of experimental positron-molecule binding energies

    International Nuclear Information System (INIS)

    Danielson, J R; Surko, C M; Young, J A

    2010-01-01

    Experiments show that positron annihilation on molecules frequently occurs via capture into vibrational Feshbach resonances. In these cases, the downshifts in the annihilation spectra from the vibrational mode spectra provide measures of the positron-molecule binding energies. An analysis of these binding energy data is presented in terms of the molecular dipole polarizability, the permanent dipole moment, and the number of π bonds in aromatic molecules. The results of this analysis are in reasonably good agreement with other information about positron-molecule bound states. Predictions for other targets and promising candidate molecules for further investigation are discussed.

  6. Global analysis of small molecule binding to related protein targets.

    Directory of Open Access Journals (Sweden)

    Felix A Kruger

    2012-01-01

    Full Text Available We report on the integration of pharmacological data and homology information for a large scale analysis of small molecule binding to related targets. Differences in small molecule binding have been assessed for curated pairs of human to rat orthologs and also for recently diverged human paralogs. Our analysis shows that in general, small molecule binding is conserved for pairs of human to rat orthologs. Using statistical tests, we identified a small number of cases where small molecule binding is different between human and rat, some of which had previously been reported in the literature. Knowledge of species specific pharmacology can be advantageous for drug discovery, where rats are frequently used as a model system. For human paralogs, we demonstrate a global correlation between sequence identity and the binding of small molecules with equivalent affinity. Our findings provide an initial general model relating small molecule binding and sequence divergence, containing the foundations for a general model to anticipate and predict within-target-family selectivity.

  7. Dielectric response of molecules in empirical tight-binding theory

    Science.gov (United States)

    Boykin, Timothy B.; Vogl, P.

    2002-01-01

    In this paper we generalize our previous approach to electromagnetic interactions within empirical tight-binding theory to encompass molecular solids and isolated molecules. In order to guarantee physically meaningful results, we rederive the expressions for relevant observables using commutation relations appropriate to the finite tight-binding Hilbert space. In carrying out this generalization, we examine in detail the consequences of various prescriptions for the position and momentum operators in tight binding. We show that attempting to fit parameters of the momentum matrix directly generally results in a momentum operator which is incompatible with the underlying tight-binding model, while adding extra position parameters results in numerous difficulties, including the loss of gauge invariance. We have applied our scheme, which we term the Peierls-coupling tight-binding method, to the optical dielectric function of the molecular solid PPP, showing that this approach successfully predicts its known optical properties even in the limit of isolated molecules.

  8. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications

    Directory of Open Access Journals (Sweden)

    Annamaria eRuscito

    2016-05-01

    Full Text Available Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then applied in aptamer-based biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is ultimately needed for the protection and wellbeing of humans and animals. However, issues such as the drastic difference in size of the aptamer and small molecule make it challenging to select, characterize, and apply aptamers for the detection of small molecules. Thus, recent (since 2012 notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed

  9. Mapping small molecule binding data to structural domains.

    Science.gov (United States)

    Kruger, Felix A; Rostom, Raghd; Overington, John P

    2012-01-01

    Large-scale bioactivity/SAR Open Data has recently become available, and this has allowed new analyses and approaches to be developed to help address the productivity and translational gaps of current drug discovery. One of the current limitations of these data is the relative sparsity of reported interactions per protein target, and complexities in establishing clear relationships between bioactivity and targets using bioinformatics tools. We detail in this paper the indexing of targets by the structural domains that bind (or are likely to bind) the ligand within a full-length protein. Specifically, we present a simple heuristic to map small molecule binding to Pfam domains. This profiling can be applied to all proteins within a genome to give some indications of the potential pharmacological modulation and regulation of all proteins. In this implementation of our heuristic, ligand binding to protein targets from the ChEMBL database was mapped to structural domains as defined by profiles contained within the Pfam-A database. Our mapping suggests that the majority of assay targets within the current version of the ChEMBL database bind ligands through a small number of highly prevalent domains, and conversely the majority of Pfam domains sampled by our data play no currently established role in ligand binding. Validation studies, carried out firstly against Uniprot entries with expert binding-site annotation and secondly against entries in the wwPDB repository of crystallographic protein structures, demonstrate that our simple heuristic maps ligand binding to the correct domain in about 90 percent of all assessed cases. Using the mappings obtained with our heuristic, we have assembled ligand sets associated with each Pfam domain. Small molecule binding has been mapped to Pfam-A domains of protein targets in the ChEMBL bioactivity database. The result of this mapping is an enriched annotation of small molecule bioactivity data and a grouping of activity classes

  10. Binding of peptides to HLA-DQ molecules: peptide binding properties of the disease-associated HLA-DQ(alpha 1*0501, beta 1*0201) molecule

    DEFF Research Database (Denmark)

    Johansen, B H; Buus, S; Vartdal, F

    1994-01-01

    Peptide binding to DQ molecules has not previously been described. Here we report a biochemical peptide-binding assay specific for the DQ2 [i.e. DQ(alpha 1*0501, beta 1*0201)] molecule. This molecule was chosen since it shows a strong association to diseases such as celiac disease and insulin...

  11. DMPD: Lipopolysaccharide-binding molecules: transporters, blockers and sensors. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 15241548 Lipopolysaccharide-binding molecules: transporters, blockers and sensors. ...binding molecules: transporters, blockers and sensors. PubmedID 15241548 Title Lipopolysaccharide-binding molecules: transport...Chaby R. Cell Mol Life Sci. 2004 Jul;61(14):1697-713. (.png) (.svg) (.html) (.csml) Show Lipopolysaccharide-

  12. Peptide binding predictions for HLA DR, DP and DQ molecules

    DEFF Research Database (Denmark)

    Wang, P.; Sidney, J.; Kim, Y.

    2010-01-01

    a significant gap in knowledge as HLA DP and DQ molecules are presumably equally important, and have only been studied less because they are more difficult to handle experimentally. RESULTS: In this study, we aimed to narrow this gap by providing a large scale dataset of over 17,000 HLA-peptide binding...... affinities for a set of 11 HLA DP and DQ alleles. We also expanded our dataset for HLA DR alleles resulting in a total of 40,000 MHC class II binding affinities covering 26 allelic variants. Utilizing this dataset, we generated prediction tools utilizing several machine learning algorithms and evaluated...... include all training data for maximum performance. 4) The recently developed NN-align prediction method significantly outperformed all other algorithms, including a naïve consensus based on all prediction methods. A new consensus method dropping the comparably weak ARB prediction method could outperform...

  13. A peptide-binding assay for the disease-associated HLA-DQ8 molecule

    DEFF Research Database (Denmark)

    Straumfors, A; Johansen, B H; Vartdal, F

    1998-01-01

    The study of peptide binding to HLA class II molecules has mostly concentrated on DR molecules. Since many autoimmune diseases show a primary association to particular DQ molecules rather than DR molecules, it is also important to study the peptide-binding properties of DQ molecules. Here we repo......-affinity binders, whereas peptides derived from myelin basic protein were among the low-affinity binders. The sequence of the high-affinity peptides conformed with a previously published peptide-binding motif of DQ8.......The study of peptide binding to HLA class II molecules has mostly concentrated on DR molecules. Since many autoimmune diseases show a primary association to particular DQ molecules rather than DR molecules, it is also important to study the peptide-binding properties of DQ molecules. Here we report...

  14. Distance between two binding sites of the same antibody molecule

    International Nuclear Information System (INIS)

    Cser, L.; Gladkikh, I.A.; Ostanevich, Y.M.; Franek, F.; Novotny, J.; Nezlin, R.S.

    1978-01-01

    Neutron small-angle scattering experiments are reported, aimed at determining the distance between the two binding sites of the same antibody molecule employing complexes of anti-Dnp antibody with an antigenically univalent, high molecular weight ligand. Although the distance values could be determined only with a large statistical error, the data allowed the conclusion that the geometrical parameters of the complexes formed with the early (i.e., precipitating) antibody are significantly different from those of the complexes formed with the late (i.e, non-precipitating) antibody. The data suggest that the precipitating antibody complexed with a high molecular weight antigen assumes an extended shape with an antigen to antigen distance of 35.8 +- 1.3 nm. (Auth.)

  15. Possible heterogeneity of centres of binding 1,8-ANS in molecules of oxygenated hemoglobin

    International Nuclear Information System (INIS)

    Parul', D.A.; Bokut', S.B.; Milyutin, A.A.; Petrov, E.P.; Nemkovich, N.A.; Sobchuk, A.N.; Dzhagarov, B.M.

    1999-01-01

    Forming of oxygenated hemoglobin is one of effects of ionizing radiation action on organism. It was revealed heterogeneity of centers of binding of 1,8-ANS in intact molecule of oxygenated hemoglobin. Two types of binding centers possible reflect the existence of two regions in protein molecule with different accessibility to molecules of water

  16. Porcine major histocompatibility complex (MHC) class I molecules and analysis of their peptide-binding specificities

    DEFF Research Database (Denmark)

    Pedersen, Lasse Eggers; Harndahl, Mikkel; Rasmussen, Michael

    2011-01-01

    a HLA-I molecule (HLA-A*11:01), thereby generating recombinant human/swine chimeric MHC-I molecules as well as the intact SLA-1*0401 molecule. Biochemical peptide-binding assays and positional scanning combinatorial peptide libraries were used to analyze the peptide-binding motifs of these molecules....... A pan-specific predictor of peptide–MHC-I binding, NetMHCpan, which was originally developed to cover the binding specificities of all known HLA-I molecules, was successfully used to predict the specificities of the SLA-1*0401 molecule as well as the porcine/human chimeric MHC-I molecules. These data......In all vertebrate animals, CD8+ cytotoxic T lymphocytes (CTLs) are controlled by major histocompatibility complex class I (MHC-I) molecules. These are highly polymorphic peptide receptors selecting and presenting endogenously derived epitopes to circulating CTLs. The polymorphism of the MHC...

  17. Single Molecule Kinetics of ENTH Binding to Lipid Membranes

    Energy Technology Data Exchange (ETDEWEB)

    Rozovsky, Sharon [Univ. of Delaware, Newark, DE (United States); Forstner, Martin B. [Syracuse Univ., NY (United States); Sondermann, Holger [Cornell Univ., Ithaca, NY (United States); Groves, Jay T. [Univ. of California, Berkeley, CA (United States); Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2012-04-03

    Transient recruitment of proteins to membranes is a fundamental mechanism by which the cell exerts spatial and temporal control over proteins’ localization and interactions. Thus, the specificity and the kinetics of peripheral proteins’ membrane residence are an attribute of their function. In this article, we describe the membrane interactions of the interfacial epsin N-terminal homology (ENTH) domain with its target lipid phosphatidylinositol (4,5)-bisphosphate (PtdIns(4,5)P2). The direct visualization and quantification of interactions of single ENTH molecules with supported lipid bilayers is achieved using total internal reflection fluorescence microscopy (TIRFM) with a time resolution of 13 ms. This enables the recording of the kinetic behavior of ENTH interacting with membranes with physiologically relevant concentrations of PtdIns(4,5)P2 despite the low effective binding affinity. Subsequent single fluorophore tracking permits us to build up distributions of residence times and to measure ENTH dissociation rates as a function of membrane composition. In addition, due to the high time resolution, we are able to resolve details of the motion of ENTH associated with a simple, homogeneous membrane. In this case ENTH’s diffusive transport appears to be the result of at least three different diffusion processes.

  18. Machine Learning Reveals a Non-Canonical Mode of Peptide Binding to MHC class II Molecules

    DEFF Research Database (Denmark)

    Andreatta, Massimo; Jurtz, Vanessa Isabell; Kaever, Thomas

    2017-01-01

    binding motif with a non-canonical binding core of length different from nine. This previously undescribed mode of peptide binding to MHCII molecules gives a more complete picture of peptide presentation by MHCII and allows us to model more accurately this event. This article is protected by copyright...

  19. DNA minor groove binding of small molecules: Experimental and ...

    Indian Academy of Sciences (India)

    Administrator

    Abstract. Eight indole derivatives were studied for their DNA binding ability using fluorescence quenching and molecular docking methods. These indole compounds have structural moieties similar as in few indole alkaloids. Experimental and theoretical studies have suggested that indole derivatives bind in the minor ...

  20. RNA targeting by small molecules: Binding of protoberberine ...

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... Studies on RNA targeting by small molecules to specifically control certain cellular functions is an .... form secondary structures such as stem-loop, hairpin, etc. ..... paired third strand of the triplex without affecting the stability.

  1. DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

    Science.gov (United States)

    Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

    2012-02-01

    We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

  2. Effect of dipole polarizability on positron binding by strongly polar molecules

    International Nuclear Information System (INIS)

    Gribakin, G F; Swann, A R

    2015-01-01

    A model for positron binding to polar molecules is considered by combining the dipole potential outside the molecule with a strongly repulsive core of a given radius. Using existing experimental data on binding energies leads to unphysically small core radii for all of the molecules studied. This suggests that electron–positron correlations neglected in the simple model play a large role in determining the binding energy. We account for these by including the polarization potential via perturbation theory and non-perturbatively. The perturbative model makes reliable predictions of binding energies for a range of polar organic molecules and hydrogen cyanide. The model also agrees with the linear dependence of the binding energies on the polarizability inferred from the experimental data (Danielson et al 2009 J. Phys. B: At. Mol. Opt. Phys. 42 235203). The effective core radii, however, remain unphysically small for most molecules. Treating molecular polarization non-perturbatively leads to physically meaningful core radii for all of the molecules studied and enables even more accurate predictions of binding energies to be made for nearly all of the molecules considered. (paper)

  3. Predicting peptides binding to MHC class II molecules using multi-objective evolutionary algorithms

    Directory of Open Access Journals (Sweden)

    Feng Lin

    2007-11-01

    Full Text Available Abstract Background Peptides binding to Major Histocompatibility Complex (MHC class II molecules are crucial for initiation and regulation of immune responses. Predicting peptides that bind to a specific MHC molecule plays an important role in determining potential candidates for vaccines. The binding groove in class II MHC is open at both ends, allowing peptides longer than 9-mer to bind. Finding the consensus motif facilitating the binding of peptides to a MHC class II molecule is difficult because of different lengths of binding peptides and varying location of 9-mer binding core. The level of difficulty increases when the molecule is promiscuous and binds to a large number of low affinity peptides. In this paper, we propose two approaches using multi-objective evolutionary algorithms (MOEA for predicting peptides binding to MHC class II molecules. One uses the information from both binders and non-binders for self-discovery of motifs. The other, in addition, uses information from experimentally determined motifs for guided-discovery of motifs. Results The proposed methods are intended for finding peptides binding to MHC class II I-Ag7 molecule – a promiscuous binder to a large number of low affinity peptides. Cross-validation results across experiments on two motifs derived for I-Ag7 datasets demonstrate better generalization abilities and accuracies of the present method over earlier approaches. Further, the proposed method was validated and compared on two publicly available benchmark datasets: (1 an ensemble of qualitative HLA-DRB1*0401 peptide data obtained from five different sources, and (2 quantitative peptide data obtained for sixteen different alleles comprising of three mouse alleles and thirteen HLA alleles. The proposed method outperformed earlier methods on most datasets, indicating that it is well suited for finding peptides binding to MHC class II molecules. Conclusion We present two MOEA-based algorithms for finding motifs

  4. Prediction of small molecule binding property of protein domains with Bayesian classifiers based on Markov chains.

    Science.gov (United States)

    Bulashevska, Alla; Stein, Martin; Jackson, David; Eils, Roland

    2009-12-01

    Accurate computational methods that can help to predict biological function of a protein from its sequence are of great interest to research biologists and pharmaceutical companies. One approach to assume the function of proteins is to predict the interactions between proteins and other molecules. In this work, we propose a machine learning method that uses a primary sequence of a domain to predict its propensity for interaction with small molecules. By curating the Pfam database with respect to the small molecule binding ability of its component domains, we have constructed a dataset of small molecule binding and non-binding domains. This dataset was then used as training set to learn a Bayesian classifier, which should distinguish members of each class. The domain sequences of both classes are modelled with Markov chains. In a Jack-knife test, our classification procedure achieved the predictive accuracies of 77.2% and 66.7% for binding and non-binding classes respectively. We demonstrate the applicability of our classifier by using it to identify previously unknown small molecule binding domains. Our predictions are available as supplementary material and can provide very useful information to drug discovery specialists. Given the ubiquitous and essential role small molecules play in biological processes, our method is important for identifying pharmaceutically relevant components of complete proteomes. The software is available from the author upon request.

  5. Characterization of binding specificities of bovine leucocyte class I molecules: impacts for rational epitope discovery

    DEFF Research Database (Denmark)

    Hansen, Andreas M.; Rasmussen, Michael; Svitek, Nicholas

    2014-01-01

    confirmed experimentally. This study demonstrates how biochemical high-throughput assays combined with immunoinformatics can be used to characterize the peptide-binding motifs of BoLA-I molecules, boosting performance of MHC peptide-binding prediction methods, and empowering rational epitope discovery...

  6. Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression.

    Science.gov (United States)

    Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S

    2016-01-15

    The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small

  7. MHC class II-derived peptides can bind to class II molecules, including self molecules, and prevent antigen presentation

    DEFF Research Database (Denmark)

    Rosloniec, E F; Vitez, L J; Buus, S

    1990-01-01

    the alpha k-3 peptide binds slightly less well. These combined data, suggesting that class II-derived peptides can bind to MHC class II molecules, including the autologous molecule from which they are derived, have important implications for the molecular basis of alloreactivity and autoreactivity. Further...... found in the first and third polymorphic regions (PMR) of the A alpha k chain (alpha k-1 and alpha k-3) were capable of inhibiting the presentation of three different HEL-derived peptide antigens to their appropriate T cells. In addition, the alpha k-1 peptide inhibited the presentation of the OVA(323......-339) immunodominant peptide to the I-Ad-restricted T cell hybridomas specific for it. Prepulsing experiments demonstrated that the PMR peptides were interacting with the APC and not with the T cell hybridomas. These observations were confirmed and extended by the demonstration that the alpha k-1 and alpha k-3...

  8. High-affinity binding of two molecules of cysteine proteinases to low-molecular-weight kininogen.

    Science.gov (United States)

    Turk, B.; Stoka, V.; Björk, I.; Boudier, C.; Johansson, G.; Dolenc, I.; Colic, A.; Bieth, J. G.; Turk, V.

    1995-01-01

    Human low-molecular-weight kininogen (LK) was shown by fluorescence titration to bind two molecules of cathepsins L and S and papain with high affinity. By contrast, binding of a second molecule of cathepsin H was much weaker. The 2:1 binding stoichiometry was confirmed by titration monitored by loss of enzyme activity and by sedimentation velocity experiments. The kinetics of binding of cathepsins L and S and papain showed the two proteinase binding sites to have association rate constants kass,1 = 10.7-24.5 x 10(6) M-1 s-1 and kass,2 = 0.83-1.4 x 10(6) M-1 s-1. Comparison of these kinetic constants with previous data for intact LK and its separated domains indicate that the faster-binding site is also the tighter-binding site and is present on domain 3, whereas the slower-binding, lower-affinity site is on domain 2. These results also indicate that there is no appreciable steric hindrance for the binding of proteinases between the two binding sites or from the kininogen light chain. PMID:8528085

  9. Minor-Groove Binding Drugs: Where Is the Second Hoechst 33258 Molecule?

    KAUST Repository

    Fornander, Louise H.

    2013-05-16

    Hoechst 33258 binds with high affinity into the minor groove of AT-rich sequences of double-helical DNA. Despite extensive studies of this and analogous DNA binding molecules, there still remains uncertainty concerning the interactions when multiple ligand molecules are accommodated within close distance. Albeit not of direct concern for most biomedical applications, which are at low drug concentrations, interaction studies for higher drug binding are important as they can give fundamental insight into binding mechanisms and specificity, including drug self-stacking interactions that can provide base-sequence specificity. Using circular dichroism (CD), isothermal titration calorimetry (ITC), and proton nuclear magnetic resonance (1H NMR), we examine the binding of Hoechst 33258 to three oligonucleotide duplexes containing AT regions of different lengths: [d(CGCGAATTCGCG)]2 (A2T2), [d(CGCAAATTTGCG)]2 (A3T 3), and [d(CGAAAATTTTCG)]2 (A4T4). We find similar binding geometries in the minor groove for all oligonucleotides when the ligand-to-duplex ratio is less than 1:1. At higher ratios, a second ligand can be accommodated in the minor groove of A4T4 but not A2T2 or A3T3. We conclude that the binding of the second Hoechst to A4T4 is not cooperative and that the molecules are sitting with a small separation apart, one after the other, and not in a sandwich structure as previously proposed. © 2013 American Chemical Society.

  10. Minor-Groove Binding Drugs: Where Is the Second Hoechst 33258 Molecule?

    KAUST Repository

    Fornander, Louise H.; Wu, Lisha; Billeter, Martin; Lincoln, Per; Nordé n, Bengt

    2013-01-01

    Hoechst 33258 binds with high affinity into the minor groove of AT-rich sequences of double-helical DNA. Despite extensive studies of this and analogous DNA binding molecules, there still remains uncertainty concerning the interactions when multiple ligand molecules are accommodated within close distance. Albeit not of direct concern for most biomedical applications, which are at low drug concentrations, interaction studies for higher drug binding are important as they can give fundamental insight into binding mechanisms and specificity, including drug self-stacking interactions that can provide base-sequence specificity. Using circular dichroism (CD), isothermal titration calorimetry (ITC), and proton nuclear magnetic resonance (1H NMR), we examine the binding of Hoechst 33258 to three oligonucleotide duplexes containing AT regions of different lengths: [d(CGCGAATTCGCG)]2 (A2T2), [d(CGCAAATTTGCG)]2 (A3T 3), and [d(CGAAAATTTTCG)]2 (A4T4). We find similar binding geometries in the minor groove for all oligonucleotides when the ligand-to-duplex ratio is less than 1:1. At higher ratios, a second ligand can be accommodated in the minor groove of A4T4 but not A2T2 or A3T3. We conclude that the binding of the second Hoechst to A4T4 is not cooperative and that the molecules are sitting with a small separation apart, one after the other, and not in a sandwich structure as previously proposed. © 2013 American Chemical Society.

  11. An in silico analysis of the binding modes and binding affinities of small molecule modulators of PDZ-peptide interactions.

    Directory of Open Access Journals (Sweden)

    Garima Tiwari

    Full Text Available Inhibitors of PDZ-peptide interactions have important implications in a variety of biological processes including treatment of cancer and Parkinson's disease. Even though experimental studies have reported characterization of peptidomimetic inhibitors of PDZ-peptide interactions, the binding modes for most of them have not been characterized by structural studies. In this study we have attempted to understand the structural basis of the small molecule-PDZ interactions by in silico analysis of the binding modes and binding affinities of a set of 38 small molecules with known K(i or K(d values for PDZ2 and PDZ3 domains of PSD-95 protein. These two PDZ domains show differential selectivity for these compounds despite having a high degree of sequence similarity and almost identical peptide binding pockets. Optimum binding modes for these ligands for PDZ2 and PDZ3 domains were identified by using a novel combination of semi-flexible docking and explicit solvent molecular dynamics (MD simulations. Analysis of the binding modes revealed most of the peptidomimectic ligands which had high K(i or K(d moved away from the peptide binding pocket, while ligands with high binding affinities remained in the peptide binding pocket. The differential specificities of the PDZ2 and PDZ3 domains primarily arise from differences in the conformation of the loop connecting βB and βC strands, because this loop interacts with the N-terminal chemical moieties of the ligands. We have also computed the MM/PBSA binding free energy values for these 38 compounds with both the PDZ domains from multiple 5 ns MD trajectories on each complex i.e. a total of 228 MD trajectories of 5 ns length each. Interestingly, computational binding free energies show good agreement with experimental binding free energies with a correlation coefficient of approximately 0.6. Thus our study demonstrates that combined use of docking and MD simulations can help in identification of potent inhibitors

  12. Functional recombinant MHC class II molecules and high-throughput peptide-binding assays

    DEFF Research Database (Denmark)

    Justesen, Sune; Harndahl, Mikkel; Lamberth, Kasper

    2009-01-01

    BACKGROUND: Molecules of the class II major histocompability complex (MHC-II) specifically bind and present exogenously derived peptide epitopes to CD4+ T helper cells. The extreme polymorphism of the MHC-II hampers the complete analysis of peptide binding. It is also a significant hurdle......-II molecules and accompanying HTS peptide-binding assay were successfully developed for nine different MHC-II molecules including the DPA1*0103/DPB1*0401 (DP401) and DQA1*0501/DQB1*0201, where both alpha and beta chains are polymorphic, illustrating the advantages of producing the two chains separately....... CONCLUSION: We have successfully developed versatile MHC-II resources, which may assist in the generation of MHC class II -wide reagents, data, and tools....

  13. Simple molecular model for the binding of antibiotic molecules to bacterial ion channels

    Science.gov (United States)

    Mafé, Salvador; Ramírez, Patricio; Alcaraz, Antonio

    2003-10-01

    A molecular model aimed at explaining recent experimental data by Nestorovich et al. [Proc. Natl. Acad. Sci. USA 99, 9789 (2002)] on the interaction of ampicillin molecules with the constriction zone in a channel of the general bacterial porin, OmpF (outer membrane protein F), is presented. The model extends T. L. Hill's theory for intermolecular interactions in a pair of binding sites [J. Am. Chem. Soc. 78, 3330 (1956)] by incorporating two binding ions and two pairs of interacting sites. The results provide new physical insights on the role of the complementary pattern of the charge distributions in the ampicillin molecule and the narrowest part of the channel pore. Charge matching of interacting sites facilitates drug binding. The dependence of the number of ampicillin binding events per second with the solution pH and salt concentration is explained qualitatively using a reduced number of fundamental concepts.

  14. Rapid and accurate prediction and scoring of water molecules in protein binding sites.

    Directory of Open Access Journals (Sweden)

    Gregory A Ross

    Full Text Available Water plays a critical role in ligand-protein interactions. However, it is still challenging to predict accurately not only where water molecules prefer to bind, but also which of those water molecules might be displaceable. The latter is often seen as a route to optimizing affinity of potential drug candidates. Using a protocol we call WaterDock, we show that the freely available AutoDock Vina tool can be used to predict accurately the binding sites of water molecules. WaterDock was validated using data from X-ray crystallography, neutron diffraction and molecular dynamics simulations and correctly predicted 97% of the water molecules in the test set. In addition, we combined data-mining, heuristic and machine learning techniques to develop probabilistic water molecule classifiers. When applied to WaterDock predictions in the Astex Diverse Set of protein ligand complexes, we could identify whether a water molecule was conserved or displaced to an accuracy of 75%. A second model predicted whether water molecules were displaced by polar groups or by non-polar groups to an accuracy of 80%. These results should prove useful for anyone wishing to undertake rational design of new compounds where the displacement of water molecules is being considered as a route to improved affinity.

  15. MHC2NNZ: A novel peptide binding prediction approach for HLA DQ molecules

    Science.gov (United States)

    Xie, Jiang; Zeng, Xu; Lu, Dongfang; Liu, Zhixiang; Wang, Jiao

    2017-07-01

    The major histocompatibility complex class II (MHC-II) molecule plays a crucial role in immunology. Computational prediction of MHC-II binding peptides can help researchers understand the mechanism of immune systems and design vaccines. Most of the prediction algorithms for MHC-II to date have made large efforts in human leukocyte antigen (HLA, the name of MHC in Human) molecules encoded in the DR locus. However, HLA DQ molecules are equally important and have only been made less progress because it is more difficult to handle them experimentally. In this study, we propose an artificial neural network-based approach called MHC2NNZ to predict peptides binding to HLA DQ molecules. Unlike previous artificial neural network-based methods, MHC2NNZ not only considers sequence similarity features but also captures the chemical and physical properties, and a novel method incorporating these properties is proposed to represent peptide flanking regions (PFR). Furthermore, MHC2NNZ improves the prediction accuracy by combining with amino acid preference at more specific positions of the peptides binding core. By evaluating on 3549 peptides binding to six most frequent HLA DQ molecules, MHC2NNZ is demonstrated to outperform other state-of-the-art MHC-II prediction methods.

  16. Resolving dual binding conformations of cellulosome cohesin-dockerin complexes using single-molecule force spectroscopy.

    Science.gov (United States)

    Jobst, Markus A; Milles, Lukas F; Schoeler, Constantin; Ott, Wolfgang; Fried, Daniel B; Bayer, Edward A; Gaub, Hermann E; Nash, Michael A

    2015-10-31

    Receptor-ligand pairs are ordinarily thought to interact through a lock and key mechanism, where a unique molecular conformation is formed upon binding. Contrary to this paradigm, cellulosomal cohesin-dockerin (Coh-Doc) pairs are believed to interact through redundant dual binding modes consisting of two distinct conformations. Here, we combined site-directed mutagenesis and single-molecule force spectroscopy (SMFS) to study the unbinding of Coh:Doc complexes under force. We designed Doc mutations to knock out each binding mode, and compared their single-molecule unfolding patterns as they were dissociated from Coh using an atomic force microscope (AFM) cantilever. Although average bulk measurements were unable to resolve the differences in Doc binding modes due to the similarity of the interactions, with a single-molecule method we were able to discriminate the two modes based on distinct differences in their mechanical properties. We conclude that under native conditions wild-type Doc from Clostridium thermocellum exocellulase Cel48S populates both binding modes with similar probabilities. Given the vast number of Doc domains with predicted dual binding modes across multiple bacterial species, our approach opens up new possibilities for understanding assembly and catalytic properties of a broad range of multi-enzyme complexes.

  17. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    Science.gov (United States)

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  18. High-affinity small molecule-phospholipid complex formation: binding of siramesine to phosphatidicacid

    DEFF Research Database (Denmark)

    Khandelia, Himanshu

    2008-01-01

    , comparable to the affinities for the binding of small molecule ligands to proteins, was measured for phosphatidic acid (PA, mole fraction of XPA ) 0.2 in phosphatidylcholine vesicles), yielding a molecular partition coefficient of 240 ( 80 × 106. An MD simulation on the siramesine:PA interaction...

  19. Interleukin 1-induced down-regulation of antibody binding to CD4 molecules on human lymphocytes

    DEFF Research Database (Denmark)

    Tvede, N; Christensen, L D; Ødum, Niels

    1988-01-01

    Interleukin 1 (IL-1) is involved in the early activation of T lymphocytes. The CD4 antigen, described as a phenotypic marker of helper T cells, is also important in early T-cell activation by its ability to bind to MHC class II molecules on antigen-presenting cells, and to transmit positive (and...

  20. Binding of neutral molecules by p-nitrophenylureido substituted calix[4]arenes

    Czech Academy of Sciences Publication Activity Database

    Cuřínová, P.; Pojarová, M.; Budka, J.; Lang, Kamil; Stibor, I.; Lhoták, P.

    2010-01-01

    Roč. 66, č. 40 (2010), s. 8047-8050 ISSN 0040-4020 R&D Projects: GA ČR GA203/09/0691 Institutional research plan: CEZ:AV0Z40320502 Keywords : calixarene * recognition * neutral molecules binding * X-ray crystallography Subject RIV: CA - Inorganic Chemistry Impact factor: 3.011, year: 2010

  1. Specific binding of large aggregates of amphiphilic molecules to the respective antibodies.

    Science.gov (United States)

    Nabok, Alexei; Tsargorodskaya, Anna; Holloway, Alan; Starodub, Nikolay F; Demchenko, Anna

    2007-07-31

    The Binding of nonylphenol to respective antibodies immobilized on solid substrates was studied with the methods of total internal reflection ellipsometry (TIRE) and QCM (quartz crystal microbalance) impedance spectroscopy. The binding reaction was proved to be highly specific having an association constant of KA=1.6x10(6) mol(-1) L and resulted in an increase in both the adsorbed layer thickness of 23 nm and the added mass of 18.3 microg/cm2 at saturation. The obtained responses of both TIRE and QCM methods are substantially higher than anticipated for the immune binding of single molecules of nonylphenol. The mechanism of binding of large aggregates of nonylphenol was suggested instead. Modeling of the micelle of amphiphilic nonylphenol molecules in aqueous solutions yielded a micelle size of about 38 nm. The mechanism of binding of large molecular aggregates to respective antibodies can be extended to other hydrophobic low-molecular-weight toxins such as T-2 mycotoxin. The formation of large molecular aggregates of nonylphenol and T-2 mycotoxin molecules on the surface was proved by the AFM study.

  2. Peptide Binding to HLA Class I Molecules: Homogenous, High-Throughput Screening, and Affinity Assays

    DEFF Research Database (Denmark)

    Harndahl, Mikkel; Justesen, Sune Frederik Lamdahl; Lamberth, Kasper

    2009-01-01

    , better signal-to-background ratios, and a higher capacity. They also describe an efficient approach to screen peptides for binding to HLA molecules. For the occasional user, this will serve as a robust, simple peptide-HLA binding assay. For the more dedicated user, it can easily be performed in a high-throughput...... the luminescent oxygen channeling immunoassay technology (abbreviated LOCI and commercialized as AlphaScreen (TM)). Compared with an enzyme-linked immunosorbent assay-based peptide-HLA class I binding assay, the LOCI assay yields virtually identical affinity measurements, although having a broader dynamic range...... screening mode using standard liquid handling robotics and 384-well plates. We have successfully applied this assay to more than 60 different HLA molecules, leading to more than 2 million measurements. (Journal of Biomolecular Screening 2009: 173-180)...

  3. Identification of potential small molecule binding pockets on Rho family GTPases.

    Directory of Open Access Journals (Sweden)

    Juan Manuel Ortiz-Sanchez

    Full Text Available Rho GTPases are conformational switches that control a wide variety of signaling pathways critical for eukaryotic cell development and proliferation. They represent attractive targets for drug design as their aberrant function and deregulated activity is associated with many human diseases including cancer. Extensive high-resolution structures (>100 and recent mutagenesis studies have laid the foundation for the design of new structure-based chemotherapeutic strategies. Although the inhibition of Rho signaling with drug-like compounds is an active area of current research, very little attention has been devoted to directly inhibiting Rho by targeting potential allosteric non-nucleotide binding sites. By avoiding the nucleotide binding site, compounds may minimize the potential for undesirable off-target interactions with other ubiquitous GTP and ATP binding proteins. Here we describe the application of molecular dynamics simulations, principal component analysis, sequence conservation analysis, and ensemble small-molecule fragment mapping to provide an extensive mapping of potential small-molecule binding pockets on Rho family members. Characterized sites include novel pockets in the vicinity of the conformationaly responsive switch regions as well as distal sites that appear to be related to the conformations of the nucleotide binding region. Furthermore the use of accelerated molecular dynamics simulation, an advanced sampling method that extends the accessible time-scale of conventional simulations, is found to enhance the characterization of novel binding sites when conformational changes are important for the protein mechanism.

  4. Faradaic Impedance Spectroscopy for Detection of Small Molecules Binding using the Avidin-Biotin Model

    International Nuclear Information System (INIS)

    Yoetz-Kopelman, Tal; Ram, Yaron; Freeman, Amihay; Shacham-Diamand, Yosi

    2015-01-01

    The changes in the Faradaic impedance of gold/biomolecules system due to specific binding of small molecule to a significantly larger binding protein molecule were investigated. The biotin (244.31 Da) - avidin (66000 Da) couple was used as a model for small ligand - binding protein biorecognition. The study was carried out under open circuit potential in the presence of [Fe(CN) 6 ] −3/−4 redox couple. An equivalent electrical circuit was proposed and used for the interpretation of the recorded impedance spectra. Adsorption of thiolated avidin increased the electron transfer resistance, R ct , by a factor of about 7.5 while subsequent addition of biotin within the concentration range of 4.1-40.9 nM reduced the value of R ct by amount proportional to the biotin concentration. The addition of biotin did not affect, however, the equivalent double layer capacitance or other equivalent circuit parameters. A simple model based on effective surface coverage by the avidin molecules and the effect of the added biotin on electron transfer through the coated surface is proposed. A model for the minimum detection limit based on the random distribution of the binding protein and its dimensions is proposed

  5. Distribution of binding energies of a water molecule in the water liquid-vapor interface

    Energy Technology Data Exchange (ETDEWEB)

    Chempath, Shaji [Los Alamos National Laboratory; Pratt, Lawrence R [TULANE UNIV

    2008-01-01

    Distributions of binding energies of a water molecule in the water liquid-vapor interface are obtained on the basis of molecular simulation with the SPC/E model of water. These binding energies together with the observed interfacial density profile are used to test a minimally conditioned Gaussian quasi-chemical statistical thermodynamic theory. Binding energy distributions for water molecules in that interfacial region clearly exhibit a composite structure. A minimally conditioned Gaussian quasi-chemical model that is accurate for the free energy of bulk liquid water breaks down for water molecules in the liquid-vapor interfacial region. This breakdown is associated with the fact that this minimally conditioned Gaussian model would be inaccurate for the statistical thermodynamics of a dilute gas. Aggressive conditioning greatly improves the performance of that Gaussian quasi-chemical model. The analogy between the Gaussian quasi-chemical model and dielectric models of hydration free energies suggests that naive dielectric models without the conditioning features of quasi-chemical theory will be unreliable for these interfacial problems. Multi-Gaussian models that address the composite nature of the binding energy distributions observed in the interfacial region might provide a mechanism for correcting dielectric models for practical applications.

  6. First-principles Hubbard U approach for small molecule binding in metal-organic frameworks

    Energy Technology Data Exchange (ETDEWEB)

    Mann, Gregory W., E-mail: gmann@berkeley.edu [Department of Chemistry, University of California, Berkeley, California 94720 (United States); Mesosphere, Inc., San Francisco, California 94105 (United States); Lee, Kyuho, E-mail: kyuholee@lbl.gov [Department of Chemical and Biomolecular Engineering, University of California, Berkeley, California 94720 (United States); Molecular Foundry, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Synopsys, Inc., Mountain View, California 94043 (United States); Cococcioni, Matteo, E-mail: matteo.cococcioni@epfl.ch [Theory and Simulation of Materials (THEOS), École Polytechnique Fédérale de Lausanne, Lausanne (Switzerland); Smit, Berend, E-mail: Berend-Smit@berkeley.edu [Department of Chemistry, University of California, Berkeley, California 94720 (United States); Department of Chemical and Biomolecular Engineering, University of California, Berkeley, California 94720 (United States); Laboratory of Molecular Simulation, Institut des Sciences et Ingénierie Chimiques, Valais Ecole Polytechnique Fédérale de Lausanne (EPFL), Rue de l’Industrie 17, CH-1951 Sion (Switzerland); Neaton, Jeffrey B., E-mail: jbneaton@lbl.gov [Molecular Foundry, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Department of Physics, University of California, Berkeley, California 94720 (United States); Kavli Energy NanoSciences Institute at Berkeley, Berkeley, California 94720 (United States)

    2016-05-07

    We apply first-principles approaches with Hubbard U corrections for calculation of small molecule binding energetics to open-shell transition metal atoms in metal-organic frameworks (MOFs). Using density functional theory with van der Waals dispersion-corrected functionals, we determine Hubbard U values ab initio through an established linear response procedure for M-MOF-74, for a number of different metal centers (M = Ti, V, Cr, Mn, Fe, Co, Ni, and Cu). While our ab initio U values differ from those used in previous work, we show that they result in lattice parameters and electronic contributions to CO{sub 2}-MOF binding energies that lead to excellent agreement with experiments and previous results, yielding lattice parameters within 3%. In addition, U-dependent calculations for an example system, Co-MOF-74, suggest that the CO{sub 2} binding energy grows monotonically with the value of Hubbard U, with the binding energy shifting 4 kJ/mol (or 0.041 eV) over the range of U = 0-5.4 eV. These results provide insight into an approximate but computationally efficient means for calculation of small molecule binding energies to open-shell transition metal atoms in MOFs and suggest that the approach can be predictive with good accuracy, independent of the cations used and the availability of experimental data.

  7. First-principles Hubbard U approach for small molecule binding in metal-organic frameworks

    International Nuclear Information System (INIS)

    Mann, Gregory W.; Lee, Kyuho; Cococcioni, Matteo; Smit, Berend; Neaton, Jeffrey B.

    2016-01-01

    We apply first-principles approaches with Hubbard U corrections for calculation of small molecule binding energetics to open-shell transition metal atoms in metal-organic frameworks (MOFs). Using density functional theory with van der Waals dispersion-corrected functionals, we determine Hubbard U values ab initio through an established linear response procedure for M-MOF-74, for a number of different metal centers (M = Ti, V, Cr, Mn, Fe, Co, Ni, and Cu). While our ab initio U values differ from those used in previous work, we show that they result in lattice parameters and electronic contributions to CO 2 -MOF binding energies that lead to excellent agreement with experiments and previous results, yielding lattice parameters within 3%. In addition, U-dependent calculations for an example system, Co-MOF-74, suggest that the CO 2 binding energy grows monotonically with the value of Hubbard U, with the binding energy shifting 4 kJ/mol (or 0.041 eV) over the range of U = 0-5.4 eV. These results provide insight into an approximate but computationally efficient means for calculation of small molecule binding energies to open-shell transition metal atoms in MOFs and suggest that the approach can be predictive with good accuracy, independent of the cations used and the availability of experimental data.

  8. Investigation of gas molecules adsorption on carbon nano tubes electric properties in tight binding model

    International Nuclear Information System (INIS)

    Moradian, R.; Mohammadi, Y.

    2007-01-01

    Based on tight binding model we investigated effects of bi-atomic molecules gas(in the general form denoted by X 2 )on single-walled carbon nano tubes electronic properties. We found for some specified values of hopping integrals and random on-site energies, adsorbed molecules bound states located inside of the (10,0) single-walled carbon nano tubes energy gap, where it is similar to the reported experimental results for O 2 adsorption while for other values there is no bound states inside of energy gap. This is similar to the N 2 adsorption on semiconductor single-walled carbon nano tubes.

  9. The Single-Molecule Centroid Localization Algorithm Improves the Accuracy of Fluorescence Binding Assays.

    Science.gov (United States)

    Hua, Boyang; Wang, Yanbo; Park, Seongjin; Han, Kyu Young; Singh, Digvijay; Kim, Jin H; Cheng, Wei; Ha, Taekjip

    2018-03-13

    Here, we demonstrate that the use of the single-molecule centroid localization algorithm can improve the accuracy of fluorescence binding assays. Two major artifacts in this type of assay, i.e., nonspecific binding events and optically overlapping receptors, can be detected and corrected during analysis. The effectiveness of our method was confirmed by measuring two weak biomolecular interactions, the interaction between the B1 domain of streptococcal protein G and immunoglobulin G and the interaction between double-stranded DNA and the Cas9-RNA complex with limited sequence matches. This analysis routine requires little modification to common experimental protocols, making it readily applicable to existing data and future experiments.

  10. Identification of residues in the insulin molecule important for binding to insulin-degrading enzyme

    International Nuclear Information System (INIS)

    Affholter, J.A.; Roth, R.A.; Cascieri, M.A.; Bayne, M.L.; Brange, J.; Casaretto, M.

    1990-01-01

    Insulin-degrading enzyme (IDE) hydrolyzes insulin at a limited number of sites. Although the positions of these cleavages are known, the residues of insulin important in its binding to IDE have not been defined. To this end, the authors have studied the binding of a variety of insulin analogues to the protease in a solid-phase binding assay using immunoimmobilized IDE. Since IDE binds insulin with 600-fold greater affinity than it does insulin-like growth factor, the first set of analogues studied were hybrid molecules of insulin and IGF I. Removal of the eight amino acid D-chain region of IGF I (which has been predicted to interfere with binding to the 23-25 region) results in a 25-fold increase in affinity for IDE, confirming the importance of residues 23-25 in the high-affinity recognition of IDE. A similar role for the corresponding (B24-26) residues of insulin is supported by the use of site-directed mutant and semisynthetic insulin analogues. Insulin mutants [B25-Asp]insulin and [B25-His]insulin display 16- and 20-fold decreases in IDE affinity versus wild-type insulin. Similar decreases in affinity are observed with the C-terminal truncation mutants [B1-24-His 25 -NH 2 ]insulin and [B1-24-Leu 25 -NH 2 ]insulin, but not [B1-24-Trp 25 -NH 2 ]insulin and [B1-24-Tyr 25 -NH 2 ]insulin. The truncated analogue with the lowest affinity for IDE ([B1-24-His 25 -NH 2 ]insulin) has one of the highest affinities for the insulin receptor. Therefore, they have identified a region of the insulin molecule responsible for its high-affinity interaction with IDE. Although the same region has been implicated in the binding of insulin to its receptor, the data suggest that the structural determinants required for binding to receptor and IDE differ

  11. Microassay for measurement of binding of radiolabelled ligands to cell surface molecules

    International Nuclear Information System (INIS)

    Woof, J.M.; Burton, D.R.

    1988-01-01

    An improved technique for measuring the binding of radiolabelled ligands to cell surface molecules has been developed by modification of a procedure using centrifugation through a water-immiscible oil to separate free and cell-bound ligand. It maximises the percentage of ligand bound since cell-bound and free ligand can be separated easily and reproducibly even when very small reaction volumes are used. This permits low levels of ligand radiolabelling and relatively low numbers of cells to be used

  12. Improved methods for predicting peptide binding affinity to MHC class II molecules.

    Science.gov (United States)

    Jensen, Kamilla Kjaergaard; Andreatta, Massimo; Marcatili, Paolo; Buus, Søren; Greenbaum, Jason A; Yan, Zhen; Sette, Alessandro; Peters, Bjoern; Nielsen, Morten

    2018-01-06

    Major histocompatibility complex class II (MHC-II) molecules are expressed on the surface of professional antigen-presenting cells where they display peptides to T helper cells, which orchestrate the onset and outcome of many host immune responses. Understanding which peptides will be presented by the MHC-II molecule is therefore important for understanding the activation of T helper cells and can be used to identify T-cell epitopes. We here present updated versions of two MHC-II-peptide binding affinity prediction methods, NetMHCII and NetMHCIIpan. These were constructed using an extended data set of quantitative MHC-peptide binding affinity data obtained from the Immune Epitope Database covering HLA-DR, HLA-DQ, HLA-DP and H-2 mouse molecules. We show that training with this extended data set improved the performance for peptide binding predictions for both methods. Both methods are publicly available at www.cbs.dtu.dk/services/NetMHCII-2.3 and www.cbs.dtu.dk/services/NetMHCIIpan-3.2. © 2018 John Wiley & Sons Ltd.

  13. The consequences of translational and rotational entropy lost by small molecules on binding to proteins

    Science.gov (United States)

    Murray, Christopher W.; Verdonk, Marcel L.

    2002-10-01

    When a small molecule binds to a protein, it loses a significant amount of rigid body translational and rotational entropy. Estimates of the associated energy barrier vary widely in the literature yet accurate estimates are important in the interpretation of results from fragment-based drug discovery techniques. This paper describes an analysis that allows the estimation of the rigid body entropy barrier from the increase in binding affinities that results when two fragments of known affinity and known binding mode are joined together. The paper reviews the relatively rare number of examples where good quality data is available. From the analysis of this data, we estimate that the barrier to binding, due to the loss of rigid-body entropy, is 15-20 kJ/mol, i.e. around 3 orders of magnitude in affinity at 298 K. This large barrier explains why it is comparatively rare to observe multiple fragments binding to non-overlapping adjacent sites in enzymes. The barrier is also consistent with medicinal chemistry experience where small changes in the critical binding regions of ligands are often poorly tolerated by enzymes.

  14. M-ficolin, an innate immune defence molecule, binds patterns of acetyl groups and activates complement

    DEFF Research Database (Denmark)

    Frederiksen, Pernille Dorthea; Thiel, Steffen; Larsen, Claus Bindslev

    2005-01-01

    Ficolins play a role in the innate immune defence as pathogen-associated molecular pattern recognition molecules. Three ficolins are found in humans: H-ficolin, L-ficolin and M-ficolin. L-ficolin and H-ficolin circulate in blood in complexes with mannan-binding lectin-associated serine proteases...... (MASPs) and are capable of activating the complement system. L-ficolin shows affinity for acetylated compounds and binds to various capsulated strains of bacteria. H-ficolin has been shown to bind Aerococcus viridans. Less is known about M-ficolin, but it is thought to be present only on monocytes. We...... system. We developed a monoclonal rat anti-human-M/L-ficolin antibody and verified by flow cytometric analysis the presence of ficolin on the surface of peripheral blood monocytes....

  15. Three-dimensional model of a selective theophylline-binding RNA molecule

    Energy Technology Data Exchange (ETDEWEB)

    Tung, Chang-Shung; Oprea, T.I.; Hummer, G.; Garcia, A.E.

    1995-07-01

    We propose a three-dimensional (3D) model for an RNA molecule that selectively binds theophylline but not caffeine. This RNA, which was found using SELEX [Jenison, R.D., et al., Science (1994) 263:1425] is 10,000 times more specific for theophylline (Kd=320 nM) than for caffeine (Kd=3.5 mM), although the two ligands are identical except for a methyl group substituted at N7 (present only in caffeine). The binding affinity for ten xanthine-based ligands was used to derive a Comparative Molecular Field Analysis (CoMFA) model (R{sup 2} = 0.93 for 3 components, with cross-validated R{sup 2} of 0.73), using the SYBYL and GOLPE programs. A pharmacophoric map was generated to locate steric and electrostatic interactions between theophylline and the RNA binding site. This information was used to identify putative functional groups of the binding pocket and to generate distance constraints. Based on a model for the secondary structure (Jenison et al., idem), the 3D structure of this RNA was then generated using the following method: each helical region of the RNA molecule was treated as a rigid body; single-stranded loops with specific end-to-end distances were generated. The structures of RNA-xanthine complexes were studied using a modified Monte Carlo algorithm. The detailed structure of an RNA-ligand complex model, as well as possible explanations for the theophylline selectivity will be discussed.

  16. The Anabaena sensory rhodopsin transducer defines a novel superfamily of prokaryotic small-molecule binding domains

    Directory of Open Access Journals (Sweden)

    De Souza Robson F

    2009-08-01

    Full Text Available Abstract The Anabaena sensory rhodopsin transducer (ASRT is a small protein that has been claimed to function as a signaling molecule downstream of the cyanobacterial sensory rhodopsin. However, orthologs of ASRT have been detected in several bacteria that lack rhodopsin, raising questions about the generality of this function. Using sequence profile searches we show that ASRT defines a novel superfamily of β-sandwich fold domains. Through contextual inference based on domain architectures and predicted operons and structural analysis we present strong evidence that these domains bind small molecules, most probably sugars. We propose that the intracellular versions like ASRT probably participate as sensors that regulate a diverse range of sugar metabolism operons or even the light sensory behavior in Anabaena by binding sugars or related metabolites. We also show that one of the extracellular versions define a predicted sugar-binding structure in a novel cell-surface lipoprotein found across actinobacteria, including several pathogens such as Tropheryma, Actinomyces and Thermobifida. The analysis of this superfamily also provides new data to investigate the evolution of carbohydrate binding modes in β-sandwich domains with very different topologies. Reviewers: This article was reviewed by M. Madan Babu and Mark A. Ragan.

  17. Small molecule inhibition of hepatitis C virus E2 binding to CD81

    International Nuclear Information System (INIS)

    Van Compernolle, Scott E.; Wiznycia, Alexander V.; Rush, Jeremy R.; Dhanasekaran, Muthu; Baures, Paul W.; Todd, Scott C.

    2003-01-01

    The hepatitis C virus (HCV) is a causal agent of chronic liver infection, cirrhosis, and hepatocellular carcinoma infecting more than 170 million people. CD81 is a receptor for HCV envelope glycoprotein E2. Although the binding of HCV-E2 with CD81 is well documented the role of this interaction in the viral life cycle remains unclear. Host specificity and mutagenesis studies suggest that the helix D region of CD81 mediates binding to HCV-E2. Structural analysis of CD81 has enabled the synthesis of small molecules designed to mimic the space and hydrophobic features of the solvent-exposed face on helix D. Utilizing a novel bis-imidazole scaffold a series of over 100 compounds has been synthesized. Seven related, imidazole-based compounds were identified that inhibit binding of HCV-E2 to CD81. The inhibitory compounds have no short-term effect on cellular expression of CD81 or other tetraspanins, do not disrupt CD81 associations with other cell surface proteins, and bind reversibly to HCV-E2. These results provide an important proof of concept that CD81-based mimics can disrupt binding of HCV-E2 to CD81

  18. Modeling of flux, binding and substitution of urea molecules in the urea transporter dvUT.

    Science.gov (United States)

    Zhang, Hai-Tian; Wang, Zhe; Yu, Tao; Sang, Jian-Ping; Zou, Xian-Wu; Zou, Xiaoqin

    2017-09-01

    Urea transporters (UTs) are transmembrane proteins that transport urea molecules across cell membranes and play a crucial role in urea excretion and water balance. Modeling the functional characteristics of UTs helps us understand how their structures accomplish the functions at the atomic level, and facilitates future therapeutic design targeting the UTs. This study was based on the crystal structure of Desulfovibrio vulgaris urea transporter (dvUT). To model the binding behavior of urea molecules in dvUT, we constructed a cooperative binding model. To model the substitution of urea by the urea analogue N,N'-dimethylurea (DMU) in dvUT, we calculated the occupation probability of DMU along the urea pore and the ratio of the occupation probabilities of DMU at the external (S ext ) and internal (S int ) binding sites, and we established the mutual substitution rule for binding and substitution of urea and DMU. Based on these calculations and modelings, together with the use of the Monte Carlo (MC) method, we further modeled the urea flux in dvUT, equilibrium urea binding to dvUT, and the substitution of urea by DMU in the dvUT. Our modeling results are in good agreement with the existing experimental functional data. Furthermore, the modelings have discovered the microscopic process and mechanisms of those functional characteristics. The methods and the results would help our future understanding of the underlying mechanisms of the diseases associated with impaired UT functions and rational drug design for the treatment of these diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. In Silico Mechanistic Profiling to Probe Small Molecule Binding to Sulfotransferases

    Science.gov (United States)

    Martiny, Virginie Y.; Carbonell, Pablo; Lagorce, David; Villoutreix, Bruno O.; Moroy, Gautier; Miteva, Maria A.

    2013-01-01

    Drug metabolizing enzymes play a key role in the metabolism, elimination and detoxification of xenobiotics, drugs and endogenous molecules. While their principal role is to detoxify organisms by modifying compounds, such as pollutants or drugs, for a rapid excretion, in some cases they render their substrates more toxic thereby inducing severe side effects and adverse drug reactions, or their inhibition can lead to drug–drug interactions. We focus on sulfotransferases (SULTs), a family of phase II metabolizing enzymes, acting on a large number of drugs and hormones and showing important structural flexibility. Here we report a novel in silico structure-based approach to probe ligand binding to SULTs. We explored the flexibility of SULTs by molecular dynamics (MD) simulations in order to identify the most suitable multiple receptor conformations for ligand binding prediction. Then, we employed structure-based docking-scoring approach to predict ligand binding and finally we combined the predicted interaction energies by using a QSAR methodology. The results showed that our protocol successfully prioritizes potent binders for the studied here SULT1 isoforms, and give new insights on specific molecular mechanisms for diverse ligands’ binding related to their binding sites plasticity. Our best QSAR models, introducing predicted protein-ligand interaction energy by using docking, showed accuracy of 67.28%, 78.00% and 75.46%, for the isoforms SULT1A1, SULT1A3 and SULT1E1, respectively. To the best of our knowledge our protocol is the first in silico structure-based approach consisting of a protein-ligand interaction analysis at atomic level that considers both ligand and enzyme flexibility, along with a QSAR approach, to identify small molecules that can interact with II phase dug metabolizing enzymes. PMID:24039991

  20. In silico mechanistic profiling to probe small molecule binding to sulfotransferases.

    Directory of Open Access Journals (Sweden)

    Virginie Y Martiny

    Full Text Available Drug metabolizing enzymes play a key role in the metabolism, elimination and detoxification of xenobiotics, drugs and endogenous molecules. While their principal role is to detoxify organisms by modifying compounds, such as pollutants or drugs, for a rapid excretion, in some cases they render their substrates more toxic thereby inducing severe side effects and adverse drug reactions, or their inhibition can lead to drug-drug interactions. We focus on sulfotransferases (SULTs, a family of phase II metabolizing enzymes, acting on a large number of drugs and hormones and showing important structural flexibility. Here we report a novel in silico structure-based approach to probe ligand binding to SULTs. We explored the flexibility of SULTs by molecular dynamics (MD simulations in order to identify the most suitable multiple receptor conformations for ligand binding prediction. Then, we employed structure-based docking-scoring approach to predict ligand binding and finally we combined the predicted interaction energies by using a QSAR methodology. The results showed that our protocol successfully prioritizes potent binders for the studied here SULT1 isoforms, and give new insights on specific molecular mechanisms for diverse ligands' binding related to their binding sites plasticity. Our best QSAR models, introducing predicted protein-ligand interaction energy by using docking, showed accuracy of 67.28%, 78.00% and 75.46%, for the isoforms SULT1A1, SULT1A3 and SULT1E1, respectively. To the best of our knowledge our protocol is the first in silico structure-based approach consisting of a protein-ligand interaction analysis at atomic level that considers both ligand and enzyme flexibility, along with a QSAR approach, to identify small molecules that can interact with II phase dug metabolizing enzymes.

  1. Substrate binding to SGLT1 investigated by single molecule force spectroscopy

    International Nuclear Information System (INIS)

    Neundlinger, I. J.

    2010-01-01

    D-glucose serves as one of the most important fuels in various organism due to its fundamental role in ATP-, protein and lipid synthesis. Thus, sustaining glucose homeostasis is a crucial issue of life as disorders can cause severe malfunctions such as glucose-galactose-malabsorbtion (GGM). Sodium-glucose co-transporter, SGLTs, especially the high affinity transporter SGLT1, play a crucial role in accumulation of glucose in the cell as they facilitate transport of the sugar into the cytoplasma across the cell membrane by a Na+-electrochemical potential. Even recently, members of the SGLT transporter family have become a therapeutic target for the treatment of hyperglycemia in type 2 diabetes. Hence, it is of particular importance to gain insights on the dynamic behavior of SGLTs during substrate binding and transport across the cell membrane on the single molecular level. In the present study, the Atomic Force Microscope (AFM) was employed to investigate the dynamic properties of the sodium-glucose co-transporter SGLT1 upon substrate binding under nearly physiological conditions. Hereto, new glucose derivatives were synthesized in order to probe the recognition efficiency of these molecules to SGLT1 embedded in the plasma membrane of living cells. A well established coupling protocol was used to covalently link (i) amino-modified D-glucose owning a conserved pyranose ring, (ii) 1-thio-β-D-glucose having a sulphur atom at C1 of the pyranose ring and (iii) the competitive inhibitor phlorizin to the AFM tip via poly(ethylene)glycol (PEG)-tether using different functional end groups and varying lengths. Binding characteristics, e.g. binding probability, interaction forces, influence of substances (glucose, phlorizin, sodium) and of molecule-linker compounds were obtained by performing single molecular recognition force spectroscopy (SMRFS) measurements. Moreover, temperature controlled radioactive binding/transport assays and SMRFS experiments yielded insights into

  2. Biophysical characterization of membrane protein-small molecule interactions

    NARCIS (Netherlands)

    Chen, Dan

    2015-01-01

    Membrane proteins are account for up to two thirds of known druggable targets. Traditionally, new drugs against this class of proteins have been discovered through HTS. However, not all GPCRs are amenable to traditional screening methods. Recently, fragment-based drug discovery (FBDD) has emerged as

  3. An extension of the fenske-hall LCAO method for approximate calculations of inner-shell binding energies of molecules

    Science.gov (United States)

    Zwanziger, Ch.; Reinhold, J.

    1980-02-01

    The approximate LCAO MO method of Fenske and Hall has been extended to an all-election method allowing the calculation of inner-shell binding energies of molecules and their chemical shifts. Preliminary results are given.

  4. Identification of residues in the insulin molecule important for binding to insulin-degrading enzyme

    Energy Technology Data Exchange (ETDEWEB)

    Affholter, J.A.; Roth, R.A. (Stanford Univ. School of Medicine, CA (USA)); Cascieri, M.A.; Bayne, M.L. (Merck Sharp and Dohme Research Labs., Rahway, NJ (USA)); Brange, J. (Novo Research Institute, Bagsvaerd (Denmark)); Casaretto, M. (Deutsches Wollforschungsinstitut an der Technischen, Aachen (West Germany))

    1990-08-21

    Insulin-degrading enzyme (IDE) hydrolyzes insulin at a limited number of sites. Although the positions of these cleavages are known, the residues of insulin important in its binding to IDE have not been defined. To this end, the authors have studied the binding of a variety of insulin analogues to the protease in a solid-phase binding assay using immunoimmobilized IDE. Since IDE binds insulin with 600-fold greater affinity than it does insulin-like growth factor, the first set of analogues studied were hybrid molecules of insulin and IGF I. Removal of the eight amino acid D-chain region of IGF I (which has been predicted to interfere with binding to the 23-25 region) results in a 25-fold increase in affinity for IDE, confirming the importance of residues 23-25 in the high-affinity recognition of IDE. A similar role for the corresponding (B24-26) residues of insulin is supported by the use of site-directed mutant and semisynthetic insulin analogues. Insulin mutants (B25-Asp)insulin and (B25-His)insulin display 16- and 20-fold decreases in IDE affinity versus wild-type insulin. Similar decreases in affinity are observed with the C-terminal truncation mutants (B1-24-His{sup 25}-NH{sub 2})insulin and (B1-24-Leu{sup 25}-NH{sub 2})insulin, but not (B1-24-Trp{sup 25}-NH{sub 2})insulin and (B1-24-Tyr{sup 25}-NH{sub 2})insulin. The truncated analogue with the lowest affinity for IDE ((B1-24-His{sup 25}-NH{sub 2})insulin) has one of the highest affinities for the insulin receptor. Therefore, they have identified a region of the insulin molecule responsible for its high-affinity interaction with IDE. Although the same region has been implicated in the binding of insulin to its receptor, the data suggest that the structural determinants required for binding to receptor and IDE differ.

  5. A DNA-Mediated Homogeneous Binding Assay for Proteins and Small Molecules

    DEFF Research Database (Denmark)

    Zhang, Zhao; Hejesen, Christian; Kjelstrup, Michael Brøndum

    2014-01-01

    . The shift occurs upon binding of a protein, for example, an antibody to its target. We demonstrate nanomolar detection of small molecules such as biotin, digoxigenin, vitamin D, and folate, in buffer and in plasma. The method is flexible, and we also show nanomolar detection of the respective antibodies......Optical detection of molecular targets typically requires immobilization, separation, or chemical or enzymatic processing. An important exception is aptamers that allow optical detection in solution based on conformational changes. This method, however, requires the laborious selection of aptamers...

  6. Localization of Bacillus thuringiensis Cry1A toxin-binding molecules in gypsy moth larval gut sections using fluorescence microscopy

    Science.gov (United States)

    Algimantas P. Valaitis

    2011-01-01

    The microbial insecticide Bacillus thuringiensis (Bt) produces Cry toxins, proteins that bind to the brush border membranes of gut epithelial cells of insects that ingest it, disrupting the integrity of the membranes, and leading to cell lysis and insect death. In gypsy moth, Lymantria dispar, two toxin-binding molecules for the...

  7. Characterizing the binding motifs of 11 common human HLA‐DP and HLA‐DQ molecules using NNAlign

    DEFF Research Database (Denmark)

    Andreatta, Massimo; Nielsen, Morten

    2012-01-01

    ‐based method NNAlign, we characterized the binding specificities of five HLA‐DP and six HLA‐DQ among the most frequent in the human population. The identified binding motifs showed an overall concurrence with earlier studies but revealed subtle differences. The DP molecules revealed a large overlap...

  8. Identification of residues in the insulin molecule important for binding to insulin-degrading enzyme.

    Science.gov (United States)

    Affholter, J A; Cascieri, M A; Bayne, M L; Brange, J; Casaretto, M; Roth, R A

    1990-08-21

    Insulin-degrading enzyme (IDE) hydrolyzes insulin at a limited number of sites. Although the positions of these cleavages are known, the residues of insulin important in its binding to IDE have not been defined. To this end, we have studied the binding of a variety of insulin analogues to the protease in a solid-phase binding assay using immunoimmobilized IDE. Since IDE binds insulin with 600-fold greater affinity than it does insulin-like growth factor I (25 nM and approximately 16,000 nM, respectively), the first set of analogues studied were hybrid molecules of insulin and IGF I. IGF I mutants [insB1-17,17-70]IGF I, [Tyr55,Gln56]IGF I, and [Phe23,Phe24,Tyr25]IGF I have been synthesized and share the property of having insulin-like amino acids at positions corresponding to primary sites of cleavage of insulin by IDE. Whereas the first two exhibit affinities for IDE similar to that of wild type IGF I, the [Phe23,Phe24,Tyr25]IGF I analogue has a 32-fold greater affinity for the immobilized enzyme. Replacement of Phe-23 by Ser eliminates this increase. Removal of the eight amino acid D-chain region of IGF I (which has been predicted to interfere with binding to the 23-25 region) results in a 25-fold increase in affinity for IDE, confirming the importance of residues 23-25 in the high-affinity recognition of IDE. A similar role for the corresponding (B24-26) residues of insulin is supported by the use of site-directed mutant and semisynthetic insulin analogues. Insulin mutants [B25-Asp]insulin and [B25-His]insulin display 16- and 20-fold decreases in IDE affinity versus wild-type insulin.(ABSTRACT TRUNCATED AT 250 WORDS)

  9. Computational analysis of protein-protein interfaces involving an alpha helix: insights for terphenyl-like molecules binding.

    Science.gov (United States)

    Isvoran, Adriana; Craciun, Dana; Martiny, Virginie; Sperandio, Olivier; Miteva, Maria A

    2013-06-14

    Protein-Protein Interactions (PPIs) are key for many cellular processes. The characterization of PPI interfaces and the prediction of putative ligand binding sites and hot spot residues are essential to design efficient small-molecule modulators of PPI. Terphenyl and its derivatives are small organic molecules known to mimic one face of protein-binding alpha-helical peptides. In this work we focus on several PPIs mediated by alpha-helical peptides. We performed computational sequence- and structure-based analyses in order to evaluate several key physicochemical and surface properties of proteins known to interact with alpha-helical peptides and/or terphenyl and its derivatives. Sequence-based analysis revealed low sequence identity between some of the analyzed proteins binding alpha-helical peptides. Structure-based analysis was performed to calculate the volume, the fractal dimension roughness and the hydrophobicity of the binding regions. Besides the overall hydrophobic character of the binding pockets, some specificities were detected. We showed that the hydrophobicity is not uniformly distributed in different alpha-helix binding pockets that can help to identify key hydrophobic hot spots. The presence of hydrophobic cavities at the protein surface with a more complex shape than the entire protein surface seems to be an important property related to the ability of proteins to bind alpha-helical peptides and low molecular weight mimetics. Characterization of similarities and specificities of PPI binding sites can be helpful for further development of small molecules targeting alpha-helix binding proteins.

  10. Benchmarking density functional tight binding models for barrier heights and reaction energetics of organic molecules.

    Science.gov (United States)

    Gruden, Maja; Andjeklović, Ljubica; Jissy, Akkarapattiakal Kuriappan; Stepanović, Stepan; Zlatar, Matija; Cui, Qiang; Elstner, Marcus

    2017-09-30

    Density Functional Tight Binding (DFTB) models are two to three orders of magnitude faster than ab initio and Density Functional Theory (DFT) methods and therefore are particularly attractive in applications to large molecules and condensed phase systems. To establish the applicability of DFTB models to general chemical reactions, we conduct benchmark calculations for barrier heights and reaction energetics of organic molecules using existing databases and several new ones compiled in this study. Structures for the transition states and stable species have been fully optimized at the DFTB level, making it possible to characterize the reliability of DFTB models in a more thorough fashion compared to conducting single point energy calculations as done in previous benchmark studies. The encouraging results for the diverse sets of reactions studied here suggest that DFTB models, especially the most recent third-order version (DFTB3/3OB augmented with dispersion correction), in most cases provide satisfactory description of organic chemical reactions with accuracy almost comparable to popular DFT methods with large basis sets, although larger errors are also seen for certain cases. Therefore, DFTB models can be effective for mechanistic analysis (e.g., transition state search) of large (bio)molecules, especially when coupled with single point energy calculations at higher levels of theory. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  11. Single-molecule photobleaching reveals increased MET receptor dimerization upon ligand binding in intact cells

    International Nuclear Information System (INIS)

    Dietz, Marina S; Haße, Daniel; Ferraris, Davide M; Göhler, Antonia; Niemann, Hartmut H; Heilemann, Mike

    2013-01-01

    The human receptor tyrosine kinase MET and its ligand hepatocyte growth factor/scatter factor are essential during embryonic development and play an important role during cancer metastasis and tissue regeneration. In addition, it was found that MET is also relevant for infectious diseases and is the target of different bacteria, amongst them Listeria monocytogenes that induces bacterial uptake through the surface protein internalin B. Binding of ligand to the MET receptor is proposed to lead to receptor dimerization. However, it is also discussed whether preformed MET dimers exist on the cell membrane. To address these issues we used single-molecule fluorescence microscopy techniques. Our photobleaching experiments show that MET exists in dimers on the membrane of cells in the absence of ligand and that the proportion of MET dimers increases significantly upon ligand binding. Our results indicate that partially preformed MET dimers may play a role in ligand binding or MET signaling. The addition of the bacterial ligand internalin B leads to an increase of MET dimers which is in agreement with the model of ligand-induced dimerization of receptor tyrosine kinases.

  12. Applications of Engineered DNA-Binding Molecules Such as TAL Proteins and the CRISPR/Cas System in Biology Research

    Directory of Open Access Journals (Sweden)

    Toshitsugu Fujita

    2015-09-01

    Full Text Available Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE proteins and the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated proteins (Cas (CRISPR/Cas system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.

  13. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Rapid long range intramolecular electron transfer within a steroid molecule with two electron binding groups

    International Nuclear Information System (INIS)

    Huddleston, R.K.; Miller, J.R.

    1983-01-01

    Intramolecular electron transfer has been observed to have occurred in less than 100 ns in a steroid molecule having two distinct electron binding groups separated by distances distributed from 7--11 A. Experiments were carried out in organic glasses at 77 K with pulse radiolysis techniques to create trapped electrons which were captured by a group on one end of the steroid molecule. Although one of the groups, benzoate, is held to the steroid spacer by a flexible linkage, the rigidity of the glassy matrices prevented movement to alter the initial distance. Interestingly, no effects of distance were seen: all ET processes appeared to have occurred much faster than our 100 ns time resolution, consistent with measurements of the rate of intermolecular electron transfer between the same functional groups in random solutions. Solvation energetics, on the other hand, had a remarkable influence on the extent and direction of electron transfer. A change in solvent polarity was observed to reverse the direction of electron transfer. Evidence was obtained for a distribution of solvation environments for ions in glasses which may be as broad as 0.15 eV

  15. Preference of small molecules for local minimum conformations when binding to proteins.

    Directory of Open Access Journals (Sweden)

    Qi Wang

    2007-09-01

    Full Text Available It is well known that small molecules (ligands do not necessarily adopt their lowest potential energy conformations when binding to proteins. Analyses of protein-bound ligand crystal structures have reportedly shown that many of them do not even adopt the conformations at local minima of their potential energy surfaces (local minimum conformations. The results of these analyses raise a concern regarding the validity of virtual screening methods that use ligands in local minimum conformations. Here we report a normal-mode-analysis (NMA study of 100 crystal structures of protein-bound ligands. Our data show that the energy minimization of a ligand alone does not automatically stop at a local minimum conformation if the minimum of the potential energy surface is shallow, thus leading to the folding of the ligand. Furthermore, our data show that all 100 ligand conformations in their protein-bound ligand crystal structures are nearly identical to their local minimum conformations obtained from NMA-monitored energy minimization, suggesting that ligands prefer to adopt local minimum conformations when binding to proteins. These results both support virtual screening methods that use ligands in local minimum conformations and caution about possible adverse effect of excessive energy minimization when generating a database of ligand conformations for virtual screening.

  16. A community resource benchmarking predictions of peptide binding to MHC-I molecules.

    Science.gov (United States)

    Peters, Bjoern; Bui, Huynh-Hoa; Frankild, Sune; Nielson, Morten; Lundegaard, Claus; Kostem, Emrah; Basch, Derek; Lamberth, Kasper; Harndahl, Mikkel; Fleri, Ward; Wilson, Stephen S; Sidney, John; Lund, Ole; Buus, Soren; Sette, Alessandro

    2006-06-09

    Recognition of peptides bound to major histocompatibility complex (MHC) class I molecules by T lymphocytes is an essential part of immune surveillance. Each MHC allele has a characteristic peptide binding preference, which can be captured in prediction algorithms, allowing for the rapid scan of entire pathogen proteomes for peptide likely to bind MHC. Here we make public a large set of 48,828 quantitative peptide-binding affinity measurements relating to 48 different mouse, human, macaque, and chimpanzee MHC class I alleles. We use this data to establish a set of benchmark predictions with one neural network method and two matrix-based prediction methods extensively utilized in our groups. In general, the neural network outperforms the matrix-based predictions mainly due to its ability to generalize even on a small amount of data. We also retrieved predictions from tools publicly available on the internet. While differences in the data used to generate these predictions hamper direct comparisons, we do conclude that tools based on combinatorial peptide libraries perform remarkably well. The transparent prediction evaluation on this dataset provides tool developers with a benchmark for comparison of newly developed prediction methods. In addition, to generate and evaluate our own prediction methods, we have established an easily extensible web-based prediction framework that allows automated side-by-side comparisons of prediction methods implemented by experts. This is an advance over the current practice of tool developers having to generate reference predictions themselves, which can lead to underestimating the performance of prediction methods they are not as familiar with as their own. The overall goal of this effort is to provide a transparent prediction evaluation allowing bioinformaticians to identify promising features of prediction methods and providing guidance to immunologists regarding the reliability of prediction tools.

  17. Promoter binding, initiation, and elongation by bacteriophage T7 RNA polymerase. A single-molecule view of the transcription cycle.

    Science.gov (United States)

    Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G

    2004-01-30

    A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.

  18. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    Science.gov (United States)

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  19. Kinetics and thermodynamics of small molecule binding to pincer-PCP rhodium(I) complexes

    KAUST Repository

    Doherty, Mark D.

    2013-04-15

    The kinetics and thermodynamics of the binding of several small molecules, L (L = N2, H2, D2, and C2H 4), to the coordinatively unsaturated pincer-PCP rhodium(I) complexes Rh[tBu2PCH2(C6H3)CH 2PtBu2] (1) and Rh[tBu 2P(CH2)2(CH)(CH2)2P tBu2] (2) in organic solvents (n-heptane, toluene, THF, and cyclohexane-d12) have been investigated by a combination of kinetic flash photolysis methods, NMR equilibrium studies, and density functional theory (DFT) calculations. Using various gas mixtures and monitoring by NMR until equilibrium was established, the relative free energies of binding of N2, H2, and C2H4 in cyclohexane-d12 were found to increase in the order C 2H4 < N2 < H2. Time-resolved infrared (TRIR) and UV-vis transient absorption spectroscopy revealed that 355 nm excitation of 1-L and 2-L results in the photoejection of ligand L. The subsequent mechanism of binding of L to 1 and 2 to regenerate 1-L and 2-L is determined by the structure of the PCP ligand framework and the nature of the solvent. In both cases, the primary transient is a long-lived, unsolvated species (τ = 50-800 ns, depending on L and its concentration in solution). For 2, this so-called less-reactive form (LRF) is in equilibrium with a more-reactive form (MRF), which reacts with L at diffusion-controlled rates to regenerate 2-L. These two intermediates are proposed to be different conformers of the three-coordinate (PCP)Rh fragment. For 1, a similar mechanism is proposed to occur, but the LRF to MRF step is irreversible. In addition, a parallel reaction pathway was observed that involves the direct reaction of the LRF of 1 with L, with second-order rate constants that vary by almost 3 orders of magnitude, depending on the nature of L (in n-heptane, k = 6.7 × 10 5 M-1 s-1 for L = C2H4; 4.0 × 106 M-1 s-1 for L = N2; 5.5 × 108 M-1 s-1 for L = H2). Experiments in the more coordinating solvent, THF, revealed the binding of THF to 1 to generate 1-THF, and its subsequent reaction with L, as a

  20. Kinetics and thermodynamics of small molecule binding to pincer-PCP rhodium(I) complexes

    KAUST Repository

    Doherty, Mark D.; Grills, David C.; Huang, Kuo-Wei; Muckerman, James T.; Polyansky, Dmitry E.; Van Eldik, Rudi V.; Fujita, Etsuko

    2013-01-01

    The kinetics and thermodynamics of the binding of several small molecules, L (L = N2, H2, D2, and C2H 4), to the coordinatively unsaturated pincer-PCP rhodium(I) complexes Rh[tBu2PCH2(C6H3)CH 2PtBu2] (1) and Rh[tBu 2P(CH2)2(CH)(CH2)2P tBu2] (2) in organic solvents (n-heptane, toluene, THF, and cyclohexane-d12) have been investigated by a combination of kinetic flash photolysis methods, NMR equilibrium studies, and density functional theory (DFT) calculations. Using various gas mixtures and monitoring by NMR until equilibrium was established, the relative free energies of binding of N2, H2, and C2H4 in cyclohexane-d12 were found to increase in the order C 2H4 < N2 < H2. Time-resolved infrared (TRIR) and UV-vis transient absorption spectroscopy revealed that 355 nm excitation of 1-L and 2-L results in the photoejection of ligand L. The subsequent mechanism of binding of L to 1 and 2 to regenerate 1-L and 2-L is determined by the structure of the PCP ligand framework and the nature of the solvent. In both cases, the primary transient is a long-lived, unsolvated species (τ = 50-800 ns, depending on L and its concentration in solution). For 2, this so-called less-reactive form (LRF) is in equilibrium with a more-reactive form (MRF), which reacts with L at diffusion-controlled rates to regenerate 2-L. These two intermediates are proposed to be different conformers of the three-coordinate (PCP)Rh fragment. For 1, a similar mechanism is proposed to occur, but the LRF to MRF step is irreversible. In addition, a parallel reaction pathway was observed that involves the direct reaction of the LRF of 1 with L, with second-order rate constants that vary by almost 3 orders of magnitude, depending on the nature of L (in n-heptane, k = 6.7 × 10 5 M-1 s-1 for L = C2H4; 4.0 × 106 M-1 s-1 for L = N2; 5.5 × 108 M-1 s-1 for L = H2). Experiments in the more coordinating solvent, THF, revealed the binding of THF to 1 to generate 1-THF, and its subsequent reaction with L, as a

  1. High-throughput screening identifies small molecules that bind to the RAS:SOS:RAS complex and perturb RAS signaling.

    Science.gov (United States)

    Burns, Michael C; Howes, Jennifer E; Sun, Qi; Little, Andrew J; Camper, DeMarco V; Abbott, Jason R; Phan, Jason; Lee, Taekyu; Waterson, Alex G; Rossanese, Olivia W; Fesik, Stephen W

    2018-05-01

    K-RAS is mutated in approximately 30% of human cancers, resulting in increased RAS signaling and tumor growth. Thus, RAS is a highly validated therapeutic target, especially in tumors of the pancreas, lung and colon. Although directly targeting RAS has proven to be challenging, it may be possible to target other proteins involved in RAS signaling, such as the guanine nucleotide exchange factor Son of Sevenless (SOS). We have previously reported on the discovery of small molecules that bind to SOS1, activate SOS-mediated nucleotide exchange on RAS, and paradoxically inhibit ERK phosphorylation (Burns et al., PNAS, 2014). Here, we describe the discovery of additional, structurally diverse small molecules that also bind to SOS1 in the same pocket and elicit similar biological effects. We tested >160,000 compounds in a fluorescence-based assay to assess their effects on SOS-mediated nucleotide exchange. X-Ray structures revealed that these small molecules bind to the CDC25 domain of SOS1. Compounds that elicited high levels of nucleotide exchange activity in vitro increased RAS-GTP levels in cells, and inhibited phospho ERK levels at higher treatment concentrations. The identification of structurally diverse SOS1 binding ligands may assist in the discovery of new molecules designed to target RAS-driven tumors. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Extended fenske-hall calculation of inner-shell binding energies using ( Z + 1)-bazis sets: Sulfur-containing molecules

    Science.gov (United States)

    Zwanziger, Ch.; Zwanziger, H.; Szargan, R.; Reinhold, J.

    1981-08-01

    It is shown that the S1s and S2p binding energies and their chemical shifts in the molecules H 2S, SO 2, SF 6 and COS obtained with hole-state calculations using an extended Fenske-Hall method are in good agreement with experimental values if mixed ( Z + 1)-basis sets are applied.

  3. Generation of tumour-necrosis-factor-alpha-specific affibody molecules capable of blocking receptor binding in vitro.

    Science.gov (United States)

    Jonsson, Andreas; Wållberg, Helena; Herne, Nina; Ståhl, Stefan; Frejd, Fredrik Y

    2009-08-17

    Affibody molecules specific for human TNF-alpha (tumour necrosis factor-alpha) were selected by phage-display technology from a library based on the 58-residue Protein A-derived Z domain. TNF-alpha is a proinflammatory cytokine involved in several inflammatory diseases and, to this day, four TNF-alpha-blocking protein pharmaceuticals have been approved for clinical use. The phage selection generated 18 unique cysteine-free affibody sequences of which 12 were chosen, after sequence cluster analysis, for characterization as proteins. Biosensor binding studies of the 12 Escherichia coli-produced and IMAC (immobilized-metal-ion affinity chromatography)-purified affibody molecules revealed three variants that demonstrated the strongest binding to human TNF-alpha. These three affibody molecules were subjected to kinetic binding analysis and also tested for their binding to mouse, rat and pig TNF-alpha. For ZTNF-alpha:185, subnanomolar affinity (KD=0.1-0.5 nM) for human TNF-alpha was demonstrated, as well as significant binding to TNF-alpha from the other species. Furthermore, the binding site was found to overlap with the binding site for the TNF-alpha receptor, since this interaction could be efficiently blocked by the ZTNF-alpha:185 affibody. When investigating six dimeric affibody constructs with different linker lengths, and one trimeric construct, it was found that the inhibition of the TNF-alpha binding to its receptor could be further improved by using dimers with extended linkers and/or a trimeric affibody construct. The potential implication of the results for the future design of affibody-based reagents for the diagnosis of inflammation is discussed.

  4. B700, a murine melanoma-specific antigen, binds Vitamin D3; conservation of binding among albuminoid molecules

    International Nuclear Information System (INIS)

    Farzaneh, N.K.; Walden, T.L. Jr.; Hearing, V.J.; Gersten, D.M.

    1990-01-01

    B700, a murine melanoma-specific antigen, is a member of the serum albumin protein family. Other members of this family include serum albumin (SMA), a-fetoprotein (AFP), vitamin D binding protein (DBP), and C700. The primary structure and biochemical functions of B700, as well as its in vivo metabolic fate are largely unknown. The authors examined the functional characteristics of MSA, AFP, and DBP, and for their ability to specifically bind [ 3 H]-1,25-dihydroxy-vitamin D 3 . Scatchard analysis revealed a single binding site for B700 with a Kd of 51,000 M and a Bmax of 4.51 x 10 -7 . There is no significant difference between the Kd and Bmax values among the albuminoid proteins. However, differences in the binding sites could be distinguished by competition of the 1,25-dihydroxy vitamin D 3 with other steroids. 2nM of vitamin D 3 , vitamin D 2 , or estrogen competed for the specific binding of 1,25-dihydroxy vitamin D 3 by B700 but not by DBP. The MSA binding site for 1,25 dihydroxy vitamin D 3 more closely resembles that of DBP than B700. These data indicate that the binding function of the albuminoid proteins has been conserved in the B700 melanoma antigen

  5. Complement activating soluble pattern recognition molecules with collagen-like regions, mannan-binding lectin, ficolins and associated proteins

    DEFF Research Database (Denmark)

    Thiel, Steffen

    2007-01-01

    Mannan-binding lectin (MBL), L-ficolin, M-ficolin and H-ficolin are all complement activating soluble pattern recognition molecules with recognition domains linked to collagen-like regions. All four may form complexes with four structurally related proteins, the three MBL-associated serine...... proteases (MASPs), MASP-1, MASP-2 and MASP-3, and a smaller MBL-associated protein (MAp19). The four recognition molecules recognize patterns of carbohydrate or acetyl-group containing ligands. After binding to the relevant targets all four are able to activate the complement system. We thus have a system...... where four different and/or overlapping patterns of microbial origin or patterns of altered-self may be recognized, but in all cases the signalling molecules, the MASPs, are shared. MASP-1 and MASP-3 are formed from one gene, MASP1/3, by alternative splicing generating two different mRNAs from a single...

  6. Two signaling molecules share a phosphotyrosine-containing binding site in the platelet-derived growth factor receptor.

    Science.gov (United States)

    Nishimura, R; Li, W; Kashishian, A; Mondino, A; Zhou, M; Cooper, J; Schlessinger, J

    1993-11-01

    Autophosphorylation sites of growth factor receptors with tyrosine kinase activity function as specific binding sites for Src homology 2 (SH2) domains of signaling molecules. This interaction appears to be a crucial step in a mechanism by which receptor tyrosine kinases relay signals to downstream signaling pathways. Nck is a widely expressed protein consisting exclusively of SH2 and SH3 domains, the overexpression of which causes cell transformation. It has been shown that various growth factors stimulate the phosphorylation of Nck and its association with autophosphorylated growth factor receptors. A panel of platelet-derived growth factor (PDGF) receptor mutations at tyrosine residues has been used to identify the Nck binding site. Here we show that mutation at Tyr-751 of the PDGF beta-receptor eliminates Nck binding both in vitro and in living cells. Moreover, the Y751F PDGF receptor mutant failed to mediate PDGF-stimulated phosphorylation of Nck in intact cells. A phosphorylated Tyr-751 is also required for binding of phosphatidylinositol-3 kinase to the PDGF receptor. Hence, the SH2 domains of p85 and Nck share a binding site in the PDGF receptor. Competition experiments with different phosphopeptides derived from the PDGF receptor suggest that binding of Nck and p85 is influenced by different residues around Tyr-751. Thus, a single tyrosine autophosphorylation site is able to link the PDGF receptor to two distinct SH2 domain-containing signaling molecules.

  7. Characterization of Small Molecule Scaffolds that Bind to the Shigella Type III Secretion System Protein IpaD

    Science.gov (United States)

    Dey, Supratim; Anbanandam, Asokan; Mumford, Ben E.; De Guzman, Roberto N.

    2017-01-01

    Many pathogens such as Shigella and other bacteria assemble the type III secretion system (T3SS) nanoinjector to inject virulence proteins into their target cells to cause infectious diseases in humans. The rise of drug resistance among pathogens that rely on the T3SS for infectivity, plus the dearth of new antibiotics require alternative strategies in developing new antibiotics. The Shigella T3SS tip protein IpaD is an attractive target for developing anti-infectives because of its essential role in virulence and its exposure on the bacterial surface. Currently, the only known small molecules that bind to IpaD are bile salts sterols. Here, we identified four new small molecule scaffolds that bind to IpaD based on the methylquinoline, pyrrolidin-aniline, hydroxyindole, and morpholinoaniline scaffolds. NMR mapping revealed potential hotspots in IpaD for binding small molecules. These scaffolds can be used as building blocks in developing small molecule inhibitors of IpaD that could lead to new anti-infectives. PMID:28750143

  8. Characterization of Small-Molecule Scaffolds That Bind to the Shigella Type III Secretion System Protein IpaD.

    Science.gov (United States)

    Dey, Supratim; Anbanandam, Asokan; Mumford, Ben E; De Guzman, Roberto N

    2017-09-21

    Many pathogens such as Shigella and other bacteria assemble the type III secretion system (T3SS) nanoinjector to inject virulence proteins into their target cells to cause infectious diseases in humans. The rise of drug resistance among pathogens that rely on the T3SS for infectivity, plus the dearth of new antibiotics require alternative strategies in developing new antibiotics. The Shigella T3SS tip protein IpaD is an attractive target for developing anti-infectives because of its essential role in virulence and its exposure on the bacterial surface. Currently, the only known small molecules that bind to IpaD are bile salt sterols. In this study we identified four new small-molecule scaffolds that bind to IpaD, based on the methylquinoline, pyrrolidine-aniline, hydroxyindole, and morpholinoaniline scaffolds. NMR mapping revealed potential hotspots in IpaD for binding small molecules. These scaffolds can be used as building blocks in developing small-molecule inhibitors of IpaD that could lead to new anti-infectives. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Single-molecule analysis reveals the kinetics and physiological relevance of MutL-ssDNA binding.

    Directory of Open Access Journals (Sweden)

    Jonghyun Park

    2010-11-01

    Full Text Available DNA binding by MutL homologs (MLH/PMS during mismatch repair (MMR has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D = 29 nM while it dramatically decreases above 100 mM (K(D>2 µM. Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.

  10. Anti-tumor activity of a novel HS-mimetic-vascular endothelial growth factor binding small molecule.

    Directory of Open Access Journals (Sweden)

    Kazuyuki Sugahara

    Full Text Available The angiogenic process is controlled by variety of factors of which the vascular endothelial growth factor (VEGF pathway plays a major role. A series of heparan sulfate mimetic small molecules targeting VEGF/VEGFR pathway has been synthesized. Among them, compound 8 (2-butyl-5-chloro-3-(4-nitro-benzyl-3H-imidazole-4-carbaldehyde was identified as a significant binding molecule for the heparin-binding domain of VEGF, determined by high-throughput-surface plasmon resonance assay. The data predicted strong binding of compound 8 with VEGF which may prevent the binding of VEGF to its receptor. We compared the structure of compound 8 with heparan sulfate (HS, which have in common the functional ionic groups such as sulfate, nitro and carbaldehyde that can be located in similar positions of the disaccharide structure of HS. Molecular docking studies predicted that compound 8 binds at the heparin binding domain of VEGF through strong hydrogen bonding with Lys-30 and Gln-20 amino acid residues, and consistent with the prediction, compound 8 inhibited binding of VEGF to immobilized heparin. In vitro studies showed that compound 8 inhibits the VEGF-induced proliferation migration and tube formation of mouse vascular endothelial cells, and finally the invasion of a murine osteosarcoma cell line (LM8G7 which secrets high levels of VEGF. In vivo, these effects produce significant decrease of tumor burden in an experimental model of liver metastasis. Collectively, these data indicate that compound 8 may prevent tumor growth through a direct effect on tumor cell proliferation and by inhibition of endothelial cell migration and angiogenesis mediated by VEGF. In conclusion, compound 8 may normalize the tumor vasculature and microenvironment in tumors probably by inhibiting the binding of VEGF to its receptor.

  11. The pattern-recognition molecule mannan-binding lectin (MBL) in the pathophysiology of diabetic nephropathy

    DEFF Research Database (Denmark)

    Axelgaard, Esben; Thiel, Steffen; Hansen, Troels Krarup

    to carbohydrates of both specific type and density, which thus provides sufficient binding avidity. The character of MBL binding-sites on host cells remain unknown, but it is speculated that altered protein glycation in diabetes permits MBL binding. Based on new studies using MBL/double knockout C57bl/6j mice, we...

  12. Specificity Characterization of SLA Class I Molecules Binding to Swine-Origin Viral Cytotoxic T Lymphocyte Epitope Peptides in Vitro

    Directory of Open Access Journals (Sweden)

    Caixia Gao

    2017-12-01

    Full Text Available Swine leukocyte antigen (SLA class I molecules play a crucial role in generating specific cellular immune responses against viruses and other intracellular pathogens. They mainly bind and present antigens of intracellular origin to circulating MHC I-restricted cytotoxic T lymphocytes (CTLs. Binding of an appropriate epitope to an SLA class I molecule is the single most selective event in antigen presentation and the first step in the killing of infected cells by CD8+ CTLs. Moreover, the antigen epitopes are strictly restricted to specific SLA molecules. In this study, we constructed SLA class I complexes in vitro comprising viral epitope peptides, the extracellular region of the SLA-1 molecules, and β2-microglobulin (β2m using splicing overlap extension polymerase chain reaction (SOE-PCR. The protein complexes were induced and expressed in an Escherichia coli prokaryotic expression system and subsequently purified and refolded. Specific binding of seven SLA-1 proteins to one classical swine fever virus (CSFV and four porcine reproductive and respiratory syndrome virus (PRRSV epitope peptides was detected by enzyme-linked immunosorbent assay (ELISA-based method. The SLA-1∗13:01, SLA-1∗11:10, and SLA-1∗11:01:02 proteins were able to bind specifically to different CTL epitopes of CSFV and PRRSV and the MHC restrictions of the five epitopes were identified. The fixed combination of Asn151Val152 residues was identified as the potentially key amino acid residues influencing the binding of viral several CTL epitope peptides to SLA-1∗13:01 and SLA-1∗04:01:01 proteins. The more flexible pocket E in the SLA-1∗13:01 protein might have fewer steric limitations and therefore be able to accommodate more residues of viral CTL epitope peptides, and may thus play a critical biochemical role in determining the peptide-binding motif of SLA-1∗13:01. Characterization of the binding specificity of peptides to SLA class I molecules provides an

  13. Direct binding of autoimmune disease related T cell epitopes to purified Lewis rat MHC class II molecules

    DEFF Research Database (Denmark)

    Joosten, I; Wauben, M H; Holewijn, M C

    1994-01-01

    New strategies applied in the treatment of experimental autoimmune disease models involve blocking or modulation of MHC-peptide-TCR interactions either at the level of peptide-MHC interaction or, alternatively, at the level of T cell recognition. In order to identify useful competitor peptides one...... characteristics of the Lewis rat MHC class II RT1.B1 molecule. We have now developed a biochemical binding assay which enables competition studies in which the relative MHC binding affinity of a set of non-labelled peptides can be assessed while employing detection of biotinylated marker peptides...

  14. Distinct phosphotyrosines on a growth factor receptor bind to specific molecules that mediate different signaling pathways.

    Science.gov (United States)

    Fantl, W J; Escobedo, J A; Martin, G A; Turck, C W; del Rosario, M; McCormick, F; Williams, L T

    1992-05-01

    The receptor for platelet-derived growth factor (PDGF) binds two proteins containing SH2 domains, GTPase activating protein (GAP) and phosphatidylinositol 3-kinase (PI3-kinase). The sites on the receptor that mediate this interaction were identified by using phosphotyrosine-containing peptides representing receptor sequences to block specifically binding of either PI3-kinase or GAP. These results suggested that PI3-kinase binds two phosphotyrosine residues, each located in a 5 aa motif with an essential methionine at the fourth position C-terminal to the tyrosine. Point mutations at these sites caused a selective elimination of PI3-kinase binding and loss of PDGF-stimulated DNA synthesis. Mutation of the binding site for GAP prevented the receptor from associating with or phosphorylating GAP, but had no effect on PI3-kinase binding and little effect on DNA synthesis. Therefore, GAP and PI3-kinase interact with the receptor by binding to different phosphotyrosine-containing sequence motifs.

  15. Small Molecule Binding, Docking, and Characterization of the Interaction between Pth1 and Peptidyl-tRNA

    Directory of Open Access Journals (Sweden)

    Mary C. Hames

    2013-11-01

    Full Text Available Bacterial Pth1 is essential for viability. Pth1 cleaves the ester bond between the peptide and nucleotide of peptidyl-tRNA generated from aborted translation, expression of mini-genes, and short ORFs. We have determined the shape of the Pth1:peptidyl-tRNA complex using small angle neutron scattering. Binding of piperonylpiperazine, a small molecule constituent of a combinatorial synthetic library common to most compounds with inhibitory activity, was mapped to Pth1 via NMR spectroscopy. We also report computational docking results, modeling piperonylpiperazine binding based on chemical shift perturbation mapping. Overall these studies promote Pth1 as a novel antibiotic target, contribute to understanding how Pth1 interacts with its substrate, advance the current model for cleavage, and demonstrate feasibility of small molecule inhibition.

  16. Two signaling molecules share a phosphotyrosine-containing binding site in the platelet-derived growth factor receptor.

    OpenAIRE

    Nishimura, R; Li, W; Kashishian, A; Mondino, A; Zhou, M; Cooper, J; Schlessinger, J

    1993-01-01

    Autophosphorylation sites of growth factor receptors with tyrosine kinase activity function as specific binding sites for Src homology 2 (SH2) domains of signaling molecules. This interaction appears to be a crucial step in a mechanism by which receptor tyrosine kinases relay signals to downstream signaling pathways. Nck is a widely expressed protein consisting exclusively of SH2 and SH3 domains, the overexpression of which causes cell transformation. It has been shown that various growth fac...

  17. Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

    International Nuclear Information System (INIS)

    Cosman, M; Zeller, L; Lightstone, F C; Krishnan, V V; Balhorn, R

    2002-01-01

    The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design of chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that

  18. Overlapping binding site for the endogenous agonist, small-molecule agonists, and ago-allosteric modulators on the ghrelin receptor

    DEFF Research Database (Denmark)

    Holst, Birgitte; Frimurer, Thomas M; Mokrosinski, Jacek

    2008-01-01

    A library of robust ghrelin receptor mutants with single substitutions at 22 positions in the main ligand-binding pocket was employed to map binding sites for six different agonists: two peptides (the 28-amino-acid octanoylated endogenous ligand ghrelin and the hexapeptide growth hormone......, and PheVI:23 on the opposing face of transmembrane domain (TM) VI. Each of the agonists was also affected selectively by specific mutations. The mutational map of the ability of L-692,429 and GHRP-6 to act as allosteric modulators by increasing ghrelin's maximal efficacy overlapped with the common....... It is concluded that although each of the ligands in addition exploits other parts of the receptor, a large, common binding site for both small-molecule agonists--including ago-allosteric modulators--and the endogenous agonist is found on the opposing faces of TM-III and -VI of the ghrelin receptor....

  19. A modern approach for epitope prediction: identification of foot-and-mouth disease virus peptides binding bovine leukocyte antigen (BoLA) class I molecules

    DEFF Research Database (Denmark)

    Pandya, Mital; Rasmussen, Michael; Hansen, Andreas

    2015-01-01

    Major histocompatibility complex (MHC) class I molecules regulate adaptive immune responses through the presentation of antigenic peptides to CD8+ T cells. Polymorphisms in the peptide binding region of class I molecules determine peptide binding affinity and stability during antigen presentation......, and different antigen peptide motifs are associated with specific genetic sequences of class I molecules. Understanding bovine leukocyte antigen (BoLA), peptide-MHC class I binding specificities may facilitate development of vaccines or reagents for quantifying the adaptive immune response to intracellular...... pathogens, such as foot-and-mouth disease virus (FMDV). Six synthetic BoLA class I (BoLA-I) molecules were produced, and the peptide binding motif was generated for five of the six molecules using a combined approach of positional scanning combinatorial peptide libraries (PSCPLs) and neural network...

  20. Implication of Crystal Water Molecules in Inhibitor Binding at ALR2 Active Site

    Directory of Open Access Journals (Sweden)

    Hymavati

    2012-01-01

    Full Text Available Water molecules play a crucial role in mediating the interaction between a ligand and a macromolecule. The solvent environment around such biomolecule controls their structure and plays important role in protein-ligand interactions. An understanding of the nature and role of these water molecules in the active site of a protein could greatly increase the efficiency of rational drug design approaches. We have performed the comparative crystal structure analysis of aldose reductase to understand the role of crystal water in protein-ligand interaction. Molecular dynamics simulation has shown the versatile nature of water molecules in bridge H bonding during interaction. Occupancy and life time of water molecules depend on the type of cocrystallized ligand present in the structure. The information may be useful in rational approach to customize the ligand, and thereby longer occupancy and life time for bridge H-bonding.

  1. Basic fibroblast growth factor binds to subendothelial extracellular matrix and is released by heparitinase and heparin-like molecules

    International Nuclear Information System (INIS)

    Bashkin, P.; Doctrow, S.; Klagsbrun, M.; Svahn, C.M.; Folkman, J.; Vlodavsky, I.

    1989-01-01

    Basic fibroblast growth factor (bFGF) exhibits specific binding to the extracellular matrix (ECM) produced by cultured endothelial cells. Binding was saturable as a function both of time and of concentration of 125 I-bFGF. Scatchard analysis of FGF binding revealed the presence of about 1.5 x 10 12 binding sites/mm 2 ECM with an apparent k D of 610 nM. FGF binds to heparan sulfate (HS) in ECM as evidenced by (i) inhibition of binding in the presence of heparin or HS at 0.1-1 μg/mL, but not by chondroitin sulfate, keratan sulfate, or hyaluronic acid at 10 μg/mL, (ii) lack of binding to ECM pretreated with heparitinase, but not with chondroitinase ABC, and (iii) rapid release of up to 90% of ECM-bound FGF by exposure to heparin, HS, or heparitinase, but not to chondroitin sulfate, keratan sulfate, hyaluronic acid, or chondroitinase ABC. Oligosaccharides derived from depolymerized heparin, and as small as the tetrasaccharide, released the ECM-bound FGF, but there was little or no release of FGF by modified nonanticoagulant heparins such as totally desulfated heparin, N-desulfated heparin, and N-acetylated heparin. FGF released from ECM was biologically active, as indicated by its stimulation of cell proliferation and DNA synthesis in vascular endothelial cells and 3T3 fibroblasts. Similar results were obtained in studies on release of endogenous FGF-like mitogenic activity from Descement's membranes of bovine corneas. It is suggested that ECM storage and release of bFGF provide a novel mechanism for regulation of capillary blood vessel growth. Whereas ECM-bound FGF may be prevented from acting on endothelial cells, its displacement by heparin-like molecules and/or HS-degrading enzymes may elicit a neovascular response

  2. Probing force-induced unfolding intermediates of a single staphylococcal nuclease molecule and the effect of ligand binding

    International Nuclear Information System (INIS)

    Ishii, Takaaki; Murayama, Yoshihiro; Katano, Atsuto; Maki, Kosuke; Kuwajima, Kunihiro; Sano, Masaki

    2008-01-01

    Single-molecule manipulation techniques have given experimental access to unfolding intermediates of proteins that are inaccessible in conventional experiments. A detailed characterization of the intermediates is a challenging problem that provides new possibilities for directly probing the energy landscape of proteins. We investigated single-molecule mechanical unfolding of a small globular protein, staphylococcal nuclease (SNase), using atomic force microscopy. The unfolding trajectories of the protein displayed sub-molecular and stochastic behavior with typical lengths corresponding to the size of the unfolded substructures. Our results support the view that the single protein unfolds along multiple pathways as suggested in recent theoretical studies. Moreover, we found the drastic change, caused by the ligand and inhibitor bindings, in the mechanical unfolding dynamics

  3. Identification of a novel Arabidopsis thaliana nitric oxide-binding molecule with guanylate cyclase activity in vitro

    KAUST Repository

    Mulaudzi, Takalani

    2011-09-01

    While there is evidence of nitric oxide (NO)-dependent signalling via the second messenger cyclic guanosine 3′,5′-monophosphate (cGMP) in plants, guanylate cyclases (GCs), enzymes that catalyse the formation of cGMP from guanosine 5′-triphosphate (GTP) have until recently remained elusive and none of the candidates identified to-date are NO-dependent. Using both a GC and heme-binding domain specific (H-NOX) search motif, we have identified an Arabidopsis flavin monooxygenase (At1g62580) and shown electrochemically that it binds NO, has a higher affinity for NO than for O 2 and that this molecule can generate cGMP from GTP in vitro in an NO-dependent manner. © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  4. Chondroitin sulfates and their binding molecules in the central nervous system.

    Science.gov (United States)

    Djerbal, L; Lortat-Jacob, H; Kwok, Jcf

    2017-06-01

    Chondroitin sulfate (CS) is the most abundant glycosaminoglycan (GAG) in the central nervous system (CNS) matrix. Its sulfation and epimerization patterns give rise to different forms of CS, which enables it to interact specifically and with a significant affinity with various signalling molecules in the matrix including growth factors, receptors and guidance molecules. These interactions control numerous biological and pathological processes, during development and in adulthood. In this review, we describe the specific interactions of different families of proteins involved in various physiological and cognitive mechanisms with CSs in CNS matrix. A better understanding of these interactions could promote a development of inhibitors to treat neurodegenerative diseases.

  5. Structure and thermodynamics of effector molecule binding to the nitrogen signal transduction PII protein GlnZ from Azospirillum brasilense.

    Science.gov (United States)

    Truan, Daphné; Bjelić, Saša; Li, Xiao-Dan; Winkler, Fritz K

    2014-07-29

    The trimeric PII signal transduction proteins regulate the function of a variety of target proteins predominantly involved in nitrogen metabolism. ATP, ADP and 2-oxoglutarate (2-OG) are key effector molecules influencing PII binding to targets. Studies of PII proteins have established that the 20-residue T-loop plays a central role in effector sensing and target binding. However, the specific effects of effector binding on T-loop conformation have remained poorly documented. We present eight crystal structures of the Azospirillum brasilense PII protein GlnZ, six of which are cocrystallized and liganded with ADP or ATP. We find that interaction with the diphosphate moiety of bound ADP constrains the N-terminal part of the T-loop in a characteristic way that is maintained in ADP-promoted complexes with target proteins. In contrast, the interactions with the triphosphate moiety in ATP complexes are much more variable and no single predominant interaction mode is apparent except for the ternary MgATP/2-OG complex. These conclusions can be extended to most investigated PII proteins of the GlnB/GlnK subfamily. Unlike reported for other PII proteins, microcalorimetry reveals no cooperativity between the three binding sites of GlnZ trimers for any of the three effectors under carefully controlled experimental conditions. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Cucurbit[8]uril-Containing Multilayer Films for the Photocontrolled Binding and Release of a Guest Molecule.

    Science.gov (United States)

    Nicolas, Henning; Yuan, Bin; Zhang, Xi; Schönhoff, Monika

    2016-03-15

    The powerful host-guest chemistry of cucurbit[8]uril (CB[8]) was employed to obtain photoresponsive polyelectrolyte multilayer films for the reversible and photocontrolled binding and release of an organic guest molecule. For this purpose, we designed and synthesized a polyelectrolyte with azobenzene side groups. Then, CB[8] was associated with the azo side group to obtain a supramolecular host-guest complex that was further used as building block in order to prepare photoresponsive and CB[8]-containing polyelectrolyte multilayer films. Ultraviolet spectroscopy and a dissipative quartz crystal microbalance are employed to monitor the formation of the host-guest complex and the layer-by-layer self-assembly of the multilayer films, respectively. We demonstrate that the photoresponsive properties of the azo side groups are maintained before and after host-guest complexation with CB[8] in solution and within the multilayer films, respectively. A guest molecule was then specifically included as second binding partner into the CB[8]-containing multilayer films. Subsequently, the release of the guest was performed by UV light irradiation due to the trans-cis isomerization of the adjacent azo side groups. Re-isomerization of the azo side groups was achieved by VIS light irradiation and enabled the rebinding of the guest into CB[8]. Finally, we demonstrate that the photocontrolled binding and release within CB[8]-containing multilayer films can reliably and reversibly be performed over a period of more than 2 weeks with constant binding efficiency. Therefore, we expect such novel type of photosensitive films to have promising future applications in the field of stimuli-responsive nanomaterials.

  7. Legume receptors perceive the rhizobial lipochitin oligosaccharide signal molecules by direct binding

    DEFF Research Database (Denmark)

    Broghammer, Angelique; Krusell, Lene; Blaise, Mickael

    2012-01-01

    Lipochitin oligosaccharides called Nod factors function as primary rhizobial signal molecules triggering legumes to develop new plant organs: root nodules that host the bacteria as nitrogen-fixing bacteroids. Here, we show that the Lotus japonicus Nod factor receptor 5 (NFR5) and Nod factor recep...

  8. Renormalization of Molecular Quasiparticle Levels at Metal-Molecule Interfaces: Trends across Binding Regimes

    DEFF Research Database (Denmark)

    Thygesen, Kristian Sommer; Rubio, Angel

    2009-01-01

    a microscopic model of the metal-molecule interface, we illustrate the basic features of this renormalization mechanism through systematic GW, Hartree-Fock, and Kohn-Sham calculations for the molecular energy levels as function of the model parameters. We identify two different polarization mechanisms: (i...

  9. Peptide-binding motifs of two common equine class I MHC molecules in Thoroughbred horses.

    Science.gov (United States)

    Bergmann, Tobias; Lindvall, Mikaela; Moore, Erin; Moore, Eugene; Sidney, John; Miller, Donald; Tallmadge, Rebecca L; Myers, Paisley T; Malaker, Stacy A; Shabanowitz, Jeffrey; Osterrieder, Nikolaus; Peters, Bjoern; Hunt, Donald F; Antczak, Douglas F; Sette, Alessandro

    2017-05-01

    Quantitative peptide-binding motifs of MHC class I alleles provide a valuable tool to efficiently identify putative T cell epitopes. Detailed information on equine MHC class I alleles is still very limited, and to date, only a single equine MHC class I allele, Eqca-1*00101 (ELA-A3 haplotype), has been characterized. The present study extends the number of characterized ELA class I specificities in two additional haplotypes found commonly in the Thoroughbred breed. Accordingly, we here report quantitative binding motifs for the ELA-A2 allele Eqca-16*00101 and the ELA-A9 allele Eqca-1*00201. Utilizing analyses of endogenously bound and eluted ligands and the screening of positional scanning combinatorial libraries, detailed and quantitative peptide-binding motifs were derived for both alleles. Eqca-16*00101 preferentially binds peptides with aliphatic/hydrophobic residues in position 2 and at the C-terminus, and Eqca-1*00201 has a preference for peptides with arginine in position 2 and hydrophobic/aliphatic residues at the C-terminus. Interestingly, the Eqca-16*00101 motif resembles that of the human HLA A02-supertype, while the Eqca-1*00201 motif resembles that of the HLA B27-supertype and two macaque class I alleles. It is expected that the identified motifs will facilitate the selection of candidate epitopes for the study of immune responses in horses.

  10. Nonequivalence of alpha-bungarotoxin binding sites in the native nicotinic receptor molecule

    International Nuclear Information System (INIS)

    Conti-Tronconi, B.M.; Tang, F.; Walgrave, S.; Gallagher, W.

    1990-01-01

    In the native, membrane-bound form of the nicotinic acetylcholine receptor (M-AcChR) the two sites for the cholinergic antagonist alpha-bungarotoxin (alpha-BGT) have different binding properties. One site has high affinity, and the M-AcChR/alpha-BGT complexes thus formed dissociate very slowly, similar to the complexes formed with detergent-solubilized AcChR (S-AcChR). The second site has much lower affinity (KD approximately 59 +/- 35 nM) and forms quickly reversible complexes. The nondenaturing detergent Triton X-100 is known to solubilize the AcChR in a form unable, upon binding of cholinergic ligands, to open the ion channel and to become desensitized. Solubilization of the AcChR in Triton X-100 affects the binding properties of this second site and converts it to a high-affinity, slowly reversible site. Prolonged incubation of M-AcChR at 4 degrees C converts the low-affinity site to a high-affinity site similar to those observed in the presence of Triton X-100. Although the two sites have similar properties when the AcChR is solubilized in Triton X-100, their nonequivalence can be demonstrated by the effect on alpha-BGT binding of concanavalin A, which strongly reduces the association rate of one site only. The Bmax of alpha-BGT to either Triton-solubilized AcChR or M-AcChR is not affected by the presence of concanavalin A. Occupancy of the high-affinity, slowly reversible site in M-AcChR inhibits the Triton X-100 induced conversion to irreversibility of the second site. At difference with alpha-BGT, the long alpha-neurotoxin from Naja naja siamensis venom (alpha-NTX) binds with high affinity and in a very slowly reversible fashion to two sites in the M-AcChR. We confirm here that Triton-solubilized AcChR or M-AcChR binds in a very slowly reversible fashion the same amount of alpha-NTX

  11. Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids

    International Nuclear Information System (INIS)

    Aradi, Balint; Frauenheim, Thomas

    2015-01-01

    A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born-Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materials science, chemistry, and biology

  12. Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids.

    Science.gov (United States)

    Aradi, Bálint; Niklasson, Anders M N; Frauenheim, Thomas

    2015-07-14

    A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born-Oppenheimer molecular dynamics. For systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can be applied to a broad range of problems in materials science, chemistry, and biology.

  13. Synthesis of Zn-MOF incorporating titanium-hydrides as active sites binding H{sub 2} molecules

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jongsik, E-mail: jkim40@nd.edu [Department of Chemical and Biomolecular Engineering, University of Notre Dame, 182, Fitzpatrick Hall, Notre Dame, IN 46556 (United States); Ok Kim, Dong; Wook Kim, Dong; Sagong, Kil [Hanwha Chemical Research & Development Center, 6, Shinseong-dong, Yuseong-gu, Daejeon 305-804 (Korea, Republic of)

    2015-10-15

    This paper describes the synthetic effort for a Zn-MOF imparting Ti-H as a preferential binding site potentially capturing H{sub 2} molecules via Kubas-type interaction. The formation mechanism of Ti-H innate to the final material was potentially demonstrated to follow a radical dissociation rather than a β-hydrogen elimination and a C-H reductive elimination. - Graphical abstract: This study details the synthesis and the formation mechanism of Zn-MOF adsorbent site-isolating TiH{sub 3} that can potentially capture H{sub 2} molecules via Kubas-binding mechanism. - Highlights: • OH-functionalized Zn-MOF was employed as a reactive template to site-isolate TiH{sub 3}. • This MOF was post-synthetically modified using a tetracyclohexyl titanium (IV). • This intermediate was hydrogenolyzed to change ligand from cyclohexyl to hydride. • Formation mechanism of TiH{sub 3} was investigated via two control GC–MS experiments. • Final Zn-MOF potentially site-isolating TiH{sub 3} species was used as a H{sub 2} adsorbent.

  14. Improved methods for predicting peptide binding affinity to MHC class II molecules

    DEFF Research Database (Denmark)

    Jensen, Kamilla Kjærgaard; Andreatta, Massimo; Marcatili, Paolo

    2018-01-01

    Major histocompatibility complex class II (MHC-II) molecules are expressed on the surface of professional antigen presenting cells where they display peptides to T helper cells, which orchestrate the onset and outcome of many host immune responses. Understanding which peptides will be presented b...... are publicly available at www.cbs.dtu.dk/services/NetMHCII-2.3 and www.cbs.dtu.dk/services/NetMHCIIpan-3.2. This article is protected by copyright. All rights reserved....

  15. Role of ICAM-1 polymorphisms (G241R, K469E) in mediating its single-molecule binding ability: Atomic force microscopy measurements on living cells

    Energy Technology Data Exchange (ETDEWEB)

    Bai, Rui [Chinese (301) General Hospital, 28 Fuxing Road, Haidian District, Beijing 100853 (China); Yi, Shaoqiong [Beijing Institute of Biotechnology, 20 Dongdajie, Fengtai, Beijing 100071 (China); Zhang, Xuejie [Beijing National Laboratory for Molecular Sciences, Key Laboratory of Molecular Nanostructure and Nanotechnology, Institute of Chemistry Chinese Academy of Sciences, 2 Zhongguancun North 1st Street, Beijing 100190 (China); Liu, Huiliang, E-mail: lhl518@vip.sina.com [Department of Cardiology, The General Hospital of Chinese People’s Armed Police Forces, Beijing 100039 (China); Fang, Xiaohong, E-mail: xfang@iccas.ac.cn [Beijing National Laboratory for Molecular Sciences, Key Laboratory of Molecular Nanostructure and Nanotechnology, Institute of Chemistry Chinese Academy of Sciences, 2 Zhongguancun North 1st Street, Beijing 100190 (China)

    2014-06-13

    Highlights: • We evaluated both single molecule binding ability and expression level of 4 ICAM-1 mutations. • AFM was used to measure single-molecule binding ability on living cells. • The SNP of ICAM-1 may induce changes in expressions rather than single-molecule binding ability. - Abstract: Atherosclerosis (As) is characterized by chronic inflammation and is a major cause of human mortality. ICAM-1-mediated adhesion of leukocytes in vessel walls plays an important role in the pathogenesis of atherosclerosis. Two single nucleotide polymorphisms (SNPs) of human intercellular adhesion molecule-1 (ICAM-1), G241R and K469E, are associated with a number of inflammatory diseases. SNP induced changes in ICAM-1 function rely not only on the expression level but also on the single-molecule binding ability which may be affected by single molecule conformation variations such as protein splicing and folding. Previous studies have shown associations between G241R/K469E polymorphisms and ICAM-1 gene expression. Nevertheless, few studies have been done that focus on the single-molecule forces of the above SNPs and their ligands. In the current study, we evaluated both single molecule binding ability and expression level of 4 ICAM-1 mutations – GK (G241/K469), GE (G241/E469), RK (R241/K469) and RE (R241/E469). No difference in adhesion ability was observed via cell adhesion assay or atomic force microscopy (AFM) measurement when comparing the GK, GE, RK, or RE genotypes of ICAM-1 to each other. On the other hand, flow cytometry suggested that there was significantly higher expression of GE genotype of ICAM-1 on transfected CHO cells. Thus, we concluded that genetic susceptibility to diseases related to ICAM-1 polymorphisms, G241R or K469E, might be due to the different expressions of ICAM-1 variants rather than to the single-molecule binding ability of ICAM-1.

  16. Role of Conserved Disulfide Bridges and Aromatic Residues in Extracellular Loop 2 of Chemokine Receptor CCR8 for Chemokine and Small Molecule Binding

    DEFF Research Database (Denmark)

    Barington, Line; Rummel, Pia C; Lückmann, Michael

    2016-01-01

    and aromatic residues in extracellular loop 2 (ECL2) for ligand binding and activation in the chemokine receptor CCR8. We used IP3 accumulation and radioligand binding experiments to determine the impact of receptor mutagenesis on both chemokine and small molecule agonist and antagonist binding and action...... in CCR8. We find that the 7 transmembrane (7TM) receptor conserved disulfide bridge (7TM bridge) linking transmembrane helix (TM)III and ECL2 is crucial for chemokine and small molecule action, whereas the chemokine receptor conserved disulfide bridge between the N terminus and TMVII is needed only...

  17. Molecule-binding dependent assembly of split aptamer and γ-cyclodextrin: A sensitive excimer signaling approach for aptamer biosensors

    International Nuclear Information System (INIS)

    Jin, Fen; Lian, Yan; Li, Jishan; Zheng, Jing; Hu, Yaping; Liu, Jinhua; Huang, Jin; Yang, Ronghua

    2013-01-01

    Graphical abstract: Adenosine-binding aptamer was splitted into two fragments P2 and P3 which labeled pyrene molecules, mainly produce monomer signal. γ-CD cavity brings P2 and P3 in close proximity, allowing for weak excimer emission. In the presence of target, P2 and P3 are expected to bind ATP and form an aptamer/target complex, leads to large increase of the pyrene excimer fluorescence. -- Highlights: •We assembled split aptamer and γ-cyclodextrin fluorescence biosensors for ATP detection. •The biosensor increased quantum yield and emission lifetime of the excimer. •Time-resolved fluorescence is effective for ATP assay in complicated environment. -- Abstract: A highly sensitive and selective fluorescence aptamer biosensors for the determination of adenosine triphosphate (ATP) was developed. Binding of a target with splitting aptamers labeled with pyrene molecules form stable pyrene dimer in the γ-cyclodextrin (γ-CD) cavity, yielding a strong excimer emission. We have found that inclusion of pyrene dimer in γ-cyclodextrin cavity not only exhibits additive increases in quantum yield and emission lifetime of the excimer, but also facilitates target-induced fusion of the splitting aptamers to form the aptamer/target complex. As proof-of-principle, the approach was applied to fluorescence detection of adenosine triphosphate. With an anti-ATP aptamer, the approach exhibits excimer fluorescence response toward ATP with a maximum signal-to-background ratio of 32.1 and remarkably low detection limit of 80 nM ATP in buffer solution. Moreover, due to the additive fluorescence lifetime of excimer induced by γ-cyclodextrin, time-resolved measurements could be conveniently used to detect as low as 0.5 μM ATP in blood serum quantitatively

  18. The HLA-B*5101 molecule-binding capacity to antigens used in animal models of Behçet's disease: a bioinformatics study.

    Science.gov (United States)

    Baharav, Ehud; Weinberger, Abraham

    2012-07-01

    The human lymphocyte antigen (HLA) molecule B*5101 is a functioning receptor of the immune system and is generally accepted as a genetic marker for Behçet disease (BD), a multi-organ, chronic inflammatory disorder. The role of the HLA-B*5101 in the pathogenesis of BD is elusive. The assumption that HLA-B*5101 has an active role in BD is suggestive, but no antigen has yet been identified. To evaluate the potential binding capacity of various antigens to the HLA-B*5101 molecule. Using bioinformatics programs, we studied the binding capacity of HLA-B*5101 and its corresponding rat molecule RT.A1 to the following antigens: heatshock protein-60 (HSP60), major histocompatibility complex class I chain-related gene A (MICA), retinal S-antigen (S-Ag), HLA-B27 molecule and its peptide (PD) and tropomyosin (TPM), all of which serve as antigens in animal models corresponding to BD. In each protein including the B*5101 molecule itself, the computerized programs revealed several short sequences with potential high binding capacity to HLA-B*5101 with the exception of B-27PD. The rat MHC RT1. Al. had no binding capacity to S-Ag. The evaluated proteins have the potential to bind to and to serve as potential antigens to the HLA-B*5101 and the rat MHC RT1.Al. molecules. The pathogenicity of these suggested short peptides should be evaluated in animal models of BD.

  19. Uncovering the Peptide-Binding Specificities of HLA-C: A General Strategy To Determine the Specificity of Any MHC Class I Molecule

    DEFF Research Database (Denmark)

    Rasmussen, Michael; Harndahl, Mikkel; Stryhn, Anette

    2014-01-01

    MHC class I molecules (HLA-I in humans) present peptides derived from endogenous proteins to CTLs. Whereas the peptide-binding specificities of HLA-A and -B molecules have been studied extensively, little is known about HLA-C specificities. Combining a positional scanning combinatorial peptide...... library approach with a peptide-HLA-I dissociation assay, in this study we present a general strategy to determine the peptide-binding specificity of any MHC class I molecule. We applied this novel strategy to 17 of the most common HLA-C molecules, and for 16 of these we successfully generated matrices...... representing their peptide-binding motifs. The motifs prominently shared a conserved C-terminal primary anchor with hydrophobic amino acid residues, as well as one or more diverse primary and auxiliary anchors at P1, P2, P3, and/or P7. Matrices were used to generate a large panel of HLA-C-specific peptide...

  20. The Minimum Binding Energy and Size of Doubly Muonic D3 Molecule

    Science.gov (United States)

    Eskandari, M. R.; Faghihi, F.; Mahdavi, M.

    The minimum energy and size of doubly muonic D3 molecule, which two of the electrons are replaced by the much heavier muons, are calculated by the well-known variational method. The calculations show that the system possesses two minimum positions, one at typically muonic distance and the second at the atomic distance. It is shown that at the muonic distance, the effective charge, zeff is 2.9. We assumed a symmetric planar vibrational model between two minima and an oscillation potential energy is approximated in this region.

  1. Characterization of novel OmpA-like protein of Leptospira interrogans that binds extracellular matrix molecules and plasminogen.

    Science.gov (United States)

    Oliveira, Rosane; de Morais, Zenaide Maria; Gonçales, Amane Paldes; Romero, Eliete Caló; Vasconcellos, Silvio Arruda; Nascimento, Ana L T O

    2011-01-01

    Leptospira interrogans is the etiological agent of leptospirosis, a zoonotic disease of human and veterinary concern. The identification of novel proteins that mediate host-pathogen interactions is important for understanding the bacterial pathogenesis as well as to identify protective antigens that would help fight the disease. We describe in this work the cloning, expression, purification and characterization of three predicted leptospiral membrane proteins, LIC10258, LIC12880 (Lp30) and LIC12238. We have employed Escherichia coli BL21 (SI) strain as a host expression system. Recently, we have identified LIC12238 as a plasminogen (PLG)-binding receptor. We show now that Lp30 and rLIC10258 are also PLG-receptors of Leptospira, both exhibiting dose-dependent and saturating binding (K(D), 68.8±25.2 nM and 167.39±60.1 nM, for rLIC10258 and rLIC12880, respectively). In addition, LIC10258, which is a novel OmpA-like protein, binds laminin and plasma fibronectin ECM molecules and hence, it was named Lsa66 (Leptospiral surface adhesin of 66 kDa). Binding of Lsa66 to ECM components was determined to be specific, dose-dependent and saturable, with a K(D) of 55.4±15.9 nM to laminin and of 290.8±11.8 nM to plasma fibronectin. Binding of the recombinant proteins to PLG or ECM components was assessed by using antibodies against each of the recombinant proteins obtained in mice and confirmed by monoclonal anti-polyhistidine antibodies. Lsa66 caused partial inhibition on leptospiral adherence to immobilized ECM and PLG. Moreover, this adhesin and rLIC12238 are recognized by antibodies in serum samples of confirmed leptospirosis cases. Thus, Lsa66 is a novel OmpA-like protein with dual activity that may promote the attachment of Leptospira to host tissues and may contribute to the leptospiral invasion. To our knowledge, this is the first leptospiral protein with ECM and PLG binding properties reported to date.

  2. Characterization of novel OmpA-like protein of Leptospira interrogans that binds extracellular matrix molecules and plasminogen.

    Directory of Open Access Journals (Sweden)

    Rosane Oliveira

    Full Text Available Leptospira interrogans is the etiological agent of leptospirosis, a zoonotic disease of human and veterinary concern. The identification of novel proteins that mediate host-pathogen interactions is important for understanding the bacterial pathogenesis as well as to identify protective antigens that would help fight the disease. We describe in this work the cloning, expression, purification and characterization of three predicted leptospiral membrane proteins, LIC10258, LIC12880 (Lp30 and LIC12238. We have employed Escherichia coli BL21 (SI strain as a host expression system. Recently, we have identified LIC12238 as a plasminogen (PLG-binding receptor. We show now that Lp30 and rLIC10258 are also PLG-receptors of Leptospira, both exhibiting dose-dependent and saturating binding (K(D, 68.8±25.2 nM and 167.39±60.1 nM, for rLIC10258 and rLIC12880, respectively. In addition, LIC10258, which is a novel OmpA-like protein, binds laminin and plasma fibronectin ECM molecules and hence, it was named Lsa66 (Leptospiral surface adhesin of 66 kDa. Binding of Lsa66 to ECM components was determined to be specific, dose-dependent and saturable, with a K(D of 55.4±15.9 nM to laminin and of 290.8±11.8 nM to plasma fibronectin. Binding of the recombinant proteins to PLG or ECM components was assessed by using antibodies against each of the recombinant proteins obtained in mice and confirmed by monoclonal anti-polyhistidine antibodies. Lsa66 caused partial inhibition on leptospiral adherence to immobilized ECM and PLG. Moreover, this adhesin and rLIC12238 are recognized by antibodies in serum samples of confirmed leptospirosis cases. Thus, Lsa66 is a novel OmpA-like protein with dual activity that may promote the attachment of Leptospira to host tissues and may contribute to the leptospiral invasion. To our knowledge, this is the first leptospiral protein with ECM and PLG binding properties reported to date.

  3. Structure Based Modeling of Small Molecules Binding to the TLR7 by Atomistic Level Simulations

    Directory of Open Access Journals (Sweden)

    Francesco Gentile

    2015-05-01

    Full Text Available Toll-Like Receptors (TLR are a large family of proteins involved in the immune system response. Both the activation and the inhibition of these receptors can have positive effects on several diseases, including viral pathologies and cancer, therefore prompting the development of new compounds. In order to provide new indications for the design of Toll-Like Receptor 7 (TLR7-targeting drugs, the mechanism of interaction between the TLR7 and two important classes of agonists (imidazoquinoline and adenine derivatives was investigated through docking and Molecular Dynamics simulations. To perform the computational analysis, a new model for the dimeric form of the receptors was necessary and therefore created. Qualitative and quantitative differences between agonists and inactive compounds were determined. The in silico results were compared with previous experimental observations and employed to define the ligand binding mechanism of TLR7.

  4. Thermodynamic analysis of water molecules at the surface of proteins and applications to binding site prediction and characterization.

    Science.gov (United States)

    Beuming, Thijs; Che, Ye; Abel, Robert; Kim, Byungchan; Shanmugasundaram, Veerabahu; Sherman, Woody

    2012-03-01

    Water plays an essential role in determining the structure and function of all biological systems. Recent methodological advances allow for an accurate and efficient estimation of the thermodynamic properties of water molecules at the surface of proteins. In this work, we characterize these thermodynamic properties and relate them to various structural and functional characteristics of the protein. We find that high-energy hydration sites often exist near protein motifs typically characterized as hydrophilic, such as backbone amide groups. We also find that waters around alpha helices and beta sheets tend to be less stable than waters around loops. Furthermore, we find no significant correlation between the hydration site-free energy and the solvent accessible surface area of the site. In addition, we find that the distribution of high-energy hydration sites on the protein surface can be used to identify the location of binding sites and that binding sites of druggable targets tend to have a greater density of thermodynamically unstable hydration sites. Using this information, we characterize the FKBP12 protein and show good agreement between fragment screening hit rates from NMR spectroscopy and hydration site energetics. Finally, we show that water molecules observed in crystal structures are less stable on average than bulk water as a consequence of the high degree of spatial localization, thereby resulting in a significant loss in entropy. These findings should help to better understand the characteristics of waters at the surface of proteins and are expected to lead to insights that can guide structure-based drug design efforts. Copyright © 2011 Wiley Periodicals, Inc.

  5. Increased Autoreactivity of the Complement-Activating Molecule Mannan-Binding Lectin in a Type 1 Diabetes Model

    Directory of Open Access Journals (Sweden)

    Jakob Appel Østergaard

    2016-01-01

    Full Text Available Background. Diabetic kidney disease is the leading cause of end-stage renal failure despite intensive treatment of modifiable risk factors. Identification of new drug targets is therefore of paramount importance. The complement system is emerging as a potential new target. The lectin pathway of the complement system, initiated by the carbohydrate-recognition molecule mannan-binding lectin (MBL, is linked to poor kidney prognosis in diabetes. We hypothesized that MBL activates complement upon binding within the diabetic glomerulus. Methods. We investigated this by comparing complement deposition and activation in kidneys from streptozotocin-induced diabetic mice and healthy control mice. Results. After 20 weeks of diabetes, glomerular deposition of MBL was significantly increased. Diabetic animals had 2.0-fold higher (95% CI 1.6–2.5 immunofluorescence intensity from anti-MBL antibodies compared with controls (P<0.001. Diabetes and control groups did not differ in glomerular immunofluorescence intensity obtained by antibodies against complement factors C4, C3, and C9. However, the circulating complement activation product C3a was increased in diabetes as compared to control mice (P=0.04. Conclusion. 20 weeks of diabetes increased MBL autoreactivity in the kidney and circulating C3a concentration. Together with previous findings, these results indicate direct effects of MBL within the kidney in diabetes.

  6. Pathogen-Specific Binding Soluble Down Syndrome Cell Adhesion Molecule (Dscam Regulates Phagocytosis via Membrane-Bound Dscam in Crab

    Directory of Open Access Journals (Sweden)

    Xue-Jie Li

    2018-04-01

    Full Text Available The Down syndrome cell adhesion molecule (Dscam gene is an extraordinary example of diversity that can produce thousands of isoforms and has so far been found only in insects and crustaceans. Cumulative evidence indicates that Dscam may contribute to the mechanistic foundations of specific immune responses in insects. However, the mechanism and functions of Dscam in relation to pathogens and immunity remain largely unknown. In this study, we identified the genome organization and alternative Dscam exons from Chinese mitten crab, Eriocheir sinensis. These variants, designated EsDscam, potentially produce 30,600 isoforms due to three alternatively spliced immunoglobulin (Ig domains and a transmembrane domain. EsDscam was significantly upregulated after bacterial challenge at both mRNA and protein levels. Moreover, bacterial specific EsDscam isoforms were found to bind specifically with the original bacteria to facilitate efficient clearance. Furthermore, bacteria-specific binding of soluble EsDscam via the complete Ig1–Ig4 domain significantly enhanced elimination of the original bacteria via phagocytosis by hemocytes; this function was abolished by partial Ig1–Ig4 domain truncation. Further studies showed that knockdown of membrane-bound EsDscam inhibited the ability of EsDscam with the same extracellular region to promote bacterial phagocytosis. Immunocytochemistry indicated colocalization of the soluble and membrane-bound forms of EsDscam at the hemocyte surface. Far-Western and coimmunoprecipitation assays demonstrated homotypic interactions between EsDscam isoforms. This study provides insights into a mechanism by which soluble Dscam regulates hemocyte phagocytosis via bacteria-specific binding and specific interactions with membrane-bound Dscam as a phagocytic receptor.

  7. Peptide-binding motif prediction by using phage display library for SasaUBA*0301, a resistance haplotype of MHC class I molecule from Atlantic Salmon (Salmo salar)

    DEFF Research Database (Denmark)

    Zhao, Heng; Hermsen, Trudi; Stet, Rene J M

    2008-01-01

    The structure of the peptide-binding specificity of major histocompatibility complex (MHC) class I has been analyzed extensively in human and mouse. For fish, there are no crystallographic models of MHC molecules, neither are there data on the peptide-binding specificity. In this study, we descri...... and there is a significant association between MHC polymorphism and the disease resistance. Therefore, our study might contribute to designing a peptide vaccine against this viral disease....... class I molecule might have a very similar binding motif at the C-terminus compared with a known mouse class I molecule H2-Kb which has L, or I, V, M at p8. Previous work showed that Atlantic Salmon carrying the allele SasaUBA*0301 are resistant to infectious Salmon aneamia virus...

  8. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  9. Leaf-specific pathogenesis-related 10 homolog, PgPR-10.3, shows in silico binding affinity with several biologically important molecules

    Directory of Open Access Journals (Sweden)

    Jin Haeng Han

    2015-10-01

    Conclusion: Although ginseng PR-10.3 gene is expressed in all organs of 3-wk-old plantlets, its expression is restricted to leaves in mature 2-yr-old ginseng plants. The putative binding property of PgPR-10.3 with Re is intriguing. Further verification of binding affinity with other biologically important molecules in the large hydrophobic cavity of PgPR-10.3 may provide an insight into the biological features of PR-10 proteins.

  10. Neural cell adhesion molecule-180-mediated homophilic binding induces epidermal growth factor receptor (EGFR) down-regulation and uncouples the inhibitory function of EGFR in neurite outgrowth

    DEFF Research Database (Denmark)

    Povlsen, Gro Klitgaard; Berezin, Vladimir; Bock, Elisabeth

    2008-01-01

    The neural cell adhesion molecule (NCAM) plays important roles in neuronal development, regeneration, and synaptic plasticity. NCAM homophilic binding mediates cell adhesion and induces intracellular signals, in which the fibroblast growth factor receptor plays a prominent role. Recent studies...... this NCAM-180-induced EGFR down-regulation involves increased EGFR ubiquitination and lysosomal EGFR degradation. Furthermore, NCAM-180-mediated EGFR down-regulation requires NCAM homophilic binding and interactions of the cytoplasmic domain of NCAM-180 with intracellular interaction partners, but does...

  11. NetMHCpan-3.0; improved prediction of binding to MHC class I molecules integrating information from multiple receptor and peptide length datasets

    DEFF Research Database (Denmark)

    Nielsen, Morten; Andreatta, Massimo

    2016-01-01

    Background: Binding of peptides to MHC class I molecules (MHC-I) is essential for antigen presentation to cytotoxic T-cells.Results: Here, we demonstrate how a simple alignment step allowing insertions and deletions in a pan-specific MHC-I binding machine-learning model enables combining informat...... specificities and ligand length scales, and demonstrated how this approach significantly improves the accuracy for prediction of peptide binding and identification of MHC ligands. The method is available at www.cbs.dtu.dk/services/NetMHCpan-3.0....

  12. Combined quantum mechanics/molecular mechanics (QM/MM) simulations for protein-ligand complexes: free energies of binding of water molecules in influenza neuraminidase.

    Science.gov (United States)

    Woods, Christopher J; Shaw, Katherine E; Mulholland, Adrian J

    2015-01-22

    The applicability of combined quantum mechanics/molecular mechanics (QM/MM) methods for the calculation of absolute binding free energies of conserved water molecules in protein/ligand complexes is demonstrated. Here, we apply QM/MM Monte Carlo simulations to investigate binding of water molecules to influenza neuraminidase. We investigate five different complexes, including those with the drugs oseltamivir and peramivir. We investigate water molecules in two different environments, one more hydrophobic and one hydrophilic. We calculate the free-energy change for perturbation of a QM to MM representation of the bound water molecule. The calculations are performed at the BLYP/aVDZ (QM) and TIP4P (MM) levels of theory, which we have previously demonstrated to be consistent with one another for QM/MM modeling. The results show that the QM to MM perturbation is significant in both environments (greater than 1 kcal mol(-1)) and larger in the more hydrophilic site. Comparison with the same perturbation in bulk water shows that this makes a contribution to binding. The results quantify how electronic polarization differences in different environments affect binding affinity and also demonstrate that extensive, converged QM/MM free-energy simulations, with good levels of QM theory, are now practical for protein/ligand complexes.

  13. A peptide derived from a trans-homophilic binding site in neural cell adhesion molecule induces neurite outgrowth and neuronal survival

    DEFF Research Database (Denmark)

    Køhler, Lene B; Soroka, Vladislav; Korshunova, Irina

    2010-01-01

    The neural cell adhesion molecule (NCAM) plays a key role in neural development, regeneration, and synaptic plasticity. The crystal structure of a fragment of NCAM comprising the three N-terminal immunoglobulin (Ig)-like modules indicates that the first and second Ig modules bind to each other, t...

  14. MHC class I molecules with superenhanced CD8 binding properties bypass the requirement for cognate TCR recognition and nonspecifically activate CTLs

    NARCIS (Netherlands)

    L. Wooldridge (Linda); M. Clement (Mathew); A. Lissina (Anna); E.S.J. Edwards (Emily); K. Ladell (Kristin); J. Ekeruche (Julia); R.E. Hewitt (Rachel); B. Laugel (Bruno); E. Gostick (Emma); D.K. Cole (David); J.E.M.A. Debets (Reno); C.A. Berrevoets (Cor); J.J. Miles (John); S.R. Burrows (Scott); D.A. Price (David); A.K. Sewell (Andrew)

    2010-01-01

    textabstractCD8+CTLs are essential for effective immune defense against intracellular microbes and neoplasia. CTLs recognize short peptide fragments presented in association with MHC class I (MHCI) molecules on the surface of infected or dysregulated cells. Ag recognition involves the binding of

  15. Label-Free, LC-MS-Based Assays to Quantitate Small-Molecule Antagonist Binding to the Mammalian BLT1 Receptor.

    Science.gov (United States)

    Chen, Xun; Stout, Steven; Mueller, Uwe; Boykow, George; Visconti, Richard; Siliphaivanh, Phieng; Spencer, Kerrie; Presland, Jeremy; Kavana, Michael; Basso, Andrea D; McLaren, David G; Myers, Robert W

    2017-08-01

    We have developed and validated label-free, liquid chromatography-mass spectrometry (LC-MS)-based equilibrium direct and competition binding assays to quantitate small-molecule antagonist binding to recombinant human and mouse BLT1 receptors expressed in HEK 293 cell membranes. Procedurally, these binding assays involve (1) equilibration of the BLT1 receptor and probe ligand, with or without a competitor; (2) vacuum filtration through cationic glass fiber filters to separate receptor-bound from free probe ligand; and (3) LC-MS analysis in selected reaction monitoring mode for bound probe ligand quantitation. Two novel, optimized probe ligands, compounds 1 and 2, were identified by screening 20 unlabeled BLT1 antagonists for direct binding. Saturation direct binding studies confirmed the high affinity, and dissociation studies established the rapid binding kinetics of probe ligands 1 and 2. Competition binding assays were established using both probe ligands, and the affinities of structurally diverse BLT1 antagonists were measured. Both binding assay formats can be executed with high specificity and sensitivity and moderate throughput (96-well plate format) using these approaches. This highly versatile, label-free method for studying ligand binding to membrane-associated receptors should find broad application as an alternative to traditional methods using labeled ligands.

  16. Amino acid sequences mediating vascular cell adhesion molecule 1 binding to integrin alpha 4: homologous DSP sequence found for JC polyoma VP1 coat protein

    Directory of Open Access Journals (Sweden)

    Michael Andrew Meyer

    2013-07-01

    Full Text Available The JC polyoma viral coat protein VP1 was analyzed for amino acid sequences homologies to the IDSP sequence which mediates binding of VLA-4 (integrin alpha 4 to vascular cell adhesion molecule 1. Although the full sequence was not found, a DSP sequence was located near the critical arginine residue linked to infectivity of the virus and binding to sialic acid containing molecules such as integrins (3. For the JC polyoma virus, a DSP sequence was found at residues 70, 71 and 72 with homology also noted for the mouse polyoma virus and SV40 virus. Three dimensional modeling of the VP1 molecule suggests that the DSP loop has an accessible site for interaction from the external side of the assembled viral capsid pentamer.

  17. Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

    Science.gov (United States)

    Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

    2016-06-03

    Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Peptide binding motifs associated with MHC molecules common in Chinese rhesus macaques are analogous to those of human HLA supertypes, and include HLA-B27-like alleles

    OpenAIRE

    Mothé, Bianca R.; Southwood, Scott; Sidney, John; English, A. Michelle; Wriston, Amanda; Hoof, Ilka; Shabanowitz, Jeffrey; Hunt, Donald F.; Sette, Alessandro

    2013-01-01

    Chinese rhesus macaques are of particular interest in SIV/HIV research as these animals have prolonged kinetics of disease progression to AIDS, compared to their Indian counterparts, suggesting that they may be a better model for HIV. Nevertheless, the specific mechanism(s) accounting for these kinetics remains unclear. The study of Major Histocompatibility Complex (MHC) molecules, including their MHC:peptide binding motifs, provides valuable information for measuring cellular immune response...

  19. N-terminal aliphatic residues dictate the structure, stability, assembly, and small molecule binding of the coiled-coil region of cartilage oligomeric matrix protein.

    Science.gov (United States)

    Gunasekar, Susheel K; Asnani, Mukta; Limbad, Chandani; Haghpanah, Jennifer S; Hom, Wendy; Barra, Hanna; Nanda, Soumya; Lu, Min; Montclare, Jin Kim

    2009-09-15

    The coiled-coil domain of cartilage oligomeric matrix protein (COMPcc) assembles into a homopentamer that naturally recognizes the small molecule 1,25-dihydroxyvitamin D(3) (vit D). To identify the residues critical for the structure, stability, oligomerization, and binding to vit D as well as two other small molecules, all-trans-retinol (ATR) and curcumin (CCM), here we perform an alanine scanning mutagenesis study. Ten residues lining the hydrophobic pocket of COMPcc were mutated into alanine; of the mutated residues, the N-terminal aliphatic residues L37, L44, V47, and L51 are responsible for maintaining the structure and function. Furthermore, two polar residues, T40 and Q54, within the N-terminal region when converted into alanine improve the alpha-helical structure, stability, and self-assembly behavior. Helical stability, oligomerization, and binding appear to be linked in a manner in which mutations that abolish helical structure and assembly bind poorly to vit D, ATR, and CCM. These results provide not only insight into COMPcc and its functional role but also useful guidelines for the design of stable, pentameric coiled-coils capable of selectively storing and delivering various small molecules.

  20. Discovery of small molecules binding to the normal conformation of prion by combining virtual screening and multiple biological activity evaluation methods

    Science.gov (United States)

    Li, Lanlan; Wei, Wei; Jia, Wen-Juan; Zhu, Yongchang; Zhang, Yan; Chen, Jiang-Huai; Tian, Jiaqi; Liu, Huanxiang; He, Yong-Xing; Yao, Xiaojun

    2017-12-01

    Conformational conversion of the normal cellular prion protein, PrPC, into the misfolded isoform, PrPSc, is considered to be a central event in the development of fatal neurodegenerative diseases. Stabilization of prion protein at the normal cellular form (PrPC) with small molecules is a rational and efficient strategy for treatment of prion related diseases. However, few compounds have been identified as potent prion inhibitors by binding to the normal conformation of prion. In this work, to rational screening of inhibitors capable of stabilizing cellular form of prion protein, multiple approaches combining docking-based virtual screening, steady-state fluorescence quenching, surface plasmon resonance and thioflavin T fluorescence assay were used to discover new compounds interrupting PrPC to PrPSc conversion. Compound 3253-0207 that can bind to PrPC with micromolar affinity and inhibit prion fibrillation was identified from small molecule databases. Molecular dynamics simulation indicated that compound 3253-0207 can bind to the hotspot residues in the binding pocket composed by β1, β2 and α2, which are significant structure moieties in conversion from PrPC to PrPSc.

  1. Single-molecule Imaging Analysis of Binding, Processive Movement, and Dissociation of Cellobiohydrolase Trichoderma reesei Cel6A and Its Domains on Crystalline Cellulose*

    Science.gov (United States)

    Nakamura, Akihiko; Tasaki, Tomoyuki; Ishiwata, Daiki; Yamamoto, Mayuko; Okuni, Yasuko; Visootsat, Akasit; Maximilien, Morice; Noji, Hiroyuki; Uchiyama, Taku; Samejima, Masahiro; Igarashi, Kiyohiko; Iino, Ryota

    2016-01-01

    Trichoderma reesei Cel6A (TrCel6A) is a cellobiohydrolase that hydrolyzes crystalline cellulose into cellobiose. Here we directly observed the reaction cycle (binding, surface movement, and dissociation) of single-molecule intact TrCel6A, isolated catalytic domain (CD), cellulose-binding module (CBM), and CBM and linker (CBM-linker) on crystalline cellulose Iα. The CBM-linker showed a binding rate constant almost half that of intact TrCel6A, whereas those of the CD and CBM were only one-tenth of intact TrCel6A. These results indicate that the glycosylated linker region largely contributes to initial binding on crystalline cellulose. After binding, all samples showed slow and fast dissociations, likely caused by the two different bound states due to the heterogeneity of cellulose surface. The CBM showed much higher specificity to the high affinity site than to the low affinity site, whereas the CD did not, suggesting that the CBM leads the CD to the hydrophobic surface of crystalline cellulose. On the cellulose surface, intact molecules showed slow processive movements (8.8 ± 5.5 nm/s) and fast diffusional movements (30–40 nm/s), whereas the CBM-Linker, CD, and a catalytically inactive full-length mutant showed only fast diffusional movements. These results suggest that both direct binding and surface diffusion contribute to searching of the hydrolysable point of cellulose chains. The duration time constant for the processive movement was 7.7 s, and processivity was estimated as 68 ± 42. Our results reveal the role of each domain in the elementary steps of the reaction cycle and provide the first direct evidence of the processive movement of TrCel6A on crystalline cellulose. PMID:27609516

  2. Characterization of the Raf kinase inhibitory protein (RKIP) binding pocket: NMR-based screening identifies small-molecule ligands.

    Science.gov (United States)

    Shemon, Anne N; Heil, Gary L; Granovsky, Alexey E; Clark, Mathew M; McElheny, Dan; Chimon, Alexander; Rosner, Marsha R; Koide, Shohei

    2010-05-05

    Raf kinase inhibitory protein (RKIP), also known as phoshaptidylethanolamine binding protein (PEBP), has been shown to inhibit Raf and thereby negatively regulate growth factor signaling by the Raf/MAP kinase pathway. RKIP has also been shown to suppress metastasis. We have previously demonstrated that RKIP/Raf interaction is regulated by two mechanisms: phosphorylation of RKIP at Ser-153, and occupation of RKIP's conserved ligand binding domain with a phospholipid (2-dihexanoyl-sn-glycero-3-phosphoethanolamine; DHPE). In addition to phospholipids, other ligands have been reported to bind this domain; however their binding properties remain uncharacterized. In this study, we used high-resolution heteronuclear NMR spectroscopy to screen a chemical library and assay a number of potential RKIP ligands for binding to the protein. Surprisingly, many compounds previously postulated as RKIP ligands showed no detectable binding in near-physiological solution conditions even at millimolar concentrations. In contrast, we found three novel ligands for RKIP that specifically bind to the RKIP pocket. Interestingly, unlike the phospholipid, DHPE, these newly identified ligands did not affect RKIP binding to Raf-1 or RKIP phosphorylation. One out of the three ligands displayed off target biological effects, impairing EGF-induced MAPK and metabolic activity. This work defines the binding properties of RKIP ligands under near physiological conditions, establishing RKIP's affinity for hydrophobic ligands and the importance of bulky aliphatic chains for inhibiting its function. The common structural elements of these compounds defines a minimal requirement for RKIP binding and thus they can be used as lead compounds for future design of RKIP ligands with therapeutic potential.

  3. Characterization of the Raf kinase inhibitory protein (RKIP binding pocket: NMR-based screening identifies small-molecule ligands.

    Directory of Open Access Journals (Sweden)

    Anne N Shemon

    2010-05-01

    Full Text Available Raf kinase inhibitory protein (RKIP, also known as phoshaptidylethanolamine binding protein (PEBP, has been shown to inhibit Raf and thereby negatively regulate growth factor signaling by the Raf/MAP kinase pathway. RKIP has also been shown to suppress metastasis. We have previously demonstrated that RKIP/Raf interaction is regulated by two mechanisms: phosphorylation of RKIP at Ser-153, and occupation of RKIP's conserved ligand binding domain with a phospholipid (2-dihexanoyl-sn-glycero-3-phosphoethanolamine; DHPE. In addition to phospholipids, other ligands have been reported to bind this domain; however their binding properties remain uncharacterized.In this study, we used high-resolution heteronuclear NMR spectroscopy to screen a chemical library and assay a number of potential RKIP ligands for binding to the protein. Surprisingly, many compounds previously postulated as RKIP ligands showed no detectable binding in near-physiological solution conditions even at millimolar concentrations. In contrast, we found three novel ligands for RKIP that specifically bind to the RKIP pocket. Interestingly, unlike the phospholipid, DHPE, these newly identified ligands did not affect RKIP binding to Raf-1 or RKIP phosphorylation. One out of the three ligands displayed off target biological effects, impairing EGF-induced MAPK and metabolic activity.This work defines the binding properties of RKIP ligands under near physiological conditions, establishing RKIP's affinity for hydrophobic ligands and the importance of bulky aliphatic chains for inhibiting its function. The common structural elements of these compounds defines a minimal requirement for RKIP binding and thus they can be used as lead compounds for future design of RKIP ligands with therapeutic potential.

  4. The common equine class I molecule Eqca-1*00101 (ELA-A3.1) is characterized by narrow peptide binding and T cell epitope repertoires.

    Science.gov (United States)

    Bergmann, Tobias; Moore, Carrie; Sidney, John; Miller, Donald; Tallmadge, Rebecca; Harman, Rebecca M; Oseroff, Carla; Wriston, Amanda; Shabanowitz, Jeffrey; Hunt, Donald F; Osterrieder, Nikolaus; Peters, Bjoern; Antczak, Douglas F; Sette, Alessandro

    2015-11-01

    Here we describe a detailed quantitative peptide-binding motif for the common equine leukocyte antigen (ELA) class I allele Eqca-1*00101, present in roughly 25 % of Thoroughbred horses. We determined a preliminary binding motif by sequencing endogenously bound ligands. Subsequently, a positional scanning combinatorial library (PSCL) was used to further characterize binding specificity and derive a quantitative motif involving aspartic acid in position 2 and hydrophobic residues at the C-terminus. Using this motif, we selected and tested 9- and 10-mer peptides derived from the equine herpesvirus type 1 (EHV-1) proteome for their capacity to bind Eqca-1*00101. PSCL predictions were very efficient, with an receiver operating characteristic (ROC) curve performance of 0.877, and 87 peptides derived from 40 different EHV-1 proteins were identified with affinities of 500 nM or higher. Quantitative analysis revealed that Eqca-1*00101 has a narrow peptide-binding repertoire, in comparison to those of most human, non-human primate, and mouse class I alleles. Peripheral blood mononuclear cells from six EHV-1-infected, or vaccinated but uninfected, Eqca-1*00101-positive horses were used in IFN-γ enzyme-linked immunospot (ELISPOT) assays. When we screened the 87 Eqca-1*00101-binding peptides for T cell reactivity, only one Eqca-1*00101 epitope, derived from the intermediate-early protein ICP4, was identified. Thus, despite its common occurrence in several horse breeds, Eqca-1*00101 is associated with a narrow binding repertoire and a similarly narrow T cell response to an important equine viral pathogen. Intriguingly, these features are shared with other human and macaque major histocompatibility complex (MHC) molecules with a similar specificity for D in position 2 or 3 in their main anchor motif.

  5. Expression of human FcgammaRIIIa as a GPI-linked molecule on CHO cells to enable measurement of human IgG binding.

    Science.gov (United States)

    Armour, Kathryn L; Smith, Cheryl S; Clark, Michael R

    2010-03-31

    The efficacy of a therapeutic IgG molecule may be as dependent on the optimisation of the constant region to suit its intended indication as on the selection of its variable regions. A crucial effector function to be maximised or minimised is antibody-dependent cell-mediated cytotoxicity by natural killer cells. Traditional assays of ADCC activity suffer from considerable inter-donor and intra-donor variability, which makes the measurement of antibody binding to human FcgammaRIIIa, the key receptor for ADCC, an attractive alternative method of assessment. Here, we describe the development of cell lines and assays for this purpose. The transmembrane receptor, FcgammaRIIIa, requires co-expression with signal transducing subunits to prevent its degradation, unlike the homologous receptor FcgammaRIIIb that is expressed as a GPI-anchored molecule. Therefore, to simplify the production of cell lines as reliable assay components, we expressed FcgammaRIIIa as a GPI-anchored molecule. Separate, stable CHO cell lines that express either the 158F or the higher-affinity 158V allotype of FcgammaRIIIa were isolated using fluorescence-activated cell sorting. The identities of the expressed receptors were confirmed using a panel of monoclonal antibodies that distinguish between subclasses and allotypes of FcgammaRIII and the cell lines were shown to have slightly higher levels of receptor than FcgammaRIII-positive peripheral blood mononuclear cells. Because the affinity of FcgammaRIIIa for IgG is intermediate amongst the receptors that bind IgG, we were able to use these cell lines to develop flow cytometric assays to measure the binding of both complexed and monomeric immunoglobulin. Thus, by choosing the appropriate method, weakly- or strongly-binding IgG can be efficiently compared. We have quantified the difference in the binding of wildtype IgG1 and IgG3 molecules to the two functional allotypes of the receptor and report that the FcgammaRIIIa-158V-antibody interaction is 3

  6. Studies on 16α-Hydroxylation of Steroid Molecules and Regioselective Binding Mode in Homology-Modeled Cytochrome P450-2C11

    Directory of Open Access Journals (Sweden)

    Hamed I. Ali

    2011-01-01

    Full Text Available We investigated the 16α-hydroxylation of steroid molecules and regioselective binding mode in homology-modeled cytochrome P450-2C11 to correlate the biological study with the computational molecular modeling. It revealed that there was a positive relationship between the observed inhibitory potencies and the binding free energies. Docking of steroid molecules into this homology-modeled CYP2C11 indicated that 16α-hydroxylation is favored with steroidal molecules possessing the following components, (1 a bent A-B ring configuration (5β-reduced, (2 C-3 α-hydroxyl group, (3 C-17β-acetyl group, and (4 methyl group at both the C-18 and C-19. These respective steroid components requirements were defined as the inhibitory contribution factor. Overall studies of the male rat CYP2C11 metabolism revealed that the above-mentioned steroid components requirements were essential to induce an effective inhibition of [3H]progesterone 16α-hydroxylation. As far as docking of homology-modeled CYP2C11 against investigated steroids is concerned, they are docked at the active site superimposed with flurbiprofen. It was also found that the distance between heme iron and C16α-H was between 4 to 6 Å and that the related angle was in the range of 180±45∘.

  7. Computational Characterization of Small Molecules Binding to the Human XPF Active Site and Virtual Screening to Identify Potential New DNA Repair Inhibitors Targeting the ERCC1-XPF Endonuclease

    Directory of Open Access Journals (Sweden)

    Francesco Gentile

    2018-04-01

    Full Text Available The DNA excision repair protein ERCC-1-DNA repair endonuclease XPF (ERCC1-XPF is a heterodimeric endonuclease essential for the nucleotide excision repair (NER DNA repair pathway. Although its activity is required to maintain genome integrity in healthy cells, ERCC1-XPF can counteract the effect of DNA-damaging therapies such as platinum-based chemotherapy in cancer cells. Therefore, a promising approach to enhance the effect of these therapies is to combine their use with small molecules, which can inhibit the repair mechanisms in cancer cells. Currently, there are no structures available for the catalytic site of the human ERCC1-XPF, which performs the metal-mediated cleavage of a DNA damaged strand at 5′. We adopted a homology modeling strategy to build a structural model of the human XPF nuclease domain which contained the active site and to extract dominant conformations of the domain using molecular dynamics simulations followed by clustering of the trajectory. We investigated the binding modes of known small molecule inhibitors targeting the active site to build a pharmacophore model. We then performed a virtual screening of the ZINC Is Not Commercial 15 (ZINC15 database to identify new ERCC1-XPF endonuclease inhibitors. Our work provides structural insights regarding the binding mode of small molecules targeting the ERCC1-XPF active site that can be used to rationally optimize such compounds. We also propose a set of new potential DNA repair inhibitors to be considered for combination cancer therapy strategies.

  8. Development of a Surface Plasmon Resonance Assay for the Characterization of Small-Molecule Binding Kinetics and Mechanism of Binding to Kynurenine 3-Monooxygenase.

    Science.gov (United States)

    Poda, Suresh B; Kobayashi, Masakazu; Nachane, Ruta; Menon, Veena; Gandhi, Adarsh S; Budac, David P; Li, Guiying; Campbell, Brian M; Tagmose, Lena

    2015-10-01

    Kynurenine 3-monooxygenase (KMO), a pivotal enzyme in the kynurenine pathway, was identified as a potential therapeutic target for treating neurodegenerative and psychiatric disorders. In this article, we describe a surface plasmon resonance (SPR) assay that delivers both kinetics and the mechanism of binding (MoB) data, enabling a detailed characterization of KMO inhibitors for the enzyme in real time. SPR assay development included optimization of the protein construct and the buffer conditions. The stability and inhibitor binding activity of the immobilized KMO were significantly improved when the experiments were performed at 10°C using a buffer containing 0.05% n-dodecyl-β-d-maltoside (DDM) as the detergent. The KD values of the known KMO inhibitors (UPF648 and RO61-8048) from the SPR assay were in good accordance with the biochemical LC/MS/MS assay. Also, the SPR assay was able to differentiate the binding kinetics (k(a) and k(d)) of the selected unknown KMO inhibitors. For example, the inhibitors that showed comparable IC50 values in the LC/MS/MS assay displayed differences in their residence time (τ = 1/k(d)) in the SPR assay. To better define the MoB of the inhibitors to KMO, an SPR-based competition assay was developed, which demonstrated that both UPF648 and RO61-8048 bound to the substrate-binding site. These results demonstrate the potential of the SPR assay for characterizing the affinity, the kinetics, and the MoB profiles of the KMO inhibitors.

  9. A tight-binding model of the transmission probability through a molecular junction; a single molecule vs. a molecular layer

    International Nuclear Information System (INIS)

    Landau, A.; Nitzan, A.

    2006-01-01

    Full Text: Molecular electronics, one of the major fields of the current effort in nano-science, may be de ed as the study of electronic behaviors, devices and applications that depend on the properties of matter at the molecular scale. If the miniaturization trend of microelectronic devices is to continue, elements such as transistors and contacts will soon shrink to single molecules. The promise of these new technological breakthroughs has been major driving force in this ld. Moreover, the consideration of molecular systems as electronic devices has raised new fundamental questions. In particular, while traditional quantum chemistry deals with electronically closed systems, we now face problems involving molecular systems that are open to their electronic environment, moreover, function in far from equilibrium situations. A generic molecular junction is made of two electrodes connected by a molecular spacer that takes the form of a molecular chain of varying length or a molecular layer of varying thickness. We use a simple nearest-neighbors tight-biding model with the non-equilibrium Green's function (NEGF) method to investigate and compare between a self-assembled monolayer (SAM), finite molecular layer (FML), and single molecule (SM) chemisorption to a surface of a metal substrate. In addition, we examine the difference in the transmission probability through a SAM, FML and SM sandwiched between two metallic electrodes. Dramatic differences are observed between the SM, FML and SAM density of electronic states and transmission functions. In addition, we analyze the effects of changing different physical parameters such as molecule-substrate interaction, molecule-molecule interactions, etc; interesting effects that pertain to the conduction properties of single molecules and molecular layers are observed. Intriguing results are attained when we investigate the commensurability of the SAM with the metallic surface

  10. Two intestinal specific nuclear factors binding to the lactase-phlorizin hydrolase and sucrase-isomaltase promoters are functionally related oligomeric molecules

    DEFF Research Database (Denmark)

    Troelsen, J T; Mitchelmore, C; Sjöström, H

    1994-01-01

    Lactase-phlorizin hydrolase (LPH) and sucrase-isomaltase (SI) are enterocyte-specific gene products. The identification of regulatory cis-elements in the promoter of these two genes has enabled us to carry out comparative studies of the corresponding intestinal-specific nuclear factors (NF-LPH1...... and SIF1-BP). Electrophoretic mobility shift assays demonstrated that the two nuclear factors compete for binding on the same cis-elements. The molecular size of the DNA binding polypeptide is estimated to be approximately 50 kDa for both factors. In the native form the factors are found as 250 k......Da oligomeric complexes. Based on these results NF-LPH1 and SIF1-BP are suggested to be either identical or closely related molecules....

  11. Assessment of Density-Functional Tight-Binding Ionization Potentials and Electron Affinities of Molecules of Interest for Organic Solar Cells Against First-Principles GW Calculations

    Directory of Open Access Journals (Sweden)

    Ala Aldin M. H. M. Darghouth

    2015-12-01

    Full Text Available Ionization potentials (IPs and electron affinities (EAs are important quantities input into most models for calculating the open-circuit voltage (Voc of organic solar cells. We assess the semi-empirical density-functional tight-binding (DFTB method with the third-order self-consistent charge (SCC correction and the 3ob parameter set (the third-order DFTB (DFTB3 organic and biochemistry parameter set against experiments (for smaller molecules and against first-principles GW (Green’s function, G, times the screened potential, W calculations (for larger molecules of interest in organic electronics for the calculation of IPs and EAs. Since GW calculations are relatively new for molecules of this size, we have also taken care to validate these calculations against experiments. As expected, DFTB is found to behave very much like density-functional theory (DFT, but with some loss of accuracy in predicting IPs and EAs. For small molecules, the best results were found with ΔSCF (Δ self-consistent field SCC-DFTB calculations for first IPs (good to ± 0.649 eV. When considering several IPs of the same molecule, it is convenient to use the negative of the orbital energies (which we refer to as Koopmans’ theorem (KT IPs as an indication of trends. Linear regression analysis shows that KT SCC-DFTB IPs are nearly as accurate as ΔSCF SCC-DFTB eigenvalues (± 0.852 eV for first IPs, but ± 0.706 eV for all of the IPs considered here for small molecules. For larger molecules, SCC-DFTB was also the ideal choice with IP/EA errors of ± 0.489/0.740 eV from ΔSCF calculations and of ± 0.326/0.458 eV from (KT orbital energies. Interestingly, the linear least squares fit for the KT IPs of the larger molecules also proves to have good predictive value for the lower energy KT IPs of smaller molecules, with significant deviations appearing only for IPs of 15–20 eV or larger. We believe that this quantitative analysis of errors in SCC-DFTB IPs and EAs may be of

  12. The pattern recognition molecule ficolin-1 exhibits differential binding to lymphocyte subsets, providing a novel link between innate and adaptive immunity

    DEFF Research Database (Denmark)

    Genster, Ninette; Ma, Ying Jie; Munthe-Fog, Lea

    2014-01-01

    is unknown. Recognition of healthy host cells by a pattern recognition molecule constitutes a potential hazard to self cells and tissues, emphasizing the importance of further elucidating the reported self-recognition. In the current study we investigated the potential recognition of lymphocytes by ficolin-1...... and demonstrated that CD56(dim) NK-cells and both CD4(+) and CD8(+) subsets of activated T-cells were recognized by ficolin-1. In contrast we did not detect binding of ficolin-1 to CD56(bright) NK-cells, NKT-cells, resting T-cells or B-cells. Furthermore, we showed that the protein-lymphocyte interaction occurred...

  13. Binding of sFRP-3 to EGF in the extra-cellular space affects proliferation, differentiation and morphogenetic events regulated by the two molecules.

    Directory of Open Access Journals (Sweden)

    Raffaella Scardigli

    Full Text Available BACKGROUND: sFRP-3 is a soluble antagonist of Wnts, widely expressed in developing embryos. The Wnt gene family comprises cysteine-rich secreted ligands that regulate cell proliferation, differentiation, organogenesis and oncogenesis of different organisms ranging from worms to mammals. In the canonical signal transduction pathway Wnt proteins bind to the extracellular domain of Frizzled receptors and consequently recruit Dishevelled (Dsh to the cell membrane. In addition to Wnt membrane receptors belonging to the Frizzled family, several other molecules have been described which share homology in the CRD domain and lack the putative trans-membrane domain, such as sFRP molecules (soluble Frizzled Related Protein. Among them, sFRP-3 was originally isolated from bovine articular cartilage and also as a component of the Spemann organizer. sFRP-3 blocks Wnt-8 induced axis duplication in Xenopus embryos and binds to the surface of cells expressing a membrane-anchored form of Wnt-1. Injection of sFRP-3 mRNA blocks expression of XMyoD mRNA and leads to embryos with enlarged heads and shortened trunks. METHODOLOGY/PRINCIPAL FINDINGS: Here we report that sFRP-3 specifically blocks EGF-induced fibroblast proliferation and foci formation. Over-expression of sFRP-3 reverts EGF-mediated inhibition of hair follicle development in the mouse ectoderm while its ablation in Xenopus maintains EGF-mediated inhibition of ectoderm differentiation. Conversely, over-expression of EGF reverts the inhibition of somitic myogenesis and axis truncation in Xenopus and mouse embryos caused by sFRP-3. In vitro experiments demonstrated a direct binding of EGF to sFRP-3 both on heparin and on the surface of CHO cells where the molecule had been membrane anchored. CONCLUSIONS/SIGNIFICANCE: sFRP-3 and EGF reciprocally inhibit their effects on cell proliferation, differentiation and morphogenesis and indeed are expressed in contiguous domains of the embryo, suggesting that in

  14. Site-specific binding of a water molecule to the sulfa drugs sulfamethoxazole and sulfisoxazole: a laser-desorption isomer-specific UV and IR study.

    Science.gov (United States)

    Uhlemann, Thomas; Seidel, Sebastian; Müller, Christian W

    2018-03-07

    To determine the preferred water molecule binding sites of the polybasic sulfa drugs sulfamethoxazole (SMX) and sulfisoxazole (SIX), we have studied their monomers and monohydrated complexes through laser-desorption conformer-specific UV and IR spectroscopy. Both the SMX and SIX monomer adopt a single conformer in the molecular beam. On the basis of their conformer-specific IR spectra in the NH stretch region, these conformers were assigned to the SMX and SIX global minimum structures, both exhibiting a staggered sulfonamide group and an intramolecular C-HO[double bond, length as m-dash]S hydrogen bond. The SMX-H 2 O and SIX-H 2 O complexes each adopt a single isomer in the molecular beam. Their isomeric structures were determined based on their isomer-specific IR spectra in the NH/OH stretch region. Quantum Theory of Atoms in Molecules analysis of the calculated electron densities revealed that in the SMX-H 2 O complex the water molecule donates an O-HN hydrogen bond to the heterocycle nitrogen atom and accepts an N-HO hydrogen bond from the sulfonamide NH group. In the SIX-H 2 O complex, however, the water molecule does not bind to the heterocycle but instead donates an O-HO[double bond, length as m-dash]S hydrogen bond to the sulfonamide group and accepts an N-HO hydrogen bond from the sulfonamide NH group. Both water complexes are additionally stabilized by a C ph -HOH 2 hydrogen bond. Interacting Quantum Atoms analysis suggests that all intermolecular hydrogen bonds are dominated by the short-range exchange-correlation contribution.

  15. Cell-killing efficiency and number of platinum atoms binding to DNA, RNA and protein molecules of HeLa cells treated with combinations of hyperthermia and carboplatin

    International Nuclear Information System (INIS)

    Akaboshi, M.; Kawai, K.; Tanaka, Y.; Takada, J.; Sumino, T.

    1999-01-01

    The effect of hyperthermia on the cell killing efficiency of Pt atoms binding to DNA, RNA and protein molecules of HeLa cells treated with cis-diamine(1,1-cyclobutanedicarboxylato)platinum(II) (CBDCA) was examined. HeLa S-3 cells were treated with 195m Pt-radiolabeled CBDCA for 60 minutes at various temperatures, and the relationship between the lethal effect and the number of Pt atoms binding to DNA, RNA and proteins was examined. The mean lethal concentration (D 0 ) of carboplatin for a 60 min-treatment at 0, 25, 37, 40, 42 and 44 deg C was 671.2, 201.5, 67.3, 33.4, 20.2 and 15.6 μM, respectively. By using identically treated cells, the number of Pt-atoms combined with DNA, RNA and protein molecules were determined in the subcellular fractions. Thus, the D 0 's given as the drug concentrations were replaced with the number of Pt-atoms combined in each fraction. Then, the cell-killing efficiency of the Pt atom was expressed as the reciprocal of the number of Pt-atoms combined and was calculated for each molecule. The efficiency for DNA molecules was 0.699, 1.42, 2.65, 4.84, 7.74 and 8.28x10 4 nucleotides, respectively, for the conditions described above. From 0 to 44 deg C, the cell-killing efficiency of Pt atoms increased by a factor of 11.9. (author)

  16. A remote arene-binding site on prostate specific membrane antigen revealed by antibody-recruiting small molecules

    Czech Academy of Sciences Publication Activity Database

    Zhang, A.X.; Murelli, R.P.; Bařinka, Cyril; Michel, J.; Cocleaza, A.; Jorgensen, W.L.; Lubkowski, J.; Spiegel, D.A.

    2010-01-01

    Roč. 132, č. 36 (2010), s. 12711-12716 ISSN 0002-7863 Institutional research plan: CEZ:AV0Z50520701 Keywords : Prostate -specific membrane antigen * antibody recruiting molecules * Structure-activity relationship Subject RIV: CE - Biochemistry Impact factor: 9.019, year: 2010

  17. Multivariate Metal-Organic Frameworks for Dialing-in the Binding and Programming the Release of Drug Molecules.

    Science.gov (United States)

    Dong, Zhiyue; Sun, Yangzesheng; Chu, Jun; Zhang, Xianzheng; Deng, Hexiang

    2017-10-11

    We report the control of guest release profiles by dialing-in desirable interactions between guest molecules and pores in metal-organic frameworks (MOFs). The interactions can be derived by the rate constants that were quantitatively correlated with the type of functional group and its proportion in the porous structure; thus the release of guest molecules can be predicted and programmed. Specifically, three probe molecules (ibuprofen, rhodamine B, and doxorubicin) were studied in a series of robust and mesoporous MOFs with multiple functional groups [MIL-101(Fe)-(NH 2 ) x , MIL-101(Fe)-(C 4 H 4 ) x , and MIL-101(Fe)-(C 4 H 4 ) x (NH 2 ) 1-x ]. The release rate can be adjusted by 32-fold [rhodamine from MIL-101(Fe)-(NH 2 ) x ], and the time of release peak can be shifted by up to 12 days over a 40-day release period [doxorubicin from MIL-101(Fe)-(C 4 H 4 ) x (NH 2 ) 1-x ], which was not obtained in the physical mixture of the single component MOF counterparts nor in other porous materials. The corelease of two pro-drug molecules (ibuprofen and doxorubicin) was also achieved.

  18. Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

    DEFF Research Database (Denmark)

    Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

    2017-01-01

    The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

  19. Cloning of a novel phosphotyrosine binding domain containing molecule, Odin, involved in signaling by receptor tyrosine kinases

    DEFF Research Database (Denmark)

    Pandey, A.; Blagoev, B.; Kratchmarova, I.

    2002-01-01

    . Deletion analysis showed that the phosphotyrosine binding domain of Odin is not required for its tyrosine phosphorylation. Overexpression of Odin, but not an unrelated adapter protein, Grb2, inhibited EGF-induced activation of c-Fos promoter. Microinjection of wild-type or a mutant version lacking the PTB...

  20. Structure of BT-3984, a member of the SusD/RagB family of nutrient-binding molecules

    International Nuclear Information System (INIS)

    Bakolitsa, Constantina; Xu, Qingping; Rife, Christopher L.; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L.; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Clayton, Thomas; Das, Debanu; Deller, Marc C.; Duan, Lian; Ellrott, Kyle; Farr, Carol L.; Feuerhelm, Julie; Grant, Joanna C.; Grzechnik, Anna; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K.; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Kumar, Abhinav; Lam, Winnie W.; Marciano, David; McMullan, Daniel; Miller, Mitchell D.; Morse, Andrew T.; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Puckett, Christina; Reyes, Ron; Tien, Henry J.; Trame, Christine B.; Bedem, Henry van den; Weekes, Dana; Hodgson, Keith O.; Wooley, John; Elsliger, Marc-André; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.

    2010-01-01

    The crystal structure of BT-3984, a SusD-family protein, reveals a TPR N-terminal region providing support for a loop-rich C-terminal subdomain and suggests possible interfaces involved in sus complex formation. The crystal structure of the Bacteroides thetaiotaomicron protein BT-3984 was determined to a resolution of 1.7 Å and was the first structure to be determined from the extensive SusD family of polysaccharide-binding proteins. SusD is an essential component of the sus operon that defines the paradigm for glycan utilization in dominant members of the human gut microbiota. Structural analysis of BT-3984 revealed an N-terminal region containing several tetratricopeptide repeats (TPRs), while the signature C-terminal region is less structured and contains extensive loop regions. Sequence and structure analysis of BT-3984 suggests the presence of binding interfaces for other proteins from the polysaccharide-utilization complex

  1. Reconstruction of calmodulin single-molecule FRET states, dye interactions, and CaMKII peptide binding by MultiNest and classic maximum entropy

    Science.gov (United States)

    DeVore, Matthew S.; Gull, Stephen F.; Johnson, Carey K.

    2013-08-01

    We analyzed single molecule FRET burst measurements using Bayesian nested sampling. The MultiNest algorithm produces accurate FRET efficiency distributions from single-molecule data. FRET efficiency distributions recovered by MultiNest and classic maximum entropy are compared for simulated data and for calmodulin labeled at residues 44 and 117. MultiNest compares favorably with maximum entropy analysis for simulated data, judged by the Bayesian evidence. FRET efficiency distributions recovered for calmodulin labeled with two different FRET dye pairs depended on the dye pair and changed upon Ca2+ binding. We also looked at the FRET efficiency distributions of calmodulin bound to the calcium/calmodulin dependent protein kinase II (CaMKII) binding domain. For both dye pairs, the FRET efficiency distribution collapsed to a single peak in the case of calmodulin bound to the CaMKII peptide. These measurements strongly suggest that consideration of dye-protein interactions is crucial in forming an accurate picture of protein conformations from FRET data.

  2. Reconstruction of Calmodulin Single-Molecule FRET States, Dye-Interactions, and CaMKII Peptide Binding by MultiNest and Classic Maximum Entropy.

    Science.gov (United States)

    Devore, Matthew S; Gull, Stephen F; Johnson, Carey K

    2013-08-30

    We analyze single molecule FRET burst measurements using Bayesian nested sampling. The MultiNest algorithm produces accurate FRET efficiency distributions from single-molecule data. FRET efficiency distributions recovered by MultiNest and classic maximum entropy are compared for simulated data and for calmodulin labeled at residues 44 and 117. MultiNest compares favorably with maximum entropy analysis for simulated data, judged by the Bayesian evidence. FRET efficiency distributions recovered for calmodulin labeled with two different FRET dye pairs depended on the dye pair and changed upon Ca 2+ binding. We also looked at the FRET efficiency distributions of calmodulin bound to the calcium/calmodulin dependent protein kinase II (CaMKII) binding domain. For both dye pairs, the FRET efficiency distribution collapsed to a single peak in the case of calmodulin bound to the CaMKII peptide. These measurements strongly suggest that consideration of dye-protein interactions is crucial in forming an accurate picture of protein conformations from FRET data.

  3. Quantum dynamics study on the binding of a positron to vibrationally excited states of hydrogen cyanide molecule

    Science.gov (United States)

    Takayanagi, Toshiyuki; Suzuki, Kento; Yoshida, Takahiko; Kita, Yukiumi; Tachikawa, Masanori

    2017-05-01

    We present computational results of vibrationally enhanced positron annihilation in the e+ + HCN/DCN collisions within a local complex potential model. Vibrationally elastic and inelastic cross sections and effective annihilation rates were calculated by solving a time-dependent complex-potential Schrödinger equation under the ab initio potential energy surface for the positron attached HCN molecule, [HCN; e+], with multi-component configuration interaction level (Kita and Tachikawa, 2014). We discuss the effect of vibrational excitation on the positron affinities from the obtained vibrational resonance features.

  4. An Augmented Pocketome: Detection and Analysis of Small-Molecule Binding Pockets in Proteins of Known 3D Structure.

    Science.gov (United States)

    Bhagavat, Raghu; Sankar, Santhosh; Srinivasan, Narayanaswamy; Chandra, Nagasuma

    2018-03-06

    Protein-ligand interactions form the basis of most cellular events. Identifying ligand binding pockets in proteins will greatly facilitate rationalizing and predicting protein function. Ligand binding sites are unknown for many proteins of known three-dimensional (3D) structure, creating a gap in our understanding of protein structure-function relationships. To bridge this gap, we detect pockets in proteins of known 3D structures, using computational techniques. This augmented pocketome (PocketDB) consists of 249,096 pockets, which is about seven times larger than what is currently known. We deduce possible ligand associations for about 46% of the newly identified pockets. The augmented pocketome, when subjected to clustering based on similarities among pockets, yielded 2,161 site types, which are associated with 1,037 ligand types, together providing fold-site-type-ligand-type associations. The PocketDB resource facilitates a structure-based function annotation, delineation of the structural basis of ligand recognition, and provides functional clues for domains of unknown functions, allosteric proteins, and druggable pockets. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Borreliacidal activity of Borrelia metal transporter A (BmtA binding small molecules by manganese transport inhibition

    Directory of Open Access Journals (Sweden)

    Wagh D

    2015-02-01

    Full Text Available Dhananjay Wagh,* Venkata Raveendra Pothineni,* Mohammed Inayathullah, Song Liu, Kwang-Min Kim, Jayakumar Rajadas Biomaterials and Advanced Drug Delivery Laboratory, Stanford Cardiovascular Pharmacology Division, Cardiovascular Institute, Stanford University School of Medicine, Palo Alto, CA, USA *These authors contributed equally to this work  Abstract: Borrelia burgdorferi, the causative agent of Lyme disease, utilizes manganese (Mn for its various metabolic needs. We hypothesized that blocking Mn transporter could be a possible approach to inhibit metabolic activity of this pathogen and eliminate the infection. We used a combination of in silico protein structure prediction together with molecular docking to target the Borrelia metal transporter A (BmtA, a single known Mn transporter in Borrelia and screened libraries of FDA approved compounds that could potentially bind to the predicted BmtA structure with high affinity. Tricyclic antihistamines such as loratadine, desloratadine, and 3-hydroxydesloratadine as well as yohimbine and tadalafil demonstrated a tight binding to the in silico folded BmtA transporter. We, then, tested borreliacidal activity and dose response of the shortlisted compounds from this screen using a series of in vitro assays. Amongst the probed compounds, desloratadine exhibited potent borreliacidal activity in vitro at and above 78 µg/mL (250 µM. Borrelia treated with lethal doses of desloratadine exhibited a significant loss of intracellular Mn specifically and a severe structural damage to the bacterial cell wall. Our results support the possibility of developing a novel, targeted therapy to treat Lyme disease by targeting specific metabolic needs of Borrelia.  Keywords: Lyme disease, BmtA, Borrelia burgdorferi, desloratadine, Bac Titer-Glo assay

  6. Identification of the Ulex europaeus agglutinin-I-binding protein as a unique glycoform of the neural cell adhesion molecule in the olfactory sensory axons of adults rats.

    Science.gov (United States)

    Pestean, A; Krizbai, I; Böttcher, H; Párducz, A; Joó, F; Wolff, J R

    1995-08-04

    Histochemical localization of two lectins, Ulex europaeus agglutinin-I (UEA-I) and Tetragonolobus purpureus (TPA), was studied in the olfactory bulb of adult rats. In contrast to TPA, UEA-I detected a fucosylated glycoprotein that is only present in the surface membranes of olfactory sensory cells including the whole course of their neurites up to the final arborization in glomeruli. Immunoblotting revealed that UEA-I binds specifically to a protein of 205 kDa, while TPA stains several other glycoproteins. Affinity chromatography with the use of a UEA-I column identified the 205 kDa protein as a glycoform of neural cell adhesion molecule (N-CAM), specific for the rat olfactory sensory nerves.

  7. The HER2-binding affibody molecule (Z(HER2∶342₂ increases radiosensitivity in SKBR-3 cells.

    Directory of Open Access Journals (Sweden)

    Lina Ekerljung

    Full Text Available We have previously shown that the HER2-specific affibody molecule (Z(HER2∶342₂ inhibits proliferation of SKBR-3 cells. Here, we continue to investigate its biological effects in vitro by studying receptor dimerization and clonogenic survival following irradiation. We found that (Z(HER2∶342₂ sensitizes the HER2-overexpressing cell line SKBR-3 to ionizing radiation. The survival after exposure to (Z(HER2∶342₂ and 8 Gy (S(8Gy 0.006 was decreased by a factor four compared to the untreated (S(8Gy 0.023. The low HER2-expressing cell line MCF-7 was more radiosensitive than SKBR-3 but did not respond to (Z(HER2∶342₂. Treatment by (Z(HER2∶342₂ strongly increased the levels of dimerized and phosphorylated HER2 even after 5 minutes of stimulation. The monomeric Z(HER2∶342 does not seem to be able to induce receptor phosphorylation and dimerization or sensitize cells to irradiation.

  8. Hyperthermostable binding molecules on phage: Assay components for point-of-care diagnostics for active tuberculosis infection.

    Science.gov (United States)

    Zhao, Ning; Spencer, John; Schmitt, Margaret A; Fisk, John D

    2017-03-15

    Tuberculosis is the leading cause of death from infectious disease worldwide. The low sensitivity, extended processing time, and high expense of current diagnostics are major challenges to the detection and treatment of tuberculosis. Mycobacterium tuberculosis ornithine transcarbamylase (Mtb OTC, Rv1656) has been identified in the urine of patients with active TB infection and is a promising target for point-of-care diagnostics. Specific binding proteins with low nanomolar affinities for Mtb OTC were selected from a phage display library built upon a hyperthermostable Sso7d scaffold. Phage particles displaying Sso7d variants were utilized to generate a sandwich ELISA-based assay for Mtb OTC. The assay response is linear between 2 ng/mL and 125 ng/mL recombinant Mtb OTC and has a limit of detection of 400 pg/mL recombinant Mtb OTC. The assay employing a phage-based detection reagent is comparable to commercially-available antibody-based biosensors. Importantly, the assay maintains functionality at both neutral and basic pH in presence of salt and urea over the range of concentrations typical for human urine. Phage-based diagnostic systems may feature improved physical stability and cost of production relative to traditional antibody-based reagents, without sacrificing specificity and sensitivity. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. LipL53, a temperature regulated protein from Leptospira interrogans that binds to extracellular matrix molecules.

    Science.gov (United States)

    Oliveira, Tatiane R; Longhi, Mariana T; Gonçales, Amane P; de Morais, Zenaide M; Vasconcellos, Silvio A; Nascimento, Ana L T O

    2010-03-01

    The regulation of gene expression by environmental signals, such as temperature and osmolarity, has been correlated with virulence. In this study, we characterize the protein LipL53 from Leptospira interrogans, previously shown to react with serum sample of individual diagnosed with leptospirosis and to be up-regulated by shift to physiological osmolarity. The recombinant protein was expressed in Escherichia coli system, in insoluble form, recovered by urea solubilization and further refolded by decreasing the denaturing agent concentration during the purification procedure. The secondary structure content of the recombinant LipL53, as assessed by circular dichroism, showed a mixture of beta-strands and alpha-helix. The presence of LipL53 transcript at 28 degrees C was only detected within the virulent strains. However, upon shifted of attenuated cultures of pathogenic strains from 28 degrees C to 37 degrees C and to 39 degrees C, this transcript could also be observed. LipL53 binds laminin, collagen IV, cellular and plasma fibronectin in dose-dependent and saturable manner. Animal challenge studies showed that LipL53, although immunogenic, elicited only partial protection in hamsters. LipL53 is probably surface exposed as seen through immunofluorescence confocal microscopy. Our results suggest that LipL53 is a novel temperature regulated adhesin of L. interrogans that may be relevant in the leptospiral pathogenesis. Copyright 2009 Elsevier Masson SAS. All rights reserved.

  10. A cell-based MHC stabilization assay for the detection of peptide binding to the canine classical class I molecule, DLA-88.

    Science.gov (United States)

    Ross, Peter; Holmes, Jennifer C; Gojanovich, Gregory S; Hess, Paul R

    2012-12-15

    Identifying immunodominant CTL epitopes is essential for studying CD8+ T-cell responses in populations, but remains difficult, as peptides within antigens typically are too numerous for all to be synthesized and screened. Instead, to facilitate discovery, in silico scanning of proteins for sequences that match the motif, or binding preferences, of the restricting MHC class I allele - the largest determinant of immunodominance - can be used to predict likely candidates. The high false positive rate with this analysis ideally requires binding confirmation, which is obtained routinely by an assay using cell lines such as RMA-S that have defective transporter associated with antigen processing (TAP) machinery, and consequently, few surface class I molecules. The stabilization and resultant increased life-span of peptide-MHC complexes on the cell surface by the addition of true binders validates their identity. To determine whether a similar assay could be developed for dogs, we transfected a prevalent class I allele, DLA-88*50801, into RMA-S. In the BARC3 clone, the recombinant heavy chain was associated with murine β2-microglobulin, and importantly, could differentiate motif-matched and -mismatched peptides by surface MHC stabilization. This work demonstrates the potential to use RMA-S cells transfected with canine alleles as a tool for CTL epitope discovery in this species. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Proteolytic processing of the cilium adhesin MHJ_0194 (P123J ) in Mycoplasma hyopneumoniae generates a functionally diverse array of cleavage fragments that bind multiple host molecules.

    Science.gov (United States)

    Raymond, Benjamin B A; Jenkins, Cheryl; Seymour, Lisa M; Tacchi, Jessica L; Widjaja, Michael; Jarocki, Veronica M; Deutscher, Ania T; Turnbull, Lynne; Whitchurch, Cynthia B; Padula, Matthew P; Djordjevic, Steven P

    2015-03-01

    Mycoplasma hyopneumoniae, the aetiological agent of porcine enzootic pneumonia, regulates the presentation of proteins on its cell surface via endoproteolysis, including those of the cilial adhesin P123 (MHJ_0194). These proteolytic cleavage events create functional adhesins that bind to proteoglycans and glycoproteins on the surface of ciliated and non-ciliated epithelial cells and to the circulatory host molecule plasminogen. Two dominant cleavage events of the P123 preprotein have been previously characterized; however, immunoblotting studies suggest that more complex processing events occur. These extensive processing events are characterized here. The functional significance of the P97 cleavage fragments is also poorly understood. Affinity chromatography using heparin, fibronectin and plasminogen as bait and peptide arrays were used to expand our knowledge of the adhesive capabilities of P123 cleavage fragments and characterize a novel binding motif in the C-terminus of P123. Further, we use immunohistochemistry to examine in vivo, the biological significance of interactions between M. hyopneumoniae and fibronectin and show that M. hyopneumoniae induces fibronectin deposition at the site of infection on the ciliated epithelium. Our data supports the hypothesis that M. hyopneumoniae possesses the molecular machinery to influence key molecular communication pathways in host cells. © 2014 John Wiley & Sons Ltd.

  12. Binding of higher alcohols onto Mn(12) single-molecule magnets (SMMs): access to the highest barrier Mn(12) SMM.

    Science.gov (United States)

    Lampropoulos, Christos; Redler, Gage; Data, Saiti; Abboud, Khalil A; Hill, Stephen; Christou, George

    2010-02-15

    Two new members of the Mn(12) family of single-molecule magnets (SMMs), [Mn(12)O(12)(O(2)CCH(2)Bu(t))(16)(Bu(t)OH)(H(2)O)(3)].2Bu(t)OH (3.2Bu(t)OH) and [Mn(12)O(12)(O(2)CCH(2)Bu(t))(16)(C(5)H(11)OH)(4)] (4) (C(5)H(11)OH is 1-pentanol), are reported. They were synthesized from [Mn(12)O(12)(O(2)CMe)(16)(H(2)O)(4)].2MeCO(2)H.4H(2)O (1) by carboxylate substitution and crystallization from the appropriate alcohol-containing solvent. Complexes 3 and 4 are new members of the recently established [Mn(12)O(12)(O(2)CCH(2)Bu(t))(16)(solv)(4)] (solv = H(2)O, alcohols) family of SMMs. Only one bulky Bu(t)OH can be accommodated into 3, and even this causes significant distortion of the [Mn(12)O(12)] core. Variable-temperature, solid-state alternating current (AC) magnetization studies were carried out on complexes 3 and 4, and they established that both possess an S = 10 ground state spin and are SMMs. However, the magnetic behavior of the two compounds was found to be significantly different, with 4 showing out-of-phase AC peaks at higher temperatures than 3. High-frequency electron paramagnetic resonance (HFEPR) studies were carried out on single crystals of 3.2Bu(t)OH and 4, and these revealed that the axial zero-field splitting constant, D, is very different for the two compounds. Furthermore, it was established that 4 is the Mn(12) SMM with the highest kinetic barrier (U(eff)) to date. The results reveal alcohol substitution as an additional and convenient means to affect the magnetization relaxation barrier of the Mn(12) SMMs without major change to the ligation or oxidation state.

  13. A single-chain fusion molecule consisting of peptide, major histocompatibility gene complex class I heavy chain and beta2-microglobulin can fold partially correctly, but binds peptide inefficiently

    DEFF Research Database (Denmark)

    Sylvester-Hvid, C; Buus, S

    1999-01-01

    of a recombinant murine MHC-I molecule, which could be produced in large amounts in bacteria. The recombinant MHC-I protein was expressed as a single molecule (PepSc) consisting of the antigenic peptide linked to the MHC-I heavy chain and further linked to human beta2-microglobulin (hbeta2m). The PepSc molecule...... electrophoresis (SDS-PAGE). Serological analysis revealed the presence of some, but not all, MHC-I-specific epitopes. Biochemically, PepSc could bind peptide, however, rather ineffectively. We suggest that a partially correctly refolded MHC-I has been obtained....

  14. Nucleotide-binding oligomerization domain 1 regulates Porphyromonas gingivalis-induced vascular cell adhesion molecule 1 and intercellular adhesion molecule 1 expression in endothelial cells through NF-κB pathway.

    Science.gov (United States)

    Wan, M; Liu, J; Ouyang, X

    2015-04-01

    Porphyromonas gingivalis has been shown to actively invade endothelial cells and induce vascular cell adhesion molecule 1 (VCAM-1) and intercellular adhesion molecule 1 (ICAM-1) overexpression. Nucleotide-binding oligomerization domain 1 (NOD1) is an intracellular pattern recognition reporter, and its involvement in this process was unknown. This study focused on endothelial cells infected with P. gingivalis, the detection of NOD1 expression and the role that NOD1 plays in the upregulation of VCAM-1 and ICAM-1. The human umbilical vein endothelial cell line (ECV-304) was intruded by P. gingivalis W83, and cells without any treatment were the control group. Expression levels of NOD1, VCAM-1, ICAM-1, phosphorylated P65 between cells with and without treatment on both mRNA and protein levels were compared. Then we examined whether mesodiaminopimelic acid (NOD1 agonist) could increase VCAM-1 and ICAM-1 expression, meanwhile, NOD1 gene silence by RNA interference could reduce VCAM-1, ICAM-1 and phosphorylated P65 release. At last, we examined whether inhibition of NF-κB by Bay117082 could reduce VCAM-1 and ICAM- 1 expression. The mRNA levels were measured by real-time polymerase chain reaction, and protein levels by western blot or electrophoretic mobility shift assays (for phosphorylated P65). P. gingivalis invasion showed significant upregulation of NOD1, VCAM-1 and ICAM-1. NOD1 activation by meso-diaminopimelic acid increased VCAM-1 and ICAM-1 expression, and NOD1 gene silence reduced VCAM-1 and ICAM-1 release markedly. The NF-κB signaling pathway was activated by P. gingivalis, while NOD1 gene silence decreased the activation of NF-κB. Moreover, inhibition of NF-κB reduced VCAM-1 and ICAM-1 expression induced by P. gingivalis in endothelial cells. The results revealed that P. gingivalis induced NOD1 overexpression in endothelial cells and that NOD1 played an important role in the process of VCAM-1 and ICAM-1 expression in endothelial cells infected with P

  15. Different binding motifs of the celiac disease-associated HLA molecules DQ2.5, DQ2.2, and DQ7.5 revealed by relative quantitative proteomics of endogenous peptide repertoires

    DEFF Research Database (Denmark)

    Bergseng, Elin; Dørum, Siri; Arntzen, Magnus Ø.

    2014-01-01

    Celiac disease is caused by intolerance to cereal gluten proteins, and HLA-DQ molecules are involved in the disease pathogenesis by presentation of gluten peptides to CD4+ T cells. The α- or β-chain sharing HLA molecules DQ2.5, DQ2.2, and DQ7.5 display different risks for the disease...... established binding motifs. The binding motif of DQ2.2 was strikingly different from that of DQ2.5 with position P3 being a major anchor having a preference for threonine and serine. This is notable as three recently identified epitopes of gluten recognized by T cells of DQ2.2 celiac patients harbor serine...... at position P3. This study demonstrates that relative quantitative comparison of endogenous peptides sampled from our protein metabolism by HLA molecules provides clues to understand HLA association with disease....

  16. Positive versus negative modulation of different endogenous chemokines for CC-chemokine receptor 1 by small molecule agonists through allosteric versus orthosteric binding

    DEFF Research Database (Denmark)

    Jensen, Pia C; Thiele, Stefanie; Ulven, Trond

    2008-01-01

    7 transmembrane-spanning (7TM) chemokine receptors having multiple endogenous ligands offer special opportunities to understand the molecular basis for allosteric mechanisms. Thus, CC-chemokine receptor 1 (CCR1) binds CC-chemokine 3 and 5 (CCL3 and CCL5) with K(d) values of 7.3 and 0.16 nm......5 and not CCL3 activation is affected by substitutions in the main ligand binding pocket including the conserved GluVII:06 anchor point. A series of metal ion chelator complexes were found to act as full agonists on CCR1 and to be critically affected by the same substitutions in the main ligand...... binding pocket as CCL5 but not by mutations in the extracellular domain. In agreement with the overlapping binding sites, the small non-peptide agonists displaced radiolabeled CCL5 with high affinity. Interestingly, the same compounds acted as allosteric enhancers of the binding of CCL3, with which...

  17. Inhibition of Metalloprotease Botulinum Serotype A from a Pseudo-Peptide Binding Mode to a Small Molecule that is Active in Primary Neurons

    National Research Council Canada - National Science Library

    Burnett, James C; Ruthel, Gordon; Stegmann, Christian M; Panchal, Rekha G; Nguyen, Tam L; Hermone, Ann R; Stafford, Robert G; Lane, Douglas J; Kenny, Tara A; McGarth, Connor F

    2007-01-01

    An efficient research strategy integrating empirically-guided, structure-based modeling and chemoinformatics was used to discover potent small molecule inhibitors of the botulinum neurotoxin serotype A light chain...

  18. Site-directed mutational analysis of structural interactions of low molecule compounds binding to the N-terminal 8 kDa domain of DNA polymerase β

    International Nuclear Information System (INIS)

    Murakami, Shizuka; Kamisuki, Shinji; Takata, Kei-ichi; Kasai, Nobuyuki; Kimura, Seisuke; Mizushina, Yoshiyuki; Ohta, Keisuke; Sugawara, Fumio; Sakaguchi, Kengo

    2006-01-01

    We previously reported the mode of inhibition of DNA polymerase β (pol. β) by long chain fatty acids and a bile acid, involving binding analyses to the N-terminal 8-kDa DNA binding domain. Here we describe a site-directed mutational analysis in which the key amino acids (L11, K35, H51, K60, L77, and T79), which are direct interaction sites in the domain, were substituted with K, A, A, A, K, and A, respectively. And their pol. β interactions with a C24-long chain fatty acid, nervonic acid (NA), and a bile acid, lithocholic acid (LCA), were investigated by gel mobility shift assay and NMR spectroscopy. In the case of K35A, there was complete loss of DNA binding activity while K60A hardly has any activity. In contrast the other mutations had no appreciable effects. Thus, K35 and K60 are key amino acid sites for binding to template DNA. The DNA binding activities of L11K, H51A, and T79A as well as the wild type were inhibited by NA to the same extent. T79A demonstrated a disturbed interaction with LCA. 1 H- 15 N HSQC NMR analysis indicated that despite their many similarities, the wild-type and the mutant proteins displayed some significant chemical shift differences. Not only were the substituted amino acid residues three-dimensionally shifted, but some amino acids which are positioned far distant from the key amino acids showed a shift. These results suggest that the interaction surface was significantly distorted with the result that LCA could not bind to the domain. These findings confirm our previous biochemical and 3D structural proposals concerning inhibition by NA and LCA

  19. An approach to the unification of suppressor T cell circuits: a simplified assay for the induction of suppression by T cell-derived, antigen-binding molecules (T-ABM).

    Science.gov (United States)

    Chue, B; Ferguson, T A; Beaman, K D; Rosenman, S J; Cone, R E; Flood, P M; Green, D R

    1989-01-01

    A system is presented in which the in vitro response to sheep red blood cells (SRBC) can be regulated using antigenic determinants coupled to SRBC and T cell-derived antigen-binding molecules (T-ABM) directed against the coupled determinants. T suppressor-inducer factors (TsiF's) are composed of two molecules, one of which is a T-ABM and one which bears I-J determinants (I-J+ molecule). Using two purified T-ABM which have not previously been shown to have in vitro activity, we produced antigen-specific TsiF's which were capable of inducing the suppression of the anti-SRBC response. Suppression was found to require both the T-ABM and the I-J+ molecule, SRBC conjugated with the antigen for which the T-ABM was specific, and a population of Ly-2+ T cells in the culture. Two monoclonal TsiF (or TsF1) were demonstrated to induce suppression of the anti-SRBC response in this system, provided the relevant antigen was coupled to the SRBC in culture. The results are discussed in terms of the general functions of T-ABM in the immune system. This model will be useful in direct, experimental comparisons of the function of T-ABM and suppressor T cell factors under study in different systems and laboratories.

  20. MD simulation of the Tat/Cyclin T1/CDK9 complex revealing the hidden catalytic cavity within the CDK9 molecule upon Tat binding.

    Directory of Open Access Journals (Sweden)

    Kaori Asamitsu

    Full Text Available In this study, we applied molecular dynamics (MD simulation to analyze the dynamic behavior of the Tat/CycT1/CDK9 tri-molecular complex and revealed the structural changes of P-TEFb upon Tat binding. We found that Tat could deliberately change the local flexibility of CycT1. Although the structural coordinates of the H1 and H2 helices did not substantially change, H1', H2', and H3' exhibited significant changes en masse. Consequently, the CycT1 residues involved in Tat binding, namely Tat-recognition residues (TRRs, lost their flexibility with the addition of Tat to P-TEFb. In addition, we clarified the structural variation of CDK9 in complex with CycT1 in the presence or absence of Tat. Interestingly, Tat addition significantly reduced the structural variability of the T-loop, thus consolidating the structural integrity of P-TEFb. Finally, we deciphered the formation of the hidden catalytic cavity of CDK9 upon Tat binding. MD simulation revealed that the PITALRE signature sequence of CDK9 flips the inactive kinase cavity of CDK9 into the active form by connecting with Thr186, which is crucial for its activity, thus presumably recruiting the substrate peptide such as the C-terminal domain of RNA pol II. These findings provide vital information for the development of effective novel anti-HIV drugs with CDK9 catalytic activity as the target.

  1. Synthesis and characterization of a Eu-DTPA-PEGO-MSH(4) derivative for evaluation of binding of multivalent molecules to melanocortin receptors.

    Science.gov (United States)

    Xu, Liping; Vagner, Josef; Alleti, Ramesh; Rao, Venkataramanarao; Jagadish, Bhumasamudram; Morse, David L; Hruby, Victor J; Gillies, Robert J; Mash, Eugene A

    2010-04-15

    A labeled variant of MSH(4), a tetrapeptide that binds to the human melanocortin 4 receptor (hMC4R) with low microM affinity, was prepared by solid-phase synthesis methods, purified, and characterized. The labeled ligand, Eu-DTPA-PEGO-His-dPhe-Arg-Trp-NH(2), exhibited a K(d) for hMC4R of 9.1+/-1.4 microM, approximately 10-fold lower affinity than the parental ligand. The labeled MSH(4) derivative was employed in a competitive binding assay to characterize the interactions of hMC4R with monovalent and divalent MSH(4) constructs derived from squalene. The results were compared with results from a similar assay that employed a more potent labeled ligand, Eu-DTPA-NDP-alpha-MSH. While results from the latter assay reflected only statistical effects, results from the former assay reflected a mixture of statistical, proximity, and/or cooperative binding effects. Copyright 2010 Elsevier Ltd. All rights reserved.

  2. Controlling gene networks and cell fate with precision-targeted DNA-binding proteins and small-molecule-based genome readers.

    Science.gov (United States)

    Eguchi, Asuka; Lee, Garrett O; Wan, Fang; Erwin, Graham S; Ansari, Aseem Z

    2014-09-15

    Transcription factors control the fate of a cell by regulating the expression of genes and regulatory networks. Recent successes in inducing pluripotency in terminally differentiated cells as well as directing differentiation with natural transcription factors has lent credence to the efforts that aim to direct cell fate with rationally designed transcription factors. Because DNA-binding factors are modular in design, they can be engineered to target specific genomic sequences and perform pre-programmed regulatory functions upon binding. Such precision-tailored factors can serve as molecular tools to reprogramme or differentiate cells in a targeted manner. Using different types of engineered DNA binders, both regulatory transcriptional controls of gene networks, as well as permanent alteration of genomic content, can be implemented to study cell fate decisions. In the present review, we describe the current state of the art in artificial transcription factor design and the exciting prospect of employing artificial DNA-binding factors to manipulate the transcriptional networks as well as epigenetic landscapes that govern cell fate.

  3. The most common Chinese rhesus macaque MHC class I molecule shares peptide binding repertoire with the HLA-B7 supertype

    DEFF Research Database (Denmark)

    Solomon, C.; Southwood, S.; Hoof, Ilka

    2010-01-01

    Of the two rhesus macaque subspecies used for AIDS studies, the Simian immunodeficiency virus-infected Indian rhesus macaque (Macaca mulatta) is the most established model of HIV infection, providing both insight into pathogenesis and a system for testing novel vaccines. Despite the Chinese rhesus.......3%) of the sequences identified were novel. From all MHC alleles detected, we prioritized Mamu-A1*02201 for functional characterization based on its higher frequency of expression. Upon the development of MHC/peptide binding assays and definition of its associated motif, we revealed that this allele shares peptide...

  4. Direction of Intercalation of a bis-Ru(II) Complex to DNA Probed by a Minor Groove Binding Molecule 4',6-Diamidino-2-phenylindole

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Yoon Jung; Kim, Raeyeong; Chitrapriya, Nataraj; Kim, Seog K.; Bae, Inho [Yeungnam Univ., Gyeongsan (Korea, Republic of)

    2013-10-15

    Direction of intercalation to DNA of the planar dipyrido[3,2-a:2',3'-c]phenazine ligands (dppz) of a bis-Ru(II) complex namely, [Ru(1,10-phenanthroline){sub 2}dipyrido[3,2-a:2',3'-c]phenazine]{sup 2+} linkered by a 1,3-bis(4-pyridyl)propane, was investigated by probing the behavior of 4',6-diamidino-2-phenylindole (DAPI) that bound deep in the minor groove. Bis-intercalation of DPPZ resulted in a little blue shift and hyperchromism in DAPI absorption band, and a large decrease in DAPI fluorescence intensity which accompanied by an increase in the dppz emission intensity. Diminishing the intensity of the positive induced circular dichroism (CD) and linear dichroism (LD) were also observed. These spectral changes indicated that insertion of dppz ligand caused the change of the binding mode of DAPI, which probably moved to the exterior of DNA from the minor groove and interacted with the phospghate groups of DNA by electrostatic interaction. At the surface of DNA, DAPI binds at the phosphate groups of DNA by electrostatic attraction. Consequently, this observation indicated that the dppz ligand intercalated from the minor groove.

  5. Enhanced binding capacity of boronate affinity adsorbent via surface modification of silica by combination of atom transfer radical polymerization and chain-end functionalization for high-efficiency enrichment of cis-diol molecules

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Wei; He, Maofang; Wang, Chaozhan; Wei, Yinmao, E-mail: ymwei@nwu.edu.cn

    2015-07-30

    Boronate affinity materials have been widely used for specific separation and preconcentration of cis-diol molecules, but most do not have sufficient capacity due to limited binding sites on the material surface. In this work, we prepared a phenylboronic acid-functionalized adsorbent with a high binding capacity via the combination of surface-initiated atom transfer radical polymerization (SI-ATRP) and chain-end functionalization. With this method, the terminal chlorides of the polymer chains were used fully, and the proposed adsorbent contains dense boronic acid polymers chain with boronic acid on the chain end. Consequently, the proposed adsorbent possesses excellent selectivity and a high binding capacity of 513.6 μmol g{sup −1} for catechol and 736.8 μmol g{sup −1} for fructose, which are much higher than those of other reported adsorbents. The dispersed solid-phase extraction (dSPE) based on the prepared adsorbent was used for extraction of three cis-diol drugs (i.e., epinephrine, isoprenaline and caffeic acid isopropyl ester) from plasma; the eluates were analyzed by HPLC-UV. The reduced amount of adsorbent (i.e., 2.0 mg) could still eliminate interferences efficiently and yielded a recovery range of 85.6–101.1% with relative standard deviations ranging from 2.5 to 9.7% (n = 5). The results indicated that the proposed strategy could serve as a promising alternative to increase the density of surface functional groups on the adsorbent; thus, the prepared adsorbent has the potential to effectively enrich cis-diol substances in real samples. - Highlights: • Boronate adsorbent is prepared via ATRP and chain-end functionalization. • The adsorbent has quite high binding capacity for cis-diols. • Binding capacity is easily manipulated by ATRP condition. • Chain-end functionalization can improve binding capacity significantly. • Reduced adsorbent is consumed in dispersed solid-phase extraction of cis-diols.

  6. Mannan-binding lectin (MBL)-associated serine protease-1 (MASP-1), a serine protease associated with humoral pattern-recognition molecules

    DEFF Research Database (Denmark)

    Thiel, S; Jensen, L; Degn, Søren Egedal

    2012-01-01

    , an important component of the innate immune system. Three proteins are produced from the MASP1 gene: MASP-1 and MASP-3 and MAp44. We present an assay specific for MASP-1, which is based on inhibition of the binding of anti-MASP-1-specific antibody to MASP-1 domains coated onto microtitre wells. MASP-1...... was found in serum in large complexes eluting in a position corresponding to ∼600 kDa after gel permeation chromatography in calcium-containing buffer and as monomers of ∼75 kDa in dissociating buffer. The concentration of MASP-1 in donor sera (n = 105) was distributed log-normally with a median value of 11...

  7. Client Proteins and Small Molecule Inhibitors Display Distinct Binding Preferences for Constitutive and Stress-Induced HSP90 Isoforms and Their Conformationally Restricted Mutants.

    Directory of Open Access Journals (Sweden)

    Thomas L Prince

    Full Text Available The two cytosolic/nuclear isoforms of the molecular chaperone HSP90, stress-inducible HSP90α and constitutively expressed HSP90β, fold, assemble and maintain the three-dimensional structure of numerous client proteins. Because many HSP90 clients are important in cancer, several HSP90 inhibitors have been evaluated in the clinic. However, little is known concerning possible unique isoform or conformational preferences of either individual HSP90 clients or inhibitors. In this report, we compare the relative interaction strength of both HSP90α and HSP90β with the transcription factors HSF1 and HIF1α, the kinases ERBB2 and MET, the E3-ubiquitin ligases KEAP1 and RHOBTB2, and the HSP90 inhibitors geldanamycin and ganetespib. We observed unexpected differences in relative client and drug preferences for the two HSP90 isoforms, with HSP90α binding each client protein with greater apparent affinity compared to HSP90β, while HSP90β bound each inhibitor with greater relative interaction strength compared to HSP90α. Stable HSP90 interaction was associated with reduced client activity. Using a defined set of HSP90 conformational mutants, we found that some clients interact strongly with a single, ATP-stabilized HSP90 conformation, only transiently populated during the dynamic HSP90 chaperone cycle, while other clients interact equally with multiple HSP90 conformations. These data suggest different functional requirements among HSP90 clientele that, for some clients, are likely to be ATP-independent. Lastly, the two inhibitors examined, although sharing the same binding site, were differentially able to access distinct HSP90 conformational states.

  8. Cold Rydberg molecules

    Science.gov (United States)

    Raithel, Georg; Zhao, Jianming

    2017-04-01

    Cold atomic systems have opened new frontiers at the interface of atomic and molecular physics. These include research on novel types of Rydberg molecules. Three types of molecules will be reviewed. Long-range, homonuclear Rydberg molecules, first predicted in [1] and observed in [2], are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium [3]). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules [3]. A classification into Hund's cases [3, 4, 5] will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction term of neutral Rydberg-Rydberg molecules is between two dipoles, while for ionic Rydberg molecules it is between a dipole and a monopole. NSF (PHY-1506093), NNSF of China (61475123).

  9. Molecular Defects in Cardiac Myofilament Ca2+-Regulation Due to Cardiomyopathy-Linked Mutations Can Be Reversed by Small Molecules Binding to Troponin.

    Science.gov (United States)

    Sheehan, Alice; Messer, Andrew E; Papadaki, Maria; Choudhry, Afnan; Kren, Vladimír; Biedermann, David; Blagg, Brian; Khandelwal, Anuj; Marston, Steven B

    2018-01-01

    . Many of these compounds were either pure re-couplers or pure desensitizers, indicating these properties are independent; moreover, re-coupling ability could be lost with small changes of compound structure, indicating the possibility of specificity. Small molecules that can re-couple may have therapeutic potential. HIGHLIGHTS - Inherited cardiomyopathies are common diseases that are currently untreatable at a fundamental level and therefore finding a small molecule treatment is highly desirable.- We have identified a molecular level dysfunction common to nearly all mutations: uncoupling of the relationship between troponin I phosphorylation and modulation of myofilament Ca 2+ -sensitivity, essential for normal responses to adrenaline.- We have identified a new class of drugs that are capable of both reducing Ca 2+ -sensitivity and/or recouping the relationship between troponin I phosphorylation and Ca 2+ -sensitivity.- The re-coupling phenomenon can be explained on the basis of a single mechanism that is testable.- Measurements with a wide range of small molecules of varying structures can indicate the critical molecular features required for recoupling and allows the prediction of other potential re-couplers.

  10. Molecular Defects in Cardiac Myofilament Ca2+-Regulation Due to Cardiomyopathy-Linked Mutations Can Be Reversed by Small Molecules Binding to Troponin

    Directory of Open Access Journals (Sweden)

    Alice Sheehan

    2018-03-01

    filaments. Many of these compounds were either pure re-couplers or pure desensitizers, indicating these properties are independent; moreover, re-coupling ability could be lost with small changes of compound structure, indicating the possibility of specificity. Small molecules that can re-couple may have therapeutic potential.HIGHLIGHTS- Inherited cardiomyopathies are common diseases that are currently untreatable at a fundamental level and therefore finding a small molecule treatment is highly desirable.- We have identified a molecular level dysfunction common to nearly all mutations: uncoupling of the relationship between troponin I phosphorylation and modulation of myofilament Ca2+-sensitivity, essential for normal responses to adrenaline.- We have identified a new class of drugs that are capable of both reducing Ca2+-sensitivity and/or recouping the relationship between troponin I phosphorylation and Ca2+-sensitivity.- The re-coupling phenomenon can be explained on the basis of a single mechanism that is testable.- Measurements with a wide range of small molecules of varying structures can indicate the critical molecular features required for recoupling and allows the prediction of other potential re-couplers.

  11. Direct binding to antigen-coated beads refines the specificity and cross-reactivity of four monoclonal antibodies that recognize polymorphic epitopes of HLA class I molecules.

    Science.gov (United States)

    Hilton, H G; Parham, P

    2013-04-01

    Monoclonal antibodies with specificity for human leukocyte antigen (HLA) class I determinants of HLA were originally characterized using serological assays in which the targets were cells expressing three to six HLA class I variants. Because of this complexity, the specificities of the antibodies were defined indirectly by correlation. Here we use a direct binding assay, in which the targets are synthetic beads coated with 1 of 111 HLA class I variants, representing the full range of HLA-A, -B and -C variation. We studied one monoclonal antibody with monomorphic specificity (W6/32) and four with polymorphic specificity (MA2.1, PA2.1, BB7.2 and BB7.1) and compared the results with those obtained previously. W6/32 reacted with all HLA class I variants. MA2.1 not only exhibits high specificity for HLA-A*02, -B*57 and -B*58, but also exhibited cross-reactivity with HLA-A*11 and -B*15:16. At low concentration (1 µg/ml), PA2.1 and BB7.2 were both specific for HLA-A*02 and -A*69, and at high concentration (50 µg/ml) exhibited significant cross-reactions with HLA-A*68, -A*23 and -A*24. BB7.1 exhibits specificity for HLA-B*07 and -B*42, as previously described, but reacts equally well with HLA-B*81, a rare allotype defined some 16 years after the description of BB7.1. The results obtained with cell-based and bead-based assays are consistent and, in combination with amino acid sequence comparison, increase understanding of the polymorphic epitopes recognized by the MA2.1, PA2.1, BB7.2 and BB7.1 antibodies. Comparison of two overlapping but distinctive bead sets from two sources gave similar results, but the overall levels of binding were significantly different. Several weaker reactions were observed with only one of the bead sets. © 2013 John Wiley & Sons A/S.

  12. A novel small molecule inhibits STAT3 phosphorylation and DNA binding activity and exhibits potent growth suppressive activity in human cancer cells

    Directory of Open Access Journals (Sweden)

    Lin Li

    2010-08-01

    Full Text Available Abstract Background Targeting Signal Transducer and Activator of Transcription 3 (STAT3 signaling is an attractive therapeutic approach for most types of human cancers with constitutively activated STAT3. A novel small molecular STAT3 inhibitor, FLLL32 was specifically designed from dietary agent, curcumin to inhibit constitutive STAT3 signaling in multiple myeloma, glioblastoma, liver cancer, and colorectal cancer cells. Results FLLL32 was found to be a potent inhibitor of STAT3 phosphorylation, STAT3 DNA binding activity, and the expression of STAT3 downstream target genes in vitro, leading to the inhibition of cell proliferation as well as the induction of Caspase-3 and PARP cleavages in human multiple myeloma, glioblastoma, liver cancer, and colorectal cancer cell lines. However, FLLL32 exhibited little inhibition on some tyrosine kinases containing SH2 or both SH2 and SH3 domains, and other protein and lipid kinases using a kinase profile assay. FLLL32 was also more potent than four previously reported JAK2 and STAT3 inhibitors as well as curcumin to inhibit cell viability in these cancer cells. Furthermore, FLLL32 selectively inhibited the induction of STAT3 phosphorylation by Interleukin-6 but not STAT1 phosphorylation by IFN-γ. Conclusion Our findings indicate that FLLL32 exhibits potent inhibitory activity to STAT3 and has potential for targeting multiple myeloma, glioblastoma, liver cancer, and colorectal cancer cells expressing constitutive STAT3 signaling.

  13. 1H NMR study of effects of synergistic anion and metal ion binding on pH titration of the histidinyl side-chain residues of the half-molecules of ovotransferrin

    International Nuclear Information System (INIS)

    Woodworth, R.C.; Butcher, N.D.; Brown, S.A.; Brown-Mason, A.

    1987-01-01

    Separation of ovotransferrin into C-terminal (OTf/2C) and N-terminal (OTf/2N) half-molecules has made possible the resolution of all expected histidinyl C(2)H resonances by proton nuclear magnetic resonance at 250 MHz. The chemical shift of many of the resonances decreases with increasing pH, allowing construction of titration curves, whereas a few resonances fail to titrate. On formation of the Ga/sup III/OTf/2(C 2 O 4 ) ternary complexes, two of the low-field C(2)H resonances in each half-molecule fail to titrate. This behavior implicates the imidazole groups giving rise to these resonances as ligands to the bound metal ion. A third C(2)H resonance in each half-molecule undergoes a marked reduction in pK'/sub a/ on formation of the ternary complex. The imidazole group displaying this resonance is implicated in a proton-relay scheme involved in binding the synergistic anion, oxalate, and a water of hydration on the bound metal ion. The titration curves for the various imidazole resonances have been fit to a four-parameter equation involving estimation of the pK'/sub a/, the limiting chemical shift values, and a Hill constant n. Hill constants of 1, which suggests positive cooperativity in the titration of this residue. The basis for this behavior cannot be rationalized at this time. 13 C NMR studies of [zeta- 13 C]Arg-OTf suggest the Arg side chains may not be intimately involved in formation of the ternary complex

  14. The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

    Science.gov (United States)

    Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

    2018-01-01

    The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

  15. Molecule nanoweaver

    Science.gov (United States)

    Gerald, II; Rex, E [Brookfield, IL; Klingler, Robert J [Glenview, IL; Rathke, Jerome W [Homer Glen, IL; Diaz, Rocio [Chicago, IL; Vukovic, Lela [Westchester, IL

    2009-03-10

    A method, apparatus, and system for constructing uniform macroscopic films with tailored geometric assemblies of molecules on the nanometer scale. The method, apparatus, and system include providing starting molecules of selected character, applying one or more force fields to the molecules to cause them to order and condense with NMR spectra and images being used to monitor progress in creating the desired geometrical assembly and functionality of molecules that comprise the films.

  16. Sequential water molecule binding enthalpies for aqueous nanodrops containing a mono-, di- or trivalent ion and between 20 and 500 water molecules† †Electronic supplementary information (ESI) available: Detailed description of the experimental and computational modeling methods. Isolation, BIRD and UVPD sequence for [Ru(NH3)6]3+·(H2O)169–171, nanoESI spectra for 2+ and 3+ ions. Detailed description of the isotope distribution simulation program. Comparison between experimental and simulated 1+, 2+ and 3+ ion isotope distributions. Wavelength dependence of the deduced sequential binding enthalpies. Comparison of experimental UVPD binding enthalpies to the liquid drop model at different temperatures. Complete list of binding enthalpies and average number of water molecules lost upon UVPD. See DOI: 10.1039/c6sc04957e Click here for additional data file.

    Science.gov (United States)

    Heiles, Sven; Cooper, Richard J.; DiTucci, Matthew J.

    2017-01-01

    Sequential water molecule binding enthalpies, ΔH n,n–1, are important for a detailed understanding of competitive interactions between ions, water and solute molecules, and how these interactions affect physical properties of ion-containing nanodrops that are important in aerosol chemistry. Water molecule binding enthalpies have been measured for small clusters of many different ions, but these values for ion-containing nanodrops containing more than 20 water molecules are scarce. Here, ΔH n,n–1 values are deduced from high-precision ultraviolet photodissociation (UVPD) measurements as a function of ion identity, charge state and cluster size between 20–500 water molecules and for ions with +1, +2 and +3 charges. The ΔH n,n–1 values are obtained from the number of water molecules lost upon photoexcitation at a known wavelength, and modeling of the release of energy into the translational, rotational and vibrational motions of the products. The ΔH n,n–1 values range from 36.82 to 50.21 kJ mol–1. For clusters containing more than ∼250 water molecules, the binding enthalpies are between the bulk heat of vaporization (44.8 kJ mol–1) and the sublimation enthalpy of bulk ice (51.0 kJ mol–1). These values depend on ion charge state for clusters with fewer than 150 water molecules, but there is a negligible dependence at larger size. There is a minimum in the ΔH n,n–1 values that depends on the cluster size and ion charge state, which can be attributed to the competing effects of ion solvation and surface energy. The experimental ΔH n,n–1 values can be fit to the Thomson liquid drop model (TLDM) using bulk ice parameters. By optimizing the surface tension and temperature change of the logarithmic partial pressure for the TLDM, the experimental sequential water molecule binding enthalpies can be fit with an accuracy of ±3.3 kJ mol–1 over the entire range of cluster sizes. PMID:28451364

  17. Hydrogen storage by polylithiated molecules and nanostructures

    NARCIS (Netherlands)

    Er, S.; de Wijs, Gilles A.; Brocks, G.

    2009-01-01

    We study polylithiated molecules as building blocks for hydrogen storage materials, using first-principles calculations. CLi4 and OLi2 bind 12 and 10 hydrogen molecules, respectively, with an average binding energy of 0.10 and 0.13 eV, leading to gravimetric densities of 37.8 and 40.3 wt % of H2.

  18. Interaction of the carbon monoxide-releasing molecule Ru(CO)3Cl(glycinate) (CORM-3) with Salmonella enterica serovar Typhimurium: in situ measurements of carbon monoxide binding by integrating cavity dual-beam spectrophotometry.

    Science.gov (United States)

    Rana, Namrata; McLean, Samantha; Mann, Brian E; Poole, Robert K

    2014-12-01

    Carbon monoxide (CO) is a toxic gas that binds to haems, but also plays critical signalling and cytoprotective roles in mammalian systems; despite problems associated with systemic delivery by inhalation of the gas, it may be employed therapeutically. CO delivered to cells and tissues by CO-releasing molecules (CO-RMs) has beneficial and toxic effects not mimicked by CO gas; CO-RMs are also attractive candidates as novel antimicrobial agents. Salmonella enterica serovar Typhimurium is an enteropathogen causing gastroenteritis in humans. Recent studies have implicated haem oxygenase-1 (HO-1), the protein that catalyses the degradation of haem into biliverdin, free iron and CO, in the host immune response to Salmonella infection. In several studies, CO administration via CO-RMs elicited many of the protective roles of HO-1 induction and so we investigated the effects of a well-characterized water-soluble CO-RM, Ru(CO)3Cl(glycinate) (CORM-3), on Salmonella. CORM-3 exhibits toxic effects at concentrations significantly lower than those reported to cause toxicity to RAW 264.7 macrophages. We demonstrated here, through oxyhaemoglobin assays, that CORM-3 did not release CO spontaneously in phosphate buffer, buffered minimal medium or very rich medium. CORM-3 was, however, accumulated to high levels intracellularly (as shown by inductively coupled plasma MS) and released CO inside cells. Using growing Salmonella cultures without prior concentration, we showed for the first time that sensitive dual-beam integrating cavity absorption spectrophotometry can detect directly the CO released from CORM-3 binding in real-time to haems of the bacterial electron transport chain. The toxic effects of CO-RMs suggested potential applications as adjuvants to antibiotics in antimicrobial therapy. © 2014 The Authors.

  19. Molecular immune recognition of botulinum neurotoxin B. The light chain regions that bind human blocking antibodies from toxin-treated cervical dystonia patients. Antigenic structure of the entire BoNT/B molecule.

    Science.gov (United States)

    Atassi, M Zouhair; Jankovic, Joseph; Steward, Lance E; Aoki, K Roger; Dolimbek, Behzod Z

    2012-01-01

    We recently mapped the regions on the heavy (H) chain of botulinum neurotoxin, type B (BoNT/B) recognized by blocking antibodies (Abs) from cervical dystonia (CD) patients who develop immunoresistance during toxin treatment. Since blocking could also be effected by Abs directed against regions on the light (L) chain, we have mapped here the L chain, using the same 30 CD antisera. We synthesized, purified and characterized 32 19-residue L chain peptides that overlapped successively by 5 residues (peptide L32 overlapped with peptide N1 of the H chain by 12 residues). In a given patient, Abs against the L chain seemed less intense than those against H chain. Most sera recognized a limited set of L chain peptides. The levels of Abs against a given region varied with the patient, consistent with immune responses to each epitope being under separate MHC control. The peptides most frequently recognized were: L13, by 30 of 30 antisera (100%); L22, by 23 of 30 (76.67%); L19, by 15 of 30 (50.00%); L26, by 11 of 30 (36.70%); and L14, by 12 of 30 (40.00%). The activity of L14 probably derives from its overlap with L13. The levels of Ab binding decreased in the following order: L13 (residues 169-187), L22 (295-313), L19 (253-271), and L26 (351-369). Peptides L12 (155-173), L18 (239-257), L15 (197-215), L1 (1-19) and L23 (309-327) exhibited very low Ab binding. The remaining peptides had little or no Ab-binding activity. The antigenic regions are analyzed in terms of their three-dimensional locations and the enzyme active site. With the previous localization of the antigenic regions on the BoNT/B H chain, the human Ab recognition of the entire BoNT/B molecule is presented and compared to the recognition of BoNT/A by human blocking Abs. Copyright © 2011. Published by Elsevier GmbH.

  20. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 4. Molecule Matters – van der Waals Molecules - History and Some Perspectives on Intermolecular Forces. E Arunan. Feature Article Volume 14 Issue 4 April 2009 pp 346-356 ...

  1. Recent advances in developing small molecules targeting RNA.

    Science.gov (United States)

    Guan, Lirui; Disney, Matthew D

    2012-01-20

    RNAs are underexploited targets for small molecule drugs or chemical probes of function. This may be due, in part, to a fundamental lack of understanding of the types of small molecules that bind RNA specifically and the types of RNA motifs that specifically bind small molecules. In this review, we describe recent advances in the development and design of small molecules that bind to RNA and modulate function that aim to fill this void.

  2. Atkins' molecules

    CERN Document Server

    Atkins, Peters

    2003-01-01

    Originally published in 2003, this is the second edition of a title that was called 'the most beautiful chemistry book ever written'. In it, we see the molecules responsible for the experiences of our everyday life - including fabrics, drugs, plastics, explosives, detergents, fragrances, tastes, and sex. With engaging prose Peter Atkins gives a non-technical account of an incredible range of aspects of the world around us, showing unexpected connections, and giving an insight into how this amazing world can be understood in terms of the atoms and molecules from which it is built. The second edition includes dozens of extra molecules, graphical presentation, and an even more accessible and enthralling account of the molecules themselves.

  3. Interstellar Molecules

    Science.gov (United States)

    Solomon, Philip M.

    1973-01-01

    Radioastronomy reveals that clouds between the stars, once believed to consist of simple atoms, contain molecules as complex as seven atoms and may be the most massive objects in our Galaxy. (Author/DF)

  4. Protein Scaffolding for Small Molecule Catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Baker, David [Univ. of Washington, Seattle, WA (United States)

    2014-09-14

    We aim to design hybrid catalysts for energy production and storage that combine the high specificity, affinity, and tunability of proteins with the potent chemical reactivities of small organometallic molecules. The widely used Rosetta and RosettaDesign methodologies will be extended to model novel protein / small molecule catalysts in which one or many small molecule active centers are supported and coordinated by protein scaffolding. The promise of such hybrid molecular systems will be demonstrated with the nickel-phosphine hydrogenase of DuBois et. al.We will enhance the hydrogenase activity of the catalyst by designing protein scaffolds that incorporate proton relays and systematically modulate the local environment of the catalyticcenter. In collaboration with DuBois and Shaw, the designs will be experimentally synthesized and characterized.

  5. Adhesion molecules

    CERN Document Server

    Preedy, Victor R

    2016-01-01

    This book covers the structure and classification of adhesion molecules in relation to signaling pathways and gene expression. It discusses immunohistochemical localization, neutrophil migration, and junctional, functional, and inflammatory adhesion molecules in pathologies such as leukocyte decompression sickness and ischemia reperfusion injury. Highlighting the medical applications of current research, chapters cover diabetes, obesity, and metabolic syndrome; hypoxia; kidney disease; smoking, atrial fibrillation, and heart disease, the brain and dementia; and tumor proliferation. Finally, it looks at molecular imaging and bioinformatics, high-throughput technologies, and chemotherapy.

  6. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Molecule Matters - Dinitrogen. A G Samuelson J Jabadurai. Volume 16 Issue 12 ... Author Affiliations. A G Samuelson1 J Jabadurai1. Department of Inroganic and Physical Chemistry, Indian Institute of Science, Bangalore 560 012, India.

  7. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 9. Molecule Matters - A Chromium Compound with a Quintuple Bond. K C Kumara Swamy. Feature Article Volume 11 Issue 9 September 2006 pp 72-75. Fulltext. Click here to view fulltext PDF. Permanent link:

  8. RNAi pathways in Mucor: A tale of proteins, small RNAs and functional diversity.

    Science.gov (United States)

    Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M

    2016-05-01

    The existence of an RNA-mediated silencing mechanism in the opportunistic fungal pathogen Mucor circinelloides was first described in the early 2000. Since then, Mucor has reached an outstanding position within the fungal kingdom as a model system to achieve a deeper understanding of regulation of endogenous functions by the RNA interference (RNAi) machinery. M. circinelloides combines diverse components of its RNAi machinery to carry out functions not only limited to the defense against invasive nucleic acids, but also to regulate expression of its own genes by producing different classes of endogenous small RNA molecules (esRNAs). The recent discovery of a novel RNase that participates in a new RNA degradation pathway adds more elements to the gene silencing-mediated regulation. This review focuses on esRNAs in M. circinelloides, the different pathways involved in their biogenesis, and their roles in regulating specific physiological and developmental processes in response to environmental signals, highlighting the complexity of silencing-mediated regulation in fungi. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Role of glial cell line-derived neurotrophic factor (GDNF)-neural cell adhesion molecule (NCAM) interactions in induction of neurite outgrowth and identification of a binding site for NCAM in the heel region of GDNF

    DEFF Research Database (Denmark)

    Nielsen, Janne; Gotfryd, Kamil; Li, Shizhong

    2009-01-01

    NCAM-induced neurite outgrowth by being independent of NCAM polysialylation. Additionally, we investigated the structural basis for GDNF-NCAM interactions and find that NCAM Ig3 is necessary for GDNF binding. Furthermore, we identify within the heel region of GDNF a binding site for NCAM...

  10. Protein binding of psychotropic agents

    International Nuclear Information System (INIS)

    Hassan, H.A.

    1990-01-01

    Based upon fluorescence measurements, protein binding of some psychotropic agents (chlorpromazine, promethazine, and trifluoperazine) to human IgG and HSA was studied in aqueous cacodylate buffer, PH7. The interaction parameters determined from emission quenching of the proteins. The interaction parameters determined include the equilibrium constant (K), calculated from equations derived by Borazan and coworkers, the number of binding sites (n) available to the monomer molecules on a single protein molecule. The results revealed a high level of affinity, as reflected by high values of K, and the existence of specific binding sites, since a limited number of n values are obtained. 39 tabs.; 37 figs.; 83 refs

  11. Superresolution microscopy with transient binding.

    Science.gov (United States)

    Molle, Julia; Raab, Mario; Holzmeister, Susanne; Schmitt-Monreal, Daniel; Grohmann, Dina; He, Zhike; Tinnefeld, Philip

    2016-06-01

    For single-molecule localization based superresolution, the concentration of fluorescent labels has to be thinned out. This is commonly achieved by photophysically or photochemically deactivating subsets of molecules. Alternatively, apparent switching of molecules can be achieved by transient binding of fluorescent labels. Here, a diffusing dye yields bright fluorescent spots when binding to the structure of interest. As the binding interaction is weak, the labeling is reversible and the dye ligand construct diffuses back into solution. This approach of achieving superresolution by transient binding (STB) is reviewed in this manuscript. Different realizations of STB are discussed and compared to other localization-based superresolution modalities. We propose the development of labeling strategies that will make STB a highly versatile tool for superresolution microscopy at highest resolution. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Transport through a Single Octanethiol Molecule

    NARCIS (Netherlands)

    Kockmann, D.; Poelsema, Bene; Zandvliet, Henricus J.W.

    2009-01-01

    Octanethiol molecules adsorbed on Pt chains are studied with scanning tunneling microscopy and spectroscopy at 77 K. The head of the octanethiol binds to a Pt atom and the tail is lying flat down on the chain. Open-loop current time traces reveal that the molecule wags its tail and attaches to the

  13. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 12. Molecule Matters van der Waals Molecules - Noble Gas Clusters are London Molecules! E Arunan. Feature Article Volume 14 Issue 12 December 2009 pp 1210-1222 ...

  14. Stability of matter-antimatter molecules

    International Nuclear Information System (INIS)

    Wong, Cheuk-Yin; Lee, Teck-Ghee

    2011-01-01

    Highlights: → We examine stability of matter-antimatter molecules with four constituents. → The binding of matter-antimatter molecules is a common phenomenon. → Molecules have bound states if ratio of constituent masses greater than ∼4. → We evaluate molecular binding energies and annihilation lifetimes. - Abstract: We examine the stability of matter-antimatter molecules by reducing the four-body problem into a simpler two-body problem with residual interactions. We find that matter-antimatter molecules with constituents (m 1 + ,m 2 - ,m-bar 2 + ,m-bar 1 - ) possess bound states if their constituent mass ratio m 1 /m 2 is greater than about 4. This stability condition suggests that the binding of matter-antimatter molecules is a rather common phenomenon. We evaluate the binding energies and eigenstates of matter-antimatter molecules (μ + e - )-(e + μ - ),(π + e - )-(e + π - ),(K + e - )-(e + K - ),(pe - )-(e + p-bar),(pμ - )-(μ + p-bar), and (K + μ - ) - (μ + K - ), which satisfy the stability condition. We estimate the molecular annihilation lifetimes in their s states.

  15. Observation of pendular butterfly Rydberg molecules

    Science.gov (United States)

    Niederprüm, Thomas; Thomas, Oliver; Eichert, Tanita; Lippe, Carsten; Pérez-Ríos, Jesús; Greene, Chris H.; Ott, Herwig

    2016-01-01

    Engineering molecules with a tunable bond length and defined quantum states lies at the heart of quantum chemistry. The unconventional binding mechanism of Rydberg molecules makes them a promising candidate to implement such tunable molecules. A very peculiar type of Rydberg molecules are the so-called butterfly molecules, which are bound by a shape resonance in the electron–perturber scattering. Here we report the observation of these exotic molecules and employ their exceptional properties to engineer their bond length, vibrational state, angular momentum and orientation in a small electric field. Combining the variable bond length with their giant dipole moment of several hundred Debye, we observe counter-intuitive molecules which locate the average electron position beyond the internuclear distance. PMID:27703143

  16. Highly parallel translation of DNA sequences into small molecules.

    Directory of Open Access Journals (Sweden)

    Rebecca M Weisinger

    Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.

  17. Individual Magnetic Molecules on Ultrathin Insulating Surfaces

    Science.gov (United States)

    El Hallak, Fadi; Warner, Ben; Hirjibehedin, Cyrus

    2012-02-01

    Single molecule magnets have attracted ample interest because of their exciting magnetic and quantum properties. Recent studies have demonstrated that some of these molecules can be evaporated on surfaces without losing their magnetic properties [M. Mannini et al., Nature 468, 417, (2010)]. This remarkable progress enhances the chances of real world applications for these molecules. We present STM imaging and spectroscopy data on iron phthalocyanine molecules deposited on Cu(100) and on a Cu2N ultrathin insulating surface. These molecules have been shown to display a large magnetic anisotropy on another thin insulating surface, oxidized Cu(110) [N. Tsukahara et al., Phys. Rev. Lett. 102, 167203 (2009)]. By using a combination of elastic and inelastic electron tunnelling spectroscopy, we investigate the binding of the molecules to the surface and the impact that the surface has on their electronic and magnetic properties.

  18. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Molecule Matters van der Waals Molecules - Rg•••HF Complexes are Debye Molecules! E Arunan. Feature Article Volume 15 Issue 7 July 2010 pp 667-674. Fulltext. Click here to view fulltext PDF. Permanent link:

  19. Large-scale integration of small molecule-induced genome-wide transcriptional responses, Kinome-wide binding affinities and cell-growth inhibition profiles reveal global trends characterizing systems-level drug action

    Directory of Open Access Journals (Sweden)

    Dusica eVidovic

    2014-09-01

    Full Text Available The Library of Integrated Network-based Cellular Signatures (LINCS project is a large-scale coordinated effort to build a comprehensive systems biology reference resource. The goals of the program include the generation of a very large multidimensional data matrix and informatics and computational tools to integrate, analyze, and make the data readily accessible. LINCS data include genome-wide transcriptional signatures, biochemical protein binding profiles, cellular phenotypic response profiles and various other datasets for a wide range of cell model systems and molecular and genetic perturbations. Here we present a partial survey of this data facilitated by data standards and in particular a robust compound standardization workflow; we integrated several types of LINCS signatures and analyzed the results with a focus on mechanism of action and chemical compounds. We illustrate how kinase targets can be related to disease models and relevant drugs. We identified some fundamental trends that appear to link Kinome binding profiles and transcriptional signatures to chemical information and biochemical binding profiles to transcriptional responses independent of chemical similarity. To fill gaps in the datasets we developed and applied predictive models. The results can be interpreted at the systems level as demonstrated based on a large number of signaling pathways. We can identify clear global relationships, suggesting robustness of cellular responses to chemical perturbation. Overall, the results suggest that chemical similarity is a useful measure at the systems level, which would support phenotypic drug optimization efforts. With this study we demonstrate the potential of such integrated analysis approaches and suggest prioritizing further experiments to fill the gaps in the current data.

  20. Quantum transport through organic molecules

    International Nuclear Information System (INIS)

    Maiti, Santanu K.

    2007-01-01

    We investigate the electronic transport for the model of benzene-1, 4-dithiolate (BDT) molecule and some other geometric models of benzene molecule attached with two semi-infinite metallic electrodes by the use of Green's function technique. An analytic approach for the electronic transport through the molecular bridges is presented, based on the tight-binding model. Transport of electrons in such molecular bridges is strongly affected by the geometry of the molecules and their coupling strength with the electrodes. Conductance (g) shows resonance peaks associated with the molecular energy eigenstates. In the weak molecule-to-electrodes coupling limit current (I) passing through the molecules shows staircase-like behavior with sharp steps, while, it varies quite continuously in the limit of strong molecular coupling with the applied bias voltage (V). In presence of the transverse magnetic field conductance gives oscillatory behavior with flux φ, threaded by the molecular ring, showing φ 0 ( = ch/e) flux-quantum periodicity. Though conductance changes with the application of transverse magnetic field, but the current-voltage characteristics remain same in presence of this magnetic field for these molecular bridge systems

  1. Molecular recognition of chromophore molecules to amine terminated surfaces

    International Nuclear Information System (INIS)

    Flores-Perez, Rosangelly; Ivanisevic, Albena

    2007-01-01

    We report the design and characterization of quartz surfaces that can bind to three retinal based chromophores. The amine terminated surfaces were engineered in order to mimic the environment of the opsin protein that accommodates binding of chromophore molecules in the human eye. Each surface coupling step was characterized by water contact angle measurements, ellipsometry, atomic force microscopy, X-ray photoelectron spectroscopy, and transmission infrared spectroscopy. The spectroscopic techniques confirmed that the three chromophore molecules can bind to the surface using a Schiff base mode. Our data suggests that the availability of the amine groups on the surface is critical in the accommodation of the binding of different chromophores

  2. Biosensors engineered from conditionally stable ligand-binding domains

    Science.gov (United States)

    Church, George M.; Feng, Justin; Mandell, Daniel J.; Baker, David; Fields, Stanley; Jester, Benjamin Ward; Tinberg, Christine Elaine

    2017-09-19

    Disclosed is a biosensor engineered to conditionally respond to the presence of specific small molecules, the biosensors including conditionally stable ligand-binding domains (LBDs) which respond to the presence of specific small molecules, wherein readout of binding is provided by reporter genes or transcription factors (TFs) fused to the LBDs.

  3. Raman spectroscopy in investigations of mechanism of binding of human serum albumin to molecular probe fluorescein

    International Nuclear Information System (INIS)

    Vlasova, I M; Saletsky, A M

    2008-01-01

    The mechanism of binding of molecular probe fluorescein to molecules of human serum albumin was studied by the Raman spectroscopy method. The position of binding Center on human serum albumin molecule for fluorescein is determined. The amino acid residues of albumin molecule, participating in binding of fluorescein at different pH values of solution, are established. The conformation rearrangements of globules of human serum albumin, taking place at binding of fluorescein at different pH values of solution, are registered

  4. Mannose-Binding Lectin Binds to Amyloid Protein and Modulates Inflammation

    Directory of Open Access Journals (Sweden)

    Mykol Larvie

    2012-01-01

    Full Text Available Mannose-binding lectin (MBL, a soluble factor of the innate immune system, is a pattern recognition molecule with a number of known ligands, including viruses, bacteria, and molecules from abnormal self tissues. In addition to its role in immunity, MBL also functions in the maintenance of tissue homeostasis. We present evidence here that MBL binds to amyloid β peptides. MBL binding to other known carbohydrate ligands is calcium-dependent and has been attributed to the carbohydrate-recognition domain, a common feature of other C-type lectins. In contrast, we find that the features of MBL binding to Aβ are more similar to the reported binding characteristics of the cysteine-rich domain of the unrelated mannose receptor and therefore may involve the MBL cysteine-rich domain. Differences in MBL ligand binding may contribute to modulation of inflammatory response and may correlate with the function of MBL in processes such as coagulation and tissue homeostasis.

  5. Drug binding properties of neonatal albumin

    DEFF Research Database (Denmark)

    Brodersen, R; Honoré, B

    1989-01-01

    Neonatal and adult albumin was isolated by gel chromatography on Sephacryl S-300, from adult and umbilical cord serum, respectively. Binding of monoacetyl-diamino-diphenyl sulfone, warfarin, sulfamethizole, and diazepam was studied by means of equilibrium dialysis and the binding data were analyzed...... by the method of several acceptable fitted curves. It was found that the binding affinity to neonatal albumin is less than to adult albumin for monoacetyl-diamino-diphenyl sulfone and warfarin. Sulfamethizole binding to the neonatal protein is similarly reduced when more than one molecule of the drug is bound...

  6. NetMHCpan, a method for MHC class I binding prediction beyond humans

    DEFF Research Database (Denmark)

    Hoof, Ilka; Peters, B; Sidney, J

    2009-01-01

    molecules. We show that the NetMHCpan-2.0 method can accurately predict binding to uncharacterized HLA molecules, including HLA-C and HLA-G. Moreover, NetMHCpan-2.0 is demonstrated to accurately predict peptide binding to chimpanzee and macaque MHC class I molecules. The power of NetMHCpan-2.0 to guide...

  7. An Electrostatic Funnel in the GABA-Binding Pathway.

    Directory of Open Access Journals (Sweden)

    Timothy S Carpenter

    2016-04-01

    Full Text Available The γ-aminobutyric acid type A receptor (GABAA-R is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a 'funnel' that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site.

  8. Formation of Ultracold Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Cote, Robin [Univ. of Connecticut, Storrs, CT (United States)

    2016-01-28

    Advances in our ability to slow down and cool atoms and molecules to ultracold temperatures have paved the way to a revolution in basic research on molecules. Ultracold molecules are sensitive of very weak interactions, even when separated by large distances, which allow studies of the effect of those interactions on the behavior of molecules. In this program, we have explored ways to form ultracold molecules starting from pairs of atoms that have already reached the ultracold regime. We devised methods that enhance the efficiency of ultracold molecule production, for example by tuning external magnetic fields and using appropriate laser excitations. We also investigates the properties of those ultracold molecules, especially their de-excitation into stable molecules. We studied the possibility of creating new classes of ultra-long range molecules, named macrodimers, thousand times more extended than regular molecules. Again, such objects are possible because ultra low temperatures prevent their breakup by collision. Finally, we carried out calculations on how chemical reactions are affected and modified at ultracold temperatures. Normally, reactions become less effective as the temperature decreases, but at ultracold temperatures, they can become very effective. We studied this counter-intuitive behavior for benchmark chemical reactions involving molecular hydrogen.

  9. The status of molecules

    International Nuclear Information System (INIS)

    Barnes, T.; Oak Ridge National Lab., TN; Tennessee Univ., Knoxville, TN

    1994-06-01

    This report summarizes the experimental and theoretical status of hadronic molecules, which are weakly-bound states of two or more hadrons. We begin with a brief history of the subject and discuss a few good candidates, and then abstract some signatures for molecules which may be of interest in the classification of possible molecule states. Next we argue that a more general understanding of 2 → 2 hadron-hadron scattering amplitudes will be crucial for molecule searches, and discuss some of our recent work in this area. We conclude with a discussion of a few more recent molecule candidates (notably the f o (1710)) which are not well established as molecules but satisfy some of the expected signatures. (Author)

  10. Retinoid-binding proteins: similar protein architectures bind similar ligands via completely different ways.

    Directory of Open Access Journals (Sweden)

    Yu-Ru Zhang

    Full Text Available BACKGROUND: Retinoids are a class of compounds that are chemically related to vitamin A, which is an essential nutrient that plays a key role in vision, cell growth and differentiation. In vivo, retinoids must bind with specific proteins to perform their necessary functions. Plasma retinol-binding protein (RBP and epididymal retinoic acid binding protein (ERABP carry retinoids in bodily fluids, while cellular retinol-binding proteins (CRBPs and cellular retinoic acid-binding proteins (CRABPs carry retinoids within cells. Interestingly, although all of these transport proteins possess similar structures, the modes of binding for the different retinoid ligands with their carrier proteins are different. METHODOLOGY/PRINCIPAL FINDINGS: In this work, we analyzed the various retinoid transport mechanisms using structure and sequence comparisons, binding site analyses and molecular dynamics simulations. Our results show that in the same family of proteins and subcellular location, the orientation of a retinoid molecule within a binding protein is same, whereas when different families of proteins are considered, the orientation of the bound retinoid is completely different. In addition, none of the amino acid residues involved in ligand binding is conserved between the transport proteins. However, for each specific binding protein, the amino acids involved in the ligand binding are conserved. The results of this study allow us to propose a possible transport model for retinoids. CONCLUSIONS/SIGNIFICANCE: Our results reveal the differences in the binding modes between the different retinoid-binding proteins.

  11. Nanopore Device for Reversible Ion and Molecule Sensing or Migration

    Science.gov (United States)

    Pourmand, Nader (Inventor); Vilozny, Boaz (Inventor); Actis, Paolo (Inventor); Seger, R. Adam (Inventor); Singaram, Bakthan (Inventor)

    2015-01-01

    Disclosed are methods and devices for detection of ion migration and binding, utilizing a nanopipette adapted for use in an electrochemical sensing circuit. The nanopipette may be functionalized on its interior bore with metal chelators for binding and sensing metal ions or other specific binding molecules such as boronic acid for binding and sensing glucose. Such a functionalized nanopipette is comprised in an electrical sensor that detects when the nanopipette selectively and reversibly binds ions or small molecules. Also disclosed is a nanoreactor, comprising a nanopipette, for controlling precipitation in aqueous solutions by voltage-directed ion migration, wherein ions may be directed out of the interior bore by a repulsing charge in the bore.

  12. Formation of ultracold NaRb Feshbach molecules

    International Nuclear Information System (INIS)

    Wang, Fudong; He, Xiaodong; Li, Xiaoke; Zhu, Bing; Chen, Jun; Wang, Dajun

    2015-01-01

    We report the creation of ultracold bosonic 23 Na 87 Rb Feshbach molecules via magneto-association. By ramping the magnetic field across an interspecies Feshbach resonance (FR), at least 4000 molecules can be produced out of the near degenerate ultracold mixture. Fast loss due to inelastic atom–molecule collisions is observed, which limits the pure molecule number, after residual atoms removal, to 1700. The pure molecule sample can live for 21.8(8) ms in the optical trap, long enough for future molecular spectroscopy studies toward coherently transferring to the singlet ro-vibrational ground state, where these molecules are stable against chemical reaction and have a permanent electric dipole moment of 3.3 Debye. We have also measured the Feshbach molecule’s binding energy near the FR by the oscillating magnetic field method and found these molecules have a large closed-channel fraction. (paper)

  13. Structural requirements for the interaction between class II MHC molecules and peptide antigens

    DEFF Research Database (Denmark)

    Sette, A; Buus, S; Appella, E

    1990-01-01

    of binding, it is possible to define certain structural features of peptides that are associated with the capacity to bind to a particular MHC specificity (IA(d) or IE(d)); 3) IA(d) and IE(d) molecules recognize different and independent structures on the antigen molecule; 4) only about 10% of the single...... IA(d) and IE(d) molecules and their peptide ligands, we found that some structural characteristics apply to both antigen-MHC interactions. In particular, we found: 1) each MHC molecule is capable of binding many unrelated peptides through the same peptide-binding site; 2) despite this permissiveness...... amino acid substitutions tested on two IA(d)- and IE(d)-binding peptides had significant effect on their MHC-binding capacities, while over 80% of these substitutions significantly impaired T cell recognition of the Ia-peptide complex; 5) based on the segregation between residues that are crucial for T...

  14. Carboplatin binding to histidine

    Energy Technology Data Exchange (ETDEWEB)

    Tanley, Simon W. M. [University of Manchester, Brunswick Street, Manchester M13 9PL (United Kingdom); Diederichs, Kay [University of Konstanz, D-78457 Konstanz (Germany); Kroon-Batenburg, Loes M. J. [Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Levy, Colin [University of Manchester, 131 Princess Street, Manchester M1 7DN (United Kingdom); Schreurs, Antoine M. M. [Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Helliwell, John R., E-mail: john.helliwell@manchester.ac.uk [University of Manchester, Brunswick Street, Manchester M13 9PL (United Kingdom)

    2014-08-29

    An X-ray crystal structure showing the binding of purely carboplatin to histidine in a model protein has finally been obtained. This required extensive crystallization trials and various novel crystal structure analyses. Carboplatin is a second-generation platinum anticancer agent used for the treatment of a variety of cancers. Previous X-ray crystallographic studies of carboplatin binding to histidine (in hen egg-white lysozyme; HEWL) showed the partial conversion of carboplatin to cisplatin owing to the high NaCl concentration used in the crystallization conditions. HEWL co-crystallizations with carboplatin in NaBr conditions have now been carried out to confirm whether carboplatin converts to the bromine form and whether this takes place in a similar way to the partial conversion of carboplatin to cisplatin observed previously in NaCl conditions. Here, it is reported that a partial chemical transformation takes place but to a transplatin form. Thus, to attempt to resolve purely carboplatin binding at histidine, this study utilized co-crystallization of HEWL with carboplatin without NaCl to eliminate the partial chemical conversion of carboplatin. Tetragonal HEWL crystals co-crystallized with carboplatin were successfully obtained in four different conditions, each at a different pH value. The structural results obtained show carboplatin bound to either one or both of the N atoms of His15 of HEWL, and this particular variation was dependent on the concentration of anions in the crystallization mixture and the elapsed time, as well as the pH used. The structural details of the bound carboplatin molecule also differed between them. Overall, the most detailed crystal structure showed the majority of the carboplatin atoms bound to the platinum centre; however, the four-carbon ring structure of the cyclobutanedicarboxylate moiety (CBDC) remained elusive. The potential impact of the results for the administration of carboplatin as an anticancer agent are described.

  15. Molecule of the Month

    Indian Academy of Sciences (India)

    Atoms in a molecule generally prefer, particularly among the neighbouring ones, certain optimmn geometrical relationships. These are manifested in specific ranges of bond lengths, bond angles, torsion angles etc. As it always happens, chemists are interested in making molecules where these 'standard relationships' are ...

  16. Molecule of the Month

    Indian Academy of Sciences (India)

    Cyclo bu tadiene (1) has been one of the most popular molecules for experimentalists and theoreticians. This molecule is unstable as . it is antiaromatic ( 4,n electrons in a cyclic array). Even though some highly substituted cyclobutadienes, for example, compound 2 and the Fe(CO)3 complex of cyclobutadiene (3) are ...

  17. Single-Molecule Spectroscopy

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 20; Issue 2. Single-Molecule Spectroscopy: Every Molecule is Different! Kankan Bhattacharyya. General Article Volume 20 Issue 2 February 2015 pp 151-164. Fulltext. Click here to view fulltext PDF. Permanent link:

  18. Single molecule conductance

    NARCIS (Netherlands)

    Willems, R.

    2008-01-01

    This thesis represents an excursion into the world of molecular electronics, i.e. the field of research trying to use individual (organic) molecules as electronic components; in this work various experimental methods have been explored to connect individual molecules to metallic contacts and

  19. Molecules in stars

    International Nuclear Information System (INIS)

    Tsuji, T.

    1986-01-01

    Recently, research related to molecules in stars has rapidly expanded because of progress in related fields. For this reason, it is almost impossible to cover all the topics related to molecules in stars. Thus, here the authors focus their attention on molecules in the atmospheres of cool stars and do not cover in any detail topics related to circumstellar molecules originating from expanding envelopes located far from the stellar surface. However, the authors do discuss molecules in quasi-static circumstellar envelopes (a recently discovered new component of circumstellar envelopes) located near the stellar surface, since molecular lines originating from such envelopes show little velocity shift relative to photospheric lines, and hence they directly affect the interpretation and analysis of stellar spectra

  20. Comprehensive Map of Molecules Implicated in Obesity.

    Directory of Open Access Journals (Sweden)

    Jaisri Jagannadham

    Full Text Available Obesity is a global epidemic affecting over 1.5 billion people and is one of the risk factors for several diseases such as type 2 diabetes mellitus and hypertension. We have constructed a comprehensive map of the molecules reported to be implicated in obesity. A deep curation strategy was complemented by a novel semi-automated text mining system in order to screen 1,000 full-length research articles and over 90,000 abstracts that are relevant to obesity. We obtain a scale free network of 804 nodes and 971 edges, composed of 510 proteins, 115 genes, 62 complexes, 23 RNA molecules, 83 simple molecules, 3 phenotype and 3 drugs in "bow-tie" architecture. We classify this network into 5 modules and identify new links between the recently discovered fat mass and obesity associated FTO gene with well studied examples such as insulin and leptin. We further built an automated docking pipeline to dock orlistat as well as other drugs against the 24,000 proteins in the human structural proteome to explain the therapeutics and side effects at a network level. Based upon our experiments, we propose that therapeutic effect comes through the binding of one drug with several molecules in target network, and the binding propensity is both statistically significant and different in comparison with any other part of human structural proteome.

  1. Self-consistent field theory of polymer-ionic molecule complexation

    OpenAIRE

    Nakamura, Issei; Shi, An-Chang

    2010-01-01

    A self-consistent field theory is developed for polymers that are capable of binding small ionic molecules (adsorbates). The polymer-ionic molecule association is described by Ising-like binding variables, C_(i)^(a)(kΔ)(= 0 or 1), whose average determines the number of adsorbed molecules, nBI. Polymer gelation can occur through polymer-ionic molecule complexation in our model. For polymer-polymer cross-links through the ionic molecules, three types of solutions for nBI are obtained, depending...

  2. Dynamics of Activated Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Mullin, Amy S. [Univ. of Maryland, College Park, MD (United States)

    2016-11-16

    Experimental studies have been performed to investigate the collisional energy transfer processes of gas-phase molecules that contain large amounts of internal energy. Such molecules are prototypes for molecules under high temperature conditions relevant in combustion and information about their energy transfer mechanisms is needed for a detailed understanding and modeling of the chemistry. We use high resolution transient IR absorption spectroscopy to measure the full, nascent product distributions for collisions of small bath molecules that relax highly vibrationally excited pyrazine molecules with E=38000 cm-1 of vibrational energy. To perform these studies, we developed new instrumentation based on modern IR light sources to expand our experimental capabilities to investigate new molecules as collision partners. This final report describes our research in four areas: the characterization of a new transient absorption spectrometer and the results of state-resolved collision studies of pyrazine(E) with HCl, methane and ammonia. Through this research we have gained fundamental new insights into the microscopic details of relatively large complex molecules at high energy as they undergo quenching collisions and redistribute their energy.

  3. Dissociation in small molecules

    International Nuclear Information System (INIS)

    Dehmer, P.M.

    1982-01-01

    The study of molecular dissociation processes is one of the most interesting areas of modern spectroscopy owing to the challenges presented bt even the simplest of diatomic molecules. This paper reviews the commonly used descriptions of molecular dissociation processes for diatomic molecules, the selection rules for predissociation, and a few of the principles to be remembered when one is forced to speculate about dissociation mechanisms in a new molecule. Some of these points will be illustrated by the example of dissociative ionization in O 2

  4. Single molecules and nanotechnology

    CERN Document Server

    Vogel, Horst

    2007-01-01

    This book focuses on recent advances in the rapidly evolving field of single molecule research. These advances are of importance for the investigation of biopolymers and cellular biochemical reactions, and are essential to the development of quantitative biology. Written by leading experts in the field, the articles cover a broad range of topics, including: quantum photonics of organic dyes and inorganic nanoparticles their use in detecting properties of single molecules the monitoring of single molecule (enzymatic) reactions single protein (un)folding in nanometer-sized confined volumes the dynamics of molecular interactions in biological cells The book is written for advanced students and scientists who wish to survey the concepts, techniques and results of single molecule research and assess them for their own scientific activities.

  5. Electron-molecule collisions

    CERN Document Server

    Takayanagi, Kazuo

    1984-01-01

    Scattering phenomena play an important role in modern physics. Many significant discoveries have been made through collision experiments. Amongst diverse kinds of collision systems, this book sheds light on the collision of an electron with a molecule. The electron-molecule collision provides a basic scattering problem. It is scattering by a nonspherical, multicentered composite particle with its centers having degrees of freedom of motion. The molecule can even disintegrate, Le., dissociate or ionize into fragments, some or all of which may also be molecules. Although it is a difficult problem, the recent theoretical, experimental, and computational progress has been so significant as to warrant publication of a book that specializes in this field. The progress owes partly to technical develop­ ments in measurements and computations. No less important has been the great and continuing stimulus from such fields of application as astrophysics, the physics of the earth's upper atmosphere, laser physics, radiat...

  6. Molecules to Materials

    Indian Academy of Sciences (India)

    evolved as a new line of thinking wherein a single molecule or perhaps a collection .... In photonic communication processes, laser light has to be modulated and .... The author wishes to thank G Rajaram for a critical reading of the manuscript.

  7. Single-Molecule Spectroscopy

    Indian Academy of Sciences (India)

    IAS Admin

    overall absorption spectrum of a molecule is a superposition of many such sharp lines .... dilute solution of the enzyme and the substrate over few drops of silicone oil placed ..... Near-field Scanning Optical Microscopy (NSOM): Development.

  8. Quantum dot molecules

    CERN Document Server

    Wu, Jiang

    2014-01-01

    This book reviews recent advances in the exciting and rapidly growing field of quantum dot molecules (QDMs). It offers state-of-the-art coverage of novel techniques and connects fundamental physical properties with device design.

  9. Molecule of the Month

    Indian Academy of Sciences (India)

    Molecule of the Month - Adamantane - A Plastic Piece of Diamond. J Chandrasekhar. Volume 16 Issue 12 ... Keywords. Adamantane; diamondoid systems; plastic crystals. ... Resonance – Journal of Science Education | News. © 2017 Indian ...

  10. Defining RNA-Small Molecule Affinity Landscapes Enables Design of a Small Molecule Inhibitor of an Oncogenic Noncoding RNA.

    Science.gov (United States)

    Velagapudi, Sai Pradeep; Luo, Yiling; Tran, Tuan; Haniff, Hafeez S; Nakai, Yoshio; Fallahi, Mohammad; Martinez, Gustavo J; Childs-Disney, Jessica L; Disney, Matthew D

    2017-03-22

    RNA drug targets are pervasive in cells, but methods to design small molecules that target them are sparse. Herein, we report a general approach to score the affinity and selectivity of RNA motif-small molecule interactions identified via selection. Named High Throughput Structure-Activity Relationships Through Sequencing (HiT-StARTS), HiT-StARTS is statistical in nature and compares input nucleic acid sequences to selected library members that bind a ligand via high throughput sequencing. The approach allowed facile definition of the fitness landscape of hundreds of thousands of RNA motif-small molecule binding partners. These results were mined against folded RNAs in the human transcriptome and identified an avid interaction between a small molecule and the Dicer nuclease-processing site in the oncogenic microRNA (miR)-18a hairpin precursor, which is a member of the miR-17-92 cluster. Application of the small molecule, Targapremir-18a, to prostate cancer cells inhibited production of miR-18a from the cluster, de-repressed serine/threonine protein kinase 4 protein (STK4), and triggered apoptosis. Profiling the cellular targets of Targapremir-18a via Chemical Cross-Linking and Isolation by Pull Down (Chem-CLIP), a covalent small molecule-RNA cellular profiling approach, and other studies showed specific binding of the compound to the miR-18a precursor, revealing broadly applicable factors that govern small molecule drugging of noncoding RNAs.

  11. Lessons learned from mice deficient in lectin complement pathway molecules

    DEFF Research Database (Denmark)

    Genster, Ninette; Takahashi, Minoru; Sekine, Hideharu

    2014-01-01

    in turn activate downstream complement components, ultimately leading to elimination of the pathogen. Mice deficient in the key molecules of lectin pathway of complement have been generated in order to build knowledge of the molecular mechanisms of the lectin pathway in health and disease. Despite......The lectin pathway of the complement system is initiated when the pattern-recognition molecules, mannose-binding lectin (MBL), ficolins or collectin-11, bind to invading pathogens or damaged host cells. This leads to activation of MBL/ficolin/collectin-11 associated serine proteases (MASPs), which...... differences in the genetic arrangements of murine and human orthologues of lectin pathway molecules, the knockout mice have proven to be valuable models to explore the effect of deficiency states in humans. In addition, new insight and unexpected findings on the diverse roles of lectin pathway molecules...

  12. Human plasminogen binding protein tetranectin

    DEFF Research Database (Denmark)

    Kastrup, J S; Rasmussen, H; Nielsen, B B

    1997-01-01

    The recombinant human plasminogen binding protein tetranectin (TN) and the C-type lectin CRD of this protein (TN3) have been crystallized. TN3 crystallizes in the tetragonal space group P4(2)2(1)2 with cell dimensions a = b = 64.0, c = 75.7 A and with one molecule per asymmetric unit. The crystals...... to at least 2.5 A. A full data set has been collected to 3.0 A. The asymmetric unit contains one monomer of TN. Molecular replacement solutions for TN3 and TN have been obtained using the structure of the C-type lectin CRD of rat mannose-binding protein as search model. The rhombohedral space group indicates...

  13. Electron-molecule collisions

    International Nuclear Information System (INIS)

    Shimamura, I.; Takayanagi, K.

    1984-01-01

    The study of collision processes plays an important research role in modern physics. Many significant discoveries have been made by means of collision experiments. Based on theoretical, experimental, and computational studies, this volume presents an overview detailing the basic processes of electron-molecule collisions. The editors have collected papers-written by a group of international experts-that consider a diverse range of phenomena occurring in electronmolecule collisions. The volume discusses first the basic formulation for scattering problems and then gives an outline of the physics of electron-molecule collisions. The main topics covered are rotational transitions, vibrational transitions, dissociation of molecules in slow collisions, the electron-molecule collision as a spectroscopic tool for studying molecular electronic structures, and experimental and computational techniques for determining the cross sections. These well-referenced chapters are self-contained and can be read independently or consecutively. Authoritative and up-to-date, Electron-Molecule Collisions is a useful addition to the libraries of students and researchers in the fields of atomic, molecular, and chemical physics, and physical chemistry

  14. MOLECULES IN η CARINAE

    International Nuclear Information System (INIS)

    Loinard, Laurent; Menten, Karl M.; Güsten, Rolf; Zapata, Luis A.; Rodríguez, Luis F.

    2012-01-01

    We report the detection toward η Carinae of six new molecules, CO, CN, HCO + , HCN, HNC, and N 2 H + , and of two of their less abundant isotopic counterparts, 13 CO and H 13 CN. The line profiles are moderately broad (∼100 km s –1 ), indicating that the emission originates in the dense, possibly clumpy, central arcsecond of the Homunculus Nebula. Contrary to previous claims, CO and HCO + do not appear to be underabundant in η Carinae. On the other hand, molecules containing nitrogen or the 13 C isotope of carbon are overabundant by about one order of magnitude. This demonstrates that, together with the dust responsible for the dimming of η Carinae following the Great Eruption, the molecules detected here must have formed in situ out of CNO-processed stellar material.

  15. Electron Accumulative Molecules.

    Science.gov (United States)

    Buades, Ana B; Sanchez Arderiu, Víctor; Olid-Britos, David; Viñas, Clara; Sillanpää, Reijo; Haukka, Matti; Fontrodona, Xavier; Paradinas, Markos; Ocal, Carmen; Teixidor, Francesc

    2018-02-28

    With the goal to produce molecules with high electron accepting capacity and low reorganization energy upon gaining one or more electrons, a synthesis procedure leading to the formation of a B-N(aromatic) bond in a cluster has been developed. The research was focused on the development of a molecular structure able to accept and release a specific number of electrons without decomposing or change in its structural arrangement. The synthetic procedure consists of a parallel decomposition reaction to generate a reactive electrophile and a synthesis reaction to generate the B-N(aromatic) bond. This procedure has paved the way to produce the metallacarboranylviologen [M(C 2 B 9 H 11 )(C 2 B 9 H 10 )-NC 5 H 4 -C 5 H 4 N-M'(C 2 B 9 H 11 )(C 2 B 9 H 10 )] (M = M' = Co, Fe and M = Co and M' = Fe) and semi(metallacarboranyl)viologen [3,3'-M(8-(NC 5 H 4 -C 5 H 4 N-1,2-C 2 B 9 H 10 )(1',2'-C 2 B 9 H 11 )] (M = Co, Fe) electron cumulative molecules. These molecules are able to accept up to five electrons and to donate one in single electron steps at accessible potentials and in a reversible way. By targeted synthesis and corresponding electrochemical tests each electron transfer (ET) step has been assigned to specific fragments of the molecules. The molecules have been carefully characterized, and the electronic communication between both metal centers (when this situation applies) has been definitely observed through the coplanarity of both pyridine fragments. The structural characteristics of these molecules imply a low reorganization energy that is a necessary requirement for low energy ET processes. This makes them electronically comparable to fullerenes, but on their side, they have a wide range of possible solvents. The ET from one molecule to another has been clearly demonstrated as well as their self-organizing capacity. We consider that these molecules, thanks to their easy synthesis, ET, self-organizing capacity, wide range of solubility, and easy processability, can

  16. Detection of secondary binding sites in proteins using fragment screening.

    Science.gov (United States)

    Ludlow, R Frederick; Verdonk, Marcel L; Saini, Harpreet K; Tickle, Ian J; Jhoti, Harren

    2015-12-29

    Proteins need to be tightly regulated as they control biological processes in most normal cellular functions. The precise mechanisms of regulation are rarely completely understood but can involve binding of endogenous ligands and/or partner proteins at specific locations on a protein that can modulate function. Often, these additional secondary binding sites appear separate to the primary binding site, which, for example for an enzyme, may bind a substrate. In previous work, we have uncovered several examples in which secondary binding sites were discovered on proteins using fragment screening approaches. In each case, we were able to establish that the newly identified secondary binding site was biologically relevant as it was able to modulate function by the binding of a small molecule. In this study, we investigate how often secondary binding sites are located on proteins by analyzing 24 protein targets for which we have performed a fragment screen using X-ray crystallography. Our analysis shows that, surprisingly, the majority of proteins contain secondary binding sites based on their ability to bind fragments. Furthermore, sequence analysis of these previously unknown sites indicate high conservation, which suggests that they may have a biological function, perhaps via an allosteric mechanism. Comparing the physicochemical properties of the secondary sites with known primary ligand binding sites also shows broad similarities indicating that many of the secondary sites may be druggable in nature with small molecules that could provide new opportunities to modulate potential therapeutic targets.

  17. Molecule of the Month

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 1; Issue 2. Molecule of the Month Isomers of Benzene - Still Pursuing Dreams. J Chandrasekhar. Feature Article Volume 1 Issue 2 February 1996 pp 80-83. Fulltext. Click here to view fulltext PDF. Permanent link:

  18. Atoms, Molecules, and Compounds

    CERN Document Server

    Manning, Phillip

    2007-01-01

    Explores the atoms that govern chemical processes. This book shows how the interactions between simple substances such as salt and water are crucial to life on Earth and how those interactions are predestined by the atoms that make up the molecules.

  19. Electrons in Molecules

    Indian Academy of Sciences (India)

    structure and properties (includingreactivt'ty) - both static (independent of time) and ... Furthermore, since the energy of H2 + in the ground state must be lower than that of .... (Figure 2b); note also that dp is positive in parts of the antibinding regions behind the two ... But, now both the sizes and shapes of molecules enter into.

  20. Molecule of the Month

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Molecule of the Month - A Stable Dibismuthene - A Compound with a Bi-Bi Double Bond. V Chandrasekhar. Volume 16 ... Author Affiliations. V Chandrasekhar1. Department of Chemistry, Indian Institute of Technology, Kanpur 208 016, India.

  1. OMG: Open molecule generator

    NARCIS (Netherlands)

    Peironcely, J.E.; Rojas-Chertó, M.; Fichera, D.; Reijmers, T.; Coulier, L.; Faulon, J.-L.; Hankemeier, T.

    2012-01-01

    Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG), which for a given elemental composition produces all non-isomorphic chemical

  2. Molecule-based magnets

    Indian Academy of Sciences (India)

    Administrator

    Employing self-assembly methods, it is possible to engineer a bulk molecular material ... synthesis of molecular magnets in 1986, a large variety of them have been synthesized, which can be catego- ... maintained stably per organic molecule, stabilization of a ..... rotating freely under an applied field because it is a magne-.

  3. Molecule of the Month

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 5. Molecule of the Month Molecular–Chameleon: Solvatochromism at its Iridescent Best! Photon Rao. Feature Article Volume 2 Issue 5 May 1997 pp 69-72. Fulltext. Click here to view fulltext PDF. Permanent link:

  4. Electron transfer dynamics of bistable single-molecule junctions

    DEFF Research Database (Denmark)

    Danilov, A.V; Kubatkin, S.; Kafanov, S. G.

    2006-01-01

    We present transport measurements of single-molecule junctions bridged by a molecule with three benzene rings connected by two double bonds and with thiol end-groups that allow chemical binding to gold electrodes. The I-V curves show switching behavior between two distinct states. By statistical ...... analysis of the switching events, we show that a 300 meV mode mediates the transition between the two states. We propose that breaking and reformation of a S-H bond in the contact zone between molecule and electrode explains the observed bistability....

  5. Exotic helium molecules

    International Nuclear Information System (INIS)

    Portier, M.

    2007-12-01

    We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range 4 He 2 (2 3 S 1 -2 3 P 0 ) molecule, or a 4 He 2 (2 3 S 1 -2 3 S 1 ) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 ± 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range 4 He 2 (2 3 S 1 -2 3 S 1 ) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime τ = (1.4 ± 0.3) μs is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)

  6. OMG: Open Molecule Generator.

    Science.gov (United States)

    Peironcely, Julio E; Rojas-Chertó, Miguel; Fichera, Davide; Reijmers, Theo; Coulier, Leon; Faulon, Jean-Loup; Hankemeier, Thomas

    2012-09-17

    Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG), which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.

  7. OMG: Open Molecule Generator

    Directory of Open Access Journals (Sweden)

    Peironcely Julio E

    2012-09-01

    Full Text Available Abstract Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG, which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.

  8. The X(3872) boson: Molecule or charmonium

    International Nuclear Information System (INIS)

    Suzuki, Mahiko

    2005-01-01

    It has been argued that the mystery boson X(3872) is a molecular state consisting of primarily D 0 (bar D)* 0 + (bar D) 0 D* 0 . In contrast, apparent puzzles and potential difficulties have been pointed out for the charmonium assignment of X(3872). They examine several aspects of these alternatives by semi-quantitative methods since quantitatively accurate results are often hard to reach on them. they point out that some of the observed properties of X(3872), in particular, the binding and the production rates are incompatible with the molecule interpretation. Despite puzzles and obstacles, X(3872) may fit more likely to the excited 3 P 1 charmonium than to the molecule after the mixing of c(bar c) with D(bar D)* + (bar D)D* is taken into account

  9. Structural characterization of some substituted azolidine molecules

    International Nuclear Information System (INIS)

    Andreocci, M.V.; Bossa, M.; Furlani, C.; Mattogno, G.; Zanoni, R.; Consiglio Nazionale delle Ricerche, Rome; Devillanova, F.A.; Verani, G.

    1981-01-01

    The electronic structure of a series of organic molecules of general formula RN - (CH 2 ) 2 - X - C = Y, which are also of interest in inorganic chemistry because of their properties as ligands towards metals, have been investigated by X-ray photoelectron spectroscopy. The results suggest a general picture of atomic charge distribution within the investigated molecules, and allow an assessment of the effect of the different substituent groups X, Y, R (X = NR', O, S, CH 2 ; Y = O, S, Se; R, R' = H, alkyl) on the electronic structure of the ligands. Satisfactory correlation is found between experimental binding energies and computed CNDO/2 atomic charges, after correction for intramolecular Madelung potentials. (orig.)

  10. Augmented-plane-wave calculations on small molecules

    International Nuclear Information System (INIS)

    Serena, P.A.; Baratoff, A.; Soler, J.M.

    1993-01-01

    We have performed ab initio calculations on a wide range of small molecules, demonstrating the accuracy and flexibility of an alternative method for calculating the electronic structure of molecules, solids, and surfaces. It is based on the local-density approximation (LDA) for exchange and correlation and the nonlinear augmented-plane-wave method. Very accurate atomic forces are obtained directly. This allows for implementation of Car-Parrinello-like techniques to determine simultaneously the self-consistent electron wave functions and the equilibrium atomic positions within an iterative scheme. We find excellent agreement with the best existing LDA-based calculations and remarkable agreement with experiment for the equilibrium geometries, vibrational frequencies, and dipole moments of a wide variety of molecules, including strongly bound homopolar and polar molecules, hydrogen-bound and electron-deficient molecules, and weakly bound alkali and noble-metal dimers, although binding energies are overestimated

  11. Thermally induced charge current through long molecules

    Science.gov (United States)

    Zimbovskaya, Natalya A.; Nitzan, Abraham

    2018-01-01

    In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.

  12. Towards single molecule biosensors using super-resolution fluorescence microscopy.

    Science.gov (United States)

    Lu, Xun; Nicovich, Philip R; Gaus, Katharina; Gooding, J Justin

    2017-07-15

    Conventional immunosensors require many binding events to give a single transducer output which represents the concentration of the analyte in the sample. Because of the requirements to selectively detect species in complex samples, immunosensing interfaces must allow immobilisation of antibodies while repelling nonspecific adsorption of other species. These requirements lead to quite sophisticated interfacial design, often with molecular level control, but we have no tools to characterise how well these interfaces work at the molecular level. The work reported herein is an initial feasibility study to show that antibody-antigen binding events can be monitored at the single molecule level using single molecule localisation microscopy (SMLM). The steps to achieve this first requires showing that indium tin oxide surfaces can be used for SMLM, then that these surfaces can be modified with self-assembled monolayers using organophosphonic acid derivatives, that the amount of antigens and antibodies on the surface can be controlled and monitored at the single molecule level and finally antibody binding to antigen modified surfaces can be monitored. The results show the amount of antibody that binds to an antigen modified surface is dependent on both the concentration of antigen on the surface and the concentration of antibody in solution. This study demonstrates the potential of SMLM for characterising biosensing interfaces and as the transducer in a massively parallel, wide field, single molecule detection scheme for quantitative analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Thermodynamic parameters for polyether adducts with neutral molecules

    International Nuclear Information System (INIS)

    Spencer, J.N.; Zafar, A.I.; Ganunis, T.F.

    1992-01-01

    Using calorimetry, thermodynamic parameters for the interaction of neutral molecules with polyether adducts are determined. When compared to its analogous acyclic ether, no macrocyclic effect is observed for 12-crown-4. The ether's collective oxygen atoms' action determines interaction with acetonitrile and malononitrile, with dimethyltin dichloride having a specific oxygen-binding site. 14 refs., 1 tab

  14. Recent improvements to Binding MOAD: a resource for protein–ligand binding affinities and structures

    Science.gov (United States)

    Ahmed, Aqeel; Smith, Richard D.; Clark, Jordan J.; Dunbar, James B.; Carlson, Heather A.

    2015-01-01

    For over 10 years, Binding MOAD (Mother of All Databases; http://www.BindingMOAD.org) has been one of the largest resources for high-quality protein–ligand complexes and associated binding affinity data. Binding MOAD has grown at the rate of 1994 complexes per year, on average. Currently, it contains 23 269 complexes and 8156 binding affinities. Our annual updates curate the data using a semi-automated literature search of the references cited within the PDB file, and we have recently upgraded our website and added new features and functionalities to better serve Binding MOAD users. In order to eliminate the legacy application server of the old platform and to accommodate new changes, the website has been completely rewritten in the LAMP (Linux, Apache, MySQL and PHP) environment. The improved user interface incorporates current third-party plugins for better visualization of protein and ligand molecules, and it provides features like sorting, filtering and filtered downloads. In addition to the field-based searching, Binding MOAD now can be searched by structural queries based on the ligand. In order to remove redundancy, Binding MOAD records are clustered in different families based on 90% sequence identity. The new Binding MOAD, with the upgraded platform, features and functionalities, is now equipped to better serve its users. PMID:25378330

  15. Recent improvements to Binding MOAD: a resource for protein-ligand binding affinities and structures.

    Science.gov (United States)

    Ahmed, Aqeel; Smith, Richard D; Clark, Jordan J; Dunbar, James B; Carlson, Heather A

    2015-01-01

    For over 10 years, Binding MOAD (Mother of All Databases; http://www.BindingMOAD.org) has been one of the largest resources for high-quality protein-ligand complexes and associated binding affinity data. Binding MOAD has grown at the rate of 1994 complexes per year, on average. Currently, it contains 23,269 complexes and 8156 binding affinities. Our annual updates curate the data using a semi-automated literature search of the references cited within the PDB file, and we have recently upgraded our website and added new features and functionalities to better serve Binding MOAD users. In order to eliminate the legacy application server of the old platform and to accommodate new changes, the website has been completely rewritten in the LAMP (Linux, Apache, MySQL and PHP) environment. The improved user interface incorporates current third-party plugins for better visualization of protein and ligand molecules, and it provides features like sorting, filtering and filtered downloads. In addition to the field-based searching, Binding MOAD now can be searched by structural queries based on the ligand. In order to remove redundancy, Binding MOAD records are clustered in different families based on 90% sequence identity. The new Binding MOAD, with the upgraded platform, features and functionalities, is now equipped to better serve its users. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Single-Molecule Nanomagnets

    Science.gov (United States)

    Friedman, Jonathan R.; Sarachik, Myriam P.

    2010-04-01

    Single-molecule magnets straddle the classical and quantum mechanical worlds, displaying many fascinating phenomena. They may have important technological applications in information storage and quantum computation. We review the physical properties of two prototypical molecular nanomagnets, Mn12-acetate and Fe8: Each behaves as a rigid, spin-10 object and exhibits tunneling between up and down directions. As temperature is lowered, the spin-reversal process evolves from thermal activation to pure quantum tunneling. At low temperatures, magnetic avalanches occur in which the magnetization of an entire sample rapidly reverses. We discuss the important role that symmetry-breaking fields play in driving tunneling and in producing Berry-phase interference. Recent experimental advances indicate that quantum coherence can be maintained on timescales sufficient to allow a meaningful number of quantum computing operations to be performed. Efforts are under way to create monolayers and to address and manipulate individual molecules.

  17. Superexcited states of molecules

    International Nuclear Information System (INIS)

    Nakamura, Hiroki; Takagi, Hidekazu.

    1990-01-01

    The report addresses the nature and major features of molecule's superexcited states, focusing on their involvement in dynamic processes. It also outlines the quantum defect theory which allows various processes involving these states to be treated in a unified way. The Rydberg state has close relation with an ionized state with a positive energy. The quantum defect theory interprets such relation. Specifically, the report first describes the quantum defect theory focusing on its basic principle. The multi-channel quantum defect theory is then outlined centering on how to describe a Rydberg-type superexcited state. Description of a dissociative double-electron excited state is also discussed. The quantum defect theory is based on the fact that the physics of the motion of a Rydberg electron vary with the region in the electron's coordinate space. Finally, various molecular processes that involve a superexcited state are addressed focusing on autoionization, photoionization, dissociative recombination and bonding ionization of diatomic molecules. (N.K.)

  18. Atoms, molecules & elements

    CERN Document Server

    Graybill, George

    2007-01-01

    Young scientists will be thrilled to explore the invisible world of atoms, molecules and elements. Our resource provides ready-to-use information and activities for remedial students using simplified language and vocabulary. Students will label each part of the atom, learn what compounds are, and explore the patterns in the periodic table of elements to find calcium (Ca), chlorine (Cl), and helium (He) through hands-on activities.

  19. Photonic Molecule Lasers Revisited

    Science.gov (United States)

    Gagnon, Denis; Dumont, Joey; Déziel, Jean-Luc; Dubé, Louis J.

    2014-05-01

    Photonic molecules (PMs) formed by coupling two or more optical resonators are ideal candidates for the fabrication of integrated microlasers, photonic molecule lasers. Whereas most calculations on PM lasers have been based on cold-cavity (passive) modes, i.e. quasi-bound states, a recently formulated steady-state ab initio laser theory (SALT) offers the possibility to take into account the spectral properties of the underlying gain transition, its position and linewidth, as well as incorporating an arbitrary pump profile. We will combine two theoretical approaches to characterize the lasing properties of PM lasers: for two-dimensional systems, the generalized Lorenz-Mie theory will obtain the resonant modes of the coupled molecules in an active medium described by SALT. Not only is then the theoretical description more complete, the use of an active medium provides additional parameters to control, engineer and harness the lasing properties of PM lasers for ultra-low threshold and directional single-mode emission. We will extend our recent study and present new results for a number of promising geometries. The authors acknowledge financial support from NSERC (Canada) and the CERC in Photonic Innovations of Y. Messaddeq.

  20. Interstellar molecules and masers

    International Nuclear Information System (INIS)

    Nguyen-Q-Rieu; Guibert, J.

    1978-01-01

    The study of dense and dark clouds, in which hydrogen is mostly in molecular form, became possible since the discovery of interstellar molecules, emitting in the centimeter and millimeter wavelengths. The molecular lines are generally not in local thermal equilibrium (LTE). Their intensity can often be explained by invoking a population inversion mechanism. Maser emission lines due to OH, H 2 O and SiO molecules are among the most intense molecular lines. The H 2 CO molecule, detected in absorption in front of the cold cosmic background radiation of 2.7 K, illustrates the inverse phenomenon, the antimaser absorption. For a radio transition of frequency v, the inversion rate Δn (relative population difference between the upper and lower level) as well as the maser gain can be determined from the radio observations. In the case of the OH lines in the 2 PIsub(3/2), J=3/2 state, the inversion rates approximately 1 to 2% derived from the observations, are comparable with those obtained in the laboratory. The determination of the excitation mechanisms of the masers, through the statistical equilibrium and radiative transfer equations, implies the knowledge of collisional and radiative transition probabilities. A pumping model, which can satisfactorily explain the radio observations of some interstellar OH clouds, will be discussed [fr

  1. Functionalisation of the hinge region in receptor molecules for explosive detection

    DEFF Research Database (Denmark)

    Krebs, Frederik C

    2003-01-01

    The functionalisation of the hinge region in a molecular tweezer molecule showing a strong binding to explosives is presented. Two versatile functional groups are introduced, a carboxylic acid and a bromine atom. (C) 2003 Elsevier Ltd. All rights reserved....

  2. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer; Vovusha, Hakkim; Kaewmaraya, Thanayut; Amornkitbamrung, Vittaya; Ahuja, Rajeev

    2017-01-01

    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory

  3. Studying small molecule-aptamer interactions using MicroScale Thermophoresis (MST).

    Science.gov (United States)

    Entzian, Clemens; Schubert, Thomas

    2016-03-15

    Aptamers are potent and versatile binding molecules recognizing various classes of target molecules. Even challenging targets such as small molecules can be identified and bound by aptamers. Studying the interaction between aptamers and drugs, antibiotics or metabolites in detail is however difficult due to the lack of sophisticated analysis methods. Basic binding parameters of these small molecule-aptamer interactions such as binding affinity, stoichiometry and thermodynamics are elaborately to access using the state of the art technologies. The innovative MicroScale Thermophoresis (MST) is a novel, rapid and precise method to characterize these small molecule-aptamer interactions in solution at microliter scale. The technology is based on the movement of molecules through temperature gradients, a physical effect referred to as thermophoresis. The thermophoretic movement of a molecule depends - besides on its size - on charge and hydration shell. Upon the interaction of a small molecule and an aptamer, at least one of these parameters is altered, leading to a change in the movement behavior, which can be used to quantify molecular interactions independent of the size of the target molecule. The MST offers free choice of buffers, even measurements in complex bioliquids are possible. The dynamic affinity range covers the pM to mM range and is therefore perfectly suited to analyze small molecule-aptamer interactions. This section describes a protocol how quantitative binding parameters for aptamer-small molecule interactions can be obtained by MST. This is demonstrated by mapping down the binding site of the well-known ATP aptamer DH25.42 to a specific region at the adenine of the ATP molecule. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. A study on interaction of DNA molecules and carbon nanotubes for an effective ejection of the molecules

    International Nuclear Information System (INIS)

    Wu, N.; Wang, Q.

    2012-01-01

    The ejection of DNA molecules from carbon nanotubes is reported from interaction energy perspectives by molecular dynamics simulations. The critical ejection energy, which is to be applied to a DNA molecule for a successful ejection from a carbon nanotube, is investigated based on a study on the friction and binding energy between the DNA molecule and the tube. An effective ejection is realized by subjecting a kinetic energy on the DNA molecule that is larger than the solved critical ejection energy. In addition, the relationship between ejection energies and sizes of DNA molecules and carbon nanotubes is investigated. -- Highlights: ► Report the ejection of DNA molecules from CNTs from interaction energy perspectives. ► Develop a methodology for the critical energy of an effective ejection of a DNA molecule from a CNT. ► Present the relationship between critical ejection energies and sizes of DNA molecules and CNTs. ► Provide a general guidance on the ejection of encapsulated molecules from CNTs.

  5. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    Science.gov (United States)

    Dimitrov, Valentin V.

    2009-01-01

    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  6. Thermodynamic parameters for binding of fatty acids to human serum albumin

    DEFF Research Database (Denmark)

    Pedersen, A O; Honoré, B; Brodersen, R

    1990-01-01

    Binding of laurate and myristate anions to human serum albumin has been studied over a range of temperatures, 5-37 degrees C, at pH 7.4. The binding curves indicate that the strength of binding of the first few molecules of fatty acid to albumin (r less than 5) decreases with increasing temperatu...

  7. Simulation of diffusion time of small molecules in protein crystals.

    Science.gov (United States)

    Geremia, Silvano; Campagnolo, Mara; Demitri, Nicola; Johnson, Louise N

    2006-03-01

    A simple model for evaluation of diffusion times of small molecule into protein crystals has been developed, which takes into account the physical and chemical properties both of protein crystal and the diffusing molecules. The model also includes consideration of binding and the binding affinity of a ligand to the protein. The model has been validated by simulation of experimental set-ups of several examples found in the literature. These experiments cover a wide range of situations: from small to relatively large diffusing molecules, crystals having low, medium, or high protein density, and different size. The reproduced experiments include ligand exchange in protein crystals by soaking techniques. Despite the simplifying assumptions of the model, theoretical and experimental data are in agreement with available data, with experimental diffusion times ranging from a few seconds to several hours. The method has been used successfully for planning intermediate cryotrapping experiments in maltodextrin phosphorylase crystals.

  8. Total iron binding capacity

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003489.htm Total iron binding capacity To use the sharing features on this page, please enable JavaScript. Total iron binding capacity (TIBC) is a blood test to ...

  9. Quark chemistry: charmonium molecules

    International Nuclear Information System (INIS)

    De Rujula, A.; Jaffe, R.L.

    1977-01-01

    The theoretical and experimental evidence for two quark-two antiquark hadrons is reviewed. Concentration is placed on predictions for S-wave ''charmonium molecules,'' built of a c anti c charmonium pair and a light quark-antiquark pair. Their spectrum and quantum numbers are predicted and an estimate of their decay couplings and their prediction in monochromatic pion decays from charmonium resonances produced in e + e - -annihilation is given. Some S-wave charmonium resonances should be detectable in these decays, but typical branching ratios are only at the 1% level. 19 references

  10. Ultra-cold molecule production

    International Nuclear Information System (INIS)

    Ramirez-Serrano, Jamie; Chandler, David W.; Strecker, Kevin; Rahn, Larry A.

    2005-01-01

    The production of Ultra-cold molecules is a goal of many laboratories through out the world. Here we are pursuing a unique technique that utilizes the kinematics of atomic and molecular collisions to achieve the goal of producing substantial numbers of sub Kelvin molecules confined in a trap. Here a trap is defined as an apparatus that spatially localizes, in a known location in the laboratory, a sample of molecules whose temperature is below one degree absolute Kelvin. Further, the storage time for the molecules must be sufficient to measure and possibly further cool the molecules. We utilize a technique unique to Sandia to form cold molecules from near mass degenerate collisions between atoms and molecules. This report describes the progress we have made using this novel technique and the further progress towards trapping molecules we have cooled

  11. Zero-mode waveguide nanophotonic structures for single molecule characterization

    Science.gov (United States)

    Crouch, Garrison M.; Han, Donghoon; Bohn, Paul W.

    2018-05-01

    Single-molecule characterization has become a crucial research tool in the chemical and life sciences, but limitations, such as limited concentration range, inability to control molecular distributions in space, and intrinsic phenomena, such as photobleaching, present significant challenges. Recent developments in non-classical optics and nanophotonics offer promising routes to mitigating these restrictions, such that even low affinity (K D ~ mM) biomolecular interactions can be studied. Here we introduce and review specific nanophotonic devices used to support single molecule studies. Optical nanostructures, such as zero-mode waveguides (ZMWs), are usually fabricated in thin gold or aluminum films and serve to confine the observation volume of optical microspectroscopy to attoliter to zeptoliter volumes. These simple nanostructures allow individual molecules to be isolated for optical and electrochemical analysis, even when the molecules of interest are present at high concentration (µM–mM) in bulk solution. Arrays of ZMWs may be combined with optical probes such as single molecule fluorescence, single molecule fluorescence resonance energy transfer, and fluorescence correlation spectroscopy for distributed analysis of large numbers of single-molecule reactions or binding events in parallel. Furthermore, ZMWs may be used as multifunctional devices, for example by combining optical and electrochemical functions in a single discrete architecture to achieve electrochemical ZMWs. In this review, we will describe the optical properties, fabrication, and applications of ZMWs for single-molecule studies, as well as the integration of ZMWs into systems for chemical and biochemical analysis.

  12. Binding of ethidium to the nucleosome core particle. 2. Internal and external binding modes

    International Nuclear Information System (INIS)

    McMurray, C.T.; Small, E.W.; van Holde, K.E.

    1991-01-01

    The authors have previously reported that the binding of ethidium bromide to the nucleosome core particle results in a stepwise dissociation of the structure which involves the initial release of one copy each of H2A and H2B. In this report, they have examined the absorbance and fluorescence properties of intercalated and outside bound forms of ethidium bromide. From these properties, they have measured the extent of external, electrostatic binding of the dye versus internal, intercalation binding to the core particle, free from contribution by linker DNA. They have established that dissociation is induced by the intercalation mode of binding to DNA within the core particle DNA, and not by binding to the histones or by nonintercalative binding to DNA. The covalent binding of [ 3 H]-8-azidoethidium to the core particle clearly shows that < 1.0 adduct is formed per histone octamer over a wide range of input ratios. Simultaneously, analyses of steady-state fluorescence enhancement and fluorescence lifetime data from bound ethidium complexes demonstrate extensive intercalation binding. Combined analyses from steady-state fluorescence intensity with equilibrium dialysis or fluorescence lifetime data revealed that dissociation began when ∼14 ethidium molecules are bound by intercalation to each core particle and < 1.0 nonintercalated ion pair was formed per core particle

  13. Surface Passivation in Empirical Tight Binding

    OpenAIRE

    He, Yu; Tan, Yaohua; Jiang, Zhengping; Povolotskyi, Michael; Klimeck, Gerhard; Kubis, Tillmann

    2015-01-01

    Empirical Tight Binding (TB) methods are widely used in atomistic device simulations. Existing TB methods to passivate dangling bonds fall into two categories: 1) Method that explicitly includes passivation atoms is limited to passivation with atoms and small molecules only. 2) Method that implicitly incorporates passivation does not distinguish passivation atom types. This work introduces an implicit passivation method that is applicable to any passivation scenario with appropriate parameter...

  14. Passing Current through Touching Molecules

    DEFF Research Database (Denmark)

    Schull, G.; Frederiksen, Thomas; Brandbyge, Mads

    2009-01-01

    The charge flow from a single C-60 molecule to another one has been probed. The conformation and electronic states of both molecules on the contacting electrodes have been characterized using a cryogenic scanning tunneling microscope. While the contact conductance of a single molecule between two...

  15. Sugar-binding sites on the surface of the carbohydrate-binding module of CBH I from Trichoderma reesei.

    Science.gov (United States)

    Tavagnacco, Letizia; Mason, Philip E; Schnupf, Udo; Pitici, Felicia; Zhong, Linghao; Himmel, Michael E; Crowley, Michael; Cesàro, Attilio; Brady, John W

    2011-05-01

    Molecular dynamics simulations were carried out for a system consisting of the carbohydrate-binding module (CBM) of the cellulase CBH I from Trichoderma reesei (Hypocrea jecorina) in a concentrated solution of β-D-glucopyranose, to determine whether there is any tendency for the sugar molecules to bind to the CBM. In spite of the general tendency of glucose to behave as an osmolyte, a marked tendency for the sugar molecules to bind to the protein was observed. However, the glucose molecules tended to bind only to specific sites on the protein. As expected, the hydrophobic face of the sugar molecules, comprising the axial H1, H3, and H5 aliphatic protons, tended to adhere to the flat faces of the three tyrosine side chains on the planar binding surface of the CBM. However, a significant tendency to bind to a groove-like feature on the upper surface of the CBM was also observed. These results would not be inconsistent with a model of the mechanism for this globular domain in which the cellodextrin chain being removed from the surface of crystalline cellulose passes over the upper surface of the CBM, presumably then available for hydrolysis in the active site tunnel of this processive cellulase. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Direct observation of hindered eccentric rotation of an individual molecule : Cu-phthalocyanine on C60

    NARCIS (Netherlands)

    Stöhr, Meike; Wagner, T; Gabriel, M; Weyers, B; Moller, R

    2002-01-01

    Individual Cu-phthalocyanine molecules have been investigated by scanning tunnel microscopy on a closed packed film of C-60 at various temperatures. The molecules are found to bind asymmetrically to one C-60. While they remain in one position at low temperature, they can hop between six equivalent

  17. Selective intercalation of six ligands molecules in a self-assembled triple helix

    NARCIS (Netherlands)

    Mateos timoneda, Miguel; Kerckhoffs, J.M.C.A.; Reinhoudt, David; Crego Calama, Mercedes

    2007-01-01

    The addition of a ligand molecule to an artificial self-assembled triple helix leads to the selective intercalation of two hydrogen-bonded trimers in specific binding pockets. Furthermore, the triple helix suffers large conformational rearrangements in order to accommodate the ligand molecules in a

  18. Adsorption of small gas molecules on pure and Al-doped graphene ...

    Indian Academy of Sciences (India)

    2017-10-03

    Oct 3, 2017 ... and the molecules is an important factor in determining the binding strength of the ... the graphene sheet on the binding strength has been esti- mated. ..... ties of carbon materials, which leads to the sensitivity. It has also been ...

  19. Guest-host chemistry with dendrimers—binding of carboxylates in aqueous solution

    DEFF Research Database (Denmark)

    Ficker, Mario; Petersen, Johannes Fabritius; Hansen, Jon Stefan

    2015-01-01

    Recognition and binding of anions in water is difficult due to the ability of water molecules to form strong hydrogen bonds and to solvate the anions. The complexation of two different carboxylates with 1-(4-carbomethoxypyrrolidone)-terminated PAMAM dendrimers was studied in aqueous solution using...... the carboxylate-dendrimer interaction selectively. The binding stoichiometry for 3-hydroxy-2-naphthoate was found to be two strongly bound guest molecules per dendrimer and an additional 40 molecules with weak binding affinity. The NOESY NMR showed a clear binding correlation of sodium 3-hydroxy-2-naphthoate...... with the lyophilic dendrimer core, possibly with the two high affinity guest molecules. In comparison, sodium 2-naphthoate showed a weaker binding strength and had a stoichiometry of two guests per dendrimer with no additional weakly bound guests. This stronger dendrimer interaction with sodium 3-hydroxy-2...

  20. DNA-Aptamers Binding Aminoglycoside Antibiotics

    Directory of Open Access Journals (Sweden)

    Nadia Nikolaus

    2014-02-01

    Full Text Available Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.

  1. Electron distributions of the first-row homonuclear diatomic molecules, A2

    International Nuclear Information System (INIS)

    Ramirez, B.I.; Bielefeld Univ.

    1982-08-01

    Electron momentum density contour maps of the first-row homonuclear diatomic molecules, A 2 , are obtained from near Hartree-Fock wave functions. Both the total momentum density and momentum density difference (molecule - isolated atoms) maps present trends that may be related to the binding in the molecules. These results are compared with the corresponding charge density maps in position space (Bader, Henneker and Cade 1967). (author)

  2. The role of water molecules in computational drug design.

    Science.gov (United States)

    de Beer, Stephanie B A; Vermeulen, Nico P E; Oostenbrink, Chris

    2010-01-01

    Although water molecules are small and only consist of two different atom types, they play various roles in cellular systems. This review discusses their influence on the binding process between biomacromolecular targets and small molecule ligands and how this influence can be modeled in computational drug design approaches. Both the structure and the thermodynamics of active site waters will be discussed as these influence the binding process significantly. Structurally conserved waters cannot always be determined experimentally and if observed, it is not clear if they will be replaced upon ligand binding, even if sufficient space is available. Methods to predict the presence of water in protein-ligand complexes will be reviewed. Subsequently, we will discuss methods to include water in computational drug research. Either as an additional factor in automated docking experiments, or explicitly in detailed molecular dynamics simulations, the effect of water on the quality of the simulations is significant, but not easily predicted. The most detailed calculations involve estimates of the free energy contribution of water molecules to protein-ligand complexes. These calculations are computationally demanding, but give insight in the versatility and importance of water in ligand binding.

  3. Lanthanide single molecule magnets

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Jinkui; Zhang, Peng [Chinese Academy of Sciences, Changchun (China). Changchun Inst. of Applied Chemistry

    2015-10-01

    This book begins by providing basic information on single-molecule magnets (SMMs), covering the magnetism of lanthanide, the characterization and relaxation dynamics of SMMs and advanced means of studying lanthanide SMMs. It then systematically introduces lanthanide SMMs ranging from mononuclear and dinuclear to polynuclear complexes, classifying them and highlighting those SMMs with high barrier and blocking temperatures - an approach that provides some very valuable indicators for the structural features needed to optimize the contribution of an Ising type spin to a molecular magnet. The final chapter presents some of the newest developments in the lanthanide SMM field, such as the design of multifunctional and stimuli-responsive magnetic materials as well as the anchoring and organization of the SMMs on surfaces. In addition, the crystal structure and magnetic data are clearly presented with a wealth of illustrations in each chapter, helping newcomers and experts alike to better grasp ongoing trends and explore new directions.

  4. Lanthanide single molecule magnets

    CERN Document Server

    Tang, Jinkui

    2015-01-01

    This book begins by providing basic information on single-molecule magnets (SMMs), covering the magnetism of lanthanide, the characterization and relaxation dynamics of SMMs, and advanced means of studying lanthanide SMMs. It then systematically introduces lanthanide SMMs ranging from mononuclear and dinuclear to polynuclear complexes, classifying them and highlighting those SMMs with high barrier and blocking temperatures – an approach that provides some very valuable indicators for the structural features needed to optimize the contribution of an Ising type spin to a molecular magnet. The final chapter presents some of the newest developments in the lanthanide SMM field, such as the design of multifunctional and stimuli-responsive magnetic materials as well as the anchoring and organization of the SMMs on surfaces. In addition, the crystal structure and magnetic data are clearly presented with a wealth of illustrations in each chapter, helping newcomers and experts alike to better grasp ongoing trends and...

  5. Molecules in the Spotlight

    Energy Technology Data Exchange (ETDEWEB)

    Cryan, James

    2010-01-26

    SLAC has just unveiled the world's first X-ray laser, the LCLS. This machine produces pulses of X-rays that are ten billion times brighter than those from conventional sources. One of the goals of this machine is to make movies of chemical reactions, including reactions necessary for life and reactions that might power new energy technologies. This public lecture will show the first results from the LCLS. As a first target, we have chosen nitrogen gas, the main component of the air we breathe. Using the unprecedented power of the LCLS X-rays as a blasting torch, we have created new forms of this molecule and with unique electronic arrangements. Please share with us the first insights from this new technology.

  6. Magnetic field modification of ultracold molecule-molecule collisions

    International Nuclear Information System (INIS)

    Tscherbul, T V; Suleimanov, Yu V; Aquilanti, V; Krems, R V

    2009-01-01

    We present an accurate quantum mechanical study of molecule-molecule collisions in the presence of a magnetic field. The work focuses on the analysis of elastic scattering and spin relaxation in collisions of O 2 ( 3 Σ g - ) molecules at cold (∼0.1 K) and ultracold (∼10 -6 K) temperatures. Our calculations show that magnetic spin relaxation in molecule-molecule collisions is extremely efficient except at magnetic fields below 1 mT. The rate constant for spin relaxation at T=0.1 K and a magnetic field of 0.1 T is found to be as large as 6.1x10 -11 cm -3 s -1 . The magnetic field dependence of elastic and inelastic scattering cross sections at ultracold temperatures is dominated by a manifold of Feshbach resonances with the density of ∼100 resonances per Tesla for collisions of molecules in the absolute ground state. This suggests that the scattering length of ultracold molecules in the absolute ground state can be effectively tuned in a very wide range of magnetic fields. Our calculations demonstrate that the number and properties of the magnetic Feshbach resonances are dramatically different for molecules in the absolute ground and excited spin states. The density of Feshbach resonances for molecule-molecule scattering in the low-field-seeking Zeeman state is reduced by a factor of 10.

  7. DNA binding and aggregation by carbon nanoparticles

    International Nuclear Information System (INIS)

    An, Hongjie; Liu, Qingdai; Ji, Qiaoli; Jin, Bo

    2010-01-01

    Significant environmental and health risks due to the increasing applications of engineered nanoparticles in medical and industrial activities have been concerned by many communities. The interactions between nanomaterials and genomes have been poorly studied so far. This study examined interactions of DNA with carbon nanoparticles (CNP) using atomic force microscopy (AFM). We experimentally assessed how CNP affect DNA molecule and bacterial growth of Escherichia coli. We found that CNP were bound to the DNA molecules during the DNA replication in vivo. The results revealed that the interaction of DNA with CNP resulted in DNA molecule binding and aggregation both in vivo and in vitro in a dose-dependent manner, and consequently inhabiting the E. coli growth. While this was a preliminary study, our results showed that this nanoparticle may have a significant impact on genomic activities.

  8. The binding of Np to rat bone

    International Nuclear Information System (INIS)

    Ramounet, B.; Taylor, D.M.

    1997-01-01

    Neptunium has been shown to massively deposit in bone, after intravenous or intramuscular injections. Initially, it was uniformly distributed on periosteal and endosteal bone surfaces. The nature of the binding molecules, for this actinide, in the skeleton, has not yet been identified. The aim of this work was to characterize the ligands of neptunium by selective extractions of bone components. The preliminary results displayed the binding of 237 Np(IV) in the organic phase of bone, after intravenous or intramuscular contamination. Further studies are in progress, to quantify the fraction of Np bound to the organic and mineral compartment of bone, and to determine the affinity constant and the turn-over of the binding proteins. (authors)

  9. Methods for the selective detection of alkyne-presenting molecules and related compositions and systems

    Science.gov (United States)

    Valdez, Carlos A.; Vu, Alexander K.

    2017-10-17

    Provided herein are methods for selectively detecting an alkyne-presenting molecule in a sample and related detection reagents, compositions, methods and systems. The methods include contacting a detection reagent with the sample for a time and under a condition to allow binding of the detection reagent to the one or more alkyne-presenting molecules possibly present in the matrix to the detection reagent. The detection reagent includes an organic label moiety presenting an azide group. The binding of the azide group to the alkyne-presenting molecules results in emission of a signal from the organic label moiety.

  10. Blu-ray based optomagnetic aptasensor for detection of small molecules

    DEFF Research Database (Denmark)

    Yang, Jaeyoung; Donolato, Marco; Pinto, Alessandro

    2016-01-01

    This paper describes an aptamer-based optomagnetic biosensor for detection of a small molecule based on target binding-induced inhibition of magnetic nanoparticle (MNP) clustering. For the detection of a target small molecule, two mutually exclusive binding reactions (aptamer-target binding...... the hydrodynamic size distribution of MNPs and their clusters. A commercial Blu-ray optical pickup unit is used for optical signal acquisition, which enables the establishment of a low-cost and miniaturized biosensing platform. Experimental results show that the degree of MNP clustering correlates well...

  11. A first-principles study on adsorption behaviors of pristine and Li-decorated graphene sheets toward hydrazine molecules

    Science.gov (United States)

    Zeng, Huadong; Cheng, Xinlu; Wang, Wei

    2018-03-01

    The adsorption behaviors and properties of hydrazine (N2H4) molecules on pristine and Li-decorated graphene sheets were investigated by means of first-principles based on density functional theory. We systematically analyzed the optimal geometry, average binding energy, charge transfer, charge density difference and density of states of N2H4 molecules adsorbed on pristine and Li-decorated graphene sheets. It is found that the interaction between single N2H4 molecule and pristine graphene is weak physisorption with the low binding energy of -0.026 eV, suggesting that the pristine graphene sheet is insensitive to the presence of N2H4 molecule. However, it is markedly enhanced after lithium decoration with the high binding energy of -1.004 eV, verifying that the Li-decorated graphene sheet is significantly sensitive to detect N2H4 molecule. Meanwhile, the effects of the concentrations of N2H4 molecules on two different substrates were studied detailedly. For pristine graphene substrate, the average binding energy augments apparently with increasing the number of N2H4 molecules, which is mainly attributed to the van der Waals interactions and hydrogen bonds among N2H4 clusters. Li-decorated graphene sheet has still a strong affinity to N2H4 molecules despite the corresponding average binding energy emerges a contrary tendency. Overall, Li-decorated graphene sheet could be considered as a potential gas sensor in field of hydrazine molecules.

  12. Small Molecule Agonists of Cell Adhesion Molecule L1 Mimic L1 Functions In Vivo.

    Science.gov (United States)

    Kataria, Hardeep; Lutz, David; Chaudhary, Harshita; Schachner, Melitta; Loers, Gabriele

    2016-09-01

    Lack of permissive mechanisms and abundance of inhibitory molecules in the lesioned central nervous system of adult mammals contribute to the failure of functional recovery after injury, leading to severe disabilities in motor functions and pain. Peripheral nerve injury impairs motor, sensory, and autonomic functions, particularly in cases where nerve gaps are large and chronic nerve injury ensues. Previous studies have indicated that the neural cell adhesion molecule L1 constitutes a viable target to promote regeneration after acute injury. We screened libraries of known drugs for small molecule agonists of L1 and evaluated the effect of hit compounds in cell-based assays in vitro and in mice after femoral nerve and spinal cord injuries in vivo. We identified eight small molecule L1 agonists and showed in cell-based assays that they stimulate neuronal survival, neuronal migration, and neurite outgrowth and enhance Schwann cell proliferation and migration and myelination of neurons in an L1-dependent manner. In a femoral nerve injury mouse model, enhanced functional regeneration and remyelination after application of the L1 agonists were observed. In a spinal cord injury mouse model, L1 agonists improved recovery of motor functions, being paralleled by enhanced remyelination, neuronal survival, and monoaminergic innervation, reduced astrogliosis, and activation of microglia. Together, these findings suggest that application of small organic compounds that bind to L1 and stimulate the beneficial homophilic L1 functions may prove to be a valuable addition to treatments of nervous system injuries.

  13. Metal binding proteins, recombinant host cells and methods

    Science.gov (United States)

    Summers, Anne O.; Caguiat, Jonathan J.

    2004-06-15

    The present disclosure provides artificial heavy metal binding proteins termed chelons by the inventors. These chelons bind cadmium and/or mercuric ions with relatively high affinity. Also disclosed are coding sequences, recombinant DNA molecules and recombinant host cells comprising those recombinant DNA molecules for expression of the chelon proteins. In the recombinant host cells or transgenic plants, the chelons can be used to bind heavy metals taken up from contaminated soil, groundwater or irrigation water and to concentrate and sequester those ions. Recombinant enteric bacteria can be used within the gastrointestinal tracts of animals or humans exposed to toxic metal ions such as mercury and/or cadmium, where the chelon recombinantly expressed in chosen in accordance with the ion to be rededicated. Alternatively, the chelons can be immobilized to solid supports to bind and concentrate heavy metals from a contaminated aqueous medium including biological fluids.

  14. Electron-excited molecule interactions

    International Nuclear Information System (INIS)

    Christophorou, L.G.; Tennessee Univ., Knoxville, TN

    1991-01-01

    In this paper the limited but significant knowledge to date on electron scattering from vibrationally/rotationally excited molecules and electron scattering from and electron impact ionization of electronically excited molecules is briefly summarized and discussed. The profound effects of the internal energy content of a molecule on its electron attachment properties are highlighted focusing in particular on electron attachment to vibrationally/rotationally and to electronically excited molecules. The limited knowledge to date on electron-excited molecule interactions clearly shows that the cross sections for certain electron-molecule collision processes can be very different from those involving ground state molecules. For example, optically enhanced electron attachment studies have shown that electron attachment to electronically excited molecules can occur with cross sections 10 6 to 10 7 times larger compared to ground state molecules. The study of electron-excited molecule interactions offers many experimental and theoretical challenges and opportunities and is both of fundamental and technological significance. 54 refs., 15 figs

  15. Cell biochemistry studied by single-molecule imaging.

    Science.gov (United States)

    Mashanov, G I; Nenasheva, T A; Peckham, M; Molloy, J E

    2006-11-01

    Over the last decade, there have been remarkable developments in live-cell imaging. We can now readily observe individual protein molecules within living cells and this should contribute to a systems level understanding of biological pathways. Direct observation of single fluorophores enables several types of molecular information to be gathered. Temporal and spatial trajectories enable diffusion constants and binding kinetics to be deduced, while analyses of fluorescence lifetime, intensity, polarization or spectra give chemical and conformational information about molecules in their cellular context. By recording the spatial trajectories of pairs of interacting molecules, formation of larger molecular complexes can be studied. In the future, multicolour and multiparameter imaging of single molecules in live cells will be a powerful analytical tool for systems biology. Here, we discuss measurements of single-molecule mobility and residency at the plasma membrane of live cells. Analysis of diffusional paths at the plasma membrane gives information about its physical properties and measurement of temporal trajectories enables rates of binding and dissociation to be derived. Meanwhile, close scrutiny of individual fluorophore trajectories enables ideas about molecular dimerization and oligomerization related to function to be tested directly.

  16. Mapping the Small Molecule Interactome by Mass Spectrometry.

    Science.gov (United States)

    Flaxman, Hope A; Woo, Christina M

    2018-01-16

    Mapping small molecule interactions throughout the proteome provides the critical structural basis for functional analysis of their impact on biochemistry. However, translation of mass spectrometry-based proteomics methods to directly profile the interaction between a small molecule and the whole proteome is challenging because of the substoichiometric nature of many interactions, the diversity of covalent and noncovalent interactions involved, and the subsequent computational complexity associated with their spectral assignment. Recent advances in chemical proteomics have begun fill this gap to provide a structural basis for the breadth of small molecule-protein interactions in the whole proteome. Innovations enabling direct characterization of the small molecule interactome include faster, more sensitive instrumentation coupled to chemical conjugation, enrichment, and labeling methods that facilitate detection and assignment. These methods have started to measure molecular interaction hotspots due to inherent differences in local amino acid reactivity and binding affinity throughout the proteome. Measurement of the small molecule interactome is producing structural insights and methods for probing and engineering protein biochemistry. Direct structural characterization of the small molecule interactome is a rapidly emerging area pushing new frontiers in biochemistry at the interface of small molecules and the proteome.

  17. Feature Binding in Zebrafish

    Directory of Open Access Journals (Sweden)

    P Neri

    2012-07-01

    Full Text Available Binding operations are primarily ascribed to cortex or similarly complex avian structures. My experiments show that the zebrafish, a lower vertebrate lacking cortex, supports visual feature binding of form and motion for the purpose of social behavior. These results challenge the notion that feature binding may require highly evolved neural structures and demonstrate that the nervous system of lower vertebrates can afford unexpectedly complex computations.

  18. Small molecule annotation for the Protein Data Bank.

    Science.gov (United States)

    Sen, Sanchayita; Young, Jasmine; Berrisford, John M; Chen, Minyu; Conroy, Matthew J; Dutta, Shuchismita; Di Costanzo, Luigi; Gao, Guanghua; Ghosh, Sutapa; Hudson, Brian P; Igarashi, Reiko; Kengaku, Yumiko; Liang, Yuhe; Peisach, Ezra; Persikova, Irina; Mukhopadhyay, Abhik; Narayanan, Buvaneswari Coimbatore; Sahni, Gaurav; Sato, Junko; Sekharan, Monica; Shao, Chenghua; Tan, Lihua; Zhuravleva, Marina A

    2014-01-01

    The Protein Data Bank (PDB) is the single global repository for three-dimensional structures of biological macromolecules and their complexes, and its more than 100,000 structures contain more than 20,000 distinct ligands or small molecules bound to proteins and nucleic acids. Information about these small molecules and their interactions with proteins and nucleic acids is crucial for our understanding of biochemical processes and vital for structure-based drug design. Small molecules present in a deposited structure may be attached to a polymer or may occur as a separate, non-covalently linked ligand. During curation of a newly deposited structure by wwPDB annotation staff, each molecule is cross-referenced to the PDB Chemical Component Dictionary (CCD). If the molecule is new to the PDB, a dictionary description is created for it. The information about all small molecule components found in the PDB is distributed via the ftp archive as an external reference file. Small molecule annotation in the PDB also includes information about ligand-binding sites and about covalent and other linkages between ligands and macromolecules. During the remediation of the peptide-like antibiotics and inhibitors present in the PDB archive in 2011, it became clear that additional annotation was required for consistent representation of these molecules, which are quite often composed of several sequential subcomponents including modified amino acids and other chemical groups. The connectivity information of the modified amino acids is necessary for correct representation of these biologically interesting molecules. The combined information is made available via a new resource called the Biologically Interesting molecules Reference Dictionary, which is complementary to the CCD and is now routinely used for annotation of peptide-like antibiotics and inhibitors. © The Author(s) 2014. Published by Oxford University Press.

  19. Organic Molecules in Meteorites

    Science.gov (United States)

    Martins, Zita

    2015-08-01

    Carbonaceous meteorites are primitive samples from the asteroid belt, containing 3-5wt% organic carbon. The exogenous delivery of organic matter by carbonaceous meteorites may have contributed to the organic inventory of the early Earth. The majority (>70%) of the meteoritic organic material consist of insoluble organic matter (IOM) [1]. The remaining meteoritic organic material (meteorites contain soluble organic molecules with different abundances and distributions, which may reflect the extension of aqueous alteration or thermal metamorphism on the meteorite parent bodies. Extensive aqueous alteration on the meteorite parent body may result on 1) the decomposition of α-amino acids [5, 6]; 2) synthesis of β- and γ-amino acids [2, 6-9]; 3) higher relative abundances of alkylated polycyclic aromatic hydrocarbons (PAHs) [6, 10]; and 4) higher L-enantiomer excess (Lee) value of isovaline [6, 11, 12].The soluble organic content of carbonaceous meteorites may also have a contribution from Fischer-Tropsch/Haber-Bosch type gas-grain reactions after the meteorite parent body cooled to lower temperatures [13, 14].The analysis of the abundances and distribution of the organic molecules present in meteorites helps to determine the physical and chemical conditions of the early solar system, and the prebiotic organic compounds available on the early Earth.[1] Cody and Alexander (2005) GCA 69, 1085. [2] Cronin and Chang (1993) in: The Chemistry of Life’s Origin. pp. 209-258. [3] Martins and Sephton (2009) in: Amino acids, peptides and proteins in organic chemistry. pp. 1-42. [4] Martins (2011) Elements 7, 35. [5] Botta et al. (2007) MAPS 42, 81. [6] Martins et al. (2015) MAPS, in press. [7] Cooper and Cronin (1995) GCA 59, 1003. [8] Glavin et al. (2006) MAPS. 41, 889. [9] Glavin et al. (2011) MAPS 45, 1948. [10] Elsila et al. (2005) GCA 5, 1349. [11] Glavin and Dworkin (2009) PNAS 106, 5487. [12] Pizzarello et al. (2003) GCA 67, 1589. [13] Chan et al. (2012) MAPS. 47, 1502

  20. Modeling Shear Induced Von Willebrand Factor Binding to Collagen

    Science.gov (United States)

    Dong, Chuqiao; Wei, Wei; Morabito, Michael; Webb, Edmund; Oztekin, Alparslan; Zhang, Xiaohui; Cheng, Xuanhong

    2017-11-01

    Von Willebrand factor (vWF) is a blood glycoprotein that binds with platelets and collagen on injured vessel surfaces to form clots. VWF bioactivity is shear flow induced: at low shear, binding between VWF and other biological entities is suppressed; for high shear rate conditions - as are found near arterial injury sites - VWF elongates, activating its binding with platelets and collagen. Based on parameters derived from single molecule force spectroscopy experiments, we developed a coarse-grain molecular model to simulate bond formation probability as a function of shear rate. By introducing a binding criterion that depends on the conformation of a sub-monomer molecular feature of our model, the model predicts shear-induced binding, even for conditions where binding is highly energetically favorable. We further investigate the influence of various model parameters on the ability to predict shear-induced binding (vWF length, collagen site density and distribution, binding energy landscape, and slip/catch bond length) and demonstrate parameter ranges where the model provides good agreement with existing experimental data. Our results may be important for understanding vWF activity and also for achieving targeted drug therapy via biomimetic synthetic molecules. National Science Foundation (NSF),Division of Mathematical Sciences (DMS).

  1. NetMHCpan 4.0: Improved peptide-MHC class I interaction predictions integrating eluted ligand and peptide binding affinity data

    OpenAIRE

    Jurtz, Vanessa; Paul, Sinu; Andreatta, Massimo; Marcatili, Paolo; Peters, Bjoern; Nielsen, Morten

    2017-01-01

    Cytotoxic T cells are of central importance in the immune systems response to disease. They recognize defective cells by binding to peptides presented on the cell surface by MHC (major histocompatibility complex) class I molecules. Peptide binding to MHC molecules is the single most selective step in the antigen presentation pathway. On the quest for T cell epitopes, the prediction of peptide binding to MHC molecules has therefore attracted large attention. In the past, predictors of peptide-...

  2. Nuclear fusion rate of the muonic T3 molecule

    International Nuclear Information System (INIS)

    Faghihi, F.; Eskandari, M. R.

    2004-01-01

    The ground state binding energy, size and effective nuclear charge of the muonic T 3 molecule are calculated using Born-Oppenheimer adiabatic approximation. The system possesses two minimum positions, one at typically muonic and the second at the atomic distances. A symmetric planar vibrational model between two minima is assumed and the approximated potential are calculated. Moreover, nuclear fusion rate calculations of the short-life molecule is carried out due to the overlap integral of the resonance nuclear compound nucleus and the molecular wave functions

  3. MHCcluster, a method for functional clustering of MHC molecules

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Lundegaard, Claus; Buus, Søren

    2013-01-01

    The identification of peptides binding to major histocompatibility complexes (MHC) is a critical step in the understanding of T cell immune responses. The human MHC genomic region (HLA) is extremely polymorphic comprising several thousand alleles, many encoding a distinct molecule. The potentially...... binding specificity. The method has a flexible web interface that allows the user to include any MHC of interest in the analysis. The output consists of a static heat map and graphical tree-based visualizations of the functional relationship between MHC variants and a dynamic TreeViewer interface where...

  4. Tunnelling of a molecule

    International Nuclear Information System (INIS)

    Jarvis, P.D.; Bulte, D.P.

    1998-01-01

    A quantum-mechanical description of tunnelling is presented for a one-dimensional system with internal oscillator degrees of freedom. The 'charged diatomic molecule' is frustrated on encountering a barrier potential by its centre of charge not being coincident with its centre of mass, resulting in transitions amongst internal states. In an adiabatic limit, the tunnelling of semiclassical coherent-like oscillator states is shown to exhibit the Hartman and Bueuttiker-Landauer times t H and t BL , with the time dependence of the coherent state parameter for the tunnelled state given by α(t) = α e -iω(t+Δt) , Δt = t H - it BL . A perturbation formalism is developed, whereby the exact transfer matrix can be expanded to any desired accuracy in a suitable limit. An 'intrinsic' time, based on the oscillator transition rate during tunnelling, transmission or reflection, is introduced. In simple situations the resulting intrinsic tunnelling time is shown to vanish to lowest order. In the general case a particular (nonzero) parametrisation is inferred, and its properties discussed in comparison with the literature on tunnelling times for both wavepackets and internal clocks. Copyright (1998) CSIRO Australia

  5. Single molecule tracking

    Science.gov (United States)

    Shera, E. Brooks

    1988-01-01

    A detection system is provided for identifying individual particles or molecules having characteristic emission in a flow train of the particles in a flow cell. A position sensitive sensor is located adjacent the flow cell in a position effective to detect the emissions from the particles within the flow cell and to assign spatial and temporal coordinates for the detected emissions. A computer is then enabled to predict spatial and temporal coordinates for the particle in the flow train as a function of a first detected emission. Comparison hardware or software then compares subsequent detected spatial and temporal coordinates with the predicted spatial and temporal coordinates to determine whether subsequently detected emissions originate from a particle in the train of particles. In one embodiment, the particles include fluorescent dyes which are excited to fluoresce a spectrum characteristic of the particular particle. Photones are emitted adjacent at least one microchannel plate sensor to enable spatial and temporal coordinates to be assigned. The effect of comparing detected coordinates with predicted coordinates is to define a moving sample volume which effectively precludes the effects of background emissions.

  6. Theoretical Investigations Regarding Single Molecules

    DEFF Research Database (Denmark)

    Pedersen, Kim Georg Lind

    Neoclassical Valence Bond Theory, Quantum Transport, Quantum Interference, Kondo Effect, and Electron Pumping. Trap a single organic molecule between two electrodes and apply a bias voltage across this "molecular junction". When electrons pass through the molecule, the different electron paths can...... interfere destructively or constructively. Destructive interference effects in electron transport could potentially improve thermo-electrics, organic logic circuits and energy harvesting. We have investigated destructive interference in off-resonant transport through organic molecules, and have found a set...

  7. Biofuels: from microbes to molecules

    National Research Council Canada - National Science Library

    Lu, Xuefeng

    2014-01-01

    .... The production of different biofuel molecules including hydrogen, methane, ethanol, butanol, higher chain alcohols, isoprenoids and fatty acid derivatives, from genetically engineered microbes...

  8. Labelled molecules, modern research implements

    International Nuclear Information System (INIS)

    Pichat, L.; Langourieux, Y.

    1974-01-01

    Details of the synthesis of carbon 14- and tritium-labelled molecules are examined. Although the methods used are those of classical organic chemistry the preparation of carbon 14-labelled molecules differs in some respects, most noticeably in the use of 14 CO 2 which requires very special handling techniques. For the tritium labelling of organic molecules the methods are somewhat different, very often involving exchange reactions. The following are described in turn: the so-called Wilzbach exchange method; exchange by catalysis in solution; catalytic hydrogenation with tritium; reductions with borotritides. Some applications of labelled molecules in organic chemistry, biochemistry and pharmacology are listed [fr

  9. Melanin-binding radiopharmaceuticals

    International Nuclear Information System (INIS)

    Packer, S.; Fairchild, R.G.; Watts, K.P.; Greenberg, D.; Hannon, S.J.

    1980-01-01

    The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed

  10. Competitive protein binding assay

    International Nuclear Information System (INIS)

    Kaneko, Toshio; Oka, Hiroshi

    1975-01-01

    The measurement of cyclic GMP (cGMP) by competitive protein binding assay was described and discussed. The principle of binding assay was represented briefly. Procedures of our method by binding protein consisted of preparation of cGMP binding protein, selection of 3 H-cyclic GMP on market, and measurement procedures. In our method, binding protein was isolated from the chrysalis of silk worm. This method was discussed from the points of incubation medium, specificity of binding protein, the separation of bound cGMP from free cGMP, and treatment of tissue from which cGMP was extracted. cGMP existing in the tissue was only one tenth or one scores of cGMP, and in addition, cGMP competed with cGMP in binding with binding protein. Therefore, Murad's technique was applied to the isolation of cGMP. This method provided the measurement with sufficient accuracy; the contamination by cAMP was within several per cent. (Kanao, N.)

  11. Growing interstellar molecules with ion-molecule reactions

    International Nuclear Information System (INIS)

    Bohme, D.K.

    1989-01-01

    Laboratory measurements of gas-phase ion-molecule reactions continue to provide important insights into the chemistry of molecular growth in interstellar environments. It is also true that the measurements are becoming more demanding as larger molecules capture our interest. While some of these measurements are motivated by current developments in chemical models of interstellar environments or by new molecular observations by astronomers, others explore novel chemistry which can lead to predictions of new interstellar molecules. Here the author views the results of some recent measurements, taken in the Ion Chemistry Laboratory at York University with the SIFT technique, which address some of the current needs of modellers and observers and which also provide some new fundamental insight into molecular growth, particularly when it occurs in the presence of large molecules such as PAH molecules which are now thought to have a major influence on the chemistry of interstellar environments in which they are present

  12. New Mechanisms of Mercury Binding to Peat

    Science.gov (United States)

    Nagy, K. L.; Manceau, A.; Gasper, J. D.; Ryan, J. N.; Aiken, G. R.

    2007-12-01

    Mercury can be immobilized in the aquatic environment by binding to peat, a solid form of natural organic matter. Binding mechanisms can vary in strength and reversibility, and therefore will control concentrations of bioreactive mercury, may explain rates of mercury methylation, and are important for designing approaches to improve water quality using natural wetlands or engineered phytoremediation schemes. In addition, strong binding between mercury and peat is likely to result in the fixation of mercury that ultimately resides in coal. The mechanisms by which aqueous mercury at low concentrations reacts with both dissolved and solid natural organic matter remain incompletely understood, despite recent efforts. We have identified three distinct binding mechanisms of divalent cationic mercury to solid peats from the Florida Everglades using EXAFS spectroscopic data (FAME beamline, European Synchrotron Radiation Facility (ESRF)) obtained on experimental samples as compared to relevant references including mercury-bearing solids and mercury bound to various organic molecules. The proportions of the three molecular configurations vary with Hg concentration, and two new configurations that involve sulfur ligands occur at Hg concentrations up to about 4000 ppm. The binding mechanism at the lowest experimental Hg concentration (60-80 ppm) elucidates published reports on the inhibition of metacinnabar formation in the presence of Hg-bearing solutions and dissolved natural organic matter, and also, the differences in extent of mercury methylation in distinct areas of the Florida Everglades.

  13. DNA binding studies of tartrazine food additive.

    Science.gov (United States)

    Kashanian, Soheila; Zeidali, Sahar Heidary

    2011-07-01

    The interaction of native calf thymus DNA with tartrazine in 10 mM Tris-HCl aqueous solution at neutral pH 7.4 was investigated. Tartrazine is a nitrous derivative and may cause allergic reactions, with a potential of toxicological risk. Also, tartrazine induces oxidative stress and DNA damage. Its DNA binding properties were studied by UV-vis and circular dichroism spectra, competitive binding with Hoechst 33258, and viscosity measurements. Tartrazine molecules bind to DNA via groove mode as illustrated by hyperchromism in the UV absorption band of tartrazine, decrease in Hoechst-DNA solution fluorescence, unchanged viscosity of DNA, and conformational changes such as conversion from B-like to C-like in the circular dichroism spectra of DNA. The binding constants (K(b)) of DNA with tartrazine were calculated at different temperatures. Enthalpy and entropy changes were calculated to be +37 and +213 kJ mol(-1), respectively, according to the Van't Hoff equation, which indicated that the reaction is predominantly entropically driven. Also, tartrazine does not cleave plasmid DNA. Tartrazine interacts with calf thymus DNA via a groove interaction mode with an intrinsic binding constant of 3.75 × 10(4) M(-1).

  14. Binding of Diphtheria Toxin to Phospholipids in Liposomes

    Science.gov (United States)

    Alving, Carl R.; Iglewski, Barbara H.; Urban, Katharine A.; Moss, Joel; Richards, Roberta L.; Sadoff, Jerald C.

    1980-04-01

    Diphtheria toxin bound to the phosphate portion of some, but not all, phospholipids in liposomes. Liposomes consisting of dimyristoyl phosphatidylcholine and cholesterol did not bind toxin. Addition of 20 mol% (compared to dimyristoyl phosphatidylcholine) of dipalmitoyl phosphatidic acid, dicetyl phosphate, phosphatidylinositol phosphate, cardiolipin, or phosphatidylserine in the liposomes resulted in substantial binding of toxin. Inclusion of phosphatidylinositol in dimyristol phosphatidylcholine / cholesterol liposomes did not result in toxin binding. The calcium salt of dipalmitoyl phosphatidic acid was more effective than the sodium salt, and the highest level of binding occurred with liposomes consisting only of dipalmitoyl phosphatidic acid (calcium salt) and cholesterol. Binding of toxin to liposomes was dependent on pH, and the pattern of pH dependence varied with liposomes having different compositions. Incubation of diphtheria toxin with liposomes containing dicetyl phosphate resulted in maximal binding at pH 3.6, whereas binding to liposomes containing phosphatidylinositol phosphate was maximal above pH 7. Toxin did not bind to liposomes containing 20 mol% of a free fatty acid (palmitic acid) or a sulfated lipid (3-sulfogalactosylceramide). Toxin binding to dicetyl phosphate or phosphatidylinositol phosphate was inhibited by UTP, ATP, phosphocholine, or p-nitrophenyl phosphate, but not by uracil. We conclude that (a) diphtheria toxin binds specifically to the phosphate portion of certain phospholipids, (b) binding to phospholipids in liposomes is dependent on pH, but is not due only to electrostatic interaction, and (c) binding may be strongly influenced by the composition of adjacent phospholipids that do not bind toxin. We propose that a minor membrane phospholipid (such as phosphatidylinositol phosphate or phosphatidic acid), or that some other phosphorylated membrane molecule (such as a phosphoprotein) may be important in the initial binding of

  15. Single Molecule Conductance of Oligothiophene Derivatives

    Science.gov (United States)

    Dell, Emma J.

    This thesis studies the electronic properties of small organic molecules based on the thiophene motif. If we are to build next-generation devices, advanced materials must be designed which possess requisite electronic functionality. Molecules present attractive candidates for these ad- vanced materials since nanoscale devices are particularly sought after. However, selecting a molecule that is suited to a certain electronic function remains a challenge, and characterization of electronic behavior is therefore critical. Single molecule conductance measurements are a powerful tool to determine properties on the nanoscale and, as such, can be used to investigate novel building blocks that may fulfill the design requirements of next-generation devices. Combining these conductance results with strategic chemical synthesis allows for the development of new families of molecules that show attractive properties for future electronic devices. Since thiophene rings are the fruitflies of organic semiconductors on the bulk scale, they present an intriguing starting point for building functional materials on the nanoscale, and therefore form the structural basis of all molecules studied herein. First, the single-molecule conductance of a family of bithiophene derivatives was measured. A broad distribution in the single-molecule conductance of bithiophene was found compared with that of a biphenyl. This increased breadth in the conductance distribution was shown to be explained by the difference in 5-fold symmetry of thiophene rings as compared to the 6-fold symmetry of benzene rings. The reduced symmetry of thiophene rings results in a restriction on the torsion angle space available to these molecules when bound between two metal electrodes in a junction, causing each molecular junction to sample a different set of conformers in the conductance measurements. By contrast, the rotations of biphenyl are essentially unimpeded by junction binding, allowing each molecular junction

  16. Enzyme Molecules in Solitary Confinement

    Directory of Open Access Journals (Sweden)

    Raphaela B. Liebherr

    2014-09-01

    Full Text Available Large arrays of homogeneous microwells each defining a femtoliter volume are a versatile platform for monitoring the substrate turnover of many individual enzyme molecules in parallel. The high degree of parallelization enables the analysis of a statistically representative enzyme population. Enclosing individual enzyme molecules in microwells does not require any surface immobilization step and enables the kinetic investigation of enzymes free in solution. This review describes various microwell array formats and explores their applications for the detection and investigation of single enzyme molecules. The development of new fabrication techniques and sensitive detection methods drives the field of single molecule enzymology. Here, we introduce recent progress in single enzyme molecule analysis in microwell arrays and discuss the challenges and opportunities.

  17. Organizing and addressing magnetic molecules.

    Science.gov (United States)

    Gatteschi, Dante; Cornia, Andrea; Mannini, Matteo; Sessoli, Roberta

    2009-04-20

    Magnetic molecules ranging from simple organic radicals to single-molecule magnets (SMMs) are intensively investigated for their potential applications in molecule-based information storage and processing. The goal of this Article is to review recent achievements in the organization of magnetic molecules on surfaces and in their individual probing and manipulation. We stress that the inherent fragility and redox sensitivity of most SMM complexes, combined with the noninnocent role played by the substrate, ask for a careful evaluation of the structural and electronic properties of deposited molecules going beyond routine methods for surface analysis. Detailed magnetic information can be directly obtained using X-ray magnetic circular dichroism or newly emerging scanning probe techniques with magnetic detection capabilities.

  18. Ion-Molecule Reaction Dynamics.

    Science.gov (United States)

    Meyer, Jennifer; Wester, Roland

    2017-05-05

    We review the recent advances in the investigation of the dynamics of ion-molecule reactions. During the past decade, the combination of single-collision experiments in crossed ion and neutral beams with the velocity map ion imaging detection technique has enabled a wealth of studies on ion-molecule reactions. These methods, in combination with chemical dynamics simulations, have uncovered new and unexpected reaction mechanisms, such as the roundabout mechanism and the subtle influence of the leaving group in anion-molecule nucleophilic substitution reactions. For this important class of reactions, as well as for many fundamental cation-molecule reactions, the information obtained with crossed-beam imaging is discussed. The first steps toward understanding micro-solvation of ion-molecule reaction dynamics are presented. We conclude with the presentation of several interesting directions for future research.

  19. Central dogma at the single-molecule level in living cells.

    Science.gov (United States)

    Li, Gene-Wei; Xie, X Sunney

    2011-07-20

    Gene expression originates from individual DNA molecules within living cells. Like many single-molecule processes, gene expression and regulation are stochastic, that is, sporadic in time. This leads to heterogeneity in the messenger-RNA and protein copy numbers in a population of cells with identical genomes. With advanced single-cell fluorescence microscopy, it is now possible to quantify transcriptomes and proteomes with single-molecule sensitivity. Dynamic processes such as transcription-factor binding, transcription and translation can be monitored in real time, providing quantitative descriptions of the central dogma of molecular biology and the demonstration that a stochastic single-molecule event can determine the phenotype of a cell.

  20. Core Level Spectra of Organic Molecules Adsorbed on Graphene

    Directory of Open Access Journals (Sweden)

    Abhilash Ravikumar

    2018-03-01

    Full Text Available We perform first principle calculations based on density functional theory to investigate the effect of the adsorption of core-excited organic molecules on graphene. We simulate Near Edge X-ray absorption Fine Structure (NEXAFS and X-ray Photoemission Spectroscopy (XPS at the N and C edges for two moieties: pyridine and the pyridine radical on graphene, which exemplify two different adsorption characters. The modifications of molecular and graphene energy levels due to their interplay with the core-level excitation are discussed. We find that upon physisorption of pyridine, the binding energies of graphene close to the adsorption site reduce mildly, and the NEXAFS spectra of the molecule and graphene resemble those of gas phase pyridine and pristine graphene, respectively. However, the chemisorption of the pyridine radical is found to significantly alter these core excited spectra. The C 1s binding energy of the C atom of graphene participating in chemisorption increases by ∼1 eV, and the C atoms of graphene alternate to the adsorption site show a reduction in the binding energy. Analogously, these C atoms also show strong modifications in the NEXAFS spectra. The NEXAFS spectrum of the chemisorbed molecule is also modified as a result of hybridization with and screening by graphene. We eventually explore the electronic properties and magnetism of the system as a core-level excitation is adiabatically switched on.

  1. Filovirus tropism: Cellular molecules for viral entry

    Directory of Open Access Journals (Sweden)

    Ayato eTakada

    2012-02-01

    Full Text Available In human and nonhuman primates, filoviruses (Ebola and Marburg viruses cause severe hemorrhagic fever.Recently, other animals such as pigs and some species of fruit bats have also been shown to be susceptible to these viruses. While having a preference for some cell types such as hepatocytes, endothelial cells, dendritic cells, monocytes, and macrophages, filoviruses are known to be pantropic in infection of primates. The envelope glycoprotein (GP is responsible for both receptor binding and fusion of the virus envelope with the host cell membrane. It has been demonstrated that filovirus GP interacts with multiple molecules for entry into host cells, whereas none of the cellular molecules so far identified as a receptor/coreceptor fully explains filovirus tissue tropism and host range. Available data suggest that the mucin-like region (MLR on GP plays an important role in attachment to the preferred target cells, whose infection is likely involved in filovirus pathogenesis, whereas the MLR is not essential for the fundamental function of the GP in viral entry into cells in vitro. Further studies elucidating the mechanisms of cellular entry of filoviruses may shed light on the development of strategies for prophylaxis and treatment of Ebola and Marburg hemorrhagic fevers.

  2. Dielectric and gravimetric studies of water binding to lysozyme

    International Nuclear Information System (INIS)

    Bone, S.

    1996-01-01

    Time domain dielectric spectroscopy and hydration isotherm measurements as a function of temperature have been applied to hydrated lysozyme powder. Two dielectric dispersions were identified, the first centred at approximately 8 MHz and a second above 1 GHz. The higher dispersion is considered to be the result of rotational relaxation of water molecules bound to the enzyme. In this case the results indicate the existence of a population of 32 water molecules per lysozyme molecule which are irrotationally bound to the lysozyme structure. A larger population of water molecules is relatively free to respond to the electric field and exhibits a dipole moment close to that of vapour phase water molecules. Multi-temperature hydration isotherm measurements are used to calculate enthalpies and entropies associated with the binding of water to lysozyme. Discontinuities both in dielectric and in thermodynamic characteristics in the range 10-14% hydration are interpreted as a re-ordering of the water structure on the enzyme surface

  3. Self-consistent field theory of polymer-ionic molecule complexation.

    Science.gov (United States)

    Nakamura, Issei; Shi, An-Chang

    2010-05-21

    A self-consistent field theory is developed for polymers that are capable of binding small ionic molecules (adsorbates). The polymer-ionic molecule association is described by Ising-like binding variables, C(i) ((a))(kDelta)(=0 or 1), whose average determines the number of adsorbed molecules, n(BI). Polymer gelation can occur through polymer-ionic molecule complexation in our model. For polymer-polymer cross-links through the ionic molecules, three types of solutions for n(BI) are obtained, depending on the equilibrium constant of single-ion binding. Spinodal lines calculated from the mean-field free energy exhibit closed-loop regions where the homogeneous phase becomes unstable. This phase instability is driven by the excluded-volume interaction due to the single occupancy of ion-binding sites on the polymers. Moreover, sol-gel transitions are examined using a critical degree of conversion. A gel phase is induced when the concentration of adsorbates is increased. At a higher concentration of the adsorbates, however, a re-entrance from a gel phase into a sol phase arises from the correlation between unoccupied and occupied ion-binding sites. The theory is applied to a model system, poly(vinyl alcohol) and borate ion in aqueous solution with sodium chloride. Good agreement between theory and experiment is obtained.

  4. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  5. A general strategy to construct small molecule biosensors in eukaryotes.

    Science.gov (United States)

    Feng, Justin; Jester, Benjamin W; Tinberg, Christine E; Mandell, Daniel J; Antunes, Mauricio S; Chari, Raj; Morey, Kevin J; Rios, Xavier; Medford, June I; Church, George M; Fields, Stanley; Baker, David

    2015-12-29

    Biosensors for small molecules can be used in applications that range from metabolic engineering to orthogonal control of transcription. Here, we produce biosensors based on a ligand-binding domain (LBD) by using a method that, in principle, can be applied to any target molecule. The LBD is fused to either a fluorescent protein or a transcriptional activator and is destabilized by mutation such that the fusion accumulates only in cells containing the target ligand. We illustrate the power of this method by developing biosensors for digoxin and progesterone. Addition of ligand to yeast, mammalian, or plant cells expressing a biosensor activates transcription with a dynamic range of up to ~100-fold. We use the biosensors to improve the biotransformation of pregnenolone to progesterone in yeast and to regulate CRISPR activity in mammalian cells. This work provides a general methodology to develop biosensors for a broad range of molecules in eukaryotes.

  6. Isotope separation by photodissociation of Van der Wall's molecules

    International Nuclear Information System (INIS)

    Lee, Y.T.

    1977-01-01

    A method of separating isotopes based on the dissociation of a Van der Waal's complex is described. A beam of molecules of a Van der Waal's complex containing, as one partner of the complex, a molecular species in which an element is present in a plurality of isotopes is subjected to radiation from a source tuned to a frequency which will selectively excite vibrational motion by a vibrational transition or through electronic transition of those complexed molecules of the molecular species which contain a desired isotope. Since the Van der Waal's binding energy is much smaller than the excitational energy of vibrational motion, the thus excited Van der Waal's complex dissociate into molecular components enriched in the desired isotope. The recoil velocity associated with vibrational to translational and rotational relaxation will send the separated molecules away from the beam whereupon the product enriched in the desired isotope can be separated from the constituents of the beam

  7. Charge transport in polyguanine-polycytosine DNA molecules

    International Nuclear Information System (INIS)

    Wei, J H; Chan, K S

    2007-01-01

    A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules

  8. Small molecule alteration of RNA sequence in cells and animals.

    Science.gov (United States)

    Guan, Lirui; Luo, Yiling; Ja, William W; Disney, Matthew D

    2017-10-18

    RNA regulation and maintenance are critical for proper cell function. Small molecules that specifically alter RNA sequence would be exceptionally useful as probes of RNA structure and function or as potential therapeutics. Here, we demonstrate a photochemical approach for altering the trinucleotide expanded repeat causative of myotonic muscular dystrophy type 1 (DM1), r(CUG) exp . The small molecule, 2H-4-Ru, binds to r(CUG) exp and converts guanosine residues to 8-oxo-7,8-dihydroguanosine upon photochemical irradiation. We demonstrate targeted modification upon irradiation in cell culture and in Drosophila larvae provided a diet containing 2H-4-Ru. Our results highlight a general chemical biology approach for altering RNA sequence in vivo by using small molecules and photochemistry. Furthermore, these studies show that addition of 8-oxo-G lesions into RNA 3' untranslated regions does not affect its steady state levels. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer

    2017-09-14

    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory calculations. Binding energy range for nucleobases, amino acids and heterocyclic molecules with both the sheets have been found to be (0.43-1.16eV), (0.70-1.58eV) and (0.22-0.96eV) respectively, which along with the binding distances show that these molecules bind to both sheets by physisorption and chemisorption process. The exchange of electric charges between the monolayers and the incident molecules has been examined by means of Bader charge analysis. It has been observed that the introduction of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules alters the electronic properties of both silicene and germanene nano sheets as studied by plotting the total (TDOS) and partial (PDOS) density of states. The DOS plots reveal the variation in the band gaps of both silicene and germanene caused by the introduction of studied molecules. Based on the obtained results we suggest that both silicene and germanene monolayers in their pristine form could be useful for sensing of biomolecules.

  10. Towards ligand docking including explicit interface water molecules.

    Directory of Open Access Journals (Sweden)

    Gordon Lemmon

    Full Text Available Small molecule docking predicts the interaction of a small molecule ligand with a protein at atomic-detail accuracy including position and conformation the ligand but also conformational changes of the protein upon ligand binding. While successful in the majority of cases, docking algorithms including RosettaLigand fail in some cases to predict the correct protein/ligand complex structure. In this study we show that simultaneous docking of explicit interface water molecules greatly improves Rosetta's ability to distinguish correct from incorrect ligand poses. This result holds true for both protein-centric water docking wherein waters are located relative to the protein binding site and ligand-centric water docking wherein waters move with the ligand during docking. Protein-centric docking is used to model 99 HIV-1 protease/protease inhibitor structures. We find protease inhibitor placement improving at a ratio of 9:1 when one critical interface water molecule is included in the docking simulation. Ligand-centric docking is applied to 341 structures from the CSAR benchmark of diverse protein/ligand complexes [1]. Across this diverse dataset we see up to 56% recovery of failed docking studies, when waters are included in the docking simulation.

  11. Single Molecule Electronics and Devices

    Science.gov (United States)

    Tsutsui, Makusu; Taniguchi, Masateru

    2012-01-01

    The manufacture of integrated circuits with single-molecule building blocks is a goal of molecular electronics. While research in the past has been limited to bulk experiments on self-assembled monolayers, advances in technology have now enabled us to fabricate single-molecule junctions. This has led to significant progress in understanding electron transport in molecular systems at the single-molecule level and the concomitant emergence of new device concepts. Here, we review recent developments in this field. We summarize the methods currently used to form metal-molecule-metal structures and some single-molecule techniques essential for characterizing molecular junctions such as inelastic electron tunnelling spectroscopy. We then highlight several important achievements, including demonstration of single-molecule diodes, transistors, and switches that make use of electrical, photo, and mechanical stimulation to control the electron transport. We also discuss intriguing issues to be addressed further in the future such as heat and thermoelectric transport in an individual molecule. PMID:22969345

  12. Anion binding by biotin[6]uril in water

    DEFF Research Database (Denmark)

    Lisbjerg, Micke; Nielsen, Bjarne Enrico; Milhøj, Birgitte Olai

    2015-01-01

    In this contribution we show that the newly discovered 6 + 6 biotin-formaldehyde macrocycle Biotin[6]uril binds a variety of anionic guest molecules in water. We discuss how and why the anions are bound based on data obtained using NMR spectroscopy, mass spectrometry, isothermal titration...

  13. Autologous peptides constitutively occupy the antigen binding site on Ia

    DEFF Research Database (Denmark)

    Buus, S; Sette, A; Colon, S M

    1988-01-01

    Low molecular weight material associated with affinity-purified class II major histocompatibility complex (MHC) molecules of mouse (Ia) had the expected properties of peptides bound to the antigen binding site of Ia. Thus, the low molecular weight material derived from the I-Ad isotype...

  14. A light controlled cavitand wall regulates guest binding.

    Science.gov (United States)

    Berryman, Orion B; Sather, Aaron C; Rebek, Julius

    2011-01-14

    Here we report a cavitand with a photochemical switch as one of the container walls. The azo-arene switch undergoes photoisomerization when subjected to UV light producing a self-fulfilled cavitand. This process is thermally and photochemically reversible. The reported cavitand binds small molecules and these guests can be ejected from the cavitand through this photochemical process.

  15. USING MICROSCALE THERMOPHORESIS TO EASILY MEASURE BINDING AFFINITY

    Directory of Open Access Journals (Sweden)

    Dennis Breitsprecher*

    2018-03-01

    Full Text Available While it’s very common for biologists and chemists to test whether or not two molecules interact with each other, it’s much more useful to gather information on the nature of that interaction. How strong is it? How long will it last? What does that mean for its biological function? One way to answer these questions is to study affinity. Binding affinity is defined as the strength of the binding interaction between a single biomolecule to its binding partner, or ligand, and it can be quantifiably measured, providing information on whether or not molecules are interacting, as well as assigning a value to the affinity. When measuring binding affinity, there are several parameters to look at, but the dissociation constant (Kd, which defines the likelihood that an interaction between two molecules will break, is a very common measurement. The smaller the dissociation constant, the more tightly bound the ligand is, and the higher the affinity is between the two molecules.

  16. Covalent bindings in proteins following UV-C irradiation

    International Nuclear Information System (INIS)

    Diezel, W.; Meffert, H.; Soennichsen, N.; Reinicke, C.

    1980-01-01

    Following a UV-C irradiation of catalase cross-linked catalase subunits could be detected by sodium dodecylsulfate gel electrophoresis. The subunits of aldolase were not cross-linked. The origin of covalent bindings in the catalase molecule is suggested to be effected by a free radical chain reaction induced by the heme component of catalase after UV-C irradiation. (author)

  17. SHBG (Sex Hormone Binding Globulin)

    Science.gov (United States)

    ... Links Patient Resources For Health Professionals Subscribe Search Sex Hormone Binding Globulin (SHBG) Send Us Your Feedback ... As Testosterone-estrogen Binding Globulin TeBG Formal Name Sex Hormone Binding Globulin This article was last reviewed ...

  18. Human pentraxin 3 binds to the complement regulator c4b-binding protein.

    Directory of Open Access Journals (Sweden)

    Anne Braunschweig

    Full Text Available The long pentraxin 3 (PTX3 is a soluble recognition molecule with multiple functions including innate immune defense against certain microbes and the clearance of apoptotic cells. PTX3 interacts with recognition molecules of the classical and lectin complement pathways and thus initiates complement activation. In addition, binding of PTX3 to the alternative complement pathway regulator factor H was shown. Here, we show that PTX3 binds to the classical and lectin pathway regulator C4b-binding protein (C4BP. A PTX3-binding site was identified within short consensus repeats 1-3 of the C4BP α-chain. PTX3 did not interfere with the cofactor activity of C4BP in the fluid phase and C4BP maintained its complement regulatory activity when bound to PTX3 on surfaces. While C4BP and factor H did not compete for PTX3 binding, the interaction of C4BP with PTX3 was inhibited by C1q and by L-ficolin. PTX3 bound to human fibroblast- and endothelial cell-derived extracellular matrices and recruited functionally active C4BP to these surfaces. Whereas PTX3 enhanced the activation of the classical/lectin pathway and caused enhanced C3 deposition on extracellular matrix, deposition of terminal pathway components and the generation of the inflammatory mediator C5a were not increased. Furthermore, PTX3 enhanced the binding of C4BP to late apoptotic cells, which resulted in an increased rate of inactivation of cell surface bound C4b and a reduction in the deposition of C5b-9. Thus, in addition to complement activators, PTX3 interacts with complement inhibitors including C4BP. This balanced interaction on extracellular matrix and on apoptotic cells may prevent excessive local complement activation that would otherwise lead to inflammation and host tissue damage.

  19. Parasites causing cerebral falciparum malaria bind multiple endothelial receptors and express EPCR and ICAM-1-binding PfEMP1

    DEFF Research Database (Denmark)

    Tuikue Ndam, Nicaise; Moussiliou, Azizath; Lavstsen, Thomas

    2017-01-01

    Background: Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) mediates the binding and accumulation of infected erythrocytes (IE) to blood vessels and tissues. Specific interactions have been described between PfEMP1 and human endothelial proteins CD36, intercellular adhesion molecule-1...

  20. Structure of a Pheromone Receptor-Associated Mhc Molecule With An Open And Empty Groove

    Energy Technology Data Exchange (ETDEWEB)

    Olson, R.; Huey-Tubman, K.E.; Dulac, C.; Bjorkman, P.J.; /Caltech /Harvard U.

    2006-10-06

    Neurons in the murine vomeronasal organ (VNO) express a family of class Ib major histocompatibility complex (MHC) proteins (M10s) that interact with the V2R class of VNO receptors. This interaction may play a direct role in the detection of pheromonal cues that initiate reproductive and territorial behaviors. The crystal structure of M10.5, an M10 family member, is similar to that of classical MHC molecules. However, the M10.5 counterpart of the MHC peptide-binding groove is open and unoccupied, revealing the first structure of an empty class I MHC molecule. Similar to empty MHC molecules, but unlike peptide-filled MHC proteins and non-peptide-binding MHC homologs, M10.5 is thermally unstable, suggesting that its groove is normally occupied. However, M10.5 does not bind endogenous peptides when expressed in mammalian cells or when offered a mixture of class I-binding peptides. The F pocket side of the M10.5 groove is open, suggesting that ligands larger than 8-10-mer class I-binding peptides could fit by extending out of the groove. Moreover, variable residues point up from the groove helices, rather than toward the groove as in classical MHC structures. These data suggest that M10s are unlikely to provide specific recognition of class I MHC-binding peptides, but are consistent with binding to other ligands, including proteins such as the V2Rs.

  1. Structure of a pheromone receptor-associated MHC molecule with an open and empty groove.

    Directory of Open Access Journals (Sweden)

    2005-08-01

    Full Text Available Neurons in the murine vomeronasal organ (VNO express a family of class Ib major histocompatibility complex (MHC proteins (M10s that interact with the V2R class of VNO receptors. This interaction may play a direct role in the detection of pheromonal cues that initiate reproductive and territorial behaviors. The crystal structure of M10.5, an M10 family member, is similar to that of classical MHC molecules. However, the M10.5 counterpart of the MHC peptide-binding groove is open and unoccupied, revealing the first structure of an empty class I MHC molecule. Similar to empty MHC molecules, but unlike peptide-filled MHC proteins and non-peptide-binding MHC homologs, M10.5 is thermally unstable, suggesting that its groove is normally occupied. However, M10.5 does not bind endogenous peptides when expressed in mammalian cells or when offered a mixture of class I-binding peptides. The F pocket side of the M10.5 groove is open, suggesting that ligands larger than 8-10-mer class I-binding peptides could fit by extending out of the groove. Moreover, variable residues point up from the groove helices, rather than toward the groove as in classical MHC structures. These data suggest that M10s are unlikely to provide specific recognition of class I MHC-binding peptides, but are consistent with binding to other ligands, including proteins such as the V2Rs.

  2. Spin tunneling in magnetic molecules

    Science.gov (United States)

    Kececioglu, Ersin

    In this thesis, we will focus on spin tunneling in a family of systems called magnetic molecules such as Fe8 and Mn12. This is comparatively new, in relation to other tunneling problems. Many issues are not completely solved and/or understood yet. The magnetic molecule Fe 8 has been observed to have a rich pattern of degeneracies in its magnetic spectrum. We focus on these degeneracies from several points of view. We start with the simplest anisotropy Hamiltonian to describe the Fe 8 molecule and extend our discussion to include higher order anisotropy terms. We give analytical expressions as much as we can, for the degeneracies in the semi-classical limit in both cases. We reintroduce jump instantons to the instanton formalism. Finally, we discuss the effect of the environment on the molecule. Our results, for all different models and techniques, agree well with both experimental and numerical results.

  3. Experimental decoherence in molecule interferometry

    International Nuclear Information System (INIS)

    Hackermueller, L.; Hornberger, K.; Stibor, A.; Zeilinger, A.; Arndt, M.; Kiesewetter, G.

    2005-01-01

    Full text: We present three mechanisms of decoherence that occur quite naturally in matter wave interferometer with large molecules. One way molecules can lose coherence is through collision with background gas particles. We observe a loss of contrast with increasing background pressure for various types of gases. We can understand this phenomenon quantitatively with a new model for collisional decoherence which corrects older models by a factor of 2 π;. The second experiment studies the thermal emission of photons related to the high internal energy of the interfering molecules. When sufficiently many or sufficiently short photons are emitted inside the interferometer, the fringe contrast is lost. We can continuously vary the temperature of the molecules and compare the loss of contrast with a model based on decoherence theory. Again we find good quantitative agreement. A third mechanism that influences our interference pattern is dephasing due to vibrations of the interference gratings. By adding additional vibrations we study this effect in more detail. (author)

  4. Quenching methods for background reduction in luminescence-based probe-target binding assays

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Hong [Los Alamos, NM; Goodwin, Peter M [Los Alamos, NM; Keller, Richard A [Los Alamos, NM; Nolan, Rhiannon L [Santa Fe, NM

    2007-04-10

    Background luminescence is reduced from a solution containing unbound luminescent probes, each having a first molecule that attaches to a target molecule and having an attached luminescent moiety, and luminescent probe/target adducts. Quenching capture reagent molecules are formed that are capable of forming an adduct with the unbound luminescent probes and having an attached quencher material effective to quench luminescence of the luminescent moiety. The quencher material of the capture reagent molecules is added to a solution of the luminescent probe/target adducts and binds in a proximity to the luminescent moiety of the unbound luminescent probes to quench luminescence from the luminescent moiety when the luminescent moiety is exposed to exciting illumination. The quencher capture reagent does not bind to probe molecules that are bound to target molecules and the probe/target adduct emission is not quenched.

  5. Photoionization of atoms and molecules

    International Nuclear Information System (INIS)

    Samson, J.A.R.

    1976-01-01

    A literature review on the present state of knowledge in photoionization is presented. Various experimental techniques that have been developed to study photoionization, such as fluorescence and photoelectron spectroscopy, mass spectroscopy, are examined. Various atoms and molecules were chosen to illustrate these techniques, specifically helium and xenon atoms and hydrogen molecules. Specialized photoionization such as in positive and negative ions, excited states, and free radicals is also treated. Absorption cross sections and ionization potentials are also discussed

  6. Low pressure tritiation of molecules

    International Nuclear Information System (INIS)

    Moran, T.F.; Powers, J.C.; Lively, M.O.

    1980-01-01

    A method is described of tritiating sensitive biological molecules by depositing molecules of the substance to be tritiated on a supporting substrate in an evacuated vacuum chamber near, but not in the path of, an electron beam which traverses the chamber, admitting tritium gas into the chamber, and subjecting the tritium to the electron beam. Vibrationally excited tritium gas species are generated which collide and react with the substance thus incorporating tritium atoms into the substance. (U.K.)

  7. Systems Based Study of the Therapeutic Potential of Small Charged Molecules for the Inhibition of IL-1 Mediated Cartilage Degradation

    Science.gov (United States)

    Kar, Saptarshi; Smith, David W.; Gardiner, Bruce S.; Grodzinsky, Alan J.

    2016-01-01

    Inflammatory cytokines are key drivers of cartilage degradation in post-traumatic osteoarthritis. Cartilage degradation mediated by these inflammatory cytokines has been extensively investigated using in vitro experimental systems. Based on one such study, we have developed a computational model to quantitatively assess the impact of charged small molecules intended to inhibit IL-1 mediated cartilage degradation. We primarily focus on the simplest possible computational model of small molecular interaction with the IL-1 system—direct binding of the small molecule to the active site on the IL-1 molecule itself. We first use the model to explore the uptake and release kinetics of the small molecule inhibitor by cartilage tissue. Our results show that negatively charged small molecules are excluded from the negatively charged cartilage tissue and have uptake kinetics in the order of hours. In contrast, the positively charged small molecules are drawn into the cartilage with uptake and release timescales ranging from hours to days. Using our calibrated computational model, we subsequently explore the effect of small molecule charge and binding constant on the rate of cartilage degradation. The results from this analysis indicate that the small molecules are most effective in inhibiting cartilage degradation if they are either positively charged and/or bind strongly to IL-1α, or both. Furthermore, our results showed that the cartilage structural homeostasis can be restored by the small molecule if administered within six days following initial tissue exposure to IL-1α. We finally extended the scope of the computational model by simulating the competitive inhibition of cartilage degradation by the small molecule. Results from this model show that small molecules are more efficient in inhibiting cartilage degradation by binding directly to IL-1α rather than binding to IL-1α receptors. The results from this study can be used as a template for the design and

  8. Thermodynamic Exploration of Eosin-Lysozyme Binding: A Physical Chemistry and Biochemistry Laboratory Experiment

    Science.gov (United States)

    Huisman, Andrew J.; Hartsell, Lydia R.; Krueger, Brent P.; Pikaart, Michael J.

    2010-01-01

    We developed a modular pair of experiments for use in the undergraduate physical chemistry and biochemistry laboratories. Both experiments examine the thermodynamics of the binding of a small molecule, eosin Y, to the protein lysozyme. The assay for binding is the quenching of lysozyme fluorescence by eosin through resonant energy transfer. In…

  9. Defining Starch Binding by Glucan Phosphatases

    DEFF Research Database (Denmark)

    Auger, Kyle; Raththagala, Madushi; Wilkens, Casper

    2015-01-01

    Starch is a vital energy molecule in plants that has a wide variety of uses in industry, such as feedstock for biomaterial processing and biofuel production. Plants employ a three enzyme cyclic process utilizing kinases, amylases, and phosphatases to degrade starch in a diurnal manner. Starch...... is comprised of the branched glucan amylopectin and the more linear glucan amylose. Our lab has determined the first structures of these glucan phosphatases and we have defined their enzymatic action. Despite this progress, we lacked a means to quickly and efficiently quantify starch binding to glucan...

  10. Efficient assembly of recombinant major histocompatibility complex class I molecules with preformed disulfide bonds

    DEFF Research Database (Denmark)

    Ostergaard Pedersen, L; Nissen, Mogens Holst; Hansen, N J

    2001-01-01

    The expression of major histocompatibility class I (MHC-I) crucially depends upon the binding of appropriate peptides. MHC-I from natural sources are therefore always preoccupied with peptides complicating their purification and analysis. Here, we present an efficient solution to this problem....... Recombinant MHC-I heavy chains were produced in Escherichia coli and subsequently purified under denaturing conditions. In contrast to common practice, the molecules were not reduced during the purification. The oxidized MHC-I heavy chain isoforms were highly active with respect to peptide binding....... This suggests that de novo folding of denatured MHC-I molecules proceed efficiently if directed by preformed disulfide bond(s). Importantly, these molecules express serological epitopes and stain specific T cells; and they bind peptides specifically. Several denatured MHC-I heavy chains were analyzed and shown...

  11. CARBOHYDRATE-CONTAINING COMPOUNDS WHICH BIND TO CARBOHYDRATE BINDING RECEPTORS

    DEFF Research Database (Denmark)

    1995-01-01

    Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases.......Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases....

  12. Thermal ion-molecule reactions in oxygen-containing molecules

    International Nuclear Information System (INIS)

    Kumakura, Minoru

    1981-02-01

    The energetics of ions and the thermal ion-molecule reactions in oxygen-containing molecules have been studied with a modified time-of-flight mass spectrometer. It was found that the translational energy of ion can be easily obtained from analysis of the decay curve using the time-of-flight mass spectrometer. The condensation-elimination reactions proceeded via cross- and homo-elimination mechanism in which the nature of intermediate-complex could be correlated with the nature of reactant ion. It was elucidated that behavior of poly-atomic oxygen-containing ions on the condensation-elimination reactions is considerably influenced by their oxonium ion structures having functional groups. In addition, the rate constants of the condensation-elimination reactions have affected with the energy state of reactant ion and the dipole moment and/or the polarizability of neutral molecule. It was clarified that the rate constants of the ion-molecule clustering reactions in poly-atomic oxygen-containing molecules such as cyclic ether of six member rings are very large and the cluster ions are stable owing to the large number of vibrational degree of freedom in the cluster ions. (author)

  13. Melanin binding study of clinical drugs with cassette dosing and rapid equilibrium dialysis inserts

    OpenAIRE

    Pelkonen L; Tengvall-Unadike U; Ruponen M; Kidron H; del Amo EM; Reinisalo M; Urtti A

    2017-01-01

    Melanin pigment is a negatively charged polymer found in pigmented human tissues. In the eye, iris, ciliary body, choroid and retinal pigment epithelium (RPE) are heavily pigmented. Several drug molecules are known to bind to melanin, but larger sets of drugs have not been compared often in similar test conditions. In this study, we introduce a powerful tool for screening of melanin binding. The binding of a set of 34 compounds to isolated porcine RPE melanin was determined by cassette (n-in-...

  14. Binding Direction-Based Two-Dimensional Flattened Contact Area Computing Algorithm for Protein-Protein Interactions.

    Science.gov (United States)

    Kang, Beom Sik; Pugalendhi, GaneshKumar; Kim, Ku-Jin

    2017-10-13

    Interactions between protein molecules are essential for the assembly, function, and regulation of proteins. The contact region between two protein molecules in a protein complex is usually complementary in shape for both molecules and the area of the contact region can be used to estimate the binding strength between two molecules. Although the area is a value calculated from the three-dimensional surface, it cannot represent the three-dimensional shape of the surface. Therefore, we propose an original concept of two-dimensional contact area which provides further information such as the ruggedness of the contact region. We present a novel algorithm for calculating the binding direction between two molecules in a protein complex, and then suggest a method to compute the two-dimensional flattened area of the contact region between two molecules based on the binding direction.

  15. Binding Direction-Based Two-Dimensional Flattened Contact Area Computing Algorithm for Protein–Protein Interactions

    Directory of Open Access Journals (Sweden)

    Beom Sik Kang

    2017-10-01

    Full Text Available Interactions between protein molecules are essential for the assembly, function, and regulation of proteins. The contact region between two protein molecules in a protein complex is usually complementary in shape for both molecules and the area of the contact region can be used to estimate the binding strength between two molecules. Although the area is a value calculated from the three-dimensional surface, it cannot represent the three-dimensional shape of the surface. Therefore, we propose an original concept of two-dimensional contact area which provides further information such as the ruggedness of the contact region. We present a novel algorithm for calculating the binding direction between two molecules in a protein complex, and then suggest a method to compute the two-dimensional flattened area of the contact region between two molecules based on the binding direction.

  16. The T-cell accessory molecule CD4 recognizes a monomorphic determinant on isolated Ia

    DEFF Research Database (Denmark)

    Gay, D; Buus, S; Pasternak, J

    1988-01-01

    The membrane protein CD4 is commonly found on mature T cells specific for antigen in association with class II major histocompatibility complex (MHC; Ia) proteins. This correlation has led to the suggestion that CD4 binds to a monomorphic region of the Ia molecule on the antigen-presenting cell...... proteins into a planar membrane system, we show that different Ia molecules can greatly enhance the ability of a CD4+ but not a CD4- variant of this class I-restricted T hybrid to respond to isolated class I molecules. T-cell responses can be strongly augmented by the concurrent expression of CD4 on the T...... cell and any of four different Ia proteins on planar membranes, thus supporting the idea that CD4 binds to a monomorphic region of the Ia molecule and increases the avidity with which the T cell can interact with its target....

  17. Isolation and partial characterization of gypsy moth BTR-270, an anionic brush border membrane glycoconjugate that binds Bacillus thuringiensis Cry1A toxins with high affinity

    Science.gov (United States)

    Algimantas P. Valaitis; Jeremy L. Jenkins; Mi Kyong Lee; Donald H. Dean; Karen J. Garner

    2001-01-01

    BTR-270, a gypsy moth (Lymantria dispar) brush border membrane molecule that binds Bacillus thuringiensis (Bt) Cry1A toxins with high affinity, was purified by preparative gel electrophoresis. Rabbit antibodies specific for the Bt toxin-binding molecule were raised. Attempts to label BTR-270 by protein-directed techniques were...

  18. The Molecule Cloud - compact visualization of large collections of molecules

    Directory of Open Access Journals (Sweden)

    Ertl Peter

    2012-07-01

    Full Text Available Abstract Background Analysis and visualization of large collections of molecules is one of the most frequent challenges cheminformatics experts in pharmaceutical industry are facing. Various sophisticated methods are available to perform this task, including clustering, dimensionality reduction or scaffold frequency analysis. In any case, however, viewing and analyzing large tables with molecular structures is necessary. We present a new visualization technique, providing basic information about the composition of molecular data sets at a single glance. Summary A method is presented here allowing visual representation of the most common structural features of chemical databases in a form of a cloud diagram. The frequency of molecules containing particular substructure is indicated by the size of respective structural image. The method is useful to quickly perceive the most prominent structural features present in the data set. This approach was inspired by popular word cloud diagrams that are used to visualize textual information in a compact form. Therefore we call this approach “Molecule Cloud”. The method also supports visualization of additional information, for example biological activity of molecules containing this scaffold or the protein target class typical for particular scaffolds, by color coding. Detailed description of the algorithm is provided, allowing easy implementation of the method by any cheminformatics toolkit. The layout algorithm is available as open source Java code. Conclusions Visualization of large molecular data sets using the Molecule Cloud approach allows scientists to get information about the composition of molecular databases and their most frequent structural features easily. The method may be used in the areas where analysis of large molecular collections is needed, for example processing of high throughput screening results, virtual screening or compound purchasing. Several example visualizations of large

  19. Interaction of an immunodominant epitope with Ia molecules in T-cell activation

    DEFF Research Database (Denmark)

    Adorini, L; Sette, A; Buus, S

    1988-01-01

    The amino acid sequence corresponding to residues 107-116 of hen egg-white lysozyme (HEL) has been identified as containing an immunodominant T-cell epitope recognized in association with the I-Ed molecule. The immunodominance of this epitope in HEL-primed H-2d mice was demonstrated by analysis o......-120)-peptide was found to be immunogenic in H-2d mice. Thus, a single semiconservative substitution drastically reduces binding capacity and abolishes immunogenicity, suggesting that a strict correlation exists between binding of a peptide to Ia molecules and its immunogenicity....

  20. AM-37 and ST-36 Are Small Molecule Bombesin Receptor Antagonists

    OpenAIRE

    Terry W. Moody; Nicole Tashakkori; Samuel A. Mantey; Paola Moreno; Irene Ramos-Alvarez; Marcello Leopoldo; Robert T. Jensen

    2017-01-01

    While peptide antagonists for the gastrin-releasing peptide receptor (BB2R), neuromedin B receptor (BB1R), and bombesin (BB) receptor subtype-3 (BRS-3) exist, there is a need to develop non-peptide small molecule inhibitors for all three BBR. The BB agonist (BA)1 binds with high affinity to the BB1R, BB2R, and BRS-3. In this communication, small molecule BBR antagonists were evaluated using human lung cancer cells. AM-37 and ST-36 inhibited binding to human BB1R, BB2R, and BRS-3 with similar ...

  1. Interactions of the humoral pattern recognition molecule PTX3 with the complement system

    DEFF Research Database (Denmark)

    Doni, Andrea; Garlanda, Cecilia; Bottazzi, Barbara

    2012-01-01

    The innate immune system comprises a cellular and a humoral arm. The long pentraxin PTX3 is a fluid phase pattern recognition molecule, which acts as an essential component of the humoral arm of innate immunity. PTX3 has antibody-like properties including interactions with complement components....... PTX3 interacts with C1q, ficolin-1 and ficolin-2 as well as mannose-binding lectin, recognition molecules in the classical and lectin complement pathways. The formation of these heterocomplexes results in cooperative pathogen recognition and complement activation. Interactions with C4b binding protein...

  2. Molecule-by-Molecule Writing Using a Focused Electron Beam

    DEFF Research Database (Denmark)

    Van Dorp, Willem F.; Zhang, Xiaoyan; Feringa, Ben L.

    2012-01-01

    atoms also be written with an electron beam? We verify this with focused electron-beam-induced deposition (FEBID), a direct-write technique that has the current record for the smallest feature written by (electron) optical lithography. We show that the deposition of an organometallic precursor...... on graphene can be followed molecule-by-molecule with FEBID. The results show that mechanisms that are inherent to the process inhibit a further increase in control over the process. Hence, our results present the resolution limit of (electron) optical lithography techniques. The writing of isolated...

  3. Simple test system for single molecule recognition force microscopy

    International Nuclear Information System (INIS)

    Riener, Christian K.; Stroh, Cordula M.; Ebner, Andreas; Klampfl, Christian; Gall, Alex A.; Romanin, Christoph; Lyubchenko, Yuri L.; Hinterdorfer, Peter; Gruber, Hermann J.

    2003-01-01

    We have established an easy-to-use test system for detecting receptor-ligand interactions on the single molecule level using atomic force microscopy (AFM). For this, avidin-biotin, probably the best characterized receptor-ligand pair, was chosen. AFM sensors were prepared containing tethered biotin molecules at sufficiently low surface concentrations appropriate for single molecule studies. A biotin tether, consisting of a 6 nm poly(ethylene glycol) (PEG) chain and a functional succinimide group at the other end, was newly synthesized and covalently coupled to amine-functionalized AFM tips. In particular, PEG 800 diamine was glutarylated, the mono-adduct NH 2 -PEG-COOH was isolated by ion exchange chromatography and reacted with biotin succinimidylester to give biotin-PEG-COOH which was then activated as N-hydroxysuccinimide (NHS) ester to give the biotin-PEG-NHS conjugate which was coupled to the aminofunctionalized AFM tip. The motional freedom provided by PEG allows for free rotation of the biotin molecule on the AFM sensor and for specific binding to avidin which had been adsorbed to mica surfaces via electrostatic interactions. Specific avidin-biotin recognition events were discriminated from nonspecific tip-mica adhesion by their typical unbinding force (∼40 pN at 1.4 nN/s loading rate), unbinding length (<13 nm), the characteristic nonlinear force-distance relation of the PEG linker, and by specific block with excess of free d-biotin. The convenience of the test system allowed to evaluate, and compare, different methods and conditions of tip aminofunctionalization with respect to specific binding and nonspecific adhesion. It is concluded that this system is well suited as calibration or start-up kit for single molecule recognition force microscopy

  4. Probing Intranuclear Environments at the Single-Molecule Level

    Science.gov (United States)

    Grünwald, David; Martin, Robert M.; Buschmann, Volker; Bazett-Jones, David P.; Leonhardt, Heinrich; Kubitscheck, Ulrich; Cardoso, M. Cristina

    2008-01-01

    Genome activity and nuclear metabolism clearly depend on accessibility, but it is not known whether and to what extent nuclear structures limit the mobility and access of individual molecules. We used fluorescently labeled streptavidin with a nuclear localization signal as an average-sized, inert protein to probe the nuclear environment. The protein was injected into the cytoplasm of mouse cells, and single molecules were tracked in the nucleus with high-speed fluorescence microscopy. We analyzed and compared the mobility of single streptavidin molecules in structurally and functionally distinct nuclear compartments of living cells. Our results indicated that all nuclear subcompartments were easily and similarly accessible for such an average-sized protein, and even condensed heterochromatin neither excluded single molecules nor impeded their passage. The only significant difference was a higher frequency of transient trappings in heterochromatin, which lasted only tens of milliseconds. The streptavidin molecules, however, did not accumulate in heterochromatin, suggesting comparatively less free volume. Interestingly, the nucleolus seemed to exclude streptavidin, as it did many other nuclear proteins, when visualized by conventional fluorescence microscopy. The tracking of single molecules, nonetheless, showed no evidence for repulsion at the border but relatively unimpeded passage through the nucleolus. These results clearly show that single-molecule tracking can provide novel insights into mobility of proteins in the nucleus that cannot be obtained by conventional fluorescence microscopy. Our results suggest that nuclear processes may not be regulated at the level of physical accessibility but rather by local concentration of reactants and availability of binding sites. PMID:18065482

  5. Phase-coherent electron transport through metallic atomic-sized contacts and organic molecules

    Energy Technology Data Exchange (ETDEWEB)

    Pauly, F.

    2007-02-02

    This work is concerned with the theoretical description of systems at the nanoscale, in particular the electric current through atomic-sized metallic contacts and organic molecules. In the first part, the characteristic peak structure in conductance histograms of different metals is analyzed within a tight-binding model. In the second part, an ab-initio method for quantum transport is developed and applied to single-atom and single-molecule contacts. (orig.)

  6. Effect of an improved molecular potential on strong-field tunneling ionization of molecules

    International Nuclear Information System (INIS)

    Zhao Songfeng; Jin Cheng; Le, Anh-Thu; Lin, C. D.

    2010-01-01

    We study the effect of one-electron model potentials on the tunneling ionization rates of molecules in strong fields. By including electron correlation using the modified Leeuwen-Baerends (LB α) model, the binding energies of outer shells of molecules are significantly improved. However, we show that the tunneling ionization rates from the LB α do not differ much from the earlier calculations [Phys. Rev. A 81, 033423 (2010)], in which the local correlation potential was neglected.

  7. CEACAM3-mediated phagocytosis of human-specific bacterial pathogens involves the adaptor molecule Nck

    OpenAIRE

    Peterson, Lisa

    2010-01-01

    Carcinoembryonic antigen-related cell adhesion molecules (CEACAMs) are exploited by human-specific pathogens to anchor themselves to or invade host cells. Interestingly, human granulocytes express a specific isoform, CEACAM3, that can direct efficient, opsonin-independent phagocytosis of CEACAM-binding Neisseria, Moraxella and Haemophilus species. As opsonin-independent phagocytosis of CEACAM-binding Neisseria depends on Src-family protein tyrosine kinase (PTK) phosphorylation of the CEACAM3 ...

  8. Physics of Complex Polymeric Molecules

    Science.gov (United States)

    Kelly, Joshua Walter

    The statistical physics of complex polymers with branches and circuits is the topic of this dissertation. An important motivation are large, single-stranded (ss) RNA molecules. Such molecules form complex ``secondary" and ``tertiary" structures that can be represented as branched polymers with circuits. Such structures are in part directly determined by the nucleotide sequence and in part subject to thermal fluctuations. The polymer physics literature on molecules in this class has mostly focused on randomly branched polymers without circuits while there has been minimal research on polymers with specific structures and on polymers that contain circuits. The dissertation is composed of three parts: Part I studies branched polymers with thermally fluctuating structure confined to a potential well as a simple model for the encapsidation of viral RNA. Excluded volume interactions were ignored. In Part II, I apply Flory theory to the study of the encapsidation of viral ss RNA molecules with specific branched structures, but without circuits, in the presence of excluded volume interaction. In Part III, I expand on Part II and consider complex polymers with specific structure including both branching and circuits. I introduce a method based on the mathematics of Laplacian matrices that allows me to calculate density profiles for such molecules, which was not possible within Flory theory.

  9. Dissociation and decay of ultracold sodium molecules

    International Nuclear Information System (INIS)

    Mukaiyama, T.; Abo-Shaeer, J.R.; Xu, K.; Chin, J.K.; Ketterle, W.

    2004-01-01

    The dissociation of ultracold molecules was studied by ramping an external magnetic field through a Feshbach resonance. The observed dissociation energies directly yielded the strength of the atom-molecule coupling. They showed nonlinear dependence on the ramp speed. This was explained by a Wigner threshold law which predicts that the decay rate of the molecules above threshold increases with the density of states. In addition, inelastic molecule-molecule and molecule-atom collisions were characterized

  10. A Correlation between the Activity of Candida antarctica Lipase B and Differences in Binding Free Energies of Organic Solvent and Substrate

    DEFF Research Database (Denmark)

    Banik, Sindrila Dutta; Nordblad, Mathias; Woodley, John

    2016-01-01

    in an inhibitory effect which is also confirmed by the binding free energies for the solvent and substrate molecules estimated from the simulations. Consequently, the catalytic activity of CALB decreases in polar solvents. This effect is significant, and CALB is over 10 orders of magnitude more active in nonpolar...... of the enzyme may be ascribed to binding of solvent molecules to the enzyme active site region and the solvation energy of substrate molecules in the different solvents. Polar solvent molecules interact strongly with CALB and compete with the substrate to bind to the active site region, resulting...

  11. Small molecule fluoride toxicity agonists.

    Science.gov (United States)

    Nelson, James W; Plummer, Mark S; Blount, Kenneth F; Ames, Tyler D; Breaker, Ronald R

    2015-04-23

    Fluoride is a ubiquitous anion that inhibits a wide variety of metabolic processes. Here, we report the identification of a series of compounds that enhance fluoride toxicity in Escherichia coli and Streptococcus mutans. These molecules were isolated by using a high-throughput screen (HTS) for compounds that increase intracellular fluoride levels as determined via a fluoride riboswitch reporter fusion construct. A series of derivatives were synthesized to examine structure-activity relationships, leading to the identification of compounds with improved activity. Thus, we demonstrate that small molecule fluoride toxicity agonists can be identified by HTS from existing chemical libraries by exploiting a natural fluoride riboswitch. In addition, our findings suggest that some molecules might be further optimized to function as binary antibacterial agents when combined with fluoride. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Double photoionisation spectra of molecules

    CERN Document Server

    Eland, John

    2017-01-01

    This book contains spectra of the doubly charged positive ions (dications) of some 75 molecules, including the major constituents of terrestrial and planetary atmospheres and prototypes of major chemical groups. It is intended to be a new resource for research in all areas of molecular spectroscopy involving high energy environments, both terrestrial and extra-terrestrial. All the spectra have been produced by photoionisation using laboratory lamps or synchrotron radiation and have been measured using the magnetic bottle time-of-flight technique by coincidence detection of correlated electron pairs. Full references to published work on the same species are given, though for several molecules these are the first published spectra. Double ionisation energies are listed and discussed in relation to the molecular electronic structure of the molecules. A full introduction to the field of molecular double ionisation is included and the mechanisms by which double photoionisation can occur are examined in detail. A p...

  13. Targeting Endothelial Adhesion Molecule Transcription for Treatment of Inflammatory Disease: A Proof-of-Concept Study

    Directory of Open Access Journals (Sweden)

    Liam M. Ashander

    2016-01-01

    Full Text Available Targeting the endothelial adhesion molecules that control leukocyte trafficking into a tissue has been explored as a biological therapy for inflammatory diseases. However, these molecules also participate in leukocyte migration for immune surveillance, and inhibiting the physiological level of an adhesion molecule might promote infection or malignancy. We explored the concept of targeting endothelial adhesion molecule transcription during inflammation in a human system. Intercellular adhesion molecule 1 (ICAM-1 mediates leukocyte migration across the retinal endothelium in noninfectious posterior uveitis. We observed an increase in the transcription factor, nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NF-κB1, in parallel with ICAM-1, in human retinal endothelial cells treated with tumor necrosis factor-alpha (TNF-α, and identified putative binding sites for NF-κB1 within the ICAM-1 regulatory region. We targeted induced NF-κB1 expression in endothelial cells with small interfering (siRNA. Knockdown of NF-κB1 significantly decreased cell surface expression of ICAM-1 protein induced by TNF-α but did not reduce constitutive ICAM-1 expression. Consistently, NF-κB1 knockdown significantly reduced leukocyte binding to cell monolayers in the presence of TNF-α but did not impact baseline binding. Findings of this proof-of-concept study indicate that induced transcription of endothelial adhesion molecules might be targeted therapeutically for inflammatory disease in humans.

  14. Targeting Jurkat T Lymphocyte Leukemia Cells by an Engineered Interferon-Alpha Hybrid Molecule

    Directory of Open Access Journals (Sweden)

    Dehai Yu

    2017-06-01

    Full Text Available Background/Aims: Adult T-cell leukemia/lymphoma (ATL is a very aggressive T cell malignancy that carries a poor prognosis, primarily due to its resistance to chemotherapy and to life-threatening infectious complications. Interferon-alpha (IFNα has been used in combination with the anti-retroviral drug zidovudine to treat patients with ATL. However, the efficacy of long-term therapy is significantly limited due to the systemic toxicity of IFNα. Methods: We utilized phage display library screening to identify short peptides that specifically bind to Jurkat T lymphocyte leukemia cells. By fusing the Jurkat-binding peptide to the C-terminus of IFNα, we constructed an engineered chimeric IFNα molecule (IFNP for the treatment of ATL. Results: We found that IFNP exhibited significantly higher activity than wild type IFNα in inhibiting the growth of leukemia cells and inducing cell blockage at the G0/G1 phase. The synthetic IFNP molecule exerted its antitumor activity by upregulating the downstream genes involved in the STAT1 pathway and in apoptosis. Using a cell receptor binding assay, we showed that this Jurkat-binding peptide facilitated the binding affinity of IFNα to the cell surface type I IFN receptor. Conclusion: The isolated Jurkat-binding peptide significantly potentiates the therapeutic activity of IFNα in T lymphocyte leukemia cells. The engineered IFNP molecule may prove to a novel antitumor approach in the treatment of patients with ATL.

  15. Identifying a Small Molecule Blocking Antigen Presentation in Autoimmune Thyroiditis.

    Science.gov (United States)

    Li, Cheuk Wun; Menconi, Francesca; Osman, Roman; Mezei, Mihaly; Jacobson, Eric M; Concepcion, Erlinda; David, Chella S; Kastrinsky, David B; Ohlmeyer, Michael; Tomer, Yaron

    2016-02-19

    We previously showed that an HLA-DR variant containing arginine at position 74 of the DRβ1 chain (DRβ1-Arg74) is the specific HLA class II variant conferring risk for autoimmune thyroid diseases (AITD). We also identified 5 thyroglobulin (Tg) peptides that bound to DRβ1-Arg74. We hypothesized that blocking the binding of these peptides to DRβ1-Arg74 could block the continuous T-cell activation in thyroiditis needed to maintain the autoimmune response to the thyroid. The aim of the current study was to identify small molecules that can block T-cell activation by Tg peptides presented within DRβ1-Arg74 pockets. We screened a large and diverse library of compounds and identified one compound, cepharanthine that was able to block peptide binding to DRβ1-Arg74. We then showed that Tg.2098 is the dominant peptide when inducing experimental autoimmune thyroiditis (EAT) in NOD mice expressing human DRβ1-Arg74. Furthermore, cepharanthine blocked T-cell activation by thyroglobulin peptides, in particular Tg.2098 in mice that were induced with EAT. For the first time we identified a small molecule that can block Tg peptide binding and presentation to T-cells in autoimmune thyroiditis. If confirmed cepharanthine could potentially have a role in treating human AITD. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Using the fast fourier transform in binding free energy calculations.

    Science.gov (United States)

    Nguyen, Trung Hai; Zhou, Huan-Xiang; Minh, David D L

    2018-04-30

    According to implicit ligand theory, the standard binding free energy is an exponential average of the binding potential of mean force (BPMF), an exponential average of the interaction energy between the unbound ligand ensemble and a rigid receptor. Here, we use the fast Fourier transform (FFT) to efficiently evaluate BPMFs by calculating interaction energies when rigid ligand configurations from the unbound ensemble are discretely translated across rigid receptor conformations. Results for standard binding free energies between T4 lysozyme and 141 small organic molecules are in good agreement with previous alchemical calculations based on (1) a flexible complex ( R≈0.9 for 24 systems) and (2) flexible ligand with multiple rigid receptor configurations ( R≈0.8 for 141 systems). While the FFT is routinely used for molecular docking, to our knowledge this is the first time that the algorithm has been used for rigorous binding free energy calculations. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  17. Knowledge-based Fragment Binding Prediction

    Science.gov (United States)

    Tang, Grace W.; Altman, Russ B.

    2014-01-01

    Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971

  18. Sequential memory: Binding dynamics

    Science.gov (United States)

    Afraimovich, Valentin; Gong, Xue; Rabinovich, Mikhail

    2015-10-01

    Temporal order memories are critical for everyday animal and human functioning. Experiments and our own experience show that the binding or association of various features of an event together and the maintaining of multimodality events in sequential order are the key components of any sequential memories—episodic, semantic, working, etc. We study a robustness of binding sequential dynamics based on our previously introduced model in the form of generalized Lotka-Volterra equations. In the phase space of the model, there exists a multi-dimensional binding heteroclinic network consisting of saddle equilibrium points and heteroclinic trajectories joining them. We prove here the robustness of the binding sequential dynamics, i.e., the feasibility phenomenon for coupled heteroclinic networks: for each collection of successive heteroclinic trajectories inside the unified networks, there is an open set of initial points such that the trajectory going through each of them follows the prescribed collection staying in a small neighborhood of it. We show also that the symbolic complexity function of the system restricted to this neighborhood is a polynomial of degree L - 1, where L is the number of modalities.

  19. Cellulose binding domain proteins

    Science.gov (United States)

    Shoseyov, Oded; Shpiegl, Itai; Goldstein, Marc; Doi, Roy

    1998-01-01

    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production thereof. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques.

  20. Binding and Bulgarian

    NARCIS (Netherlands)

    Schürcks-Grozeva, Lilia Lubomirova

    2003-01-01

    In haar proefschrift analyseert Lilia Schürcks de anaforische verschijnselen in de Bulgaarse taal. Het gaat dan om wederkerende aspecten, uitgedrukt bij woorden als ‘zich’ en ‘elkaar’. De situatie in het Bulgaars blijkt moeilijk in te passen in de klassieke Binding Theory van Noam Chomsky. Bron: RUG

  1. Technetium-aspirin molecule complexes

    International Nuclear Information System (INIS)

    El-Shahawy, A.S.; Mahfouz, R.M.; Aly, A.A.M.; El-Zohry, M.

    1993-01-01

    Technetium-aspirin and technetium-aspirin-like molecule complexes were prepared. The structure of N-acetylanthranilic acid (NAA) has been decided through CNDO calculations. The ionization potential and electron affinity of the NAA molecule as well as the charge densities were calculated. The electronic absorption spectra of Tc(V)-Asp and Tc(V)-ATS complexes have two characteristic absorption bands at 450 and 600 nm, but the Tc(V)-NAA spectrum has one characteristic band at 450 nm. As a comparative study, Mo-ATS complex was prepared and its electronic absorption spectrum is comparable with the Tc-ATS complex spectrum. (author)

  2. Teaching lasers to control molecules

    International Nuclear Information System (INIS)

    Judson, R.S.; Rabitz, H.

    1992-01-01

    We simulate a method to teach a laser pulse sequences to excite specified molecular states. We use a learning procedure to direct the production of pulses based on ''fitness'' information provided by a laboratory measurement device. Over a series of pulses the algorithm learns an optimal sequence. The experimental apparatus, which consists of a laser, a sample of molecules and a measurement device, acts as an analog computer that solves Schroedinger's equation n/Iexactly, in real time. We simulate an apparatus that learns to excite specified rotational states in a diatomic molecule

  3. Osmotic stress regulates the strength and kinetics of sugar binding to the maltoporin channel

    International Nuclear Information System (INIS)

    Gurnev, Philip A; Bezrukov, Sergey M; Harries, Daniel; Adrian Parsegian, V

    2010-01-01

    We study the effect of osmotic stress, exerted by salts, on carbohydrate binding to the sugar-specific bacterial channel maltoporin. When the channel is reconstituted into planar lipid bilayers, single events of its occlusion by sugar are seen as transient interruptions in the flow of small ions. We find that, for most salts, changes in the free energy of maltoporin-sugar binding vary linearly with solution osmotic pressure. Such a change in binding with solution osmolarity indicates that for each salt a constant number of salt-excluding water molecules is released upon sugar-maltoporin association at all salt concentrations. We find that larger numbers of water molecules are released upon binding of the cyclic carbohydrate β-cyclodextrin (CD) than upon binding of the corresponding linear homologue maltoheptaose (m7). Remarkably, the extent to which salts affect the binding constants and rates depends sensitively on the type of salt; dehydration in solutions of different anions corresponds to the Hofmeister series. In sodium sulfate solutions, CD and m7 respectively release about 120 and 35 salt-excluding water molecules; in sodium chloride solutions, 35 and 15 waters. No water release is observed with sodium bromide. Finally, by adding adamantane, known to form an inclusion complex with CD, we can infer that CD not only dehydrates but also undergoes a conformational change upon binding to the channel. As a practical outcome, our results also demonstrate how osmotic stress can improve single-molecule detection of different solutes using protein-based nanopores.

  4. Exotic helium molecules; Molecules exotiques d'helium

    Energy Technology Data Exchange (ETDEWEB)

    Portier, M

    2007-12-15

    We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}P{sub 0}) molecule, or a {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 {+-} 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime {tau} = (1.4 {+-} 0.3) {mu}s is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)

  5. Exotic helium molecules; Molecules exotiques d'helium

    Energy Technology Data Exchange (ETDEWEB)

    Portier, M

    2007-12-15

    We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}P{sub 0}) molecule, or a {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 {+-} 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime {tau} = (1.4 {+-} 0.3) {mu}s is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)

  6. Predicting protein-binding RNA nucleotides with consideration of binding partners.

    Science.gov (United States)

    Tuvshinjargal, Narankhuu; Lee, Wook; Park, Byungkyu; Han, Kyungsook

    2015-06-01

    In recent years several computational methods have been developed to predict RNA-binding sites in protein. Most of these methods do not consider interacting partners of a protein, so they predict the same RNA-binding sites for a given protein sequence even if the protein binds to different RNAs. Unlike the problem of predicting RNA-binding sites in protein, the problem of predicting protein-binding sites in RNA has received little attention mainly because it is much more difficult and shows a lower accuracy on average. In our previous study, we developed a method that predicts protein-binding nucleotides from an RNA sequence. In an effort to improve the prediction accuracy and usefulness of the previous method, we developed a new method that uses both RNA and protein sequence data. In this study, we identified effective features of RNA and protein molecules and developed a new support vector machine (SVM) model to predict protein-binding nucleotides from RNA and protein sequence data. The new model that used both protein and RNA sequence data achieved a sensitivity of 86.5%, a specificity of 86.2%, a positive predictive value (PPV) of 72.6%, a negative predictive value (NPV) of 93.8% and Matthews correlation coefficient (MCC) of 0.69 in a 10-fold cross validation; it achieved a sensitivity of 58.8%, a specificity of 87.4%, a PPV of 65.1%, a NPV of 84.2% and MCC of 0.48 in independent testing. For comparative purpose, we built another prediction model that used RNA sequence data alone and ran it on the same dataset. In a 10 fold-cross validation it achieved a sensitivity of 85.7%, a specificity of 80.5%, a PPV of 67.7%, a NPV of 92.2% and MCC of 0.63; in independent testing it achieved a sensitivity of 67.7%, a specificity of 78.8%, a PPV of 57.6%, a NPV of 85.2% and MCC of 0.45. In both cross-validations and independent testing, the new model that used both RNA and protein sequences showed a better performance than the model that used RNA sequence data alone in

  7. Mass amplifying probe for sensitive fluorescence anisotropy detection of small molecules in complex biological samples.

    Science.gov (United States)

    Cui, Liang; Zou, Yuan; Lin, Ninghang; Zhu, Zhi; Jenkins, Gareth; Yang, Chaoyong James

    2012-07-03

    Fluorescence anisotropy (FA) is a reliable and excellent choice for fluorescence sensing. One of the key factors influencing the FA value for any molecule is the molar mass of the molecule being measured. As a result, the FA method with functional nucleic acid aptamers has been limited to macromolecules such as proteins and is generally not applicable for the analysis of small molecules because their molecular masses are relatively too small to produce observable FA value changes. We report here a molecular mass amplifying strategy to construct anisotropy aptamer probes for small molecules. The probe is designed in such a way that only when a target molecule binds to the probe does it activate its binding ability to an anisotropy amplifier (a high molecular mass molecule such as protein), thus significantly increasing the molecular mass and FA value of the probe/target complex. Specifically, a mass amplifying probe (MAP) consists of a targeting aptamer domain against a target molecule and molecular mass amplifying aptamer domain for the amplifier protein. The probe is initially rendered inactive by a small blocking strand partially complementary to both target aptamer and amplifier protein aptamer so that the mass amplifying aptamer domain would not bind to the amplifier protein unless the probe has been activated by the target. In this way, we prepared two probes that constitute a target (ATP and cocaine respectively) aptamer, a thrombin (as the mass amplifier) aptamer, and a fluorophore. Both probes worked well against their corresponding small molecule targets, and the detection limits for ATP and cocaine were 0.5 μM and 0.8 μM, respectively. More importantly, because FA is less affected by environmental interferences, ATP in cell media and cocaine in urine were directly detected without any tedious sample pretreatment. Our results established that our molecular mass amplifying strategy can be used to design aptamer probes for rapid, sensitive, and selective

  8. Vesicle Encapsulation Studies Reveal that Single Molecule Ribozyme Heterogeneities Are Intrinsic

    Science.gov (United States)

    Okumus, Burak; Wilson, Timothy J.; Lilley, David M. J.; Ha, Taekjip

    2004-01-01

    Single-molecule measurements have revealed that what were assumed to be identical molecules can differ significantly in their static and dynamic properties. One of the most striking examples is the hairpin ribozyme, which was shown to exhibit two to three orders of magnitude variation in folding kinetics between molecules. Although averaged behavior of single molecules matched the bulk solution data, it was not possible to exclude rigorously the possibility that the variations around the mean values arose from different ways of interacting with the surface environment. To test this, we minimized the molecules' interaction with the surface by encapsulating DNA or RNA molecules inside 100- to 200-nm diameter unilamellar vesicles, following the procedures described by Haran and coworkers. Vesicles were immobilized on a supported lipid bilayer via biotin-streptavidin linkages. We observed no direct binding of DNA or RNA on the supported bilayer even at concentrations exceeding 100 nM, indicating that these molecules do not bind stably on the membrane. Since the vesicle diameter is smaller than the resolution of optical microscopy, the lateral mobility of the molecules is severely constrained, allowing long observation periods. We used fluorescence correlation spectroscopy, nuclease digestion, and external buffer exchange to show that the molecules were indeed encapsulated within the vesicles. When contained within vesicles, the natural form of the hairpin ribozyme exhibited 50-fold variation in both folding and unfolding rates in 0.5 mM Mg2+, which is identical to what was observed from the molecules tethered directly on the surface. This strongly indicates that the observed heterogeneity in dynamic properties does not arise as an artifact of surface attachment, but is intrinsic to the nature of the molecules. PMID:15454471

  9. Crystal structure of axolotl (Ambystoma mexicanum) liver bile acid-binding protein bound to cholic and oleic acid.

    Science.gov (United States)

    Capaldi, Stefano; Guariento, Mara; Perduca, Massimiliano; Di Pietro, Santiago M; Santomé, José A; Monaco, Hugo L

    2006-07-01

    The family of the liver bile acid-binding proteins (L-BABPs), formerly called liver basic fatty acid-binding proteins (Lb-FABPs) shares fold and sequence similarity with the paralogous liver fatty acid-binding proteins (L-FABPs) but has a different stoichiometry and specificity of ligand binding. This article describes the first X-ray structure of a member of the L-BABP family, axolotl (Ambystoma mexicanum) L-BABP, bound to two different ligands: cholic and oleic acid. The protein binds one molecule of oleic acid in a position that is significantly different from that of either of the two molecules that bind to rat liver FABP. The stoichiometry of binding of cholate is of two ligands per protein molecule, as observed in chicken L-BABP. The cholate molecule that binds buried most deeply into the internal cavity overlaps well with the analogous bound to chicken L-BABP, whereas the second molecule, which interacts with the first only through hydrophobic contacts, is more external and exposed to the solvent. (c) 2006 Wiley-Liss, Inc.

  10. Nucleic Acids as Information Molecules.

    Science.gov (United States)

    McInerney, Joseph D.

    1996-01-01

    Presents an activity that aims at enabling students to recognize that DNA and RNA are information molecules whose function is to store, copy, and make available the information in biological systems, without feeling overwhelmed by the specialized vocabulary and the minutia of the central dogma. (JRH)

  11. Small Molecule PET-Radiopharmaceuticals

    NARCIS (Netherlands)

    Elsinga, Philip H.; Dierckx, Rudi A. J. O.

    This review describes several aspects required for the development of small molecule PET-tracers. Design and selection criteria are important to consider before starting to develop novel PET-tracers. Principles and latest trends in C-11 and F-18-radiochemistry are summarized. In addition an update

  12. Hybrid molecule/superconductor assemblies

    International Nuclear Information System (INIS)

    McDevitt, J.T.; Haupt, S.G.; Riley, D.R.; Zhao, J.; Zhou, J.P., Jones, C.

    1993-01-01

    The fabrication of electronic devices from molecular materials has attracted much attention recently. Schottky diodes, molecular transistors, metal-insulator-semiconductor diodes, MIS field effect transistors and light emitting diodes have all been prepared utilizing such substances. The active elements in these devices have been constructed by depositing the molecular phase onto the surface of a metal, semiconductor or insulating substrate. With the recent discovery of high temperature superconductivity, new opportunities now exist for the study of molecule/superconductor interactions as well as for the construction of novel hybrid molecule/superconductor devices. In this paper, methods for preparing the initial two composite molecule/semiconductor devices will be reported. Consequently, light sensors based on dye-coated superconductor junctions as well as molecular switches fashioned from conductive polymer coated superconductor junctions as well as molecular switches fashioned from conductive polymer coated superconductor microbridges will be discussed. Moreover, molecule/superconductor energy and electron transfer phenomena will be illustrated also for the first time

  13. Mass spectrometry of large molecules

    International Nuclear Information System (INIS)

    Facchetti, S.

    1985-01-01

    The lectures in this volume were given at a course on mass spectrometry of large molecules, organized within the framework of the Training and Education programme of the Joint Research Centre of the European Communities. Although first presented in 1983, most of the lectures have since been updated by their authors. (orig.)

  14. WHAT ARE THE MOLECULES DOING?

    African Journals Online (AJOL)

    Temechegn

    University of the Witwatersrand, Johannesburg, South Africa ... [African Journal of Chemical Education—AJCE 6(2), July 2016] ... understand science concepts: in essence these are macroscopic (phenomena), microscopic .... than the simple freeing up of already-existing smaller molecules: this implies a high melting point.

  15. Fascinating Organic Molecules from Nature

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 18; Issue 5. Fascinating Organic Molecules from Nature - Using a Natural ... Road Banashankari 2nd Stage Bangalore 560 070, India. Department of Chemistry Sri Sathya Sai Institute of Higher Learning Brindavan Campus Bangalore 560 067, India.

  16. Fascinating Organic Molecules from Nature

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 18; Issue 7. Fascinating Organic Molecules from Nature - Sweet Stimulants of ... Road Banashankari 2nd Stage Bangalore 560 070, India. Department of Chemistry Sri Sathya Sai Institute of Higher Learning Brindavan Campus Bangalore 560 067, India.

  17. Multiphoton dissociation of polyatomic molecules

    International Nuclear Information System (INIS)

    Schulz, P.A.

    1979-10-01

    The dynamics of infrared multiphoton excitation and dissociation of SF 6 was investigated under collision free conditions by a crossed laser-molecular beam method. In order to understand the excitation mechanism and to elucidate the requirements of laser intensity and energy fluence, a series of experiments were carried out to measure the dissociation yield dependences on energy fluence, vibrational temperature of SF 6 , the pulse duration of the CO 2 laser and the frequency in both one and two laser experiments. Translational energy distributions of the SF 5 dissociation product measured by time of flight and angular distributions and the dissociation lifetime of excited SF 6 as inferred from the observation of secondary dissociation of SF 5 into SF 4 and F during the laser pulse suggest that the dynamics of dissociation of excited molecules is dominated by complete energy randomization and rapid intramolecular energy transfer on a nanosecond timescale, and can be adequately described by RRKM theory. An improved phenomenological model including the initial intensity dependent excitation, a rate equation describing the absorption and stimulated emission of single photons, and the unimolecular dissociation of excited molecules is constructed based on available experimental results. The model shows that the energy fluence of the laser determines the excitation of molecules in the quasi-continuum and the excess energy with which molecules dissociate after the laser pulse. The role played by the laser intensity in multiphoton dissociation is more significant than just that of overcoming the intensity dependent absorption in the lowest levels. 63 references

  18. Exact Monte Carlo for molecules

    International Nuclear Information System (INIS)

    Lester, W.A. Jr.; Reynolds, P.J.

    1985-03-01

    A brief summary of the fixed-node quantum Monte Carlo method is presented. Results obtained for binding energies, the classical barrier height for H + H 2 , and the singlet-triplet splitting in methylene are presented and discussed. 17 refs

  19. In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.

    Science.gov (United States)

    Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C

    2017-12-14

    Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  20. Functional consequences of piceatannol binding to glyceraldehyde-3-phosphate dehydrogenase.

    Science.gov (United States)

    Gerszon, Joanna; Serafin, Eligiusz; Buczkowski, Adam; Michlewska, Sylwia; Bielnicki, Jakub Antoni; Rodacka, Aleksandra

    2018-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is one of the key redox-sensitive proteins whose activity is largely affected by oxidative modifications at its highly reactive cysteine residue in the enzyme's active site (Cys149). Prolonged exposure to oxidative stress may cause, inter alia, the formation of intermolecular disulfide bonds leading to accumulation of GAPDH aggregates and ultimately to cell death. Recently these anomalies have been linked with the pathogenesis of Alzheimer's disease. Novel evidences indicate that low molecular compounds may be effective inhibitors potentially preventing the GAPDH translocation to the nucleus, and inhibiting or slowing down its aggregation and oligomerization. Therefore, we decided to establish the ability of naturally occurring compound, piceatannol, to interact with GAPDH and to reveal its effect on functional properties and selected parameters of the dehydrogenase structure. The obtained data revealed that piceatannol binds to GAPDH. The ITC analysis indicated that one molecule of the tetrameric enzyme may bind up to 8 molecules of polyphenol (7.3 ± 0.9). Potential binding sites of piceatannol to the GAPDH molecule were analyzed using the Ligand Fit algorithm. Conducted analysis detected 11 ligand binding positions. We indicated that piceatannol decreases GAPDH activity. Detailed analysis allowed us to presume that this effect is due to piceatannol ability to assemble a covalent binding with nucleophilic cysteine residue (Cys149) which is directly involved in the catalytic reaction. Consequently, our studies strongly indicate that piceatannol would be an exceptional inhibitor thanks to its ability to break the aforementioned pathologic disulfide linkage, and therefore to inhibit GAPDH aggregation. We demonstrated that by binding with GAPDH piceatannol blocks cysteine residue and counteracts its oxidative modifications, that induce oligomerization and GAPDH aggregation.

  1. Functional consequences of piceatannol binding to glyceraldehyde-3-phosphate dehydrogenase.

    Directory of Open Access Journals (Sweden)

    Joanna Gerszon

    Full Text Available Glyceraldehyde-3-phosphate dehydrogenase (GAPDH is one of the key redox-sensitive proteins whose activity is largely affected by oxidative modifications at its highly reactive cysteine residue in the enzyme's active site (Cys149. Prolonged exposure to oxidative stress may cause, inter alia, the formation of intermolecular disulfide bonds leading to accumulation of GAPDH aggregates and ultimately to cell death. Recently these anomalies have been linked with the pathogenesis of Alzheimer's disease. Novel evidences indicate that low molecular compounds may be effective inhibitors potentially preventing the GAPDH translocation to the nucleus, and inhibiting or slowing down its aggregation and oligomerization. Therefore, we decided to establish the ability of naturally occurring compound, piceatannol, to interact with GAPDH and to reveal its effect on functional properties and selected parameters of the dehydrogenase structure. The obtained data revealed that piceatannol binds to GAPDH. The ITC analysis indicated that one molecule of the tetrameric enzyme may bind up to 8 molecules of polyphenol (7.3 ± 0.9. Potential binding sites of piceatannol to the GAPDH molecule were analyzed using the Ligand Fit algorithm. Conducted analysis detected 11 ligand binding positions. We indicated that piceatannol decreases GAPDH activity. Detailed analysis allowed us to presume that this effect is due to piceatannol ability to assemble a covalent binding with nucleophilic cysteine residue (Cys149 which is directly involved in the catalytic reaction. Consequently, our studies strongly indicate that piceatannol would be an exceptional inhibitor thanks to its ability to break the aforementioned pathologic disulfide linkage, and therefore to inhibit GAPDH aggregation. We demonstrated that by binding with GAPDH piceatannol blocks cysteine residue and counteracts its oxidative modifications, that induce oligomerization and GAPDH aggregation.

  2. Identifying Interactions that Determine Fragment Binding at Protein Hotspots.

    Science.gov (United States)

    Radoux, Chris J; Olsson, Tjelvar S G; Pitt, Will R; Groom, Colin R; Blundell, Tom L

    2016-05-12

    Locating a ligand-binding site is an important first step in structure-guided drug discovery, but current methods do little to suggest which interactions within a pocket are the most important for binding. Here we illustrate a method that samples atomic hotspots with simple molecular probes to produce fragment hotspot maps. These maps specifically highlight fragment-binding sites and their corresponding pharmacophores. For ligand-bound structures, they provide an intuitive visual guide within the binding site, directing medicinal chemists where to grow the molecule and alerting them to suboptimal interactions within the original hit. The fragment hotspot map calculation is validated using experimental binding positions of 21 fragments and subsequent lead molecules. The ligands are found in high scoring areas of the fragment hotspot maps, with fragment atoms having a median percentage rank of 97%. Protein kinase B and pantothenate synthetase are examined in detail. In each case, the fragment hotspot maps are able to rationalize a Free-Wilson analysis of SAR data from a fragment-based drug design project.

  3. Bovine Chymosin: A Computational Study of Recognition and Binding of Bovine κ-Casein

    DEFF Research Database (Denmark)

    Palmer, David S.; Christensen, Anders Uhrenholt; Sørensen, Jesper

    2010-01-01

    search algorithms, and molecular dynamics simulations. In agreement with limited experimental evidence, the model suggests that the substrate binds in an extended conformation with charged residues on either side of the scissile bond playing an important role in stabilizing the binding pose. Lys111......) is found to be important for stabilizing the binding pose. The catalytic site (including the catalytic water molecule) is stable in the starting conformation of the previously proposed general acid/base catalytic mechanism for 18 ns of molecular dynamics simulations...... and Lys112 are observed to bind to the N-terminal domain of chymosin displacing a conserved water molecule. A cluster of histidine and proline residues (His98-Pro99-His100-Pro101-His102) in κ-casein binds to the C-terminal domain of the protein, where a neighboring conserved arginine residue (Arg97...

  4. Further biochemical characterization of Mycobacterium leprae laminin-binding proteins

    Directory of Open Access Journals (Sweden)

    M.A.M. Marques

    2001-04-01

    Full Text Available It has been demonstrated that the alpha2 chain of laminin-2 present on the surface of Schwann cells is involved in the process of attachment of Mycobacterium leprae to these cells. Searching for M. leprae laminin-binding molecules, in a previous study we isolated and characterized the cationic proteins histone-like protein (Hlp and ribosomal proteins S4 and S5 as potential adhesins involved in M. leprae-Schwann cell interaction. Hlp was shown to bind alpha2-laminins and to greatly enhance the attachment of mycobacteria to ST88-14 Schwann cells. In the present study, we investigated the laminin-binding capacity of the ribosomal proteins S4 and S5. The genes coding for these proteins were PCR amplified and their recombinant products were shown to bind alpha2-laminins in overlay assays. However, when tested in ELISA-based assays and in adhesion assays with ST88-14 cells, in contrast to Hlp, S4 and S5 failed to bind laminin and act as adhesins. The laminin-binding property and adhesin capacity of two basic host-derived proteins were also tested, and only histones, but not cytochrome c, were able to increase bacterial attachment to ST88-14 cells. Our data suggest that the alanine/lysine-rich sequences shared by Hlp and eukaryotic H1 histones might be involved in the binding of these cationic proteins to laminin.

  5. In vitro DNA binding studies of Aspartame, an artificial sweetener.

    Science.gov (United States)

    Kashanian, Soheila; Khodaei, Mohammad Mehdi; Kheirdoosh, Fahimeh

    2013-03-05

    A number of small molecules bind directly and selectively to DNA, by inhibiting replication, transcription or topoisomerase activity. In this work the interaction of native calf thymus DNA (CT-DNA) with Aspartame (APM), an artificial sweeteners was studied at physiological pH. DNA binding study of APM is useful to understand APM-DNA interaction mechanism and to provide guidance for the application and design of new and safer artificial sweeteners. The interaction was investigated using spectrophotometric, spectrofluorometric competition experiment and circular dichroism (CD). Hypochromism and red shift are shown in UV absorption band of APM. A strong fluorescence quenching reaction of DNA to APM was observed and the binding constants (Kf) of DNA with APM and corresponding number of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy changes (ΔH) and entropy changes (ΔS) were calculated to be +181kJmol(-1) and +681Jmol(-1)K(-1) according to Van't Hoff equation, which indicated that reaction is predominantly entropically driven. Moreover, spectrofluorometric competition experiment and circular dichroism (CD) results are indicative of non-intercalative DNA binding nature of APM. We suggest that APM interacts with calf thymus DNA via groove binding mode with an intrinsic binding constant of 5×10(+4)M(-1). Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Isotope separation using vibrationally excited molecules

    International Nuclear Information System (INIS)

    Woodroffe, J.A.; Keck, J.C.

    1979-01-01

    Vibrational excitation of molecules having components of a selected isotope type is used to produce a conversion from vibrational to translational excitation of the molecules by collision with the molecules of a heavy carrier gas. The resulting difference in translaton between the molecules of the selected isotope type and all other molecules of the same compound permits their separate collection. When applied to uranium enrichment, a subsonic cryogenic flow of molecules of uranium hexafluoride in combination with an argon carrier gas is directed through a cooled chamber that is illuminated by laser radiaton tuned to vibrationally excite the uranium hexafluoride molecules of a specific uranium isotope. The excited molecules collide with carrier gas molecules, causing a conversion of the excitation energy into a translation of the excited molecule, which results in a higher thermal energy or diffusivity than that of the other uranium hexafluoride molecules. The flowing molecules including the excited molecules directly enter a set of cryogenically cooled channels. The higher thermal velocity of the excited molecules increases the probability of their striking a collector surface. The molecules which strike this surface immediately condense. After a predetermined thickness of molecules is collected on the surface, the flow of uranium hexafluoride is interrupted and the chamber heated to the point of vaporization of the collected hexafluoride, permitting its removal. (LL)

  7. The productive cellulase binding capacity of cellulosic substrates.

    Science.gov (United States)

    Karuna, Nardrapee; Jeoh, Tina

    2017-03-01

    Cellulosic biomass is the most promising feedstock for renewable biofuel production; however, the mechanisms of the heterogeneous cellulose saccharification reaction are still unsolved. As cellulases need to bind isolated molecules of cellulose at the surface of insoluble cellulose fibrils or larger aggregated cellulose structures in order to hydrolyze glycosidic bonds, the "accessibility of cellulose to cellulases" is considered to be a reaction limiting property of cellulose. We have defined the accessibility of cellulose to cellulases as the productive binding capacity of cellulose, that is, the concentration of productive binding sites on cellulose that are accessible for binding and hydrolysis by cellulases. Productive cellulase binding to cellulose results in hydrolysis and can be quantified by measuring hydrolysis rates. In this study, we measured the productive Trichoderma reesei Cel7A (TrCel7A) binding capacity of five cellulosic substrates from different sources and processing histories. Swollen filter paper and bacterial cellulose had higher productive binding capacities of ∼6 µmol/g while filter paper, microcrystalline cellulose, and algal cellulose had lower productive binding capacities of ∼3 µmol/g. Swelling and regenerating filter paper using phosphoric acid increased the initial accessibility of the reducing ends to TrCel7A from 4 to 6 µmol/g. Moreover, this increase in initial productive binding capacity accounted in large part for the difference in the overall digestibility between filter paper and swollen filter paper. We further demonstrated that an understanding of how the productive binding capacity declines over the course of the hydrolysis reaction has the potential to predict overall saccharification time courses. Biotechnol. Bioeng. 2017;114: 533-542. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. Broad spectrum pro-quorum-sensing molecules as inhibitors of virulence in vibrios.

    Directory of Open Access Journals (Sweden)

    Wai-Leung Ng

    Full Text Available Quorum sensing (QS is a bacterial cell-cell communication process that relies on the production and detection of extracellular signal molecules called autoinducers. QS allows bacteria to perform collective activities. Vibrio cholerae, a pathogen that causes an acute disease, uses QS to repress virulence factor production and biofilm formation. Thus, molecules that activate QS in V. cholerae have the potential to control pathogenicity in this globally important bacterium. Using a whole-cell high-throughput screen, we identified eleven molecules that activate V. cholerae QS: eight molecules are receptor agonists and three molecules are antagonists of LuxO, the central NtrC-type response regulator that controls the global V. cholerae QS cascade. The LuxO inhibitors act by an uncompetitive mechanism by binding to the pre-formed LuxO-ATP complex to inhibit ATP hydrolysis. Genetic analyses suggest that the inhibitors bind in close proximity to the Walker B motif. The inhibitors display broad-spectrum capability in activation of QS in Vibrio species that employ LuxO. To the best of our knowledge, these are the first molecules identified that inhibit the ATPase activity of a NtrC-type response regulator. Our discovery supports the idea that exploiting pro-QS molecules is a promising strategy for the development of novel anti-infectives.

  9. A study of planar anchor groups for graphene-based single-molecule electronics.

    Science.gov (United States)

    Bailey, Steven; Visontai, David; Lambert, Colin J; Bryce, Martin R; Frampton, Harry; Chappell, David

    2014-02-07

    To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for -OH and -CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

  10. A study of planar anchor groups for graphene-based single-molecule electronics

    Energy Technology Data Exchange (ETDEWEB)

    Bailey, Steven; Visontai, David; Lambert, Colin J., E-mail: c.lambert@lancaster.ac.uk [Department of Physics, Lancaster University, Lancaster LA1 4YB (United Kingdom); Bryce, Martin R. [Department of Chemistry, Durham University, Durham DH1 3LE (United Kingdom); Frampton, Harry; Chappell, David [BP Exploration Operating Company Limited, Chertsey Road, Sunbury on Thames, Middlesex TW16 7BP (United Kingdom)

    2014-02-07

    To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for –OH and –CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

  11. A study of planar anchor groups for graphene-based single-molecule electronics

    Science.gov (United States)

    Bailey, Steven; Visontai, David; Lambert, Colin J.; Bryce, Martin R.; Frampton, Harry; Chappell, David

    2014-02-01

    To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for -OH and -CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

  12. A study of planar anchor groups for graphene-based single-molecule electronics

    International Nuclear Information System (INIS)

    Bailey, Steven; Visontai, David; Lambert, Colin J.; Bryce, Martin R.; Frampton, Harry; Chappell, David

    2014-01-01

    To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for –OH and –CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains

  13. Data of conformation changes by some binding - ConfC | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available pair which ID% (sequence identity) is more than 99%, and Dmax (maximum distance between Cα atoms of superimp... molecular type confName Name of binding molecules dmax Maximum distance between Cα atoms of superimposed pr

  14. Preparation of translationally cold neutral molecules.

    Science.gov (United States)

    Di Domenicantonio, Giulia; Bertsche, Benjamin; Osterwalder, Andreas

    2011-01-01

    Efforts at EPFL to obtain translationally cold neutral molecules are described. Active deceleration of polar molecules is performed by confining the molecules in moving three-dimensional electrostatic traps, and by appropriately choosing the velocity of those traps. Alternatively, cold molecules can be obtained by velocity filtering. Here, the velocity of the molecules is not changed, but instead the cold molecules are extracted from a thermal sample by using the competition between the electrostatic force and the centrifugal force inside a bent electrostatic guide for polar molecules.

  15. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  16. Small molecule inhibitors of bromodomain-acetyl-lysine interactions.

    Science.gov (United States)

    Brand, Michael; Measures, Angelina R; Measures, Angelina M; Wilson, Brian G; Cortopassi, Wilian A; Alexander, Rikki; Höss, Matthias; Hewings, David S; Rooney, Timothy P C; Paton, Robert S; Conway, Stuart J

    2015-01-16

    Bromodomains are protein modules that bind to acetylated lysine residues. Their interaction with histone proteins suggests that they function as "readers" of histone lysine acetylation, a component of the proposed "histone code". Bromodomain-containing proteins are often found as components of larger protein complexes with roles in fundamental cellular process including transcription. The publication of two potent ligands for the BET bromodomains in 2010 demonstrated that small molecules can inhibit the bromodomain-acetyl-lysine protein-protein interaction. These molecules display strong phenotypic effects in a number of cell lines and affect a range of cancers in vivo. This work stimulated intense interest in developing further ligands for the BET bromodomains and the design of ligands for non-BET bromodomains. Here we review the recent progress in the field with particular attention paid to ligand design, the assays employed in early ligand discovery, and the use of computational approaches to inform ligand design.

  17. Small-molecule modulators of PXR and CAR

    Science.gov (United States)

    Chai, Sergio C.; Cherian, Milu T.; Wang, Yue-Ming; Chen, Taosheng

    2016-01-01

    Two nuclear receptors, the pregnane X receptor (PXR) and the constitutive androstane receptor (CAR), participate in the xenobiotic detoxification system by regulating the expression of drug-metabolizing enzymes and transporters in order to degrade and excrete foreign chemicals or endogenous metabolites. This review aims to expand the perceived relevance of PXR and CAR beyond their established role as master xenosensors to disease-oriented areas, emphasizing their modulation by small molecules. Structural studies of these receptors have provided much-needed insight into the nature of their binding promiscuity and the important elements that lead to ligand binding. Reports of species- and isoform-selective activation highlight the need for further scrutiny when extrapolating from animal data to humans, as animal models are at the forefront of early drug discovery. PMID:26921498

  18. Analysis of DNA interactions using single-molecule force spectroscopy.

    Science.gov (United States)

    Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

    2013-06-01

    Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

  19. Structural Changes of Creatine Kinase upon Substrate Binding

    OpenAIRE

    Forstner, Michael; Kriechbaum, Manfred; Laggner, Peter; Wallimann, Theo

    1998-01-01

    Small-angle x-ray scattering was used to investigate structural changes upon binding of individual substrates or a transition state analog complex (TSAC; Mg-ADP, creatine, and KNO3) to creatine kinase (CK) isoenzymes (dimeric muscle-type (M)-CK and octameric mitochondrial (Mi)-CK) and monomeric arginine kinase (AK). Considerable changes in the shape and the size of the molecules occurred upon binding of Mg-nucleotide or TSAC. The radius of gyration of Mi-CK was reduced from 55.6 A (free enzym...

  20. Hydrophilicity and Microsolvation of an Organic Molecule Resolved on the Sub-molecular Level by Scanning Tunneling Microscopy.

    Science.gov (United States)

    Lucht, Karsten; Loose, Dirk; Ruschmeier, Maximilian; Strotkötter, Valerie; Dyker, Gerald; Morgenstern, Karina

    2018-01-26

    Low-temperature scanning tunneling microscopy was used to follow the formation of a solvation shell around an adsorbed functionalized azo dye from the attachment of the first water molecule to a fully solvated molecule. Specific functional groups bind initially one water molecule each, which act as anchor points for additional water molecules. Further water attachment occurs in areas close to these functional groups even when the functional groups themselves are already saturated. In contrast, water molecules surround the hydrophobic parts of the molecule only when the two-dimensional solvation shell closes around them. This study thus traces hydrophilic and hydrophobic properties of an organic molecule down to a sub-molecular length scale. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Development of novel small molecules for imaging and drug release

    Science.gov (United States)

    Cao, Yanting

    Small organic molecules, including small molecule based fluorescent probes, small molecule based drugs or prodrugs, and smart multifunctional fluorescent drug delivery systems play important roles in biological research, drug discovery, and clinical practices. Despite the significant progress made in these fields, the development of novel and diverse small molecules is needed to meet various demands for research and clinical applications. My Ph.D study focuses on the development of novel functional molecules for recognition, imaging and drug release. In the first part, a turn-on fluorescent probe is developed for the detection of intracellular adenosine-5'-triphosphate (ATP) levels based on multiplexing recognitions. Considering the unique and complicated structure of ATP molecules, a fluorescent probe has been implemented with improved sensitivity and selectivity due to two synergistic binding recognitions by incorporating of 2, 2'-dipicolylamine (Dpa)-Zn(II) for targeting of phospho anions and phenylboronic acid group for cis-diol moiety. The novel probe is able to detect intracellular ATP levels in SH-SY5Y cells. Meanwhile, the advantages of multiplexing recognition design concept have been demonstrated using two control molecules. In the second part, a prodrug system is developed to deliver multiple drugs within one small molecule entity. The prodrug is designed by using 1-(2-nitrophenyl)ethyl (NPE) as phototrigger, and biphenol biquaternary ammonium as the prodrug. With controlled photo activation, both DNA cross-linking agents mechlorethamine and o-quinone methide are delivered and released at the preferred site, leading to efficient DNA cross-links formation and cell death. The prodrug shows negligible cytotoxicity towards normal skin cells (Hekn cells) with and without UV activation, but displays potent activity towards cancer cells (HeLa cells) upon UV activation. The multiple drug release system may hold a great potential for practical application. In the

  2. STICKING OF MOLECULES ON NONPOROUS AMORPHOUS WATER ICE

    Energy Technology Data Exchange (ETDEWEB)

    He, Jiao; Vidali, Gianfranco [Physics Department, Syracuse University, Syracuse, NY 13244 (United States); Acharyya, Kinsuk, E-mail: gvidali@syr.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States)

    2016-05-20

    Accurate modeling of physical and chemical processes in the interstellar medium (ISM) requires detailed knowledge of how atoms and molecules adsorb on dust grains. However, the sticking coefficient, a number between 0 and 1 that measures the first step in the interaction of a particle with a surface, is usually assumed in simulations of ISM environments to be either 0.5 or 1. Here we report on the determination of the sticking coefficient of H{sub 2}, D{sub 2}, N{sub 2}, O{sub 2}, CO, CH{sub 4}, and CO{sub 2} on nonporous amorphous solid water. The sticking coefficient was measured over a wide range of surface temperatures using a highly collimated molecular beam. We showed that the standard way of measuring the sticking coefficient—the King–Wells method—leads to the underestimation of trapping events in which there is incomplete energy accommodation of the molecule on the surface. Surface scattering experiments with the use of a pulsed molecular beam are used instead to measure the sticking coefficient. Based on the values of the measured sticking coefficient, we suggest a useful general formula of the sticking coefficient as a function of grain temperature and molecule-surface binding energy. We use this formula in a simulation of ISM gas–grain chemistry to find the effect of sticking on the abundance of key molecules both on grains and in the gas phase.

  3. High-order above-threshold dissociation of molecules

    Science.gov (United States)

    Lu, Peifen; Wang, Junping; Li, Hui; Lin, Kang; Gong, Xiaochun; Song, Qiying; Ji, Qinying; Zhang, Wenbin; Ma, Junyang; Li, Hanxiao; Zeng, Heping; He, Feng; Wu, Jian

    2018-03-01

    Electrons bound to atoms or molecules can simultaneously absorb multiple photons via the above-threshold ionization featured with discrete peaks in the photoelectron spectrum on account of the quantized nature of the light energy. Analogously, the above-threshold dissociation of molecules has been proposed to address the multiple-photon energy deposition in the nuclei of molecules. In this case, nuclear energy spectra consisting of photon-energy spaced peaks exceeding the binding energy of the molecular bond are predicted. Although the observation of such phenomena is difficult, this scenario is nevertheless logical and is based on the fundamental laws. Here, we report conclusive experimental observation of high-order above-threshold dissociation of H2 in strong laser fields where the tunneling-ionized electron transfers the absorbed multiphoton energy, which is above the ionization threshold to the nuclei via the field-driven inelastic rescattering. Our results provide an unambiguous evidence that the electron and nuclei of a molecule as a whole absorb multiple photons, and thus above-threshold ionization and above-threshold dissociation must appear simultaneously, which is the cornerstone of the nowadays strong-field molecular physics.

  4. MicroRNA and Cancer: Tiny Molecules with Major Implications

    OpenAIRE

    VandenBoom II, Timothy G; Li, Yiwei; Philip, Philip A; Sarkar, Fazlul H

    2008-01-01

    Cancer is currently a major public health problem and, as such, emerging research is making significant progress in identifying major players in its biology. One recent topic of interest involves microRNAs (miRNAs) which are small, non-coding RNA molecules that inhibit gene expression post-transcriptionally. They accomplish this by binding to the 3? untranslated region (3?UTR) of target messengerRNA (mRNA), resulting in either their degradation or inhibition of translation, depending on the d...

  5. Interaction between a "processed" ovalbumin peptide and Ia molecules

    DEFF Research Database (Denmark)

    Buus, S; Colon, S; Smith, C

    1986-01-01

    The binding of 125I-labeled immunogenic peptides to purified Ia molecules in detergent solution was examined by equilibrium dialysis. We used the chicken ovalbumin peptide ovalbumin-(323-339)-Tyr, which is immunogenic in the BALB/c mouse and restricted to I-Ad. 125I-labeled ovalbumin-(323-339)-Tyr......-Ak but not to I-Ek, I-Ad, or I-Ed. Thus, a specific interaction between Ia and antigen that correlates with the major histocompatibility complex restriction was demonstrated, strongly arguing in favor of a determinant selection hypothesis for such restriction....

  6. Discovery and characterization of small molecule Rac1 inhibitors.

    Science.gov (United States)

    Arnst, Jamie L; Hein, Ashley L; Taylor, Margaret A; Palermo, Nick Y; Contreras, Jacob I; Sonawane, Yogesh A; Wahl, Andrew O; Ouellette, Michel M; Natarajan, Amarnath; Yan, Ying

    2017-05-23

    Aberrant activation of Rho GTPase Rac1 has been observed in various tumor types, including pancreatic cancer. Rac1 activates multiple signaling pathways that lead to uncontrolled proliferation, invasion and metastasis. Thus, inhibition of Rac1 activity is a viable therapeutic strategy for proliferative disorders such as cancer. Here we identified small molecule inhibitors that target the nucleotide-binding site of Rac1 through in silico screening. Follow up in vitro studies demonstrated that two compounds blocked active Rac1 from binding to its effector PAK1. Fluorescence polarization studies indicate that these compounds target the nucleotide-binding site of Rac1. In cells, both compounds blocked Rac1 binding to its effector PAK1 following EGF-induced Rac1 activation in a dose-dependent manner, while showing no inhibition of the closely related Cdc42 and RhoA activity. Furthermore, functional studies indicate that both compounds reduced cell proliferation and migration in a dose-dependent manner in multiple pancreatic cancer cell lines. Additionally, the two compounds suppressed the clonogenic survival of pancreatic cancer cells, while they had no effect on the survival of normal pancreatic ductal cells. These compounds do not share the core structure of the known Rac1 inhibitors and could serve as additional lead compounds to target pancreatic cancers with high Rac1 activity.

  7. Evaluating the binding efficiency of pheromone binding protein with its natural ligand using molecular docking and fluorescence analysis

    Science.gov (United States)

    Ilayaraja, Renganathan; Rajkumar, Ramalingam; Rajesh, Durairaj; Muralidharan, Arumugam Ramachandran; Padmanabhan, Parasuraman; Archunan, Govindaraju

    2014-06-01

    Chemosignals play a crucial role in social and sexual communication among inter- and intra-species. Chemical cues are bound with protein that is present in the pheromones irrespective of sex are commonly called as pheromone binding protein (PBP). In rats, the pheromone compounds are bound with low molecular lipocalin protein α2u-globulin (α2u). We reported farnesol is a natural endogenous ligand (compound) present in rat preputial gland as a bound volatile compound. In the present study, an attempt has been made through computational method to evaluating the binding efficiency of α2u with the natural ligand (farnesol) and standard fluorescent molecule (2-naphthol). The docking analysis revealed that the binding energy of farnesol and 2-naphthol was almost equal and likely to share some binding pocket of protein. Further, to extrapolate the results generated through computational approach, the α2u protein was purified and subjected to fluorescence titration and binding assay. The results showed that the farnesol is replaced by 2-naphthol with high hydrophobicity of TYR120 in binding sites of α2u providing an acceptable dissociation constant indicating the binding efficiency of α2u. The obtained results are in corroboration with the data made through computational approach.

  8. A sequence-based dynamic ensemble learning system for protein ligand-binding site prediction

    KAUST Repository

    Chen, Peng

    2015-12-03

    Background: Proteins have the fundamental ability to selectively bind to other molecules and perform specific functions through such interactions, such as protein-ligand binding. Accurate prediction of protein residues that physically bind to ligands is important for drug design and protein docking studies. Most of the successful protein-ligand binding predictions were based on known structures. However, structural information is not largely available in practice due to the huge gap between the number of known protein sequences and that of experimentally solved structures

  9. A sequence-based dynamic ensemble learning system for protein ligand-binding site prediction

    KAUST Repository

    Chen, Peng; Hu, ShanShan; Zhang, Jun; Gao, Xin; Li, Jinyan; Xia, Junfeng; Wang, Bing

    2015-01-01

    Background: Proteins have the fundamental ability to selectively bind to other molecules and perform specific functions through such interactions, such as protein-ligand binding. Accurate prediction of protein residues that physically bind to ligands is important for drug design and protein docking studies. Most of the successful protein-ligand binding predictions were based on known structures. However, structural information is not largely available in practice due to the huge gap between the number of known protein sequences and that of experimentally solved structures

  10. Mu receptor binding of some commonly used opioids and their metabolites

    International Nuclear Information System (INIS)

    Chen, Zhaorong; Irvine, R.J.; Somogyi, A.A.; Bochner, F.

    1991-01-01

    The binding affinity to the μ receptor of some opioids chemically related to morphine and some of their metabolites was examined in rat brain homogenates with 3 H-DAMGO. The chemical group at position 6 of the molecule had little effect on binding. Decreasing the length of the alkyl group at position 3 decreased the K i values (morphine < codeine < ethylmorphine < pholcodine). Analgesics with high clinical potency containing a methoxyl group at position 3 had relatively weak receptor binding, while their O-demethylated metabolites had much stronger binding. Many opioids may exert their pharmacological actions predominantly through metabolites

  11. Mu receptor binding of some commonly used opioids and their metabolites

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Zhaorong; Irvine, R.J. (Univ. of Adelaide (Australia)); Somogyi, A.A.; Bochner, F. (Univ. of Adelaide (Australia) Royal Adelaide Hospital (Australia))

    1991-01-01

    The binding affinity to the {mu} receptor of some opioids chemically related to morphine and some of their metabolites was examined in rat brain homogenates with {sup 3}H-DAMGO. The chemical group at position 6 of the molecule had little effect on binding. Decreasing the length of the alkyl group at position 3 decreased the K{sub i} values (morphine < codeine < ethylmorphine < pholcodine). Analgesics with high clinical potency containing a methoxyl group at position 3 had relatively weak receptor binding, while their O-demethylated metabolites had much stronger binding. Many opioids may exert their pharmacological actions predominantly through metabolites.

  12. Compact quantum dots for single-molecule imaging.

    Science.gov (United States)

    Smith, Andrew M; Nie, Shuming

    2012-10-09

    Single-molecule imaging is an important tool for understanding the mechanisms of biomolecular function and for visualizing the spatial and temporal heterogeneity of molecular behaviors that underlie cellular biology (1-4). To image an individual molecule of interest, it is typically conjugated to a fluorescent tag (dye, protein, bead, or quantum dot) and observed with epifluorescence or total internal reflection fluorescence (TIRF) microscopy. While dyes and fluorescent proteins have been the mainstay of fluorescence imaging for decades, their fluorescence is unstable under high photon fluxes necessary to observe individual molecules, yielding only a few seconds of observation before complete loss of signal. Latex beads and dye-labeled beads provide improved signal stability but at the expense of drastically larger hydrodynamic size, which can deleteriously alter the diffusion and behavior of the molecule under study. Quantum dots (QDs) offer a balance between these two problematic regimes. These nanoparticles are composed of semiconductor materials and can be engineered with a hydrodynamically compact size with exceptional resistance to photodegradation (5). Thus in recent years QDs have been instrumental in enabling long-term observation of complex macromolecular behavior on the single molecule level. However these particles have still been found to exhibit impaired diffusion in crowded molecular environments such as the cellular cytoplasm and the neuronal synaptic cleft, where their sizes are still too large (4,6,7). Recently we have engineered the cores and surface coatings of QDs for minimized hydrodynamic size, while balancing offsets to colloidal stability, photostability, brightness, and nonspecific binding that have hindered the utility of compact QDs in the past (8,9). The goal of this article is to demonstrate the synthesis, modification, and characterization of these optimized nanocrystals, composed of an alloyed HgxCd1-xSe core coated with an

  13. H19 RNA binds four molecules of insulin-like growth factor II mRNA-binding protein

    DEFF Research Database (Denmark)

    Runge, Steffen; Nielsen, Finn Cilius; Nielsen, Jacob

    2000-01-01

    H19 RNA is a major oncofetal 2.5-kilobase untranslated RNA of unknown function. The maternally expressed H19 gene is located 90 kilobase pairs downstream from the paternally expressed insulin-like growth factor II (IGF-II) gene on human chromosome 11 and mouse chromosome 7; and due to their recip......H19 RNA is a major oncofetal 2.5-kilobase untranslated RNA of unknown function. The maternally expressed H19 gene is located 90 kilobase pairs downstream from the paternally expressed insulin-like growth factor II (IGF-II) gene on human chromosome 11 and mouse chromosome 7; and due...

  14. Small-Molecule Compounds Exhibiting Target-Mediated Drug Disposition (TMDD): A Minireview.

    Science.gov (United States)

    An, Guohua

    2017-02-01

    Nonlinearities are commonplace in pharmacokinetics, and 1 special source is the saturable binding of the drug to a high-affinity, low-capacity target, a phenomenon known as target-mediated drug disposition (TMDD). Compared with large-molecule compounds undergoing TMDD, which has been well recognized due to its high prevalence, TMDD in small-molecule compounds is more counterintuitive and has not been well appreciated. With more and more potent small-molecule drugs acting on highly specific targets being developed as well as increasingly sensitive analytical techniques becoming available, many small-molecule compounds have recently been reported to have nonlinear pharmacokinetics imparted by TMDD. To expand our current knowledge of TMDD in small-molecule compounds and increase the awareness of this clinically important phenomenon, this minireview provides an overview of the small-molecule compounds that demonstrate nonlinear pharmacokinetics imparted by TMDD. The present review also summarizes the general features of TMDD in small-molecule compounds and highlights the differences between TMDD in small-molecule compounds and large-molecule compounds. © 2016, The American College of Clinical Pharmacology.

  15. Observing electron motion in molecules

    International Nuclear Information System (INIS)

    Chelkowski, S; Yudin, G L; Bandrauk, A D

    2006-01-01

    We study analytically the possibility for monitoring electron motion in a molecule using two ultrashort laser pulses. The first prepares a coherent superposition of two electronic molecular states whereas the second (attosecond pulse) photoionizes the molecule. We show that interesting information about electron dynamics can be obtained from measurement of the photoelectron spectra as a function of the time delay between two pulses. In particular, asymmetries in photoelectron angular distribution provide a simple signature of the electron motion within the initial time-dependent coherently coupled two molecular states. Both asymmetries and electron spectra show very strong two-centre interference patterns. We illustrate these effects using as an example a dissociating hydrogen molecular ion probed by the attosecond pulses

  16. Tunneling Ionization of Diatomic Molecules

    DEFF Research Database (Denmark)

    Svensmark, Jens Søren Sieg

    2016-01-01

    When a molecule is subject to a strong laser field, there is a probability that an electron can escape, even though the electrons are bound by a large potential barrier. This is possible because electrons are quantum mechanical in nature, and they are therefore able to tunnel through potential...... barriers, an ability classical particles do not possess. Tunnelling is a fundamental quantum mechanical process, a process that is distinctly non-classical, so solving this tunnelling problem is not only relevant for molecular physics, but also for quantum theory in general. In this dissertation the theory...... of tunneling ionizaion of molecules is presented and the results of numerical calculations are shown. One perhaps surprising result is, that the frequently used Born-Oppenheimer approximation breaks down for weak fields when describing tunneling ionization. An analytic theory applicable in the weak-field limit...

  17. Physics of atoms and molecules

    International Nuclear Information System (INIS)

    Bransden, B.H.; Joachain, C.J.

    1983-01-01

    This book presents a unified account of the physics of atoms and molecules at a level suitable for second- and third-year undergraduate students of physics and physical chemistry. Following a brief historical introduction to the subject the authors outline the ideas and approximation methods of quantum mechanics to be used later in the book. Six chapters look at the structure of atoms and the interactions between atoms and electromagnetic radiation. The authors then move on to describe the structure of molecules and molecular spectra. Three chapters deal with atomic collisions, the scattering of electrons by atoms and the scattering of atoms by atoms. The concluding chapter considers a few of the many important applications of atomic physics within astrophysics, laser technology, and nuclear fusion. Problems are given at the end of each chapter, with hints at the solutions in an appendix. Other appendices include various special topics and derivations together with useful tables of units. (author)

  18. Electronic Transport in Single Molecule Junctions: Control of the Molecule-Electrode Coupling Through Intramolecular Tunneling Barriers

    DEFF Research Database (Denmark)

    Danilov, Andrey; Kubatkin, Sergey; Kafanov, Sergey

    2008-01-01

    We report on single molecule electron transport measurements of two oligophenylenevinylene (OPV3) derivatives placed in a nanogap between gold (Au) or lead (Pb) electrodes in a field effect transistor device. Both derivatives contain thiol end groups that allow chemical binding to the electrodes....... One derivative has additional methylene groups separating the thiols from the delocalized -electron system. The insertion of methylene groups changes the open state conductance by 3-4 orders of magnitude and changes the transport mechanism from a coherent regime with finite zero-bias conductance...

  19. Electrondriven processes in polyatomic molecules

    Energy Technology Data Exchange (ETDEWEB)

    McKoy, Vincent [California Inst. of Technology (CalTech), Pasadena, CA (United States)

    2017-03-20

    This project developed and applied scalable computational methods to obtain information about low-energy electron collisions with larger polyatomic molecules. Such collisions are important in modeling radiation damage to living systems, in spark ignition and combustion, and in plasma processing of materials. The focus of the project was to develop efficient methods that could be used to obtain both fundamental scientific insights and data of practical value to applications.

  20. Intersystem crossing in complex molecules

    International Nuclear Information System (INIS)

    Pappalardo, R.G.

    1980-01-01

    The general question of singlet-triplet intersystem crossing is addressed in the context of large organic molecules, i.e., ''complex'' molecules capable of self-relaxation in the absence of collisions. Examples of spectral properties of such molecules in the vapor phase are discussed, relying on extensive Russian literature in this area. Formal expressions for the relaxation rate in the electronic excited states are derived on the basis of the formalism of collision theory, and are applied to the specific case of intersystem crossing. The derivation of the ''energy-gap'' law for triplet-singlet conversion in aromatic hydrocarbons is briefly outlined. The steep rise of internal conversion rates as a function of excess excitation energy, and its competition with the intersystem crossing process, are reviewed for the case of naphthalene vapor. A general expression for the spin-orbit interaction Hamiltonian in molecular systems is outlined. Experimental observations on singlet-triplet conversion rates and the factors that can drastically affect such rates are discussed, with emphasis on the ''in- ternal'' and ''external'' heavy-atom effects. Basic relations of ESR spectroscopy and magnetophotoselection are reviewed. Technological implications of the singlet-triplet crossing in complex molecules are discussed in the context of chelate lasers, dye lasers and luminescent displays. Effects related to singlet-triplet crossing, and generally to excited-state energy-transfer in biological systems, are exemplified by the role of aromatic amino-acids in the phosphorescence of proteins, by some recent studies of energy-transfer in models of biomembranes, and by the clustering of triplet-energy donor-acceptor pairs in micelles

  1. Cellular Adhesion and Adhesion Molecules

    OpenAIRE

    SELLER, Zerrin

    2014-01-01

    In recent years, cell adhesion and cell adhesion molecules have been shown to be important for many normal biological processes, including embryonic cell migration, immune system functions and wound healing. It has also been shown that they contribute to the pathogenesis of a large number of common human disorders, such as rheumatoid arthritis and tumor cell metastasis in cancer. In this review, the basic mechanisms of cellular adhesion and the structural and functional features of adhes...

  2. Electron interactions with polar molecules

    International Nuclear Information System (INIS)

    Garrett, W.R.

    1981-01-01

    A description is given of a number of the features of discrete and continuous spectra of electrons interacting with polar molecules. Attention is focused on the extent to which theoretical predictions concerning cross sections, resonances, and bound states are strongly influenced by the various approximations that are so ubiquitous in the treatment of such problems. Similarly, threshold scattering and photodetachment processes are examined for the case of weakly bound dipole states whose higher members overlap the continuum

  3. Is X(3872) a molecule?

    International Nuclear Information System (INIS)

    Thomas, C. E.; Close, F. E.

    2008-01-01

    We show that the literature on pion exchange between charm and bottom mesons is inconsistent. We derive the formalism explicitly, expose differences between papers in the literature, and clarify the implications. We show that the X(3872) can be a bound state but that results are very sensitive to a poorly constrained parameter. We confirm that bound states in the BB sector are possible. The circumstances whereby exotic combinations can bind with cc or bb quantum numbers are explored.

  4. Improved pan-specific MHC class I peptide-binding predictions using a novel representation of the MHC-binding cleft environment

    DEFF Research Database (Denmark)

    Carrasco Pro, S.; Zimic, M.; Nielsen, Morten

    2014-01-01

    of the current state-of-the-art methods for MHC class I is NetMHCpan, which has a core ingredient for the representation of the MHC class I molecule using a pseudo-sequence representation of the binding cleft amino acid environment. New and large MHC-peptide-binding data sets are constantly being made available...... of different MHC data sets including human leukocyte antigen (HLA), non-human primates (chimpanzee, macaque and gorilla) and other animal alleles (cattle, mouse and swine). From these constructs, we showed that by focusing on MHC sequence positions found to be polymorphic across the MHC molecules used to train...

  5. Structure and ligand-binding properties of the biogenic amine-binding protein from the saliva of a blood-feeding insect vector of Trypanosoma cruzi

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Xueqing; Chang, Bianca W. [NIH/NIAID, 12735 Twinbrook Parkway, Rockville, MD 20852 (United States); Mans, Ben J. [NIH/NIAID, 12735 Twinbrook Parkway, Rockville, MD 20852 (United States); Agricultural Research Council, Onderstepoort 0110 (South Africa); Ribeiro, Jose M. C.; Andersen, John F., E-mail: jandersen@niaid.nih.gov [NIH/NIAID, 12735 Twinbrook Parkway, Rockville, MD 20852 (United States)

    2013-01-01

    Biogenic amine-binding proteins mediate the anti-inflammatory and antihemostatic activities of blood-feeding insect saliva. The structure of the amine-binding protein from R. prolixus reveals the interaction of biogenic amine ligands with the protein. Proteins that bind small-molecule mediators of inflammation and hemostasis are essential for blood-feeding by arthropod vectors of infectious disease. In ticks and triatomine insects, the lipocalin protein family is greatly expanded and members have been shown to bind biogenic amines, eicosanoids and ADP. These compounds are potent mediators of platelet activation, inflammation and vascular tone. In this paper, the structure of the amine-binding protein (ABP) from Rhodnius prolixus, a vector of the trypanosome that causes Chagas disease, is described. ABP binds the biogenic amines serotonin and norepinephrine with high affinity. A complex with tryptamine shows the presence of a binding site for a single ligand molecule in the central cavity of the β-barrel structure. The cavity contains significant additional volume, suggesting that this protein may have evolved from the related nitrophorin proteins, which bind a much larger heme ligand in the central cavity.

  6. Structure and ligand-binding properties of the biogenic amine-binding protein from the saliva of a blood-feeding insect vector of Trypanosoma cruzi

    International Nuclear Information System (INIS)

    Xu, Xueqing; Chang, Bianca W.; Mans, Ben J.; Ribeiro, Jose M. C.; Andersen, John F.

    2013-01-01

    Biogenic amine-binding proteins mediate the anti-inflammatory and antihemostatic activities of blood-feeding insect saliva. The structure of the amine-binding protein from R. prolixus reveals the interaction of biogenic amine ligands with the protein. Proteins that bind small-molecule mediators of inflammation and hemostasis are essential for blood-feeding by arthropod vectors of infectious disease. In ticks and triatomine insects, the lipocalin protein family is greatly expanded and members have been shown to bind biogenic amines, eicosanoids and ADP. These compounds are potent mediators of platelet activation, inflammation and vascular tone. In this paper, the structure of the amine-binding protein (ABP) from Rhodnius prolixus, a vector of the trypanosome that causes Chagas disease, is described. ABP binds the biogenic amines serotonin and norepinephrine with high affinity. A complex with tryptamine shows the presence of a binding site for a single ligand molecule in the central cavity of the β-barrel structure. The cavity contains significant additional volume, suggesting that this protein may have evolved from the related nitrophorin proteins, which bind a much larger heme ligand in the central cavity

  7. A single-molecule diode

    Science.gov (United States)

    Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B.; Mayor, Marcel

    2005-01-01

    We have designed and synthesized a molecular rod that consists of two weakly coupled electronic π -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current–voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur–gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current–voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical π -systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current–voltage characteristics, similar to the phenomena in a semiconductor diode. PMID:15956208

  8. The largest molecules in space

    International Nuclear Information System (INIS)

    Greenberg, J.M.

    1983-01-01

    The bulk of complex molecules in the space between the stars is shown to be in the small frozen particles of interstellar dust. Each dust grain typically contains some 10 9 atoms of oxygen, carbon and nitrogen in an amorphous molecular mixture. As a result of chemical processing of the particles by ultraviolet photons over times spanning proportional10 8 -10 9 years a substantial portion of each dust grain is converted into complex organic molecules whose maximum molecular weight is limited only by the size of the grain. Laboratory studies of evolution of analog grain materials shows that molecular weights of the order of 500 are readily created and that there is an excellent probability of much more complex molecules being produced. The organic dust component constitutes about one tenth of a percent of the total mass of the Milky Way and far outweighs any estimates of the total mass of all the planets. A planet like the earth is continually accreting matter from space and there was a high probability that in the first five hundred million years after its crust formed it passed through several dark clouds and accreted from a hundred million to ten thousand million tonnes of the organic material of the interstellar dust during each passage. It is suggested that this rain of material could have provided the molecular templates for the origin of life. (orig.)

  9. Electric moments in molecule interferometry

    International Nuclear Information System (INIS)

    Eibenberger, Sandra; Gerlich, Stefan; Arndt, Markus; Tuexen, Jens; Mayor, Marcel

    2011-01-01

    We investigate the influence of different electric moments on the shift and dephasing of molecules in a matter wave interferometer. Firstly, we provide a quantitative comparison of two molecules that are non-polar yet polarizable in their thermal ground state and that differ in their stiffness and response to thermal excitations. While C 25 H 20 is rather rigid, its larger derivative C 49 H 16 F 52 is additionally equipped with floppy side chains and vibrationally activated dipole moment variations. Secondly, we elucidate the role of a permanent electric dipole momentby contrasting the quantum interference pattern of a (nearly) non-polar and a polar porphyrin derivative. We find that a high molecular polarizability and even sizeable dipole moment fluctuations are still well compatible with high-contrast quantum interference fringes. The presence of permanent electric dipole moments, however, can lead to a dephasing and rapid degradation of the quantum fringe pattern already at moderate electric fields. This finding is of high relevance for coherence experiments with large organic molecules, which are generally equipped with strong electric moments.

  10. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

    Science.gov (United States)

    Stigter, Dirk

    2004-07-01

    Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

  11. Identification and characterization of small molecule inhibitors of a PHD finger§

    Science.gov (United States)

    Wagner, Elise K.; Nath, Nidhi; Flemming, Rod; Feltenberger, John B.; Denu, John M.

    2012-01-01

    A number of histone-binding domains are implicated in cancer through improper binding of chromatin. In a clinically reported case of acute myeloid leukemia (AML), a genetic fusion protein between nucleoporin 98 and the third plant homeodomain (PHD) finger of JARID1A drives an oncogenic transcriptional program that is dependent on histone binding by the PHD finger. By exploiting the requirement for chromatin binding in oncogenesis, therapeutics targeting histone readers may represent a new paradigm in drug development. In this study, we developed a novel small molecule screening strategy that utilizes HaloTag technology to identify several small molecules that disrupt binding of the JARID1A PHD finger to histone peptides. Small molecule inhibitors were validated biochemically through affinity pull downs, fluorescence polarization, and histone reader specificity studies. One compound was modified through medicinal chemistry to improve its potency while retaining histone reader selectivity. Molecular modeling and site-directed mutagenesis of JARID1A PHD3 provided insights into the biochemical basis of competitive inhibition. PMID:22994852

  12. Where's water? The many binding sites of hydantoin.

    Science.gov (United States)

    Gruet, Sébastien; Pérez, Cristóbal; Steber, Amanda L; Schnell, Melanie

    2018-02-21

    Prebiotic hydantoin and its complexes with one and two water molecules are investigated using high-resolution broadband rotational spectroscopy in the 2-8 GHz frequency range. The hyperfine structure due to the nuclear quadrupole coupling of the two 14 N atoms is analysed for the monomer and the complexes. This characteristic hyperfine structure will support a definitive assignment from low frequency radioastronomy data. Experiments with H 2 18 O provide accurate experimental information on the preferred binding sites of water, which are compared with quantum-chemically calculated coordinates. In the 2-water complexes, the water molecules bind to hydantoin as a dimer instead of individually, indicating the strong water-water interactions. This information provides first insight on how hydantoin interacts with water on the molecular level.

  13. [Adenylate cyclase from rabbit heart: substrate binding site].

    Science.gov (United States)

    Perfil'eva, E A; Khropov, Iu V; Khachatrian, L; Bulargina, T V; Baranova, L A

    1981-08-01

    The effects of 17 ATP analogs on the solubilized rabbit heart adenylate cyclase were studied. The triphosphate chain, position 8 of the adenine base and the ribose residue of the ATP molecule were modified. Despite the presence of the alkylating groups in two former types of the analogs tested, no covalent blocking of the active site of the enzyme was observed. Most of the compounds appeared to be competitive reversible inhibitors. The kinetic data confirmed the importance of the triphosphate chain for substrate binding in the active site of adenylate cyclase. (Formula: See Text) The inhibitors with different substituents in position 8 of the adenine base had a low affinity for the enzyme. The possible orientation of the triphosphate chain and the advantages of anti-conformation of the ATP molecule for their binding in the active site of adenylate cyclase are discussed.

  14. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    Science.gov (United States)

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  15. Identification of potential small molecule allosteric modulator sites on IL-1R1 ectodomain using accelerated conformational sampling method.

    Directory of Open Access Journals (Sweden)

    Chao-Yie Yang

    Full Text Available The interleukin-1 receptor (IL-1R is the founding member of the interleukin 1 receptor family which activates innate immune response by its binding to cytokines. Reports showed dysregulation of cytokine production leads to aberrant immune cells activation which contributes to auto-inflammatory disorders and diseases. Current therapeutic strategies focus on utilizing antibodies or chimeric cytokine biologics. The large protein-protein interaction interface between cytokine receptor and cytokine poses a challenge in identifying binding sites for small molecule inhibitor development. Based on the significant conformational change of IL-1R type 1 (IL-1R1 ectodomain upon binding to different ligands observed in crystal structures, we hypothesized that transient small molecule binding sites may exist when IL-1R1 undergoes conformational transition and thus suitable for inhibitor development. Here, we employed accelerated molecular dynamics (MD simulation to efficiently sample conformational space of IL-1R1 ectodomain. Representative IL-1R1 ectodomain conformations determined from the hierarchy cluster analysis were analyzed by the SiteMap program which leads to identify small molecule binding sites at the protein-protein interaction interface and allosteric modulator locations. The cosolvent mapping analysis using phenol as the probe molecule further confirms the allosteric modulator site as a binding hotspot. Eight highest ranked fragment molecules identified from in silico screening at the modulator site were evaluated by MD simulations. Four of them restricted the IL-1R1 dynamical motion to inactive conformational space. The strategy from this study, subject to in vitro experimental validation, can be useful to identify small molecule compounds targeting the allosteric modulator sites of IL-1R and prevent IL-1R from binding to cytokine by trapping IL-1R in inactive conformations.

  16. Optical Binding of Nanowires

    Czech Academy of Sciences Publication Activity Database

    Simpson, Stephen Hugh; Zemánek, Pavel; Marago, O.M.; Jones, P.H.; Hanna, S.

    2017-01-01

    Roč. 17, č. 6 (2017), s. 3485-3492 ISSN 1530-6984 R&D Projects: GA ČR GB14-36681G Grant - others:AV ČR(CZ) CNR-16-12 Program:Bilaterální spolupráce Institutional support: RVO:68081731 Keywords : optical binding nanowires * Brownian motion * self-organization * non-equilibrium thermodynamics * non-equilibrium steady state * spin-orbit coupling * emergent phenomena Subject RIV: BH - Optics, Masers, Lasers OBOR OECD: Optics (including laser optics and quantum optics) Impact factor: 12.712, year: 2016

  17. The synthesis and host-guest applications of synthetic receptor molecules

    Science.gov (United States)

    Osner, Zachary R.

    2011-12-01

    Host-guest chemistry involves the complimentary binding between two molecules. Host molecules have been synthesized to bind negative, positive, and neutral molecules such as proteins and enzymes, and have been used as optical sensors, electrochemical sensors, supramolecular catalysts, and in the pharmaceutical industry as anti-cancer agents.1 The field of nanoscience has exploited guest-host interactions to create optical sensors with colloidal gold and Dip-Pen nanolithography technologies. Gold nanoparticles, have been functionalized with DNA, and have been developed as a selective colorimetric detection system, that upon binding turns the solution from a red to blue in color.2 Cyclotriveratrylene (CTV) 1 is a common supramolecular scaffold that has been previously employed in guest-host chemistry, and the construction of CTV involves the cyclic trimerization of veratryl alcohol via the veratryl cation.3 Due to the rigid bowl shaped structure of CTV, CTV has been shown to act as a host molecule for fullerene-C60.4 Lectin binding receptor proteins are a specific class of proteins found in bacteria, viruses, plants, and animals that can bind to complimentary carbohydrates. It is these lectins that are believed to be responsible for cell-cell interactions and the formation of biofilms in pathenogenic bacteria.5 P. aeruginosa is a pathenogenic bacterium, shown to have a high resistance to many antibiotics, which can form biofilms in human lung tissue, causing respiratory tract infections in patients with compromised immune systems. 5 I will exploit guest-host interactions to create synthetic supramolecular and carbohydrate receptor molecules to that will be of use as biological sensing devices via self-assembled monolayers on solid surfaces and nanoparticle technologies. *Please refer to dissertation for references/footnotes.

  18. Aspirin and salicylate bind to immunoglobulin heavy chain binding protein (BiP) and inhibit its ATPase activity in human fibroblasts.

    Science.gov (United States)

    Deng, W G; Ruan, K H; Du, M; Saunders, M A; Wu, K K

    2001-11-01

    Salicylic acid (SA), an endogenous signaling molecule of plants, possesses anti-inflammatory and anti-neoplastic actions in human. Its derivative, aspirin, is the most commonly used anti-inflammatory and analgesic drug. Aspirin and sodium salicylate (salicylates) have been reported to have multiple pharmacological actions. However, it is unclear whether they bind to a cellular protein. Here, we report for the first time the purification from human fibroblasts of a approximately 78 kDa salicylate binding protein with sequence identity to immunoglobulin heavy chain binding protein (BiP). The Kd values of SA binding to crude extract and to recombinant BiP were 45.2 and 54.6 microM, respectively. BiP is a chaperone protein containing a polypeptide binding site recognizing specific heptapeptide sequence and an ATP binding site. A heptapeptide with the specific sequence displaced SA binding in a concentration-dependent manner whereas a control heptapeptide did not. Salicylates inhibited ATPase activity stimulated by this specific heptapeptide but did not block ATP binding or induce BiP expression. These results indicate that salicylates bind specifically to the polypeptide binding site of BiP in human cells that may interfere with folding and transport of proteins important in inflammation.

  19. Real-Time Ligand Binding Pocket Database Search Using Local Surface Descriptors

    Science.gov (United States)

    Chikhi, Rayan; Sael, Lee; Kihara, Daisuke

    2010-01-01

    Due to the increasing number of structures of unknown function accumulated by ongoing structural genomics projects, there is an urgent need for computational methods for characterizing protein tertiary structures. As functions of many of these proteins are not easily predicted by conventional sequence database searches, a legitimate strategy is to utilize structure information in function characterization. Of a particular interest is prediction of ligand binding to a protein, as ligand molecule recognition is a major part of molecular function of proteins. Predicting whether a ligand molecule binds a protein is a complex problem due to the physical nature of protein-ligand interactions and the flexibility of both binding sites and ligand molecules. However, geometric and physicochemical complementarity is observed between the ligand and its binding site in many cases. Therefore, ligand molecules which bind to a local surface site in a protein can be predicted by finding similar local pockets of known binding ligands in the structure database. Here, we present two representations of ligand binding pockets and utilize them for ligand binding prediction by pocket shape comparison. These representations are based on mapping of surface properties of binding pockets, which are compactly described either by the two dimensional pseudo-Zernike moments or the 3D Zernike descriptors. These compact representations allow a fast real-time pocket searching against a database. Thorough benchmark study employing two different datasets show that our representations are competitive with the other existing methods. Limitations and potentials of the shape-based methods as well as possible improvements are discussed. PMID:20455259

  20. Sensitive quantitative predictions of peptide-MHC binding by a 'Query by Committee' artificial neural network approach

    DEFF Research Database (Denmark)

    Buus, S.; Lauemoller, S.L.; Worning, Peder

    2003-01-01

    We have generated Artificial Neural Networks (ANN) capable of performing sensitive, quantitative predictions of peptide binding to the MHC class I molecule, HLA-A*0204. We have shown that such quantitative ANN are superior to conventional classification ANN, that have been trained to predict bind...... of an iterative feedback loop whereby advanced, computational bioinformatics optimize experimental strategy, and vice versa....

  1. Long chain fatty acids alter the interactive binding of ligands to the two principal drug binding sites of human serum albumin.

    Directory of Open Access Journals (Sweden)

    Keishi Yamasaki

    Full Text Available A wide variety of drugs bind to human serum albumin (HSA at its two principal sites, namely site I and site II. A number of reports indicate that drug binding to these two binding sites are not completely independent, and that interactions between ligands of these two discrete sites can play a role. In this study, the effect of the binding of long-chain fatty acids on the interactive binding between dansyl-L-asparagine (DNSA; site I ligand and ibuprofen (site II ligand at pH6.5 was examined. Binding experiments showed that the binding of sodium oleate (Ole to HSA induces conformational changes in the molecule, which, in turn, changes the individual binding of DNSA and ibuprofen, as well as the mode of interaction between these two ligands from a 'competitive-like' allosteric interaction in the case of the defatted HSA conformer to a 'nearly independent' binding in the case of non-defatted HSA conformer. Circular dichroism measurements indicated that ibuprofen and Ole are likely to modify the spatial orientation of DNSA at its binding site. Docking simulations suggest that the long-distance electric repulsion between DNSA and ibuprofen on defatted HSA contributes to a 'competitive-like' allosteric interaction, whereas extending the distance between ligands and/or increasing the flexibility or size of the DNSA binding site in fatted HSA evokes a change in the interaction mode to 'nearly independent' binding. The present findings provide further insights into the structural dynamics of HSA upon the binding of fatty acids, and its effects on drug binding and drug-drug interactions that occur on HSA.

  2. Molecular dynamics simulations suggest ligand's binding to nicotinamidase/pyrazinamidase.

    Science.gov (United States)

    Zhang, Ji-Long; Zheng, Qing-Chuan; Li, Zheng-Qiang; Zhang, Hong-Xing

    2012-01-01

    The research on the binding process of ligand to pyrazinamidase (PncA) is crucial for elucidating the inherent relationship between resistance of Mycobacterium tuberculosis and PncA's activity. In the present study, molecular dynamics (MD) simulation methods were performed to investigate the unbinding process of nicotinamide (NAM) from two PncA enzymes, which is the reverse of the corresponding binding process. The calculated potential of mean force (PMF) based on the steered molecular dynamics (SMD) simulations sheds light on an optimal binding/unbinding pathway of the ligand. The comparative analyses between two PncAs clearly exhibit the consistency of the binding/unbinding pathway in the two enzymes, implying the universality of the pathway in all kinds of PncAs. Several important residues dominating the pathway were also determined by the calculation of interaction energies. The structural change of the proteins induced by NAM's unbinding or binding shows the great extent interior motion in some homologous region adjacent to the active sites of the two PncAs. The structure comparison substantiates that this region should be very important for the ligand's binding in all PncAs. Additionally, MD simulations also show that the coordination position of the ligand is displaced by one water molecule in the unliganded enzymes. These results could provide the more penetrating understanding of drug resistance of M. tuberculosis and be helpful for the development of new antituberculosis drugs.

  3. Molecular dynamics simulations suggest ligand's binding to nicotinamidase/pyrazinamidase.

    Directory of Open Access Journals (Sweden)

    Ji-Long Zhang

    Full Text Available The research on the binding process of ligand to pyrazinamidase (PncA is crucial for elucidating the inherent relationship between resistance of Mycobacterium tuberculosis and PncA's activity. In the present study, molecular dynamics (MD simulation methods were performed to investigate the unbinding process of nicotinamide (NAM from two PncA enzymes, which is the reverse of the corresponding binding process. The calculated potential of mean force (PMF based on the steered molecular dynamics (SMD simulations sheds light on an optimal binding/unbinding pathway of the ligand. The comparative analyses between two PncAs clearly exhibit the consistency of the binding/unbinding pathway in the two enzymes, implying the universality of the pathway in all kinds of PncAs. Several important residues dominating the pathway were also determined by the calculation of interaction energies. The structural change of the proteins induced by NAM's unbinding or binding shows the great extent interior motion in some homologous region adjacent to the active sites of the two PncAs. The structure comparison substantiates that this region should be very important for the ligand's binding in all PncAs. Additionally, MD simulations also show that the coordination position of the ligand is displaced by one water molecule in the unliganded enzymes. These results could provide the more penetrating understanding of drug resistance of M. tuberculosis and be helpful for the development of new antituberculosis drugs.

  4. IGF binding proteins.

    Science.gov (United States)

    Bach, Leon A

    2017-12-18

    Insulin-like growth factor binding proteins (IGFBPs) 1-6 bind IGFs but not insulin with high affinity. They were initially identified as serum carriers and passive inhibitors of IGF actions. However, subsequent studies showed that, although IGFBPs inhibit IGF actions in many circumstances, they may also potentiate these actions. IGFBPs are widely expressed in most tissues, and they are flexible endocrine and autocrine/paracrine regulators of IGF activity, which is essential for this important physiological system. More recently, individual IGFBPs have been shown to have IGF-independent actions. Mechanisms underlying these actions include (i) interaction with non-IGF proteins in compartments including the extracellular space and matrix, the cell surface and intracellularly; (ii) interaction with and modulation of other growth factor pathways including EGF, TGF- and VEGF; and (iii) direct or indirect transcriptional effects following nuclear entry of IGFBPs. Through these IGF-dependent and IGF-independent actions, IGFBPs modulate essential cellular processes including proliferation, survival, migration, senescence, autophagy and angiogenesis. They have been implicated in a range of disorders including malignant, metabolic, neurological and immune diseases. A more complete understanding of their cellular roles may lead to the development of novel IGFBP-based therapeutic opportunities.

  5. Heterobifunctional crosslinkers for tethering single ligand molecules to scanning probes

    International Nuclear Information System (INIS)

    Riener, Christian K.; Kienberger, Ferry; Hahn, Christoph D.; Buchinger, Gerhard M.; Egwim, Innocent O.C.; Haselgruebler, Thomas; Ebner, Andreas; Romanin, Christoph; Klampfl, Christian; Lackner, Bernd; Prinz, Heino; Blaas, Dieter; Hinterdorfer, Peter; Gruber, Hermann J.

    2003-01-01

    Single molecule recognition force microscopy (SMRFM) is a versatile atomic force microscopy (AFM) method to probe specific interactions of cognitive molecules on the single molecule level. It allows insights to be gained into interaction potentials and kinetic barriers and is capable of mapping interaction sites with nm positional accuracy. These applications require a ligand to be attached to the AFM tip, preferably by a distensible poly(ethylene glycol) (PEG) chain between the measuring tip and the ligand molecule. The PEG chain greatly facilitates specific binding of the ligand to immobile receptor sites on the sample surface. The present study contributes to tip-PEG-ligand tethering in three ways: (i) a convenient synthetic route was found to prepare NH 2 -PEG-COOH which is the key intermediate for long heterobifunctional crosslinkers; (ii) a variety of heterobifunctional PEG derivatives for tip-PEG-ligand linking were prepared from NH 2 -PEG-COOH; (iii) in particular, a new PEG crosslinker with one thiol-reactive end and one terminal nitrilotriacetic acid (NTA) group was synthesized and successfully used to tether His 6 -tagged protein molecules to AFM tips via noncovalent NTA-Ni 2+ -His 6 bridges. The new crosslinker was applied to link a recombinant His 6 -tagged fragment of the very-low density lipoprotein receptor to the AFM tip whereupon specific docking to the capsid of human rhinovirus particles was observed by force microscopy. In a parallel study, the specific interaction of the small GTPase Ran with the nuclear import receptor importin β1 was studied in detail by SMRFM, using the new crosslinker to link His 6 -tagged Ran to the measuring tip [Nat. Struct. Biol. (2003), 10, 553-557

  6. Scattering of atoms by molecules adsorbed at solid surfaces

    International Nuclear Information System (INIS)

    Parra, Zaida.

    1988-01-01

    The formalism of collisional time-correlation functions, appropriate for scattering by many-body targets, is implemented to study energy transfer in the scattering of atoms and ions from molecules adsorbed on metal surfaces. Double differential cross-sections for the energy and angular distributions of atoms and ions scattered by a molecule adsorbed on a metal surface are derived in the limit of impulsive collisions and within a statistical model that accounts for single and double collisions. They are found to be given by the product of an effective cross-section that accounts for the probability of deflection into a solid angle times a probability per unit energy transfer. A cluster model is introduced for the vibrations of an adsorbed molecule which includes the molecular atoms, the surface atoms binding the molecule, and their nearest neighbors. The vibrational modes of CO adsorbed on a Ni(001) metal surface are obtained using two different cluster models to represent the on-top and bridge-bonding situations. A He/OC-Ni(001) potential is constructed from a strongly repulsive potential of He interacting with the oxygen atom in the CO molecule and a van der Waals attraction accounting for the He interaction with the free Ni(001) surface. A potential is presented for the Li + /OC-Ni(001) where a coulombic term is introduced to account for the image force. Trajectory studies are performed and analyzed in three dimensions to obtain effective classical cross-sections for the He/OC-Ni(001) and Li + /OC-Ni(001) systems. Results for the double differential cross-sections are presented as functions of scattering angles, energy transfer and collisional energy. Temperature dependence results are also analyzed. Extensions of the approach and inclusion of effects such as anharmonicity, collisions at lower energies, and applications of the approach to higher coverages are discussed

  7. Impact of Dendrimers on Solubility of Hydrophobic Drug Molecules

    Directory of Open Access Journals (Sweden)

    Sonam Choudhary

    2017-05-01

    Full Text Available Adequate aqueous solubility has been one of the desired properties while selecting drug molecules and other bio-actives for product development. Often solubility of a drug determines its pharmaceutical and therapeutic performance. Majority of newly synthesized drug molecules fail or are rejected during the early phases of drug discovery and development due to their limited solubility. Sufficient permeability, aqueous solubility and physicochemical stability of the drug are important for achieving adequate bioavailability and therapeutic outcome. A number of different approaches including co-solvency, micellar solubilization, micronization, pH adjustment, chemical modification, and solid dispersion have been explored toward improving the solubility of various poorly aqueous-soluble drugs. Dendrimers, a new class of polymers, possess great potential for drug solubility improvement, by virtue of their unique properties. These hyper-branched, mono-dispersed molecules have the distinct ability to bind the drug molecules on periphery as well as to encapsulate these molecules within the dendritic structure. There are numerous reported studies which have successfully used dendrimers to enhance the solubilization of poorly soluble drugs. These promising outcomes have encouraged the researchers to design, synthesize, and evaluate various dendritic polymers for their use in drug delivery and product development. This review will discuss the aspects and role of dendrimers in the solubility enhancement of poorly soluble drugs. The review will also highlight the important and relevant properties of dendrimers which contribute toward drug solubilization. Finally, hydrophobic drugs which have been explored for dendrimer assisted solubilization, and the current marketing status of dendrimers will be discussed.

  8. Preparation and antimicrobial action of three tryptic digested functional molecules of bovine lactoferrin.

    Directory of Open Access Journals (Sweden)

    Nilisha Rastogi

    Full Text Available Lactoferrin is an 80 kDa bilobal, iron binding glycoprotein which is primarily antimicrobial in nature. The hydrolysis of lactoferrin by various proteases in the gut produces several functional fragments of lactoferrin which have varying molecular sizes and properties. Here, bovine lactoferrin has been hydrolyzed by trypsin, the major enzyme present in the gut, to produce three functional molecules of sizes approximately 21 kDa, 38 kDa and 45 kDa. The molecules have been purified using ion exchange and gel filtration chromatography and identified using N-terminal sequencing, which reveals that while the 21 kDa molecule corresponds to the N2 domain (21LF, the 38 kDa represents the whole C-lobe (38LF and the 45 kDa is a portion of N1 domain of N-lobe attached to the C-lobe (45LF. The iron binding and release properties of 21LF, 38LF and 45LF have been studied and compared. The sequence and structure analysis of the portions of the excision sites of LF from various species have been done. The antibacterial properties of these three molecules against bacterial strains, Streptococcus pyogenes, Escherichia coli, Yersinia enterocolitica and Listeria monocytogenes were investigated. The antifungal action of the molecules was also evaluated against Candida albicans. This is the first report on the antimicrobial actions of the trypsin cleaved functional molecules of lactoferrin from any species.

  9. A mosquito hemolymph odorant-binding protein family member specifically binds juvenile hormone

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Il Hwan; Pham, Van; Jablonka, Willy; Goodman, Walter G.; Ribeiro, José M. C.; Andersen, John F.

    2017-07-27

    Juvenile hormone (JH) is a key regulator of insect development and reproduction. In adult mosquitoes, it is essential for maturation of the ovary and normal male reproductive behavior, but how JH distribution and activity is regulated after secretion is unclear. Here, we report a new type of specific JH-binding protein, given the name mosquito juvenile hormone-binding protein (mJHBP), which circulates in the hemolymph of pupal and adult Aedes aegypti males and females. mJHBP is a member of the odorant-binding protein (OBP) family, and orthologs are present in the genomes of Aedes, Culex, and Anopheles mosquito species. Using isothermal titration calorimetry, we show that mJHBP specifically binds JH II and JH III but not eicosanoids or JH derivatives. mJHBP was crystallized in the presence of JH III and found to have a double OBP domain structure reminiscent of salivary “long” D7 proteins of mosquitoes. We observed that a single JH III molecule is contained in the N-terminal domain binding pocket that is closed in an apparent conformational change by a C-terminal domain-derived α-helix. The electron density for the ligand indicated a high occupancy of the natural 10R enantiomer of JH III. Of note, mJHBP is structurally unrelated to hemolymph JHBP from lepidopteran insects. A low level of expression of mJHBP in Ae. aegypti larvae suggests that it is primarily active during the adult stage where it could potentially influence the effects of JH on egg development, mating behavior, feeding, or other processes.

  10. A mosquito hemolymph odorant-binding protein family member specifically binds juvenile hormone.

    Science.gov (United States)

    Kim, Il Hwan; Pham, Van; Jablonka, Willy; Goodman, Walter G; Ribeiro, José M C; Andersen, John F

    2017-09-15

    Juvenile hormone (JH) is a key regulator of insect development and reproduction. In adult mosquitoes, it is essential for maturation of the ovary and normal male reproductive behavior, but how JH distribution and activity is regulated after secretion is unclear. Here, we report a new type of specific JH-binding protein, given the name mosquito juvenile hormone-binding protein (mJHBP), which circulates in the hemolymph of pupal and adult Aedes aegypti males and females. mJHBP is a member of the odorant-binding protein (OBP) family, and orthologs are present in the genomes of Aedes , Culex , and Anopheles mosquito species. Using isothermal titration calorimetry, we show that mJHBP specifically binds JH II and JH III but not eicosanoids or JH derivatives. mJHBP was crystallized in the presence of JH III and found to have a double OBP domain structure reminiscent of salivary "long" D7 proteins of mosquitoes. We observed that a single JH III molecule is contained in the N-terminal domain binding pocket that is closed in an apparent conformational change by a C-terminal domain-derived α-helix. The electron density for the ligand indicated a high occupancy of the natural 10 R enantiomer of JH III. Of note, mJHBP is structurally unrelated to hemolymph JHBP from lepidopteran insects. A low level of expression of mJHBP in Ae. aegypti larvae suggests that it is primarily active during the adult stage where it could potentially influence the effects of JH on egg development, mating behavior, feeding, or other processes.

  11. Single Molecule Nano-Metronome

    OpenAIRE

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

    2006-01-01

    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule ...

  12. Single Molecule Nano-Metronome

    Science.gov (United States)

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

    2008-01-01

    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

  13. XUV ionization of aligned molecules

    Energy Technology Data Exchange (ETDEWEB)

    Kelkensberg, F.; Siu, W.; Gademann, G. [FOM Institute AMOLF, Science Park 104, NL-1098 XG Amsterdam (Netherlands); Rouzee, A.; Vrakking, M. J. J. [FOM Institute AMOLF, Science Park 104, NL-1098 XG Amsterdam (Netherlands); Max-Born-Institut, Max-Born Strasse 2A, D-12489 Berlin (Germany); Johnsson, P. [FOM Institute AMOLF, Science Park 104, NL-1098 XG Amsterdam (Netherlands); Department of Physics, Lund University, Post Office Box 118, SE-221 00 Lund (Sweden); Lucchini, M. [Department of Physics, Politecnico di Milano, Istituto di Fotonica e Nanotecnologie CNR-IFN, Piazza Leonardo da Vinci 32, 20133 Milano (Italy); Lucchese, R. R. [Department of Chemistry, Texas A and M University, College Station, Texas 77843-3255 (United States)

    2011-11-15

    New extreme-ultraviolet (XUV) light sources such as high-order-harmonic generation (HHG) and free-electron lasers (FELs), combined with laser-induced alignment techniques, enable novel methods for making molecular movies based on measuring molecular frame photoelectron angular distributions. Experiments are presented where CO{sub 2} molecules were impulsively aligned using a near-infrared laser and ionized using femtosecond XUV pulses obtained by HHG. Measured electron angular distributions reveal contributions from four orbitals and the onset of the influence of the molecular structure.

  14. ''Crown molecules'' for separating cesium

    International Nuclear Information System (INIS)

    Dozol, J.F.; Lamare, V.

    2002-01-01

    After the minor actinides, the second category of radionuclides that must be isolated to optimize nuclear waste management concerns fission products, especially two cesium isotopes. If the cesium-135 isotope could be extracted, it could subsequently be transmuted or conditioned using a tailor-made process. Eliminating the 137 isotope from reprocessing and nuclear facility-dismantling waste would allow to dispose of most of this waste in near-surface facilities, and simply process the small remaining quantity containing long-lived elements. CEA research teams and their international partners have thought up crown molecules that could be used to pick out the cesium and meet these objectives. (authors)

  15. XUV ionization of aligned molecules

    International Nuclear Information System (INIS)

    Kelkensberg, F.; Siu, W.; Gademann, G.; Rouzee, A.; Vrakking, M. J. J.; Johnsson, P.; Lucchini, M.; Lucchese, R. R.

    2011-01-01

    New extreme-ultraviolet (XUV) light sources such as high-order-harmonic generation (HHG) and free-electron lasers (FELs), combined with laser-induced alignment techniques, enable novel methods for making molecular movies based on measuring molecular frame photoelectron angular distributions. Experiments are presented where CO 2 molecules were impulsively aligned using a near-infrared laser and ionized using femtosecond XUV pulses obtained by HHG. Measured electron angular distributions reveal contributions from four orbitals and the onset of the influence of the molecular structure.

  16. The neural cell adhesion molecule

    DEFF Research Database (Denmark)

    Berezin, V; Bock, E; Poulsen, F M

    2000-01-01

    During the past year, the understanding of the structure and function of neural cell adhesion has advanced considerably. The three-dimensional structures of several of the individual modules of the neural cell adhesion molecule (NCAM) have been determined, as well as the structure of the complex...... between two identical fragments of the NCAM. Also during the past year, a link between homophilic cell adhesion and several signal transduction pathways has been proposed, connecting the event of cell surface adhesion to cellular responses such as neurite outgrowth. Finally, the stimulation of neurite...

  17. The molecule-metal interface

    CERN Document Server

    Koch, Norbert; Wee, Andrew Thye Shen

    2013-01-01

    Reviewing recent progress in the fundamental understanding of the molecule-metal interface, this useful addition to the literature focuses on experimental studies and introduces the latest analytical techniques as applied to this interface.The first part covers basic theory and initial principle studies, while the second part introduces readers to photoemission, STM, and synchrotron techniques to examine the atomic structure of the interfaces. The third part presents photoelectron spectroscopy, high-resolution UV photoelectron spectroscopy and electron spin resonance to study the electroni

  18. MANAGING TIGHT BINDING RECEPTORS FOR NEW SPEARATIONS TECHNOLOGIES

    Energy Technology Data Exchange (ETDEWEB)

    DARYLE H BUSCH RICHARD S GIVENS

    2004-12-10

    Much of the earth's pollution involves compounds of the metallic elements, including actinides, strontium, cesium, technetium, and RCRA metals. Metal ions bind to molecules called ligands, which are the molecular tools that can manipulate the metal ions under most conditions. This DOE-EMSP sponsored program strives (1) to provide the foundations for using the most powerful ligands in transformational separations technologies and (2) to produce seminal examples of their applications to separations appropriate to the DOE EM mission. These ultra tight-binding ligands can capture metal ions in the most competitive of circumstances (from mineralized sites, lesser ligands, and even extremely dilute solutions), but they react so slowly that they are useless in traditional separations methodologies. Two attacks on this problem are underway. The first accommodates to the challenging molecular lethargy by developing a seminal slow separations methodology termed the soil poultice. The second designs ligands that are only tight-binding while wrapped around the targeted metal ion, but can be put in place by switch-binding and removed by switch-release. We envision a kind of molecular switching process to accelerate the union between metal ion and tight-binding ligand. Molecular switching processes are suggested for overcoming the slow natural equilibration rate with which ultra tight-binding ligands combine with metal ions. Ligands that bind relatively weakly combine with metal ions rapidly, so the trick is to convert a ligand from a weak, rapidly binding species to a powerful, slow releasing ligand--during the binding of the ligand to the metal ion. Such switch-binding ligands must react with themselves, and the reaction must take place under the influence of the metal ion. For example, our generation 1 ligands showed that a well-designed linear ligand with ends that readily combine, forms a cyclic molecule when it wraps around a metal ion. Our generation 2 ligands are

  19. Echinococcus granulosus fatty acid binding proteins subcellular localization.

    Science.gov (United States)

    Alvite, Gabriela; Esteves, Adriana

    2016-05-01

    Two fatty acid binding proteins, EgFABP1 and EgFABP2, were isolated from the parasitic platyhelminth Echinococcus granulosus. These proteins bind fatty acids and have particular relevance in flatworms since de novo fatty acids synthesis is absent. Therefore platyhelminthes depend on the capture and intracellular distribution of host's lipids and fatty acid binding proteins could participate in lipid distribution. To elucidate EgFABP's roles, we investigated their intracellular distribution in the larval stage by a proteomic approach. Our results demonstrated the presence of EgFABP1 isoforms in cytosolic, nuclear, mitochondrial and microsomal fractions, suggesting that these molecules could be involved in several cellular processes. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Efficient computation of optimal oligo-RNA binding.

    Science.gov (United States)

    Hodas, Nathan O; Aalberts, Daniel P

    2004-01-01

    We present an algorithm that calculates the optimal binding conformation and free energy of two RNA molecules, one or both oligomeric. This algorithm has applications to modeling DNA microarrays, RNA splice-site recognitions and other antisense problems. Although other recent algorithms perform the same calculation in time proportional to the sum of the lengths cubed, O((N1 + N2)3), our oligomer binding algorithm, called bindigo, scales as the product of the sequence lengths, O(N1*N2). The algorithm performs well in practice with the aid of a heuristic for large asymmetric loops. To demonstrate its speed and utility, we use bindigo to investigate the binding proclivities of U1 snRNA to mRNA donor splice sites.