Novel causative mutations in patients with Nance-Horan syndrome and altered localization of the mutant NHS-A protein isoform.

Science.gov (United States)

Sharma, Shiwani; Burdon, Kathryn P; Dave, Alpana; Jamieson, Robyn V; Yaron, Yuval; Billson, Frank; Van Maldergem, Lionel; Lorenz, Birgit; Gécz, Jozef; Craig, Jamie E

2008-01-01

Nance-Horan syndrome is typically characterized by severe bilateral congenital cataracts and dental abnormalities. Truncating mutations in the Nance-Horan syndrome (NHS) gene cause this X-linked genetic disorder. NHS encodes two isoforms, NHS-A and NHS-1A. The ocular lens expresses NHS-A, the epithelial and neuronal cell specific isoform. The NHS-A protein localizes in the lens epithelium at the cellular periphery. The data to date suggest a role for this isoform at cell-cell junctions in epithelial cells. This study aimed to identify the causative mutations in new patients diagnosed with Nance-Horan syndrome and to investigate the effect of mutations on subcellular localization of the NHS-A protein. All coding exons of NHS were screened for mutations by polymerase chain reaction (PCR) and sequencing. PCR-based mutagenesis was performed to introduce three independent mutations in the NHS-A cDNA. Expression and localization of the mutant proteins was determined in mammalian epithelial cells. Truncating mutations were found in 6 out of 10 unrelated patients from four countries. Each of four patients carried a novel mutation (R248X, P264fs, K1198fs, and I1302fs), and each of the two other patients carried two previously reported mutations (R373X and R879X). No mutation was found in the gene in four patients. Two disease-causing mutations (R134fs and R901X) and an artificial mutation (T1357fs) resulted in premature truncation of the NHS-A protein. All three mutant proteins failed to localize to the cellular periphery in epithelial cells and instead were found in the cytoplasm. This study brings the total number of mutations identified in NHS to 18. The mislocalization of the mutant NHS-A protein, revealed by mutation analysis, is expected to adversely affect cell-cell junctions in epithelial cells such as the lens epithelium, which may explain cataractogenesis in Nance-Horan syndrome patients. Mutation analysis also shed light on the significance of NHS-A regions for

Heterozygous RFX6 protein truncating variants are associated with MODY with reduced penetrance.

Science.gov (United States)

Patel, Kashyap A; Kettunen, Jarno; Laakso, Markku; Stančáková, Alena; Laver, Thomas W; Colclough, Kevin; Johnson, Matthew B; Abramowicz, Marc; Groop, Leif; Miettinen, Päivi J; Shepherd, Maggie H; Flanagan, Sarah E; Ellard, Sian; Inagaki, Nobuya; Hattersley, Andrew T; Tuomi, Tiinamaija; Cnop, Miriam; Weedon, Michael N

2017-10-12

Finding new causes of monogenic diabetes helps understand glycaemic regulation in humans. To find novel genetic causes of maturity-onset diabetes of the young (MODY), we sequenced MODY cases with unknown aetiology and compared variant frequencies to large public databases. From 36 European patients, we identify two probands with novel RFX6 heterozygous nonsense variants. RFX6 protein truncating variants are enriched in the MODY discovery cohort compared to the European control population within ExAC (odds ratio = 131, P = 1 × 10 -4 ). We find similar results in non-Finnish European (n = 348, odds ratio = 43, P = 5 × 10 -5 ) and Finnish (n = 80, odds ratio = 22, P = 1 × 10 -6 ) replication cohorts. RFX6 heterozygotes have reduced penetrance of diabetes compared to common HNF1A and HNF4A-MODY mutations (27, 70 and 55% at 25 years of age, respectively). The hyperglycaemia results from beta-cell dysfunction and is associated with lower fasting and stimulated gastric inhibitory polypeptide (GIP) levels. Our study demonstrates that heterozygous RFX6 protein truncating variants are associated with MODY with reduced penetrance.Maturity-onset diabetes of the young (MODY) is the most common subtype of familial diabetes. Here, Patel et al. use targeted DNA sequencing of MODY patients and large-scale publically available data to show that RFX6 heterozygous protein truncating variants cause reduced penetrance MODY.

Mutations in POGLUT1, Encoding Protein O-Glucosyltransferase 1, Cause Autosomal-Dominant Dowling-Degos Disease

Science.gov (United States)

Basmanav, F. Buket; Oprisoreanu, Ana-Maria; Pasternack, Sandra M.; Thiele, Holger; Fritz, Günter; Wenzel, Jörg; Größer, Leopold; Wehner, Maria; Wolf, Sabrina; Fagerberg, Christina; Bygum, Anette; Altmüller, Janine; Rütten, Arno; Parmentier, Laurent; El Shabrawi-Caelen, Laila; Hafner, Christian; Nürnberg, Peter; Kruse, Roland; Schoch, Susanne; Hanneken, Sandra; Betz, Regina C.

2014-01-01

Dowling-Degos disease (DDD) is an autosomal-dominant genodermatosis characterized by progressive and disfiguring reticulate hyperpigmentation. We previously identified loss-of-function mutations in KRT5 but were only able to detect pathogenic mutations in fewer than half of our subjects. To identify additional causes of DDD, we performed exome sequencing in five unrelated affected individuals without mutations in KRT5. Data analysis identified three heterozygous mutations from these individuals, all within the same gene. These mutations, namely c.11G>A (p.Trp4∗), c.652C>T (p.Arg218∗), and c.798-2A>C, are within POGLUT1, which encodes protein O-glucosyltransferase 1. Further screening of unexplained cases for POGLUT1 identified six additional mutations, as well as two of the above described mutations. Immunohistochemistry of skin biopsies of affected individuals with POGLUT1 mutations showed significantly weaker POGLUT1 staining in comparison to healthy controls with strong localization of POGLUT1 in the upper parts of the epidermis. Immunoblot analysis revealed that translation of either wild-type (WT) POGLUT1 or of the protein carrying the p.Arg279Trp substitution led to the expected size of about 50 kDa, whereas the c.652C>T (p.Arg218∗) mutation led to translation of a truncated protein of about 30 kDa. Immunofluorescence analysis identified a colocalization of the WT protein with the endoplasmic reticulum and a notable aggregating pattern for the truncated protein. Recently, mutations in POFUT1, which encodes protein O-fucosyltransferase 1, were also reported to be responsible for DDD. Interestingly, both POGLUT1 and POFUT1 are essential regulators of Notch activity. Our results furthermore emphasize the important role of the Notch pathway in pigmentation and keratinocyte morphology. PMID:24387993

A truncated Kv1.1 protein in the brain of the megencephaly mouse: expression and interaction

Directory of Open Access Journals (Sweden)

Århem Peter

2005-11-01

Full Text Available Abstract Background The megencephaly mouse, mceph/mceph, is epileptic and displays a dramatically increased brain volume and neuronal count. The responsible mutation was recently revealed to be an eleven base pair deletion, leading to a frame shift, in the gene encoding the potassium channel Kv1.1. The predicted MCEPH protein is truncated at amino acid 230 out of 495. Truncated proteins are usually not expressed since nonsense mRNAs are most often degraded. However, high Kv1.1 mRNA levels in mceph/mceph brain indicated that it escaped this control mechanism. Therefore, we hypothesized that the truncated Kv1.1 would be expressed and dysregulate other Kv1 subunits in the mceph/mceph mice. Results We found that the MCEPH protein is expressed in the brain of mceph/mceph mice. MCEPH was found to lack mature (Golgi glycosylation, but to be core glycosylated and trapped in the endoplasmic reticulum (ER. Interactions between MCEPH and other Kv1 subunits were studied in cell culture, Xenopus oocytes and the brain. MCEPH can form tetramers with Kv1.1 in cell culture and has a dominant negative effect on Kv1.2 and Kv1.3 currents in oocytes. However, it does not retain Kv1.2 in the ER of neurons. Conclusion The megencephaly mice express a truncated Kv1.1 in the brain, and constitute a unique tool to study Kv1.1 trafficking relevant for understanding epilepsy, ataxia and pathologic brain overgrowth.

No evidence that protein truncating variants in BRIP1 are associated with breast cancer risk: implications for gene panel testing

OpenAIRE

Easton, Douglas Frederick; Lesueur, Fabienne; Decker, Brennan; Michailidou, Kyriaki; Li, Jun; Allen, Jamie; Luccarini, Craig; Pooley, Karen Anne; Shah, Mitulkumar Nandlal; Bolla, Manjeet K; Wang, Qin; Dennis, Joe; Ahmad, Jamil; Thompson, Ella R; Damiola, Francesca

2016-01-01

Background BRCA1 interacting protein C-terminal helicase 1 (BRIP1) is one of the Fanconi Anaemia Complementation (FANC) group family of DNA repair proteins. Biallelic mutations in BRIP1 are responsible for FANC group J, and previous studies have also suggested that rare protein truncating variants in BRIP1 are associated with an increased risk of breast cancer. These studies have led to inclusion of BRIP1 on targeted sequencing panels for breast cancer risk prediction. Metho...

NF1 truncating mutations associated to aggressive clinical phenotype with elephantiasis neuromatosa and solid malignancies.

Science.gov (United States)

Ponti, Giovanni; Martorana, Davide; Pellacani, Giovanni; Ruini, Cristel; Loschi, Pietro; Baccarani, Alessio; De Santis, Giorgio; Pollio, Annamaria; Neri, Tauro Maria; Mandel, Victor Desmond; Maiorana, Antonio; Maccio, Livia; Maccaferri, Monia; Tomasi, Aldo

2014-06-01

Von Recklinghausen disease is a syndrome characterized by a wide phenotypic variability giving rise to both, cutaneous and visceral benign and malignant neoplasms. The first include cutaneous neurofibromas, subcutaneous and plexiform neurofibromas. The latter can undergo malignant transformation and/or determine elephantiasis neuromatosa. Visceral tumors may include malignant peripheral nerve sheet tumors, gastrointestinal stromal tumors, cerebral gliomas and abdominal neurofibromas. In the present study, the authors discuss the clinical and biomolecular characterization of a cohort of 20 families with a diagnosis of type 1 neurofibromatosis. Clinically, the cohort includes three probands with elephantiasis neuromatosa and a peculiarly high incidence of breast and gastrointestinal cancer. Among the 14 NF1 mutations documented, 10 encoding for a truncated protein have been associated to particularly aggressive clinical phenotypes including elephantiasis neuromatosa, malignant peripheral nerve sheet tumors, breast cancer, gastrointestinal stromal tumors. This effect on protein synthesis, rather than the type of NF1 mutation, is the key to the explanation of the genotype-phenotype correlations in the context of neurofibromatosis type 1. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Truncated SALL1 Impedes Primary Cilia Function in Townes-Brocks Syndrome

DEFF Research Database (Denmark)

Bozal-Basterra, Laura; Martín-Ruíz, Itziar; Pirone, Lucia

2018-01-01

by mutations in the gene encoding the transcriptional repressor SALL1 and is associated with the presence of a truncated protein that localizes to the cytoplasm. Here, we provide evidence that SALL1 mutations might cause TBS by means beyond its transcriptional capacity. By using proximity proteomics, we show...

Truncating Plakophilin-2 Mutations in Arrhythmogenic Cardiomyopathy Are Associated with Protein Haploinsufficiency in Both Myocardium and Epidermis

DEFF Research Database (Denmark)

Rasmussen, Torsten Bloch; Nissen, Peter H; Palmfeldt, Johan

2014-01-01

BACKGROUND: Arrhythmogenic cardiomyopathy (AC) is a hereditary cardiac condition associated with ventricular arrhythmias, heart failure, and sudden death. The disease is most often caused by mutations in the desmosomal gene for plakophilin-2 (PKP2), which is expressed in both myocardial...... and epidermal tissue. This study aimed to investigate protein expression in myocardial tissue of patients with AC carrying PKP2 mutations and elucidate whether keratinocytes of the same individuals exhibited a similar pattern of protein expression. METHODS AND RESULTS: Direct sequencing of 5 AC genes in 71...... unrelated patients with AC identified 10 different PKP2 mutations in 12 index patients. One patient, heterozygous for a PKP2 nonsense mutation, developed severe heart failure and underwent cardiac transplantation. Western blotting and immunohistochemistry of the explanted heart showed a significant decrease...

Germline RAD51B truncating mutation in a family with cutaneous melanoma

DEFF Research Database (Denmark)

Wadt, Karin A W; Aoude, Lauren G; Golmard, Lisa

2015-01-01

Known melanoma predisposition genes only account for around 40% of high-density melanoma families. Other rare mutations are likely to play a role in melanoma predisposition. RAD51B plays an important role in DNA repair through homologous recombination, and inactivation of RAD51B has been implicated...... in tumorigenesis. Thus RAD51B is a good candidate melanoma susceptibility gene, and previously, a germline splicing mutation in RAD51B has been identified in a family with early-onset breast cancer. In order to find genetic variants associated with melanoma predisposition, whole-exome sequencing was carried out...... on blood samples from a three-case cutaneous melanoma family. We identified a novel germline RAD51B nonsense mutation, and we demonstrate reduced expression of RAD51B in melanoma cells indicating inactivation of RAD51B. This is only the second report of a germline truncating RAD51B mutation. While...

Epitope-positive truncating MLH1 mutation and loss of PMS2: implications for IHC-directed genetic testing for Lynch syndrome.

Science.gov (United States)

Zighelboim, Israel; Powell, Matthew A; Babb, Sheri A; Whelan, Alison J; Schmidt, Amy P; Clendenning, Mark; Senter, Leigha; Thibodeau, Stephen N; de la Chapelle, Albert; Goodfellow, Paul J

2009-01-01

We assessed mismatch repair by immunohistochemistry (IHC) and microsatellite instability (MSI) analysis in an early onset endometrial cancer and a sister's colon cancer. We demonstrated high-level MSI and normal expression for MLH1, MSH2 and MSH6. PMS2 failed to stain in both tumors, strongly implicating a PMS2 defect. This family did not meet clinical criteria for Lynch syndrome. However, early onset endometrial cancers in the proband and her sister, a metachronous colorectal cancer in the sister as well as MSI in endometrial and colonic tumors suggested a heritable mismatch repair defect. PCR-based direct exonic sequencing and multiplex ligation-dependent probe amplification (MLPA) were undertaken to search for PMS2 mutations in the germline DNA from the proband and her sister. No mutation was identified in the PMS2 gene. However, PMS2 exons 3, 4, 13, 14, 15 were not evaluated by MLPA and as such, rearrangements involving those exons cannot be excluded. Clinical testing for MLH1 and MSH2 mutation revealed a germline deletion of MLH1 exons 14 and 15. This MLH1 germline deletion leads to an immunodetectable stable C-terminal truncated MLH1 protein which based on the IHC staining must abrogate PMS2 stabilization. To the best of our knowledge, loss of PMS2 in MLH1 truncating mutation carriers that express MLH1 in their tumors has not been previously reported. This family points to a potential limitation of IHC-directed gene testing for suspected Lynch syndrome and the need to consider comprehensive MLH1 testing for individuals whose tumors lack PMS2 but for whom PMS2 mutations are not identified.

POC1A truncation mutation causes a ciliopathy in humans characterized by primordial dwarfism.

Science.gov (United States)

Shaheen, Ranad; Faqeih, Eissa; Shamseldin, Hanan E; Noche, Ramil R; Sunker, Asma; Alshammari, Muneera J; Al-Sheddi, Tarfa; Adly, Nouran; Al-Dosari, Mohammed S; Megason, Sean G; Al-Husain, Muneera; Al-Mohanna, Futwan; Alkuraya, Fowzan S

2012-08-10

Primordial dwarfism (PD) is a phenotype characterized by profound growth retardation that is prenatal in onset. Significant strides have been made in the last few years toward improved understanding of the molecular underpinning of the limited growth that characterizes the embryonic and postnatal development of PD individuals. These include impaired mitotic mechanics, abnormal IGF2 expression, perturbed DNA-damage response, defective spliceosomal machinery, and abnormal replication licensing. In three families affected by a distinct form of PD, we identified a founder truncating mutation in POC1A. This gene is one of two vertebrate paralogs of POC1, which encodes one of the most abundant proteins in the Chlamydomonas centriole proteome. Cells derived from the index individual have abnormal mitotic mechanics with multipolar spindles, in addition to clearly impaired ciliogenesis. siRNA knockdown of POC1A in fibroblast cells recapitulates this ciliogenesis defect. Our findings highlight a human ciliopathy syndrome caused by deficiency of a major centriolar protein. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

A truncating mutation of HDAC2 in human cancers confers resistance to histone deacetylase inhibition

DEFF Research Database (Denmark)

Ropero, S; Fraga, MF; Ballestar, E

2006-01-01

Disruption of histone acetylation patterns is a common feature of cancer cells, but very little is known about its genetic basis. We have identified truncating mutations in one of the primary human histone deacetylases, HDAC2, in sporadic carcinomas with microsatellite instability and in tumors a...... deacetylase inhibitors. As such drugs may serve as therapeutic agents for cancer, our findings support the use of HDAC2 mutational status in future pharmacogenetic treatment of these individuals....

Identification of a novel truncating PALB2 mutation and analysis of its contribution to early-onset breast cancer in French-Canadian women.

Science.gov (United States)

Foulkes, William D; Ghadirian, Parviz; Akbari, Mohammed Reza; Hamel, Nancy; Giroux, Sylvie; Sabbaghian, Nelly; Darnel, Andrew; Royer, Robert; Poll, Aletta; Fafard, Eve; Robidoux, André; Martin, Ginette; Bismar, Tarek A; Tischkowitz, Marc; Rousseau, Francois; Narod, Steven A

2007-01-01

PALB2 has recently been identified as a breast cancer susceptibility gene. PALB2 mutations are rare causes of hereditary breast cancer but may be important in countries such as Finland where a founder mutation is present. We sought to estimate the contribution of PALB2 mutations to the burden of breast cancer in French Canadians from Quebec. We screened all coding exons of PALB2 in a sample of 50 French-Canadian women diagnosed with either early-onset breast cancer or familial breast cancer at a single Montreal hospital. The genetic variants identified in this sample were then studied in 356 additional women with breast cancer diagnosed before age 50 and in 6,448 newborn controls. We identified a single protein-truncating mutation in PALB2 (c.2323 C>T, resulting in Q775X) in 1 of the 50 high-risk women. This variant was present in 2 of 356 breast cancer cases and in none of 6,440 newborn French-Canadian controls (P = 0.003). We also identified two novel new non-synonymous single nucleotide polymorphisms in exon 4 of PALB2 (c.5038 A>G [I76V] and c.5156 G>T [G115V]). G115V was found in 1 of 356 cases and in 15 of 6,442 controls (P = 0.6). The I76V variant was not identified in either the extended case series or the controls. We have identified a novel truncating mutation in PALB2. The mutation was found in approximately 0.5% of unselected French-Canadian women with early-onset breast cancer and appears to have a single origin. Although mutations are infrequent, PALB2 can be added to the list of breast cancer susceptibility genes for which founder mutations have been identified in the French-Canadian population.

Novel and recurrent non-truncating mutations of the MITF basic domain: genotypic and phenotypic variations in Waardenburg and Tietz syndromes

Science.gov (United States)

Léger, Sandy; Balguerie, Xavier; Goldenberg, Alice; Drouin-Garraud, Valérie; Cabot, Annick; Amstutz-Montadert, Isabelle; Young, Paul; Joly, Pascal; Bodereau, Virginie; Holder-Espinasse, Muriel; Jamieson, Robyn V; Krause, Amanda; Chen, Hongsheng; Baumann, Clarisse; Nunes, Luis; Dollfus, Hélène; Goossens, Michel; Pingault, Véronique

2012-01-01

The microphthalmia-associated transcription factor (MITF) is a basic helix-loop-helix leucine zipper transcription factor, which regulates melanocyte development and the biosynthetic melanin pathway. A notable relationship has been described between non-truncating mutations of its basic domain and Tietz syndrome, which is characterized by albinoid-like hypopigmentation of the skin and hair, rather than the patchy depigmentation seen in Waardenburg syndrome, and severe hearing loss. Twelve patients with new or recurrent non-truncating mutations of the MITF basic domain from six families were enrolled in this study. We observed a wide range of phenotypes and some unexpected features. All the patients had blue irides and pigmentation abnormalities that ranged from diffuse hypopigmentation to Waardenburg-like patches. In addition, they showed congenital complete hearing loss, diffuse hypopigmentation of the skin, freckling and ocular abnormalities, more frequently than patients with MITF mutations outside the basic domain. In conclusion, the non-truncating mutations of the basic domain do not always lead to Tietz syndrome but rather to a large range of phenotypes. Sun-exposed freckles are interestingly observed more frequently in Asian populations. This variability argues for the possible interaction with modifier loci. PMID:22258527

A novel germline mutation in the aryl hydrocarbon receptor-interacting protein (AIP) gene in an Italian family with gigantism.

Science.gov (United States)

Urbani, C; Russo, D; Raggi, F; Lombardi, M; Sardella, C; Scattina, I; Lupi, I; Manetti, L; Tomisti, L; Marcocci, C; Martino, E; Bogazzi, F

2014-10-01

Acromegaly usually occurs as a sporadic disease, but it may be a part of familial pituitary tumor syndromes in rare cases. Germline mutations in the aryl hydrocarbon receptor-interacting protein (AIP) gene have been associated with a predisposition to familial isolated pituitary adenoma. The aim of the present study was to evaluate the AIP gene in a patient with gigantism and in her relatives. Direct sequencing of AIP gene was performed in fourteen members of the family, spanning among three generations. The index case was an 18-year-old woman with gigantism due to an invasive GH-secreting pituitary adenoma and a concomitant tall-cell variant of papillary thyroid carcinoma. A novel germline mutation in the AIP gene (c.685C>T, p.Q229X) was identified in the proband and in two members of her family, who did not present clinical features of acromegaly or other pituitary disorders. Eleven subjects had no mutation in the AIP gene. Two members of the family with clinical features of acromegaly refused either the genetic or the biochemical evaluation. The Q229X mutation was predicted to generate a truncated AIP protein, lacking the last two tetratricopeptide repeat domains and the final C-terminal α-7 helix. We identified a new AIP germline mutation predicted to produce a truncated AIP protein, lacking its biological properties due to the disruption of the C-terminus binding sites for both the chaperones and the client proteins of AIP.

Truncating Mutations of MAGEL2, a Gene within the Prader-Willi Locus, Are Responsible for Severe Arthrogryposis

Science.gov (United States)

Mejlachowicz, Dan; Nolent, Flora; Maluenda, Jérome; Ranjatoelina-Randrianaivo, Hanitra; Giuliano, Fabienne; Gut, Ivo; Sternberg, Damien; Laquerrière, Annie; Melki, Judith

2015-01-01

Arthrogryposis multiplex congenita (AMC) is characterized by the presence of multiple joint contractures resulting from reduced or absent fetal movement. Here, we report two unrelated families affected by lethal AMC. By genetic mapping and whole-exome sequencing in a multiplex family, a heterozygous truncating MAGEL2 mutation leading to frameshift and a premature stop codon (c.1996delC, p.Gln666Serfs∗36) and inherited from the father was identified in the probands. In another family, a distinct heterozygous truncating mutation leading to frameshift (c.2118delT, p.Leu708Trpfs∗7) and occurring de novo on the paternal allele of MAGEL2 was identified in the affected individual. In both families, RNA analysis identified the mutated paternal MAGEL2 transcripts only in affected individuals. MAGEL2 is one of the paternally expressed genes within the Prader-Willi syndrome (PWS) locus. PWS is associated with, to varying extents, reduced fetal mobility, severe infantile hypotonia, childhood-onset obesity, hypogonadism, and intellectual disability. MAGEL2 mutations have been recently reported in affected individuals with features resembling PWS and called Schaaf-Yang syndrome. Here, we show that paternal MAGEL2 mutations are also responsible for lethal AMC, recapitulating the clinical spectrum of PWS and suggesting that MAGEL2 is a PWS-determining gene. PMID:26365340

Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

Energy Technology Data Exchange (ETDEWEB)

Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)

1995-08-28

Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

Mutation avoidance and DNA repair proficiency in Ustilago maydis are differentially lost with progressive truncation of the REC1 gene product

Energy Technology Data Exchange (ETDEWEB)

Onel, K.; Thelen, M.P.; Ferguson, D.O.; Bennett, R.L.; Holloman, W.K. [Cornell Univ. Medical College, NY, NY (United States)

1995-10-01

The REC1 gene of Ustilago maydis has an uninterrupted open reading frame, predicted from the genomic sequence to encode a protein of 522 amino acid residues. Nevertheless, an intron is present, and functional activity of the gene in mitotic cells requires an RNA processing event to remove the intron. This results in a change in reading frame and production of a protein of 463 amino acid residues. The 3{prime}{r_arrow}5{prime} exonuclease activity of proteins derived form the REC1 genomic open reading frame, the intronless open reading frame, and several mutants was investigated. The mutants included a series of deletions constructed by removing restriction fragments at the 3{prime} end of the cloned REC1 gene and a set of mutant alleles previously isolated in screens for radiation sensitivity. The results indicated that elimination of the C-terminal third of the protein did not result in a serious reduction in 3{prime}{r_arrow}5{prime} exonuclease activity, but deletion into the midsection caused a severe loss of activity. The biological activity of the rec1-1 allele, which encodes a truncated polypeptide with full 3{prime}{r_arrow}5{prime} exonuclease activity, and the rec1-5 allele, which encodes a more severely truncated polypeptide with no exonuclease activity, was investigated. The two mutants were equally sensitive to the lethal effect of UV light, but the spontaneous mutation rate was elevated 10-fold over the wild-type rate in the rec1-1 mutant and 100-fold in the rec1-5 mutant. The elevated spontaneous mutation rate correlated with the ablation of exonuclease activity, but the radiation sensitivity did not. These results indicate that the C-terminal portion of the Rec1 protein is not essential for exonuclease activity but is crucial in the role of REC1 in DNA damage repair. 49 refs., 3 figs., 1 tab.

A protein-truncating R179X variant in RNF186 confers protection against ulcerative colitis

NARCIS (Netherlands)

Rivas, Manuel A.; Graham, Daniel; Sulem, Patrick; Stevens, Christine; Desch, A. Nicole; Goyette, Philippe; Gudbjartsson, Daniel; Jonsdottir, Ingileif; Thorsteinsdottir, Unnur; Degenhardt, Frauke; Mucha, Soeren; Kurki, Mitja I.; Li, Dalin; D'Amato, Mauro; Annese, Vito; Vermeire, Severine; Weersma, Rinse K.; Halfvarson, Jonas; Paavola-Sakki, Paulina; Lappalainen, Maarit; Lek, Monkol; Cummings, Beryl; Tukiainen, Taru; Haritunians, Talin; Halme, Leena; Koskinen, Lotta L. E.; Ananthakrishnan, Ashwin N.; Luo, Yang; Heap, Graham A.; Visschedijk, Marijn C.; MacArthur, Daniel G.; Neale, Benjamin M.; Ahmad, Tariq; Anderson, Carl A.; Brant, Steven R.; Duerr, Richard H.; Silverberg, Mark S.; Cho, Judy H.; Palotie, Aarno; Saavalainen, Paivi; Kontula, Kimmo; Farkkila, Martti; McGovern, Dermot P. B.; Franke, Andre; Stefansson, Kari; Rioux, John D.; Xavier, Ramnik J.; Daly, Mark J.

Protein-truncating variants protective against human disease provide in vivo validation of therapeutic targets. Here we used targeted sequencing to conduct a search for protein-truncating variants conferring protection against inflammatory bowel disease exploiting knowledge of common variants

Truncated forms of viral VP2 proteins fused to EGFP assemble into fluorescent parvovirus-like particles

Directory of Open Access Journals (Sweden)

Vuento Matti

2006-12-01

Full Text Available Abstract Fluorescence correlation spectroscopy (FCS monitors random movements of fluorescent molecules in solution, giving information about the number and the size of for example nano-particles. The canine parvovirus VP2 structural protein as well as N-terminal deletion mutants of VP2 (-14, -23, and -40 amino acids were fused to the C-terminus of the enhanced green fluorescent protein (EGFP. The proteins were produced in insect cells, purified, and analyzed by western blotting, confocal and electron microscopy as well as FCS. The non-truncated form, EGFP-VP2, diffused with a hydrodynamic radius of 17 nm, whereas the fluorescent mutants truncated by 14, 23 and 40 amino acids showed hydrodynamic radii of 7, 20 and 14 nm, respectively. These results show that the non-truncated EGFP-VP2 fusion protein and the EGFP-VP2 constructs truncated by 23 and by as much as 40 amino acids were able to form virus-like particles (VLPs. The fluorescent VLP, harbouring VP2 truncated by 23 amino acids, showed a somewhat larger hydrodynamic radius compared to the non-truncated EGFP-VP2. In contrast, the construct containing EGFP-VP2 truncated by 14 amino acids was not able to assemble into VLP-resembling structures. Formation of capsid structures was confirmed by confocal and electron microscopy. The number of fluorescent fusion protein molecules present within the different VLPs was determined by FCS. In conclusion, FCS provides a novel strategy to analyze virus assembly and gives valuable structural information for strategic development of parvovirus-like particles.

A novel truncating mutation in FLNA causes periventricular nodular heterotopia, Ehlers-Danlos-like collagenopathy and macrothrombocytopenia.

Science.gov (United States)

Ieda, Daisuke; Hori, Ikumi; Nakamura, Yuji; Ohshita, Hironori; Negishi, Yutaka; Shinohara, Tsutomu; Hattori, Ayako; Kato, Takenori; Inukai, Sachiko; Kitamura, Katsumasa; Kawai, Tomoki; Ohara, Osamu; Kunishima, Shinji; Saitoh, Shinji

2018-06-01

Filamin A (FLNA) is located in Xq28, and encodes the actin binding protein, filamin A. A mutation in FLNA is the most common cause of periventricular nodular heterotopia (PVNH), but a clear phenotype-genotype correlation has not been established. Indeed, some patients with a FLNA mutation have recently been shown to additionally have Ehlers-Danlos-like collagenopathy or macrothrombocytopenia. In an attempt to establish a clearer correlation between clinical symptoms and genotype, we have investigated a phenotype that involves thrombocytopenia in a patient with a truncation of the FLNA gene. We present the case of a 4-year-old girl who, at birth, showed a ventral hernia. At 2 months of age, she was diagnosed with patent ductus arteriosus (PDA) and aortic valve regurgitation. At 11 months, she underwent ligation of the PDA. She was also diagnosed with diaphragmatic eventration by a preoperative test. At 19 months, motor developmental delay was noted, and brain MRI revealed bilateral PVNH with mega cisterna magna. Presently, there is no evidence of epilepsy, intellectual disability or motor developmental delay. She has chronic, mild thrombocytopenia, and a platelet count that transiently decreases after viral infection. Dilation of the ascending aorta is progressing gradually. Genetic testing revealed a de novo nonsense heterozygous mutation in FLNA (NM_001456.3: c.1621G > T; p.Glu541Ter). Immunofluorescence staining of a peripheral blood smear showed a lack of filamin A expression in 21.1% of her platelets. These filamin A-negative platelets were slightly larger than her normal platelets. Our data suggests immunofluorescence staining of peripheral blood smears is a convenient diagnostic approach to identify patients with a FLNA mutation, which will facilitate further investigation of the correlation between FLNA mutations and patient phenotype. Copyright © 2018 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Functional characterization of fidgetin, an AAA-family protein mutated in fidget mice

International Nuclear Information System (INIS)

Yang Yan; Mahaffey, Connie L.; Berube, Nathalie; Nystuen, Arne; Frankel, Wayne N.

2005-01-01

The mouse fidget mutation is an autosomal recessive mutation that renders reduced or absent semicircular canals, microphthalmia, and various skeletal abnormalities to affected mice. We previously identified the defective gene which encodes fidgetin, a new member of the ATPases associated with diverse cellular activities (AAA proteins). Here, we report on the subcellular localization of fidgetin as well as that of two closely related proteins, fidgetin-like 1 and fidgetin-like 2. Epitope-tagging and immunostaining revealed that both fidgetin and fidgetin-like 2 were predominantly localized to the nucleus, whereas fidgetin-like 1 was both nuclear and cytoplasmic. Furthermore, deletion studies identified a putative bipartite nuclear localization signal in the middle portion of the fidgetin protein. Since AAA proteins are known to form functional hetero- or homo-hexamers, we used reciprocal immunoprecipitation to examine the potential interaction among these proteins. We found that fidgetin interacted with itself and this specific interaction was abolished when either the N- or C-terminus of the protein was truncated. Taken together, our results suggest that fidgetin is a nuclear AAA-family protein with the potential to form homo-oligomers, thus representing the first step towards the elucidation of fidgetin's cellular function and the disease mechanism in fidget mutant mice

Identification of a functionally distinct truncated BDNF mRNA splice variant and protein in Trachemys scripta elegans.

Directory of Open Access Journals (Sweden)

Ganesh Ambigapathy

Full Text Available Brain-derived neurotrophic factor (BDNF has a diverse functional role and complex pattern of gene expression. Alternative splicing of mRNA transcripts leads to further diversity of mRNAs and protein isoforms. Here, we describe the regulation of BDNF mRNA transcripts in an in vitro model of eyeblink classical conditioning and a unique transcript that forms a functionally distinct truncated BDNF protein isoform. Nine different mRNA transcripts from the BDNF gene of the pond turtle Trachemys scripta elegans (tBDNF are selectively regulated during classical conditioning: exon I mRNA transcripts show no change, exon II transcripts are downregulated, while exon III transcripts are upregulated. One unique transcript that codes from exon II, tBDNF2a, contains a 40 base pair deletion in the protein coding exon that generates a truncated tBDNF protein. The truncated transcript and protein are expressed in the naïve untrained state and are fully repressed during conditioning when full-length mature tBDNF is expressed, thereby having an alternate pattern of expression in conditioning. Truncated BDNF is not restricted to turtles as a truncated mRNA splice variant has been described for the human BDNF gene. Further studies are required to determine the ubiquity of truncated BDNF alternative splice variants across species and the mechanisms of regulation and function of this newly recognized BDNF protein.

Identification of a functionally distinct truncated BDNF mRNA splice variant and protein in Trachemys scripta elegans.

Science.gov (United States)

Ambigapathy, Ganesh; Zheng, Zhaoqing; Li, Wei; Keifer, Joyce

2013-01-01

Brain-derived neurotrophic factor (BDNF) has a diverse functional role and complex pattern of gene expression. Alternative splicing of mRNA transcripts leads to further diversity of mRNAs and protein isoforms. Here, we describe the regulation of BDNF mRNA transcripts in an in vitro model of eyeblink classical conditioning and a unique transcript that forms a functionally distinct truncated BDNF protein isoform. Nine different mRNA transcripts from the BDNF gene of the pond turtle Trachemys scripta elegans (tBDNF) are selectively regulated during classical conditioning: exon I mRNA transcripts show no change, exon II transcripts are downregulated, while exon III transcripts are upregulated. One unique transcript that codes from exon II, tBDNF2a, contains a 40 base pair deletion in the protein coding exon that generates a truncated tBDNF protein. The truncated transcript and protein are expressed in the naïve untrained state and are fully repressed during conditioning when full-length mature tBDNF is expressed, thereby having an alternate pattern of expression in conditioning. Truncated BDNF is not restricted to turtles as a truncated mRNA splice variant has been described for the human BDNF gene. Further studies are required to determine the ubiquity of truncated BDNF alternative splice variants across species and the mechanisms of regulation and function of this newly recognized BDNF protein.

Mutations in a Novel Isoform of TRIOBP That Encodes a Filamentous-Actin Binding Protein Are Responsible for DFNB28 Recessive Nonsyndromic Hearing Loss

OpenAIRE

Shahin, Hashem; Walsh, Tom; Sobe, Tama; Abu Sa’ed, Judeh; Abu Rayan, Amal; Lynch, Eric D.; Lee, Ming K.; Avraham, Karen B.; King, Mary-Claire; Kanaan, Moein

2005-01-01

In a large consanguineous Palestinian kindred, we previously mapped DFNB28—a locus associated with recessively inherited, prelingual, profound sensorineural hearing impairment—to chromosome 22q13.1. We report here that mutations in a novel 218-kDa isoform of TRIOBP (TRIO and filamentous actin [F-actin] binding protein) are associated with DFNB28 hearing loss in a total of nine Palestinian families. Two nonsense mutations (R347X and Q581X) truncate the protein, and a potentially deleterious mi...

Novel C16orf57 mutations in patients with Poikiloderma with Neutropenia: bioinformatic analysis of the protein and predicted effects of all reported mutations

Directory of Open Access Journals (Sweden)

Colombo Elisa A

2012-01-01

Full Text Available Abstract Background Poikiloderma with Neutropenia (PN is a rare autosomal recessive genodermatosis caused by C16orf57 mutations. To date 17 mutations have been identified in 31 PN patients. Results We characterize six PN patients expanding the clinical phenotype of the syndrome and the mutational repertoire of the gene. We detect the two novel C16orf57 mutations, c.232C>T and c.265+2T>G, as well as the already reported c.179delC, c.531delA and c.693+1G>T mutations. cDNA analysis evidences the presence of aberrant transcripts, and bioinformatic prediction of C16orf57 protein structure gauges the mutations effects on the folded protein chain. Computational analysis of the C16orf57 protein shows two conserved H-X-S/T-X tetrapeptide motifs marking the active site of a two-fold pseudosymmetric structure recalling the 2H phosphoesterase superfamily. Based on this model C16orf57 is likely a 2H-active site enzyme functioning in RNA processing, as a presumptive RNA ligase. According to bioinformatic prediction, all known C16orf57 mutations, including the novel mutations herein described, impair the protein structure by either removing one or both tetrapeptide motifs or by destroying the symmetry of the native folding. Finally, we analyse the geographical distribution of the recurrent mutations that depicts clusters featuring a founder effect. Conclusions In cohorts of patients clinically affected by genodermatoses with overlapping symptoms, the molecular screening of C16orf57 gene seems the proper way to address the correct diagnosis of PN, enabling the syndrome-specific oncosurveillance. The bioinformatic prediction of the C16orf57 protein structure denotes a very basic enzymatic function consistent with a housekeeping function. Detection of aberrant transcripts, also in cells from PN patients carrying early truncated mutations, suggests they might be translatable. Tissue-specific sensitivity to the lack of functionally correct protein accounts for the

Functional analysis of the novel TBX5 c.1333delC mutation resulting in an extended TBX5 protein

Directory of Open Access Journals (Sweden)

Ekman-Joelsson Britt-Marie

2008-10-01

Full Text Available Abstract Background Autosomal dominant Holt-Oram syndrome (HOS is caused by mutations in the TBX5 gene and is characterized by congenital heart and preaxial radial ray upper limb defects. Most of the TBX5 mutations found in patients with HOS cause premature truncation of the primary TBX5 transcript. TBX5 missense mutations alter the three-dimensional structure of the protein and result in failed nuclear localization or reduced binding to target DNA. In this study we present our functional analyses of the novel and unusual c.1333delC mutation found in a patient with classical HOS. Methods The functional impact of this novel mutation was assessed by investigating the intracellular localization of the resulting TBX5 protein and its ability to activate the expression of its downstream target ANF. Results The deletion of the cytosine is the first TBX5 frameshift mutation predicted to result in an elongated TBX5 protein with 74 miscoding amino acids and 62 supernumerary C-terminal amino acids. The c.1333delC mutation affects neither the nuclear localization, nor its colocalization with SALL4, but severely affects the activation of the ANF promoter. Conclusion The mutation c.1333delC does not locate within functional domains, but impairs the activation of the downstream target. This suggests that misfolding of the protein prevents its biological function.

USH1G with unique retinal findings caused by a novel truncating mutation identified by genome-wide linkage analysis

Science.gov (United States)

Taibah, Khalid; Bin-Khamis, Ghada; Kennedy, Shelley; Hemidan, Amal; Al-Qahtani, Faisal; Tabbara, Khalid; Mubarak, Bashayer Al; Ramzan, Khushnooda; Meyer, Brian F.; Al-Owain, Mohammed

2012-01-01

Purpose Usher syndrome (USH) is an autosomal recessive disorder divided into three distinct clinical subtypes based on the severity of the hearing loss, manifestation of vestibular dysfunction, and the age of onset of retinitis pigmentosa and visual symptoms. To date, mutations in seven different genes have been reported to cause USH type 1 (USH1), the most severe form. Patients diagnosed with USH1 are known to be ideal candidates to benefit from cochlear implantation. Methods Genome-wide linkage analysis using Affymetrix GeneChip Human Mapping 10K arrays were performed in three cochlear implanted Saudi siblings born from a consanguineous marriage, clinically diagnosed with USH1 by comprehensive clinical, audiological, and ophthalmological examinations. From the linkage results, the USH1G gene was screened for mutations by direct sequencing of the coding exons. Results We report the identification of a novel p.S243X truncating mutation in USH1G that segregated with the disease phenotype and was not present in 300 ethnically matched normal controls. We also report on the novel retinal findings and the outcome of cochlear implantation in the affected individuals. Conclusions In addition to reporting a novel truncating mutation, this report expands the retinal phenotype in USH1G and presents the first report of successful cochlear implants in this disease. PMID:22876113

Differential isotope dansylation labeling combined with liquid chromatography mass spectrometry for quantification of intact and N-terminal truncated proteins

International Nuclear Information System (INIS)

Tang, Yanan; Li, Liang

2013-01-01

Graphical abstract: -- Highlights: •LC–MS was developed for quantifying protein mixtures containing both intact and N-terminal truncated proteins. • 12 C 2 -Dansylation of the N-terminal amino acid of proteins was done first, followed by microwave-assisted acid hydrolysis. •The released 12 C 2 -dansyl labeled N-terminal amino acid was quantified using 13 C 2 -dansyl labeled amino acid standards. •The method provided accurate and precise results for quantifying intact and N-terminal truncated proteins within 8 h. -- Abstract: The N-terminal amino acids of proteins are important structure units for maintaining the biological function, localization, and interaction networks of proteins. Under different biological conditions, one or several N-terminal amino acids could be cleaved from an intact protein due to processes, such as proteolysis, resulting in the change of protein properties. Thus, the ability to quantify the N-terminal truncated forms of proteins is of great importance, particularly in the area of development and production of protein-based drugs where the relative quantity of the intact protein and its truncated form needs to be monitored. In this work, we describe a rapid method for absolute quantification of protein mixtures containing intact and N-terminal truncated proteins. This method is based on dansylation labeling of the N-terminal amino acids of proteins, followed by microwave-assisted acid hydrolysis of the proteins into amino acids. It is shown that dansyl labeled amino acids are stable in acidic conditions and can be quantified by liquid chromatography mass spectrometry (LC–MS) with the use of isotope analog standards

Novel APC gene mutations associated with protein alteration in diffuse type gastric cancer.

Science.gov (United States)

Ghatak, Souvik; Chakraborty, Payel; Sarkar, Sandeep Roy; Chowdhury, Biswajit; Bhaumik, Arup; Kumar, Nachimuthu Senthil

2017-06-02

The role of adenomatous polyposis coli (APC) gene in mitosis might be critical for regulation of genomic stability and chromosome segregation. APC gene mutations have been associated to have a role in colon cancer and since gastric and colon tumors share some common genetic lesions, it is relevant to investigate the role of APC tumor suppressor gene in gastric cancer. We investigated for somatic mutations in the Exons 14 and 15 of APC gene from 40 diffuse type gastric cancersamples. Rabbit polyclonal anti-APC antibody was used, which detects the wild-type APC protein and was recommended for detection of the respective protein in human tissues. Cell cycle analysis was done from tumor and adjacent normal tissue. APC immunoreactivity showed positive expression of the protein in stages I, II, III and negative expression in Stages III and IV. Two novel deleterious variations (g.127576C > A, g.127583C > T) in exon 14 sequence were found to generate stop codon (Y622* and Q625*)in the tumor samples. Due to the generation of stop codon, the APC protein might be truncated and all the regulatory features could be lost which has led to the down-regulation of protein expression. Our results indicate that aneuploidy might occurdue to the codon 622 and 625 APC-driven gastric tumorigenesis, in agreement with our cell cycle analysis. The APC gene function in mitosis and chromosomal stability might be lost and G1 might be arrested with high quantity of DNA in the S phase. Six missense somatic mutations in tumor samples were detected in exon 15 A-B, twoof which showed pathological and disease causing effects based on SIFT, Polyphen2 and SNPs & GO score and were not previously reported in the literature or the public mutation databases. The two novel pathological somatic mutations (g.127576C > A, g.127583C > T) in exon 14 might be altering the protein expression leading to development of gastric cancer in the study population. Our study showed that mutations in the APC

Two truncating USH3A mutations, including one novel, in a German family with Usher syndrome.

Science.gov (United States)

Ebermann, Inga; Wilke, Robert; Lauhoff, Thomas; Lübben, Dirk; Zrenner, Eberhart; Bolz, Hanno Jörn

2007-08-30

To identify the genetic defect in a German family with Usher syndrome (USH) and linkage to the USH3A locus. DNA samples of five family members (both parents and the three patients) were genotyped with polymorphic microsatellite markers specific for eight USH genes. Three affected family members underwent detailed ocular and audiologic characterization. Symptoms in the patients were compatible with Usher syndrome and show intrafamilial variation, for both hearing loss (ranging from severe to profound with non-linear progression) and vision. Genotyping of microsatellite markers for the different USH loci was in line with a defect in the USH3A gene on chromosome 3q25. Sequence analysis of the USH3A gene revealed two truncating mutations; c.149_152delCAGGinsTGTCCAAT, which has been described previously, and a novel mutation, c.502_503insA, segregating with the phenotype. To date, only 11 USH3A mutations have been described. This is the first description of a German family with USH due to USH3A mutations, including one novel. Our findings indicate that also in the Central European population, USH3A mutations should be considered in cases of USH.

Differential isotope dansylation labeling combined with liquid chromatography mass spectrometry for quantification of intact and N-terminal truncated proteins

Energy Technology Data Exchange (ETDEWEB)

Tang, Yanan; Li, Liang, E-mail: Liang.Li@ualberta.ca

2013-08-20

Graphical abstract: -- Highlights: •LC–MS was developed for quantifying protein mixtures containing both intact and N-terminal truncated proteins. •{sup 12}C{sub 2}-Dansylation of the N-terminal amino acid of proteins was done first, followed by microwave-assisted acid hydrolysis. •The released {sup 12}C{sub 2}-dansyl labeled N-terminal amino acid was quantified using {sup 13}C{sub 2}-dansyl labeled amino acid standards. •The method provided accurate and precise results for quantifying intact and N-terminal truncated proteins within 8 h. -- Abstract: The N-terminal amino acids of proteins are important structure units for maintaining the biological function, localization, and interaction networks of proteins. Under different biological conditions, one or several N-terminal amino acids could be cleaved from an intact protein due to processes, such as proteolysis, resulting in the change of protein properties. Thus, the ability to quantify the N-terminal truncated forms of proteins is of great importance, particularly in the area of development and production of protein-based drugs where the relative quantity of the intact protein and its truncated form needs to be monitored. In this work, we describe a rapid method for absolute quantification of protein mixtures containing intact and N-terminal truncated proteins. This method is based on dansylation labeling of the N-terminal amino acids of proteins, followed by microwave-assisted acid hydrolysis of the proteins into amino acids. It is shown that dansyl labeled amino acids are stable in acidic conditions and can be quantified by liquid chromatography mass spectrometry (LC–MS) with the use of isotope analog standards.

Expression and characterization of an N-truncated form of the NifA protein of Azospirillum brasilense

Directory of Open Access Journals (Sweden)

C.Y. Nishikawa

2012-02-01

Full Text Available Azospirillum brasilense is a nitrogen-fixing bacterium associated with important agricultural crops such as rice, wheat and maize. The expression of genes responsible for nitrogen fixation (nif genes in this bacterium is dependent on the transcriptional activator NifA. This protein contains three structural domains: the N-terminal domain is responsible for the negative control by fixed nitrogen; the central domain interacts with the RNA polymerase σ54 co-factor and the C-terminal domain is involved in DNA binding. The central and C-terminal domains are linked by the interdomain linker (IDL. A conserved four-cysteine motif encompassing the end of the central domain and the IDL is probably involved in the oxygen-sensitivity of NifA. In the present study, we have expressed, purified and characterized an N-truncated form of A. brasilense NifA. The protein expression was carried out in Escherichia coli and the N-truncated NifA protein was purified by chromatography using an affinity metal-chelating resin followed by a heparin-bound resin. Protein homogeneity was determined by densitometric analysis. The N-truncated protein activated in vivo nifH::lacZ transcription regardless of fixed nitrogen concentration (absence or presence of 20 mM NH4Cl but only under low oxygen levels. On the other hand, the aerobically purified N-truncated NifA protein bound to the nifB promoter, as demonstrated by an electrophoretic mobility shift assay, implying that DNA-binding activity is not strictly controlled by oxygen levels. Our data show that, while the N-truncated NifA is inactive in vivo under aerobic conditions, it still retains DNA-binding activity, suggesting that the oxidized form of NifA bound to DNA is not competent to activate transcription.

Expression and characterization of an N-truncated form of the NifA protein of Azospirillum brasilense

Energy Technology Data Exchange (ETDEWEB)

Nishikawa, C.Y.; Araújo, L.M.; Kadowaki, M.A.S.; Monteiro, R.A.; Steffens, M.B.R.; Pedrosa, F.O.; Souza, E.M.; Chubatsu, L.S. [Departamento de Bioquímica e Biologia Molecular, Universidade Federal do Paraná, Curitiba, PR (Brazil)

2012-01-27

Azospirillum brasilense is a nitrogen-fixing bacterium associated with important agricultural crops such as rice, wheat and maize. The expression of genes responsible for nitrogen fixation (nif genes) in this bacterium is dependent on the transcriptional activator NifA. This protein contains three structural domains: the N-terminal domain is responsible for the negative control by fixed nitrogen; the central domain interacts with the RNA polymerase σ{sup 54} factor and the C-terminal domain is involved in DNA binding. The central and C-terminal domains are linked by the interdomain linker (IDL). A conserved four-cysteine motif encompassing the end of the central domain and the IDL is probably involved in the oxygen-sensitivity of NifA. In the present study, we have expressed, purified and characterized an N-truncated form of A. brasilense NifA. The protein expression was carried out in Escherichia coli and the N-truncated NifA protein was purified by chromatography using an affinity metal-chelating resin followed by a heparin-bound resin. Protein homogeneity was determined by densitometric analysis. The N-truncated protein activated in vivo nifH::lacZ transcription regardless of fixed nitrogen concentration (absence or presence of 20 mM NH{sub 4}Cl) but only under low oxygen levels. On the other hand, the aerobically purified N-truncated NifA protein bound to the nifB promoter, as demonstrated by an electrophoretic mobility shift assay, implying that DNA-binding activity is not strictly controlled by oxygen levels. Our data show that, while the N-truncated NifA is inactive in vivo under aerobic conditions, it still retains DNA-binding activity, suggesting that the oxidized form of NifA bound to DNA is not competent to activate transcription.

Expression and characterization of an N-truncated form of the NifA protein of Azospirillum brasilense.

Science.gov (United States)

Nishikawa, C Y; Araújo, L M; Kadowaki, M A S; Monteiro, R A; Steffens, M B R; Pedrosa, F O; Souza, E M; Chubatsu, L S

2012-02-01

Azospirillum brasilense is a nitrogen-fixing bacterium associated with important agricultural crops such as rice, wheat and maize. The expression of genes responsible for nitrogen fixation (nif genes) in this bacterium is dependent on the transcriptional activator NifA. This protein contains three structural domains: the N-terminal domain is responsible for the negative control by fixed nitrogen; the central domain interacts with the RNA polymerase σ(54) co-factor and the C-terminal domain is involved in DNA binding. The central and C-terminal domains are linked by the interdomain linker (IDL). A conserved four-cysteine motif encompassing the end of the central domain and the IDL is probably involved in the oxygen-sensitivity of NifA. In the present study, we have expressed, purified and characterized an N-truncated form of A. brasilense NifA. The protein expression was carried out in Escherichia coli and the N-truncated NifA protein was purified by chromatography using an affinity metal-chelating resin followed by a heparin-bound resin. Protein homogeneity was determined by densitometric analysis. The N-truncated protein activated in vivo nifH::lacZ transcription regardless of fixed nitrogen concentration (absence or presence of 20 mM NH(4)Cl) but only under low oxygen levels. On the other hand, the aerobically purified N-truncated NifA protein bound to the nifB promoter, as demonstrated by an electrophoretic mobility shift assay, implying that DNA-binding activity is not strictly controlled by oxygen levels. Our data show that, while the N-truncated NifA is inactive in vivo under aerobic conditions, it still retains DNA-binding activity, suggesting that the oxidized form of NifA bound to DNA is not competent to activate transcription.

Expression and characterization of an N-truncated form of the NifA protein of Azospirillum brasilense

International Nuclear Information System (INIS)

Nishikawa, C.Y.; Araújo, L.M.; Kadowaki, M.A.S.; Monteiro, R.A.; Steffens, M.B.R.; Pedrosa, F.O.; Souza, E.M.; Chubatsu, L.S.

2012-01-01

Azospirillum brasilense is a nitrogen-fixing bacterium associated with important agricultural crops such as rice, wheat and maize. The expression of genes responsible for nitrogen fixation (nif genes) in this bacterium is dependent on the transcriptional activator NifA. This protein contains three structural domains: the N-terminal domain is responsible for the negative control by fixed nitrogen; the central domain interacts with the RNA polymerase σ 54 factor and the C-terminal domain is involved in DNA binding. The central and C-terminal domains are linked by the interdomain linker (IDL). A conserved four-cysteine motif encompassing the end of the central domain and the IDL is probably involved in the oxygen-sensitivity of NifA. In the present study, we have expressed, purified and characterized an N-truncated form of A. brasilense NifA. The protein expression was carried out in Escherichia coli and the N-truncated NifA protein was purified by chromatography using an affinity metal-chelating resin followed by a heparin-bound resin. Protein homogeneity was determined by densitometric analysis. The N-truncated protein activated in vivo nifH::lacZ transcription regardless of fixed nitrogen concentration (absence or presence of 20 mM NH 4 Cl) but only under low oxygen levels. On the other hand, the aerobically purified N-truncated NifA protein bound to the nifB promoter, as demonstrated by an electrophoretic mobility shift assay, implying that DNA-binding activity is not strictly controlled by oxygen levels. Our data show that, while the N-truncated NifA is inactive in vivo under aerobic conditions, it still retains DNA-binding activity, suggesting that the oxidized form of NifA bound to DNA is not competent to activate transcription

Maltose binding protein-fusion enhances the bioactivity of truncated forms of pig myostatin propeptide produced in E. coli.

Directory of Open Access Journals (Sweden)

Sang Beum Lee

Full Text Available Myostatin (MSTN is a potent negative regulator of skeletal muscle growth. MSTN propeptide (MSTNpro inhibits MSTN binding to its receptor through complex formation with MSTN, implying that MSTNpro can be a useful agent to improve skeletal muscle growth in meat-producing animals. Four different truncated forms of pig MSTNpro containing N-terminal maltose binding protein (MBP as a fusion partner were expressed in E. coli, and purified by the combination of affinity chromatography and gel filtration. The MSTN-inhibitory capacities of these proteins were examined in an in vitro gene reporter assay. A MBP-fused, truncated MSTNpro containing residues 42-175 (MBP-Pro42-175 exhibited the same MSTN-inhibitory potency as the full sequence MSTNpro. Truncated MSTNpro proteins containing either residues 42-115 (MBP-Pro42-115 or 42-98 (MBP-Pro42-98 also exhibited MSTN-inhibitory capacity even though the potencies were significantly lower than that of full sequence MSTNpro. In pull-down assays, MBP-Pro42-175, MBP-Pro42-115, and MBP-Pro42-98 demonstrated their binding to MSTN. MBP was removed from the truncated MSTNpro proteins by incubation with factor Xa to examine the potential role of MBP on MSTN-inhibitory capacity of those proteins. Removal of MBP from MBP-Pro42-175 and MBP-Pro42-98 resulted in 20-fold decrease in MSTN-inhibitory capacity of Pro42-175 and abolition of MSTN-inhibitory capacity of Pro42-98, indicating that MBP as fusion partner enhanced the MSTN-inhibitory capacity of those truncated MSTNpro proteins. In summary, this study shows that MBP is a very useful fusion partner in enhancing MSTN-inhibitory potency of truncated forms of MSTNpro proteins, and MBP-fused pig MSTNpro consisting of amino acid residues 42-175 is sufficient to maintain the full MSTN-inhibitory capacity.

Mutations in Alström protein impair terminal differentiation of cardiomyocytes.

Science.gov (United States)

Shenje, Lincoln T; Andersen, Peter; Halushka, Marc K; Lui, Cecillia; Fernandez, Laviel; Collin, Gayle B; Amat-Alarcon, Nuria; Meschino, Wendy; Cutz, Ernest; Chang, Kenneth; Yonescu, Raluca; Batista, Denise A S; Chen, Yan; Chelko, Stephen; Crosson, Jane E; Scheel, Janet; Vricella, Luca; Craig, Brian D; Marosy, Beth A; Mohr, David W; Hetrick, Kurt N; Romm, Jane M; Scott, Alan F; Valle, David; Naggert, Jürgen K; Kwon, Chulan; Doheny, Kimberly F; Judge, Daniel P

2014-03-04

Cardiomyocyte cell division and replication in mammals proceed through embryonic development and abruptly decline soon after birth. The process governing cardiomyocyte cell cycle arrest is poorly understood. Here we carry out whole-exome sequencing in an infant with evidence of persistent postnatal cardiomyocyte replication to determine the genetic risk factors. We identify compound heterozygous ALMS1 mutations in the proband, and confirm their presence in her affected sibling, one copy inherited from each heterozygous parent. Next, we recognize homozygous or compound heterozygous truncating mutations in ALMS1 in four other children with high levels of postnatal cardiomyocyte proliferation. Alms1 mRNA knockdown increases multiple markers of proliferation in cardiomyocytes, the percentage of cardiomyocytes in G2/M phases, and the number of cardiomyocytes by 10% in cultured cells. Homozygous Alms1-mutant mice have increased cardiomyocyte proliferation at 2 weeks postnatal compared with wild-type littermates. We conclude that deficiency of Alström protein impairs postnatal cardiomyocyte cell cycle arrest.

C-terminal truncations in human 3'-5' DNA exonuclease TREX1 cause autosomal dominant retinal vasculopathy with cerebral leukodystrophy

NARCIS (Netherlands)

Richards, Anna; van den Maagdenberg, Arn M. J. M.; Jen, Joanna C.; Kavanagh, David; Bertram, Paula; Spitzer, Dirk; Liszewski, M. Kathryn; Barilla-LaBarca, Maria-Louise; Terwindt, Gisela M.; Kasai, Yumi; McLellan, Mike; Grand, Mark Gilbert; Vanmolkot, Kaate R. J.; de Vries, Boukje; Wan, Jijun; Kane, Michael J.; Mamsa, Hafsa; Schäfer, Ruth; Stam, Anine H.; Haan, Joost; de Jong, Paulus T. V. M.; Storimans, Caroline W.; van Schooneveld, Mary J.; Oosterhuis, Jendo A.; Gschwendter, Andreas; Dichgans, Martin; Kotschet, Katya E.; Hodgkinson, Suzanne; Hardy, Todd A.; Delatycki, Martin B.; Hajj-Ali, Rula A.; Kothari, Parul H.; Nelson, Stanley F.; Frants, Rune R.; Baloh, Robert W.; Ferrari, Michel D.; Atkinson, John P.

2007-01-01

Autosomal dominant retinal vasculopathy with cerebral leukodystrophy is a microvascular endotheliopathy with middle-age onset. In nine families, we identified heterozygous C-terminal frameshift mutations in TREX1, which encodes a 3'-5' exonuclease. These truncated proteins retain exonuclease

C-terminal truncations in human 3 '-5 ' DNA exonuclease TREX1 cause autosomal dominant retinal vasculopathy with cerebral leukodystrophy

NARCIS (Netherlands)

Richards, Anna; van den Maagdenberg, Arn M. J. M.; Jen, Joanna C.; Kavanagh, David; Bertram, Paula; Spitzer, Dirk; Liszewski, M. Kathryn; Barilla-LaBarca, Maria-Louise; Terwindt, Gisela M.; Kasai, Yumi; McLellan, Mike; Grand, Mark Gilbert; Vanmolkot, Kaate R. J.; de Vries, Boukje; Wan, Jijun; Kane, Michael J.; Mamsa, Hafsa; Schaefer, Ruth; Stam, Anine H.; Haan, Joost; Paulus, T. V. M. de Jong; Storimans, Caroline W.; van Schooneveld, Mary J.; Oosterhuis, Jendo A.; Gschwendter, Andreas; Dichgans, Martin; Kotschet, Katya E.; Hodgkinson, Suzanne; Hardy, Todd A.; Delatycki, Martin B.; Hajj-Ali, Rula A.; Kothari, Parul H.; Nelson, Stanley F.; Frants, Rune R.; Baloh, Robert W.; Ferrari, Michel D.; Atkinson, John P.

Autosomal dominant retinal vasculopathy with cerebral leukodystrophy is a microvascular endotheliopathy with middle- age onset. In nine families, we identified heterozygous C- terminal frameshift mutations in TREX1, which encodes a 3'-5' exonuclease. These truncated proteins retain exonuclease

Truncating mutation in the NHS gene: phenotypic heterogeneity of Nance-Horan syndrome in an asian Indian family.

Science.gov (United States)

Ramprasad, Vedam Lakshmi; Thool, Alka; Murugan, Sakthivel; Nancarrow, Derek; Vyas, Prateep; Rao, Srinivas Kamalakar; Vidhya, Authiappan; Ravishankar, Krishnamoorthy; Kumaramanickavel, Govindasamy

2005-01-01

A four-generation family containing eight affected males who inherited X-linked developmental lens opacity and microcornea was studied. Some members in the family had mild to moderate nonocular clinical features suggestive of Nance-Horan syndrome. The purpose of the study was to map genetically the gene in the large 57-live-member Asian-Indian pedigree. PCR-based genotyping was performed on the X-chromosome, by using fluorescent microsatellite markers (10-cM intervals). Parametric linkage analysis was performed by using two disease models, assuming either recessive or dominant X-linked transmission by the MLINK/ILINK and FASTLINK (version 4.1P) programs (http:www.hgmp.mrc.ac.uk/; provided in the public domain by the Human Genome Mapping Project Resources Centre, Cambridge, UK). The NHS gene at the linked region was screened for mutation. By fine mapping, the disease gene was localized to Xp22.13. Multipoint analysis placed the peak LOD of 4.46 at DSX987. The NHS gene mapped to this region. Mutational screening in all the affected males and carrier females (heterozygous form) revealed a truncating mutation 115C-->T in exon 1, resulting in conversion of glutamine to stop codon (Q39X), but was not observed in unaffected individuals and control subjects. conclusions. A family with X-linked Nance-Horan syndrome had severe ocular, but mild to moderate nonocular, features. The clinical phenotype of the truncating mutation (Q39X) in the NHS gene suggests allelic heterogeneity at the NHS locus or the presence of modifier genes. X-linked families with cataract should be carefully examined for both ocular and nonocular features, to exclude Nance-Horan syndrome. RT-PCR analysis did not suggest nonsense-mediated mRNA decay as the possible mechanism for clinical heterogeneity.

Mutational definition of binding requirements of an hnRNP-like protein in Arabidopsis using fluorescence correlation spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Leder, Verena [Molecular Cell Physiology, Faculty of Biology, Bielefeld University (Germany); Biomolecular Photonics, Faculty of Physics, Bielefeld University (Germany); Lummer, Martina [Molecular Cell Physiology, Faculty of Biology, Bielefeld University (Germany); Tegeler, Kathrin [Molecular Cell Physiology, Faculty of Biology, Bielefeld University (Germany); Biomolecular Photonics, Faculty of Physics, Bielefeld University (Germany); Humpert, Fabian [Biomolecular Photonics, Faculty of Physics, Bielefeld University (Germany); Lewinski, Martin [Molecular Cell Physiology, Faculty of Biology, Bielefeld University (Germany); Schüttpelz, Mark [Biomolecular Photonics, Faculty of Physics, Bielefeld University (Germany); Staiger, Dorothee, E-mail: dorothee.staiger@uni-bielefeld.de [Molecular Cell Physiology, Faculty of Biology, Bielefeld University (Germany)

2014-10-10

Highlights: • We use FCS to investigate binding site requirements for the hnRNP-like protein AtGRP7. • We identify three nucleotides critical for AtGRP7 binding to its own intron. • Mutation of the conserved R{sup 49} abolishes binding altogether. • The paralogue AtGRP8 binds to an overlapping motif with different sequence requirement. • The glycine-rich stretch of a plant hnRNP-like protein contributes to binding. - Abstract: Arabidopsis thaliana glycine-rich RNA binding protein 7 (AtGRP7) is part of a negative feedback loop through which it regulates alternative splicing and steady-state abundance of its pre-mRNA. Here we use fluorescence correlation spectroscopy to investigate the requirements for AtGRP7 binding to its intron using fluorescently-labelled synthetic oligonucleotides. By systematically introducing point mutations we identify three nucleotides that lead to an increased K{sub d} value when mutated and thus are critical for AtGRP7 binding. Simultaneous mutation of all three residues abrogates binding. The paralogue AtGRP8 binds to an overlapping motif but with a different sequence preference, in line with overlapping but not identical functions of this protein pair. Truncation of the glycine-rich domain reduces the binding affinity of AtGRP7, showing for the first time that the glycine-rich stretch of a plant hnRNP-like protein contributes to binding. Mutation of the conserved R{sup 49} that is crucial for AtGRP7 function in pathogen defence and splicing abolishes binding.

Mutational definition of binding requirements of an hnRNP-like protein in Arabidopsis using fluorescence correlation spectroscopy

International Nuclear Information System (INIS)

Leder, Verena; Lummer, Martina; Tegeler, Kathrin; Humpert, Fabian; Lewinski, Martin; Schüttpelz, Mark; Staiger, Dorothee

2014-01-01

Highlights: • We use FCS to investigate binding site requirements for the hnRNP-like protein AtGRP7. • We identify three nucleotides critical for AtGRP7 binding to its own intron. • Mutation of the conserved R 49 abolishes binding altogether. • The paralogue AtGRP8 binds to an overlapping motif with different sequence requirement. • The glycine-rich stretch of a plant hnRNP-like protein contributes to binding. - Abstract: Arabidopsis thaliana glycine-rich RNA binding protein 7 (AtGRP7) is part of a negative feedback loop through which it regulates alternative splicing and steady-state abundance of its pre-mRNA. Here we use fluorescence correlation spectroscopy to investigate the requirements for AtGRP7 binding to its intron using fluorescently-labelled synthetic oligonucleotides. By systematically introducing point mutations we identify three nucleotides that lead to an increased K d value when mutated and thus are critical for AtGRP7 binding. Simultaneous mutation of all three residues abrogates binding. The paralogue AtGRP8 binds to an overlapping motif but with a different sequence preference, in line with overlapping but not identical functions of this protein pair. Truncation of the glycine-rich domain reduces the binding affinity of AtGRP7, showing for the first time that the glycine-rich stretch of a plant hnRNP-like protein contributes to binding. Mutation of the conserved R 49 that is crucial for AtGRP7 function in pathogen defence and splicing abolishes binding

Disease-associated extracellular loop mutations in the adhesion G protein-coupled receptor G1 (ADGRG1; GPR56) differentially regulate downstream signaling.

Science.gov (United States)

Kishore, Ayush; Hall, Randy A

2017-06-09

Mutations to the adhesion G protein-coupled receptor ADGRG1 (G1; also known as GPR56) underlie the neurological disorder bilateral frontoparietal polymicrogyria. Disease-associated mutations in G1 studied to date are believed to induce complete loss of receptor function through disruption of either receptor trafficking or signaling activity. Given that N-terminal truncation of G1 and other adhesion G protein-coupled receptors has been shown to significantly increase the receptors' constitutive signaling, we examined two different bilateral frontoparietal polymicrogyria-inducing extracellular loop mutations (R565W and L640R) in the context of both full-length and N-terminally truncated (ΔNT) G1. Interestingly, we found that these mutations reduced surface expression of full-length G1 but not G1-ΔNT in HEK-293 cells. Moreover, the mutations ablated receptor-mediated activation of serum response factor luciferase, a classic measure of Gα 12/13 -mediated signaling, but had no effect on G1-mediated signaling to nuclear factor of activated T cells (NFAT) luciferase. Given these differential signaling results, we sought to further elucidate the pathway by which G1 can activate NFAT luciferase. We found no evidence that ΔNT activation of NFAT is dependent on Gα q/11 -mediated or β-arrestin-mediated signaling but rather involves liberation of Gβγ subunits and activation of calcium channels. These findings reveal that disease-associated mutations to the extracellular loops of G1 differentially alter receptor trafficking, depending on the presence of the N terminus, and differentially alter signaling to distinct downstream pathways. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Spectrum of small mutations in the dystrophin coding region

Energy Technology Data Exchange (ETDEWEB)

Prior, T.W.; Bartolo, C.; Pearl, D.K. [Ohio State Univ., Columbus, OH (United States)] [and others

1995-07-01

Duchenne and Becker muscular dystrophies (DMD and BMD) are caused by defects in the dystrophin gene. About two-thirds of the affected patients have large deletions or duplications, which occur in the 5` and central portion of the gene. The nondeletion/duplication cases are most likely the result of smaller mutations that cannot be identified by current diagnostic screening strategies. We screened {approximately} 80% of the dystrophin coding sequence for small mutations in 158 patients without deletions or duplications and identified 29 mutations. The study indicates that many of the DMD and the majority of the BMD small mutations lie in noncoding regions of the gene. All of the mutations identified were unique to single patients, and most of the mutations resulted in protein truncation. We did not find a clustering of small mutations similar to the deletion distribution but found > 40% of the small mutations 3` of exon 55. The extent of protein truncation caused by the 3` mutations did not determine the phenotype, since even the exon 76 nonsense mutation resulted in the severe DMD phenotype. Our study confirms that the dystrophin gene is subject to a high rate of mutation in CpG sequences. As a consequence of not finding any hotspots or prevalent small mutations, we conclude that it is presently not possible to perform direct carrier and prenatal diagnostics for many families without deletions or duplications. 71 refs., 2 figs., 2 tabs.

Protein-truncating mutations in ASPM cause variable reduction in brain size

NARCIS (Netherlands)

Bond, Jacquelyn; Scott, Sheila; Hampshire, Daniel J.; Springell, Kelly; Corry, Peter; Abramowicz, Marc J.; Mochida, Ganesh H.; Hennekam, Raoul C. M.; Maher, Eamonn R.; Fryns, Jean-Pierre; Alswaid, Abdulrahman; Jafri, Hussain; Rashid, Yasmin; Mubaidin, Ammar; Walsh, Christopher A.; Roberts, Emma; Woods, C. Geoffrey

2003-01-01

Mutations in the ASPM gene at the MCPH5 locus are expected to be the most common cause of human autosomal recessive primary microcephaly (MCPH), a condition in which there is a failure of normal fetal brain development, resulting in congenital microcephaly and mental retardation. We have performed

Altered intracellular localization and mobility of SBDS protein upon mutation in Shwachman-Diamond syndrome.

Directory of Open Access Journals (Sweden)

Claudia Orelio

Full Text Available Shwachman-Diamond Syndrome (SDS is a rare inherited disease caused by mutations in the SBDS gene. Hematopoietic defects, exocrine pancreas dysfunction and short stature are the most prominent clinical features. To gain understanding of the molecular properties of the ubiquitously expressed SBDS protein, we examined its intracellular localization and mobility by live cell imaging techniques. We observed that SBDS full-length protein was localized in both the nucleus and cytoplasm, whereas patient-related truncated SBDS protein isoforms localize predominantly to the nucleus. Also the nucleo-cytoplasmic trafficking of these patient-related SBDS proteins was disturbed. Further studies with a series of SBDS mutant proteins revealed that three distinct motifs determine the intracellular mobility of SBDS protein. A sumoylation motif in the C-terminal domain, that is lacking in patient SBDS proteins, was found to play a pivotal role in intracellular motility. Our structure-function analyses provide new insight into localization and motility of the SBDS protein, and show that patient-related mutant proteins are altered in their molecular properties, which may contribute to the clinical features observed in SDS patients.

Low incidence of germline mutation in BRCA1 Exon 11 among early-onset and familial Filipino breast cancer patients

International Nuclear Information System (INIS)

Nato, Alejandro Q. Jr; Deocaris, Custer C.; Sajise, Sheila C.

2002-01-01

Breast cancer susceptibility gene, type 1 (BRCA1) has been thought to be responsible for about 45% of families with multiple breast carcinoma cases and for more than 80% of hereditary breast and ovarian cancer (HBOC) families. About 61-75% of the reported distinct alterations that result in truncated protein products have been found in exon 11 which comprises 61% (3427bp) of the coding sequence of BRCA1(5592bp). Protein truncation test (PTT) has become a popular method as an efficient means of screening mutations in a coding sequence that lead to a truncated protein product. In this study, 34 early-onset and/or familial breast cancer (FBC) patients were investigated. Twenty-six patients are early-onset B(o)C cases (diagnosed≤40 years old), 14 of which have familiality of the disease. Among the 8 patients that have been diagnosed above 40 years old, 7 have familial clustering. Through radioactive PTT analysis of the 34 BC cases in a 5-20% denaturing gradient polyacrylamide gel, we found only one mutation in exon 11 having a 29.7 kDa truncated protein product. Our results corroborate the findings of a recently reported study of unselected incident breast cancer cases in the Philippines where the prevalence of BRCA1 mutation is also low. This would, however, be the second documented mutation in BRCA1 exon 11 in a Filipino BC patient since 1998. (author)

The prevalence of CHD7 missense versus truncating mutations is higher in patients with Kallmann syndrome than in typical CHARGE patients

DEFF Research Database (Denmark)

Marcos, Séverine; Sarfati, Julie; Leroy, Chrystel

2014-01-01

CONTEXT: Mutations in CHD7, a gene previously implicated in CHARGE (coloboma, heart defect, choanal atresia, retardation of growth and/or development, genital hypoplasia, ear anomalies) syndrome, have been reported in patients presenting with Kallmann syndrome (KS) or congenital hypogonadotropic...... hypogonadism (CHH). Most mutations causing CHARGE syndrome result in premature stop codons and occur de novo, but the proportion of truncating vs nontruncating mutations in KS and CHH patients is still unknown. OBJECTIVE: The objective of the study was to determine the nature, prevalence, mode of transmission......, and clinical spectrum of CHD7 mutations in a large series of patients. DESIGN: We studied 209 KS and 94 CHH patients. These patients had not been diagnosed with CHARGE syndrome according to the current criteria. We searched for mutations in 16 KS and CHH genes including CHD7. RESULTS: We found presumably...

Formation of truncated proteins and high-molecular-mass aggregates upon soft illumination of photosynthetic proteins

DEFF Research Database (Denmark)

Rinalducci, Sara; Campostrini, Natascia; Antonioli, Paolo

2005-01-01

Different spot profiles were observed in 2D gel electrophoresis of thylakoid membranes performed either under complete darkness or by leaving the sample for a short time to low visible light. In the latter case, a large number of new spots with lower molecular masses, ranging between 15,000 and 25......,000 Da, were observed, and high-molecular-mass aggregates, seen as a smearing in the upper part of the gel, appeared in the region around 250 kDa. Identification of protein(s) contained in these new spots by MS/MS revealed that most of them are simply truncated proteins deriving from native ones...

Truncation of the C-terminal region of Toscana Virus NSs protein is critical for interferon-β antagonism and protein stability.

Science.gov (United States)

Gori Savellini, Gianni; Gandolfo, Claudia; Cusi, Maria Grazia

2015-12-01

Toscana Virus (TOSV) is a Phlebovirus responsible for central nervous system (CNS) injury in humans. The TOSV non-structural protein (NSs), which interacting with RIG-I leads to its degradation, was analysed in the C terminus fragment in order to identify its functional domains. To this aim, two C-terminal truncated NSs proteins, Δ1C-NSs (aa 1-284) and Δ2C-NSs (aa 1-287) were tested. Only Δ1C-NSs did not present any inhibitory effect on RIG-I and it showed a greater stability than the whole NSs protein. Moreover, the deletion of the TLQ aa sequence interposed between the two ΔC constructs caused a greater accumulation of the protein with a weak inhibitory effect on RIG-I, indicating some involvement of these amino acids in the NSs activity. Nevertheless, all the truncated proteins were still able to interact with RIG-I, suggesting that the domains responsible for RIG-I signaling and RIG-I interaction are mapped on different regions of the protein. Copyright © 2015 Elsevier Inc. All rights reserved.

N-terminally truncated POM121C inhibits HIV-1 replication.

Directory of Open Access Journals (Sweden)

Hideki Saito

Full Text Available Recent studies have identified host cell factors that regulate early stages of HIV-1 infection including viral cDNA synthesis and orientation of the HIV-1 capsid (CA core toward the nuclear envelope, but it remains unclear how viral DNA is imported through the nuclear pore and guided to the host chromosomal DNA. Here, we demonstrate that N-terminally truncated POM121C, a component of the nuclear pore complex, blocks HIV-1 infection. This truncated protein is predominantly localized in the cytoplasm, does not bind to CA, does not affect viral cDNA synthesis, reduces the formation of 2-LTR and diminished the amount of integrated proviral DNA. Studies with an HIV-1-murine leukemia virus (MLV chimeric virus carrying the MLV-derived Gag revealed that Gag is a determinant of this inhibition. Intriguingly, mutational studies have revealed that the blockade by N-terminally-truncated POM121C is closely linked to its binding to importin-β/karyopherin subunit beta 1 (KPNB1. These results indicate that N-terminally-truncated POM121C inhibits HIV-1 infection after completion of reverse transcription and before integration, and suggest an important role for KPNB1 in HIV-1 replication.

Stop-gain mutations in PKP2 are associated with a later age of onset of arrhythmogenic right ventricular cardiomyopathy.

Directory of Open Access Journals (Sweden)

Mireia Alcalde

Full Text Available BACKGROUND: Arrhythmogenic right ventricular cardiomyopathy (ARVC is a cardiac disease characterized by the presence of fibrofatty replacement of the right ventricular myocardium, which may cause ventricular arrhythmias and sudden cardiac death. Pathogenic mutations in several genes encoding mainly desmosomal proteins have been reported. Our aim is to perform genotype-phenotype correlations to establish the diagnostic value of genetics and to assess the role of mutation type in age-related penetrance in ARVC. METHODS AND RESULTS: Thirty unrelated Spanish patients underwent a complete clinical evaluation. They all were screened for PKP2, DSG2, DSC2, DSP, JUP and TMEM43 genes. A total of 70 relatives of four families were also studied. The 30 patients fulfilled definite disease diagnostic criteria. Genetic analysis revealed a pathogenic mutation in 19 patients (13 in PKP2, 3 in DSG2, 2 in DSP, and 1 in DSC2. Nine of these mutations created a truncated protein due to the generation of a stop codon. Familial assessment revealed 28 genetic carriers among family members. Stop-gain mutations were associated to a later age of onset of ARVC, without differences in the severity of the pathology. CONCLUSIONS: Familial genetic analysis helps to identify the cause responsible for the pathology. In discrepancy with previous studies, the presence of a truncating protein does not confer a worse severity. This information could suggest that truncating proteins may be compensated by the normal allele and that missense mutations may act as poison peptides.

Sequencing the GRHL3 Coding Region Reveals Rare Truncating Mutations and a Common Susceptibility Variant for Nonsyndromic Cleft Palate

Science.gov (United States)

Mangold, Elisabeth; Böhmer, Anne C.; Ishorst, Nina; Hoebel, Ann-Kathrin; Gültepe, Pinar; Schuenke, Hannah; Klamt, Johanna; Hofmann, Andrea; Gölz, Lina; Raff, Ruth; Tessmann, Peter; Nowak, Stefanie; Reutter, Heiko; Hemprich, Alexander; Kreusch, Thomas; Kramer, Franz-Josef; Braumann, Bert; Reich, Rudolf; Schmidt, Gül; Jäger, Andreas; Reiter, Rudolf; Brosch, Sibylle; Stavusis, Janis; Ishida, Miho; Seselgyte, Rimante; Moore, Gudrun E.; Nöthen, Markus M.; Borck, Guntram; Aldhorae, Khalid A.; Lace, Baiba; Stanier, Philip; Knapp, Michael; Ludwig, Kerstin U.

2016-01-01

Nonsyndromic cleft lip with/without cleft palate (nsCL/P) and nonsyndromic cleft palate only (nsCPO) are the most frequent subphenotypes of orofacial clefts. A common syndromic form of orofacial clefting is Van der Woude syndrome (VWS) where individuals have CL/P or CPO, often but not always associated with lower lip pits. Recently, ∼5% of VWS-affected individuals were identified with mutations in the grainy head-like 3 gene (GRHL3). To investigate GRHL3 in nonsyndromic clefting, we sequenced its coding region in 576 Europeans with nsCL/P and 96 with nsCPO. Most strikingly, nsCPO-affected individuals had a higher minor allele frequency for rs41268753 (0.099) than control subjects (0.049; p = 1.24 × 10−2). This association was replicated in nsCPO/control cohorts from Latvia, Yemen, and the UK (pcombined = 2.63 × 10−5; ORallelic = 2.46 [95% CI 1.6–3.7]) and reached genome-wide significance in combination with imputed data from a GWAS in nsCPO triads (p = 2.73 × 10−9). Notably, rs41268753 is not associated with nsCL/P (p = 0.45). rs41268753 encodes the highly conserved p.Thr454Met (c.1361C>T) (GERP = 5.3), which prediction programs denote as deleterious, has a CADD score of 29.6, and increases protein binding capacity in silico. Sequencing also revealed four novel truncating GRHL3 mutations including two that were de novo in four families, where all nine individuals harboring mutations had nsCPO. This is important for genetic counseling: given that VWS is rare compared to nsCPO, our data suggest that dominant GRHL3 mutations are more likely to cause nonsyndromic than syndromic CPO. Thus, with rare dominant mutations and a common risk variant in the coding region, we have identified an important contribution for GRHL3 in nsCPO. PMID:27018475

six novel mutations in the TSC1 and TSC2 genes

Indian Academy of Sciences (India)

M. GLUSHKOVA

2018-04-30

Apr 30, 2018 ... RESEARCH ARTICLE ... nant disorder caused by inactivating TSC1 or TSC2 gene variants (Van ... premature protein truncation, while missense mutations are rare ..... TSC2 variants in our cohort are missense, frame-shift.

A novel homozygous truncating GNAT1 mutation implicated in retinal degeneration

OpenAIRE

Carrigan, Matthew; Duignan, Emma; Humphries, Pete; Palfi, Arpad; Kenna, Paul F; Farrar, G Jane

2015-01-01

Background The GNAT1 gene encodes the ? subunit of the rod transducin protein, a key element in the rod phototransduction cascade. Variants in GNAT1 have been implicated in stationary night-blindness in the past, but unlike other proteins in the same pathway, it has not previously been implicated in retinitis pigmentosa. Methods A panel of 182 retinopathy-associated genes was sequenced to locate disease-causing mutations in patients with inherited retinopathies. Results Sequencing revealed a ...

Novel causative mutations in patients with Nance-Horan syndrome and altered localization of the mutant NHS-A protein isoform

OpenAIRE

Sharma, Shiwani; Burdon, Kathryn P.; Dave, Alpana; Jamieson, Robyn V.; Yaron, Yuval; Billson, Frank; Van Maldergem, Lionel; Lorenz, Birgit; Gécz, Jozef; Craig, Jamie E.

2008-01-01

Purpose Nance-Horan syndrome is typically characterized by severe bilateral congenital cataracts and dental abnormalities. Truncating mutations in the Nance-Horan syndrome (NHS) gene cause this X-linked genetic disorder. NHS encodes two isoforms, NHS-A and NHS-1A. The ocular lens expresses NHS-A, the epithelial and neuronal cell specific isoform. The NHS-A protein localizes in the lens epithelium at the cellular periphery. The data to date suggest a role for this isoform at cell-cell junction...

Characterization of pathogenic germline mutations in human Protein Kinases

Directory of Open Access Journals (Sweden)

Orengo Christine A

2011-07-01

Full Text Available Abstract Background Protein Kinases are a superfamily of proteins involved in crucial cellular processes such as cell cycle regulation and signal transduction. Accordingly, they play an important role in cancer biology. To contribute to the study of the relation between kinases and disease we compared pathogenic mutations to neutral mutations as an extension to our previous analysis of cancer somatic mutations. First, we analyzed native and mutant proteins in terms of amino acid composition. Secondly, mutations were characterized according to their potential structural effects and finally, we assessed the location of the different classes of polymorphisms with respect to kinase-relevant positions in terms of subfamily specificity, conservation, accessibility and functional sites. Results Pathogenic Protein Kinase mutations perturb essential aspects of protein function, including disruption of substrate binding and/or effector recognition at family-specific positions. Interestingly these mutations in Protein Kinases display a tendency to avoid structurally relevant positions, what represents a significant difference with respect to the average distribution of pathogenic mutations in other protein families. Conclusions Disease-associated mutations display sound differences with respect to neutral mutations: several amino acids are specific of each mutation type, different structural properties characterize each class and the distribution of pathogenic mutations within the consensus structure of the Protein Kinase domain is substantially different to that for non-pathogenic mutations. This preferential distribution confirms previous observations about the functional and structural distribution of the controversial cancer driver and passenger somatic mutations and their use as a proxy for the study of the involvement of somatic mutations in cancer development.

Expression of a truncated receptor protein tyrosine phosphatase kappa in the brain of an adult transgenic mouse

DEFF Research Database (Denmark)

Shen, P; Canoll, P D; Sap, J

1999-01-01

that goal, we have used this mouse model to map the distribution of the truncated RPTP-kappa/beta-geo fusion protein in the adult mouse brain using beta-galactosidase as a marker enzyme. Visualization of the beta-galactosidase activity revealed a non-random pattern of expression, and identified cells......-6596]. Nevertheless, since the transgene's expression is driven by the endogenous RPTP-kappa promoter, distribution of the truncated RPTP-kappa/beta-geo fusion protein should reflect the regional and cellular expression of wild-type RPTP-kappa, and thus may identify sites where RPTP-kappa is important. Towards...

Screening for mutations in the uroporphyrinogen decarboxylase gene using denaturing gradient gel electrophoresis

DEFF Research Database (Denmark)

Christiansen, L; Ged, C; Hombrados, I

1999-01-01

to exon skipping, and a 2-bp deletion (415-416delTA) resulting in a frameshift and the introduction of a premature stop codon. Heterologous expression and enzymatic studies of the mutant proteins demonstrate that the three mutations leading to shortening or truncation of the UROD protein have no residual......, confirming the heterogeneity of the underlying genetic defects of these diseases. We have established a denaturing gradient gel electrophoresis (DGGE) assay for mutation detection in the UROD gene, enabling the simultaneous screening for known and unknown mutations. The established assay has proved able...

N-terminally truncated GADD34 proteins are convenient translation enhancers in a human cell-derived in vitro protein synthesis system.

Science.gov (United States)

Mikami, Satoshi; Kobayashi, Tominari; Machida, Kodai; Masutani, Mamiko; Yokoyama, Shigeyuki; Imataka, Hiroaki

2010-07-01

Human cell-derived in vitro protein synthesis systems are useful for the production of recombinant proteins. Productivity can be increased by supplementation with GADD34, a protein that is difficult to express in and purify from E. coli. Deletion of the N-terminal 120 or 240 amino acids of GADD34 improves recovery of this protein from E. coli without compromising its ability to boost protein synthesis in an in vitro protein synthesis system. The use of N-terminally truncated GADD34 proteins in place of full-length GADD34 should improve the utility of human cell-based cell-free protein synthesis systems.

Prevalence of PALB2 mutations in breast cancer patients in multi-ethnic Asian population in Malaysia and Singapore.

Science.gov (United States)

Phuah, Sze Yee; Lee, Sheau Yee; Kang, Peter; Kang, In Nee; Yoon, Sook-Yee; Thong, Meow Keong; Hartman, Mikael; Sng, Jen-Hwei; Yip, Cheng Har; Taib, Nur Aishah Mohd; Teo, Soo-Hwang

2013-01-01

The partner and localizer of breast cancer 2 (PALB2) is responsible for facilitating BRCA2-mediated DNA repair by serving as a bridging molecule, acting as the physical and functional link between the breast cancer 1 (BRCA1) and breast cancer 2 (BRCA2) proteins. Truncating mutations in the PALB2 gene are rare but are thought to be associated with increased risks of developing breast cancer in various populations. We evaluated the contribution of PALB2 germline mutations in 122 Asian women with breast cancer, all of whom had significant family history of breast and other cancers. Further screening for nine PALB2 mutations was conducted in 874 Malaysian and 532 Singaporean breast cancer patients, and in 1342 unaffected Malaysian and 541 unaffected Singaporean women. By analyzing the entire coding region of PALB2, we found two novel truncating mutations and ten missense mutations in families tested negative for BRCA1/2-mutations. One additional novel truncating PALB2 mutation was identified in one patient through genotyping analysis. Our results indicate a low prevalence of deleterious PALB2 mutations and a specific mutation profile within the Malaysian and Singaporean populations.

A combination of two truncating mutations in USH2A causes more severe and progressive hearing impairment in Usher syndrome type IIa.

Science.gov (United States)

Hartel, Bas P; Löfgren, Maria; Huygen, Patrick L M; Guchelaar, Iris; Lo-A-Njoe Kort, Nicole; Sadeghi, Andre M; van Wijk, Erwin; Tranebjærg, Lisbeth; Kremer, Hannie; Kimberling, William J; Cremers, Cor W R J; Möller, Claes; Pennings, Ronald J E

2016-09-01

Usher syndrome is an inherited disorder that is characterized by hearing impairment (HI), retinitis pigmentosa, and in some cases vestibular dysfunction. Usher syndrome type IIa is caused by mutations in USH2A. HI in these patients is highly heterogeneous and the present study evaluates the effects of different types of USH2A mutations on the audiometric phenotype. Data from two large centres of expertise on Usher Syndrome in the Netherlands and Sweden were combined in order to create a large combined sample of patients to identify possible genotype-phenotype correlations. A retrospective study on HI in 110 patients (65 Dutch and 45 Swedish) genetically diagnosed with Usher syndrome type IIa. We used methods especially designed for characterizing and testing differences in audiological phenotype between patient subgroups. These methods included Age Related Typical Audiograms (ARTA) and a method to evaluate the difference in the degree of HI developed throughout life between subgroups. Cross-sectional linear regression analysis of last-visit audiograms for the best hearing ear demonstrated a gradual decline of hearing over decades. The congenital level of HI was in the range of 16-33 dB at 0.25-0.5 kHz, and in the range of 51-60 dB at 1-8 kHz. The annual threshold deterioration was in the range of 0.4-0.5 dB/year at 0.25-2 kHz and in the range of 0.7-0.8 dB/year at 4-8 kHz. Patients with two truncating mutations, including homozygotes for the common c.2299delG mutation, developed significantly more severe HI throughout life than patients with one truncating mutation combined with one nontruncating mutation, and patients with two nontruncating mutations. The results have direct implications for patient counselling in terms of prognosis of hearing and may serve as baseline measures for future (genetic) therapeutic interventions. Copyright © 2016 Elsevier B.V. All rights reserved.

Prion Protein on Astrocytes or in Extracellular Fluid Impedes Neurodegeneration Induced by Truncated Prion Protein

OpenAIRE

Race, Brent; Meade-White, Kimberly; Race, Richard; Baumann, Frank; Aguzzi, Adriano; Chesebro, Bruce

2009-01-01

Prion protein (PrP) is a host-encoded membrane-anchored glycoprotein which is required for susceptibility to prion disease. PrP may also be important for normal brain functions such as hippocampal spatial memory. Previously transgenic mice expressing amino terminally truncated mouse PrP (Δ32–134) spontaneously developed a fatal disease associated with degeneration of cerebellar granular neurons as well as vacuolar degeneration of deep cerebellar and brain stem white matter. This disease could...

Mutations in a Novel Isoform of TRIOBP That Encodes a Filamentous-Actin Binding Protein Are Responsible for DFNB28 Recessive Nonsyndromic Hearing Loss

Science.gov (United States)

Shahin, Hashem; Walsh, Tom; Sobe, Tama; Abu Sa’ed, Judeh; Abu Rayan, Amal; Lynch, Eric D.; Lee, Ming K.; Avraham, Karen B.; King, Mary-Claire; Kanaan, Moein

2006-01-01

In a large consanguineous Palestinian kindred, we previously mapped DFNB28—a locus associated with recessively inherited, prelingual, profound sensorineural hearing impairment—to chromosome 22q13.1. We report here that mutations in a novel 218-kDa isoform of TRIOBP (TRIO and filamentous actin [F-actin] binding protein) are associated with DFNB28 hearing loss in a total of nine Palestinian families. Two nonsense mutations (R347X and Q581X) truncate the protein, and a potentially deleterious missense mutation (G1019R) occurs in a conserved motif in a putative SH3-binding domain. In seven families, 27 deaf individuals are homozygous for one of the nonsense mutations; in two other families, 3 deaf individuals are compound heterozygous for the two nonsense mutations or for Q581X and G1019R. The novel long isoform of TRIOBP has a restricted expression profile, including cochlea, retina, and fetal brain, whereas the original short isoform is widely expressed. Antibodies to TRIOBP reveal expression in sensory cells of the inner ear and colocalization with F-actin along the length of the stereocilia. PMID:16385458

Evolution favors protein mutational robustness in sufficiently large populations

Directory of Open Access Journals (Sweden)

Venturelli Ophelia S

2007-07-01

Full Text Available Abstract Background An important question is whether evolution favors properties such as mutational robustness or evolvability that do not directly benefit any individual, but can influence the course of future evolution. Functionally similar proteins can differ substantially in their robustness to mutations and capacity to evolve new functions, but it has remained unclear whether any of these differences might be due to evolutionary selection for these properties. Results Here we use laboratory experiments to demonstrate that evolution favors protein mutational robustness if the evolving population is sufficiently large. We neutrally evolve cytochrome P450 proteins under identical selection pressures and mutation rates in populations of different sizes, and show that proteins from the larger and thus more polymorphic population tend towards higher mutational robustness. Proteins from the larger population also evolve greater stability, a biophysical property that is known to enhance both mutational robustness and evolvability. The excess mutational robustness and stability is well described by mathematical theory, and can be quantitatively related to the way that the proteins occupy their neutral network. Conclusion Our work is the first experimental demonstration of the general tendency of evolution to favor mutational robustness and protein stability in highly polymorphic populations. We suggest that this phenomenon could contribute to the mutational robustness and evolvability of viruses and bacteria that exist in large populations.

Defective Proteasome Delivery of Polyubiquitinated Proteins by Ubiquilin-2 Proteins Containing ALS Mutations.

Directory of Open Access Journals (Sweden)

Lydia Chang

Full Text Available Ubiquilin proteins facilitate delivery of ubiquitinated proteins to the proteasome for degradation. Interest in the proteins has been heightened by the discovery that gene mutations in UBQLN2 cause dominant inheritance of amyotrophic lateral sclerosis (ALS. However, the mechanisms by which the mutations cause ALS are not known. Here we report on the underlying defect of ubiquilin-2 proteins containing ALS-linked mutations in affecting proteasome-mediated degradation. We found that overexpression of ubiquilin-2 proteins containing any one of five different ALS mutations slow degradation of Myc, a prototypic proteasome substrate. Examination of coprecipitating proteins indicated that the mutant proteins are generally capable of binding polyubiquitinated proteins, but defective in binding the proteasome. GST-pulldown studies revealed that many of the mutants bind weaker to the S5a subunit of the proteasome, compared with wild type (WT ubiquilin-2 protein. The results suggest the mutant proteins are unable to deliver their captured cargo to the proteasome for degradation, which presumably leads to toxicity. Quantification of cell death is consistent with this idea. Measurement of protein turnover further indicated the mutant proteins have longer half-lives than WT ubiquilin-2. Our studies provide novel insight into the mechanism by which ALS-linked mutations in UBQLN2 interfere with protein degradation.

Mutations in the Gene PRRT2 Cause Paroxysmal Kinesigenic Dyskinesia with Infantile Convulsions

Directory of Open Access Journals (Sweden)

Hsien-Yang Lee

2012-01-01

Full Text Available Paroxysmal kinesigenic dyskinesia with infantile convulsions (PKD/IC is an episodic movement disorder with autosomal-dominant inheritance and high penetrance, but the causative genetic mutation is unknown. We have now identified four truncating mutations involving the gene PRRT2 in the vast majority (24/25 of well-characterized families with PKD/IC. PRRT2 truncating mutations were also detected in 28 of 78 additional families. PRRT2 encodes a proline-rich transmembrane protein of unknown function that has been reported to interact with the t-SNARE, SNAP25. PRRT2 localizes to axons but not to dendritic processes in primary neuronal culture, and mutants associated with PKD/IC lead to dramatically reduced PRRT2 levels, leading ultimately to neuronal hyperexcitability that manifests in vivo as PKD/IC.

Contribution of TARDBP mutations to sporadic amyotrophic lateral sclerosis.

Science.gov (United States)

Daoud, H; Valdmanis, P N; Kabashi, E; Dion, P; Dupré, N; Camu, W; Meininger, V; Rouleau, G A

2009-02-01

Mutations in the TARDBP gene, which encodes the TAR DNA binding protein (TDP-43), have been described in individuals with familial and sporadic amyotrophic lateral sclerosis (ALS). We screened the TARDBP gene in 285 French sporadic ALS patients to assess the frequency of TARDBP mutations in ALS. Six individuals had potentially deleterious mutations of which three were novel including a Y374X truncating mutation and P363A and A382P missense mutations. This suggests that TARDBP mutations may predispose to ALS in approximately 2% of the individuals followed in this study. Our findings, combined with those from other collections, brings the total number of mutations in unrelated ALS patients to 17, further suggesting that mutations in the TARDBP gene have an important role in the pathogenesis of ALS.

The LMNA mutation p.Arg321Ter associated with dilated cardiomyopathy leads to reduced expression and a skewed ratio of lamin A and lamin C proteins

Energy Technology Data Exchange (ETDEWEB)

Al-Saaidi, Rasha [Research Unit for Molecular Medicine, Aarhus University and Aarhus University Hospital, Aarhus (Denmark); Rasmussen, Torsten B. [Department of Cardiology, Aarhus University Hospital, Aarhus (Denmark); Palmfeldt, Johan [Research Unit for Molecular Medicine, Aarhus University and Aarhus University Hospital, Aarhus (Denmark); Nissen, Peter H. [Department of Clinical Biochemistry, Aarhus University Hospital, Aarhus (Denmark); Beqqali, Abdelaziz [Heart Failure Research Center, Academic Medical Center, Amsterdam (Netherlands); Hansen, Jakob [Department of Forensic Medicine, Bioanalytical Unit, University of Aarhus (Denmark); Pinto, Yigal M. [Heart Failure Research Center, Academic Medical Center, Amsterdam (Netherlands); Boesen, Thomas [Department of Molecular Biology and Genetics, University of Aarhus (Denmark); Mogensen, Jens [Department of Cardiology, Odense University Hospital, Odense (Denmark); Bross, Peter, E-mail: peter.bross@ki.au.dk [Research Unit for Molecular Medicine, Aarhus University and Aarhus University Hospital, Aarhus (Denmark)

2013-11-15

Dilated cardiomyopathy (DCM) is a disease of the heart muscle characterized by cardiac chamber enlargement and reduced systolic function of the left ventricle. Mutations in the LMNA gene represent the most frequent known genetic cause of DCM associated with disease of the conduction systems. The LMNA gene generates two major transcripts encoding the nuclear lamina major components lamin A and lamin C by alternative splicing. Both haploinsuffiency and dominant negative effects have been proposed as disease mechanism for premature termination codon (PTC) mutations in LMNA. These mechanisms however are still not clearly established. In this study, we used a representative LMNA nonsense mutation, p.Arg321Ter, to shed light on the molecular disease mechanisms. Cultured fibroblasts from three DCM patients carrying this mutation were analyzed. Quantitative reverse transcriptase PCR and sequencing of these PCR products indicated that transcripts from the mutant allele were degraded by the nonsense-mediated mRNA decay (NMD) mechanism. The fact that no truncated mutant protein was detectable in western blot (WB) analysis strengthens the notion that the mutant transcript is efficiently degraded. Furthermore, WB analysis showed that the expression of lamin C protein was reduced by the expected approximately 50%. Clearly decreased lamin A and lamin C levels were also observed by immunofluorescence microscopy analysis. However, results from both WB and nano-liquid chromatography/mass spectrometry demonstrated that the levels of lamin A protein were more reduced suggesting an effect on expression of lamin A from the wild type allele. PCR analysis of the ratio of lamin A to lamin C transcripts showed unchanged relative amounts of lamin A transcript suggesting that the effect on the wild type allele was operative at the protein level. Immunofluorescence microscopy analysis showed no abnormal nuclear morphology of patient fibroblast cells. Based on these data, we propose that

Recombinant Protein Truncation Strategy for Inducing Bactericidal Antibodies to the Macrophage Infectivity Potentiator Protein of Neisseria meningitidis and Circumventing Potential Cross-Reactivity with Human FK506-Binding Proteins

Science.gov (United States)

Bielecka, Magdalena K.; Devos, Nathalie; Gilbert, Mélanie; Hung, Miao-Chiu; Weynants, Vincent; Heckels, John E.

2014-01-01

A recombinant macrophage infectivity potentiator (rMIP) protein of Neisseria meningitidis induces significant serum bactericidal antibody production in mice and is a candidate meningococcal vaccine antigen. However, bioinformatics analysis of MIP showed some amino acid sequence similarity to human FK506-binding proteins (FKBPs) in residues 166 to 252 located in the globular domain of the protein. To circumvent the potential concern over generating antibodies that could recognize human proteins, we immunized mice with recombinant truncated type I rMIP proteins that lacked the globular domain and the signal leader peptide (LP) signal sequence (amino acids 1 to 22) and contained the His purification tag at either the N or C terminus (C-term). The immunogenicity of truncated rMIP proteins was compared to that of full (i.e., full-length) rMIP proteins (containing the globular domain) with either an N- or C-terminal His tag and with or without the LP sequence. By comparing the functional murine antibody responses to these various constructs, we determined that C-term His truncated rMIP (−LP) delivered in liposomes induced high levels of antibodies that bound to the surface of wild-type but not Δmip mutant meningococci and showed bactericidal activity against homologous type I MIP (median titers of 128 to 256) and heterologous type II and III (median titers of 256 to 512) strains, thereby providing at least 82% serogroup B strain coverage. In contrast, in constructs lacking the LP, placement of the His tag at the N terminus appeared to abrogate bactericidal activity. The strategy used in this study would obviate any potential concerns regarding the use of MIP antigens for inclusion in bacterial vaccines. PMID:25452551

Recombinant protein truncation strategy for inducing bactericidal antibodies to the macrophage infectivity potentiator protein of Neisseria meningitidis and circumventing potential cross-reactivity with human FK506-binding proteins.

Science.gov (United States)

Bielecka, Magdalena K; Devos, Nathalie; Gilbert, Mélanie; Hung, Miao-Chiu; Weynants, Vincent; Heckels, John E; Christodoulides, Myron

2015-02-01

A recombinant macrophage infectivity potentiator (rMIP) protein of Neisseria meningitidis induces significant serum bactericidal antibody production in mice and is a candidate meningococcal vaccine antigen. However, bioinformatics analysis of MIP showed some amino acid sequence similarity to human FK506-binding proteins (FKBPs) in residues 166 to 252 located in the globular domain of the protein. To circumvent the potential concern over generating antibodies that could recognize human proteins, we immunized mice with recombinant truncated type I rMIP proteins that lacked the globular domain and the signal leader peptide (LP) signal sequence (amino acids 1 to 22) and contained the His purification tag at either the N or C terminus (C-term). The immunogenicity of truncated rMIP proteins was compared to that of full (i.e., full-length) rMIP proteins (containing the globular domain) with either an N- or C-terminal His tag and with or without the LP sequence. By comparing the functional murine antibody responses to these various constructs, we determined that C-term His truncated rMIP (-LP) delivered in liposomes induced high levels of antibodies that bound to the surface of wild-type but not Δmip mutant meningococci and showed bactericidal activity against homologous type I MIP (median titers of 128 to 256) and heterologous type II and III (median titers of 256 to 512) strains, thereby providing at least 82% serogroup B strain coverage. In contrast, in constructs lacking the LP, placement of the His tag at the N terminus appeared to abrogate bactericidal activity. The strategy used in this study would obviate any potential concerns regarding the use of MIP antigens for inclusion in bacterial vaccines. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Loss-of-function mutations in SLC30A8 protect against type 2 diabetes.

Science.gov (United States)

Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L; Jacobs, Suzanne B R; Grarup, Niels; Burtt, Noël P; Mahajan, Anubha; Fuchsberger, Christian; Atzmon, Gil; Benediktsson, Rafn; Blangero, John; Bowden, Don W; Brandslund, Ivan; Brosnan, Julia; Burslem, Frank; Chambers, John; Cho, Yoon Shin; Christensen, Cramer; Douglas, Desirée A; Duggirala, Ravindranath; Dymek, Zachary; Farjoun, Yossi; Fennell, Timothy; Fontanillas, Pierre; Forsén, Tom; Gabriel, Stacey; Glaser, Benjamin; Gudbjartsson, Daniel F; Hanis, Craig; Hansen, Torben; Hreidarsson, Astradur B; Hveem, Kristian; Ingelsson, Erik; Isomaa, Bo; Johansson, Stefan; Jørgensen, Torben; Jørgensen, Marit Eika; Kathiresan, Sekar; Kong, Augustine; Kooner, Jaspal; Kravic, Jasmina; Laakso, Markku; Lee, Jong-Young; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Masson, Gisli; Meitinger, Thomas; Mohlke, Karen L; Molven, Anders; Morris, Andrew P; Potluri, Shobha; Rauramaa, Rainer; Ribel-Madsen, Rasmus; Richard, Ann-Marie; Rolph, Tim; Salomaa, Veikko; Segrè, Ayellet V; Skärstrand, Hanna; Steinthorsdottir, Valgerdur; Stringham, Heather M; Sulem, Patrick; Tai, E Shyong; Teo, Yik Ying; Teslovich, Tanya; Thorsteinsdottir, Unnur; Trimmer, Jeff K; Tuomi, Tiinamaija; Tuomilehto, Jaakko; Vaziri-Sani, Fariba; Voight, Benjamin F; Wilson, James G; Boehnke, Michael; McCarthy, Mark I; Njølstad, Pål R; Pedersen, Oluf; Groop, Leif; Cox, David R; Stefansson, Kari; Altshuler, David

2014-04-01

Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating variants in SLC30A8, which encodes an islet zinc transporter (ZnT8) and harbors a common variant (p.Trp325Arg) associated with T2D risk and glucose and proinsulin levels. Collectively, carriers of protein-truncating variants had 65% reduced T2D risk (P = 1.7 × 10(-6)), and non-diabetic Icelandic carriers of a frameshift variant (p.Lys34Serfs*50) demonstrated reduced glucose levels (-0.17 s.d., P = 4.6 × 10(-4)). The two most common protein-truncating variants (p.Arg138* and p.Lys34Serfs*50) individually associate with T2D protection and encode unstable ZnT8 proteins. Previous functional study of SLC30A8 suggested that reduced zinc transport increases T2D risk, and phenotypic heterogeneity was observed in mouse Slc30a8 knockouts. In contrast, loss-of-function mutations in humans provide strong evidence that SLC30A8 haploinsufficiency protects against T2D, suggesting ZnT8 inhibition as a therapeutic strategy in T2D prevention.

Molecular and clinical analyses of Greig cephalopolysyndactyly and Pallister-Hall syndromes: Robust phenotype prediction from the type and position of GLI3 mutations

NARCIS (Netherlands)

Johnston, Jennifer J.; Olivos-Glander, Isabelle; Killoran, Christina; Elson, Emma; Turner, Joyce T.; Peters, Kathryn F.; Abbott, Margaret H.; Aughton, David J.; Aylsworth, Arthur S.; Bamshad, Michael J.; Booth, Carol; Curry, Cynthia J.; David, Albert; Dinulos, Mary Beth; Flannery, David B.; Fox, Michelle A.; Graham, John M.; Grange, Dorothy K.; Guttmacher, Alan E.; Hannibal, Mark C.; Henn, Wolfram; Hennekam, Raoul C. M.; Holmes, Lewis B.; Hoyme, H. Eugene; Leppig, Kathleen A.; Lin, Angela E.; Macleod, Patrick; Manchester, David K.; Marcelis, Carlo; Mazzanti, Laura; McCann, Emma; McDonald, Marie T.; Mendelsohn, Nancy J.; Moeschler, John B.; Moghaddam, Billur; Neri, Giovanni; Newbury-Ecob, Ruth; Pagon, Roberta A.; Phillips, John A.; Sadler, Laurie S.; Stoler, Joan M.; Tilstra, David; Walsh Vockley, Catherine M.; Zackai, Elaine H.; Zadeh, Touran M.; Brueton, Louise; Black, Graeme Charles M.; Biesecker, Leslie G.

2005-01-01

Mutations in the GLI3 zinc-finger transcription factor gene cause Greig cephalopolysyndactyly syndrome (GCPS) and Pallister-Hall syndrome (PHS), which are variable but distinct clinical entities. We hypothesized that GLI3 mutations that predict a truncated functional repressor protein cause PHS and

New mutations in APOB100 involved in familial hypobetalipoproteinemia

DEFF Research Database (Denmark)

Brusgaard, Klaus; Kjaersgaard, Lars; Hansen, Anne-Birthe Bo

2011-01-01

Familial hypolipoproteinemia (FHBL) is characterized by an inherited low plasma level of apolipoprotein B containing lipoproteins. FHBL may be caused by mutations of APOB. Individuals with FHBL typically have intestinal malabsorption and frequently suffer from a deficiency of fat-soluble vitamins....... Most mutations that cause FHBL are APOB truncating mutations. Here we describe a patient with FHBL caused by a novel truncating mutation together with a novel missense mutation....

Effect of Mutations on HP Lattice Proteins

Science.gov (United States)

Shi, Guangjie; Vogel, Thomas; Landau, David; Li, Ying; Wüst, Thomas

2013-03-01

Using Wang-Landau sampling with approriate trial moves[2], we investigate the effect of different types of mutations on lattice proteins in the HP model. While exact studies have been carried out for short HP proteins[3], the systems we investigate are of much larger size and hence not accessible for exact enumerations. Based on the estimated density of states, we systematically analyse the changes in structure and degeneracy of ground states of particular proteins and measure thermodynamic quantities like the stability of ground states and the specific heat, for example. Both, neutral mutations, which do not change the structure and stability of ground states, as well as critical mutations, which do change the thermodynamic behavior qualitatively, have been observed. Research supported by NSF

Immunopurification of adenomatous polyposis coli (APC) proteins

Science.gov (United States)

2013-01-01

Background The adenomatous polyposis coli (APC) tumour suppressor gene encodes a 2843 residue (310 kDa) protein. APC is a multifunctional protein involved in the regulation of β-catenin/Wnt signalling, cytoskeletal dynamics and cell adhesion. APC mutations occur in most colorectal cancers and typically result in truncation of the C-terminal half of the protein. Results In order to investigate the biophysical properties of APC, we have generated a set of monoclonal antibodies which enable purification of recombinant forms of APC. Here we describe the characterisation of these anti-APC monoclonal antibodies (APC-NT) that specifically recognise endogenous APC both in solution and in fixed cells. Full-length APC(1–2843) and cancer-associated, truncated APC proteins, APC(1–1638) and APC(1–1311) were produced in Sf9 insect cells. Conclusions Recombinant APC proteins were purified using a two-step affinity approach using our APC-NT antibodies. The purification of APC proteins provides the basis for detailed structure/function analyses of full-length, cancer-truncated and endogenous forms of the protein. PMID:24156781

New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.

Science.gov (United States)

Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B

2006-09-01

Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

Science.gov (United States)

Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

2014-07-01

In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

De Novo Truncating Mutations in AHDC1 in Individuals with Syndromic Expressive Language Delay, Hypotonia, and Sleep Apnea

Science.gov (United States)

Xia, Fan; Bainbridge, Matthew N.; Tan, Tiong Yang; Wangler, Michael F.; Scheuerle, Angela E.; Zackai, Elaine H.; Harr, Margaret H.; Sutton, V. Reid; Nalam, Roopa L.; Zhu, Wenmiao; Nash, Margot; Ryan, Monique M.; Yaplito-Lee, Joy; Hunter, Jill V.; Deardorff, Matthew A.; Penney, Samantha J.; Beaudet, Arthur L.; Plon, Sharon E.; Boerwinkle, Eric A.; Lupski, James R.; Eng, Christine M.; Muzny, Donna M.; Yang, Yaping; Gibbs, Richard A.

2014-01-01

Clinical whole-exome sequencing (WES) for identification of mutations leading to Mendelian disease has been offered to the medical community since 2011. Clinically undiagnosed neurological disorders are the most frequent basis for test referral, and currently, approximately 25% of such cases are diagnosed at the molecular level. To date, there are approximately 4,000 “known” disease-associated loci, and many are associated with striking dysmorphic features, making genotype-phenotype correlations relatively straightforward. A significant fraction of cases, however, lack characteristic dysmorphism or clinical pathognomonic traits and are dependent upon molecular tests for definitive diagnoses. Further, many molecular diagnoses are guided by recent gene-disease association discoveries. Hence, there is a critical interplay between clinical testing and research leading to gene-disease association discovery. Here, we describe four probands, all of whom presented with hypotonia, intellectual disability, global developmental delay, and mildly dysmorphic facial features. Three of the four also had sleep apnea. Each was a simplex case without a remarkable family history. Using WES, we identified AHDC1 de novo truncating mutations that most likely cause this genetic syndrome. PMID:24791903

New truncation mutation of the NR2E3 gene in a Japanese patient with enhanced S-cone syndrome.

Science.gov (United States)

Kuniyoshi, Kazuki; Hayashi, Takaaki; Sakuramoto, Hiroyuki; Mishima, Hiroshi; Tsuneoka, Hiroshi; Tsunoda, Kazushige; Iwata, Takeshi; Shimomura, Yoshikazu

2016-11-01

The enhanced S-cone syndrome (ESCS) is a rare hereditary retinal degeneration that has enhanced short wavelength-sensitive cone (S-cone) functions. The longitudinal clinical course of this disease has been rarely reported, and the genetic aspects of ESCS have not been well investigated in the Japanese population. In this report, we present our clinical and genetic findings for 2 patients with ESCS. The patients were 2 unrelated Japanese men. Standard ophthalmic examinations and mutation screening for the NR2E3 gene were performed. Patient 1 was a 36-year-old man, and his clinical findings were typical of ESCS. His decimal best-corrected visual acuity (BCVA) was 1.0 OD and 0.5 OS after removal of cataracts. Genetic investigations revealed a homozygous truncation frameshift, the p.I307LfsX33 mutation. Patient 2 was an 11-year-old boy when he was first examined by us. His clinical findings were typical of ESCS except for uveitis in the left eye. His decimal BCVA at the age of 39 years was maintained at 1.5 in each eye, although the retinal degeneration and visual field impairments had progressed during the follow-up period. The genetic investigations revealed homozygous mutations of p.R104Q in the NR2E3 gene. The frameshift mutation, p.I307LfsX33, in the NR2E3 gene is a new causative mutation for ESCS. The clinical observations for patient 2 are the longest ever reported. The retinal degeneration caused by this mutation is slowly progressive, and these patients maintained good vision with maintenance of the foveal structure until their late thirties.

Mutations in plasmalemma vesicle-associated protein cause severe syndromic protein-losing enteropathy.

Science.gov (United States)

Broekaert, Ilse Julia; Becker, Kerstin; Gottschalk, Ingo; Körber, Friederike; Dötsch, Jörg; Thiele, Holger; Altmüller, Janine; Nürnberg, Peter; Hünseler, Christoph; Cirak, Sebahattin

2018-04-16

Protein-losing enteropathy (PLE) is characterised by gastrointestinal protein leakage due to loss of mucosal integrity or lymphatic abnormalities. PLE can manifest as congenital diarrhoea and should be differentiated from other congenital diarrhoeal disorders. Primary PLEs are genetically heterogeneous and the underlying genetic defects are currently emerging. We report an infant with fatal PLE for whom we aimed to uncover the underlying pathogenic mutation. We performed whole exome sequencing (WES) for the index patient. Variants were classified based on the American College of Medical Genetics and Genomics guidelines. WES results and our detailed clinical description of the patient were compared with the literature. We discovered a novel homozygous stop mutation (c.988C>T, p.Q330*) in the Plasmalemma Vesicle-Associated Protein ( PLVAP ) gene in a newborn with fatal PLE, facial dysmorphism, and renal, ocular and cardiac anomalies. The Q330* mutation is predicted to result in complete loss of PLVAP protein expression leading to deletion of the diaphragms of endothelial fenestrae, resulting in plasma protein extravasation and PLE. Recently, another single homozygous stop mutation in PLVAP causing lethal PLE in an infant was reported. Our findings validate PLVAP mutations as a cause of syndromic PLE. Prenatal anomalies, severe PLE and syndromic features may guide the diagnosis of this rare disease. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Mutations in the Norrie disease gene.

Science.gov (United States)

Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

1995-01-01

We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

LGI2 truncation causes a remitting focal epilepsy in dogs.

Directory of Open Access Journals (Sweden)

Eija H Seppälä

2011-07-01

Full Text Available One quadrillion synapses are laid in the first two years of postnatal construction of the human brain, which are then pruned until age 10 to 500 trillion synapses composing the final network. Genetic epilepsies are the most common neurological diseases with onset during pruning, affecting 0.5% of 2-10-year-old children, and these epilepsies are often characterized by spontaneous remission. We previously described a remitting epilepsy in the Lagotto romagnolo canine breed. Here, we identify the gene defect and affected neurochemical pathway. We reconstructed a large Lagotto pedigree of around 34 affected animals. Using genome-wide association in 11 discordant sib-pairs from this pedigree, we mapped the disease locus to a 1.7 Mb region of homozygosity in chromosome 3 where we identified a protein-truncating mutation in the Lgi2 gene, a homologue of the human epilepsy gene LGI1. We show that LGI2, like LGI1, is neuronally secreted and acts on metalloproteinase-lacking members of the ADAM family of neuronal receptors, which function in synapse remodeling, and that LGI2 truncation, like LGI1 truncations, prevents secretion and ADAM interaction. The resulting epilepsy onsets at around seven weeks (equivalent to human two years, and remits by four months (human eight years, versus onset after age eight in the majority of human patients with LGI1 mutations. Finally, we show that Lgi2 is expressed highly in the immediate post-natal period until halfway through pruning, unlike Lgi1, which is expressed in the latter part of pruning and beyond. LGI2 acts at least in part through the same ADAM receptors as LGI1, but earlier, ensuring electrical stability (absence of epilepsy during pruning years, preceding this same function performed by LGI1 in later years. LGI2 should be considered a candidate gene for common remitting childhood epilepsies, and LGI2-to-LGI1 transition for mechanisms of childhood epilepsy remission.

Expression of a truncated receptor protein tyrosine phosphatase kappa in the brain of an adult transgenic mouse

DEFF Research Database (Denmark)

Shen, P; Canoll, P D; Sap, J

1999-01-01

processes such as axonal growth and target recognition, as has been demonstrated for certain Drosophila RPTPs. The brain distribution of RPTP-kappa-expressing cells has not been determined, however. In a gene-trap mouse model with a beta-gal+neo (beta-geo) insertion in the endogenous RPTP-kappa gene......-6596]. Nevertheless, since the transgene's expression is driven by the endogenous RPTP-kappa promoter, distribution of the truncated RPTP-kappa/beta-geo fusion protein should reflect the regional and cellular expression of wild-type RPTP-kappa, and thus may identify sites where RPTP-kappa is important. Towards...... that goal, we have used this mouse model to map the distribution of the truncated RPTP-kappa/beta-geo fusion protein in the adult mouse brain using beta-galactosidase as a marker enzyme. Visualization of the beta-galactosidase activity revealed a non-random pattern of expression, and identified cells...

Neurodegeneration caused by expression of human truncated tau leads to progressive neurobehavioural impairment in transgenic rats.

Science.gov (United States)

Hrnkova, Miroslava; Zilka, Norbert; Minichova, Zuzana; Koson, Peter; Novak, Michal

2007-01-26

Human truncated tau protein is an active constituent of the neurofibrillary degeneration in sporadic Alzheimer's disease. We have shown that modified tau protein, when expressed as a transgene in rats, induced AD characteristic tau cascade consisting of tau hyperphosphorylation, formation of argyrophilic tangles and sarcosyl-insoluble tau complexes. These pathological changes led to the functional impairment characterized by a variety of neurobehavioural symptoms. In the present study we have focused on the behavioural alterations induced by transgenic expression of human truncated tau. Transgenic rats underwent a battery of behavioural tests involving cognitive- and sensorimotor-dependent tasks accompanied with neurological assessment at the age of 4.5, 6 and 9 months. Behavioural examination of these rats showed altered spatial navigation in Morris water maze resulting in less time spent in target quadrant (popen field was not influenced by transgene expression. However beam walking test revealed that transgenic rats developed progressive sensorimotor disturbances related to the age of tested animals. The disturbances were most pronounced at the age of 9 months (p<0.01). Neurological alterations indicating impaired reflex responses were other added features of behavioural phenotype of this novel transgenic rat. These results allow us to suggest that neurodegeneration, caused by the non-mutated human truncated tau derived from sporadic human AD, result in the neuronal dysfunction consequently leading to the progressive neurobehavioural impairment.

Pressure Overload by Transverse Aortic Constriction Induces Maladaptive Hypertrophy in a Titin-Truncated Mouse Model

Directory of Open Access Journals (Sweden)

Qifeng Zhou

2015-01-01

Full Text Available Mutations in the giant sarcomeric protein titin (TTN are a major cause for inherited forms of dilated cardiomyopathy (DCM. We have previously developed a mouse model that imitates a TTN truncation mutation we found in a large pedigree with DCM. While heterozygous Ttn knock-in mice do not display signs of heart failure under sedentary conditions, they recapitulate the human phenotype when exposed to the pharmacological stressor angiotensin II or isoproterenol. In this study we investigated the effects of pressure overload by transverse aortic constriction (TAC in heterozygous (Het Ttn knock-in mice. Two weeks after TAC, Het mice developed marked impairment of left ventricular ejection fraction (p<0.05, while wild-type (WT TAC mice did not. Het mice also trended toward increased ventricular end diastolic pressure and volume compared to WT littermates. We found an increase in histologically diffuse cardiac fibrosis in Het compared to WT in TAC mice. This study shows that a pattern of DCM can be induced by TAC-mediated pressure overload in a TTN-truncated mouse model. This model enlarges our arsenal of cardiac disease models, adding a valuable tool to understand cardiac pathophysiological remodeling processes and to develop therapeutic approaches to combat heart failure.

Three common GJB2 mutations causing nonsyndromic hearing loss in Chinese populations are retained in the endoplasmic reticulum.

Science.gov (United States)

Zhang, Yanping; Wang, Ju; Li, Lina; Sun, Yurui; Feng, Bo

2010-07-01

The three most common GJB2 mutations found in the Chinese populations, c.235delC, c.299-300delAT, and c.176-191de1 (16) bp, cannot form gap junctons (GJs) in the plasma membrane. These mutant proteins were retained in the endoplasmic reticulum (ER), suggesting that ER stress (ERS) and subsequent ERS-induced cell death may be responsible for hearing loss caused by these GJB2 truncation mutations. The objective of this study was to investigate the subcellular location of the protein products of three GJB2 mutants (c.235de1C, c.299-300delAT, and c.176-191de1 (16) bp) and to explore the deafness mechanism caused by these GJB2 truncation mutations. Mutant-eGFP fusion protein vectors were constructed by PCR and TA cloning. HEK293 cells were transfected by a liposome-mediated method. Transfected cells were incubated with ER-Tracker and observed under a confocal microscope. Cells transfected with wild type gave characteristic punctuate patterns of GJs in the cell membrane. In contrast, c.235de1C, c.299-300delAT, and c.176-191de1 (16) bp mutant proteins were found to be trapped in the ER, and were therefore unable to form GJs in the plasma membrane.

Functional analysis of HNPCC-related missense mutations in MSH2

International Nuclear Information System (INIS)

Luetzen, Anne; Wind, Niels de; Georgijevic, Dubravka; Nielsen, Finn Cilius; Rasmussen, Lene Juel

2008-01-01

Hereditary nonpolyposis colorectal cancer (HNPCC) is associated with germline mutations in the human DNA mismatch repair (MMR) genes, most frequently MSH2 and MLH1. The majority of HNPCC mutations cause truncations and thus loss of function of the affected polypeptide. However, a significant proportion of MMR mutations found in HNPCC patients are single amino acid substitutions and the functional consequences of many of these mutations in DNA repair are unclear. We have examined the consequences of seven MSH2 missense mutations found in HNPCC families by testing the MSH2 mutant proteins in functional assays as well as by generating equivalent missense mutations in Escherichia coli MutS and analyzing the phenotypes of these mutants. Here we show that two mutant proteins, MSH2-P622L and MSH2-C697F confer multiple biochemical defects, namely in mismatch binding, in vivo interaction with MSH6 and EXO1, and in nuclear localization in the cell. Mutation G674R, located in the ATP-binding region of MSH2, appears to confer resistance to ATP-dependent mismatch release. Mutations D167H and H639R show reduced mismatch binding. Results of in vivo experiments in E. coli with MutS mutants show that one additional mutant, equivalent of MSH2-A834T that do not show any defects in MSH2 assays, is repair deficient. In conclusion, all mutant proteins (except for MSH2-A305T) have defects; either in mismatch binding, ATP-release, mismatch repair activity, subcellular localization or protein-protein interactions

Functional analysis of HNPCC-related missense mutations in MSH2

Energy Technology Data Exchange (ETDEWEB)

Luetzen, Anne [Department of Science, Systems and Models, Roskilde University, DK-4000 Roskilde (Denmark); Wind, Niels de; Georgijevic, Dubravka [Department of Toxicogenetics, Leiden University Medical Center, PO Box 9600, 2300 RC Leiden (Netherlands); Nielsen, Finn Cilius [Department of Clinical Biochemistry, Rigshospitalet, DK-2100 Copenhagen (Denmark); Rasmussen, Lene Juel [Department of Science, Systems and Models, Roskilde University, DK-4000 Roskilde (Denmark)], E-mail: ljr@ruc.dk

2008-10-14

Hereditary nonpolyposis colorectal cancer (HNPCC) is associated with germline mutations in the human DNA mismatch repair (MMR) genes, most frequently MSH2 and MLH1. The majority of HNPCC mutations cause truncations and thus loss of function of the affected polypeptide. However, a significant proportion of MMR mutations found in HNPCC patients are single amino acid substitutions and the functional consequences of many of these mutations in DNA repair are unclear. We have examined the consequences of seven MSH2 missense mutations found in HNPCC families by testing the MSH2 mutant proteins in functional assays as well as by generating equivalent missense mutations in Escherichia coli MutS and analyzing the phenotypes of these mutants. Here we show that two mutant proteins, MSH2-P622L and MSH2-C697F confer multiple biochemical defects, namely in mismatch binding, in vivo interaction with MSH6 and EXO1, and in nuclear localization in the cell. Mutation G674R, located in the ATP-binding region of MSH2, appears to confer resistance to ATP-dependent mismatch release. Mutations D167H and H639R show reduced mismatch binding. Results of in vivo experiments in E. coli with MutS mutants show that one additional mutant, equivalent of MSH2-A834T that do not show any defects in MSH2 assays, is repair deficient. In conclusion, all mutant proteins (except for MSH2-A305T) have defects; either in mismatch binding, ATP-release, mismatch repair activity, subcellular localization or protein-protein interactions.

An intronic mutation c.6430-3C>G in the F8 gene causes splicing efficiency and premature termination in hemophilia A.

Science.gov (United States)

Xia, Zunjing; Lin, Jie; Lu, Lingping; Kim, Chol; Yu, Ping; Qi, Ming

2018-06-01

: Hemophilia A is a bleeding disorder caused by coagulation factor VIII protein deficiency or dysfunction, which is classified into severe, moderate, and mild according to factor clotting activity. An overwhelming majority of missense and nonsense mutations occur in exons of F8 gene, whereas mutations in introns can also be pathogenic. This study aimed to investigate the effect of an intronic mutation, c.6430-3C>G (IVS22-3C>G), on pre-mRNA splicing of the F8 gene. We applied DNA and cDNA sequencing in a Chinese boy with hemophilia A to search if any pathogenic mutation in the F8 gene. Functional analysis was performed to investigate the effect of an intronic mutation at the transcriptional level. Human Splicing Finder and PyMol were also used to predict its effect. We found the mutation c.6430-3C>G (IVS22-3C>G) in the F8 gene in the affected boy, with his mother being a carrier. cDNA from the mother and pSPL3 splicing assay showed that the mutation IVS22-3C>G results in a two-nucleotide AG inclusion at the 3' end of intron 22 and leads to a truncated coagulation factor VIII protein, with partial loss of the C1 domain and complete loss of the C2 domain. The in-silico tool predicted that the mutation induces altered pre-mRNA splicing by using a cryptic acceptor site in intron 22. The IVS22-3C>G mutation was confirmed to affect pre-mRNA splicing and produce a truncated protein, which reduces the stability of binding between the F8 protein and von Willebrand factor carrier protein due to the loss of an interaction domain.

The truncate mutation of Notch2 enhances cell proliferation through activating the NF-κB signal pathway in the diffuse large B-cell lymphomas.

Directory of Open Access Journals (Sweden)

Xinxia Zhang

Full Text Available The Notch2 is a critical membrane receptor for B-cell functions, and also displays various biological roles in lymphoma pathogenesis. In this article, we reported that 3 of 69 (4.3% diffuse large B-cell lymphomas (DLBCLs exhibited a truncate NOTCH2 mutation at the nucleotide 7605 (G/A in the cDNA sequence, which led to partial deletion of the C-terminal of PEST (proline-, glutamic acid-, serine- and threonine-rich domain. The truncate Notch2 activated both the Notch2 and the NF-κB signals and promoted the proliferation of B-cell lymphoma cell lines, including DLBCL and Burkitt's lymphoma cell lines. Moreover, the ectopic proliferation was completely inhibited by ammonium pyrrolidinedithiocarbamate (PDTC, an NF-κB inhibitor. Simultaneously, PDTC also reduced the expression level of Notch2. Based on these results, we conclude that the Notch2 receptor with PEST domain truncation enhances cell proliferation which may be associated with the activation of the Notch2 and the NF-κB signaling. Our results are expected to provide a possible target for new DLBCL therapies by suppressing the Notch2 and the NF-κB signaling.

EDAR mutation in autosomal dominant hypohidrotic ectodermal dysplasia in two Swedish families

Directory of Open Access Journals (Sweden)

Schmitt-Egenolf Marcus

2006-11-01

Full Text Available Abstract Background Hypohidrotic ectodermal dysplasia (HED is a genetic disorder characterized by defective development of teeth, hair, nails and eccrine sweat glands. Both autosomal dominant and autosomal recessive forms of HED have previously been linked to mutations in the ectodysplasin 1 anhidrotic receptor (EDAR protein that plays an important role during embryogenesis. Methods The coding DNA sequence of the EDAR gene was analyzed in two large Swedish three-generational families with autosomal dominant HED. Results A non-sense C to T mutation in exon 12 was identified in both families. This disease-specific mutation changes an arginine amino acid in position 358 of the EDAR protein into a stop codon (p.Arg358X, thereby truncating the protein. In addition to the causative mutation two polymorphisms, not associated with the HED disorder, were also found in the EDAR gene. Conclusion The finding of the p.Arg358X mutation in the Swedish families is the first corroboration of a previously described observation in an American family. Thus, our study strengthens the role of this particular mutation in the aetiology of autosomal dominant HED and confirms the importance of EDAR for the development of HED.

Heteroduplex analysis of the dystrophin gene: Application to point mutation and carrier detection

Energy Technology Data Exchange (ETDEWEB)

Prior, T.W.; Papp, A.C.; Snyder, P.J.; Sedra, M.S.; Western, L.M.; Bartolo, C.; Mendell, J.R. [Ohio State Univ., Columbus, OH (United States); Moxley, R.T. [Univ. of Rochester Medical Center, NY (United States)

1994-03-01

Approximately one-third of Duchenne muscular dystrophy patients have undefined mutations in the dystrophin gene. For carrier and prenatal studies in families without detectable mutations, the indirect restriction fragment length polymorphism linkage approach is used. Using a multiplex amplification and heteroduplex analysis of dystrophin exons, the authors identified nonsense mutations in two DMD patients. Although the nonsense mutations are predicted to severely truncate the dystrophin protein, both patients presented with mild clinical courses of the disease. As a result of identifying the mutation in the affected boys, direct carrier studies by heteroduplex analysis were extended to other relatives. The authors conclude that the technique is not only ideal for mutation detection but is also useful for diagnostic testing. 29 refs., 4 figs.

Annotating Mutational Effects on Proteins and Protein Interactions: Designing Novel and Revisiting Existing Protocols.

Science.gov (United States)

Li, Minghui; Goncearenco, Alexander; Panchenko, Anna R

2017-01-01

In this review we describe a protocol to annotate the effects of missense mutations on proteins, their functions, stability, and binding. For this purpose we present a collection of the most comprehensive databases which store different types of sequencing data on missense mutations, we discuss their relationships, possible intersections, and unique features. Next, we suggest an annotation workflow using the state-of-the art methods and highlight their usability, advantages, and limitations for different cases. Finally, we address a particularly difficult problem of deciphering the molecular mechanisms of mutations on proteins and protein complexes to understand the origins and mechanisms of diseases.

Loss-of-function mutations in SLC30A8 protect against type 2 diabetes

DEFF Research Database (Denmark)

Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L

2014-01-01

Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating va...

Functional Characterization of a Novel Truncating Mutation in Lamin A/C Gene in a Family with a Severe Cardiomyopathy with Conduction Defects

Directory of Open Access Journals (Sweden)

Andrea Gerbino

2017-12-01

Full Text Available Background/Aims: Truncating LMNA gene mutations occur in many inherited cardiomyopathy cases, but the molecular mechanisms involved in the disease they cause have not yet been systematically investigated. Here, we studied a novel frameshift LMNA variant (p.D243Gfs*4 identified in three members of an Italian family co-segregating with a severe form of cardiomyopathy with conduction defects. Methods: HEK293 cells and HL-1 cardiomyocytes were transiently transfected with either Lamin A or D243Gfs*4 tagged with GFP (or mCherry. D243Gfs*4 expression, cellular localization and its effects on diverse cellular mechanisms were evaluated with western blotting, laser-scanning confocal microscopy and video-imaging analysis in single cells. Results: When expressed in HEK293 cells, GFP- (or mCherry-tagged LMNA D243Gfs*4 colocalized with calnexin within the ER. ER mislocalization of LMNA D243Gfs*4 did not significantly induce ER stress response, abnormal Ca2+ handling and apoptosis when compared with HEK293 cells expressing another truncated mutant of LMNA (R321X which similarly accumulates within the ER. Of note, HEK293-LMNA D243Gfs*4 cells showed a significant reduction of connexin 43 (CX43 expression level, which was completely rescued by activation of the WNT/β-catenin signaling pathway. When expressed in HL-1 cardiomyocytes, D243Gfs*4 significantly impaired the spontaneous Ca2+ oscillations recorded in these cells as result of propagation of the depolarizing waves through the gap junctions between non-transfected cells surrounding a cell harboring the mutation. Furthermore, mCh-D243Gfs*4 HL-1 cardiomyocytes showed reduced CX43-dependent Lucifer Yellow (LY loading and propagation. Of note, activation of β-catenin rescued both LY loading and LMNA D243Gfs*4 -HL-1 cells spontaneous activity propagation. Conclusion: Overall, the present results clearly indicate the involvement of the aberrant CX43 expression/activity as a pathogenic mechanism for the

SETBP1 mutations drive leukemic transformation in ASXL1-mutated MDS.

Science.gov (United States)

Inoue, D; Kitaura, J; Matsui, H; Hou, H-A; Chou, W-C; Nagamachi, A; Kawabata, K C; Togami, K; Nagase, R; Horikawa, S; Saika, M; Micol, J-B; Hayashi, Y; Harada, Y; Harada, H; Inaba, T; Tien, H-F; Abdel-Wahab, O; Kitamura, T

2015-04-01

Mutations in ASXL1 are frequent in patients with myelodysplastic syndrome (MDS) and are associated with adverse survival, yet the molecular pathogenesis of ASXL1 mutations (ASXL1-MT) is not fully understood. Recently, it has been found that deletion of Asxl1 or expression of C-terminal-truncating ASXL1-MTs inhibit myeloid differentiation and induce MDS-like disease in mice. Here, we find that SET-binding protein 1 (SETBP1) mutations (SETBP1-MT) are enriched among ASXL1-mutated MDS patients and associated with increased incidence of leukemic transformation, as well as shorter survival, suggesting that SETBP1-MT play a critical role in leukemic transformation of MDS. We identify that SETBP1-MT inhibit ubiquitination and subsequent degradation of SETBP1, resulting in increased expression. Expression of SETBP1-MT, in turn, inhibited protein phosphatase 2A activity, leading to Akt activation and enhanced expression of posterior Hoxa genes in ASXL1-mutant cells. Biologically, SETBP1-MT augmented ASXL1-MT-induced differentiation block, inhibited apoptosis and enhanced myeloid colony output. SETBP1-MT collaborated with ASXL1-MT in inducing acute myeloid leukemia in vivo. The combination of ASXL1-MT and SETBP1-MT activated a stem cell signature and repressed the tumor growth factor-β signaling pathway, in contrast to the ASXL1-MT-induced MDS model. These data reveal that SETBP1-MT are critical drivers of ASXL1-mutated MDS and identify several deregulated pathways as potential therapeutic targets in high-risk MDS.

Homozygous premature truncation of the HERG protein : the human HERG knockout

NARCIS (Netherlands)

Hoorntje, T.; Alders, M.; van Tintelen, P.; van der Lip, K.; Sreeram, N.; van der Wal, A.; Mannens, M.; Wilde, A.

1999-01-01

Background-In long-QT syndrome (LQTS), heterozygosity for a mutation in 1 of the K(+) channel genes leads to prolongation of the cardiac action potential, because the aberrant protein exhibits "loss of function." HERG, which is involved in LQT2, is the gene encoding the rapid component of the

Disease-associated mutations disrupt functionally important regions of intrinsic protein disorder.

Directory of Open Access Journals (Sweden)

Vladimir Vacic

Full Text Available The effects of disease mutations on protein structure and function have been extensively investigated, and many predictors of the functional impact of single amino acid substitutions are publicly available. The majority of these predictors are based on protein structure and evolutionary conservation, following the assumption that disease mutations predominantly affect folded and conserved protein regions. However, the prevalence of the intrinsically disordered proteins (IDPs and regions (IDRs in the human proteome together with their lack of fixed structure and low sequence conservation raise a question about the impact of disease mutations in IDRs. Here, we investigate annotated missense disease mutations and show that 21.7% of them are located within such intrinsically disordered regions. We further demonstrate that 20% of disease mutations in IDRs cause local disorder-to-order transitions, which represents a 1.7-2.7 fold increase compared to annotated polymorphisms and neutral evolutionary substitutions, respectively. Secondary structure predictions show elevated rates of transition from helices and strands into loops and vice versa in the disease mutations dataset. Disease disorder-to-order mutations also influence predicted molecular recognition features (MoRFs more often than the control mutations. The repertoire of disorder-to-order transition mutations is limited, with five most frequent mutations (R→W, R→C, E→K, R→H, R→Q collectively accounting for 44% of all deleterious disorder-to-order transitions. As a proof of concept, we performed accelerated molecular dynamics simulations on a deleterious disorder-to-order transition mutation of tumor protein p63 and, in agreement with our predictions, observed an increased α-helical propensity of the region harboring the mutation. Our findings highlight the importance of mutations in IDRs and refine the traditional structure-centric view of disease mutations. The results of this study

The point mutation process in proteins

Science.gov (United States)

Schwartz, R. M.; Dayhoff, M. O.

1978-01-01

An optimized scoring matrix for residue-by-residue comparisons of distantly related protein sequences has been developed. The scoring matrix is based on observed exchanges and mutabilities of amino acids in 1572 closely related sequences derived from a cross-section of protein groups. Very few superimposed or parallel mutations are included in the data. The scoring matrix is most useful for demonstrating the relatedness of proteins between 65 and 85% different.

Risk modeling and screening for BRCA1 mutations among Filipino breast cancer patients

International Nuclear Information System (INIS)

Nato, Alejandro Q. Jr.

2003-03-01

Breast cancer susceptibility gene, type 1(BRCA1) has been thought to be responsible for ∼45% of families with multiple breast carcinomas and for ∼80% of breast and ovarian cancer families. In this study, we investigated 34 familial Filipino breast cancer (BC) patients to: (a) estimate breast cancer risks and BRCA1/2 mutation carrier probabilities using risk assessment and prior probability models, respectively; (b) screen for putative polymorphisms at selected smaller exons of BRCA1 by single-strand conformation polymorphism (SSCP) analysis; (c) screen for truncated mutations at BRCA1 exon 11 by radioactive protein truncation test (PTT); and (d) estimate posterior probabilities upon incorporation of screening results. SSCP analysis revealed 8 unique putative polymorphisms. Low prevalence of unique putative polymorphisms at exon 2, 5, 17, and 22 may indicate probable mutations. Contrastingly, high prevalence of unique putative polymorphisms at exons 13, 15, and 16 may suggest true polymorphisms which are biologically insignificant. PTT, DHPLC, and sequence analyses revealed a novel mutation in exon 11 involving GT insertion that resulted to a stop codon which generated a 29.7 kDa truncated protein product. This is the second documented mutation in BRCA1 exon 11 in a Filipino BC patient since 1998. Initial genotype-phenotype correlations in Filipino BC patients may be elucidated based on screening tests performed. Our results corroborate the findings of a study on unselected incident Filipino BC cases where the reported prevalence of BRCA1 mutation is low. The higher prevalence of putative polypmorphisms may be attributed to the increased stringency in patient prospecting. The Gail, Claus, and BRCAPRO models can be utilized to estimate BC risk in unaffected high-risk individuals but validation is needed. Most of the BRCAPRO and Myriad.com prior probability estimates coincide with the presence of BRCA1 mutation and/or putative polymorphisms. This pioneering

Risk modeling and screening for BRCA1 mutations among Filipino breast cancer patients

Energy Technology Data Exchange (ETDEWEB)

Nato, Jr, Alejandro Q

2003-03-01

Breast cancer susceptibility gene, type 1(BRCA1) has been thought to be responsible for {approx}45% of families with multiple breast carcinomas and for {approx}80% of breast and ovarian cancer families. In this study, we investigated 34 familial Filipino breast cancer (BC) patients to: (a) estimate breast cancer risks and BRCA1/2 mutation carrier probabilities using risk assessment and prior probability models, respectively; (b) screen for putative polymorphisms at selected smaller exons of BRCA1 by single-strand conformation polymorphism (SSCP) analysis; (c) screen for truncated mutations at BRCA1 exon 11 by radioactive protein truncation test (PTT); and (d) estimate posterior probabilities upon incorporation of screening results. SSCP analysis revealed 8 unique putative polymorphisms. Low prevalence of unique putative polymorphisms at exon 2, 5, 17, and 22 may indicate probable mutations. Contrastingly, high prevalence of unique putative polymorphisms at exons 13, 15, and 16 may suggest true polymorphisms which are biologically insignificant. PTT, DHPLC, and sequence analyses revealed a novel mutation in exon 11 involving GT insertion that resulted to a stop codon which generated a 29.7 kDa truncated protein product. This is the second documented mutation in BRCA1 exon 11 in a Filipino BC patient since 1998. Initial genotype-phenotype correlations in Filipino BC patients may be elucidated based on screening tests performed. Our results corroborate the findings of a study on unselected incident Filipino BC cases where the reported prevalence of BRCA1 mutation is low. The higher prevalence of putative polypmorphisms may be attributed to the increased stringency in patient prospecting. The Gail, Claus, and BRCAPRO models can be utilized to estimate BC risk in unaffected high-risk individuals but validation is needed. Most of the BRCAPRO and Myriad.com prior probability estimates coincide with the presence of BRCA1 mutation and/or putative polymorphisms. This

Mutations in SYNGAP1 Cause Intellectual Disability, Autism, and a Specific Form of Epilepsy by Inducing Haploinsufficiency

DEFF Research Database (Denmark)

Berryer, Martin H; Hamdan, Fadi F; Klitten, Laura L

2013-01-01

De novo mutations in SYNGAP1, which codes for a RAS/RAP GTP-activating protein, cause nonsyndromic intellectual disability (NSID). All disease-causing point mutations identified until now in SYNGAP1 are truncating, raising the possibility of an association between this type of mutations and NSID...... also showed ataxia, autism, and a specific form of generalized epilepsy that can be refractory to treatment. All of these mutations occurred de novo, except c.283dupC, which was inherited from a father who is a mosaic. Biolistic transfection of wild-type SYNGAP1 in pyramidal cells from cortical...

Mutations in STX1B, encoding a presynaptic protein, cause fever-associated epilepsy syndromes

DEFF Research Database (Denmark)

Schubert, J.; Siekierska, A.; Langlois, M.

2014-01-01

Febrile seizures affect 2-4% of all children(1) and have a strong genetic component(2). Recurrent mutations in three main genes (SCN1A, SCN1B and GABRG2)(3-5) have been identified that cause febrile seizures with or without epilepsy. Here we report the identification of mutations in STX1B, encoding...... syntaxin-1B(6), that are associated with both febrile seizures and epilepsy. Whole-exome sequencing in independent large pedigrees(7,8) identified cosegregating STX1B mutations predicted to cause an early truncation or an in-frame insertion or deletion. Three additional nonsense or missense mutations...... and a de novo microdeletion encompassing STX1B were then identified in 449 familial or sporadic cases. Video and local field potential analyses of zebrafish larvae with antisense knockdown of stx1b showed seizure-like behavior and epileptiform discharges that were highly sensitive to increased temperature...

Expression of truncated PITX3 in the developing lens leads to microphthalmia and aphakia in mice.

Directory of Open Access Journals (Sweden)

Kenta Wada

Full Text Available Microphthalmia is a severe ocular disorder, and this condition is typically caused by mutations in transcription factors that are involved in eye development. Mice carrying mutations in these transcription factors would be useful tools for defining the mechanisms underlying developmental eye disorders. We discovered a new spontaneous recessive microphthalmos mouse mutant in the Japanese wild-derived inbred strain KOR1/Stm. The homozygous mutant mice were histologically characterized as microphthalmic by the absence of crystallin in the lens, a condition referred to as aphakia. By positional cloning, we identified the nonsense mutation c.444C>A outside the genomic region that encodes the homeodomain of the paired-like homeodomain transcription factor 3 gene (Pitx3 as the mutation responsible for the microphthalmia and aphakia. We examined Pitx3 mRNA expression of mutant mice during embryonic stages using RT-PCR and found that the expression levels are higher than in wild-type mice. Pitx3 over-expression in the lens during developmental stages was also confirmed at the protein level in the microphthalmos mutants via immunohistochemical analyses. Although lens fiber differentiation was not observed in the mutants, strong PITX3 protein signals were observed in the lens vesicles of the mutant lens. Thus, we speculated that abnormal PITX3, which lacks the C-terminus (including the OAR domain as a result of the nonsense mutation, is expressed in mutant lenses. We showed that the expression of the downstream genes Foxe3, Prox1, and Mip was altered because of the Pitx3 mutation, with large reductions in the lens vesicles in the mutants. Similar profiles were observed by immunohistochemical analysis of these proteins. The expression profiles of crystallins were also altered in the mutants. Therefore, we speculated that the microphthalmos/aphakia in this mutant is caused by the expression of truncated PITX3, resulting in the abnormal expression of

Dietary factors and Truncating APC Mutations in Sporadic Colorectal Adenomas

NARCIS (Netherlands)

Diergaarde, B.; Tiemersma, E.W.; Braam, H.; Muijen, van G.N.P.; Nagengast, F.M.; Kok, F.J.; Kampman, E.

2005-01-01

Inactivating mutations in APC are thought to be early, initiating events in colorectal carcinogenesis. To gain insight into the relationship between diet and inactivating APC mutations, we evaluated associations between dietary factors and the occurrence of these mutations in a Dutch case-control

Dietary factors and truncating APC mutations in sporadic colorectal adenomas.

NARCIS (Netherlands)

Diergaarde, B.; Tiemersma, E.W.; Braam, H.; Muijen, G.N.P. van; Nagengast, F.M.; Kok, F.J.; Kampman, E.

2005-01-01

Inactivating mutations in APC are thought to be early, initiating events in colorectal carcinogenesis. To gain insight into the relationship between diet and inactivating APC mutations, we evaluated associations between dietary factors and the occurrence of these mutations in a Dutch case-control

CRISPR/Cas9-mediated mutation revealed cytoplasmic tail is dispensable for IZUMO1 function and male fertility

DEFF Research Database (Denmark)

Young, Samantha A M; Miyata, Haruhiko; Satouh, Yuhkoh

2016-01-01

manipulation system of CRISPR/Cas9 to generate a point mutation resulting in a premature stop codon, producing mice with truncated IZUMO1. Mice without the cytoplasmic tail of IZUMO1 showed normal fertility but decreased the amount of protein, indicating that whilst this region is important for the expression...

Structure based modification of Bluetongue virus helicase protein VP6 to produce a viable VP6-truncated BTV

Energy Technology Data Exchange (ETDEWEB)

Matsuo, Eiko [Microbiology and Immunology, Division of Animal Science, Department of Bioresource Science, Graduate School of Agricultural Science, Kobe University, 1-1, Rokkodai, Nada-ku, Kobe-City 657-8501 (Japan); Faculty of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, Keppel Street, London WC1E 7HT (United Kingdom); Leon, Esther; Matthews, Steve J. [Division of Molecular Biosciences, Centre for Structural Biology, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Roy, Polly, E-mail: polly.roy@lshtm.ac.uk [Faculty of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, Keppel Street, London WC1E 7HT (United Kingdom)

2014-09-05

Highlights: • NMR analysis on BTV VP6 reveals two large loop regions. • The loss of a loop (aa 34–130) does not affect the overall fold of the protein. • A region of VP6 (aa 34–92) is not required for BTV replication. • A region of VP6 (aa 93–130) plays an essential role in the virus replication. - Abstract: Bluetongue virus core protein VP6 is an ATP hydrolysis dependent RNA helicase. However, despite much study, the precise role of VP6 within the viral capsid and its structure remain unclear. To investigate the requirement of VP6 in BTV replication, we initiated a structural and biological study. Multinuclear nuclear magnetic resonance spectra were assigned on his-tagged full-length VP6 (329 amino acid residues) as well as several truncated VP6 variants. The analysis revealed a large structured domain with two large loop regions that exhibit significant conformational exchange. One of the loops (amino acid position 34–130) could be removed without affecting the overall fold of the protein. Moreover, using a BTV reverse genetics system, it was possible to demonstrate that the VP6-truncated BTV was viable in BHK cells in the absence of any helper VP6 protein, suggesting that a large portion of this loop region is not absolutely required for BTV replication.

Venous thromboembolism associated with protein S deficiency due

Indian Academy of Sciences (India)

This mutation interrupts the reading frame by premature termination codon at position 451 and may lead to the production of truncated protein. The present case combined with the review of the literature suggests that p.Arg451* in the PROS1 gene mainly leads to clinically evident thrombosisfollowing trauma, surgery or ...

A novel mutation in the sterol 27-hydroxylase gene of a woman with autosomal recessive cerebrotendinous xanthomatosis

Directory of Open Access Journals (Sweden)

Garuti Rita

2010-10-01

Full Text Available Article abstract Mutations of the gene encoding the mitochondrial enzyme sterol 27-hydroxylase (CYP27A1 gene cause defects in the cholesterol pathway to bile acids that lead to the storage of cholestanol and cholesterol in tendons, lenses and the central nervous system. This disorder is the cause of a clinical syndrome known as cerebrotendinous xanthomatosis (CTX. Since 1991 several mutations of the CYP27A1 gene have been reported. We diagnosed the clinical features of CTX in a caucasian woman. Serum levels of cholestanol and 7α-hydroxycholesterol were elevated and the concentration of 27-hydroxycholesterol was reduced. Bile alcohols in the urine and faeces were increased. The analysis of the CYP27A1 gene showed that the patient was a compound heterozygote carrying two mutations both located in exon 8. One mutation is a novel four nucleotide deletion (c.1330-1333delTTCC that results in a frameshift and the occurrence of a premature stop codon leading to the formation of a truncated protein of 448 amino acids. The other mutation, previously reported, is a C - > T transition (c. c.1381C > T that converts the glutamine codon at position 461 into a termination codon (p.Q461X. These truncated proteins are expected to have no biological function being devoid of the cysteine residue at position 476 of the normal enzyme that is crucial for heme binding and enzyme activity.

Cancer3D: understanding cancer mutations through protein structures.

Science.gov (United States)

Porta-Pardo, Eduard; Hrabe, Thomas; Godzik, Adam

2015-01-01

The new era of cancer genomics is providing us with extensive knowledge of mutations and other alterations in cancer. The Cancer3D database at http://www.cancer3d.org gives an open and user-friendly way to analyze cancer missense mutations in the context of structures of proteins in which they are found. The database also helps users analyze the distribution patterns of the mutations as well as their relationship to changes in drug activity through two algorithms: e-Driver and e-Drug. These algorithms use knowledge of modular structure of genes and proteins to separately study each region. This approach allows users to find novel candidate driver regions or drug biomarkers that cannot be found when similar analyses are done on the whole-gene level. The Cancer3D database provides access to the results of such analyses based on data from The Cancer Genome Atlas (TCGA) and the Cancer Cell Line Encyclopedia (CCLE). In addition, it displays mutations from over 14,700 proteins mapped to more than 24,300 structures from PDB. This helps users visualize the distribution of mutations and identify novel three-dimensional patterns in their distribution. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Mutations Affecting G-Protein Subunit α11 in Hypercalcemia and Hypocalcemia

Science.gov (United States)

Babinsky, Valerie N.; Head, Rosie A.; Cranston, Treena; Rust, Nigel; Hobbs, Maurine R.; Heath, Hunter; Thakker, Rajesh V.

2013-01-01

BACKGROUND Familial hypocalciuric hypercalcemia is a genetically heterogeneous disorder with three variants: types 1, 2, and 3. Type 1 is due to loss-of-function mutations of the calcium-sensing receptor, a guanine nucleotide–binding protein (G-protein)–coupled receptor that signals through the G-protein subunit α11 (Gα11). Type 3 is associated with adaptor-related protein complex 2, sigma 1 subunit (AP2S1) mutations, which result in altered calcium-sensing receptor endocytosis. We hypothesized that type 2 is due to mutations effecting Gα11 loss of function, since Gα11 is involved in calcium-sensing receptor signaling, and its gene (GNA11) and the type 2 locus are colocalized on chromosome 19p13.3. We also postulated that mutations effecting Gα11 gain of function, like the mutations effecting calcium-sensing receptor gain of function that cause autosomal dominant hypocalcemia type 1, may lead to hypocalcemia. METHODS We performed GNA11 mutational analysis in a kindred with familial hypocalciuric hypercalcemia type 2 and in nine unrelated patients with familial hypocalciuric hypercalcemia who did not have mutations in the gene encoding the calcium-sensing receptor (CASR) or AP2S1. We also performed this analysis in eight unrelated patients with hypocalcemia who did not have CASR mutations. In addition, we studied the effects of GNA11 mutations on Gα11 protein structure and calcium-sensing receptor signaling in human embryonic kidney 293 (HEK293) cells. RESULTS The kindred with familial hypocalciuric hypercalcemia type 2 had an in-frame deletion of a conserved Gα11 isoleucine (Ile200del), and one of the nine unrelated patients with familial hypocalciuric hypercalcemia had a missense GNA11 mutation (Leu135Gln). Missense GNA11 mutations (Arg181Gln and Phe341Leu) were detected in two unrelated patients with hypocalcemia; they were therefore identified as having autosomal dominant hypocalcemia type 2. All four GNA11 mutations predicted disrupted protein

Digestion proteomics: tracking lactoferrin truncation and peptide release during simulated gastric digestion.

Science.gov (United States)

Grosvenor, Anita J; Haigh, Brendan J; Dyer, Jolon M

2014-11-01

The extent to which nutritional and functional benefit is derived from proteins in food is related to its breakdown and digestion in the body after consumption. Further, detailed information about food protein truncation during digestion is critical to understanding and optimising the availability of bioactives, in controlling and limiting allergen release, and in minimising or monitoring the effects of processing and food preparation. However, tracking the complex array of products formed during the digestion of proteins is not easily accomplished using classical proteomics. We here present and develop a novel proteomic approach using isobaric labelling to mapping and tracking protein truncation and peptide release during simulated gastric digestion, using bovine lactoferrin as a model food protein. The relative abundance of related peptides was tracked throughout a digestion time course, and the effect of pasteurisation on peptide release assessed. The new approach to food digestion proteomics developed here therefore appears to be highly suitable not only for tracking the truncation and relative abundance of released peptides during gastric digestion, but also for determining the effects of protein modification on digestibility and potential bioavailability.

TARDBP and FUS mutations associated with amyotrophic lateral sclerosis: summary and update.

Science.gov (United States)

Lattante, Serena; Rouleau, Guy A; Kabashi, Edor

2013-06-01

Mutations in the TAR DNA Binding Protein gene (TARDBP), encoding the protein TDP-43, were identified in amyotrophic lateral sclerosis (ALS) patients. Interestingly, TDP-43 positive inclusion bodies were first discovered in ubiquitin-positive, tau-negative ALS and frontotemporal dementia (FTD) inclusion bodies, and subsequently observed in the majority of neurodegenerative disorders. To date, 47 missense and one truncating mutations have been described in a large number of familial (FALS) and sporadic (SALS) patients. Fused in sarcoma (FUS) was found to be responsible for a previously identified ALS6 locus, being mutated in both FALS and SALS patients. TARDBP and FUS have a structural and functional similarity and most of mutations in both genes are also clustered in the C-terminus of the proteins. The molecular mechanisms through which mutant TDP-43 and FUS may cause motor neuron degeneration are not well understood. Both proteins play an important role in mRNA transport, axonal maintenance, and motor neuron development. Functional characterization of these mutations in in vitro and in vivo systems is helping to better understand how motor neuron degeneration occurs. This report summarizes the biological and clinical relevance of TARDBP and FUS mutations in ALS. All the data reviewed here have been submitted to a database based on the Leiden Open (source) Variation Database (LOVD) and is accessible online at www.lovd.nl/TARDBP, www.lovd.nl/FUS. © 2013 Wiley Periodicals, Inc.

MutHTP: Mutations in Human Transmembrane Proteins.

Science.gov (United States)

A, Kulandaisamy; S, Binny Priya; R, Sakthivel; Tarnovskaya, Svetlana; Bizin, Ilya; Hönigschmid, Peter; Frishman, Dmitrij; Gromiha, M Michael

2018-02-01

We have developed a novel database, MutHTP, which contains information on 183395 disease-associated and 17827 neutral mutations in human transmembrane proteins. For each mutation site MutHTP provides a description of its location with respect to the membrane protein topology, structural environment (if available) and functional features. Comprehensive visualization, search, display and download options are available. The database is publicly available at http://www.iitm.ac.in/bioinfo/MutHTP/. The website is implemented using HTML, PHP and javascript and supports recent versions of all major browsers, such as Firefox, Chrome and Opera. gromiha@iitm.ac.in. Supplementary data are available at Bioinformatics online. © The Author (2018). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Transiently truncated and differentially regulated expression of midkine during mouse embryogenesis

International Nuclear Information System (INIS)

Chen Qin; Yuan Yuanyang; Lin Shuibin; Chang Youde; Zhuo Xinming; Wei Wei; Tao Ping; Ruan Lingjuan; Li Qifu; Li Zhixing

2005-01-01

Midkine (MK) is a retinoic acid response cytokine, mostly expressed in embryonic tissues. Aberrant expression of MK was found in numerous cancers. In human, a truncated MK was expressed specifically in tumor/cancer tissues. Here we report the discovery of a novel truncated form of MK transiently expressed during normal mouse embryonic development. In addition, MK is concentrated at the interface between developing epithelium and mesenchyme as well as highly proliferating cells. Its expression, which is closely coordinated with angiogenesis and vasculogenesis, is spatiotemporally regulated with peaks in extensive organogenesis period and undifferentiated cells tailing off in maturing cells, implying its role in nascent blood vessel (endothelial) signaling of tissue differentiation and stem cell renewal/differentiation.. Cloning and sequencing analysis revealed that the embryonic truncated MK, in which the conserved domain is in-frame deleted, presumably producing a novel secreted small peptide, is different from the truncated form in human cancer tissues, whose deletion results in a frame-shift mutation. Our data suggest that MK may play a role in epithelium-mesenchyme interactions, blood vessel signaling, and the decision of proliferation vs differentiation. Detection of the transiently expressed truncated MK reveals its novel function in development and sheds light on its role in carcinogenesis

A new biotype of Fusarium oxysporum f. sp. lycopersici race 2 emerged by a transposon-driven mutation of avirulence gene AVR1.

Science.gov (United States)

Kashiwa, Takeshi; Suzuki, Tatsuya; Sato, Akira; Akai, Kotaro; Teraoka, Tohru; Komatsu, Ken; Arie, Tsutomu

2016-07-01

Emergence of races in Fusarium oxysporum f. sp. lycopersici (Fol) is caused by loss or mutation of at least one avirulence (AVR) gene. The product of AVR1 is a small protein (Avr1) secreted by Fol in tomato xylem sap during infection. This protein triggers Fol race 1 specific resistance (I) in tomato, indicating that AVR1 is an AVR gene. Deletion of AVR1 in race 1 resulted in the emergence of race 2, and an additional mutation in AVR2 generated race 3. Previously, we reported a new biotype of race 3, KoChi-1, in which AVR1 was truncated by a transposon Hormin, which suggested a new route to evolution of races in Fol However, to date no race 2 isolate carrying Hormin-truncated AVR1 has been reported. In this report, we describe such isolates, represented by Chiba-5, in which Hormin insertion occurred in AVR1 at a position different from that in KoChi-1. AVR1 truncation in both isolates resulted in production of defective Avr1 proteins. Chiba-5 and KoChi-1 belong to different phylogenetic clades, A1 and A2, respectively, suggesting that insertion of Hormin in AVR1 in Chiba-5 and KoChi-1 occurred as independent evolutionary events. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A donor splice site mutation in CISD2 generates multiple truncated, non-functional isoforms in Wolfram syndrome type 2 patients.

Science.gov (United States)

Cattaneo, Monica; La Sala, Lucia; Rondinelli, Maurizio; Errichiello, Edoardo; Zuffardi, Orsetta; Puca, Annibale Alessandro; Genovese, Stefano; Ceriello, Antonio

2017-12-13

Mutations in the gene that encodes CDGSH iron sulfur domain 2 (CISD2) are causative of Wolfram syndrome type 2 (WFS2), a rare autosomal recessive neurodegenerative disorder mainly characterized by diabetes mellitus, optic atrophy, peptic ulcer bleeding and defective platelet aggregation. Four mutations in the CISD2 gene have been reported. Among these mutations, the homozygous c.103 + 1G > A substitution was identified in the donor splice site of intron 1 in two Italian sisters and was predicted to cause a exon 1 to be skipped. Here, we employed molecular assays to characterize the c.103 + 1G > A mutation using the patient's peripheral blood mononuclear cells (PBMCs). 5'-RACE coupled with RT-PCR were used to analyse the effect of the c.103 + 1G > A mutation on mRNA splicing. Western blot analysis was used to analyse the consequences of the CISD2 mutation on the encoded protein. We demonstrated that the c.103 + 1G > A mutation functionally impaired mRNA splicing, producing multiple splice variants characterized by the whole or partial absence of exon 1, which introduced amino acid changes and a premature stop. The affected mRNAs resulted in either predicted targets for nonsense mRNA decay (NMD) or non-functional isoforms. We concluded that the c.103 + 1G > A mutation resulted in the loss of functional CISD2 protein in the two Italian WFS2 patients.

Novel de novo BRCA2 mutation in a patient with a family history of breast cancer

DEFF Research Database (Denmark)

Hansen, Thomas V O; Bisgaard, Marie Luise; Jønson, Lars

2008-01-01

whole blood. The paternity was determined by single nucleotide polymorphism (SNP) microarray analysis. Parental origin of the de novo mutation was determined by establishing mutation-SNP haplotypes by variant specific PCR, while de novo and mosaic status was investigated by sequencing of DNA from......BACKGROUND: BRCA2 germ-line mutations predispose to breast and ovarian cancer. Mutations are widespread and unclassified splice variants are frequently encountered. We describe the parental origin and functional characterization of a novel de novo BRCA2 splice site mutation found in a patient...... and synthesis of a truncated BRCA2 protein. The aberrant splicing was verified by RT-PCR analysis on RNA isolated from whole blood of the affected patient. The mutation was not found in any of the patient's parents or in the mother's carcinoma, showing it is a de novo mutation. Variant specific PCR indicates...

Analysis of Low Frequency Protein Truncating Stop-Codon Variants and Fasting Concentration of Growth Hormone.

Directory of Open Access Journals (Sweden)

Erik Hallengren

Full Text Available The genetic background of Growth Hormone (GH secretion is not well understood. Mutations giving rise to a stop codon have a high likelihood of affecting protein function.To analyze likely functional stop codon mutations that are associated with fasting plasma concentration of Growth Hormone.We analyzed stop codon mutations in 5451 individuals in the Malmö Diet and Cancer study by genotyping the Illumina Exome Chip. To enrich for stop codon mutations with likely functional effects on protein function, we focused on those disrupting >80% of the predicted amino acid sequence, which were carried by ≥ 10 individuals. Such mutations were related to GH concentration, measured with a high sensitivity assay (hs-GH and, if nominally significant, to GH related phenotypes, using linear regression analysis.Two stop codon mutations were associated with the fasting concentration of hs-GH. rs121909305 (NP_005370.1:p.R93* [Minor Allele Frequency (MAF = 0.8%] in the Myosin 1A gene (MYO1A was associated with a 0.36 (95%CI, 0.04 to 0.54; p=0.02 increment of the standardized value of the natural logarithm of hs-GH per 1 minor allele and rs35699176 (NP_067040.1:p.Q100* in the Zink Finger protein 77 gene (ZNF77 (MAF = 4.8% was associated with a 0.12 (95%CI, 0.02 to 0.22; p = 0.02 increase of hs-GH. The mutated high hs-GH associated allele of MYO1A was related to lower BMI (β-coefficient, -0.22; p = 0.05, waist (β-coefficient, -0.22; p = 0.04, body fat percentage (β-coefficient, -0.23; p = 0.03 and with higher HDL (β-coefficient, 0.23; p = 0.04. The ZNF77 stop codon was associated with height (β-coefficient, 0.11; p = 0.02 but not with cardiometabolic risk factors.We here suggest that a stop codon of MYO1A, disrupting 91% of the predicted amino acid sequence, is associated with higher hs-GH and GH-related traits suggesting that MYO1A is involved in GH metabolism and possibly body fat distribution. However, our results are preliminary and need replication in

Mutation choice to eliminate buried free cysteines in protein therapeutics.

Science.gov (United States)

Xia, Xue; Longo, Liam M; Blaber, Michael

2015-02-01

Buried free-cysteine (Cys) residues can contribute to an irreversible unfolding pathway that promotes protein aggregation, increases immunogenic potential, and significantly reduces protein functional half-life. Consequently, mutation of buried free-Cys residues can result in significant improvement in the storage, reconstitution, and pharmacokinetic properties of protein-based therapeutics. Mutational design to eliminate buried free-Cys residues typically follows one of two common heuristics: either substitution by Ser (polar and isosteric), or substitution by Ala or Val (hydrophobic); however, a detailed structural and thermodynamic understanding of Cys mutations is lacking. We report a comprehensive structure and stability study of Ala, Ser, Thr, and Val mutations at each of the three buried free-Cys positions (Cys16, Cys83, and Cys117) in fibroblast growth factor-1. Mutation was almost universally destabilizing, indicating a general optimization for the wild-type Cys, including van der Waals and H-bond interactions. Structural response to Cys mutation characteristically involved changes to maintain, or effectively substitute, local H-bond interactions-by either structural collapse to accommodate the smaller oxygen radius of Ser/Thr, or conversely, expansion to enable inclusion of novel H-bonding solvent. Despite the diverse structural effects, the least destabilizing average substitution at each position was Ala, and not isosteric Ser. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.

Comprehensive molecular diagnosis of 67 Chinese Usher syndrome probands: high rate of ethnicity specific mutations in Chinese USH patients.

Science.gov (United States)

Jiang, Lichun; Liang, Xiaofang; Li, Yumei; Wang, Jing; Zaneveld, Jacques Eric; Wang, Hui; Xu, Shan; Wang, Keqing; Wang, Binbin; Chen, Rui; Sui, Ruifang

2015-09-04

Usher syndrome (USH) is the most common disease causing combined deafness and blindness. It is predominantly an autosomal recessive genetic disorder with occasionally digenic cases. Molecular diagnosis of USH patients is important for disease management. Few studies have tried to find the genetic cause of USH in Chinese patients. This study was designed to determine the mutation spectrum of Chinese USH patients. We applied next generation sequencing to characterize the mutation spectrum in 67 independent Chinese families with at least one member diagnosed with USH. Blood was collected at Peking Union Medical College Hospital. This cohort is one of the largest USH cohorts reported. We utilized customized panel and whole exome sequencing, variant analysis, Sanger validation and segregation tests to find disease causing mutations in these families. We identified biallelic disease causing mutations in known USH genes in 70 % (49) of our patients. As has been previously reported, MYO7A is the most frequently mutated gene in our USH type I patients while USH2A is the most mutated gene in our USH type II patients. In addition, we identify mutations in CLRN1, DFNB31, GPR98 and PCDH15 for the first time in Chinese USH patients. Together, mutations in CLRN1, DNFB31, GPR98 and PCDH15 account for 11.4 % of disease in our cohort. Interestingly, although the spectrum of disease genes is quite similar between our Chinese patient cohort and other patient cohorts from different (and primarily Caucasian) ethnic backgrounds, the mutations themselves are dramatically different. In particular, 76 % (52/68) of alleles found in this study have never been previously reported. Interestingly, we observed a strong enrichment for severe protein truncating mutations expected to have severe functional consequence on the protein in USH II patients compared to the reported mutation spectrum in RP patients, who often carry partial protein truncating mutations. Our study provides the first

Missense Mutation in the USH2A Gene: Association with Recessive Retinitis Pigmentosa without Hearing Loss

OpenAIRE

Rivolta, Carlo; Sweklo, Elizabeth A.; Berson, Eliot L.; Dryja, Thaddeus P.

2000-01-01

Microdeletions Glu767(1-bp del), Thr967(1-bp del), and Leu1446(2-bp del) in the human USH2A gene have been reported to cause Usher syndrome type II, a disorder characterized by retinitis pigmentosa (RP) and mild-to-severe hearing loss. Each of these three frameshift mutations is predicted to lead to an unstable mRNA transcript that, if translated, would result in a truncated protein lacking the carboxy terminus. Here, we report Cys759Phe, a novel missense mutation in this gene that changes an...

AB072. Novel mutation in the hepatocyte nuclear factor 1b/maturity-onset diabetes of the young type 5 gene—unreported Vietnamese case

OpenAIRE

Dung, Vu Chi; Thao, Bui Phuong; Ngoc, Can Thi Bich; Khanh, Nguyen Ngoc; Ellard, Sian

2015-01-01

Maturity-onset diabetes of the young type 5 (MODY5), a type of dominantly inherited diabetes mellitus and nephropathy, has been associated with mutations of the hepatocyte nuclear factor-1 (HNF-1β) gene, mostly generating truncated protein. Various phenotypes are related to HNF-1β mutations. Our aim to describe clinical and genetic findings in the unreported Vietnamese case identified with HNF-1β mutations. The proband with kidney failure from 7.5 years of age and diabetes diagnosed at 13.5 y...

A telomerase immortalized human proximal tubule cell line with a truncation mutation (Q4004X in polycystin-1.

Directory of Open Access Journals (Sweden)

Brittney-Shea Herbert

Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is associated with a variety of cellular phenotypes in renal epithelial cells. Cystic epithelia are secretory as opposed to absorptive, have higher proliferation rates in cell culture and have some characteristics of epithelial to mesenchymal transitions. In this communication we describe a telomerase immortalized cell line that expresses proximal tubule markers and is derived from renal cysts of an ADPKD kidney. These cells have a single detectable truncating mutation (Q4004X in polycystin-1. These cells make normal appearing but shorter cilia and fail to assemble polycystin-1 in the cilia, and less uncleaved polycystin-1 in membrane fractions. This cell line has been maintained in continuous passage for over 35 passages without going into senescence. Nephron segment specific markers suggest a proximal tubule origin for these cells and the cell line will be useful to study mechanistic details of cyst formation in proximal tubule cells.

A novel PTCH1 mutation in a patient with Gorlin syndrome.

Science.gov (United States)

Okamoto, Nana; Naruto, Takuya; Kohmoto, Tomohiro; Komori, Takahide; Imoto, Issei

2014-01-01

Gorlin syndrome is an autosomal dominant disorder characterized by a wide range of developmental abnormalities and a predisposition to various tumors, and it is linked to the alteration of several causative genes, including PTCH1. We performed targeted resequencing using a next-generation sequencer to analyze genes associated with known clinical phenotypes in an 11-year-old male with sporadic jaw keratocysts. A novel duplication mutation (c.426dup) in PTCH1, resulting in a truncated protein, was identified.

Genetic analysis of a four generation Indian family with Usher syndrome: a novel insertion mutation in MYO7A.

Science.gov (United States)

Kumar, Arun; Babu, Mohan; Kimberling, William J; Venkatesh, Conjeevaram P

2004-11-24

Usher syndrome (USH) is a rare autosomal recessive disorder characterized by deafness and retinitis pigmentosa. The purpose of this study was to determine the genetic cause of USH in a four generation Indian family. Peripheral blood samples were collected from individuals for genomic DNA isolation. To determine the linkage of this family to known USH loci, microsatellite markers were selected from the candidate regions of known loci and used to genotype the family. Exon specific intronic primers for the MYO7A gene were used to amplify DNA samples from one affected individual from the family. PCR products were subsequently sequenced to detect mutation. PCR-SSCP analysis was used to determine if the mutation segregated with the disease in the family and was not present in 50 control individuals. All affected individuals had a classic USH type I (USH1) phenotype which included deafness, vestibular dysfunction and retinitis pigmentosa. Pedigree analysis suggested an autosomal recessive mode of inheritance of USH in the family. Haplotype analysis suggested linkage of this family to the USH1B locus on chromosome 11q. DNA sequence analysis of the entire coding region of the MYO7A gene showed a novel insertion mutation c.2663_2664insA in a homozygous state in all affected individuals, resulting in truncation of MYO7A protein. This is the first study from India which reports a novel MYO7A insertion mutation in a four generation USH family. The mutation is predicted to produce a truncated MYO7A protein. With the novel mutation reported here, the total number of USH causing mutations in the MYO7A gene described to date reaches to 75.

Furin is a chemokine-modifying enzyme: in vitro and in vivo processing of CXCL10 generates a C-terminally truncated chemokine retaining full activity.

Science.gov (United States)

Hensbergen, Paul J; Verzijl, Dennis; Balog, Crina I A; Dijkman, Remco; van der Schors, Roel C; van der Raaij-Helmer, Elizabeth M H; van der Plas, Mariena J A; Leurs, Rob; Deelder, André M; Smit, Martine J; Tensen, Cornelis P

2004-04-02

Chemokines comprise a class of structurally related proteins that are involved in many aspects of leukocyte migration under basal and inflammatory conditions. In addition to the large number of genes, limited processing of these proteins by a variety of enzymes enhances the complexity of the total spectrum of chemokine variants. We have recently shown that the native chemokine CXCL10 is processed at the C terminus, thereby shedding the last four amino acids. The present study was performed to elucidate the mechanism in vivo and in vitro and to study the biological activity of this novel isoform of CXCL10. Using a combination of protein purification and mass spectrometric techniques, we show that the production of C-terminally truncated CXCL10 by primary keratinocytes is inhibited in vivo by a specific inhibitor of pro-protein convertases (e.g. furin) but not by inhibition of matrix metalloproteinases. Moreover, CXCL10 is processed by furin in vitro, which is abrogated by a mutation in the furin recognition site. Using GTPgammaS binding, Ca(2+) mobilization, and chemotaxis assays, we demonstrate that the C-terminally truncated CXCL10 variant is a potent ligand for CXCR3. Moreover, the inverse agonist activity on the virally encoded receptor ORF74 and the direct antibacterial activity of CXCL10 are fully retained. Hence, we have identified furin as a novel chemokine-modifying enzyme in vitro and most probably also in vivo, generating a C-terminally truncated CXCL10, which fully retains its (inverse) agonistic properties.

Suitability of two-dimensional electrophoretic protein separations for quantitative detection of mutations

International Nuclear Information System (INIS)

Taylor, J.; Anderson, N.L.; Anderson, N.G.; Gemmell, A.; Giometti, C.S.; Nance, S.L.; Tollaksen, S.L.

1986-01-01

Separation of proteins by two-dimensional electrophoresis (2DE) provides a powerful method for mutagenesis studies, since hundreds of proteins can be monitored simultaneously. In previous mutation studies in which 2DE has been used, only qualitative protein differences were monitored; quantitative protein variations were not evaluated. Although significant differences in protein abundance can be detected by eye, the large number of protein spots present in 2DE patterns together with the large number of individual patterns required for a mutagenesis study would necessitate the use of a computerized analysis system to detect the rare quantitative protein changes indicative of gene deletions or inactivation of genes by point mutations in regulatory genes. A pilot study to search for heritable mutations induced by treatment of mice with either ethylnitrosourea or gamma radiation is underway. Samples are being monitored for quantitative changes that reduce the amount of protein by about 50%. The results of this study indicate that the key methods to improve the application of 2DE to mutation screening are to increase the number of measurable spots (i.e., improve stain sensitivity) and to decrease the spread of values for the volume measurements. Even small improvements in these areas could greatly increase the number of monitorable spots. 9 refs., 4 figs

A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle.

Science.gov (United States)

Koltes, James E; Mishra, Bishnu P; Kumar, Dinesh; Kataria, Ranjit S; Totir, Liviu R; Fernando, Rohan L; Cobbold, Rowland; Steffen, David; Coppieters, Wouter; Georges, Michel; Reecy, James M

2009-11-17

Historically, dwarfism was the major genetic defect in U.S. beef cattle. Aggressive culling and sire testing were used to minimize its prevalence; however, neither of these practices can eliminate a recessive genetic defect. We assembled a 4-generation pedigree to identify the mutation underlying dwarfism in American Angus cattle. An adaptation of the Elston-Steward algorithm was used to overcome small pedigree size and missing genotypes. The dwarfism locus was fine-mapped to BTA6 between markers AFR227 and BM4311. Four candidate genes were sequenced, revealing a nonsense mutation in exon 15 of cGMP-dependant type II protein kinase (PRKG2). This C/T transition introduced a stop codon (R678X) that truncated 85 C-terminal amino acids, including a large portion of the kinase domain. Of the 75 mutations discovered in this region, only this mutation was 100% concordant with the recessive pattern of inheritance in affected and carrier individuals (log of odds score = 6.63). Previous research has shown that PRKG2 regulates SRY (sex-determining region Y) box 9 (SOX9)-mediated transcription of collagen 2 (COL2). We evaluated the ability of wild-type (WT) or R678X PRKG2 to regulate COL2 expression in cell culture. Real-time PCR results confirmed that COL2 is overexpressed in cells that overexpressed R678X PRKG2 as compared with WT PRKG2. Furthermore, COL2 and COL10 mRNA expression was increased in dwarf cattle compared with unaffected cattle. These experiments indicate that the R678X mutation is functional, resulting in a loss of PRKG2 regulation of COL2 and COL10 mRNA expression. Therefore, we present PRKG2 R678X as a causative mutation for dwarfism cattle.

Expression and characterization of truncated human heme oxygenase (hHO-1) and a fusion protein of hHO-1 with human cytochrome P450 reductase.

Science.gov (United States)

Wilks, A; Black, S M; Miller, W L; Ortiz de Montellano, P R

1995-04-04

A human heme oxygenase (hHO-1) gene without the sequence coding for the last 23 amino acids has been expressed in Escherichia coli behind the pho A promoter. The truncated enzyme is obtained in high yields as a soluble, catalytically-active protein, making it available for the first time for detailed mechanistic studies. The purified, truncated hHO-1/heme complex is spectroscopically indistinguishable from that of the rat enzyme and converts heme to biliverdin when reconstituted with rat liver cytochrome P450 reductase. A self-sufficient heme oxygenase system has been obtained by fusing the truncated hHO-1 gene to the gene for human cytochrome P450 reductase without the sequence coding for the 20 amino acid membrane binding domain. Expression of the fusion protein in pCWori+ yields a protein that only requires NADPH for catalytic turnover. The failure of exogenous cytochrome P450 reductase to stimulate turnover and the insensitivity of the catalytic rate toward changes in ionic strength establish that electrons are transferred intramolecularly between the reductase and heme oxygenase domains of the fusion protein. The Vmax for the fusion protein is 2.5 times higher than that for the reconstituted system. Therefore, either the covalent tether does not interfere with normal docking and electron transfer between the flavin and heme domains or alternative but equally efficient electron transfer pathways are available that do not require specific docking.

The combination of i-leader truncation and gemcitabine improves oncolytic adenovirus efficacy in an immunocompetent model.

Science.gov (United States)

Puig-Saus, C; Laborda, E; Rodríguez-García, A; Cascalló, M; Moreno, R; Alemany, R

2014-02-01

Adenovirus (Ad) i-leader protein is a small protein of unknown function. The C-terminus truncation of the i-leader protein increases Ad release from infected cells and cytotoxicity. In the current study, we use the i-leader truncation to enhance the potency of an oncolytic Ad. In vitro, an i-leader truncated oncolytic Ad is released faster to the supernatant of infected cells, generates larger plaques, and is more cytotoxic in both human and Syrian hamster cell lines. In mice bearing human tumor xenografts, the i-leader truncation enhances oncolytic efficacy. However, in a Syrian hamster pancreatic tumor model, which is immunocompetent and less permissive to human Ad, antitumor efficacy is only observed when the i-leader truncated oncolytic Ad, but not the non-truncated version, is combined with gemcitabine. This synergistic effect observed in the Syrian hamster model was not seen in vitro or in immunodeficient mice bearing the same pancreatic hamster tumors, suggesting a role of the immune system in this synergism. These results highlight the interest of the i-leader C-terminus truncation because it enhances the antitumor potency of an oncolytic Ad and provides synergistic effects with gemcitabine in the presence of an immune competent system.

Three novel and two known androgen receptor gene mutations ...

Indian Academy of Sciences (India)

gene mutations associated with androgen insensitivity syndrome in sex-reversed XY female patients. J. Genet. ... signal and a C-terminal. Keywords. androgen insensitivity syndrome; androgen receptor; truncation mutation; N-terminal domain; XY sex reversal. .... and an increased risk of gonadal tumour. Mutations in SRY.

Tbc1d1 mutation in lean mouse strain confers leanness and protects from diet-induced obesity

DEFF Research Database (Denmark)

Chadt, Alexandra; Leicht, Katja; Deshmukh, Atul

2008-01-01

We previously identified Nob1 as a quantitative trait locus for high-fat diet-induced obesity and diabetes in genome-wide scans of outcross populations of obese and lean mouse strains. Additional crossbreeding experiments indicated that Nob1 represents an obesity suppressor from the lean Swiss Jim...... Lambert (SJL) strain. Here we identify a SJL-specific mutation in the Tbc1d1 gene that results in a truncated protein lacking the TBC Rab-GTPase-activating protein domain. TBC1D1, which has been recently linked to human obesity, is related to the insulin signaling protein AS160 and is predominantly...... and reduced glucose uptake in isolated skeletal muscle. Our data strongly suggest that mutation of Tbc1d1 suppresses high-fat diet-induced obesity by increasing lipid use in skeletal muscle....

A homozygous nonsense CEP250 mutation combined with a heterozygous nonsense C2orf71 mutation is associated with atypical Usher syndrome.

Science.gov (United States)

Khateb, Samer; Zelinger, Lina; Mizrahi-Meissonnier, Liliana; Ayuso, Carmen; Koenekoop, Robert K; Laxer, Uri; Gross, Menachem; Banin, Eyal; Sharon, Dror

2014-07-01

Usher syndrome (USH) is a heterogeneous group of inherited retinitis pigmentosa (RP) and sensorineural hearing loss (SNHL) caused by mutations in at least 12 genes. Our aim is to identify additional USH-related genes. Clinical examination included visual acuity test, funduscopy and electroretinography. Genetic analysis included homozygosity mapping and whole exome sequencing (WES). A combination of homozygosity mapping and WES in a large consanguineous family of Iranian Jewish origin revealed nonsense mutations in two ciliary genes: c.3289C>T (p.Q1097*) in C2orf71 and c.3463C>T (p.R1155*) in centrosome-associated protein CEP250 (C-Nap1). The latter has not been associated with any inherited disease and the c.3463C>T mutation was absent in control chromosomes. Patients who were double homozygotes had SNHL accompanied by early-onset and severe RP, while patients who were homozygous for the CEP250 mutation and carried a single mutant C2orf71 allele had SNHL with mild retinal degeneration. No ciliary structural abnormalities in the respiratory system were evident by electron microscopy analysis. CEP250 expression analysis of the mutant allele revealed the generation of a truncated protein lacking the NEK2-phosphorylation region. A homozygous nonsense CEP250 mutation, in combination with a heterozygous C2orf71 nonsense mutation, causes an atypical form of USH, characterised by early-onset SNHL and a relatively mild RP. The severe retinal involvement in the double homozygotes indicates an additive effect caused by nonsense mutations in genes encoding ciliary proteins. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Genetic analysis of Chinese families reveals a novel truncation allele of the retinitis pigmentosa GTPase regulator gene

Directory of Open Access Journals (Sweden)

Fang Hu

2014-10-01

Full Text Available AIM: To make comprehensive molecular diagnosis for retinitis pigmentosa (RP patients in a consanguineous Han Chinese family using next generation sequencing based Capture-NGS screen technology. METHODS: A five-generation Han Chinese family diagnosed as non-syndromic X-linked recessive RP (XLRP was recruited, including four affected males, four obligate female carriers and eleven unaffected family members. Capture-NGS was performed using a custom designed capture panel covers 163 known retinal disease genes including 47 RP genes, followed by the validation of detected mutation using Sanger sequencing in all recruited family members. RESULTS: Capture-NGS in one affected 47-year-old male reveals a novel mutation, c.2417_2418insG:p.E806fs, in exon ORF15 of RP GTPase regulator (RPGR gene results in a frameshift change that results in a premature stop codon and a truncated protein product. The mutation was further validated in three of four affected males and two of four female carriers but not in the other unaffected family members. CONCLUSION: We have identified a novel mutation, c.2417_2418insG:p.E806fs, in a Han Chinese family with XLRP. Our findings expand the mutation spectrum of RPGR and the phenotypic spectrum of XLRP in Han Chinese families, and confirms Capture-NGS could be an effective and economic approach for the comprehensive molecular diagnosis of RP.

[Construction of FANCA mutant protein from Fanconi anemia patient and analysis of its function].

Science.gov (United States)

Chen, Fei; Zhang, Ke-Jian; Zuo, Xue-Lan; Zeng, Xian-Chang

2007-11-01

To study FANCA protein expression in Fanconi anemia patient's (FA) cells and explore its function. FANCA protein expression was analyzed in 3 lymphoblast cell lines derived from 3 cases of type A FA (FA-A) patients using Western blot. Nucleus and cytoplasm localization of FANCA protein was analyzed in one case of FA-A which contained a truncated FANCA (exon 5 deletion). The FANCA mutant was constructed from the same patient and its interaction with FANCG was evaluated by mammalian two-hybrid (M2H) assay. FANCA protein was not detected in the 3 FA-A patients by rabbit anti-human MoAb, but a truncated FANCA protein was detected in 1 of them by mouse anti-human MoAb. The truncated FANCA could not transport from cytoplasm into nucleus. The disease-associated FANCA mutant was defective in binding to FANCG in M2H system. FANCA proteins are defective in the 3 FA-A patients. Disfunction of disease-associated FANCA mutant proved to be the pathogenic mutations in FANCA gene. Exon 5 of FANCA gene was involved in the interaction between FANCA and FANCG.

Truncating Homozygous Mutation of Carboxypeptidase E (CPE in a Morbidly Obese Female with Type 2 Diabetes Mellitus, Intellectual Disability and Hypogonadotrophic Hypogonadism.

Directory of Open Access Journals (Sweden)

Suzanne I M Alsters

Full Text Available Carboxypeptidase E is a peptide processing enzyme, involved in cleaving numerous peptide precursors, including neuropeptides and hormones involved in appetite control and glucose metabolism. Exome sequencing of a morbidly obese female from a consanguineous family revealed homozygosity for a truncating mutation of the CPE gene (c.76_98del; p.E26RfsX68. Analysis detected no CPE expression in whole blood-derived RNA from the proband, consistent with nonsense-mediated decay. The morbid obesity, intellectual disability, abnormal glucose homeostasis and hypogonadotrophic hypogonadism seen in this individual recapitulates phenotypes in the previously described fat/fat and Cpe knockout mouse models, evidencing the importance of this peptide/hormone-processing enzyme in regulating body weight, metabolism, and brain and reproductive function in humans.

Biochemical and mutational analyses of a multidomain cellulase/mannanase from Caldicellulosiruptor bescii.

Science.gov (United States)

Su, Xiaoyun; Mackie, Roderick I; Cann, Isaac K O

2012-04-01

Thermophilic cellulases and hemicellulases are of significant interest to the biofuel industry due to their perceived advantages over their mesophilic counterparts. We describe here biochemical and mutational analyses of Caldicellulosiruptor bescii Cel9B/Man5A (CbCel9B/Man5A), a highly thermophilic enzyme. As one of the highly secreted proteins of C. bescii, the enzyme is likely to be critical to nutrient acquisition by the bacterium. CbCel9B/Man5A is a modular protein composed of three carbohydrate-binding modules flanked at the N terminus and the C terminus by a glycoside hydrolase family 9 (GH9) module and a GH5 module, respectively. Based on truncational analysis of the polypeptide, the cellulase and mannanase activities within CbCel9B/Man5A were assigned to the N- and C-terminal modules, respectively. CbCel9B/Man5A and its truncational mutants, in general, exhibited a pH optimum of ∼5.5 and a temperature optimum of 85°C. However, at this temperature, thermostability was very low. After 24 h of incubation at 75°C, the wild-type protein maintained 43% activity, whereas a truncated mutant, TM1, maintained 75% activity. The catalytic efficiency with phosphoric acid swollen cellulose as a substrate for the wild-type protein was 7.2 s(-1) ml/mg, and deleting the GH5 module led to a mutant (TM1) with a 2-fold increase in this kinetic parameter. Deletion of the GH9 module also increased the apparent k(cat) of the truncated mutant TM5 on several mannan-based substrates; however, a concomitant increase in the K(m) led to a decrease in the catalytic efficiencies on all substrates. These observations lead us to postulate that the two catalytic activities are coupled in the polypeptide.

Germline APC mutations in hepatoblastoma.

Science.gov (United States)

Yang, Adeline; Sisson, Rebecca; Gupta, Anita; Tiao, Greg; Geller, James I

2018-04-01

Conflicting reports on the frequency of germline adenomatous polyposis coli (APC) gene mutations in patients with hepatoblastoma (HB) have called into question the clinical value of APC mutation testing on apparently sporadic HB. An Institutional Review Board approved retrospective review of clinical data collected from patients with HB who received APC testing at our institution was conducted. All HB patients seen at Cincinnati Children's Hospital Medical Center were eligible for testing. Potential genotype/phenotype correlations were assessed. As of July 2015, 29 patients with HB had received constitutional APC testing. Four (14%) were found to have APC pathogenic truncations of the APC protein and in addition two (7%) had APC missense variants of unknown clinical significance. Two patients (7%) had family histories indicative of familial adenomatous polyposis (FAP). Response to chemotherapy tracked differently in APC pathogenic cases, with a slower imaging response despite an equivalent or slightly faster α-fetoprotein (AFP) response. The prevalence of pathogenic APC variants in apparently sporadic HB may be higher than previously detected. Differences in time to imaging response, despite similar AFP response, may impact surgical planning. All patients with HB warrant germline APC mutation testing for underlying FAP. © 2017 Wiley Periodicals, Inc.

A Post-Truncation Parameterization of Truncated Normal Technical Inefficiency

OpenAIRE

Christine Amsler; Peter Schmidt; Wen-Jen Tsay

2013-01-01

In this paper we consider a stochastic frontier model in which the distribution of technical inefficiency is truncated normal. In standard notation, technical inefficiency u is distributed as N^+ (μ,σ^2). This distribution is affected by some environmental variables z that may or may not affect the level of the frontier but that do affect the shortfall of output from the frontier. We will distinguish the pre-truncation mean (μ) and variance (σ^2) from the post-truncation mean μ_*=E(u) and var...

ALS Associated Mutations in Matrin 3 Alter Protein-Protein Interactions and Impede mRNA Nuclear Export.

Science.gov (United States)

Boehringer, Ashley; Garcia-Mansfield, Krystine; Singh, Gurkaran; Bakkar, Nadine; Pirrotte, Patrick; Bowser, Robert

2017-11-06

Mutations in Matrin 3 have recently been linked to ALS, though the mechanism that induces disease in these patients is unknown. To define the protein interactome of wild-type and ALS-linked MATR3 mutations, we performed immunoprecipitation followed by mass spectrometry using NSC-34 cells expressing human wild-type or mutant Matrin 3. Gene ontology analysis identified a novel role for Matrin 3 in mRNA transport centered on proteins in the TRanscription and EXport (TREX) complex, known to function in mRNA biogenesis and nuclear export. ALS-linked mutations in Matrin 3 led to its re-distribution within the nucleus, decreased co-localization with endogenous Matrin 3 and increased co-localization with specific TREX components. Expression of disease-causing Matrin 3 mutations led to nuclear mRNA export defects of both global mRNA and more specifically the mRNA of TDP-43 and FUS. Our findings identify a potential pathogenic mechanism attributable to MATR3 mutations and further link cellular transport defects to ALS.

Equivalence of truncated count mixture distributions and mixtures of truncated count distributions.

Science.gov (United States)

Böhning, Dankmar; Kuhnert, Ronny

2006-12-01

This article is about modeling count data with zero truncation. A parametric count density family is considered. The truncated mixture of densities from this family is different from the mixture of truncated densities from the same family. Whereas the former model is more natural to formulate and to interpret, the latter model is theoretically easier to treat. It is shown that for any mixing distribution leading to a truncated mixture, a (usually different) mixing distribution can be found so that the associated mixture of truncated densities equals the truncated mixture, and vice versa. This implies that the likelihood surfaces for both situations agree, and in this sense both models are equivalent. Zero-truncated count data models are used frequently in the capture-recapture setting to estimate population size, and it can be shown that the two Horvitz-Thompson estimators, associated with the two models, agree. In particular, it is possible to achieve strong results for mixtures of truncated Poisson densities, including reliable, global construction of the unique NPMLE (nonparametric maximum likelihood estimator) of the mixing distribution, implying a unique estimator for the population size. The benefit of these results lies in the fact that it is valid to work with the mixture of truncated count densities, which is less appealing for the practitioner but theoretically easier. Mixtures of truncated count densities form a convex linear model, for which a developed theory exists, including global maximum likelihood theory as well as algorithmic approaches. Once the problem has been solved in this class, it might readily be transformed back to the original problem by means of an explicitly given mapping. Applications of these ideas are given, particularly in the case of the truncated Poisson family.

Predicting protein folding rate change upon point mutation using residue-level coevolutionary information.

Science.gov (United States)

Mallik, Saurav; Das, Smita; Kundu, Sudip

2016-01-01

Change in folding kinetics of globular proteins upon point mutation is crucial to a wide spectrum of biological research, such as protein misfolding, toxicity, and aggregations. Here we seek to address whether residue-level coevolutionary information of globular proteins can be informative to folding rate changes upon point mutations. Generating residue-level coevolutionary networks of globular proteins, we analyze three parameters: relative coevolution order (rCEO), network density (ND), and characteristic path length (CPL). A point mutation is considered to be equivalent to a node deletion of this network and respective percentage changes in rCEO, ND, CPL are found linearly correlated (0.84, 0.73, and -0.61, respectively) with experimental folding rate changes. The three parameters predict the folding rate change upon a point mutation with 0.031, 0.045, and 0.059 standard errors, respectively. © 2015 Wiley Periodicals, Inc.

How Truncating Are 'Truncating Languages'? Evidence from Russian and German.

Science.gov (United States)

Rathcke, Tamara V

Russian and German have pr eviously been described as 'truncating', or cutting off target frequencies of the phrase-final pitch trajectories when the time available for voicing is compromised. However, supporting evidence is rare and limited to only a few pitch categories. This paper reports a production study conducted to document pitch adjustments to linguistic materials, in which the amount of voicing available for the realization of a pitch pattern varies from relatively long to extremely short. Productions of nuclear H+L*, H* and L*+H pitch accents followed by a low boundary tone were investigated in the two languages. The results of the study show that speakers of both 'truncating languages' do not utilize truncation exclusively when accommodating to different segmental environments. On the contrary, they employ several strategies - among them is truncation but also compression and temporal re-alignment - to produce the target pitch categories under increasing time pressure. Given that speakers can systematically apply all three adjustment strategies to produce some pitch patterns (H* L% in German and Russian) while not using truncation in others (H+L* L% particularly in Russian), we question the effectiveness of the typological classification of these two languages as 'truncating'. Moreover, the phonetic detail of truncation varies considerably, both across and within the two languages, indicating that truncation cannot be easily modeled as a unified phenomenon. The results further suggest that the phrase-final pitch adjustments are sensitive to the phonological composition of the tonal string and the status of a particular tonal event (associated vs. boundary tone), and do not apply to falling vs. rising pitch contours across the board, as previously put forward for German. Implications for the intonational phonology and prosodic typology are addressed in the discussion. © 2017 S. Karger AG, Basel.

OBSCN Mutations Associated with Dilated Cardiomyopathy and Haploinsufficiency.

Directory of Open Access Journals (Sweden)

Steven Marston

Full Text Available Studies of the functional consequences of DCM-causing mutations have been limited to a few cases where patients with known mutations had heart transplants. To increase the number of potential tissue samples for direct investigation we performed whole exon sequencing of explanted heart muscle samples from 30 patients that had a diagnosis of familial dilated cardiomyopathy and screened for potentially disease-causing mutations in 58 HCM or DCM-related genes.We identified 5 potentially disease-causing OBSCN mutations in 4 samples; one sample had two OBSCN mutations and one mutation was judged to be not disease-related. Also identified were 6 truncating mutations in TTN, 3 mutations in MYH7, 2 in DSP and one each in TNNC1, TNNI3, MYOM1, VCL, GLA, PLB, TCAP, PKP2 and LAMA4. The mean level of obscurin mRNA was significantly greater and more variable in healthy donor samples than the DCM samples but did not correlate with OBSCN mutations. A single obscurin protein band was observed in human heart myofibrils with apparent mass 960 ± 60 kDa. The three samples with OBSCN mutations had significantly lower levels of obscurin immunoreactive material than DCM samples without OBSCN mutations (45±7, 48±3, and 72±6% of control level.Obscurin levels in DCM controls, donor heart and myectomy samples were the same.OBSCN mutations may result in the development of a DCM phenotype via haploinsufficiency. Mutations in the obscurin gene should be considered as a significant causal factor of DCM, alone or in concert with other mutations.

Deriving a Mutation Index of Carcinogenicity Using Protein Structure and Protein Interfaces

Science.gov (United States)

Hakas, Jarle; Pearl, Frances; Zvelebil, Marketa

2014-01-01

With the advent of Next Generation Sequencing the identification of mutations in the genomes of healthy and diseased tissues has become commonplace. While much progress has been made to elucidate the aetiology of disease processes in cancer, the contributions to disease that many individual mutations make remain to be characterised and their downstream consequences on cancer phenotypes remain to be understood. Missense mutations commonly occur in cancers and their consequences remain challenging to predict. However, this knowledge is becoming more vital, for both assessing disease progression and for stratifying drug treatment regimes. Coupled with structural data, comprehensive genomic databases of mutations such as the 1000 Genomes project and COSMIC give an opportunity to investigate general principles of how cancer mutations disrupt proteins and their interactions at the molecular and network level. We describe a comprehensive comparison of cancer and neutral missense mutations; by combining features derived from structural and interface properties we have developed a carcinogenicity predictor, InCa (Index of Carcinogenicity). Upon comparison with other methods, we observe that InCa can predict mutations that might not be detected by other methods. We also discuss general limitations shared by all predictors that attempt to predict driver mutations and discuss how this could impact high-throughput predictions. A web interface to a server implementation is publicly available at http://inca.icr.ac.uk/. PMID:24454733

Functional defect of truncated hepatocyte nuclear factor-1{alpha} (G554fsX556) associated with maturity-onset diabetes of the young

Energy Technology Data Exchange (ETDEWEB)

Kooptiwut, Suwattanee, E-mail: S_kooptiwut@hotmail.com [Department of Physiology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Sujjitjoon, Jatuporn [Department of Immunology and Immunology Graduate Program, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Plengvidhya, Nattachet [Department of Immunology and Immunology Graduate Program, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Division of Endocrinology and Metabolism, Department of Medicine, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Boonyasrisawat, Watip; Chongjaroen, Nalinee; Jungtrakoon, Prapapron [Department of Immunology and Immunology Graduate Program, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Semprasert, Namoiy [Department of Physiology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Furuta, Hiroto; Nanjo, Kishio [The First Department, Wakayama Medical University (Japan); Banchuin, Napatawn [Department of Immunology and Immunology Graduate Program, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Yenchitsomanus, Pa-thai [Division of Medical Molecular Biology, Medicine Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Medical Biotechnology Unit, National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), Bangkok (Thailand)

2009-05-22

A novel frameshift mutation attributable to 14-nucleotide insertion in hepatocyte nuclear factor-1{alpha} (HNF-1{alpha}) encoding a truncated HNF-1{alpha} (G554fsX556) with 76-amino acid deletion at its carboxyl terminus was identified in a Thai family with maturity-onset diabetes of the young (MODY). The wild-type and mutant HNF-1{alpha} proteins were expressed by in vitro transcription and translation (TNT) assay and by transfection in HeLa cells. The wild-type and mutant HNF-1{alpha} could similarly bind to human glucose-transporter 2 (GLUT2) promoter examined by electrophoretic mobility shift assay (EMSA). However, the transactivation activities of mutant HNF-1{alpha} on human GLUT2 and rat L-type pyruvate kinase (L-PK) promoters in HeLa cells determined by luciferase reporter assay were reduced to approximately 55-60% of the wild-type protein. These results suggested that the functional defect of novel truncated HNF-1{alpha} (G554fsX556) on the transactivation of its target-gene promoters would account for the {beta}-cell dysfunction associated with the pathogenesis of MODY.

Functional defect of truncated hepatocyte nuclear factor-1α (G554fsX556) associated with maturity-onset diabetes of the young

International Nuclear Information System (INIS)

Kooptiwut, Suwattanee; Sujjitjoon, Jatuporn; Plengvidhya, Nattachet; Boonyasrisawat, Watip; Chongjaroen, Nalinee; Jungtrakoon, Prapapron; Semprasert, Namoiy; Furuta, Hiroto; Nanjo, Kishio; Banchuin, Napatawn; Yenchitsomanus, Pa-thai

2009-01-01

A novel frameshift mutation attributable to 14-nucleotide insertion in hepatocyte nuclear factor-1α (HNF-1α) encoding a truncated HNF-1α (G554fsX556) with 76-amino acid deletion at its carboxyl terminus was identified in a Thai family with maturity-onset diabetes of the young (MODY). The wild-type and mutant HNF-1α proteins were expressed by in vitro transcription and translation (TNT) assay and by transfection in HeLa cells. The wild-type and mutant HNF-1α could similarly bind to human glucose-transporter 2 (GLUT2) promoter examined by electrophoretic mobility shift assay (EMSA). However, the transactivation activities of mutant HNF-1α on human GLUT2 and rat L-type pyruvate kinase (L-PK) promoters in HeLa cells determined by luciferase reporter assay were reduced to approximately 55-60% of the wild-type protein. These results suggested that the functional defect of novel truncated HNF-1α (G554fsX556) on the transactivation of its target-gene promoters would account for the β-cell dysfunction associated with the pathogenesis of MODY.

Statistical theory of neutral protein evolution by random site mutations

Indian Academy of Sciences (India)

Administrator

Understanding the features of the protein conformational space represents a key component to characterize ... Neutral evolution; protein design; mutations; foldability criteria. 1. Introduction ... analysis of the vast evolutionary landscape is re- ... intra-molecular interactions in the protein which may not be ... This is the main in-.

Canine chondrodysplasia caused by a truncating mutation in collagen-binding integrin alpha subunit 10.

Directory of Open Access Journals (Sweden)

Kaisa Kyöstilä

Full Text Available The skeletal dysplasias are disorders of the bone and cartilage tissues. Similarly to humans, several dog breeds have been reported to suffer from different types of genetic skeletal disorders. We have studied the molecular genetic background of an autosomal recessive chondrodysplasia that affects the Norwegian Elkhound and Karelian Bear Dog breeds. The affected dogs suffer from disproportionate short stature dwarfism of varying severity. Through a genome-wide approach, we mapped the chondrodysplasia locus to a 2-Mb region on canine chromosome 17 in nine affected and nine healthy Elkhounds (praw = 7.42×10(-6, pgenome-wide = 0.013. The associated locus contained a promising candidate gene, cartilage specific integrin alpha 10 (ITGA10, and mutation screening of its 30 exons revealed a nonsense mutation in exon 16 (c.2083C>T; p.Arg695* that segregated fully with the disease in both breeds (p = 2.5×10(-23. A 24% mutation carrier frequency was indicated in NEs and an 8% frequency in KBDs. The ITGA10 gene product, integrin receptor α10-subunit combines into a collagen-binding α10β1 integrin receptor, which is expressed in cartilage chondrocytes and mediates chondrocyte-matrix interactions during endochondral ossification. As a consequence of the nonsense mutation, the α10-protein was not detected in the affected cartilage tissue. The canine phenotype highlights the importance of the α10β1 integrin in bone growth, and the large animal model could be utilized to further delineate its specific functions. Finally, this study revealed a candidate gene for human chondrodysplasias and enabled the development of a genetic test for breeding purposes to eradicate the disease from the two dog breeds.

TP53 mutation and human papilloma virus status of oral squamous cell carcinomas in young adult patients.

Science.gov (United States)

Braakhuis, B J M; Rietbergen, M M; Buijze, M; Snijders, P J F; Bloemena, E; Brakenhoff, R H; Leemans, C R

2014-09-01

Little is known about the molecular carcinogenesis of oral squamous cell carcinoma (OSCC) in young adult patients. The aim of this study was to investigate the detailed TP53 mutation and human papilloma virus (HPV) status of OSCC in patients, younger than 45 years. TP53 mutations were determined with direct sequencing on paraffin-embedded carcinoma tissue from 31 young patients and compared with two older age OSCC reference groups: one from the same institute (N = 87) and an independent one (N = 675). Biologically active tumour HPV was detected by p16-immunohistochemistry followed by a HPV-DNA GP5 + /6 + -PCR. HPV16 was present in one OSCC (3%). TP53 mutations were found in 14 (45%) OSCC: five were missense and nine resulted in a truncated protein. Six of these latter were insertions or deletions of one or more nucleotides leading to frameshift, one was at a splice site and two resulted in a stop codon. The percentage of truncating mutations (64% of all mutations) was higher than that observed in the institute's reference group (44%, P = 0.23) and in the independent reference group (24%, P = 0.002). This study shows that TP53 mutations are common in OSCC of young adult patients; infection with biologically active HPV is rare. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

New acute transforming feline retovirus with fms homology specifies a C-terminally truncated version of the c-fms protein that is different from SM-feline sarcoma virus v-fms protein

International Nuclear Information System (INIS)

Besmer, P.; Lader, E.; George, P.C.; Bergold, P.J.; Qui, F.; Zuckerman, E.E.; Hardy, W.D.

1986-01-01

The HZ5-feline sarcoma virus (FeSV) is a new acute transforming feline retrovirus which was isolated from a multicentric fibrosarcoma of a domestic cat. The HZ5-FeSV transforms fibroblasts in vitro and is replication defective. A biologically active integrated HZ5-FeSV provirus was molecularly cloned from cellular DNA of HZ5-FeSV-infected FRE-3A rat cells. The HZ5-FeSV has oncogene homology with the fms sequences of the SM-FeSV. The genome organization of the 8.6-kilobase HZ5-FeSV provirus is 5' Δgag-fms-Δpol-Δenv 3'. The HZ5- and SM-FeSVs display indistinguishable in vitro transformation characteristics, and the structures of the gag-fms transforming genes in the two viruses are very similar. In the HZ5-FeSV and the SM-FeSV, identical c-fms and feline leukemia virus p10 sequences form the 5' gag-fms junction. With regard to v-fms the two viruses are homologous up to 11 amino acids before the C terminus of the SM-FeSV v-fms protein. In HZ5-FeSV a segment of 362 nucleotides then follows before the 3' recombination site with feline leukemia virus pol. The new 3' v-fms sequence encodes 27 amino acids before reaching a TGA termination signal. The relationship of this sequence with the recently characterized human c-fms sequence has been examined. The 3' HZ5-FeSV v-fms sequence is homologous with 3' c-fms sequences. A frameshift mutation (11-base-pair deletion) was found in the C-terminal fms coding sequence of the HZ5-FeSV. As a result, the HZ5-FeSV v-fms protein is predicted to be a C-terminally truncated version of c-fms. This frameshift mutation may determine the oncogenic properties of v-fms in the HZ5-FeSV

New acute transforming feline retovirus with fms homology specifies a C-terminally truncated version of the c-fms protein that is different from SM-feline sarcoma virus v-fms protein

Energy Technology Data Exchange (ETDEWEB)

Besmer, P.; Lader, E.; George, P.C.; Bergold, P.J.; Qui, F.; Zuckerman, E.E.; Hardy, W.D.

1986-10-01

The HZ5-feline sarcoma virus (FeSV) is a new acute transforming feline retrovirus which was isolated from a multicentric fibrosarcoma of a domestic cat. The HZ5-FeSV transforms fibroblasts in vitro and is replication defective. A biologically active integrated HZ5-FeSV provirus was molecularly cloned from cellular DNA of HZ5-FeSV-infected FRE-3A rat cells. The HZ5-FeSV has oncogene homology with the fms sequences of the SM-FeSV. The genome organization of the 8.6-kilobase HZ5-FeSV provirus is 5' ..delta..gag-fms-..delta..pol-..delta..env 3'. The HZ5- and SM-FeSVs display indistinguishable in vitro transformation characteristics, and the structures of the gag-fms transforming genes in the two viruses are very similar. In the HZ5-FeSV and the SM-FeSV, identical c-fms and feline leukemia virus p10 sequences form the 5' gag-fms junction. With regard to v-fms the two viruses are homologous up to 11 amino acids before the C terminus of the SM-FeSV v-fms protein. In HZ5-FeSV a segment of 362 nucleotides then follows before the 3' recombination site with feline leukemia virus pol. The new 3' v-fms sequence encodes 27 amino acids before reaching a TGA termination signal. The relationship of this sequence with the recently characterized human c-fms sequence has been examined. The 3' HZ5-FeSV v-fms sequence is homologous with 3' c-fms sequences. A frameshift mutation (11-base-pair deletion) was found in the C-terminal fms coding sequence of the HZ5-FeSV. As a result, the HZ5-FeSV v-fms protein is predicted to be a C-terminally truncated version of c-fms. This frameshift mutation may determine the oncogenic properties of v-fms in the HZ5-FeSV.

C-terminal of human histamine H1 receptors regulates their agonist-induced clathrin-mediated internalization and G-protein signaling.

Science.gov (United States)

Hishinuma, Shigeru; Nozawa, Hiroki; Akatsu, Chizuru; Shoji, Masaru

2016-11-01

It has been suggested that the agonist-induced internalization of G-protein-coupled receptors from the cell surface into intracellular compartments regulates cellular responsiveness. We previously reported that G q/11 -protein-coupled human histamine H 1 receptors internalized via clathrin-dependent mechanisms upon stimulation with histamine. However, the molecular determinants of H 1 receptors responsible for agonist-induced internalization remain unclear. In this study, we evaluated the roles of the intracellular C-terminal of human histamine H 1 receptors tagged with hemagglutinin (HA) at the N-terminal in histamine-induced internalization in Chinese hamster ovary cells. The histamine-induced internalization was evaluated by the receptor binding assay with [ 3 H]mepyramine and confocal immunofluorescence microscopy with an anti-HA antibody. We found that histamine-induced internalization was inhibited under hypertonic conditions or by pitstop, a clathrin terminal domain inhibitor, but not by filipin or nystatin, disruptors of the caveolar structure and function. The histamine-induced internalization was also inhibited by truncation of a single amino acid, Ser487, located at the end of the intracellular C-terminal of H 1 receptors, but not by its mutation to alanine. In contrast, the receptor-G-protein coupling, which was evaluated by histamine-induced accumulation of [ 3 H]inositol phosphates, was potentiated by truncation of Ser487, but was lost by its mutation to alanine. These results suggest that the intracellular C-terminal of human H 1 receptors, which only comprises 17 amino acids (Cys471-Ser487), plays crucial roles in both clathrin-dependent internalization of H 1 receptors and G-protein signaling, in which truncation of Ser487 and its mutation to alanine are revealed to result in biased signaling toward activation of G-proteins and clathrin-mediated internalization, respectively. © 2016 International Society for Neurochemistry.

De Novo GMNN Mutations Cause Autosomal-Dominant Primordial Dwarfism Associated with Meier-Gorlin Syndrome.

Science.gov (United States)

Burrage, Lindsay C; Charng, Wu-Lin; Eldomery, Mohammad K; Willer, Jason R; Davis, Erica E; Lugtenberg, Dorien; Zhu, Wenmiao; Leduc, Magalie S; Akdemir, Zeynep C; Azamian, Mahshid; Zapata, Gladys; Hernandez, Patricia P; Schoots, Jeroen; de Munnik, Sonja A; Roepman, Ronald; Pearring, Jillian N; Jhangiani, Shalini; Katsanis, Nicholas; Vissers, Lisenka E L M; Brunner, Han G; Beaudet, Arthur L; Rosenfeld, Jill A; Muzny, Donna M; Gibbs, Richard A; Eng, Christine M; Xia, Fan; Lalani, Seema R; Lupski, James R; Bongers, Ernie M H F; Yang, Yaping

2015-12-03

Meier-Gorlin syndrome (MGS) is a genetically heterogeneous primordial dwarfism syndrome known to be caused by biallelic loss-of-function mutations in one of five genes encoding pre-replication complex proteins: ORC1, ORC4, ORC6, CDT1, and CDC6. Mutations in these genes cause disruption of the origin of DNA replication initiation. To date, only an autosomal-recessive inheritance pattern has been described in individuals with this disorder, with a molecular etiology established in about three-fourths of cases. Here, we report three subjects with MGS and de novo heterozygous mutations in the 5' end of GMNN, encoding the DNA replication inhibitor geminin. We identified two truncating mutations in exon 2 (the 1(st) coding exon), c.16A>T (p.Lys6(∗)) and c.35_38delTCAA (p.Ile12Lysfs(∗)4), and one missense mutation, c.50A>G (p.Lys17Arg), affecting the second-to-last nucleotide of exon 2 and possibly RNA splicing. Geminin is present during the S, G2, and M phases of the cell cycle and is degraded during the metaphase-anaphase transition by the anaphase-promoting complex (APC), which recognizes the destruction box sequence near the 5' end of the geminin protein. All three GMNN mutations identified alter sites 5' to residue Met28 of the protein, which is located within the destruction box. We present data supporting a gain-of-function mechanism, in which the GMNN mutations result in proteins lacking the destruction box and hence increased protein stability and prolonged inhibition of replication leading to autosomal-dominant MGS. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Hereditary thrombophilia: identification of nonsense and missense mutations in the protein C gene

International Nuclear Information System (INIS)

Romeo, G.; Hassan, H.J.; Staempfli, S.

1987-01-01

The structure of the gene for protein C, an anticoagulant serine protease, was analyzed in 29 unrelated patients with hereditary thrombophilia and protein C deficiency. Gene deletion(s) or gross rearrangement(s) was not demonstrable by Southern blot hybridization to cDNA probes. However, two unrelated patients showed a variant restriction pattern after Pvu II or BamHi digestion, due to mutations in the last exon: analysis of their pedigrees, including three or seven heterozygotes, respectively, with ∼50% reduction of both enzymatic and antigen level, showed the abnormal restriction pattern in all heterozygous individuals, but not in normal relatives. Cloning of protein C gene and sequencing of the last exon allowed the authors to identify a nonsense and a missense mutation, respectively. In the first case, codon 306 (CGA, arginine) is mutated to an inframe stop codon, thus generating a new Pvu II recognition site. In the second case, a missense mutation in the BamHI palindrome (GGATCC → GCATCC) leads to substitution of a key amino acid (a tryptophan to cysteine substitution at position 402), invariantly conserved in eukaryotic serine proteases. These point mutations may explain the protein C-deficiency phenotype of heterozygotes in the two pedigrees

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

Directory of Open Access Journals (Sweden)

Muhammad I. Ullah

2017-12-01

Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

R Programs for Truncated Distributions

Directory of Open Access Journals (Sweden)

Saralees Nadarajah

2006-08-01

Full Text Available Truncated distributions arise naturally in many practical situations. In this note, we provide programs for computing six quantities of interest (probability density function, mean, variance, cumulative distribution function, quantile function and random numbers for any truncated distribution: whether it is left truncated, right truncated or doubly truncated. The programs are written in R: a freely downloadable statistical software.

Meta-analysis of SHANK Mutations in Autism Spectrum Disorders: a gradient of severity in cognitive impairments.

Science.gov (United States)

Leblond, Claire S; Nava, Caroline; Polge, Anne; Gauthier, Julie; Huguet, Guillaume; Lumbroso, Serge; Giuliano, Fabienne; Stordeur, Coline; Depienne, Christel; Mouzat, Kevin; Pinto, Dalila; Howe, Jennifer; Lemière, Nathalie; Durand, Christelle M; Guibert, Jessica; Ey, Elodie; Toro, Roberto; Peyre, Hugo; Mathieu, Alexandre; Amsellem, Frédérique; Rastam, Maria; Gillberg, I Carina; Rappold, Gudrun A; Holt, Richard; Monaco, Anthony P; Maestrini, Elena; Galan, Pilar; Heron, Delphine; Jacquette, Aurélia; Afenjar, Alexandra; Rastetter, Agnès; Brice, Alexis; Devillard, Françoise; Assouline, Brigitte; Laffargue, Fanny; Lespinasse, James; Chiesa, Jean; Rivier, François; Bonneau, Dominique; Regnault, Beatrice; Zelenika, Diana; Delepine, Marc; Lathrop, Mark; Sanlaville, Damien; Schluth-Bolard, Caroline; Edery, Patrick; Perrin, Laurence; Tabet, Anne Claude; Schmeisser, Michael J; Boeckers, Tobias M; Coleman, Mary; Sato, Daisuke; Szatmari, Peter; Scherer, Stephen W; Rouleau, Guy A; Betancur, Catalina; Leboyer, Marion; Gillberg, Christopher; Delorme, Richard; Bourgeron, Thomas

2014-09-01

SHANK genes code for scaffold proteins located at the post-synaptic density of glutamatergic synapses. In neurons, SHANK2 and SHANK3 have a positive effect on the induction and maturation of dendritic spines, whereas SHANK1 induces the enlargement of spine heads. Mutations in SHANK genes have been associated with autism spectrum disorders (ASD), but their prevalence and clinical relevance remain to be determined. Here, we performed a new screen and a meta-analysis of SHANK copy-number and coding-sequence variants in ASD. Copy-number variants were analyzed in 5,657 patients and 19,163 controls, coding-sequence variants were ascertained in 760 to 2,147 patients and 492 to 1,090 controls (depending on the gene), and, individuals carrying de novo or truncating SHANK mutations underwent an extensive clinical investigation. Copy-number variants and truncating mutations in SHANK genes were present in ∼1% of patients with ASD: mutations in SHANK1 were rare (0.04%) and present in males with normal IQ and autism; mutations in SHANK2 were present in 0.17% of patients with ASD and mild intellectual disability; mutations in SHANK3 were present in 0.69% of patients with ASD and up to 2.12% of the cases with moderate to profound intellectual disability. In summary, mutations of the SHANK genes were detected in the whole spectrum of autism with a gradient of severity in cognitive impairment. Given the rare frequency of SHANK1 and SHANK2 deleterious mutations, the clinical relevance of these genes remains to be ascertained. In contrast, the frequency and the penetrance of SHANK3 mutations in individuals with ASD and intellectual disability-more than 1 in 50-warrant its consideration for mutation screening in clinical practice.

Meta-analysis of SHANK Mutations in Autism Spectrum Disorders: a gradient of severity in cognitive impairments.

Directory of Open Access Journals (Sweden)

Claire S Leblond

2014-09-01

Full Text Available SHANK genes code for scaffold proteins located at the post-synaptic density of glutamatergic synapses. In neurons, SHANK2 and SHANK3 have a positive effect on the induction and maturation of dendritic spines, whereas SHANK1 induces the enlargement of spine heads. Mutations in SHANK genes have been associated with autism spectrum disorders (ASD, but their prevalence and clinical relevance remain to be determined. Here, we performed a new screen and a meta-analysis of SHANK copy-number and coding-sequence variants in ASD. Copy-number variants were analyzed in 5,657 patients and 19,163 controls, coding-sequence variants were ascertained in 760 to 2,147 patients and 492 to 1,090 controls (depending on the gene, and, individuals carrying de novo or truncating SHANK mutations underwent an extensive clinical investigation. Copy-number variants and truncating mutations in SHANK genes were present in ∼1% of patients with ASD: mutations in SHANK1 were rare (0.04% and present in males with normal IQ and autism; mutations in SHANK2 were present in 0.17% of patients with ASD and mild intellectual disability; mutations in SHANK3 were present in 0.69% of patients with ASD and up to 2.12% of the cases with moderate to profound intellectual disability. In summary, mutations of the SHANK genes were detected in the whole spectrum of autism with a gradient of severity in cognitive impairment. Given the rare frequency of SHANK1 and SHANK2 deleterious mutations, the clinical relevance of these genes remains to be ascertained. In contrast, the frequency and the penetrance of SHANK3 mutations in individuals with ASD and intellectual disability-more than 1 in 50-warrant its consideration for mutation screening in clinical practice.

Genotype and phenotype correlation in von Hippel-Lindau disease based on alteration of the HIF-α binding site in VHL protein.

Science.gov (United States)

Liu, Sheng-Jie; Wang, Jiang-Yi; Peng, Shuang-He; Li, Teng; Ning, Xiang-Hui; Hong, Bao-An; Liu, Jia-Yuan; Wu, Peng-Jie; Zhou, Bo-Wen; Zhou, Jing-Cheng; Qi, Nie-Nie; Peng, Xiang; Zhang, Jiu-Feng; Ma, Kai-Fang; Cai, Lin; Gong, Kan

2018-03-29

PurposeVon Hippel-Lindau (VHL) disease is a rare hereditary cancer syndrome that reduces life expectancy. We aimed to construct a more valuable genotype-phenotype correlation based on alterations in VHL protein (pVHL).MethodsVHL patients (n = 339) were recruited and grouped based on mutation types: HIF-α binding site missense (HM) mutations, non-HIF-α binding site missense (nHM) mutations, and truncating (TR) mutations. Age-related risks of VHL-associated tumors and patient survival were compared.ResultsMissense mutations conferred an increased risk of pheochromocytoma (HR = 1.854, p = 0.047) compared with truncating mutations. The risk of pheochromocytoma was lower in the HM group than in the nHM group (HR = 0.298, p = 0.003) but was similar between HM and TR groups (HR = 0.901, p = 0.810). Patients in the nHM group had a higher risk of pheochromocytoma (HR = 3.447, p counseling and pathogenesis studies.Genetics in Medicine advance online publication, 29 March 2018; doi:10.1038/gim.2017.261.

Charge neutralization as the major factor for the assembly of nucleocapsid-like particles from C-terminal truncated hepatitis C virus core protein

OpenAIRE

Theo Luiz Ferraz de Souza; Sheila Maria Barbosa de Lima; Vanessa L. de Azevedo Braga; David S. Peabody; Davis Fernandes Ferreira; M. Lucia Bianconi; Andre Marco de Oliveira Gomes; Jerson Lima Silva; Andréa Cheble de Oliveira

2016-01-01

Background Hepatitis C virus (HCV) core protein, in addition to its structural role to form the nucleocapsid assembly, plays a critical role in HCV pathogenesis by interfering in several cellular processes, including microRNA and mRNA homeostasis. The C-terminal truncated HCV core protein (C124) is intrinsically unstructured in solution and is able to interact with unspecific nucleic acids, in the micromolar range, and to assemble into nucleocapsid-like particles (NLPs) in vitro. The specific...

Missense mutation Lys18Asn in dystrophin that triggers X-linked dilated cardiomyopathy decreases protein stability, increases protein unfolding, and perturbs protein structure, but does not affect protein function.

Directory of Open Access Journals (Sweden)

Surinder M Singh

Full Text Available Genetic mutations in a vital muscle protein dystrophin trigger X-linked dilated cardiomyopathy (XLDCM. However, disease mechanisms at the fundamental protein level are not understood. Such molecular knowledge is essential for developing therapies for XLDCM. Our main objective is to understand the effect of disease-causing mutations on the structure and function of dystrophin. This study is on a missense mutation K18N. The K18N mutation occurs in the N-terminal actin binding domain (N-ABD. We created and expressed the wild-type (WT N-ABD and its K18N mutant, and purified to homogeneity. Reversible folding experiments demonstrated that both mutant and WT did not aggregate upon refolding. Mutation did not affect the protein's overall secondary structure, as indicated by no changes in circular dichroism of the protein. However, the mutant is thermodynamically less stable than the WT (denaturant melts, and unfolds faster than the WT (stopped-flow kinetics. Despite having global secondary structure similar to that of the WT, mutant showed significant local structural changes at many amino acids when compared with the WT (heteronuclear NMR experiments. These structural changes indicate that the effect of mutation is propagated over long distances in the protein structure. Contrary to these structural and stability changes, the mutant had no significant effect on the actin-binding function as evident from co-sedimentation and depolymerization assays. These results summarize that the K18N mutation decreases thermodynamic stability, accelerates unfolding, perturbs protein structure, but does not affect the function. Therefore, K18N is a stability defect rather than a functional defect. Decrease in stability and increase in unfolding decrease the net population of dystrophin molecules available for function, which might trigger XLDCM. Consistently, XLDCM patients have decreased levels of dystrophin in cardiac muscle.

Germline mutations of regulator of telomere elongation helicase 1, RTEL1, in Dyskeratosis congenita.

Science.gov (United States)

Ballew, Bari J; Yeager, Meredith; Jacobs, Kevin; Giri, Neelam; Boland, Joseph; Burdett, Laurie; Alter, Blanche P; Savage, Sharon A

2013-04-01

Dyskeratosis congenita (DC) is an inherited bone marrow failure and cancer predisposition syndrome caused by aberrant telomere biology. The classic triad of dysplastic nails, abnormal skin pigmentation, and oral leukoplakia is diagnostic of DC, but substantial clinical heterogeneity exists; the clinically severe variant Hoyeraal Hreidarsson syndrome (HH) also includes cerebellar hypoplasia, severe immunodeficiency, enteropathy, and intrauterine growth retardation. Germline mutations in telomere biology genes account for approximately one-half of known DC families. Using exome sequencing, we identified mutations in RTEL1, a helicase with critical telomeric functions, in two families with HH. In the first family, two siblings with HH and very short telomeres inherited a premature stop codon from their mother who has short telomeres. The proband from the second family has HH and inherited a premature stop codon in RTEL1 from his father and a missense mutation from his mother, who also has short telomeres. In addition, inheritance of only the missense mutation led to very short telomeres in the proband's brother. Targeted sequencing identified a different RTEL1 missense mutation in one additional DC proband who has bone marrow failure and short telomeres. Both missense mutations affect the helicase domain of RTEL1, and three in silico prediction algorithms suggest that they are likely deleterious. The nonsense mutations both cause truncation of the RTEL1 protein, resulting in loss of the PIP box; this may abrogate an important protein-protein interaction. These findings implicate a new telomere biology gene, RTEL1, in the etiology of DC.

Spinal muscular atrophy pathogenic mutations impair the axonogenic properties of axonal-survival of motor neuron.

Science.gov (United States)

Locatelli, Denise; d'Errico, Paolo; Capra, Silvia; Finardi, Adele; Colciaghi, Francesca; Setola, Veronica; Terao, Mineko; Garattini, Enrico; Battaglia, Giorgio

2012-05-01

The axonal survival of motor neuron (a-SMN) protein is a truncated isoform of SMN1, the spinal muscular atrophy (SMA) disease gene. a-SMN is selectively localized in axons and endowed with remarkable axonogenic properties. At present, the role of a-SMN in SMA is unknown. As a first step to verify a link between a-SMN and SMA, we investigated by means of over-expression experiments in neuroblastoma-spinal cord hybrid cell line (NSC34) whether SMA pathogenic mutations located in the N-terminal part of the protein affected a-SMN function. We demonstrated here that either SMN1 missense mutations or small intragenic re-arrangements located in the Tudor domain consistently altered the a-SMN capability of inducing axonal elongation in vitro. Mutated human a-SMN proteins determined in almost all NSC34 motor neurons the growth of short axons with prominent morphologic abnormalities. Our data indicate that the Tudor domain is critical in dictating a-SMN function possibly because it is an association domain for proteins involved in axon growth. They also indicate that Tudor domain mutations are functionally relevant not only for FL-SMN but also for a-SMN, raising the possibility that also a-SMN loss of function may contribute to the pathogenic steps leading to SMA. © 2012 The Authors. Journal of Neurochemistry © 2012 International Society for Neurochemistry.

NF2 tumor suppressor gene: a comprehensive and efficient detection of somatic mutations by denaturing HPLC and microarray-CGH.

Science.gov (United States)

Szijan, Irene; Rochefort, Daniel; Bruder, Carl; Surace, Ezequiel; Machiavelli, Gloria; Dalamon, Viviana; Cotignola, Javier; Ferreiro, Veronica; Campero, Alvaro; Basso, Armando; Dumanski, Jan P; Rouleau, Guy A

2003-01-01

The NF2 tumor suppressor gene, located in chromosome 22q12, is involved in the development of multiple tumors of the nervous system, either associated with neurofibromatosis 2 or sporadic ones, mainly schwannomas and meningiomas. In order to evaluate the role of the NF2 gene in sporadic central nervous system (CNS) tumors, we analyzed NF2 mutations in 26 specimens: 14 meningiomas, 4 schwannomas, 4 metastases, and 4 other histopathological types of neoplasms. Denaturing high performance liquid chromatography (denaturing HPLC) and comparative genomic hybridization on a DNA microarray (microarray- CGH) were used as scanning methods for small mutations and gross rearrangements respectively. Small mutations were identified in six out of seventeen meningiomas and schwannomas, one mutation was novel. Large deletions were detected in six meningiomas. All mutations were predicted to result in truncated protein or in the absence of a large protein domain. No NF2 mutations were found in other histopathological types of CNS tumors. These results provide additional evidence that mutations in the NF2 gene play an important role in the development of sporadic meningiomas and schwannomas. Denaturing HPLC analysis of small mutations and microarray-CGH of large deletions are complementary, fast, and efficient methods for the detection of mutations in tumor tissues.

Animal Models of Congenital Cardiomyopathies Associated With Mutations in Z-Line Proteins.

Science.gov (United States)

Bang, Marie-Louise

2017-01-01

The cardiac Z-line at the boundary between sarcomeres is a multiprotein complex connecting the contractile apparatus with the cytoskeleton and the extracellular matrix. The Z-line is important for efficient force generation and transmission as well as the maintenance of structural stability and integrity. Furthermore, it is a nodal point for intracellular signaling, in particular mechanosensing and mechanotransduction. Mutations in various genes encoding Z-line proteins have been associated with different cardiomyopathies, including dilated cardiomyopathy, hypertrophic cardiomyopathy, arrhythmogenic right ventricular cardiomyopathy, restrictive cardiomyopathy, and left ventricular noncompaction, and mutations even within the same gene can cause widely different pathologies. Animal models have contributed to a great advancement in the understanding of the physiological function of Z-line proteins and the pathways leading from mutations in Z-line proteins to cardiomyopathy, although genotype-phenotype prediction remains a great challenge. This review presents an overview of the currently available animal models for Z-line and Z-line associated proteins involved in human cardiomyopathies with special emphasis on knock-in and transgenic mouse models recapitulating the clinical phenotypes of human cardiomyopathy patients carrying mutations in Z-line proteins. Pros and cons of mouse models will be discussed and a future outlook will be given. J. Cell. Physiol. 232: 38-52, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Expression of wild-type Rp1 protein in Rp1 knock-in mice rescues the retinal degeneration phenotype.

Directory of Open Access Journals (Sweden)

Qin Liu

Full Text Available Mutations in the retinitis pigmentosa 1 (RP1 gene are a common cause of autosomal dominant retinitis pigmentosa (adRP, and have also been found to cause autosomal recessive RP (arRP in a few families. The 33 dominant mutations and 6 recessive RP1 mutations identified to date are all nonsense or frameshift mutations, and almost exclusively (38 out of 39 are located in the 4(th and final exon of RP1. To better understand the underlying disease mechanisms of and help develop therapeutic strategies for RP1 disease, we performed a series of human genetic and animal studies using gene targeted and transgenic mice. Here we report that a frameshift mutation in the 3(rd exon of RP1 (c.686delC; p.P229QfsX35 found in a patient with recessive RP1 disease causes RP in the homozygous state, whereas the heterozygous carriers are unaffected, confirming that haploinsufficiency is not the causative mechanism for RP1 disease. We then generated Rp1 knock-in mice with a nonsense Q662X mutation in exon 4, as well as Rp1 transgenic mice carrying a wild-type BAC Rp1 transgene. The Rp1-Q662X allele produces a truncated Rp1 protein, and homozygous Rp1-Q662X mice experience a progressive photoreceptor degeneration characterized disorganization of photoreceptor outer segments. This phenotype could be prevented by expression of a normal amount of Rp1 protein from the BAC transgene without removal of the mutant Rp1-Q662X protein. Over-expression of Rp1 protein in additional BAC Rp1 transgenic lines resulted in retinal degeneration. These findings suggest that the truncated Rp1-Q662X protein does not exert a toxic gain-of-function effect. These results also imply that in principle gene augmentation therapy could be beneficial for both recessive and dominant RP1 patients, but the levels of RP1 protein delivered for therapy will have to be carefully controlled.

A structural systems biology approach for quantifying the systemic consequences of missense mutations in proteins.

Directory of Open Access Journals (Sweden)

Tammy M K Cheng

Full Text Available Gauging the systemic effects of non-synonymous single nucleotide polymorphisms (nsSNPs is an important topic in the pursuit of personalized medicine. However, it is a non-trivial task to understand how a change at the protein structure level eventually affects a cell's behavior. This is because complex information at both the protein and pathway level has to be integrated. Given that the idea of integrating both protein and pathway dynamics to estimate the systemic impact of missense mutations in proteins remains predominantly unexplored, we investigate the practicality of such an approach by formulating mathematical models and comparing them with experimental data to study missense mutations. We present two case studies: (1 interpreting systemic perturbation for mutations within the cell cycle control mechanisms (G2 to mitosis transition for yeast; (2 phenotypic classification of neuron-related human diseases associated with mutations within the mitogen-activated protein kinase (MAPK pathway. We show that the application of simplified mathematical models is feasible for understanding the effects of small sequence changes on cellular behavior. Furthermore, we show that the systemic impact of missense mutations can be effectively quantified as a combination of protein stability change and pathway perturbation.

Synonymous mutations in RNASEH2A create cryptic splice sites impairing RNase H2 enzyme function in Aicardi-Goutières syndrome.

Science.gov (United States)

Rice, Gillian I; Reijns, Martin A M; Coffin, Stephanie R; Forte, Gabriella M A; Anderson, Beverley H; Szynkiewicz, Marcin; Gornall, Hannah; Gent, David; Leitch, Andrea; Botella, Maria P; Fazzi, Elisa; Gener, Blanca; Lagae, Lieven; Olivieri, Ivana; Orcesi, Simona; Swoboda, Kathryn J; Perrino, Fred W; Jackson, Andrew P; Crow, Yanick J

2013-08-01

Aicardi-Goutières syndrome is an inflammatory disorder resulting from mutations in TREX1, RNASEH2A/2B/2C, SAMHD1, or ADAR1. Here, we provide molecular, biochemical, and cellular evidence for the pathogenicity of two synonymous variants in RNASEH2A. Firstly, the c.69G>A (p.Val23Val) mutation causes the formation of a splice donor site within exon 1, resulting in an out of frame deletion at the end of exon 1, leading to reduced RNase H2 protein levels. The second mutation, c.75C>T (p.Arg25Arg), also introduces a splice donor site within exon 1, and the internal deletion of 18 amino acids. The truncated protein still forms a heterotrimeric RNase H2 complex, but lacks catalytic activity. However, as a likely result of leaky splicing, a small amount of full-length active protein is apparently produced in an individual homozygous for this mutation. Recognition of the disease causing status of these variants allows for diagnostic testing in relevant families. © 2013 WILEY PERIODICALS, INC.

Functional analysis of Rift Valley fever virus NSs encoding a partial truncation.

Science.gov (United States)

Head, Jennifer A; Kalveram, Birte; Ikegami, Tetsuro

2012-01-01

Rift Valley fever virus (RVFV), belongs to genus Phlebovirus of the family Bunyaviridae, causes high rates of abortion and fetal malformation in infected ruminants as well as causing neurological disorders, blindness, or lethal hemorrhagic fever in humans. RVFV is classified as a category A priority pathogen and a select agent in the U.S., and currently there are no therapeutics available for RVF patients. NSs protein, a major virulence factor of RVFV, inhibits host transcription including interferon (IFN)-β mRNA synthesis and promotes degradation of dsRNA-dependent protein kinase (PKR). NSs self-associates at the C-terminus 17 aa., while NSs at aa.210-230 binds to Sin3A-associated protein (SAP30) to inhibit the activation of IFN-β promoter. Thus, we hypothesize that NSs function(s) can be abolished by truncation of specific domains, and co-expression of nonfunctional NSs with intact NSs will result in the attenuation of NSs function by dominant-negative effect. Unexpectedly, we found that RVFV NSs truncated at aa. 6-30, 31-55, 56-80, 81-105, 106-130, 131-155, 156-180, 181-205, 206-230, 231-248 or 249-265 lack functions of IFN-β mRNA synthesis inhibition and degradation of PKR. Truncated NSs were less stable in infected cells, while nuclear localization was inhibited in NSs lacking either of aa.81-105, 106-130, 131-155, 156-180, 181-205, 206-230 or 231-248. Furthermore, none of truncated NSs had exhibited significant dominant-negative functions for NSs-mediated IFN-β suppression or PKR degradation upon co-expression in cells infected with RVFV. We also found that any of truncated NSs except for intact NSs does not interact with RVFV NSs even in the presence of intact C-terminus self-association domain. Our results suggest that conformational integrity of NSs is important for the stability, cellular localization and biological functions of RVFV NSs, and the co-expression of truncated NSs does not exhibit dominant-negative phenotype.

Functional analysis of Rift Valley fever virus NSs encoding a partial truncation.

Directory of Open Access Journals (Sweden)

Jennifer A Head

Full Text Available Rift Valley fever virus (RVFV, belongs to genus Phlebovirus of the family Bunyaviridae, causes high rates of abortion and fetal malformation in infected ruminants as well as causing neurological disorders, blindness, or lethal hemorrhagic fever in humans. RVFV is classified as a category A priority pathogen and a select agent in the U.S., and currently there are no therapeutics available for RVF patients. NSs protein, a major virulence factor of RVFV, inhibits host transcription including interferon (IFN-β mRNA synthesis and promotes degradation of dsRNA-dependent protein kinase (PKR. NSs self-associates at the C-terminus 17 aa., while NSs at aa.210-230 binds to Sin3A-associated protein (SAP30 to inhibit the activation of IFN-β promoter. Thus, we hypothesize that NSs function(s can be abolished by truncation of specific domains, and co-expression of nonfunctional NSs with intact NSs will result in the attenuation of NSs function by dominant-negative effect. Unexpectedly, we found that RVFV NSs truncated at aa. 6-30, 31-55, 56-80, 81-105, 106-130, 131-155, 156-180, 181-205, 206-230, 231-248 or 249-265 lack functions of IFN-β mRNA synthesis inhibition and degradation of PKR. Truncated NSs were less stable in infected cells, while nuclear localization was inhibited in NSs lacking either of aa.81-105, 106-130, 131-155, 156-180, 181-205, 206-230 or 231-248. Furthermore, none of truncated NSs had exhibited significant dominant-negative functions for NSs-mediated IFN-β suppression or PKR degradation upon co-expression in cells infected with RVFV. We also found that any of truncated NSs except for intact NSs does not interact with RVFV NSs even in the presence of intact C-terminus self-association domain. Our results suggest that conformational integrity of NSs is important for the stability, cellular localization and biological functions of RVFV NSs, and the co-expression of truncated NSs does not exhibit dominant-negative phenotype.

Prediction of phenotypes of missense mutations in human proteins from biological assemblies.

Science.gov (United States)

Wei, Qiong; Xu, Qifang; Dunbrack, Roland L

2013-02-01

Single nucleotide polymorphisms (SNPs) are the most frequent variation in the human genome. Nonsynonymous SNPs that lead to missense mutations can be neutral or deleterious, and several computational methods have been presented that predict the phenotype of human missense mutations. These methods use sequence-based and structure-based features in various combinations, relying on different statistical distributions of these features for deleterious and neutral mutations. One structure-based feature that has not been studied significantly is the accessible surface area within biologically relevant oligomeric assemblies. These assemblies are different from the crystallographic asymmetric unit for more than half of X-ray crystal structures. We find that mutations in the core of proteins or in the interfaces in biological assemblies are significantly more likely to be disease-associated than those on the surface of the biological assemblies. For structures with more than one protein in the biological assembly (whether the same sequence or different), we find the accessible surface area from biological assemblies provides a statistically significant improvement in prediction over the accessible surface area of monomers from protein crystal structures (P = 6e-5). When adding this information to sequence-based features such as the difference between wildtype and mutant position-specific profile scores, the improvement from biological assemblies is statistically significant but much smaller (P = 0.018). Combining this information with sequence-based features in a support vector machine leads to 82% accuracy on a balanced dataset of 50% disease-associated mutations from SwissVar and 50% neutral mutations from human/primate sequence differences in orthologous proteins. Copyright © 2012 Wiley Periodicals, Inc.

Generation of truncated recombinant form of tumor necrosis factor ...

African Journals Online (AJOL)

7. Original Research Article. Generation of truncated recombinant form of tumor necrosis factor ... as 6×His tagged using E.coli BL21 (DE3) expression system. The protein was ... proapoptotic signaling cascade through TNFR1. [5] which is ...

Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

Science.gov (United States)

McCutchen-Maloney, Sandra L.

2002-01-01

Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

Docking-based modeling of protein-protein interfaces for extensive structural and functional characterization of missense mutations.

Science.gov (United States)

Barradas-Bautista, Didier; Fernández-Recio, Juan

2017-01-01

Next-generation sequencing (NGS) technologies are providing genomic information for an increasing number of healthy individuals and patient populations. In the context of the large amount of generated genomic data that is being generated, understanding the effect of disease-related mutations at molecular level can contribute to close the gap between genotype and phenotype and thus improve prevention, diagnosis or treatment of a pathological condition. In order to fully characterize the effect of a pathological mutation and have useful information for prediction purposes, it is important first to identify whether the mutation is located at a protein-binding interface, and second to understand the effect on the binding affinity of the affected interaction/s. Computational methods, such as protein docking are currently used to complement experimental efforts and could help to build the human structural interactome. Here we have extended the original pyDockNIP method to predict the location of disease-associated nsSNPs at protein-protein interfaces, when there is no available structure for the protein-protein complex. We have applied this approach to the pathological interaction networks of six diseases with low structural data on PPIs. This approach can almost double the number of nsSNPs that can be characterized and identify edgetic effects in many nsSNPs that were previously unknown. This can help to annotate and interpret genomic data from large-scale population studies, and to achieve a better understanding of disease at molecular level.

Docking-based modeling of protein-protein interfaces for extensive structural and functional characterization of missense mutations.

Directory of Open Access Journals (Sweden)

Didier Barradas-Bautista

Full Text Available Next-generation sequencing (NGS technologies are providing genomic information for an increasing number of healthy individuals and patient populations. In the context of the large amount of generated genomic data that is being generated, understanding the effect of disease-related mutations at molecular level can contribute to close the gap between genotype and phenotype and thus improve prevention, diagnosis or treatment of a pathological condition. In order to fully characterize the effect of a pathological mutation and have useful information for prediction purposes, it is important first to identify whether the mutation is located at a protein-binding interface, and second to understand the effect on the binding affinity of the affected interaction/s. Computational methods, such as protein docking are currently used to complement experimental efforts and could help to build the human structural interactome. Here we have extended the original pyDockNIP method to predict the location of disease-associated nsSNPs at protein-protein interfaces, when there is no available structure for the protein-protein complex. We have applied this approach to the pathological interaction networks of six diseases with low structural data on PPIs. This approach can almost double the number of nsSNPs that can be characterized and identify edgetic effects in many nsSNPs that were previously unknown. This can help to annotate and interpret genomic data from large-scale population studies, and to achieve a better understanding of disease at molecular level.

Identification of four novel mutations of the WFS1 gene in Iranian Wolfram syndrome pedigrees.

Science.gov (United States)

Ghahraman, Martha; Abbaszadegan, Mohammad Reza; Vakili, Rahim; Hosseini, Sousan; Fardi Golyan, Fatemeh; Ghaemi, Nosrat; Forghanifard, Mohammad Mahdi

2016-12-01

Wolfram syndrome is a rare neurodegenerative disorder with an autosomal recessive pattern of inheritance characterized by various clinical manifestations. The related gene, WFS1, encodes a transmembrane glycoprotein, named wolframin. Genetic analyses demonstrated that mutations in this gene are associated with WS type 1. Our aim in this study was to sequence WFS1 coding region in Iranian Wolfram syndrome pedigrees. Genomic DNA was extracted from peripheral blood of 12 WS patients and their healthy parents. Exons 2-8 and the exon-intron junctions of WFS1 were sequenced. DNA sequences were compared to the reference using Sequencher software. Molecular analysis of WFS1 revealed six different mutations. Four novel and two previously reported mutations were identified. One novel mutation, c.1379_1381del, is predicted to produce an aberrant protein. A second novel mutation, c.1384G > T, encodes a truncated protein. Novel mutation, c.1097-1107dup (11 bp), causes a frameshift which results in a premature stop codon. We screened for the novel missense mutation, c.1010C > T, in 100 control alleles. This mutation was not found in any of the healthy controls. Our study increased the spectrum of WFS1 mutations and supported the role of WFS1 in susceptibility to WS. We hope that these findings open new horizons to future molecular investigations which may help to prevent and treat this devastating disease.

Overview of xeroderma pigmentosum proteins architecture, mutations and post-translational modifications.

Science.gov (United States)

Feltes, Bruno César; Bonatto, Diego

2015-01-01

The xeroderma pigmentosum complementation group proteins (XPs), which include XPA through XPG, play a critical role in coordinating and promoting global genome and transcription-coupled nucleotide excision repair (GG-NER and TC-NER, respectively) pathways in eukaryotic cells. GG-NER and TC-NER are both required for the repair of bulky DNA lesions, such as those induced by UV radiation. Mutations in genes that encode XPs lead to the clinical condition xeroderma pigmentosum (XP). Although the roles of XPs in the GG-NER/TC-NER subpathways have been extensively studied, complete knowledge of their three-dimensional structure is only beginning to emerge. Hence, this review aims to summarize the current knowledge of mapped mutations and other structural information on XP proteins that influence their function and protein-protein interactions. We also review the possible post-translational modifications for each protein and the impact of these modifications on XP protein functions. Copyright © 2014 Elsevier B.V. All rights reserved.

G protein-coupled receptor mutations and human genetic disease.

Science.gov (United States)

Thompson, Miles D; Hendy, Geoffrey N; Percy, Maire E; Bichet, Daniel G; Cole, David E C

2014-01-01

Genetic variations in G protein-coupled receptor genes (GPCRs) disrupt GPCR function in a wide variety of human genetic diseases. In vitro strategies and animal models have been used to identify the molecular pathologies underlying naturally occurring GPCR mutations. Inactive, overactive, or constitutively active receptors have been identified that result in pathology. These receptor variants may alter ligand binding, G protein coupling, receptor desensitization and receptor recycling. Receptor systems discussed include rhodopsin, thyrotropin, parathyroid hormone, melanocortin, follicle-stimulating hormone (FSH), luteinizing hormone, gonadotropin-releasing hormone (GNRHR), adrenocorticotropic hormone, vasopressin, endothelin-β, purinergic, and the G protein associated with asthma (GPRA or neuropeptide S receptor 1 (NPSR1)). The role of activating and inactivating calcium-sensing receptor (CaSR) mutations is discussed in detail with respect to familial hypocalciuric hypercalcemia (FHH) and autosomal dominant hypocalemia (ADH). The CASR mutations have been associated with epilepsy. Diseases caused by the genetic disruption of GPCR functions are discussed in the context of their potential to be selectively targeted by drugs that rescue altered receptors. Examples of drugs developed as a result of targeting GPCRs mutated in disease include: calcimimetics and calcilytics, therapeutics targeting melanocortin receptors in obesity, interventions that alter GNRHR loss from the cell surface in idiopathic hypogonadotropic hypogonadism and novel drugs that might rescue the P2RY12 receptor congenital bleeding phenotype. De-orphanization projects have identified novel disease-associated receptors, such as NPSR1 and GPR35. The identification of variants in these receptors provides genetic reagents useful in drug screens. Discussion of the variety of GPCRs that are disrupted in monogenic Mendelian disorders provides the basis for examining the significance of common

Engineered mutations in fibrillin-1 leading to Marfan syndrome act at the protein, cellular and organismal levels.

Science.gov (United States)

Zeyer, Karina A; Reinhardt, Dieter P

2015-01-01

Fibrillins are the major components of microfibrils in the extracellular matrix of elastic and non-elastic tissues. They are multi-domain proteins, containing primarily calcium binding epidermal growth factor-like (cbEGF) domains and 8-cysteine/transforming growth factor-beta binding protein-like (TB) domains. Mutations in the fibrillin-1 gene give rise to Marfan syndrome, a connective tissue disorder with clinical complications in the cardiovascular, skeletal, ocular and other organ systems. Here, we review the consequences of engineered Marfan syndrome mutations in fibrillin-1 at the protein, cellular and organismal levels. Representative point mutations associated with Marfan syndrome in affected individuals have been introduced and analyzed in recombinant fibrillin-1 fragments. Those mutations affect fibrillin-1 on a structural and functional level. Mutations which impair folding of cbEGF domains can affect protein trafficking. Protein folding disrupted by some mutations can lead to defective secretion in mutant fibrillin-1 fragments, whereas fragments with other Marfan mutations are secreted normally. Many Marfan mutations render fibrillin-1 more susceptible to proteolysis. There is also evidence that some mutations affect heparin binding. Few mutations have been further analyzed in mouse models. An extensively studied mouse model of Marfan syndrome expresses mouse fibrillin-1 with a missense mutation (p.C1039G). The mice display similar characteristics to human patients with Marfan syndrome. Overall, the analyses of engineered mutations leading to Marfan syndrome provide important insights into the pathogenic molecular mechanisms exerted by mutated fibrillin-1. Copyright © 2015 Elsevier B.V. All rights reserved.

Whole-genome sequencing identifies recurrent somatic NOTCH2 mutations in splenic marginal zone lymphoma.

Science.gov (United States)

Kiel, Mark J; Velusamy, Thirunavukkarasu; Betz, Bryan L; Zhao, Lili; Weigelin, Helmut G; Chiang, Mark Y; Huebner-Chan, David R; Bailey, Nathanael G; Yang, David T; Bhagat, Govind; Miranda, Roberto N; Bahler, David W; Medeiros, L Jeffrey; Lim, Megan S; Elenitoba-Johnson, Kojo S J

2012-08-27

Splenic marginal zone lymphoma (SMZL), the most common primary lymphoma of spleen, is poorly understood at the genetic level. In this study, using whole-genome DNA sequencing (WGS) and confirmation by Sanger sequencing, we observed mutations identified in several genes not previously known to be recurrently altered in SMZL. In particular, we identified recurrent somatic gain-of-function mutations in NOTCH2, a gene encoding a protein required for marginal zone B cell development, in 25 of 99 (∼25%) cases of SMZL and in 1 of 19 (∼5%) cases of nonsplenic MZLs. These mutations clustered near the C-terminal proline/glutamate/serine/threonine (PEST)-rich domain, resulting in protein truncation or, rarely, were nonsynonymous substitutions affecting the extracellular heterodimerization domain (HD). NOTCH2 mutations were not present in other B cell lymphomas and leukemias, such as chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL; n = 15), mantle cell lymphoma (MCL; n = 15), low-grade follicular lymphoma (FL; n = 44), hairy cell leukemia (HCL; n = 15), and reactive lymphoid hyperplasia (n = 14). NOTCH2 mutations were associated with adverse clinical outcomes (relapse, histological transformation, and/or death) among SMZL patients (P = 0.002). These results suggest that NOTCH2 mutations play a role in the pathogenesis and progression of SMZL and are associated with a poor prognosis.

Structure Based Thermostability Prediction Models for Protein Single Point Mutations with Machine Learning Tools.

Directory of Open Access Journals (Sweden)

Lei Jia

Full Text Available Thermostability issue of protein point mutations is a common occurrence in protein engineering. An application which predicts the thermostability of mutants can be helpful for guiding decision making process in protein design via mutagenesis. An in silico point mutation scanning method is frequently used to find "hot spots" in proteins for focused mutagenesis. ProTherm (http://gibk26.bio.kyutech.ac.jp/jouhou/Protherm/protherm.html is a public database that consists of thousands of protein mutants' experimentally measured thermostability. Two data sets based on two differently measured thermostability properties of protein single point mutations, namely the unfolding free energy change (ddG and melting temperature change (dTm were obtained from this database. Folding free energy change calculation from Rosetta, structural information of the point mutations as well as amino acid physical properties were obtained for building thermostability prediction models with informatics modeling tools. Five supervised machine learning methods (support vector machine, random forests, artificial neural network, naïve Bayes classifier, K nearest neighbor and partial least squares regression are used for building the prediction models. Binary and ternary classifications as well as regression models were built and evaluated. Data set redundancy and balancing, the reverse mutations technique, feature selection, and comparison to other published methods were discussed. Rosetta calculated folding free energy change ranked as the most influential features in all prediction models. Other descriptors also made significant contributions to increasing the accuracy of the prediction models.

Role of Decorin Core Protein in Collagen Organisation in Congenital Stromal Corneal Dystrophy (CSCD.

Directory of Open Access Journals (Sweden)

Christina S Kamma-Lorger

Full Text Available The role of Decorin in organising the extracellular matrix was examined in normal human corneas and in corneas from patients with Congenital Stromal Corneal Dystrophy (CSCD. In CSCD, corneal clouding occurs due to a truncating mutation (c.967delT in the decorin (DCN gene. Normal human Decorin protein and the truncated one were reconstructed in silico using homology modelling techniques to explore structural changes in the diseased protein. Corneal CSCD specimens were also examined using 3-D electron tomography and Small Angle X-ray diffraction (SAXS, to image the collagen-proteoglycan arrangement and to quantify fibrillar diameters, respectively. Homology modelling showed that truncated Decorin had a different spatial geometry to the normal one, with the truncation removing a major part of the site that interacts with collagen, compromising its ability to bind effectively. Electron tomography showed regions of abnormal stroma, where collagen fibrils came together to form thicker fibrillar structures, showing that Decorin plays a key role in the maintenance of the order in the normal corneal extracellular matrix. Average diameter of individual fibrils throughout the thickness of the cornea however remained normal.

Spectrum of FANCA mutations in Italian Fanconi anemia patients: identification of six novel alleles and phenotypic characterization of the S858R variant.

Science.gov (United States)

Savino, Maria; Borriello, Adriana; D'Apolito, Maria; Criscuolo, Maria; Del Vecchio, Maria; Bianco, Anna Monica; Di Perna, Michele; Calzone, Rita; Nobili, Bruno; Zatterale, Adriana; Zelante, Leopoldo; Joenje, Hans; Della Ragione, Fulvio; Savoia, Anna

2003-10-01

Fanconi anemia (FA) is an autosomal recessive disorder characterized by genomic instability, bone marrow failure, congenital malformations, and cancer predisposition. FA is a genetically heterogeneous disease with at least seven genes so far identified. The role of FA proteins is unknown although they interact in a common functional pathway. Here, we report six novel FANCA sequence changes and review all the mutations identified in Italy. Except for two missense substitutions, all are expected to cause a premature termination of the FANCA protein at various sites throughout the molecule. The premature terminations are due to nonsense and splice site mutations, as well as small insertions and deletions, and large genomic rearrangements. The expected truncated proteins were not detectable on Western blot analyses. The FANCA-S858R variant is instead expressed at lower level than that seen in normal cell lines and is associated with a non-ubiquinated FANCD2 protein, strongly suggesting that the amino acid substitution is a disease-causing mutation. The spectrum of FA mutations is widely in agreement with the heterogeneous ethnic origin of the Italian population. Copyright 2003 Wiley-Liss, Inc.

Early presentation of cystic kidneys in a family with a homozygous INVS mutation.

Science.gov (United States)

Oud, Machteld M; van Bon, Bregje W; Bongers, Ernie M H F; Hoischen, Alexander; Marcelis, Carlo L; de Leeuw, Nicole; Mol, Suzanne J J; Mortier, Geert; Knoers, Nine V A M; Brunner, Han G; Roepman, Ronald; Arts, Heleen H

2014-07-01

Nephronophthisis (NPHP) is an autosomal recessive cystic kidney disease that is the most frequent monogenic cause of end-stage renal disease in children. Infantile NPHP, often in combination with other features like situs inversus, are commonly caused by mutations in the INVS gene. INVS encodes the ciliary protein inversin, and mutations induce dysfunction of the primary cilia. In this article, we present a family with two severely affected fetuses that were aborted after discovery of grossly enlarged cystic kidneys by ultrasonography before 22 weeks gestation. Exome sequencing showed that the fetuses were homozygous for a previously unreported nonsense mutation, resulting in a truncation in the IQ1 domain of inversin. This mutation induces nonsense-mediated RNA decay, as suggested by a reduced RNA level in fibroblasts derived from the fetus. However, a significant amount of mutant INVS RNA was present in these fibroblasts, yielding mutant inversin protein that was mislocalized. In control fibroblasts, inversin was present in the ciliary axoneme as well as at the basal body, whereas in the fibroblasts from the fetus, inversin could only be detected at the basal body. The phenotype of both fetuses is partly characteristic of infantile NPHP and Potter sequence. We also identified that the fetuses had mild skeletal abnormalities, including shortening and bowing of long bones, which may expand the phenotypic spectrum associated with INVS mutations. © 2014 Wiley Periodicals, Inc.

Functional analysis of HNPCC-related missense mutations in MSH2

DEFF Research Database (Denmark)

Lützen, Anne; de Wind, Niels; Georgijevic, Dubravka

2008-01-01

Hereditary nonpolyposis colorectal cancer (HNPCC) is associated with germline mutations in the human DNA mismatch repair (MMR) genes, most frequently MSH2 and MLH1. The majority of HNPCC mutations cause truncations and thus loss of function of the affected polypeptide. However, a significant...

Carboxy-terminal truncation activates glp-1 protein to specify vulval fates in Caenorhabditis elegans.

Science.gov (United States)

Mango, S E; Maine, E M; Kimble, J

1991-08-29

The glp-1 and lin-12 genes encode homologous transmembrane proteins that may act as receptors for cell interactions during development. The glp-1 product is required for induction of germ-line proliferation and for embryogenesis. By contrast, lin-12 mediates somatic cell interactions, including those between the precursor cells that form the vulval hypodermis (VPCs). Here we analyse an unusual allele of glp-1, glp-1(q35), which displays a semidominant multivulva phenotype (Muv), as well as the typical recessive, loss-of-function Glp phenotypes (sterility and embryonic lethality). We find that the effects of glp-1(q35) on VPC development mimic those of dominant lin-12 mutations, even in the absence of lin-12 activity. The glp-1(q35) gene bears a nonsense mutation predicted to eliminate the 122 C-terminal amino acids, including a ProGluSerThr (PEST) sequence thought to destabilize proteins. We suggest that the carboxy terminus bears a negative regulatory domain which normally inactivates glp-1 in the VPCs. We propose that inappropriate glp-1(q35) activity can substitute for lin-12 to determine vulval fate, perhaps by driving the VPCs to proliferate.

Application of the AMPLE cluster-and-truncate approach to NMR structures for molecular replacement

Energy Technology Data Exchange (ETDEWEB)

Bibby, Jaclyn [University of Liverpool, Liverpool L69 7ZB (United Kingdom); Keegan, Ronan M. [Research Complex at Harwell, STFC Rutherford Appleton Laboratory, Didcot OX11 0FA (United Kingdom); Mayans, Olga [University of Liverpool, Liverpool L69 7ZB (United Kingdom); Winn, Martyn D. [Science and Technology Facilities Council Daresbury Laboratory, Warrington WA4 4AD (United Kingdom); Rigden, Daniel J., E-mail: drigden@liv.ac.uk [University of Liverpool, Liverpool L69 7ZB (United Kingdom)

2013-11-01

Processing of NMR structures for molecular replacement by AMPLE works well. AMPLE is a program developed for clustering and truncating ab initio protein structure predictions into search models for molecular replacement. Here, it is shown that its core cluster-and-truncate methods also work well for processing NMR ensembles into search models. Rosetta remodelling helps to extend success to NMR structures bearing low sequence identity or high structural divergence from the target protein. Potential future routes to improved performance are considered and practical, general guidelines on using AMPLE are provided.

Mutations in Plasmalemma Vesicle Associated Protein Result in Sieving Protein-Losing Enteropathy Characterized by Hypoproteinemia, Hypoalbuminemia, and HypertriglyceridemiaSummary

Directory of Open Access Journals (Sweden)

Abdul Elkadri

2015-07-01

Full Text Available Background & Aims: Severe intestinal diseases observed in very young children are often the result of monogenic defects. We used whole-exome sequencing (WES to examine genetics in a patient with a distinct severe form of protein-losing enteropathy (PLE characterized by hypoproteinemia, hypoalbuminemia, and hypertriglyceridemia. Methods: WES was performed at the Centre for Applied Genomics, Hospital for Sick Children, Toronto, Canada, and exome library preparation was performed with the Ion Torrent AmpliSeq RDY Exome Kit. Functional studies were based on the identified mutation. Results: Using WES we identified a homozygous nonsense mutation (1072C>T; p.Arg358* in the PLVAP (plasmalemma vesicle-associated protein gene in an infant from consanguineous parents who died at 5 months of age of severe PLE. Functional studies determined that the mutated PLVAP mRNA and protein were not expressed in the patient biopsy tissues, presumably secondary to nonsense-mediated mRNA decay. Pathological analysis showed that the loss of PLVAP resulted in disruption of endothelial fenestrated diaphragms. Conclusions: The PLVAP p.Arg358* mutation resulted in the loss of PLVAP expression with subsequent deletion of the diaphragms of endothelial fenestrae, which led to plasma protein extravasation, PLE, and ultimately death. Keywords: Endothelium, Fenestrae, Hypertriglyceridemia, Hypoalbuminemia, Hypoproteinemia, Very Early Onset Inflammatory Bowel Disease, Monogenic Diseases, Protein-Losing Enteropathy, Whole-Exome Sequencing

Identification of a novel WFS1 homozygous nonsense mutation in Jordanian children with Wolfram syndrome.

Science.gov (United States)

Bodoor, Khaldon; Batiha, Osama; Abu-Awad, Ayman; Al-Sarihin, Khaldon; Ziad, Haya; Jarun, Yousef; Abu-Sheikha, Aya; Abu Jalboush, Sara; Alibrahim, Khoulod S

2016-09-01

Wolfram syndrome (WS) is a rare autosomal recessive neurodegenerative disorder characterized by the presentation of early onset type I diabetes mellitus and optic atrophy with later onset diabetes insipidus and deafness. WFS1 gene was identified on chromosome 4p16.1 as the gene responsible for WS disease given that most of the WS patients were found to carry mutations in this gene. This study was carried out to investigate the molecular spectrum of WFS1 gene in Jordanian families. Molecular and clinical characterization was performed on five WS patients from two unrelated Jordanian families. Our data indicated that WS patients of the first family harbored two deletion mutations (V415del and F247fs) located in exon 8 and exon 7 respectively, with a compound heterozygous pattern of inheritance; while in the second family, we identified a novel nonsense mutation (W185X) located in exon 5 in the N-terminal cytoplasmic domain with a homozygous pattern of inheritance. This mutation can be considered as loss of function mutation since the resulting truncated protein lost both the transmembrane domain and the C-terminal domain. Additionally, the W185X mutation lies within the CaM binding domain in wolframin protein which is thought to have a role in the regulation of wolframin function in response to calcium levels.

Zero-truncated negative binomial - Erlang distribution

Science.gov (United States)

Bodhisuwan, Winai; Pudprommarat, Chookait; Bodhisuwan, Rujira; Saothayanun, Luckhana

2017-11-01

The zero-truncated negative binomial-Erlang distribution is introduced. It is developed from negative binomial-Erlang distribution. In this work, the probability mass function is derived and some properties are included. The parameters of the zero-truncated negative binomial-Erlang distribution are estimated by using the maximum likelihood estimation. Finally, the proposed distribution is applied to real data, the number of methamphetamine in the Bangkok, Thailand. Based on the results, it shows that the zero-truncated negative binomial-Erlang distribution provided a better fit than the zero-truncated Poisson, zero-truncated negative binomial, zero-truncated generalized negative-binomial and zero-truncated Poisson-Lindley distributions for this data.

Identification of target genes for wild type and truncated HMGA2 in mesenchymal stem-like cells

DEFF Research Database (Denmark)

Henriksen, Jørn Mølgaard; Stabell, Marianne; Meza-Zepeda, Leonardo A

2010-01-01

The HMGA2 gene, coding for an architectural transcription factor involved in mesenchymal embryogenesis, is frequently deranged by translocation and/or amplification in mesenchymal tumours, generally leading to over-expression of shortened transcripts and a truncated protein.......The HMGA2 gene, coding for an architectural transcription factor involved in mesenchymal embryogenesis, is frequently deranged by translocation and/or amplification in mesenchymal tumours, generally leading to over-expression of shortened transcripts and a truncated protein....

Mutation screening of the PCDH15 gene in Spanish patients with Usher syndrome type I.

Science.gov (United States)

Jaijo, Teresa; Oshima, Aki; Aller, Elena; Carney, Carol; Usami, Shin-ichi; Millán, José M; Kimberling, William J

2012-01-01

PCDH15 codes for protocadherin-15, a cell-cell adhesion protein essential in the morphogenesis and cohesion of stereocilia bundles and in the function or preservation of photoreceptor cells. Mutations in the PCDH15 gene are responsible for Usher syndrome type I (USH1F) and non-syndromic hearing loss (DFNB23). The purpose of this work was to perform PCDH15 mutation screening to identify the genetic cause of the disease in a cohort of Spanish patients with Usher syndrome type I and establish phenotype-genotype correlation. Mutation analysis of PCDH15 included additional exons recently identified and was performed by direct sequencing. The screening was performed in 19 probands with USH already screened for mutations in the most prevalent USH1 genes, myosin VIIA (MYO7A) and cadherin-23 (CDH23), and for copy number variants in PCDH15. Seven different point mutations, five novel, were detected. Including the large PCDH15 rearrangements previously reported in our cohort of patients, a total of seven of 19 patients (36.8%) were carriers of at least one pathogenic allele. Thirteen out of the 38 screened alleles carried pathogenic PCDH15 variants (34.2%). Five out of the seven point mutations reported in the present study are novel, supporting the idea that most PCDH15 mutations are private. Furthermore, no mutational hotspots have been identified. In most patients, detected mutations led to a truncated protein, reinforcing the hypothesis that severe mutations cause the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

Expression of a truncated ATHB17 protein in maize increases ear weight at silking.

Directory of Open Access Journals (Sweden)

Elena A Rice

Full Text Available ATHB17 (AT2G01430 is an Arabidopsis gene encoding a member of the α-subclass of the homeodomain leucine zipper class II (HD-Zip II family of transcription factors. The ATHB17 monomer contains four domains common to all class II HD-Zip proteins: a putative repression domain adjacent to a homeodomain, leucine zipper, and carboxy terminal domain. However, it also possesses a unique N-terminus not present in other members of the family. In this study we demonstrate that the unique 73 amino acid N-terminus is involved in regulation of cellular localization of ATHB17. The ATHB17 protein is shown to function as a transcriptional repressor and an EAR-like motif is identified within the putative repression domain of ATHB17. Transformation of maize with an ATHB17 expression construct leads to the expression of ATHB17Δ113, a truncated protein lacking the first 113 amino acids which encodes a significant portion of the repression domain. Because ATHB17Δ113 lacks the repression domain, the protein cannot directly affect the transcription of its target genes. ATHB17Δ113 can homodimerize, form heterodimers with maize endogenous HD-Zip II proteins, and bind to target DNA sequences; thus, ATHB17Δ113 may interfere with HD-Zip II mediated transcriptional activity via a dominant negative mechanism. We provide evidence that maize HD-Zip II proteins function as transcriptional repressors and that ATHB17Δ113 relieves this HD-Zip II mediated transcriptional repression activity. Expression of ATHB17Δ113 in maize leads to increased ear size at silking and, therefore, may enhance sink potential. We hypothesize that this phenotype could be a result of modulation of endogenous HD-Zip II pathways in maize.

Expression of a truncated ATHB17 protein in maize increases ear weight at silking.

Science.gov (United States)

Rice, Elena A; Khandelwal, Abha; Creelman, Robert A; Griffith, Cara; Ahrens, Jeffrey E; Taylor, J Philip; Murphy, Lesley R; Manjunath, Siva; Thompson, Rebecca L; Lingard, Matthew J; Back, Stephanie L; Larue, Huachun; Brayton, Bonnie R; Burek, Amanda J; Tiwari, Shiv; Adam, Luc; Morrell, James A; Caldo, Rico A; Huai, Qing; Kouadio, Jean-Louis K; Kuehn, Rosemarie; Sant, Anagha M; Wingbermuehle, William J; Sala, Rodrigo; Foster, Matt; Kinser, Josh D; Mohanty, Radha; Jiang, Dongming; Ziegler, Todd E; Huang, Mingya G; Kuriakose, Saritha V; Skottke, Kyle; Repetti, Peter P; Reuber, T Lynne; Ruff, Thomas G; Petracek, Marie E; Loida, Paul J

2014-01-01

ATHB17 (AT2G01430) is an Arabidopsis gene encoding a member of the α-subclass of the homeodomain leucine zipper class II (HD-Zip II) family of transcription factors. The ATHB17 monomer contains four domains common to all class II HD-Zip proteins: a putative repression domain adjacent to a homeodomain, leucine zipper, and carboxy terminal domain. However, it also possesses a unique N-terminus not present in other members of the family. In this study we demonstrate that the unique 73 amino acid N-terminus is involved in regulation of cellular localization of ATHB17. The ATHB17 protein is shown to function as a transcriptional repressor and an EAR-like motif is identified within the putative repression domain of ATHB17. Transformation of maize with an ATHB17 expression construct leads to the expression of ATHB17Δ113, a truncated protein lacking the first 113 amino acids which encodes a significant portion of the repression domain. Because ATHB17Δ113 lacks the repression domain, the protein cannot directly affect the transcription of its target genes. ATHB17Δ113 can homodimerize, form heterodimers with maize endogenous HD-Zip II proteins, and bind to target DNA sequences; thus, ATHB17Δ113 may interfere with HD-Zip II mediated transcriptional activity via a dominant negative mechanism. We provide evidence that maize HD-Zip II proteins function as transcriptional repressors and that ATHB17Δ113 relieves this HD-Zip II mediated transcriptional repression activity. Expression of ATHB17Δ113 in maize leads to increased ear size at silking and, therefore, may enhance sink potential. We hypothesize that this phenotype could be a result of modulation of endogenous HD-Zip II pathways in maize.

Expression of a Truncated ATHB17 Protein in Maize Increases Ear Weight at Silking

Science.gov (United States)

Creelman, Robert A.; Griffith, Cara; Ahrens, Jeffrey E.; Taylor, J. Philip; Murphy, Lesley R.; Manjunath, Siva; Thompson, Rebecca L.; Lingard, Matthew J.; Back, Stephanie L.; Larue, Huachun; Brayton, Bonnie R.; Burek, Amanda J.; Tiwari, Shiv; Adam, Luc; Morrell, James A.; Caldo, Rico A.; Huai, Qing; Kouadio, Jean-Louis K.; Kuehn, Rosemarie; Sant, Anagha M.; Wingbermuehle, William J.; Sala, Rodrigo; Foster, Matt; Kinser, Josh D.; Mohanty, Radha; Jiang, Dongming; Ziegler, Todd E.; Huang, Mingya G.; Kuriakose, Saritha V.; Skottke, Kyle; Repetti, Peter P.; Reuber, T. Lynne; Ruff, Thomas G.; Petracek, Marie E.; Loida, Paul J.

2014-01-01

ATHB17 (AT2G01430) is an Arabidopsis gene encoding a member of the α-subclass of the homeodomain leucine zipper class II (HD-Zip II) family of transcription factors. The ATHB17 monomer contains four domains common to all class II HD-Zip proteins: a putative repression domain adjacent to a homeodomain, leucine zipper, and carboxy terminal domain. However, it also possesses a unique N-terminus not present in other members of the family. In this study we demonstrate that the unique 73 amino acid N-terminus is involved in regulation of cellular localization of ATHB17. The ATHB17 protein is shown to function as a transcriptional repressor and an EAR-like motif is identified within the putative repression domain of ATHB17. Transformation of maize with an ATHB17 expression construct leads to the expression of ATHB17Δ113, a truncated protein lacking the first 113 amino acids which encodes a significant portion of the repression domain. Because ATHB17Δ113 lacks the repression domain, the protein cannot directly affect the transcription of its target genes. ATHB17Δ113 can homodimerize, form heterodimers with maize endogenous HD-Zip II proteins, and bind to target DNA sequences; thus, ATHB17Δ113 may interfere with HD-Zip II mediated transcriptional activity via a dominant negative mechanism. We provide evidence that maize HD-Zip II proteins function as transcriptional repressors and that ATHB17Δ113 relieves this HD-Zip II mediated transcriptional repression activity. Expression of ATHB17Δ113 in maize leads to increased ear size at silking and, therefore, may enhance sink potential. We hypothesize that this phenotype could be a result of modulation of endogenous HD-Zip II pathways in maize. PMID:24736658

Angular truncation errors in integrating nephelometry

International Nuclear Information System (INIS)

Moosmueller, Hans; Arnott, W. Patrick

2003-01-01

Ideal integrating nephelometers integrate light scattered by particles over all directions. However, real nephelometers truncate light scattered in near-forward and near-backward directions below a certain truncation angle (typically 7 deg. ). This results in truncation errors, with the forward truncation error becoming important for large particles. Truncation errors are commonly calculated using Mie theory, which offers little physical insight and no generalization to nonspherical particles. We show that large particle forward truncation errors can be calculated and understood using geometric optics and diffraction theory. For small truncation angles (i.e., <10 deg. ) as typical for modern nephelometers, diffraction theory by itself is sufficient. Forward truncation errors are, by nearly a factor of 2, larger for absorbing particles than for nonabsorbing particles because for large absorbing particles most of the scattered light is due to diffraction as transmission is suppressed. Nephelometers calibration procedures are also discussed as they influence the effective truncation error

Rare mutations predisposing to familial adenomatous polyposis in Greek FAP patients

International Nuclear Information System (INIS)

Mihalatos, Markos; Fountzilas, George; Agnantis, Niki J; Nasioulas, Georgios; Apessos, Angela; Dauwerse, Hans; Velissariou, Voula; Psychias, Aristidis; Koliopanos, Alexander; Petropoulos, Konstantinos; Triantafillidis, John K; Danielidis, Ioannis

2005-01-01

Familial Adenomatous Polyposis (FAP) is caused by germline mutations in the APC (Adenomatous Polyposis Coli) gene. The vast majority of APC mutations are point mutations or small insertions / deletions which lead to truncated protein products. Splicing mutations or gross genomic rearrangements are less common inactivating events of the APC gene. In the current study genomic DNA or RNA from ten unrelated FAP suspected patients was examined for germline mutations in the APC gene. Family history and phenotype were used in order to select the patients. Methods used for testing were dHPLC (denaturing High Performance Liquid Chromatography), sequencing, MLPA (Multiplex Ligation – dependent Probe Amplification), Karyotyping, FISH (Fluorescence In Situ Hybridization) and RT-PCR (Reverse Transcription – Polymerase Chain Reaction). A 250 Kbp deletion in the APC gene starting from intron 5 and extending beyond exon 15 was identified in one patient. A substitution of the +5 conserved nucleotide at the splice donor site of intron 9 in the APC gene was shown to produce frameshift and inefficient exon skipping in a second patient. Four frameshift mutations (1577insT, 1973delAG, 3180delAAAA, 3212delA) and a nonsense mutation (C1690T) were identified in the rest of the patients. Screening for APC mutations in FAP patients should include testing for splicing defects and gross genomic alterations

No evidence that protein truncating variants in BRIP1 are associated with breast cancer risk: Implications for gene panel testing

NARCIS (Netherlands)

D.F. Easton (Douglas F.); F. Lesueur (Fabienne); B. Decker (Brennan); K. Michailidou (Kyriaki); J. Li (Jun); J. Allen (Jamie); C. Luccarini (Craig); K.A. Pooley (Karen); M. Shah (Mitul); M.K. Bolla (Manjeet); Q. Wang (Qin); J. Dennis (Joe); J. Ahmad (Jamil); E.R. Thompson (Ella); F. Damiola (Francesca); M. Pertesi (Maroulio); C. Voegele (Catherine); N. Mebirouk (Noura); N. Robinot (Nivonirina); G. Durand (Geoffroy); N. Forey (Nathalie); R.N. Luben (Robert); S. Ahmed (Shahana); K. Aittomäki (Kristiina); H. Anton-Culver (Hoda); V. Arndt (Volker); C. Baynes (Caroline); M.W. Beckmann (Matthias); J. Benítez (Javier); D. Van Den Berg (David); W.J. Blot (William); N.V. Bogdanova (Natalia); S.E. Bojesen (Stig); H. Brenner (Hermann); J. Chang-Claude (Jenny); K.S. Chia (Kee Seng); J.-Y. Choi (Ji-Yeob); D. Conroy (Don); A. Cox (Angela); S.S. Cross (Simon S.); K. Czene (Kamila); H. Darabi (Hatef); P. Devilee (Peter); M. Eriksson (Mats); P.A. Fasching (Peter); J.D. Figueroa (Jonine); H. Flyger (Henrik); F. Fostira (Florentia); M. García-Closas (Montserrat); G.G. Giles (Graham); G. Glendon (Gord); A. González-Neira (Anna); P. Guénel (Pascal); C.A. Haiman (Christopher A.); P. Hall (Per); S.N. Hart (Steven N.); J.M. Hartman (Joost); M.J. Hooning (Maartje); C.-N. Hsiung (Chia-Ni); H. Ito (Hidemi); A. Jakubowska (Anna); P.A. James (Paul A.); E.M. John (Esther M.); N. Johnson (Nichola); M. Jones (Michael); M. Kabisch (Maria); D. Kang (Daehee); V-M. Kosma (Veli-Matti); V. Kristensen (Vessela); D. Lambrechts (Diether); N. Li (Na); E. Myöhänen (Eija); H. Kemiläinen (Helena); A. Lindblom (Annika); J. Long (Jirong); A. Lophatananon (Artitaya); J. Lubinski (Jan); A. Mannermaa (Arto); K. Matsuo (Keitaro); S. Margolin (Sara); K. Matsuo (Keitaro); A. Meindl (Alfons); G. Mitchell (Gillian); K.R. Muir (K.); I. Nevelsteen (Ines); A.M.W. van den Ouweland (Ans); P. Peterlongo (Paolo); S.-Y. Phuah (Sze-Yee); K. Pykäs (Katri); S.M. Rowley (Simone M.); C-Y. Shen (Chen-Yang); R.K. Schmutzler (Rita); C.-Y. Shen (Chen-Yang); X.-O. Shu (Xiao-Ou); M.C. Southey (Melissa); H. Surowy (Harald); A.J. Swerdlow (Anthony ); S.-H. Teo (Soo-Hwang); R.A.E.M. Tollenaar (Rob); I.P. Tomlinson (Ian); C. Vachon (Celine); T. Truong (Thérèse); C. Vachon (Celine); S. Verhoef; M. Wong-Brown (Michelle); W. Zheng (Wei); Y. Zheng (Ying); H. Nevanlinna (Heli); R.J. Scott (Rodney); I.L. Andrulis (Irene); F.J. Couch (Fergus); J.L. Hopper (John); B. Burwinkel (Barbara); R. Winqvist (Robert); B. Burwinkel (Barbara); E.J. Sawyer (Elinor); M.K. Schmidt (Marjanka); A. Rudolph (Anja); T. Dörk (Thilo); S.L. Neuhausen (Susan); U. Hamann (Ute); S.L. Neuhausen (Susan L.); R.L. Milne (Roger); O. Fletcher (Olivia); P.D.P. Pharoah (Paul); I. Campbell (Ian); D. Goldgar (David); S.V. Tavtigian (Sean); D.E. Goldgar (David E.); S.V. Tavtigian (Sean V.); G. Chenevix-Trench (Georgia); K. Kleivi (Kristine); L. Ottestad (Lars); R. Karesen (Rolf); A. Langerød (Anita); E. Schlichting (Ellen); M.M. Holmen (Marit Muri); T. Sauer (Toril); V. Haakensen (Vilde); O. Engebråten (Olav); B. Naume (Bjorn); C.E. Kiserud (Cecile E.); K.V. Reinertsen (Kristin V.); Å. Helland (Åslaug); M. Riis (Margit); I. Bukholm (Ida); P.E. Lønning (Per ); S. Nord (Silje); G.G. Alnæs (Grethe)

2016-01-01

textabstractBackground BRCA1 interacting protein C-terminal helicase 1 (BRIP1) is one of the Fanconi Anaemia Complementation (FANC) group family of DNA repair proteins. Biallelic mutations in BRIP1 are responsible for FANC group J, and previous studies have also suggested that rare protein

Selective apoptosis induction in MCF-7 cell line by truncated minimal functional region of Apoptin

International Nuclear Information System (INIS)

Shen Ni, Lim; Allaudin, Zeenathul Nazariah bt; Mohd Lila, Mohd Azmi b; Othman, Abas Mazni b; Othman, Fauziah bt

2013-01-01

Chicken Anemia Virus (CAV) VP3 protein (also known as Apoptin), a basic and proline-rich protein has a unique capability in inducing apoptosis in cancer cells but not in normal cells. Five truncated Apoptin proteins were analyzed to determine their selective ability to migrate into the nucleus of human breast adenocarcinoma MCF-7 cells for inducing apoptosis. For identification of the minimal selective domain for apoptosis, the wild-type Apoptin gene had been reconstructed by PCR to generate segmental deletions at the N’ terminal and linked with nuclear localization sites (NLS1 and NLS2). All the constructs were fused with maltose-binding protein gene and individually expressed by in vitro Rapid Translation System. Standardized dose of proteins were delivered into human breast adenocarcinoma MCF-7 cells and control human liver Chang cells by cytoplasmic microinjection, and subsequently observed for selective apoptosis effect. Three of the truncated Apoptin proteins with N-terminal deletions spanning amino acid 32–83 retained the cancer selective nature of wild-type Apoptin. The proteins were successfully translocated to the nucleus of MCF-7 cells initiating apoptosis, whereas non-toxic cytoplasmic retention was observed in normal Chang cells. Whilst these truncated proteins retained the tumour-specific death effector ability, the specificity for MCF-7 cells was lost in two other truncated proteins that harbor deletions at amino acid 1–31. The detection of apoptosing normal Chang cells and MCF-7 cells upon cytoplasmic microinjection of these proteins implicated a loss in Apoptin’s signature targeting activity. Therefore, the critical stretch spanning amino acid 1–31 at the upstream of a known hydrophobic leucine-rich stretch (LRS) was strongly suggested as one of the prerequisite region in Apoptin for cancer targeting. Identification of this selective domain provides a platform for developing small targets to facilitating carrier-mediated-transport across

A Novel Founder Mutation in MYBPC3: Phenotypic Comparison With the Most Prevalent MYBPC3 Mutation in Spain.

Science.gov (United States)

Sabater-Molina, María; Saura, Daniel; García-Molina Sáez, Esperanza; González-Carrillo, Josefa; Polo, Luis; Pérez-Sánchez, Inmaculada; Olmo, María Del Carmen; Oliva-Sandoval, María José; Barriales-Villa, Roberto; Carbonell, Pablo; Pascual-Figal, Domigo; Gimeno, Juan R

2017-02-01

Mutations in MYBPC3 are the cause of hypertrophic cardiomyopathy (HCM). Although most lead to a truncating protein, the severity of the phenotype differs. We describe the clinical phenotype of a novel MYBPC3 mutation, p.Pro108Alafs*9, present in 13 families from southern Spain and compare it with the most prevalent MYBPC3 mutation in this region (c.2308+1 G>A). We studied 107 relatives of 13 index cases diagnosed as HCM carriers of the p.Pro108Alafs*9 mutation. Pedigree analysis, clinical evaluation, and genotyping were performed. A total of 54 carriers of p.Pro108Alafs*9 were identified, of whom 39 had HCM. There were 5 cases of sudden death in the 13 families. Disease penetrance was greater as age increased and HCM patients were more frequently male and developed disease earlier than female patients. The phenotype was similar in p.Pro108Alafs*9 and in c.2308+1 G>A, but differences were found in several risk factors and in survival. There was a trend toward a higher left ventricular mass in p.Pro108Alafs*9 vs c.2308+1G>A. Cardiac magnetic resonance revealed a similar extent and pattern of fibrosis. The p.Pro108Alafs*9 mutation is associated with HCM, high penetrance, and disease onset in middle age. Copyright © 2016 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

Modeling the Effect of APC Truncation on Destruction Complex Function in Colorectal Cancer Cells

Science.gov (United States)

Barua, Dipak; Hlavacek, William S.

2013-01-01

In colorectal cancer cells, APC, a tumor suppressor protein, is commonly expressed in truncated form. Truncation of APC is believed to disrupt degradation of β—catenin, which is regulated by a multiprotein complex called the destruction complex. The destruction complex comprises APC, Axin, β—catenin, serine/threonine kinases, and other proteins. The kinases and , which are recruited by Axin, mediate phosphorylation of β—catenin, which initiates its ubiquitination and proteosomal degradation. The mechanism of regulation of β—catenin degradation by the destruction complex and the role of truncation of APC in colorectal cancer are not entirely understood. Through formulation and analysis of a rule-based computational model, we investigated the regulation of β—catenin phosphorylation and degradation by APC and the effect of APC truncation on function of the destruction complex. The model integrates available mechanistic knowledge about site-specific interactions and phosphorylation of destruction complex components and is consistent with an array of published data. We find that the phosphorylated truncated form of APC can outcompete Axin for binding to β—catenin, provided that Axin is limiting, and thereby sequester β—catenin away from Axin and the Axin-recruited kinases and . Full-length APC also competes with Axin for binding to β—catenin; however, full-length APC is able, through its SAMP repeats, which bind Axin and which are missing in truncated oncogenic forms of APC, to bring β—catenin into indirect association with Axin and Axin-recruited kinases. Because our model indicates that the positive effects of truncated APC on β—catenin levels depend on phosphorylation of APC, at the first 20-amino acid repeat, and because phosphorylation of this site is mediated by , we suggest that is a potential target for therapeutic intervention in colorectal cancer. Specific inhibition of is predicted to limit binding of β—catenin to truncated

A novel NHS mutation causes Nance-Horan Syndrome in a Chinese family.

Science.gov (United States)

Tian, Qi; Li, Yunping; Kousar, Rizwana; Guo, Hui; Peng, Fenglan; Zheng, Yu; Yang, Xiaohua; Long, Zhigao; Tian, Runyi; Xia, Kun; Lin, Haiying; Pan, Qian

2017-01-07

Nance-Horan Syndrome (NHS) (OMIM: 302350) is a rare X-linked developmental disorder characterized by bilateral congenital cataracts, with occasional dental anomalies, characteristic dysmorphic features, brachymetacarpia and mental retardation. Carrier females exhibit similar manifestations that are less severe than in affected males. Here, we report a four-generation Chinese family with multiple affected individuals presenting Nance-Horan Syndrome. Whole-exome sequencing combined with RT-PCR and Sanger sequencing was used to search for a genetic cause underlying the disease phenotype. Whole-exome sequencing identified in all affected individuals of the family a novel donor splicing site mutation (NM_198270: c.1045 + 2T > A) in intron 4 of the gene NHS, which maps to chromosome Xp22.13. The identified mutation results in an RNA processing defect causing a 416-nucleotide addition to exon 4 of the mRNA transcript, likely producing a truncated NHS protein. The donor splicing site mutation NM_198270: c.1045 + 2T > A of the NHS gene is the causative mutation in this Nance-Horan Syndrome family. This research broadens the spectrum of NHS gene mutations, contributing to our understanding of the molecular genetics of NHS.

A novel mutation in the MITF may be digenic with GJB2 mutations in a large Chinese family of Waardenburg syndrome type II.

Science.gov (United States)

Yan, Xukun; Zhang, Tianyu; Wang, Zhengmin; Jiang, Yi; Chen, Yan; Wang, Hongyan; Ma, Duan; Wang, Lei; Li, Huawei

2011-12-20

Waardenburg syndrome type II (WS2) is associated with syndromic deafness. A subset of WS2, WS2A, accounting for approximately 15% of patients, is attributed to mutations in the microphthalmia-associated transcription factor (MITF) gene. We examined the genetic basis of WS2 in a large Chinese family. All 9 exons of the MITF gene, the single coding exon (exon 2) of the most common hereditary deafness gene GJB2 and the mitochondrial DNA (mtDNA) 12S rRNA were sequenced. A novel heterozygous mutation c.[742_743delAAinsT;746_747delCA] in exon 8 of the MITF gene co-segregates with WS2 in the family. The MITF mutation results in a premature termination codon and a truncated MITF protein with only 247 of the 419 wild type amino acids. The deaf proband had this MITF gene heterozygous mutation as well as a c.[109G>A]+[235delC] compound heterozygous pathogenic mutation in the GJB2 gene. No pathogenic mutation was found in mtDNA 12S rRNA in this family. Thus, a novel compound heterozygous mutation, c.[742_743delAAinsT;746_747delCA] in MITF exon 8 was the key genetic reason for WS2 in this family, and a digenic effect of MITF and GJB2 genes may contribute to deafness of the proband. Copyright © 2011. Published by Elsevier Ltd.

Genomic analysis of an attenuated Chlamydia abortus live vaccine strain reveals defects in central metabolism and surface proteins.

Science.gov (United States)

Burall, L S; Rodolakis, A; Rekiki, A; Myers, G S A; Bavoil, P M

2009-09-01

Comparative genomic analysis of a wild-type strain of the ovine pathogen Chlamydia abortus and its nitrosoguanidine-induced, temperature-sensitive, virulence-attenuated live vaccine derivative identified 22 single nucleotide polymorphisms unique to the mutant, including nine nonsynonymous mutations, one leading to a truncation of pmpG, which encodes a polymorphic membrane protein, and two intergenic mutations potentially affecting promoter sequences. Other nonsynonymous mutations mapped to a pmpG pseudogene and to predicted coding sequences encoding a putative lipoprotein, a sigma-54-dependent response regulator, a PhoH-like protein, a putative export protein, two tRNA synthetases, and a putative serine hydroxymethyltransferase. One of the intergenic mutations putatively affects transcription of two divergent genes encoding pyruvate kinase and a putative SOS response nuclease, respectively. These observations suggest that the temperature-sensitive phenotype and associated virulence attenuation of the vaccine strain result from disrupted metabolic activity due to altered pyruvate kinase expression and/or alteration in the function of one or more membrane proteins, most notably PmpG and a putative lipoprotein.

CHARACTERIZATION OF ENU-INDUCED MUTATIONS IN RED BLOOD CELL STRUCTURAL PROTEINS

Directory of Open Access Journals (Sweden)

Katrina Kildey

2013-03-01

Full Text Available Murine models with modified gene function as a result of N-ethyl-N-nitrosourea (ENU mutagenesis have been used to study phenotypes resulting from genetic change. This study investigated genetic factors associated with red blood cell (RBC physiology and structural integrity that may impact on blood component storage and transfusion outcome. Forward and reverse genetic approaches were employed with pedigrees of ENU-treated mice using a homozygous recessive breeding strategy. In a “forward genetic” approach, pedigree selection was based upon identification of an altered phenotype followed by exome sequencing to identify a causative mutation. In a second strategy, a “reverse genetic” approach based on selection of pedigrees with mutations in genes of interest was utilised and, following breeding to homozygosity, phenotype assessed. Thirty-three pedigrees were screened by the forward genetic approach. One pedigree demonstrated reticulocytosis, microcytic anaemia and thrombocytosis. Exome sequencing revealed a novel single nucleotide variation (SNV in Ank1 encoding the RBC structural protein ankyrin-1 and the pedigree was designated Ank1EX34. The reticulocytosis and microcytic anaemia observed in the Ank1EX34 pedigree were similar to clinical features of hereditary spherocytosis in humans. For the reverse genetic approach three pedigrees with different point mutations in Spnb1 encoding RBC protein spectrin-1β, and one pedigree with a mutation in Epb4.1, encoding band 4.1 were selected for study. When bred to homozygosity two of the spectrin-1β pedigrees (a, b demonstrated increased RBC count, haemoglobin (Hb and haematocrit (HCT. The third Spnb1 mutation (spectrin-1β c and mutation in Epb4.1 (band 4.1 did not significantly affect the haematological phenotype, despite these two mutations having a PolyPhen score predicting the mutation may be damaging. Exome sequencing allows rapid identification of causative mutations and development of

Kin-Driver: a database of driver mutations in protein kinases.

Science.gov (United States)

Simonetti, Franco L; Tornador, Cristian; Nabau-Moretó, Nuria; Molina-Vila, Miguel A; Marino-Buslje, Cristina

2014-01-01

Somatic mutations in protein kinases (PKs) are frequent driver events in many human tumors, while germ-line mutations are associated with hereditary diseases. Here we present Kin-driver, the first database that compiles driver mutations in PKs with experimental evidence demonstrating their functional role. Kin-driver is a manual expert-curated database that pays special attention to activating mutations (AMs) and can serve as a validation set to develop new generation tools focused on the prediction of gain-of-function driver mutations. It also offers an easy and intuitive environment to facilitate the visualization and analysis of mutations in PKs. Because all mutations are mapped onto a multiple sequence alignment, analogue positions between kinases can be identified and tentative new mutations can be proposed for studying by transferring annotation. Finally, our database can also be of use to clinical and translational laboratories, helping them to identify uncommon AMs that can correlate with response to new antitumor drugs. The website was developed using PHP and JavaScript, which are supported by all major browsers; the database was built using MySQL server. Kin-driver is available at: http://kin-driver.leloir.org.ar/ © The Author(s) 2014. Published by Oxford University Press.

Novel mutation predicted to disrupt SGOL1 protein function

African Journals Online (AJOL)

Rohit Gupta

2012-11-02

Nov 2, 2012 ... structural consequences of mutation over folding conformation of the 3rd exon. Further we carried .... Coiled Coil domain [PDB IDs: 3FGA] was retrieved from. Protein Data ... 1.0 nm of 216 SPC water molecules. We used 2CLА ...

The smallest teeth in the world are caused by mutations in the PCNT gene.

Science.gov (United States)

Kantaputra, Piranit; Tanpaiboon, Pranoot; Porntaveetus, Thantrira; Ohazama, Atsushi; Sharpe, Paul; Rauch, Anita; Hussadaloy, Atiwat; Thiel, Christian T

2011-06-01

We report a follow up study on two MOPD II Thai families with severe dental anomalies and hypoplastic alveolar bone. Striking dental anomalies comprise severe microdontia, opalescent and abnormally shaped teeth, and rootless molars. As a result of severe hypoplastic alveolar bone, most permanent teeth have been lost. Mutation analysis of PCNT revealed 2 novel mutations (p.Lys3154del and p.Glu1154X) and a recurrent mutation (p.Pro1923X). Teeth of the patient who carried a homozygous novel mutation of p.Glu1154X are probably the smallest ever reported. The sizes of the mandibular permanent incisors and all premolars were approximately 2-2.5 mm, mesiodistally. All previously reported, PCNT mutations have been described to cause premature truncation of the pericentrin protein. p.Lys3154del mutation was unique as it was pathogenic as a result of missing only a single amino acid. In situ hybridization of Pcnt shows its expression in the epithelium and mesenchyme during early stages of rodent tooth development. It is evident that PCNT has crucial role in tooth development. The permanent dentition is more severely affected than the one. This implies that PCNT appears to have more role in the development of the permanent dentition. As pericentrin is a critical centrosomal protein, the dental phenotype found in MOPD II patients is postulated to be the consequence of loss of microtubule integrity which leads to defective centrosome function. Copyright © 2011 Wiley-Liss, Inc.

Prediction of mutational tolerance in HIV-1 protease and reverse transcriptase using flexible backbone protein design.

Directory of Open Access Journals (Sweden)

Elisabeth Humphris-Narayanan

Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.

Clonal architectures and driver mutations in metastatic melanomas.

Directory of Open Access Journals (Sweden)

Li Ding

Full Text Available To reveal the clonal architecture of melanoma and associated driver mutations, whole genome sequencing (WGS and targeted extension sequencing were used to characterize 124 melanoma cases. Significantly mutated gene analysis using 13 WGS cases and 15 additional paired extension cases identified known melanoma genes such as BRAF, NRAS, and CDKN2A, as well as a novel gene EPHA3, previously implicated in other cancer types. Extension studies using tumors from another 96 patients discovered a large number of truncation mutations in tumor suppressors (TP53 and RB1, protein phosphatases (e.g., PTEN, PTPRB, PTPRD, and PTPRT, as well as chromatin remodeling genes (e.g., ASXL3, MLL2, and ARID2. Deep sequencing of mutations revealed subclones in the majority of metastatic tumors from 13 WGS cases. Validated mutations from 12 out of 13 WGS patients exhibited a predominant UV signature characterized by a high frequency of C->T transitions occurring at the 3' base of dipyrimidine sequences while one patient (MEL9 with a hypermutator phenotype lacked this signature. Strikingly, a subclonal mutation signature analysis revealed that the founding clone in MEL9 exhibited UV signature but the secondary clone did not, suggesting different mutational mechanisms for two clonal populations from the same tumor. Further analysis of four metastases from different geographic locations in 2 melanoma cases revealed phylogenetic relationships and highlighted the genetic alterations responsible for differential drug resistance among metastatic tumors. Our study suggests that clonal evaluation is crucial for understanding tumor etiology and drug resistance in melanoma.

Association of a homozygous nonsense mutation in the ABCA4 (ABCR) gene with cone-rod dystrophy phenotype in an Italian family.

Science.gov (United States)

Simonelli, Francesca; Testa, Francesco; Zernant, Jana; Nesti, Anna; Rossi, Settimio; Rinaldi, Ernesto; Allikmets, Rando

2004-01-01

Genetic variation in the ABCA4 (ABCR) gene has been associated with several distinct retinal phenotypes, including Stargardt disease/fundus flavimaculatus (STGD/FFM), cone-rod dystrophy (CRD), retinitis pigmentosa (RP) and age-related macular degeneration. The current model of genotype/phenotype association suggests that patients harboring deleterious mutations in both ABCR alleles would develop RP-like retinal pathology. Here we describe ABCA4-associated phenotypes, including a proband with a homozygous nonsense mutation in a family from Southern Italy. The proband had been originally diagnosed with STGD. Ophthalmologic examination included kinetic perimetry, electrophysiological studies and fluorescein angiography. DNA of the affected individual and family members was analyzed for variants in all 50 exons of the ABCA4 gene by screening on the ABCR400 microarray. A homozygous nonsense mutation 2971G>T (G991X) was detected in a patient initially diagnosed with STGD based on funduscopic evidence, including bull's eye depigmentation of the fovea and flecks at the posterior pole extending to the mid-peripheral retina. Since this novel nucleotide substitution results in a truncated, nonfunctional, ABCA4 protein, the patient was examined in-depth for the severity of the disease phenotype. Indeed, subsequent electrophysiological studies determined severely reduced cone amplitude as compared to the rod amplitude, suggesting the diagnosis of CRD. ABCR400 microarray is an efficient tool for determining causal genetic variation, including new mutations. A homozygous protein-truncating mutation in ABCA4 can cause a phenotype ranging from STGD to CRD as diagnosed at an early stage of the disease. Only a combination of comprehensive genotype/phenotype correlation studies will determine the proper diagnosis and prognosis of ABCA4-associated pathology. Copyright 2004 S. Karger AG, Basel

Increased frequency of FBN1 truncating and splicing variants in Marfan syndrome patients with aortic events.

Science.gov (United States)

Baudhuin, Linnea M; Kotzer, Katrina E; Lagerstedt, Susan A

2015-03-01

Marfan syndrome is a systemic disorder that typically involves FBN1 mutations and cardiovascular manifestations. We investigated FBN1 genotype-phenotype correlations with aortic events (aortic dissection and prophylactic aortic surgery) in patients with Marfan syndrome. Genotype and phenotype information from probands (n = 179) with an FBN1 pathogenic or likely pathogenic variant were assessed. A higher frequency of truncating or splicing FBN1 variants was observed in Ghent criteria-positive patients with an aortic event (n = 34) as compared with all other probands (n = 145) without a reported aortic event (79 vs. 39%; P Marfan syndrome patients with FBN1 truncating and splicing variants.Genet Med 17 3, 177-187.

[Mutation screening of MITF gene in patients with Waardenburg syndrome type 2].

Science.gov (United States)

Chen, Jing; Yang, Shu-Zhi; Liu, Jun; Han, Bing; Wang, Guo-Jian; Zhang, Xin; Kang, Dong-Yang; Dai, Pu; Young, Wie-Yen; Yuan, Hui-Jun

2008-04-01

Warrgenburg syndrome type 2 (WS2) is the most common autosomal dominantly-inherited syndrome with hearing loss. MITF (microphthalmia associated transcription factor)is a basic-helix-loop-helix-luecine zipper (bHLHZip) factor which regulates expression of tyrosinase, and is involved in melanocyte differentiation. Mutations in MITF associated with WS2 have been identified in some but not all affected families. Here, we report a three-generation Chinese family with a point mutation in the MITF gene causing WS2. The proband exhibits congenital severe sensorineural hearing loss, heterochromia iridis and facial freckles. One of family members manifests sensorineural deafness, and the other patients show premature greying or/and freckles. This mutation, heterozygous deletion c.639delA, creates a stop codon in exon 7 and is predicted to result in a truncated protein lacking normal interaction with its target DNA motif. This mutation is a novel mutation and the third case identified in exon 7 of MITF in WS2. Though there is only one base pair distance between this novel mutation and the other two documented cases and similar amino acids change, significant difference is seen in clinical phenotype, which suggests genetic background may play an important role.

Case report: a novel KERA mutation associated with cornea plana and its predicted effect on protein function

DEFF Research Database (Denmark)

Roos, Laura; Bertelsen, Birgitte; Harris, Pernille

2015-01-01

individuals, hypotrichosis was found. KERA was screened for mutations using Sanger sequencing. We detected a novel KERA variant, p.(Ile225Thr), that segregates with the disease in the homozygous form. The three-dimensional structure of keratocan protein was modelled, and we showed that this missense variation...... of the keratocan gene (KERA) on chromosome 12q22. To date, only nine different disease-associated KERA mutations, including four missense mutations, have been described. Case presentation: In this report, we present clinical data from a Turkish family with autosomal recessive cornea plana. In some of the affected...... are predicted to result in destabilization of the protein. Conclusion: We present the 10th pathogenic KERA mutation identified so far. Protein modelling is a useful tool in predicting the effect of missense mutations. This case underline the importance of the leucin rich repeat domain for the protein function...

Common pathological mutations in PQBP1 induce nonsense-mediated mRNA decay and enhance exclusion of the mutant exon.

Science.gov (United States)

Musante, Luciana; Kunde, Stella-Amrei; Sulistio, Tina O; Fischer, Ute; Grimme, Astrid; Frints, Suzanna G M; Schwartz, Charles E; Martínez, Francisco; Romano, Corrado; Ropers, Hans-Hilger; Kalscheuer, Vera M

2010-01-01

The polyglutamine binding protein 1 (PQBP1) gene plays an important role in X-linked mental retardation (XLMR). Nine of the thirteen PQBP1 mutations known to date affect the AG hexamer in exon 4 and cause frameshifts introducing premature termination codons (PTCs). However, the phenotype in this group of patients is variable. To investigate the pathology of these PQBP1 mutations, we evaluated their consequences on mRNA and protein expression. RT-PCRs revealed mutation-specific reduction of PQBP1 mRNAs carrying the PTCs that can be partially restored by blocking translation, thus indicating a role for the nonsense-mediated mRNA decay pathway. In addition, these mutations resulted in altered levels of PQBP1 transcripts that skipped exon 4, probably as a result of altering important splicing motifs via nonsense-associated altered splicing (NAS). This hypothesis is supported by transfection experiments using wild-type and mutant PQBP1 minigenes. Moreover, we show that a truncated PQBP1 protein is indeed present in the patients. Remarkably, patients with insertion/deletion mutations in the AG hexamer express significantly increased levels of a PQBP1 isoform, which is very likely encoded by the transcripts without exon 4, confirming the findings at the mRNA level. Our study provides significant insight into the early events contributing to the pathogenesis of the PQBP1 related XLMR disease.

Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma

International Nuclear Information System (INIS)

Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.

2014-01-01

Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)

A case of early onset rectal cancer of Lynch syndrome with a novel deleterious PMS2 mutation.

Science.gov (United States)

Nomura, Sachio; Fujimoto, Yoshiya; Yamamoto, Noriko; Sato, Yuri; Ashihara, Yuumi; Kita, Mizuho; Yamaguchi, Junya; Ishikawa, Yuichi; Ueno, Masashi; Arai, Masami

2015-10-01

Heterozygous deleterious mutation of the PMS2 gene is a cause of Lynch syndrome, an autosomal dominant cancer disease. However, the frequency of PMS2 mutation is rare compared with that of the other causative genes; MSH2, MLH1 and MSH6. PMS2 mutation has so far only been reported once from a Japanese facility. Detection of PMS2 mutation is relatively complicated due to the existence of 15 highly homologous pseudogenes, and its gene conversion event with the pseudogene PMS2CL. Therefore, for PMS2 mutation analysis, it is crucial to clearly distinguish PMS2 from its pseudogenes. We report here a novel deleterious 11 bp deletion mutation of exon 11 of PMS2 distinguished from PMS2CL in a 34-year-old Japanese female with rectal cancer. PMS2 mutated at c.1492del11 results in a truncated 500 amino acid protein rather than the wild-type protein of 862 amino acids. This is supported by the fact that, although there is usually concordance between MLH1 and PMS2 expression, cells were immunohistochemically positive for MLH1, whereas PMS2 could not be immunohistochemically stained using an anti-C-terminal PMS2 antibody, or effective PMS2 mRNA degradation with NMD caused by the frameshift mutation. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Herpes simplex virus type 1 strain KOS carries a defective US9 and a mutated US8A gene.

Science.gov (United States)

Negatsch, Alexandra; Mettenleiter, Thomas C; Fuchs, Walter

2011-01-01

The membrane protein encoded by the US9 gene of alphaherpesviruses plays an important role during virion assembly and transport in neurons. Here, we demonstrate that in herpes simplex virus type 1 (HSV-1) strain KOS, due to base substitutions, the predicted TATA-box of US9 is mutated, and a premature stop is present at codon 58 of US9, which contains 91 codons in other HSV-1 strains. The TATA-box mutation also removes the native stop codon of the adjacent US8A gene, leading to extension of the coding region from 160 to 191 codons. Northern blot analyses revealed reduced transcription of US9 in cells infected with HSV-1 KOS. Moreover, a US9-specific antiserum did not detect any gene products in Western blot and immunofluorescence analyses of KOS-infected cells, indicating that the truncated protein is not stable. In contrast, Western blot reactions of a pUS8A-specific antiserum confirmed enlargement of this protein in HSV-1 KOS.

In silico characterization of a novel pathogenic deletion mutation identified in XPA gene in a Pakistani family with severe xeroderma pigmentosum.

Science.gov (United States)

Nasir, Muhammad; Ahmad, Nafees; Sieber, Christian M K; Latif, Amir; Malik, Salman Akbar; Hameed, Abdul

2013-09-24

Xeroderma Pigmentosum (XP) is a rare skin disorder characterized by skin hypersensitivity to sunlight and abnormal pigmentation. The aim of this study was to investigate the genetic cause of a severe XP phenotype in a consanguineous Pakistani family and in silico characterization of any identified disease-associated mutation. The XP complementation group was assigned by genotyping of family for known XP loci. Genotyping data mapped the family to complementation group A locus, involving XPA gene. Mutation analysis of the candidate XP gene by DNA sequencing revealed a novel deletion mutation (c.654del A) in exon 5 of XPA gene. The c.654del A, causes frameshift, which pre-maturely terminates protein and result into a truncated product of 222 amino acid (aa) residues instead of 273 (p.Lys218AsnfsX5). In silico tools were applied to study the likelihood of changes in structural motifs and thus interaction of mutated protein with binding partners. In silico analysis of mutant protein sequence, predicted to affect the aa residue which attains coiled coil structure. The coiled coil structure has an important role in key cellular interactions, especially with DNA damage-binding protein 2 (DDB2), which has important role in DDB-mediated nucleotide excision repair (NER) system. Our findings support the fact of genetic and clinical heterogeneity in XP. The study also predicts the critical role of DDB2 binding region of XPA protein in NER pathway and opens an avenue for further research to study the functional role of the mutated protein domain.

RBFOX1 and RBFOX3 mutations in rolandic epilepsy

DEFF Research Database (Denmark)

Lal, Dennis; Reinthaler, Eva M; Altmüller, Janine

2013-01-01

Partial deletions of the gene encoding the neuronal splicing regulator RBFOX1 have been reported in a range of neurodevelopmental diseases, including idiopathic generalized epilepsy. The RBFOX1 protein and its homologues (RBFOX2 and RBFOX3) regulate alternative splicing of many neuronal transcripts...... involved in the homeostatic control of neuronal excitability. In this study, we explored if structural microdeletions and exonic sequence variations in RBFOX1, RBFOX2, RBFOX3 confer susceptibility to rolandic epilepsy (RE), a common idiopathic focal childhood epilepsy. By high-density SNP array screening...... that exon deletions and truncating mutations of RBFOX1 and RBFOX3 contribute to the genetic variance of partial and generalized idiopathic epilepsy syndromes....

A homologous mapping method for three-dimensional reconstruction of protein networks reveals disease-associated mutations.

Science.gov (United States)

Huang, Sing-Han; Lo, Yu-Shu; Luo, Yong-Chun; Tseng, Yu-Yao; Yang, Jinn-Moon

2018-03-19

One of the crucial steps toward understanding the associations among molecular interactions, pathways, and diseases in a cell is to investigate detailed atomic protein-protein interactions (PPIs) in the structural interactome. Despite the availability of large-scale methods for analyzing PPI networks, these methods often focused on PPI networks using genome-scale data and/or known experimental PPIs. However, these methods are unable to provide structurally resolved interaction residues and their conservations in PPI networks. Here, we reconstructed a human three-dimensional (3D) structural PPI network (hDiSNet) with the detailed atomic binding models and disease-associated mutations by enhancing our PPI families and 3D-domain interologs from 60,618 structural complexes and complete genome database with 6,352,363 protein sequences across 2274 species. hDiSNet is a scale-free network (γ = 2.05), which consists of 5177 proteins and 19,239 PPIs with 5843 mutations. These 19,239 structurally resolved PPIs not only expanded the number of PPIs compared to present structural PPI network, but also achieved higher agreement with gene ontology similarities and higher co-expression correlation than the ones of 181,868 experimental PPIs recorded in public databases. Among 5843 mutations, 1653 and 790 mutations involved in interacting domains and contacting residues, respectively, are highly related to diseases. Our hDiSNet can provide detailed atomic interactions of human disease and their associated proteins with mutations. Our results show that the disease-related mutations are often located at the contacting residues forming the hydrogen bonds or conserved in the PPI family. In addition, hDiSNet provides the insights of the FGFR (EGFR)-MAPK pathway for interpreting the mechanisms of breast cancer and ErbB signaling pathway in brain cancer. Our results demonstrate that hDiSNet can explore structural-based interactions insights for understanding the mechanisms of disease

The polyproline site in hinge 2 influences the functional capacity of truncated dystrophins.

Directory of Open Access Journals (Sweden)

Glen B Banks

2010-05-01

Full Text Available Mutations in dystrophin can lead to Duchenne muscular dystrophy or the more mild form of the disease, Becker muscular dystrophy. The hinge 3 region in the rod domain of dystrophin is particularly prone to deletion mutations. In-frame deletions of hinge 3 are predicted to lead to BMD, however the severity of disease can vary considerably. Here we performed extensive structure-function analyses of truncated dystrophins with modified hinges and spectrin-like repeats in mdx mice. We found that the polyproline site in hinge 2 profoundly influences the functional capacity of a microdystrophin(DeltaR4-R23/DeltaCT with a large deletion in the hinge 3 region. Inclusion of polyproline in microdystrophin(DeltaR4-R23/DeltaCT led to small myofibers (12% smaller than wild-type, Achilles myotendinous disruption, ringed fibers, and aberrant neuromuscular junctions in the mdx gastrocnemius muscles. Replacing hinge 2 of microdystrophin(DeltaR4-R23/DeltaCT with hinge 3 significantly improved the functional capacity to prevent muscle degeneration, increase muscle fiber area, and maintain the junctions. We conclude that the rigid alpha-helical structure of the polyproline site significantly impairs the functional capacity of truncated dystrophins to maintain appropriate connections between the cytoskeleton and extracellular matrix.

Stereochemical criteria for prediction of the effects of proline mutations on protein stability.

Directory of Open Access Journals (Sweden)

Kanika Bajaj

2007-12-01

Full Text Available When incorporated into a polypeptide chain, proline (Pro differs from all other naturally occurring amino acid residues in two important respects. The phi dihedral angle of Pro is constrained to values close to -65 degrees and Pro lacks an amide hydrogen. Consequently, mutations which result in introduction of Pro can significantly affect protein stability. In the present work, we describe a procedure to accurately predict the effect of Pro introduction on protein thermodynamic stability. Seventy-seven of the 97 non-Pro amino acid residues in the model protein, CcdB, were individually mutated to Pro, and the in vivo activity of each mutant was characterized. A decision tree to classify the mutation as perturbing or nonperturbing was created by correlating stereochemical properties of mutants to activity data. The stereochemical properties including main chain dihedral angle phi and main chain amide H-bonds (hydrogen bonds were determined from 3D models of the mutant proteins built using MODELLER. We assessed the performance of the decision tree on a large dataset of 163 single-site Pro mutations of T4 lysozyme, 74 nsSNPs, and 52 other Pro substitutions from the literature. The overall accuracy of this algorithm was found to be 81% in the case of CcdB, 77% in the case of lysozyme, 76% in the case of nsSNPs, and 71% in the case of other Pro substitution data. The accuracy of Pro scanning mutagenesis for secondary structure assignment was also assessed and found to be at best 69%. Our prediction procedure will be useful in annotating uncharacterized nsSNPs of disease-associated proteins and for protein engineering and design.

Stereochemical criteria for prediction of the effects of proline mutations on protein stability.

Science.gov (United States)

Bajaj, Kanika; Madhusudhan, M S; Adkar, Bharat V; Chakrabarti, Purbani; Ramakrishnan, C; Sali, Andrej; Varadarajan, Raghavan

2007-12-01

When incorporated into a polypeptide chain, proline (Pro) differs from all other naturally occurring amino acid residues in two important respects. The phi dihedral angle of Pro is constrained to values close to -65 degrees and Pro lacks an amide hydrogen. Consequently, mutations which result in introduction of Pro can significantly affect protein stability. In the present work, we describe a procedure to accurately predict the effect of Pro introduction on protein thermodynamic stability. Seventy-seven of the 97 non-Pro amino acid residues in the model protein, CcdB, were individually mutated to Pro, and the in vivo activity of each mutant was characterized. A decision tree to classify the mutation as perturbing or nonperturbing was created by correlating stereochemical properties of mutants to activity data. The stereochemical properties including main chain dihedral angle phi and main chain amide H-bonds (hydrogen bonds) were determined from 3D models of the mutant proteins built using MODELLER. We assessed the performance of the decision tree on a large dataset of 163 single-site Pro mutations of T4 lysozyme, 74 nsSNPs, and 52 other Pro substitutions from the literature. The overall accuracy of this algorithm was found to be 81% in the case of CcdB, 77% in the case of lysozyme, 76% in the case of nsSNPs, and 71% in the case of other Pro substitution data. The accuracy of Pro scanning mutagenesis for secondary structure assignment was also assessed and found to be at best 69%. Our prediction procedure will be useful in annotating uncharacterized nsSNPs of disease-associated proteins and for protein engineering and design.

A targeted constitutive mutation in the APC tumor suppressor gene underlies mammary but not intestinal tumorigenesis.

Directory of Open Access Journals (Sweden)

Claudia Gaspar

2009-07-01

Full Text Available Germline mutations in the adenomatous polyposis coli (APC gene are responsible for familial adenomatous polyposis (FAP, an autosomal dominant hereditary predisposition to the development of multiple colorectal adenomas and of a broad spectrum of extra-intestinal tumors. Moreover, somatic APC mutations play a rate-limiting and initiating role in the majority of sporadic colorectal cancers. Notwithstanding its multifunctional nature, the main tumor suppressing activity of the APC gene resides in its ability to regulate Wnt/beta-catenin signaling. Notably, genotype-phenotype correlations have been established at the APC gene between the length and stability of the truncated proteins encoded by different mutant alleles, the corresponding levels of Wnt/beta-catenin signaling activity they encode for, and the incidence and distribution of intestinal and extra-intestinal tumors. Here, we report a novel mouse model, Apc1572T, obtained by targeting a truncated mutation at codon 1572 in the endogenous Apc gene. This hypomorphic mutant allele results in intermediate levels of Wnt/beta-catenin signaling activation when compared with other Apc mutations associated with multifocal intestinal tumors. Notwithstanding the constitutive nature of the mutation, Apc(+/1572T mice have no predisposition to intestinal cancer but develop multifocal mammary adenocarcinomas and subsequent pulmonary metastases in both genders. The histology of the Apc1572T primary mammary tumours is highly heterogeneous with luminal, myoepithelial, and squamous lineages and is reminiscent of metaplastic carcinoma of the breast in humans. The striking phenotype of Apc(+/1572T mice suggests that specific dosages of Wnt/beta-catenin signaling activity differentially affect tissue homeostasis and initiate tumorigenesis in an organ-specific fashion.

Mutations of 3c and spike protein genes correlate with the occurrence of feline infectious peritonitis.

Science.gov (United States)

Bank-Wolf, Barbara Regina; Stallkamp, Iris; Wiese, Svenja; Moritz, Andreas; Tekes, Gergely; Thiel, Heinz-Jürgen

2014-10-10

The genes encoding accessory proteins 3a, 3b, 3c, 7a and 7b, the S2 domain of the spike (S) protein gene and the membrane (M) protein gene of feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV) samples were amplified, cloned and sequenced. For this faeces and/or ascites samples from 19 cats suffering from feline infectious peritonitis (FIP) as well as from 20 FECV-infected healthy cats were used. Sequence comparisons revealed that 3c genes of animals with FIP were heavily affected by nucleotide deletions and point mutations compared to animals infected with FECV; these alterations resulted either in early termination or destruction of the translation initiation codon. Two ascites-derived samples of cats with FIP which displayed no alterations of ORF3c harboured mutations in the S2 domain of the S protein gene which resulted in amino acid exchanges or deletions. Moreover, changes in 3c were often accompanied by mutations in S2. In contrast, in samples obtained from faeces of healthy cats, the ORF3c was never affected by such mutations. Similarly ORF3c from faecal samples of the cats with FIP was mostly intact and showed only in a few cases the same mutations found in the respective ascites samples. The genes encoding 3a, 3b, 7a and 7b displayed no mutations linked to the feline coronavirus (FCoV) biotype. The M protein gene was found to be conserved between FECV and FIPV samples. Our findings suggest that mutations of 3c and spike protein genes correlate with the occurrence of FIP. Copyright © 2014 Elsevier B.V. All rights reserved.

A mutation in canine CLN5 causes neuronal ceroid lipofuscinosis in Border collie dogs.

Science.gov (United States)

Melville, Scott A; Wilson, Carmen L; Chiang, Chiu S; Studdert, Virginia P; Lingaas, Frode; Wilton, Alan N

2005-09-01

Neuronal ceroid lipofuscinosis (NCL) is a neurodegenerative disease found in Border collie dogs, humans, and other animals. Disease gene studies in humans and animals provided candidates for the NCL gene in Border collies. A combination of linkage analysis and comparative genomics localized the gene to CFA22 in an area syntenic to HSA13q that contains the CLN5 gene responsible for the Finnish variant of human late infantile NCL. Sequencing of CLN5 revealed a nonsense mutation (Q206X) within exon 4 that correlated with NCL in Border collies. This truncation mutation should result in a protein product of a size similar to that of some mutations identified in human CLN5 and therefore the Border collie may make a good model for human NCL. A simple test was developed to enable screening of the Border collie population for carriers so the disease can be eliminated as a problem in the breed.

Search for gene mutations affecting protein structure in children of A-bomb survivors, 2

International Nuclear Information System (INIS)

Satoh, Chiyoko; Fujita, Mikio; Goriki, Kazuaki; Asakawa, Jun-ichi; Takahashi, Norio; Hamilton, H.B.; Hazama, Ryuji; Neel, J.V.

1984-01-01

Children who were born between May 1, 1946 and April 1, 1971 to survivor(s) exposed to A-bombing within 2,000 m from the hypocenter in Hiroshima and Nagasaki were selected as exposed group; their sex- and age-matched children born to survivor(s) who were exposed at 2,500 m or farther were selected as control group. When these children were in junior high school, mutation of protein structure was examined by using electrophoresis and by determining red cell enzymes with decreased activity and heat-unstable red cell enzymes. Electrophoretic study revealed a ''rare type of protein mutation'' in 635 of 12,242 individuals in the exposed group and in 448 of 10,154 individuals in the control group. The number of locuses in all proteins examined was calculated. The number of locuses per protein was corrected using the rate of parents' mutation type, and relative number of locuses were obtained. As a result, there was no difference in the mutation frequency per locus and generation between the exposed and control groups. Among children having red cell enzymes with decreased activity, mutant in triose phosphate isomerase was detected in one child in the exposed group, in whom electrophoretic pattern was normal and red cell enzymes were stable to heat. Heat-unstable red cell enzymes were seen in 9 children and their parents. However, family survey revealed genetic mutation in all instances irrespective of A-bombing. (Namekawa, K.)

Tau truncation is a productive posttranslational modification of neurofibrillary degeneration in Alzheimer's disease.

Science.gov (United States)

Kovacech, B; Novak, M

2010-12-01

Deposits of the misfolded neuronal protein tau are major hallmarks of neurodegeneration in Alzheimer's disease (AD) and other tauopathies. The etiology of the transformation process of the intrinsically disordered soluble protein tau into the insoluble misordered aggregate has attracted much attention. Tau undergoes multiple modifications in AD, most notably hyperphosphorylation and truncation. Hyperphosphorylation is widely regarded as the hottest candidate for the inducer of the neurofibrillary pathology. However, the true nature of the impetus that initiates the whole process in the human brains remains unknown. In AD, several site-specific tau cleavages were identified and became connected to the progression of the disease. In addition, western blot analyses of tau species in AD brains reveal multitudes of various truncated forms. In this review we summarize evidence showing that tau truncation alone is sufficient to induce the complete cascade of neurofibrillary pathology, including hyperphosphorylation and accumulation of misfolded insoluble forms of tau. Therefore, proteolytical abnormalities in the stressed neurons and production of aberrant tau cleavage products deserve closer attention and should be considered as early therapeutic targets for Alzheimer's disease.

A natural mutation-led truncation in one of the two aluminum-activated malate transporter-like genes at the Ma locus is associated with low fruit acidity in apple.

Science.gov (United States)

Bai, Yang; Dougherty, Laura; Li, Mingjun; Fazio, Gennaro; Cheng, Lailiang; Xu, Kenong

2012-08-01

Acidity levels greatly affect the taste and flavor of fruit, and consequently its market value. In mature apple fruit, malic acid is the predominant organic acid. Several studies have confirmed that the major quantitative trait locus Ma largely controls the variation of fruit acidity levels. The Ma locus has recently been defined in a region of 150 kb that contains 44 predicted genes on chromosome 16 in the Golden Delicious genome. In this study, we identified two aluminum-activated malate transporter-like genes, designated Ma1 and Ma2, as strong candidates of Ma by narrowing down the Ma locus to 65-82 kb containing 12-19 predicted genes depending on the haplotypes. The Ma haplotypes were determined by sequencing two bacterial artificial chromosome clones from G.41 (an apple rootstock of genotype Mama) that cover the two distinct haplotypes at the Ma locus. Gene expression profiling in 18 apple germplasm accessions suggested that Ma1 is the major determinant at the Ma locus controlling fruit acidity as Ma1 is expressed at a much higher level than Ma2 and the Ma1 expression is significantly correlated with fruit titratable acidity (R (2) = 0.4543, P = 0.0021). In the coding sequences of low acidity alleles of Ma1 and Ma2, sequence variations at the amino acid level between Golden Delicious and G.41 were not detected. But the alleles for high acidity vary considerably between the two genotypes. The low acidity allele of Ma1, Ma1-1455A, is mainly characterized by a mutation at base 1455 in the open reading frame. The mutation leads to a premature stop codon that truncates the carboxyl terminus of Ma1-1455A by 84 amino acids compared with Ma1-1455G. A survey of 29 apple germplasm accessions using marker CAPS(1455) that targets the SNP(1455) in Ma1 showed that the CAPS(1455A) allele was associated completely with high pH and highly with low titratable acidity, suggesting that the natural mutation-led truncation is most likely responsible for the abolished function of Ma

RNF43 is mutated less frequently in Lynch Syndrome compared with sporadic microsatellite unstable colorectal cancers.

Science.gov (United States)

Fennell, Lochlan J; Clendenning, Mark; McKeone, Diane M; Jamieson, Saara H; Balachandran, Samanthy; Borowsky, Jennifer; Liu, John; Kawamata, Futoshi; Bond, Catherine E; Rosty, Christophe; Burge, Matthew E; Buchanan, Daniel D; Leggett, Barbara A; Whitehall, Vicki L J

2018-01-01

The WNT signaling pathway is commonly altered during colorectal cancer development. The E3 ubiquitin ligase, RNF43, negatively regulates the WNT signal through increased ubiquitination and subsequent degradation of the Frizzled receptor. RNF43 has recently been reported to harbor frequent truncating frameshift mutations in sporadic microsatellite unstable (MSI) colorectal cancers. This study assesses the relative frequency of RNF43 mutations in hereditary colorectal cancers arising in the setting of Lynch syndrome. The entire coding region of RNF43 was Sanger sequenced in 24 colorectal cancers from 23 patients who either (i) carried a germline mutation in one of the DNA mismatch repair genes (MLH1, MSH6, MSH2, PMS2), or (ii) showed immunohistochemical loss of expression of one or more of the DNA mismatch repair proteins, was BRAF wild type at V600E, were under 60 years of age at diagnosis, and demonstrated no promoter region methylation for MLH1 in tumor DNA. A validation cohort of 44 colorectal cancers from mismatch repair germline mutation carriers from the Australasian Colorectal Cancer Family Registry (ACCFR) were sequenced for the most common truncating mutation hotspots (X117 and X659). RNF43 mutations were found in 9 of 24 (37.5%) Lynch syndrome colorectal cancers. The majority of mutations were frameshift deletions in the G659 G7 repeat tract (29%); 2 cancers (2/24, 8%) from the one patient harbored frameshift mutations at codon R117 (C6 repeat tract) within exon 3. In the ACCFR validation cohort, RNF43 hotspot mutations were identified in 19/44 (43.2%) of samples, which was not significantly different to the initial series. The proportion of mutant RNF43 in Lynch syndrome related colorectal cancers is significantly lower than the previously reported mutation rate found in sporadic MSI colorectal cancers. These findings identify further genetic differences between sporadic and hereditary colorectal cancers. This may be because Lynch Syndrome cancers

Fusion events lead to truncation of FOS in epithelioid hemangioma of bone

DEFF Research Database (Denmark)

van IJzendoorn, David G P; de Jong, Danielle; Romagosa, Cleofe

2015-01-01

in exon 4 of the FOS gene and the fusion event led to the introduction of a stop codon. In all instances, the truncation of the FOS gene would result in the loss of the transactivation domain (TAD). Using FISH probes we found a break in the FOS gene in two additional cases, in none of these cases...... differential diagnosis of vascular tumors of bone. Our data suggest that the translocation causes truncation of the FOS protein, with loss of the TAD, which is thereby a novel mechanism involved in tumorigenesis....

Truncated Groebner fans and lattice ideals

OpenAIRE

Lauritzen, Niels

2005-01-01

We outline a generalization of the Groebner fan of a homogeneous ideal with maximal cells parametrizing truncated Groebner bases. This "truncated" Groebner fan is usually much smaller than the full Groebner fan and offers the natural framework for conversion between truncated Groebner bases. The generic Groebner walk generalizes naturally to this setting by using the Buchberger algorithm with truncation on facets. We specialize to the setting of lattice ideals. Here facets along the generic w...

Surfactant protein B deficiency and gene mutations for neonatal respiratory distress syndrome in China Han ethnic population

Science.gov (United States)

Yin, Xiaojuan; Meng, Fanping; wang, Yan; Xie, Lu; Kong, Xiangyong; Feng, Zhichun

2013-01-01

Objective: To determine whether the SP-B deficiency and gene mutations in exon 4 is associated with neonatal RDS in China Han ethnic population. Methods: The study population consisted of 40 neonates with RDS and 40 neonates with other diseases as control in China Han ethnic population. We Compared SP-B expression in lung tissue and bronchoalveolar lavage fluid with immunoblotting, and analyzed mutations in the SP-B gene with polymerase chain reaction (PCR) and gene sequencing. Results: In RDS group, low mature Surfactant protein B was found in both lung tissue and bronchoalveolar lavage fluid in 8 neonates. In control group, only 4 neonates with low mature Surfactant protein B in both lung tissue and bronchoalveolar lavage fluid. In RDS group, 20 neonates were found to have mutations in exon 4, 12 homozygous mutations with C/C genotype and 8 heterozygous mutations with C/T genotype in surfactant protein B gene+1580 polymorphism. There were 8 cases mutations in control group, 1 in C/C and 7 in C/T genotype. The frequency of homozygotes with C/C genotype was 0.3 and frequency of heterozygotes with C/T genotype was 0.02 in RDS group. In control group, frequency of homozygotes with C/C genotype was 0.025 and frequency of heterozygote with C/T genotype was 0.175. Conclusion: Low mature Surfactant protein B is associated with the pathogenesis of neonatal respiratory distress syndrome (RDS) in China Han ethnic population. Mutations in exon 4 of the surfactant protein B gene demonstrate an association between homozygous mutations with C/C genotype in SP-B gene and neonatal RDS. PMID:23330012

A single mutation in the envelope protein modulates flavivirus antigenicity, stability, and pathogenesis.

Directory of Open Access Journals (Sweden)

Leslie Goo

2017-02-01

Full Text Available The structural flexibility or 'breathing' of the envelope (E protein of flaviviruses allows virions to sample an ensemble of conformations at equilibrium. The molecular basis and functional consequences of virus conformational dynamics are poorly understood. Here, we identified a single mutation at residue 198 (T198F of the West Nile virus (WNV E protein domain I-II hinge that regulates virus breathing. The T198F mutation resulted in a ~70-fold increase in sensitivity to neutralization by a monoclonal antibody targeting a cryptic epitope in the fusion loop. Increased exposure of this otherwise poorly accessible fusion loop epitope was accompanied by reduced virus stability in solution at physiological temperatures. Introduction of a mutation at the analogous residue of dengue virus (DENV, but not Zika virus (ZIKV, E protein also increased accessibility of the cryptic fusion loop epitope and decreased virus stability in solution, suggesting that this residue modulates the structural ensembles sampled by distinct flaviviruses at equilibrium in a context dependent manner. Although the T198F mutation did not substantially impair WNV growth kinetics in vitro, studies in mice revealed attenuation of WNV T198F infection. Overall, our study provides insight into the molecular basis and the in vitro and in vivo consequences of flavivirus breathing.

Dermal fibroblasts in Hutchinson-Gilford progeria syndrome with the lamin A G608G mutation have dysmorphic nuclei and are hypersensitive to heat stress

Directory of Open Access Journals (Sweden)

Worman Howard J

2005-06-01

Full Text Available Abstract Background Hutchinson-Gilford progeria syndrome (HGPS, OMIM 176670 is a rare sporadic disorder with an incidence of approximately 1 per 8 million live births. The phenotypic appearance consists of short stature, sculptured nose, alopecia, prominent scalp veins, small face, loss of subcutaneous fat, faint mid-facial cyanosis, and dystrophic nails. HGPS is caused by mutations in LMNA, the gene that encodes nuclear lamins A and C. The most common mutation in subjects with HGPS is a de novo single-base pair substitution, G608G (GGC>GGT, within exon 11 of LMNA. This creates an abnormal splice donor site, leading to expression of a truncated protein. Results We studied a new case of a 5 year-old girl with HGPS and found a heterozygous point mutation, G608G, in LMNA. Complementary DNA sequencing of RNA showed that this mutation resulted in the deletion of 50 amino acids in the carboxyl-terminal tail domain of prelamin A. We characterized a primary dermal fibroblast cell line derived from the subject's skin. These cells expressed the mutant protein and exhibited a normal growth rate at early passage in primary culture but showed alterations in nuclear morphology. Expression levels and overall distributions of nuclear lamins and emerin, an integral protein of the inner nuclear membrane, were not dramatically altered. Ultrastructural analysis of the nuclear envelope using electron microscopy showed that chromatin is in close association to the nuclear lamina, even in areas with abnormal nuclear envelope morphology. The fibroblasts were hypersensitive to heat shock, and demonstrated a delayed response to heat stress. Conclusion Dermal fibroblasts from a subject with HGPS expressing a mutant truncated lamin A have dysmorphic nuclei, hypersensitivity to heat shock, and delayed response to heat stress. This suggests that the mutant protein, even when expressed at low levels, causes defective cell stability, which may be responsible for phenotypic

Investigation of selection methods im mutation breeding of barley for protein quantity and quality

International Nuclear Information System (INIS)

Ulonska, E.; Gaul, H.; Baumer, M.; Gesellschaft fuer Strahlen- und Umweltforschung m.b.H., Gruenbach

1975-01-01

This mutation breeding programme is investigating the qualification of micro-mutations for the selection of improved protein quality and quantity. Normally, improvement of protein content in micro-mutations is rather small. Therefore, it is important to develop methods and conditions of selection being (a) capable of measuring these small deviations in protein content and quality, and (b) simple to use. In two experiments carried out in 1971 and 1972 nitrogen fertilization was found to be the most important factor in the improvement of selection conditions. There is a highly significant negative correlation between crude protein content and the standard deviation; i.e. the higher the content of crude protein, the lower the variation coefficient. This in turn leads to an increase of genetic variation necessary for better selection progress. Nitrogen fertilization, especially during ear emergence, covers environmental influences - e.g., planting space, sowing rate, growing in different plots (6, 3, 2, 1 rows or in half-ear hills) - to a great extent. Thus, by applying high doses of nitrogen dressings comparable results can be achieved. In an overall selection experiment (testing the entire crossing and mutation material available at Weihenstephan in a stepwise selection from 1971 to 1973) and two selection experiments conducted in 1971 to 1973 with micro-mutants - variety Nota, 4 times X-rayed and the naked barley strain 1606 treated once with EMS - significant selection results were found. (author)

Novel germline MSH2 mutation in lynch syndrome patient surviving multiple cancers

Directory of Open Access Journals (Sweden)

Janavicius Ramunas

2012-01-01

Full Text Available Abstract Lynch syndrome (LS individuals are predisposed to a variety of cancers, most commonly colorectal, uterine, urinary tract, ovarian, small bowel, stomach and biliary tract cancers. The risk of extracolonic manifestations appears to be highest in MSH2 mutations carriers. We present a carrier case with a novel MSH2 gene mutation that clearly demonstrates the broad extent of LS phenotypic expression and highlights several important clinical aspects. Current evidence suggests that colorectal tumors from LS patients tend to have better prognoses than their sporadic counterparts, however survival benefits for other cancers encountered in LS are unclear. In this article we describe a family with a novel protein truncating mutation of c.2388delT in the MSH2 gene, particularly focusing on one individual carrier affected with multiple primary cancers who is surviving 25 years on. Our report of multiple primary tumors occurring in the 12-25 years interval might suggest these patients do not succumb to other extracolonic cancers, provided they are regularly followed-up.

Functional requirements of the yellow fever virus capsid protein.

Science.gov (United States)

Patkar, Chinmay G; Jones, Christopher T; Chang, Yu-hsuan; Warrier, Ranjit; Kuhn, Richard J

2007-06-01

Although it is known that the flavivirus capsid protein is essential for genome packaging and formation of infectious particles, the minimal requirements of the dimeric capsid protein for virus assembly/disassembly have not been characterized. By use of a trans-packaging system that involved packaging a yellow fever virus (YFV) replicon into pseudo-infectious particles by supplying the YFV structural proteins using a Sindbis virus helper construct, the functional elements within the YFV capsid protein (YFC) were characterized. Various N- and C-terminal truncations, internal deletions, and point mutations of YFC were analyzed for their ability to package the YFV replicon. Consistent with previous reports on the tick-borne encephalitis virus capsid protein, YFC demonstrates remarkable functional flexibility. Nearly 40 residues of YFC could be removed from the N terminus while the ability to package replicon RNA was retained. Additionally, YFC containing a deletion of approximately 27 residues of the C terminus, including a complete deletion of C-terminal helix 4, was functional. Internal deletions encompassing the internal hydrophobic sequence in YFC were, in general, tolerated to a lesser extent. Site-directed mutagenesis of helix 4 residues predicted to be involved in intermonomeric interactions were also analyzed, and although single mutations did not affect packaging, a YFC with the double mutation of leucine 81 and valine 88 was nonfunctional. The effects of mutations in YFC on the viability of YFV infection were also analyzed, and these results were similar to those obtained using the replicon packaging system, thus underscoring the flexibility of YFC with respect to the requirements for its functioning.

High-quality Thermodynamic Data on the Stability Changes of Proteins Upon Single-site Mutations

Energy Technology Data Exchange (ETDEWEB)

Pucci, Fabrizio, E-mail: fapucci@ulb.ac.be; Bourgeas, Raphaël, E-mail: rbourgeas@ulb.ac.be; Rooman, Marianne, E-mail: mrooman@ulb.ac.be [Department of BioModeling, BioInformatics and BioProcesses, Université Libre de Bruxelles, CP 165/61, Roosevelt Avenue 50, 1050 Brussels, Belgium and Interuniversity Institute of Bioinformatics in Brussels, CP 263, Triumph Bld, 1050 Brussels (Belgium)

2016-06-15

We have set up and manually curated a dataset containing experimental information on the impact of amino acid substitutions in a protein on its thermal stability. It consists of a repository of experimentally measured melting temperatures (T{sub m}) and their changes upon point mutations (ΔT{sub m}) for proteins having a well-resolved x-ray structure. This high-quality dataset is designed for being used for the training or benchmarking of in silico thermal stability prediction methods. It also reports other experimentally measured thermodynamic quantities when available, i.e., the folding enthalpy (ΔH) and heat capacity (ΔC{sub P}) of the wild type proteins and their changes upon mutations (ΔΔH and ΔΔC{sub P}), as well as the change in folding free energy (ΔΔG) at a reference temperature. These data are analyzed in view of improving our insights into the correlation between thermal and thermodynamic stabilities, the asymmetry between the number of stabilizing and destabilizing mutations, and the difference in stabilization potential of thermostable versus mesostable proteins.

The TIR domain of TIR-NB-LRR resistance proteins is a signaling domain involved in cell death induction.

Science.gov (United States)

Swiderski, Michal R; Birker, Doris; Jones, Jonathan D G

2009-02-01

In plants, the TIR (toll interleukin 1 receptor) domain is found almost exclusively in nucleotide-binding (NB) leucine-rich repeat resistance proteins and their truncated homologs, and has been proposed to play a signaling role during resistance responses mediated by TIR containing R proteins. Transient expression in Nicotiana benthamiana leaves of "TIR + 80", the RPS4 truncation without the NB-ARC domain, leads to EDS1-, SGT1-, and HSP90-dependent cell death. Transgenic Arabidopsis plants expressing the RPS4 TIR+80 from either dexamethasone or estradiol-inducible promoters display inducer-dependent cell death. Cell death is also elicited by transient expression of similarly truncated constructs from two other R proteins, RPP1A and At4g19530, but is not elicited by similar constructs representing RPP2A and RPP2B proteins. Site-directed mutagenesis of the RPS4 TIR domain identified many loss-of-function mutations but also revealed several gain-of function substitutions. Lack of cell death induction by the E160A substitution suggests that amino acids outside of the TIR domain contribute to cell death signaling in addition to the TIR domain itself. This is consistent with previous observations that the TIR domain itself is insufficient to induce cell death upon transient expression.

Identification of a nuclear localization signal in the retinitis pigmentosa-mutated RP26 protein, ceramide kinase-like protein

International Nuclear Information System (INIS)

Inagaki, Yuichi; Mitsutake, Susumu; Igarashi, Yasuyuki

2006-01-01

Retinitis pigmentosa (RP) is a genetically heterogeneous disease characterized by degeneration of the retina. A mutation in a new ceramide kinase (CERK) homologous gene, named CERK-like protein (CERKL), was found to cause autosomal recessive retinitis pigmentosa (RP26). Here, we show a point mutation of one of two putative nuclear localization signal (NLS) sequences inhibited the nuclear localization of the protein. Furthermore, the tetra-GFP-tagged NLS, which cannot passively enter the nucleus, was observed not only in the nucleus but also in the nucleolus. Our results provide First evidence of the active nuclear import of CERKL and suggest that the identified NLS might be responsible for nucleolar retention of the protein. As recent studies have shown other RP-related proteins are localized in the nucleus or the nucleolus, our identification of NLS in CERKL suggests that CERKL likely plays important roles for retinal functions in the nucleus and the nucleolus

Fibrillin mutations in the Marfan syndrome

Energy Technology Data Exchange (ETDEWEB)

Price, C.E.; Wang, M.; Wang, J.; Godfrey, M. [Univ. of Nebraska Medical Center, Omaha, NE (United States)

1994-09-01

The Marfan syndrome (MFS) is an autosomal dominant heritable disorder of connective tissue manifested by variable and pleiotropic defect in the skeletal, ocular, and cardiovascular systems. We have recently begun to use intron-specific primers that have become available through the International Marfan Syndrome Consortium to screen for fibrillin mutations in MFS patients. Using the genomic PCR-based approach in addition to RT-PCR methodologies, we have identified several novel mutations. A single base insertion was identified in all affected individuals of one family. The insertion of an {open_quote}A{close_quote} at position 1891 in exon 15 causes a premature stop codon and thus a truncated polypeptide. The truncated protein of 617 amino acids has an expected molecular weight of 63 kD. Metabolic labeling and immunoprecipitation studies are in progress. A C{r_arrow}T transition at position 1634 in exon 12 causing a 5th position Cys to Phe substitution in an EGF-like motif was observed in another MFS patient. Finally, we have identified a G{r_arrow}A transition at the +1 position of the donor splice site that causes the deletion of fibrillin exon 32 in a patient with the neonatal form of MFS. Exon 32 is a precursor EGF-like calcium binding motif that is located in a single stretch of 12 similar domains. We had previously identified the skipping of this exon due to an A{r_arrow}T transversion at the -2 position of the consensus acceptor splice site in another patient with neonatal MFS. The reason that the skipping of exon 32 causes a neonatal lethal MFS phenotype is presently unclear. These studies will help elucidate the role of diverse regions of fibrillin.

Association of Mismatch Repair Mutation With Age at Cancer Onset in Lynch Syndrome: Implications for Stratified Surveillance Strategies.

Science.gov (United States)

Ryan, Neil A J; Morris, Julie; Green, Kate; Lalloo, Fiona; Woodward, Emma R; Hill, James; Crosbie, Emma J; Evans, D Gareth

2017-12-01

Lynch syndrome is caused by dominantly inherited germline mutations that predispose individuals to colorectal, endometrial, ovarian, and other cancers through inactivation of the cellular mismatch repair system. Lynch syndrome–associated cancers are amenable to surveillance strategies that may improve survival. The age at which surveillance should start is disputed. To determine whether mutated gene and type of mutation influence age at onset of Lynch syndrome–associated cancers. A retrospective cohort study of individuals with Lynch syndrome–associated colorectal, endometrial, and/or ovarian cancers whose medical records were included in the clinical database of a large quaternary referral center for genomic medicine in the Northwest of England. Mutated gene (MLH1, MSH2, MSH6, and/or PMS2) and type of mutation (truncating, splicing, or large rearrangement). Age at cancer diagnosis. A total of 1063 individuals with proven Lynch syndrome were included, 495 male and 568 female (mean age 52 years; age range, 10-93 years [children were included in the database, but no children developed cancer]). There were 546 men and women with colorectal cancer, 162 women with endometrial cancer, and 49 women with ovarian cancer; mean follow-up was 68.2 months. Among MLH1 mutation carriers, mutations in MLH1 were associated with colorectal cancer in 249 (61%) of 409 men and women; endometrial cancer in 53 of 196 (27%) women; and ovarian cancer in 15 (8%) of 196 women. Among MSH2 mutation carriers, mutations in MSH2 (the most prevalent mutations overall) were most commonly associated with female-specific cancers: endometrial cancer in 83 (30%) of 279 women; ovarian cancer in 28 (10%) of 279 women; and colorectal cancer in 239 (50%) 479 men and women. Mutations in MSH6 were less prevalent, and MSH6 mutation carriers presented with colorectal and endometrial cancer at later ages than carriers of mutations in MSH2 or MLH1. When stratified by mutation type, women with truncating

Statistical estimation for truncated exponential families

CERN Document Server

Akahira, Masafumi

2017-01-01

This book presents new findings on nonregular statistical estimation. Unlike other books on this topic, its major emphasis is on helping readers understand the meaning and implications of both regularity and irregularity through a certain family of distributions. In particular, it focuses on a truncated exponential family of distributions with a natural parameter and truncation parameter as a typical nonregular family. This focus includes the (truncated) Pareto distribution, which is widely used in various fields such as finance, physics, hydrology, geology, astronomy, and other disciplines. The family is essential in that it links both regular and nonregular distributions, as it becomes a regular exponential family if the truncation parameter is known. The emphasis is on presenting new results on the maximum likelihood estimation of a natural parameter or truncation parameter if one of them is a nuisance parameter. In order to obtain more information on the truncation, the Bayesian approach is also considere...

NLO renormalization in the Hamiltonian truncation

Science.gov (United States)

Elias-Miró, Joan; Rychkov, Slava; Vitale, Lorenzo G.

2017-09-01

Hamiltonian truncation (also known as "truncated spectrum approach") is a numerical technique for solving strongly coupled quantum field theories, in which the full Hilbert space is truncated to a finite-dimensional low-energy subspace. The accuracy of the method is limited only by the available computational resources. The renormalization program improves the accuracy by carefully integrating out the high-energy states, instead of truncating them away. In this paper, we develop the most accurate ever variant of Hamiltonian Truncation, which implements renormalization at the cubic order in the interaction strength. The novel idea is to interpret the renormalization procedure as a result of integrating out exactly a certain class of high-energy "tail states." We demonstrate the power of the method with high-accuracy computations in the strongly coupled two-dimensional quartic scalar theory and benchmark it against other existing approaches. Our work will also be useful for the future goal of extending Hamiltonian truncation to higher spacetime dimensions.

The BAG3 gene variants in Polish patients with dilated cardiomyopathy: four novel mutations and a genotype-phenotype correlation.

Science.gov (United States)

Franaszczyk, Maria; Bilinska, Zofia T; Sobieszczańska-Małek, Małgorzata; Michalak, Ewa; Sleszycka, Justyna; Sioma, Agnieszka; Małek, Łukasz A; Kaczmarska, Dorota; Walczak, Ewa; Włodarski, Paweł; Hutnik, Łukasz; Milanowska, Blanka; Dzielinska, Zofia; Religa, Grzegorz; Grzybowski, Jacek; Zieliński, Tomasz; Ploski, Rafal

2014-07-09

BAG3 gene mutations have been recently implicated as a novel cause of dilated cardiomyopathy (DCM). Our aim was to evaluate the prevalence of BAG3 mutations in Polish patients with DCM and to search for genotype-phenotype correlations. We studied 90 unrelated probands by direct sequencing of BAG3 exons and splice sites. Large deletions/insertions were screened for by quantitative real time polymerase chain reaction (qPCR). We found 5 different mutations in 6 probands and a total of 21 mutations among their relatives: the known p.Glu455Lys mutation (2 families), 4 novel mutations: p.Gln353ArgfsX10 (c.1055delC), p.Gly379AlafsX45 (c.1135delG), p.Tyr451X (c.1353C>A) and a large deletion of 17,990 bp removing BAG3 exons 3-4. Analysis of mutation positive relatives of the probands from this study pooled with those previously reported showed higher DCM prevalence among those with missense vs. truncating mutations (OR = 8.33, P = 0.0058) as well as a difference in age at disease onset between the former and the latter in Kaplan-Meier survival analysis (P = 0.006). Clinical data from our study suggested that in BAG3 mutation carriers acute onset DCM with hemodynamic compromise may be triggered by infection. BAG3 point mutations and large deletions are relatively frequent cause of DCM. Delayed DCM onset associated with truncating vs. non-truncating mutations may be important for genetic counseling.

Germline PMS2 mutation screened by mismatch repair protein immunohistochemistry of colorectal cancer in Japan.

Science.gov (United States)

Sugano, Kokichi; Nakajima, Takeshi; Sekine, Shigeki; Taniguchi, Hirokazu; Saito, Shinya; Takahashi, Masahiro; Ushiama, Mineko; Sakamoto, Hiromi; Yoshida, Teruhiko

2016-11-01

Germline PMS2 gene mutations were detected by RT-PCR/direct sequencing of total RNA extracted from puromycin-treated peripheral blood lymphocytes (PBL) and multiplex ligation-dependent probe amplification (MLPA) analyses of Japanese patients with colorectal cancer (CRC) fulfilling either the revised Bethesda Guidelines or being an age at disease onset of younger than 70 years, and screened by mismatch repair protein immunohistochemistry of formalin-fixed paraffin embedded sections. Of the 501 subjects examined, 7 (1.40%) showed the downregulated expression of the PMS2 protein alone and were referred to the genetic counseling clinic. Germline PMS2 mutations were detected in 6 (85.7%), including 3 nonsense and 1 frameshift mutations by RT-PCR/direct sequencing and 2 genomic deletions by MLPA. No mutations were identified in the other MMR genes (i.e. MSH2, MLH1 and MSH6). The prevalence of the downregulated expression of the PMS2 protein alone was 1.40% among the subjects examined and IHC results predicted the presence of PMS2 germline mutations. RT-PCR from puromycin-treated PBL and MLPA may be employed as the first screening step to detect PMS2 mutations without pseudogene interference, followed by the long-range PCR/nested PCR validation using genomic DNA. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

A Mutation in PGM2 Causing Inefficient Galactose Metabolism in the Probiotic Yeast Saccharomyces boulardii.

Science.gov (United States)

Liu, Jing-Jing; Zhang, Guo-Chang; Kong, In Iok; Yun, Eun Ju; Zheng, Jia-Qi; Kweon, Dae-Hyuk; Jin, Yong-Su

2018-05-15

The probiotic yeast Saccharomyces boulardii has been extensively studied for the prevention and treatment of diarrheal diseases, and it is now commercially available in some countries. S. boulardii displays notable phenotypic characteristics, such as a high optimal growth temperature, high tolerance against acidic conditions, and the inability to form ascospores, which differentiate S. boulardii from Saccharomyces cerevisiae The majority of prior studies stated that S. boulardii exhibits sluggish or halted galactose utilization. Nonetheless, the molecular mechanisms underlying inefficient galactose uptake have yet to be elucidated. When the galactose utilization of a widely used S. boulardii strain, ATCC MYA-796, was examined under various culture conditions, the S. boulardii strain could consume galactose, but at a much lower rate than that of S. cerevisiae While all GAL genes were present in the S. boulardii genome, according to analysis of genomic sequencing data in a previous study, a point mutation (G1278A) in PGM2 , which codes for phosphoglucomutase, was identified in the genome of the S. boulardii strain. As the point mutation resulted in the truncation of the Pgm2 protein, which is known to play a pivotal role in galactose utilization, we hypothesized that the truncated Pgm2 might be associated with inefficient galactose metabolism. Indeed, complementation of S. cerevisiae PGM2 in S. boulardii restored galactose utilization. After reverting the point mutation to a full-length PGM2 in S. boulardii by Cas9-based genome editing, the growth rates of wild-type (with a truncated PGM2 gene) and mutant (with a full-length PGM2 ) strains with glucose or galactose as the carbon source were examined. As expected, the mutant (with a full-length PGM2 ) was able to ferment galactose faster than the wild-type strain. Interestingly, the mutant showed a lower growth rate than that of the wild-type strain on glucose at 37°C. Also, the wild-type strain was enriched in the

Mutation analysis of inhibitory guanine nucleotide binding protein alpha (GNAI) loci in young and familial pituitary adenomas.

Science.gov (United States)

Demir, Hande; Donner, Iikki; Kivipelto, Leena; Kuismin, Outi; Schalin-Jäntti, Camilla; De Menis, Ernesto; Karhu, Auli

2014-01-01

Pituitary adenomas are neoplasms of the anterior pituitary lobe and account for 15-20% of all intracranial tumors. Although most pituitary tumors are benign they can cause severe symptoms related to tumor size as well as hypopituitarism and/or hypersecretion of one or more pituitary hormones. Most pituitary adenomas are sporadic, but it has been estimated that 5% of patients have a familial background. Germline mutations of the tumor suppressor gene aryl hydrocarbon receptor-interacting protein (AIP) predispose to hereditary pituitary neoplasia. Recently, it has been demonstrated that AIP mutations predispose to pituitary tumorigenesis through defective inhibitory GTP binding protein (Gαi) signaling. This finding prompted us to examine whether germline loss-of-function mutations in inhibitory guanine nucleotide (GTP) binding protein alpha (GNAI) loci are involved in genetic predisposition of pituitary tumors. To our knowledge, this is the first time GNAI genes are sequenced in order to examine the occurrence of inactivating germline mutations. Thus far, only somatic gain-of-function hot-spot mutations have been studied in these loci. Here, we have analyzed the coding regions of GNAI1, GNAI2, and GNAI3 in a set of young sporadic somatotropinoma patients (n = 32; mean age of diagnosis 32 years) and familial index cases (n = 14), thus in patients with a disease phenotype similar to that observed in AIP mutation carriers. In addition, expression of Gαi proteins was studied in human growth hormone (GH), prolactin (PRL), adrenocorticotropic hormone (ACTH)-secreting and non-functional pituitary tumors. No pathogenic germline mutations affecting the Gαi proteins were detected. The result suggests that loss-of-function mutations of GNAI loci are rare or nonexistent in familial pituitary adenomas.

Single-Point Mutation with a Rotamer Library Toolkit: Toward Protein Engineering.

Science.gov (United States)

Pottel, Joshua; Moitessier, Nicolas

2015-12-28

Protein engineers have long been hard at work to harness biocatalysts as a natural source of regio-, stereo-, and chemoselectivity in order to carry out chemistry (reactions and/or substrates) not previously achieved with these enzymes. The extreme labor demands and exponential number of mutation combinations have induced computational advances in this domain. The first step in our virtual approach is to predict the correct conformations upon mutation of residues (i.e., rebuilding side chains). For this purpose, we opted for a combination of molecular mechanics and statistical data. In this work, we have developed automated computational tools to extract protein structural information and created conformational libraries for each amino acid dependent on a variable number of parameters (e.g., resolution, flexibility, secondary structure). We have also developed the necessary tool to apply the mutation and optimize the conformation accordingly. For side-chain conformation prediction, we obtained overall average root-mean-square deviations (RMSDs) of 0.91 and 1.01 Å for the 18 flexible natural amino acids within two distinct sets of over 3000 and 1500 side-chain residues, respectively. The commonly used dihedral angle differences were also evaluated and performed worse than the state of the art. These two metrics are also compared. Furthermore, we generated a family-specific library for kinases that produced an average 2% lower RMSD upon side-chain reconstruction and a residue-specific library that yielded a 17% improvement. Ultimately, since our protein engineering outlook involves using our docking software, Fitted/Impacts, we applied our mutation protocol to a benchmarked data set for self- and cross-docking. Our side-chain reconstruction does not hinder our docking software, demonstrating differences in pose prediction accuracy of approximately 2% (RMSD cutoff metric) for a set of over 200 protein/ligand structures. Similarly, when docking to a set of over 100

A duchenne muscular dystrophy gene hot spot mutation in dystrophin-deficient cavalier king charles spaniels is amenable to exon 51 skipping.

Directory of Open Access Journals (Sweden)

Gemma L Walmsley

2010-01-01

Full Text Available Duchenne muscular dystrophy (DMD, which afflicts 1 in 3500 boys, is one of the most common genetic disorders of children. This fatal degenerative condition is caused by an absence or deficiency of dystrophin in striated muscle. Most affected patients have inherited or spontaneous deletions in the dystrophin gene that disrupt the reading frame resulting in unstable truncated products. For these patients, restoration of the reading frame via antisense oligonucleotide-mediated exon skipping is a promising therapeutic approach. The major DMD deletion "hot spot" is found between exons 45 and 53, and skipping exon 51 in particular is predicted to ameliorate the dystrophic phenotype in the greatest number of patients. Currently the mdx mouse is the most widely used animal model of DMD, although its mild phenotype limits its suitability in clinical trials. The Golden Retriever muscular dystrophy (GRMD model has a severe phenotype, but due to its large size, is expensive to use. Both these models have mutations in regions of the dystrophin gene distant from the commonly mutated DMD "hot spot".Here we describe the severe phenotype, histopathological findings, and molecular analysis of Cavalier King Charles Spaniels with dystrophin-deficient muscular dystrophy (CKCS-MD. The dogs harbour a missense mutation in the 5' donor splice site of exon 50 that results in deletion of exon 50 in mRNA transcripts and a predicted premature truncation of the translated protein. Antisense oligonucleotide-mediated skipping of exon 51 in cultured myoblasts from an affected dog restored the reading frame and protein expression.Given the small size of the breed, the amiable temperament and the nature of the mutation, we propose that CKCS-MD is a valuable new model for clinical trials of antisense oligonucleotide-induced exon skipping and other therapeutic approaches for DMD.

Mutations in iron-sulfur cluster proteins that improve xylose utilization

Science.gov (United States)

Froehlich, Allan; Henningsen, Brooks; Covalla, Sean; Zelle, Rintze M.

2018-03-20

There is provided an engineered host cells comprising (a) one or more mutations in one or more endogenous genes encoding a protein associated with iron metabolism; and (b) at least one gene encoding a polypeptide having xylose isomerase activity, and methods of their use thereof.

Progranulin modulates zebrafish motoneuron development in vivo and rescues truncation defects associated with knockdown of Survival motor neuron 1

Directory of Open Access Journals (Sweden)

Bateman Andrew

2010-10-01

Full Text Available Abstract Background Progranulin (PGRN encoded by the GRN gene, is a secreted glycoprotein growth factor that has been implicated in many physiological and pathophysiological processes. PGRN haploinsufficiency caused by autosomal dominant mutations within the GRN gene leads to progressive neuronal atrophy in the form of frontotemporal lobar degeneration (FTLD. This form of the disease is associated with neuronal inclusions that bear the ubiquitinated TAR DNA Binding Protein-43 (TDP-43 molecular signature (FTLD-U. The neurotrophic properties of PGRN in vitro have recently been reported but the role of PGRN in neurons is not well understood. Here we document the neuronal expression and functions of PGRN in spinal cord motoneuron (MN maturation and branching in vivo using zebrafish, a well established model of vertebrate embryonic development. Results Whole-mount in situ hybridization and immunohistochemical analyses of zebrafish embryos revealed that zfPGRN-A is expressed within the peripheral and central nervous systems including the caudal primary (CaP MNs within the spinal cord. Knockdown of zfPGRN-A mRNA translation mediated by antisense morpholino oligonucleotides disrupted normal CaP MN development resulting in both truncated MNs and inappropriate early branching. Ectopic over-expression of zfPGRN-A mRNA resulted in increased MN branching and rescued the truncation defects brought about by knockdown of zfPGRN-A expression. The ability of PGRN to interact with established MN developmental pathways was tested. PGRN over-expression was found to reverse the truncation defect resulting from knockdown of Survival of motor neuron 1 (smn1. This is involved in small ribonucleoprotein biogenesis RNA processing, mutations of which cause Spinal Muscular Atrophy (SMA in humans. It did not reverse the MN defects caused by interfering with the neuronal guidance pathway by knockdown of expression of NRP-1, a semaphorin co-receptor. Conclusions Expression of

Novel autosomal dominant TNNT1 mutation causing nemaline myopathy.

Science.gov (United States)

Konersman, Chamindra G; Freyermuth, Fernande; Winder, Thomas L; Lawlor, Michael W; Lagier-Tourenne, Clotilde; Patel, Shailendra B

2017-11-01

Nemaline myopathy (NEM) is one of the three major forms of congenital myopathy and is characterized by diffuse muscle weakness, hypotonia, respiratory insufficiency, and the presence of nemaline rod structures on muscle biopsy. Mutations in troponin T1 (TNNT1) is 1 of 10 genes known to cause NEM. To date, only homozygous nonsense mutations or compound heterozygous truncating or internal deletion mutations in TNNT1 gene have been identified in NEM. This extended family is of historical importance as some members were reported in the 1960s as initial evidence that NEM is a hereditary disorder. Proband and extended family underwent Sanger sequencing for TNNT1. We performed RT-PCR and immunoblot on muscle to assess TNNT1 RNA expression and protein levels in proband and father. We report a novel heterozygous missense mutation of TNNT1 c.311A>T (p.E104V) that segregated in an autosomal dominant fashion in a large family residing in the United States. Extensive sequencing of the other known genes for NEM failed to identify any other mutant alleles. Muscle biopsies revealed a characteristic pattern of nemaline rods and severe myofiber hypotrophy that was almost entirely restricted to the type 1 fiber population. This novel mutation alters a residue that is highly conserved among vertebrates. This report highlights not only a family with autosomal dominant inheritance of NEM, but that this novel mutation likely acts via a dominant negative mechanism. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Stability of Slopes Reinforced with Truncated Piles

Directory of Open Access Journals (Sweden)

Shu-Wei Sun

2016-01-01

Full Text Available Piles are extensively used as a means of slope stabilization. A novel engineering technique of truncated piles that are unlike traditional piles is introduced in this paper. A simplified numerical method is proposed to analyze the stability of slopes stabilized with truncated piles based on the shear strength reduction method. The influential factors, which include pile diameter, pile spacing, depth of truncation, and existence of a weak layer, are systematically investigated from a practical point of view. The results show that an optimum ratio exists between the depth of truncation and the pile length above a slip surface, below which truncating behavior has no influence on the piled slope stability. This optimum ratio is bigger for slopes stabilized with more flexible piles and piles with larger spacing. Besides, truncated piles are more suitable for slopes with a thin weak layer than homogenous slopes. In practical engineering, the piles could be truncated reasonably while ensuring the reinforcement effect. The truncated part of piles can be filled with the surrounding soil and compacted to reduce costs by using fewer materials.

Novel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.

Science.gov (United States)

Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

2015-03-15

Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein

Novel CREB3L3 Nonsense Mutation in a Family With Dominant Hypertriglyceridemia.

Science.gov (United States)

Cefalù, Angelo B; Spina, Rossella; Noto, Davide; Valenti, Vincenza; Ingrassia, Valeria; Giammanco, Antonina; Panno, Maria D; Ganci, Antonina; Barbagallo, Carlo M; Averna, Maurizio R

2015-12-01

Cyclic AMP responsive element-binding protein 3-like 3 (CREB3L3) is a novel candidate gene for dominant hypertriglyceridemia. To date, only 4 kindred with dominant hypertriglyceridemia have been found to be carriers of 2 nonsense mutations in CREB3L3 gene (245fs and W46X). We investigated a family in which hypertriglyceridemia displayed an autosomal dominant pattern of inheritance. The proband was a 49-year-old woman with high plasma triglycerides (≤1300 mg/dL; 14.68 mmol/L). Her father had a history of moderate hypertriglyceridemia, and her 51-year-old brother had triglycerides levels as high as 1600 mg/dL (18.06 mmol/L). To identify the causal mutation in this family, we analyzed the candidate genes of recessive and dominant forms of primary hypertriglyceridemia by direct sequencing. The sequencing of CREB3L3 gene led to the discovery of a novel minute frame shift mutation in exon 3 of CREB3L3 gene, predicted to result in the formation of a truncated protein devoid of function (c.359delG-p.K120fsX20). Heterozygosity for the c.359delG mutation resulted in a severe phenotype occurring later in life in the proband and her brother and a good response to diet and a hypotriglyceridemic treatment. The same mutation was detected in a 13-year-old daughter who to date is normotriglyceridemic. We have identified a novel pathogenic mutation in CREB3L3 gene in a family with dominant hypertriglyceridemia with a variable pattern of penetrance. © 2015 American Heart Association, Inc.

Newly identified CHO ERCC3/XPB mutations and phenotype characterization

Science.gov (United States)

Rybanská, Ivana; Gurský, Ján; Fašková, Miriam; Salazar, Edmund P.; Kimlíčková-Polakovičová, Erika; Kleibl, Karol; Thompson, Larry H.; Piršel, Miroslav

2010-01-01

Nucleotide excision repair (NER) is a complex multistage process involving many interacting gene products to repair a wide range of DNA lesions. Genetic defects in NER cause human hereditary diseases including xeroderma pigmentosum (XP), Cockayne syndrome (CS), trichothiodystrophy and a combined XP/CS overlapping symptom. One key gene product associated with all these disorders is the excision repair cross-complementing 3/xeroderma pigmentosum B (ERCC3/XPB) DNA helicase, a subunit of the transcription factor IIH complex. ERCC3 is involved in initiation of basal transcription and global genome repair as well as in transcription-coupled repair (TCR). The hamster ERCC3 gene shows high degree of homology with the human ERCC3/XPB gene. We identified new mutations in the Chinese hamster ovary cell ERCC3 gene and characterized the role of hamster ERCC3 protein in DNA repair of ultraviolet (UV)-induced and oxidative DNA damage. All but one newly described mutations are located in the protein C-terminal region around the last intron–exon boundary. Due to protein truncations or frameshifts, they lack amino acid Ser751, phosphorylation of which prevents the 5′ incision of the UV-induced lesion during NER. Thus, despite the various locations of the mutations, their phenotypes are similar. All ercc3 mutants are extremely sensitive to UV-C light and lack recovery of RNA synthesis (RRS), confirming a defect in TCR of UV-induced damage. Their limited global genome NER capacity averages ∼8%. We detected modest sensitivity of ercc3 mutants to the photosensitizer Ro19-8022, which primarily introduces 8-oxoguanine lesions into DNA. Ro19-8022-induced damage interfered with RRS, and some of the ercc3 mutants had delayed kinetics. All ercc3 mutants showed efficient base excision repair (BER). Thus, the positions of the mutations have no effect on the sensitivity to, and repair of, Ro19-8022-induced DNA damage, suggesting that the ERCC3 protein is not involved in BER. PMID:19942596

Charge neutralization as the major factor for the assembly of nucleocapsid-like particles from C-terminal truncated hepatitis C virus core protein.

Science.gov (United States)

de Souza, Theo Luiz Ferraz; de Lima, Sheila Maria Barbosa; Braga, Vanessa L de Azevedo; Peabody, David S; Ferreira, Davis Fernandes; Bianconi, M Lucia; Gomes, Andre Marco de Oliveira; Silva, Jerson Lima; de Oliveira, Andréa Cheble

2016-01-01

Hepatitis C virus (HCV) core protein, in addition to its structural role to form the nucleocapsid assembly, plays a critical role in HCV pathogenesis by interfering in several cellular processes, including microRNA and mRNA homeostasis. The C-terminal truncated HCV core protein (C124) is intrinsically unstructured in solution and is able to interact with unspecific nucleic acids, in the micromolar range, and to assemble into nucleocapsid-like particles (NLPs) in vitro . The specificity and propensity of C124 to the assembly and its implications on HCV pathogenesis are not well understood. Spectroscopic techniques, transmission electron microscopy and calorimetry were used to better understand the propensity of C124 to fold or to multimerize into NLPs when subjected to different conditions or in the presence of unspecific nucleic acids of equivalent size to cellular microRNAs. The structural analysis indicated that C124 has low propensity to self-folding. On the other hand, for the first time, we show that C124, in the absence of nucleic acids, multimerizes into empty NLPs when subjected to a pH close to its isoelectric point (pH ≈ 12), indicating that assembly is mainly driven by charge neutralization. Isothermal calorimetry data showed that the assembly of NLPs promoted by nucleic acids is enthalpy driven. Additionally, data obtained from fluorescence correlation spectroscopy show that C124, in nanomolar range, was able to interact and to sequester a large number of short unspecific nucleic acids into NLPs. Together, our data showed that the charge neutralization is the major factor for the nucleocapsid-like particles assembly from C-terminal truncated HCV core protein. This finding suggests that HCV core protein may physically interact with unspecific cellular polyanions, which may correspond to microRNAs and mRNAs in a host cell infected by HCV, triggering their confinement into infectious particles.

Missense mutation in the USH2A gene: association with recessive retinitis pigmentosa without hearing loss.

Science.gov (United States)

Rivolta, C; Sweklo, E A; Berson, E L; Dryja, T P

2000-06-01

Microdeletions Glu767(1-bp del), Thr967(1-bp del), and Leu1446(2-bp del) in the human USH2A gene have been reported to cause Usher syndrome type II, a disorder characterized by retinitis pigmentosa (RP) and mild-to-severe hearing loss. Each of these three frameshift mutations is predicted to lead to an unstable mRNA transcript that, if translated, would result in a truncated protein lacking the carboxy terminus. Here, we report Cys759Phe, a novel missense mutation in this gene that changes an amino-acid residue within the fifth laminin-epidermal growth factor-like domain of the USH2A gene and that is associated with recessive RP without hearing loss. This single mutation was found in 4.5% of 224 patients with recessive RP, suggesting that USH2A could cause more cases of nonsyndromic recessive RP than does any other gene identified to date.

Immunohistochemical null-phenotype for mismatch repair proteins in colonic carcinoma associated with concurrent MLH1 hypermethylation and MSH2 somatic mutations.

Science.gov (United States)

Wang, Tao; Stadler, Zsofia K; Zhang, Liying; Weiser, Martin R; Basturk, Olca; Hechtman, Jaclyn F; Vakiani, Efsevia; Saltz, Lenard B; Klimstra, David S; Shia, Jinru

2018-04-01

Microsatellite instability, a well-established driver pathway in colorectal carcinogenesis, can develop in both sporadic and hereditary conditions via different molecular alterations in the DNA mismatch repair (MMR) genes. MMR protein immunohistochemistry (IHC) is currently widely used for the detection of MMR deficiency in solid tumors. The IHC test, however, can show varied staining patterns, posing challenges in the interpretation of the staining results in some cases. Here we report a case of an 80-year-old female with a colonic adenocarcinoma that exhibited an unusual "null" IHC staining pattern with complete loss of all four MMR proteins (MLH1, MSH2, MSH6, and PMS2). This led to subsequent MLH1 methylation testing and next generation sequencing which demonstrated that the loss of all MMR proteins was associated with concurrent promoter hypermethylation of MLH1 and double somatic truncating mutations in MSH2. These molecular findings, in conjunction with the patient's age being 80 years and the fact that the patient had no personal or family cancer history, indicated that the MMR deficiency was highly likely sporadic in nature. Thus, the stringent Lynch syndrome type surveillance programs were not recommended to the patient and her family members. This case illustrates a rare but important scenario where a null IHC phenotype signifies complex underlying molecular alternations that bear clinical management implications, highlighting the need for recognition and awareness of such unusual IHC staining patterns.

A phosphatase-independent gain-of-function mutation in PTEN triggers aberrant cell growth in astrocytes through an autocrine IGF-1 loop.

Science.gov (United States)

Fernández, S; Genis, L; Torres-Alemán, I

2014-08-07

Loss-of-function mutations in the phosphatase PTEN (phosphatase and tensin homolog deleted on chromosome10) contribute to aberrant cell growth in part through upregulation of the mitogenic IGF-1/PI3K/Akt pathway. In turn, this pathway exerts a homeostatic feedback over PTEN. Using mutagenesis analysis to explore a possible impact of this mutual control on astrocyte growth, we found that truncation of the C-terminal region of PTEN (Δ51) associates with a marked increase in NFκB activity, a transcription factor overactivated in astrocyte tumors. Whereas mutations of PTEN are considered to lead to a loss-of-function, PTENΔ51, a truncation that comprises a region frequently mutated in human gliomas, displayed a neomorphic (gain-of-function) activity that was independent of its phosphatase activity. This gain-of-function of PTENΔ51 includes stimulation of IGF-1 synthesis through protein kinase A activation of the IGF-1 promoter. Increased IGF-1 originates an autocrine loop that activates Akt and NFκB. Constitutive activation of NFκB in PTENΔ51-expressing astrocytes leads to aberrant cell growth; astrocytes expressing this mutant PTEN generate colonies in vitro and tumors in vivo. Mutations converting a tumor suppressor such as PTEN into a tumor promoter through a gain-of-function involving IGF-1 production may further our understanding of the role played by this growth factor in glioma growth and help us define druggable targets for personalized therapy.

Screening of mutations affecting protein stability and dynamics of FGFR1—A simulation analysis

Directory of Open Access Journals (Sweden)

C. George Priya Doss

2012-12-01

Full Text Available Single amino acid substitutions in Fibroblast Growth Factor Receptor 1 (FGFR1 destabilize protein and have been implicated in several genetic disorders like various forms of cancer, Kallamann syndrome, Pfeiffer syndrome, Jackson Weiss syndrome, etc. In order to gain functional insight into mutation caused by amino acid substitution to protein function and expression, special emphasis was laid on molecular dynamics simulation techniques in combination with in silico tools such as SIFT, PolyPhen 2.0, I-Mutant 3.0 and SNAP. It has been estimated that 68% nsSNPs were predicted to be deleterious by I-Mutant, slightly higher than SIFT (37%, PolyPhen 2.0 (61% and SNAP (58%. From the observed results, P722S mutation was found to be most deleterious by comparing results of all in silico tools. By molecular dynamics approach, we have shown that P722S mutation leads to increase in flexibility, and deviated more from the native structure which was supported by the decrease in the number of hydrogen bonds. In addition, biophysical analysis revealed a clear insight of stability loss due to P722S mutation in FGFR1 protein. Majority of mutations predicted by these in silico tools were in good concordance with the experimental results.

A novel PRNP Y218N mutation in Gerstmann-Sträussler-Scheinker disease with neurofibrillary degeneration.

Science.gov (United States)

Alzualde, Ainhoa; Indakoetxea, Begoña; Ferrer, Isidre; Moreno, Fermin; Barandiaran, Myriam; Gorostidi, Ana; Estanga, Ainara; Ruiz, Irune; Calero, Miguel; van Leeuwen, Fred W; Atares, Begoña; Juste, Ramón; Rodriguez-Martínez, Ana Belén; López de Munain, Adolfo

2010-08-01

Gerstmann-Sträussler-Scheinker (GSS) disease is a prion disease associated with prion protein gene (PRNP) mutations. We report a novel PRNP mutation (Y218N) associated with GSS disease in a pathologically confirmed case and in two other affected family members. The clinical features of these cases met criteria for possible Alzheimer disease and possible frontotemporal dementia. Neuropathologic analysis revealed deposition of proteinase K-resistant prion protein (PrP(res)), widespread hyperphosphorylated tau pathology, abnormal accumulation of mitochondria in the vicinity of PrP deposits, and expression of mutant ubiquitin (UBB(+1)) in neurofibrillary tangles and dystrophic neurites. Prion protein immunoblotting using 3F4 and 1E4 antibodies disclosed multiple bands ranging from approximately 20 kd to 80 kd and lower bands of 15 kd and approximately 10 kd, the latter only seen after a long incubation. These bands were partially resistant to proteinase K pretreatment. This pattern differs from those seen in Creutzfeldt-Jakob disease andresembles those reported in other GSS cases. The approximately 10kd band was recognized with anti-PrP C-terminus antibodies but not with anti-N terminus antibodies, suggesting PrP truncation at the N terminal. This new mutation extends the list of known mutations responsible for GSS disease and reinforces its clinical heterogeneity. Genetic examination of the PRNP gene should be included in the workup of patients with poorly classifiable dementia.

Characterization of two second-site mutations preventing wild type protein aggregation caused by a dominant negative PMA1 mutant.

Directory of Open Access Journals (Sweden)

Pilar Eraso

Full Text Available The correct biogenesis and localization of Pma1 at the plasma membrane is essential for yeast growth. A subset of PMA1 mutations behave as dominant negative because they produce aberrantly folded proteins that form protein aggregates, which in turn provoke the aggregation of the wild type protein. One approach to understand this dominant negative effect is to identify second-site mutations able to suppress the dominant lethal phenotype caused by those mutant alleles. We isolated and characterized two intragenic second-site suppressors of the PMA1-D378T dominant negative mutation. We present here the analysis of these new mutations that are located along the amino-terminal half of the protein and include a missense mutation, L151F, and an in-frame 12bp deletion that eliminates four residues from Cys409 to Ala412. The results show that the suppressor mutations disrupt the interaction between the mutant and wild type enzymes, and this enables the wild type Pma1 to reach the plasma membrane.

Adaptation of the delta-m and δ-fit truncation methods to vector radiative transfer: Effect of truncation on radiative transfer accuracy

International Nuclear Information System (INIS)

Sanghavi, Suniti; Stephens, Graeme

2015-01-01

In the presence of aerosol and/or clouds, the use of appropriate truncation methods becomes indispensable for accurate but cost-efficient radiative transfer computations. Truncation methods allow the reduction of the large number (usually several hundreds) of Fourier components associated with particulate scattering functions to a more manageable number, thereby making it possible to carry out radiative transfer computations with a modest number of streams. While several truncation methods have been discussed for scalar radiative transfer, few rigorous studies have been made of truncation methods for the vector case. Here, we formally derive the vector form of Wiscombe's delta-m truncation method. Two main sources of error associated with delta-m truncation are identified as the delta-separation error (DSE) and the phase-truncation error (PTE). The view angles most affected by truncation error occur in the vicinity of the direction of exact backscatter. This view geometry occurs commonly in satellite based remote sensing applications, and is hence of considerable importance. In order to deal with these errors, we adapt the δ-fit approach of Hu et al. (2000) [17] to vector radiative transfer. The resulting δBGE-fit is compared with the vectorized delta-m method. For truncation at l=25 of an original phase matrix consisting of over 300 Fourier components, the use of the δBGE-fit minimizes the error due to truncation at these view angles, while practically eliminating error at other angles. We also show how truncation errors have a distorting effect on hyperspectral absorption line shapes. The choice of the δBGE-fit method over delta-m truncation minimizes errors in absorption line depths, thus affording greater accuracy for sensitive retrievals such as those of XCO 2 from OCO-2 or GOSAT measurements. - Highlights: • Derives vector form for delta-m truncation method. • Adapts δ-fit truncation approach to vector RTE as δBGE-fit. • Compares truncation

Disease-Causing Mutations in the G Protein Gαs Subvert the Roles of GDP and GTP.

Science.gov (United States)

Hu, Qi; Shokat, Kevan M

2018-05-17

The single most frequent cancer-causing mutation across all heterotrimeric G proteins is R201C in Gαs. The current model explaining the gain-of-function activity of the R201 mutations is through the loss of GTPase activity and resulting inability to switch off to the GDP state. Here, we find that the R201C mutation can bypass the need for GTP binding by directly activating GDP-bound Gαs through stabilization of an intramolecular hydrogen bond network. Having found that a gain-of-function mutation can convert GDP into an activator, we postulated that a reciprocal mutation might disrupt the normal role of GTP. Indeed, we found R228C, a loss-of-function mutation in Gαs that causes pseudohypoparathyroidism type 1a (PHP-Ia), compromised the adenylyl cyclase-activating activity of Gαs bound to a non-hydrolyzable GTP analog. These findings show that disease-causing mutations in Gαs can subvert the canonical roles of GDP and GTP, providing new insights into the regulation mechanism of G proteins. Copyright © 2018 Elsevier Inc. All rights reserved.

Prion protein amyloidosis with divergent phenotype associated with two novel nonsense mutations in PRNP

NARCIS (Netherlands)

Jansen, Casper; Parchi, Piero; Capellari, Sabina; Vermeij, Ad J.; Corrado, Patrizia; Baas, Frank; Strammiello, Rosaria; van Gool, Willem A.; van Swieten, John C.; Rozemuller, Annemieke J. M.

2010-01-01

Stop codon mutations in the gene encoding the prion protein (PRNP) are very rare and have thus far only been described in two patients with prion protein cerebral amyloid angiopathy (PrP-CAA). In this report, we describe the clinical, histopathological and pathological prion protein (PrPSc)

New recA mutations that dissociate the various RecA protein activities in Escherichia coli provide evidence for an additional role for RecA protein in UV mutagenesis

Energy Technology Data Exchange (ETDEWEB)

Dutreix, M.; Moreau, P.L.; Bailone, A.; Galibert, F.; Battista, J.R.; Walker, G.C.; Devoret, R.

1989-05-01

To isolate strains with new recA mutations that differentially affect RecA protein functions, we mutagenized in vitro the recA gene carried by plasmid mini-F and then introduced the mini-F-recA plasmid into a delta recA host that was lysogenic for prophage phi 80 and carried a lac duplication. By scoring prophage induction and recombination of the lac duplication, we isolated new recA mutations. A strain carrying mutation recA1734 (Arg-243 changed to Leu) was found to be deficient in phi 80 induction but proficient in recombination. The mutation rendered the host not mutable by UV, even in a lexA(Def) background. Yet, the recA1734 host became mutable upon introduction of a plasmid encoding UmuD*, the active carboxyl-terminal fragment of UmuD. Although the recA1734 mutation permits cleavage of lambda and LexA repressors, it renders the host deficient in the cleavage of phi 80 repressor and UmuD protein. Another strain carrying mutation recA1730 (Ser-117 changed to Phe) was found to be proficient in phi 80 induction but deficient in recombination. The recombination defect conferred by the mutation was partly alleviated in a cell devoid of LexA repressor, suggesting that, when amplified, RecA1730 protein is active in recombination. Since LexA protein was poorly cleaved in the recA1730 strain while phage lambda was induced, we conclude that RecA1730 protein cannot specifically mediate LexA protein cleavage. Our results show that the recA1734 and recA1730 mutations differentially affect cleavage of various substrates. The recA1730 mutation prevented UV mutagenesis, even upon introduction into the host of a plasmid encoding UmuD* and was dominant over recA+.

New recA mutations that dissociate the various RecA protein activities in Escherichia coli provide evidence for an additional role for RecA protein in UV mutagenesis

International Nuclear Information System (INIS)

Dutreix, M.; Moreau, P.L.; Bailone, A.; Galibert, F.; Battista, J.R.; Walker, G.C.; Devoret, R.

1989-01-01

To isolate strains with new recA mutations that differentially affect RecA protein functions, we mutagenized in vitro the recA gene carried by plasmid mini-F and then introduced the mini-F-recA plasmid into a delta recA host that was lysogenic for prophage phi 80 and carried a lac duplication. By scoring prophage induction and recombination of the lac duplication, we isolated new recA mutations. A strain carrying mutation recA1734 (Arg-243 changed to Leu) was found to be deficient in phi 80 induction but proficient in recombination. The mutation rendered the host not mutable by UV, even in a lexA(Def) background. Yet, the recA1734 host became mutable upon introduction of a plasmid encoding UmuD*, the active carboxyl-terminal fragment of UmuD. Although the recA1734 mutation permits cleavage of lambda and LexA repressors, it renders the host deficient in the cleavage of phi 80 repressor and UmuD protein. Another strain carrying mutation recA1730 (Ser-117 changed to Phe) was found to be proficient in phi 80 induction but deficient in recombination. The recombination defect conferred by the mutation was partly alleviated in a cell devoid of LexA repressor, suggesting that, when amplified, RecA1730 protein is active in recombination. Since LexA protein was poorly cleaved in the recA1730 strain while phage lambda was induced, we conclude that RecA1730 protein cannot specifically mediate LexA protein cleavage. Our results show that the recA1734 and recA1730 mutations differentially affect cleavage of various substrates. The recA1730 mutation prevented UV mutagenesis, even upon introduction into the host of a plasmid encoding UmuD* and was dominant over recA+

Computing correct truncated excited state wavefunctions

Science.gov (United States)

Bacalis, N. C.; Xiong, Z.; Zang, J.; Karaoulanis, D.

2016-12-01

We demonstrate that, if a wave function's truncated expansion is small, then the standard excited states computational method, of optimizing one "root" of a secular equation, may lead to an incorrect wave function - despite the correct energy according to the theorem of Hylleraas, Undheim and McDonald - whereas our proposed method [J. Comput. Meth. Sci. Eng. 8, 277 (2008)] (independent of orthogonality to lower lying approximants) leads to correct reliable small truncated wave functions. The demonstration is done in He excited states, using truncated series expansions in Hylleraas coordinates, as well as standard configuration-interaction truncated expansions.

Evolution of a G protein-coupled receptor response by mutations in regulatory network interactions

DEFF Research Database (Denmark)

Di Roberto, Raphaël B; Chang, Belinda; Trusina, Ala

2016-01-01

All cellular functions depend on the concerted action of multiple proteins organized in complex networks. To understand how selection acts on protein networks, we used the yeast mating receptor Ste2, a pheromone-activated G protein-coupled receptor, as a model system. In Saccharomyces cerevisiae......, Ste2 is a hub in a network of interactions controlling both signal transduction and signal suppression. Through laboratory evolution, we obtained 21 mutant receptors sensitive to the pheromone of a related yeast species and investigated the molecular mechanisms behind this newfound sensitivity. While...... demonstrate that a new receptor-ligand pair can evolve through network-altering mutations independently of receptor-ligand binding, and suggest a potential role for such mutations in disease....

Molecular analysis of HEXA gene in Argentinean patients affected with Tay-Sachs disease: possible common origin of the prevalent c.459+5A>G mutation.

Science.gov (United States)

Zampieri, Stefania; Montalvo, Annalisa; Blanco, Mariana; Zanin, Irene; Amartino, Hernan; Vlahovicek, Kristian; Szlago, Marina; Schenone, Andrea; Pittis, Gabriela; Bembi, Bruno; Dardis, Andrea

2012-05-15

Tay-Sachs disease (TSD) is a recessively inherited disorder caused by the deficient activity of hexosaminidase A due to mutations in the HEXA gene. Up to date there is no information regarding the molecular genetics of TSD in Argentinean patients. In the present study we have studied 17 Argentinean families affected by TSD, including 20 patients with the acute infantile form and 3 with the sub-acute form. Overall, we identified 14 different mutations accounting for 100% of the studied alleles. Eight mutations were novel: 5 were single base changes leading to drastic residue changes or truncated proteins, 2 were small deletions and one was an intronic mutation that may cause a splicing defect. Although the spectrum of mutations was highly heterogeneous, a high frequency of the c.459+5G>A mutation, previously described in different populations was found among the studied cohort. Haplotype analysis suggested that in these families the c.459+5G>A mutation might have arisen by a single mutational event. Copyright © 2012 Elsevier B.V. All rights reserved.

Getting from A to B-exploring the activation motifs of the class B adhesion G protein-coupled receptor subfamily G member 4/GPR112

DEFF Research Database (Denmark)

Cornelia Peeters, Miriam; Mos, Iris; Lenselink, Eelke B

2016-01-01

The adhesion G protein-coupled receptors (ADGRs/class B2 G protein-coupled receptors) constitute an ancient family of G protein-coupled receptors that have recently been demonstrated to play important roles in cellular and developmental processes. Here, we describe a first insight...... into the structure-function relationship of ADGRs using the family member ADGR subfamily G member 4 (ADGRG4)/GPR112 as a model receptor. In a bioinformatics approach, we compared conserved, functional elements of the well-characterized class A and class B1 secretin-like G protein-coupled receptors with the ADGRs. We...... identified several potential equivalent motifs and subjected those to mutational analysis. The importance of the mutated residues was evaluated by examining their effect on the high constitutive activity of the N-terminally truncated ADGRG4/GPR112 in a 1-receptor-1-G protein Saccharomyces cerevisiae...

Peeling skin syndrome: genetic defects in late terminal differentiation of the epidermis.

Science.gov (United States)

Bowden, Paul E

2011-03-01

In this issue, Israeli and colleagues confirm that homozygous mutations in corneodesmosin (CDSN) cause type B peeling skin syndrome (PSS), an autosomal recessive skin disorder. The deletion mutation described resulted in a frameshift, producing a downstream premature stop codon and early truncation of the protein. The recently described CDSN nonsense mutation in another PSS family also resulted in protein truncation and nonsense-mediated mRNA decay. Type B generalized PSS can now be clearly distinguished from acral PSS, caused by mutations in transglutaminase 5. This directly affects cornified envelope cross-linking rather than corneodesmosome adherence. These observations provide new insight into the molecular defects underlying two closely related forms of PSS.

Common pathogenic effects of missense mutations in the P-type ATPase ATP13A2 (PARK9) associated with early-onset parkinsonism.

Science.gov (United States)

Podhajska, Agata; Musso, Alessandra; Trancikova, Alzbeta; Stafa, Klodjan; Moser, Roger; Sonnay, Sarah; Glauser, Liliane; Moore, Darren J

2012-01-01

Mutations in the ATP13A2 gene (PARK9) cause autosomal recessive, juvenile-onset Kufor-Rakeb syndrome (KRS), a neurodegenerative disease characterized by parkinsonism. KRS mutations produce truncated forms of ATP13A2 with impaired protein stability resulting in a loss-of-function. Recently, homozygous and heterozygous missense mutations in ATP13A2 have been identified in subjects with early-onset parkinsonism. The mechanism(s) by which missense mutations potentially cause parkinsonism are not understood at present. Here, we demonstrate that homozygous F182L, G504R and G877R missense mutations commonly impair the protein stability of ATP13A2 leading to its enhanced degradation by the proteasome. ATP13A2 normally localizes to endosomal and lysosomal membranes in neurons and the F182L and G504R mutations disrupt this vesicular localization and promote the mislocalization of ATP13A2 to the endoplasmic reticulum. Heterozygous T12M, G533R and A746T mutations do not obviously alter protein stability or subcellular localization but instead impair the ATPase activity of microsomal ATP13A2 whereas homozygous missense mutations disrupt the microsomal localization of ATP13A2. The overexpression of ATP13A2 missense mutants in SH-SY5Y neural cells does not compromise cellular viability suggesting that these mutant proteins lack intrinsic toxicity. However, the overexpression of wild-type ATP13A2 may impair neuronal integrity as it causes a trend of reduced neurite outgrowth of primary cortical neurons, whereas the majority of disease-associated missense mutations lack this ability. Finally, ATP13A2 overexpression sensitizes cortical neurons to neurite shortening induced by exposure to cadmium or nickel ions, supporting a functional interaction between ATP13A2 and heavy metals in post-mitotic neurons, whereas missense mutations influence this sensitizing effect. Collectively, our study provides support for common loss-of-function effects of homozygous and heterozygous missense

Mutational scanning reveals the determinants of protein insertion and association energetics in the plasma membrane.

Science.gov (United States)

Elazar, Assaf; Weinstein, Jonathan; Biran, Ido; Fridman, Yearit; Bibi, Eitan; Fleishman, Sarel Jacob

2016-01-29

Insertion of helix-forming segments into the membrane and their association determines the structure, function, and expression levels of all plasma membrane proteins. However, systematic and reliable quantification of membrane-protein energetics has been challenging. We developed a deep mutational scanning method to monitor the effects of hundreds of point mutations on helix insertion and self-association within the bacterial inner membrane. The assay quantifies insertion energetics for all natural amino acids at 27 positions across the membrane, revealing that the hydrophobicity of biological membranes is significantly higher than appreciated. We further quantitate the contributions to membrane-protein insertion from positively charged residues at the cytoplasm-membrane interface and reveal large and unanticipated differences among these residues. Finally, we derive comprehensive mutational landscapes in the membrane domains of Glycophorin A and the ErbB2 oncogene, and find that insertion and self-association are strongly coupled in receptor homodimers.

A Review of the Giant Protein Titin in Clinical Molecular Diagnostics of Cardiomyopathies

Directory of Open Access Journals (Sweden)

Marta Gigli

2016-07-01

Full Text Available Titin (TTN is known as the largest sarcomeric protein that resides within the heart muscle. Due to alternative splicing of TTN the heart expresses two major isoforms (N2B and N2BA that incorporate four distinct regions termed the Z-line, I-band, A-band, and M-line. Next-generation sequencing allows a large number of genes to be sequenced simultaneously and provides the opportunity to easily analyze giant genes such as TTN. Mutations in the TTN gene can cause cardiomyopathies, in particular dilated cardiomyopathy (DCM. DCM is the most common form of cardiomyopathy and it is characterized by systolic dysfunction and dilation of the left ventricle. TTN truncating variants have been described as the most common cause of DCM while the real impact of TTN missense variants in the pathogenesis of DCM is still unclear. In a recent population screening study, rare missense variants potentially pathogenic based on bioinformatic filtering represented only 12.6% of the several hundred rare TTN missense variants found, suggesting that missense variants are very common in TTN and frequently benign. The aim of this review is to understand the clinical role of TTN mutations in DCM and in other cardiomyopathies. Whereas TTN truncations are common in DCM, there is evidence that TTN truncations are rare in the HCM phenotype. Furthermore TTN mutations can also cause arrhythmogenic right ventricular cardiomyopathy (ARVC with distinct clinical features and outcomes. Finally, the identification of a rare missense variant in TTN cosegregating with the restrictive cardiomyopathy (RCM phenotype suggests that TTN is a novel gene in this disease. Clinical diagnostic testing is currently able to analyze over 100 cardiomyopathy genes, including TTN, however, the size and presence of extensive genetic variation in TTN presents clinical challenges in determining significant disease-causing mutations. This review discusses the current knowledge of TTN genetic variations in

Mixtures of truncated basis functions

DEFF Research Database (Denmark)

Langseth, Helge; Nielsen, Thomas Dyhre; Rumí, Rafael

2012-01-01

In this paper we propose a framework, called mixtures of truncated basis functions (MoTBFs), for representing general hybrid Bayesian networks. The proposed framework generalizes both the mixture of truncated exponentials (MTEs) framework and the mixture of polynomials (MoPs) framework. Similar t...

Applications of Fast Truncated Multiplication in Cryptography

Directory of Open Access Journals (Sweden)

Laszlo Hars

2006-12-01

Full Text Available Truncated multiplications compute truncated products, contiguous subsequences of the digits of integer products. For an n-digit multiplication algorithm of time complexity O(nα, with 1<α≤2, there is a truncated multiplication algorithm, which is constant times faster when computing a short enough truncated product. Applying these fast truncated multiplications, several cryptographic long integer arithmetic algorithms are improved, including integer reciprocals, divisions, Barrett and Montgomery multiplications, 2n-digit modular multiplication on hardware for n-digit half products. For example, Montgomery multiplication is performed in 2.6 Karatsuba multiplication time.

A novel loss-of-function heterozygous BRCA2 c.8946_8947delAG mutation found in a Chinese woman with family history of breast cancer.

Science.gov (United States)

Ma, Jing; Yang, Jichun; Jian, Wenjing; Wang, Xianming; Xiao, Deyong; Xia, Wenjun; Xiong, Likuan; Ma, Duan

2017-04-01

Breast cancer is the most frequent female malignancy worldwide. Among them, some cases have hereditary susceptibility in two leading genes, BRCA1 and BRCA2. Heterozygous germ line mutations in them are related with increased risk of breast, ovarian and other cancer, following autosomal dominant inheritance mode. For purpose of early finding, early diagnosis and early treatment, mutation detecting of BRCA1/2 genes was performed in unselected 300 breast or ovarian patients and unaffected women using next-generation sequencing and then confirmed by Sanger sequencing. A non-previously reported heterozygous mutation c.8946_8947delAG (p.D2983FfsX34) of BRCA2 gene was identified in an unaffected Chinese woman with family history of breast cancer (her breast cancer mother, also carrying this mutation). The BRCA2-truncated protein resulted from the frame shift mutation was found to lose two putative nuclear localization signals and a Rad51-binding motif in the extreme C-terminal region by bioinformatic prediction. And then in vitro experiments showed that nearly all the mutant protein was unable to translocate to the nucleus to perform DNA repair activity. This novel mutant BRCA2 protein is dysfunction. We classify the mutation into disease causing and conclude that it is the risk factor for breast cancer in this family. So, conducting the same mutation test and providing genetic counseling for this family is practically meaningful and significant. Meanwhile, the identification of this new mutation enriches the Breast Cancer Information Core database, especially in China.

Prefoldin Promotes Proteasomal Degradation of Cytosolic Proteins with Missense Mutations by Maintaining Substrate Solubility.

Directory of Open Access Journals (Sweden)

Sophie A Comyn

2016-07-01

Full Text Available Misfolded proteins challenge the ability of cells to maintain protein homeostasis and can accumulate into toxic protein aggregates. As a consequence, cells have adopted a number of protein quality control pathways to prevent protein aggregation, promote protein folding, and target terminally misfolded proteins for degradation. In this study, we employed a thermosensitive allele of the yeast Guk1 guanylate kinase as a model misfolded protein to investigate degradative protein quality control pathways. We performed a flow cytometry based screen to identify factors that promote proteasomal degradation of proteins misfolded as the result of missense mutations. In addition to the E3 ubiquitin ligase Ubr1, we identified the prefoldin chaperone subunit Gim3 as an important quality control factor. Whereas the absence of GIM3 did not impair proteasomal function or the ubiquitination of the model substrate, it led to the accumulation of the poorly soluble model substrate in cellular inclusions that was accompanied by delayed degradation. We found that Gim3 interacted with the Guk1 mutant allele and propose that prefoldin promotes the degradation of the unstable model substrate by maintaining the solubility of the misfolded protein. We also demonstrated that in addition to the Guk1 mutant, prefoldin can stabilize other misfolded cytosolic proteins containing missense mutations.

Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon

NARCIS (Netherlands)

Nouwen, N; Driessen, AJM

2005-01-01

Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.

The ter mutation in the rat Dnd1 gene initiates gonadal teratomas and infertility in both genders.

Science.gov (United States)

Northrup, Emily; Zschemisch, Nils-Holger; Eisenblätter, Regina; Glage, Silke; Wedekind, Dirk; Cuppen, Edwin; Dorsch, Martina; Hedrich, Hans-Jürgen

2012-01-01

A spontaneous mutation leading to the formation of congenital ovarian and testicular tumors was detected in the WKY/Ztm rat strain. The histological evaluation revealed derivatives from all three germ layers, thereby identifying these tumors as teratomas. Teratocarcinogenesis was accompanied by infertility and the underlying mutation was termed ter. Linkage analysis of 58 (WKY-ter×SPRD-Cu3) F2 rats associated the ter mutation with RNO18 (LOD = 3.25). Sequencing of candidate genes detected a point mutation in exon 4 of the dead-end homolog 1 gene (Dnd1), which introduces a premature stop codon assumed to cause a truncation of the Dnd1 protein. Genotyping of the recessive ter mutation revealed a complete penetrance of teratocarcinogenesis and infertility in homozygous ter rats of both genders. Morphologically non-tumorous testes of homozygous ter males were reduced in both size and weight. This testicular malformation was linked to a lack of spermatogenesis using immunohistochemical and histological staining. Our WKY-Dnd1(ter)/Ztm rat is a novel animal model to investigate gonadal teratocarcinogenesis and the molecular mechanisms involved in germ cell development of both genders.

Point mutation in the MITF gene causing Waardenburg syndrome type II in a three-generation Indian family.

Science.gov (United States)

Lalwani, A K; Attaie, A; Randolph, F T; Deshmukh, D; Wang, C; Mhatre, A; Wilcox, E

1998-12-04

Waardenburg syndrome (WS) is an autosomal-dominant neural crest cell disorder phenotypically characterized by hearing impairment and disturbance of pigmentation. A presence of dystopia canthorum is indicative of WS type 1, caused by loss of function mutation in the PAX3 gene. In contrast, type 2 WS (WS2) is characterized by normally placed medial canthi and is genetically heterogeneous; mutations in MITF (microphthalmia associated transcription factor) associated with WS2 have been identified in some but not all affected families. Here, we report on a three-generation Indian family with a point mutation in the MITF gene causing WS2. This mutation, initially reported in a Northern European family, creates a stop codon in exon 7 and is predicted to result in a truncated protein lacking the HLH-Zip or Zip structure necessary for normal interaction with its target DNA motif. Comparison of the phenotype between the two families demonstrates a significant difference in pigmentary disturbance of the eye. This family, with the first documented case of two unrelated WS2 families harboring identical mutations, provides additional evidence for the importance of genetic background on the clinical phenotype.

Two microcephaly-associated novel missense mutations in CASK specifically disrupt the CASK-neurexin interaction.

Science.gov (United States)

LaConte, Leslie E W; Chavan, Vrushali; Elias, Abdallah F; Hudson, Cynthia; Schwanke, Corbin; Styren, Katie; Shoof, Jonathan; Kok, Fernando; Srivastava, Sarika; Mukherjee, Konark

2018-03-01

Deletion and truncation mutations in the X-linked gene CASK are associated with severe intellectual disability (ID), microcephaly and pontine and cerebellar hypoplasia in girls (MICPCH). The molecular origin of CASK-linked MICPCH is presumed to be due to disruption of the CASK-Tbr-1 interaction. This hypothesis, however, has not been directly tested. Missense variants in CASK are typically asymptomatic in girls. We report three severely affected girls with heterozygous CASK missense mutations (M519T (2), G659D (1)) who exhibit ID, microcephaly, and hindbrain hypoplasia. The mutation M519T results in the replacement of an evolutionarily invariant methionine located in the PDZ signaling domain known to be critical for the CASK-neurexin interaction. CASK M519T is incapable of binding to neurexin, suggesting a critically important role for the CASK-neurexin interaction. The mutation G659D is in the SH3 (Src homology 3) domain of CASK, replacing a semi-conserved glycine with aspartate. We demonstrate that the CASK G659D mutation affects the CASK protein in two independent ways: (1) it increases the protein's propensity to aggregate; and (2) it disrupts the interface between CASK's PDZ (PSD95, Dlg, ZO-1) and SH3 domains, inhibiting the CASK-neurexin interaction despite residing outside of the domain deemed critical for neurexin interaction. Since heterozygosity of other aggregation-inducing mutations (e.g., CASK W919R ) does not produce MICPCH, we suggest that the G659D mutation produces microcephaly by disrupting the CASK-neurexin interaction. Our results suggest that disruption of the CASK-neurexin interaction, not the CASK-Tbr-1 interaction, produces microcephaly and cerebellar hypoplasia. These findings underscore the importance of functional validation for variant classification.

Identification of SCN1A and PCDH19 mutations in Chinese children with Dravet syndrome.

Directory of Open Access Journals (Sweden)

Anna Ka-Yee Kwong

Full Text Available BACKGROUND: Dravet syndrome is a severe form of epilepsy. Majority of patients have a mutation in SCN1A gene, which encodes a voltage-gated sodium channel. A recent study has demonstrated that 16% of SCN1A-negative patients have a mutation in PCDH19, the gene encoding protocadherin-19. Mutations in other genes account for only a very small proportion of families. TSPYL4 is a novel candidate gene within the locus 6q16.3-q22.31 identified by linkage study. OBJECTIVE: The present study examined the mutations in epileptic Chinese children with emphasis on Dravet syndrome. METHODS: A hundred children with severe epilepsy were divided into Dravet syndrome and non-Dravet syndrome groups and screened for SCN1A mutations by direct sequencing. SCN1A-negative Dravet syndrome patients and patients with phenotypes resembling Dravet syndrome were checked for PCDH19 and TSPYL4 mutations. RESULTS: Eighteen patients (9 males, 9 females were diagnosed to have Dravet syndrome. Among them, 83% (15/18 had SCN1A mutations including truncating (7, splice site (2 and missense mutations (6. The truncating/splice site mutations were associated with moderate to severe degree of intellectual disability (p<0.05. During the progression of disease, 73% (11/15 had features fitting into the diagnostic criteria of autism spectrum disorder and 53% (8/15 had history of vaccination-induced seizures. A novel PCDH19 p.D377N mutation was identified in one SCN1A-negative female patient with Dravet syndrome and a known PCDH19 p.N340S mutation in a female non-Dravet syndrome patient. The former also inherited a TSPYL4 p.G60R variant. CONCLUSION: A high percentage of SCN1A mutations was identified in our Chinese cohort of Dravet syndrome patients but none in the rest of patients. We demonstrated that truncating/splice site mutations were linked to moderate to severe intellectual disability in these patients. A de novo PCDH19 missense mutation together with an inherited TSPYL4 missense

Advanced method for high-throughput expression of mutated eukaryotic membrane proteins in Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Ito, Keisuke; Sugawara, Taishi; Shiroishi, Mitsunori; Tokuda, Natsuko; Kurokawa, Azusa; Misaka, Takumi; Makyio, Hisayoshi; Yurugi-Kobayashi, Takami; Shimamura, Tatsuro; Nomura, Norimichi; Murata, Takeshi; Abe, Keiko; Iwata, So

2008-01-01

Crystallization of eukaryotic membrane proteins is a challenging, iterative process. The protein of interest is often modified in an attempt to improve crystallization and diffraction results. To accelerate this process, we took advantage of a GFP-fusion yeast expression system that uses PCR to direct homologous recombination and gene cloning. We explored the possibility of employing more than one PCR fragment to introduce various mutations in a single step, and found that when up to five PCR fragments were co-transformed into yeast, the recombination frequency was maintained as the number of fragments was increased. All transformants expressed the model membrane protein, while the resulting plasmid from each clone contained the designed mutations only. Thus, we have demonstrated a technique allowing the expression of mutant membrane proteins within 5 days, combining a GFP-fusion expression system and yeast homologous recombination

Mutational analysis of PVX TGBp3 links subcellular accumulation and protein turnover

International Nuclear Information System (INIS)

Ju, H.-J.; Ye, C.-M.; Verchot-Lubicz, Jeanmarie

2008-01-01

Potato virus X (PVX) TGBp3 is required for virus cell-to-cell transport, has an N-terminal transmembrane domain, and a C-terminal cytosolic domain. In the absence of virus infection TGBp3:GFP is seen in the cortical and perinuclear ER. In PVX infected cells the TGBp3:GFP fusion is also seen in the nucleoplasm indicating that events during PVX infection trigger entry into the nucleus. Mutational analysis failed to identify a nuclear targeting domain. Mutations inhibiting TGBp3 association with the ER and inhibiting virus movement did not block TGBp3:GFP in the nucleoplasm. A mutation disrupting the N-terminal transmembrane domain of TGBp3 caused the fusion to accumulate in the nucleus indicating that nuclear import is regulated by ER interactions. Tunicamycin, an ER-stress inducing chemical, caused lower levels of GFP and TGBp3:GFP to accumulate in virus infected protoplasts. MG115 and MG132 were used to demonstrate that wild-type and mutant TGBp3:GFP fusions were degraded by the 26S proteasome. These observations are consistent with an ER-associated protein degradation (ERAD) pathway suggesting that PVX TGBp3, similar to aberrant ER proteins, is translocate to the cytoplasm for degradation. Nuclear accumulation of mutant and wild-type TGBp3:GFP is independent of other PVX proteins and may be another feature of an ERAD pathway

P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

International Nuclear Information System (INIS)

Mukh-Syaifudin

2006-01-01

Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

Properties of truncated multiplicity distributions

International Nuclear Information System (INIS)

Lupia, S.

1995-01-01

Truncation effects on multiplicity distributions are discussed. Observables sensitive to the tail, like factorial moments, factorial cumulants and their ratio, are shown to be strongly affected by truncation. A possible way to overcome this problem by looking at the head of the distribution is suggested. (author)

Properties of truncated multiplicity distributions

Energy Technology Data Exchange (ETDEWEB)

Lupia, S. [Turin Univ. (Italy). Dipt. di Fisica

1995-12-31

Truncation effects on multiplicity distributions are discussed. Observables sensitive to the tail, like factorial moments, factorial cumulants and their ratio, are shown to be strongly affected by truncation. A possible way to overcome this problem by looking at the head of the distribution is suggested. (author)

Analysis of truncation limit in probabilistic safety assessment

International Nuclear Information System (INIS)

Cepin, Marko

2005-01-01

A truncation limit defines the boundaries of what is considered in the probabilistic safety assessment and what is neglected. The truncation limit that is the focus here is the truncation limit on the size of the minimal cut set contribution at which to cut off. A new method was developed, which defines truncation limit in probabilistic safety assessment. The method specifies truncation limits with more stringency than presenting existing documents dealing with truncation criteria in probabilistic safety assessment do. The results of this paper indicate that the truncation limits for more complex probabilistic safety assessments, which consist of larger number of basic events, should be more severe than presently recommended in existing documents if more accuracy is desired. The truncation limits defined by the new method reduce the relative errors of importance measures and produce more accurate results for probabilistic safety assessment applications. The reduced relative errors of importance measures can prevent situations, where the acceptability of change of equipment under investigation according to RG 1.174 would be shifted from region, where changes can be accepted, to region, where changes cannot be accepted, if the results would be calculated with smaller truncation limit

PrPST, a Soluble, Protease Resistant and Truncated PrP Form Features in the Pathogenesis of a Genetic Prion Disease

Science.gov (United States)

Frid, Kati; Binyamin, Orli; Gabizon, Ruth

2013-01-01

While the conversion of PrPC into PrPSc in the transmissible form of prion disease requires a preexisting PrPSc seed, in genetic prion disease accumulation of disease related PrP could be associated with biochemical and metabolic modifications resulting from the designated PrP mutation. To investigate this possibility, we looked into the time related changes of PrP proteins in the brains of TgMHu2ME199K/wt mice, a line modeling for heterozygous genetic prion disease linked to the E200K PrP mutation. We found that while oligomeric entities of mutant E199KPrP exist at all ages, aggregates of wt PrP in the same brains presented only in advanced disease, indicating a late onset conversion process. We also show that most PK resistant PrP in TgMHu2ME199K mice is soluble and truncated (PrPST), a pathogenic form never before associated with prion disease. We next looked into brain samples from E200K patients and found that both PK resistant PrPs, PrPST as in TgMHu2ME199K mice, and “classical” PrPSc as in infectious prion diseases, coincide in the patient's post mortem brains. We hypothesize that aberrant metabolism of mutant PrPs may result in the formation of previously unknown forms of the prion protein and that these may be central for the fatal outcome of the genetic prion condition. PMID:23922744

MUTATION ON WD DIPEPTIDE MOTIFS OF THE p48 SUBUNIT OF CHROMATIN ASSEMBLY FACTOR-1 CAUSING VIABILITY AND GROWTH OF DT40 CHICKEN B CELL LINE

Directory of Open Access Journals (Sweden)

Ahyar Ahmad

2010-07-01

Full Text Available Chromatin assembly factor-1 (CAF-1, a protein complex consisting of three subunits, p150, p60, and p48, is highly conserved from yeast to humans and facilitated nucleosome assembly of newly replicated DNA. The p48 subunit, CAF-1p48 (p48, with seven WD (Trp-Asp repeat motifs, is a member of the WD protein family. The immunoprecipitation experiment revealed that ß-propeller structure of p48 was less stringent for it's binding to HDAC-1, but more stringent for its binding to both histones H4 and CAF-1p60 but not to ASF-1, indicating that the proper ß-propeller structure of p48 is essential for the binding to these two proteins histone H4 and CAF-1p60. Complementation experiments, involving missense and truncated mutants of FLAG-tagged p48, revealed that mutations of every of seven WD dipeptide motifs, like both the N-terminal and C-terminal truncated mutations, could not rescue for the tet-induced lethality. These results indicate not only that p48 is essential for the viability of vertebrate cells, although the yeast p48 homolog is nonessential, but also that all the seven WD dipeptide motifs are necessary for the maintenance of the proper structure of p48 that is fundamentally important for cell viability.   Keywords: Chromatin assembly factor-1, complementation experiments, viability

PLK1 has tumor-suppressive potential in APC-truncated colon cancer cells.

Science.gov (United States)

Raab, Monika; Sanhaji, Mourad; Matthess, Yves; Hörlin, Albrecht; Lorenz, Ioana; Dötsch, Christina; Habbe, Nils; Waidmann, Oliver; Kurunci-Csacsko, Elisabeth; Firestein, Ron; Becker, Sven; Strebhardt, Klaus

2018-03-16

The spindle assembly checkpoint (SAC) acts as a molecular safeguard in ensuring faithful chromosome transmission during mitosis, which is regulated by a complex interplay between phosphatases and kinases including PLK1. Adenomatous polyposis coli (APC) germline mutations cause aneuploidy and are responsible for familial adenomatous polyposis (FAP). Here we study the role of PLK1 in colon cancer cells with chromosomal instability promoted by APC truncation (APC-ΔC). The expression of APC-ΔC in colon cells reduces the accumulation of mitotic cells upon PLK1 inhibition, accelerates mitotic exit and increases the survival of cells with enhanced chromosomal abnormalities. The inhibition of PLK1 in mitotic, APC-∆C-expressing cells reduces the kinetochore levels of Aurora B and hampers the recruitment of SAC component suggesting a compromised mitotic checkpoint. Furthermore, Plk1 inhibition (RNAi, pharmacological compounds) promotes the development of adenomatous polyps in two independent Apc Min/+ mouse models. High PLK1 expression increases the survival of colon cancer patients expressing a truncated APC significantly.

Construction and heterologous expression of a truncated Haemagglutinin (HA) protein from the avian influenza virus H5N1 in Escherichia coli.

Science.gov (United States)

Chee Wei, T; Nurul Wahida, A G; Shaharum, S

2014-12-01

Malaysia first reported H5N1 poultry case in 2004 and subsequently outbreak in poultry population in 2007. Here, a recombinant gene encoding of peptide epitopes, consisting fragments of HA1, HA2 and a polybasic cleavage site of H5N1 strain Malaysia, was amplified and cloned into pET-47b(+) bacterial expression vector. DNA sequencing and alignment analysis confirmed that the gene had no alteration and in-frame to the vector. Then, His-tagged truncated HA protein was expressed in Escherichia coli BL21 (DE3) under 1 mM IPTG induction. The protein expression was optimized under a time-course induction study and further purified using Ni-NTA agarose under reducing condition. Migration size of protein was detected at 15 kDa by Western blot using anti-His tag monoclonal antibody and demonstrated no discrepancy compared to its calculated molecular weight.

Truncated Calogero-Sutherland models

Science.gov (United States)

Pittman, S. M.; Beau, M.; Olshanii, M.; del Campo, A.

2017-05-01

A one-dimensional quantum many-body system consisting of particles confined in a harmonic potential and subject to finite-range two-body and three-body inverse-square interactions is introduced. The range of the interactions is set by truncation beyond a number of neighbors and can be tuned to interpolate between the Calogero-Sutherland model and a system with nearest and next-nearest neighbors interactions discussed by Jain and Khare. The model also includes the Tonks-Girardeau gas describing impenetrable bosons as well as an extension with truncated interactions. While the ground state wave function takes a truncated Bijl-Jastrow form, collective modes of the system are found in terms of multivariable symmetric polynomials. We numerically compute the density profile, one-body reduced density matrix, and momentum distribution of the ground state as a function of the range r and the interaction strength.

Lamp with a truncated reflector cup

Science.gov (United States)

Li, Ming; Allen, Steven C.; Bazydola, Sarah; Ghiu, Camil-Daniel

2013-10-15

A lamp assembly, and method for making same. The lamp assembly includes first and second truncated reflector cups. The lamp assembly also includes at least one base plate disposed between the first and second truncated reflector cups, and a light engine disposed on a top surface of the at least one base plate. The light engine is configured to emit light to be reflected by one of the first and second truncated reflector cups.

The HCM-linked W792R mutation in cardiac myosin-binding protein C reduces C6 FnIII domain stability.

Science.gov (United States)

Smelter, Dan F; de Lange, Willem J; Cai, Wenxuan; Ge, Ying; Ralphe, J Carter

2018-06-01

Cardiac myosin-binding protein C (cMyBP-C) is a functional sarcomeric protein that regulates contractility in response to contractile demand, and many mutations in cMyBP-C lead to hypertrophic cardiomyopathy (HCM). To gain insight into the effects of disease-causing cMyBP-C missense mutations on contractile function, we expressed the pathogenic W792R mutation (substitution of a highly conserved tryptophan residue by an arginine residue at position 792) in mouse cardiomyocytes lacking endogenous cMyBP-C and studied the functional effects using three-dimensional engineered cardiac tissue constructs (mECTs). Based on complete conservation of tryptophan at this location in fibronectin type II (FnIII) domains, we hypothesized that the W792R mutation affects folding of the C6 FnIII domain, destabilizing the mutant protein. Adenoviral transduction of wild-type (WT) and W792R cDNA achieved equivalent mRNA transcript abundance, but not equivalent protein levels, with W792R compared with WT controls. mECTs expressing W792R demonstrated abnormal contractile kinetics compared with WT mECTs that were nearly identical to cMyBP-C-deficient mECTs. We studied whether common pathways of protein degradation were responsible for the rapid degradation of W792R cMyBP-C. Inhibition of both ubiquitin-proteasome and lysosomal degradation pathways failed to increase full-length mutant protein abundance to WT equivalence, suggesting rapid cytosolic degradation. Bacterial expression of WT and W792R protein fragments demonstrated decreased mutant stability with altered thermal denaturation and increased susceptibility to trypsin digestion. These data suggest that the W792R mutation destabilizes the C6 FnIII domain of cMyBP-C, resulting in decreased full-length protein expression. This study highlights the vulnerability of FnIII-like domains to mutations that alter domain stability and further indicates that missense mutations in cMyBP-C can cause disease through a mechanism of

CtIP Mutations Cause Seckel and Jawad Syndromes.

Directory of Open Access Journals (Sweden)

Per Qvist

2011-10-01

Full Text Available Seckel syndrome is a recessively inherited dwarfism disorder characterized by microcephaly and a unique head profile. Genetically, it constitutes a heterogeneous condition, with several loci mapped (SCKL1-5 but only three disease genes identified: the ATR, CENPJ, and CEP152 genes that control cellular responses to DNA damage. We previously mapped a Seckel syndrome locus to chromosome 18p11.31-q11.2 (SCKL2. Here, we report two mutations in the CtIP (RBBP8 gene within this locus that result in expression of C-terminally truncated forms of CtIP. We propose that these mutations are the molecular cause of the disease observed in the previously described SCKL2 family and in an additional unrelated family diagnosed with a similar form of congenital microcephaly termed Jawad syndrome. While an exonic frameshift mutation was found in the Jawad family, the SCKL2 family carries a splicing mutation that yields a dominant-negative form of CtIP. Further characterization of cell lines derived from the SCKL2 family revealed defective DNA damage induced formation of single-stranded DNA, a critical co-factor for ATR activation. Accordingly, SCKL2 cells present a lowered apoptopic threshold and hypersensitivity to DNA damage. Notably, over-expression of a comparable truncated CtIP variant in non-Seckel cells recapitulates SCKL2 cellular phenotypes in a dose-dependent manner. This work thus identifies CtIP as a disease gene for Seckel and Jawad syndromes and defines a new type of genetic disease mechanism in which a dominant negative mutation yields a recessively inherited disorder.

USP7 Is a Tumor-Specific WNT Activator for APC-Mutated Colorectal Cancer by Mediating β-Catenin Deubiquitination

Directory of Open Access Journals (Sweden)

Laura Novellasdemunt

2017-10-01

Full Text Available The tumor suppressor gene adenomatous polyposis coli (APC is mutated in most colorectal cancers (CRCs, resulting in constitutive Wnt activation. To understand the Wnt-activating mechanism of the APC mutation, we applied CRISPR/Cas9 technology to engineer various APC-truncated isogenic lines. We find that the β-catenin inhibitory domain (CID in APC represents the threshold for pathological levels of Wnt activation and tumor transformation. Mechanistically, CID-deleted APC truncation promotes β-catenin deubiquitination through reverse binding of β-TrCP and USP7 to the destruction complex. USP7 depletion in APC-mutated CRC inhibits Wnt activation by restoring β-catenin ubiquitination, drives differentiation, and suppresses xenograft tumor growth. Finally, the Wnt-activating role of USP7 is specific to APC mutations; thus, it can be used as a tumor-specific therapeutic target for most CRCs.

Expression and characterization of a novel truncated rotavirus VP4 for the development of a recombinant rotavirus vaccine.

Science.gov (United States)

Li, Yijian; Xue, Miaoge; Yu, Linqi; Luo, Guoxing; Yang, Han; Jia, Lianzhi; Zeng, Yuanjun; Li, Tingdong; Ge, Shengxiang; Xia, Ningshao

2018-04-12

The outer capsid protein VP4 is an important target for the development of a recombinant rotavirus vaccine because it mediates the attachment and penetration of rotavirus. Due to the poor solubility of full-length VP4, VP8 was explored as candidate rotavirus vaccines in the past years. In previous studies, it has been found that the N-terminal truncated VP8 protein, VP8-1 (aa26-231), could be expressed in soluble form with improved immunogenicity compared to the core of VP8 (aa65-223). However, this protein stimulated only a weak immune response when aluminum hydroxide was used as an adjuvant. In addition, it should be noted that the protective efficacy of VP4 was higher than that of VP8 and VP5. In this study, it was found that when the N-terminal 25 amino acids were deleted, the truncated VP4 ∗ (aa26-476) containing VP8 and the stalk domain of VP5 could be expressed in soluble form in E. coli and purified to homogeneous trimers. Furthermore, the truncated VP4 could induce high titers of neutralizing antibodies when aluminum adjuvant was used and conferred high protective efficacy in reducing the severity of diarrhea and rotavirus shedding in stools in animal models. The immunogenicity of the truncated VP4 was significantly higher than that of VP8 ∗ and VP5 ∗ alone. Taken together, the truncated VP4 ∗ (aa26-476), with enhanced immunogenicity and immunoprotectivity, could be considered as a viable candidate for further development and has the potential to become a parenterally administered rotavirus vaccine. Copyright © 2018 Elsevier Ltd. All rights reserved.

Identification of functionally important amino acid residues in the mitochondria targeting sequence of Hepatitis B virus X protein

International Nuclear Information System (INIS)

Li, Sai Kam; Ho, Sai Fan; Tsui, Kwok Wing; Fung, Kwok Pui; Waye, M.Y. Mary

2008-01-01

Chronic hepatitis B virus (HBV) infection has been strongly associated with hepatocellular carcinoma (HCC) and the X protein (HBx) is thought to mediate the cellular changes associated with carcinogenesis. Recently, isolation of the hepatitis B virus integrants from HCC tissue by others have established the fact that the X gene is often truncated at its C-terminus. Expression of the GFP fusion proteins of HBx and its truncation mutants with a GFP tag in human liver cell-lines in this study revealed that the C-terminus of HBx is indispensable for its specific localization in the mitochondria. A crucial region of seven amino acids at the C-terminus has been mapped out in which the cysteine residue at position 115 serves as the most important residue for the subcellular localization. When cysteine 115 of HBx is mutated to alanine the mitochondria targeting property of HBx is abrogated

Ligand uptake in Mycobacterium tuberculosis truncated hemoglobins is controlled by both internal tunnels and active site water molecules [version 2; referees: 2 approved

Directory of Open Access Journals (Sweden)

Ignacio Boron

2015-07-01

Full Text Available Mycobacterium tuberculosis, the causative agent of human tuberculosis, has two proteins belonging to the truncated hemoglobin (trHb family. Mt-trHbN presents well-defined internal hydrophobic tunnels that allow O2 and •ŸNO to migrate easily from the solvent to the active site, whereas Mt-trHbO possesses tunnels interrupted by a few bulky residues, particularly a tryptophan at position G8. Differential ligand migration rates allow Mt-trHbN to detoxify Ÿ•NO, a crucial step for pathogen survival once under attack by the immune system, much more efficiently than Mt-trHbO. In order to investigate the differences between these proteins, we performed experimental kinetic measurements, Ÿ•NO decomposition, as well as molecular dynamics simulations of the wild type Mt-trHbN and two mutants, VG8F and VG8W. These mutations affect both the tunnels accessibility as well as the affinity of distal site water molecules, thus modifying the ligand access to the iron. We found that a single mutation allows Mt-trHbN to acquire ligand migration rates comparable to those observed for Mt-trHbO, confirming that ligand migration is regulated by the internal tunnel architecture as well as by water molecules stabilized in the active site.

Hypo- and hypermorphic FOXC1 mutations in dominant glaucoma: transactivation and phenotypic variability.

Directory of Open Access Journals (Sweden)

Cristina Medina-Trillo

Full Text Available Dominant glaucoma, a heterogeneous, infrequent and irreversible optic neuropathy, is often associated with elevated intraocular pressure and early-onset. The role of FOXC1 in this type of glaucoma was investigated in twelve Spanish probands via nucleotide variation screening of its proximal promoter and unique exon. Functional evaluations of the identified variants included analyses of the transcriptional activity, protein stability, DNA binding ability and subcellular localization. Four different mutations that were identified in four probands (33.3% were associated with remarkable phenotypic variability and were functionally classified as either hypermorphic (p.Y47X, p.Q106X and p.G447_G448insDG or hypomorphic (p.I126S alleles. To the best of our knowledge, three of the variants are novel (p.Y47X, p.I126S and p.G447_G448insDG and, in addition, hypermorphic FOXC1 mutations are reported herein for the first time. The presence of an intact N-terminal activation domain in the truncated proteins p.Y47X and p.Q106X may underlie their associated transactivation hyperactivity by a gain-of-function mechanism involving dysregulated protein-protein interactions. Similarly, altered molecular interactions may also lead to increased p.G447_G448insDG activity. In contrast, the partial loss-of-function associated with p.I126S was due to impaired protein stability, DNA binding, protein phosphorylation and subcellular distribution. These results support that moderate and variable FOXC1 transactivation changes are associated with moderate goniodysgenesis, dominant glaucoma and remarkable phenotypic variability.

Hypo- and Hypermorphic FOXC1 Mutations in Dominant Glaucoma: Transactivation and Phenotypic Variability

Science.gov (United States)

Medina-Trillo, Cristina; Sánchez-Sánchez, Francisco; Aroca-Aguilar, José-Daniel; Ferre-Fernández, Jesús-José; Morales, Laura; Méndez-Hernández, Carmen-Dora; Blanco-Kelly, Fiona; Ayuso, Carmen; García-Feijoo, Julián; Escribano, Julio

2015-01-01

Dominant glaucoma, a heterogeneous, infrequent and irreversible optic neuropathy, is often associated with elevated intraocular pressure and early-onset. The role of FOXC1 in this type of glaucoma was investigated in twelve Spanish probands via nucleotide variation screening of its proximal promoter and unique exon. Functional evaluations of the identified variants included analyses of the transcriptional activity, protein stability, DNA binding ability and subcellular localization. Four different mutations that were identified in four probands (33.3%) were associated with remarkable phenotypic variability and were functionally classified as either hypermorphic (p.Y47X, p.Q106X and p.G447_G448insDG) or hypomorphic (p.I126S) alleles. To the best of our knowledge, three of the variants are novel (p.Y47X, p.I126S and p.G447_G448insDG) and, in addition, hypermorphic FOXC1 mutations are reported herein for the first time. The presence of an intact N-terminal activation domain in the truncated proteins p.Y47X and p.Q106X may underlie their associated transactivation hyperactivity by a gain-of-function mechanism involving dysregulated protein-protein interactions. Similarly, altered molecular interactions may also lead to increased p.G447_G448insDG activity. In contrast, the partial loss-of-function associated with p.I126S was due to impaired protein stability, DNA binding, protein phosphorylation and subcellular distribution. These results support that moderate and variable FOXC1 transactivation changes are associated with moderate goniodysgenesis, dominant glaucoma and remarkable phenotypic variability. PMID:25786029

Improving protein quality of soybean through induced mutations

International Nuclear Information System (INIS)

Manjaya, J.G.

2011-01-01

Soybean is one of the most economical and nutritious food packed with basic nutrients that combat diseases stemming from mal- and under-nutrition. Despite its rich nutritional profile, use of soybean in food has been limited because soybean proteins are often associated with compounds, which could exert a negative impact on the nutritional quality of the protein. Trypsin inhibitor (TI) is one of the important anti-nutritional factors that exert negative effect by causing growth inhibition. Soybean cultivar VLS-2 was irradiated with 250 Gy gamma rays in a gamma cell (200) with 60 Co source installed at BARC to induce mutations for low trypsin inhibitor content. Three mutants with lower levels of TI content were identified and can be utilized for developing elite varieties of soybean. (author)

Formal truncations of connected kernel equations

International Nuclear Information System (INIS)

Dixon, R.M.

1977-01-01

The Connected Kernel Equations (CKE) of Alt, Grassberger and Sandhas (AGS); Kouri, Levin and Tobocman (KLT); and Bencze, Redish and Sloan (BRS) are compared against reaction theory criteria after formal channel space and/or operator truncations have been introduced. The Channel Coupling Class concept is used to study the structure of these CKE's. The related wave function formalism of Sandhas, of L'Huillier, Redish and Tandy and of Kouri, Krueger and Levin are also presented. New N-body connected kernel equations which are generalizations of the Lovelace three-body equations are derived. A method for systematically constructing fewer body models from the N-body BRS and generalized Lovelace (GL) equations is developed. The formally truncated AGS, BRS, KLT and GL equations are analyzed by employing the criteria of reciprocity and two-cluster unitarity. Reciprocity considerations suggest that formal truncations of BRS, KLT and GL equations can lead to reciprocity-violating results. This study suggests that atomic problems should employ three-cluster connected truncations and that the two-cluster connected truncations should be a useful starting point for nuclear systems

BAP1 missense mutation c.2054 A>T (p.E685V completely disrupts normal splicing through creation of a novel 5' splice site in a human mesothelioma cell line.

Directory of Open Access Journals (Sweden)

Arianne Morrison

Full Text Available BAP1 is a tumor suppressor gene that is lost or deleted in diverse cancers, including uveal mela¬noma, malignant pleural mesothelioma (MPM, clear cell renal carcinoma, and cholangiocarcinoma. Recently, BAP1 germline mutations have been reported in families with combinations of these same cancers. A particular challenge for mutation screening is the classification of non-truncating BAP1 sequence variants because it is not known whether these subtle changes can affect the protein function sufficiently to predispose to cancer development. Here we report mRNA splicing analysis on a homozygous substitution mutation, BAP1 c. 2054 A&T (p.Glu685Val, identified in an MPM cell line derived from a mesothelioma patient. The mutation occurred at the 3rd nucleotide from the 3' end of exon 16. RT-PCR, cloning and subsequent sequencing revealed several aberrant splicing products not observed in the controls: 1 a 4 bp deletion at the end of exon 16 in all clones derived from the major splicing product. The BAP1 c. 2054 A&T mutation introduced a new 5' splice site (GU, which resulted in the deletion of 4 base pairs and presumably protein truncation; 2 a variety of alternative splicing products that led to retention of different introns: introns 14-16; introns 15-16; intron 14 and intron 16; 3 partial intron 14 and 15 retentions caused by activation of alternative 3' splice acceptor sites (AG in the introns. Taken together, we were unable to detect any correctly spliced mRNA transcripts in this cell line. These results suggest that aberrant splicing caused by this mutation is quite efficient as it completely abolishes normal splicing through creation of a novel 5' splice site and activation of cryptic splice sites. These data support the conclusion that BAP1 c.2054 A&T (p.E685V variant is a pathogenic mutation and contributes to MPM through disruption of normal splicing.

AIP mutations in young patients with acromegaly and the Tampico Giant: the Mexican experience.

Science.gov (United States)

Ramírez-Rentería, Claudia; Hernández-Ramírez, Laura C; Portocarrero-Ortiz, Lesly; Vargas, Guadalupe; Melgar, Virgilio; Espinosa, Etual; Espinosa-de-Los-Monteros, Ana Laura; Sosa, Ernesto; González, Baldomero; Zúñiga, Sergio; Unterländer, Martina; Burger, Joachim; Stals, Karen; Bussell, Anne-Marie; Ellard, Sian; Dang, Mary; Iacovazzo, Donato; Kapur, Sonal; Gabrovska, Plamena; Radian, Serban; Roncaroli, Federico; Korbonits, Márta; Mercado, Moisés

2016-08-01

Although aryl hydrocarbon receptor-interacting protein (AIP) mutations are rare in sporadic acromegaly, their prevalence among young patients is nonnegligible. The objectives of this study were to evaluate the frequency of AIP mutations in a cohort of Mexican patients with acromegaly with disease onset before the age of 30 and to search for molecular abnormalities in the AIP gene in teeth obtained from the "Tampico Giant". Peripheral blood DNA from 71 patients with acromegaly (51 females) with disease onset T (p.Arg304Ter), well-known truncating mutation was identified; in one of these two cases and her identical twin sister, the mutation proved to be a de novo event, since neither of their parents were found to be carriers. In the remaining three patients, new mutations were identified: a frameshift mutation (c.976_977insC, p.Gly326AfsTer), an in-frame deletion (c.872_877del, p.Val291_Leu292del) and a nonsense mutation (c.868A > T, p.Lys290Ter), which are predicted to be pathogenic based on in silico analysis. Patients with AIP mutations tended to have an earlier onset of acromegaly and harboured larger and more invasive tumours. A previously described genetic variant of unknown significance (c.869C > T, p.Ala299Val) was identified in DNA from the Tampico Giant. The prevalence of AIP mutations in young Mexican patients with acromegaly is similar to that of European cohorts. Our results support the need for genetic evaluation of patients with early onset acromegaly.

A functional alternative splicing mutation in AIRE gene causes autoimmune polyendocrine syndrome type 1.

Directory of Open Access Journals (Sweden)

Junyu Zhang

Full Text Available Autoimmune polyendocrine syndrome type 1 (APS-1 is a rare autosomal recessive disease defined by the presence of two of the three conditions: mucocutaneous candidiasis, hypoparathyroidism, and Addison's disease. Loss-of-function mutations of the autoimmune regulator (AIRE gene have been linked to APS-1. Here we report mutational analysis and functional characterization of an AIRE mutation in a consanguineous Chinese family with APS-1. All exons of the AIRE gene and adjacent exon-intron sequences were amplified by PCR and subsequently sequenced. We identified a homozygous missense AIRE mutation c.463G>A (p.Gly155Ser in two siblings with different clinical features of APS-1. In silico splice-site prediction and minigene analysis were carried out to study the potential pathological consequence. Minigene splicing analysis and subsequent cDNA sequencing revealed that the AIRE mutation potentially compromised the recognition of the splice donor of intron 3, causing alternative pre-mRNA splicing by intron 3 retention. Furthermore, the aberrant AIRE transcript was identified in a heterozygous carrier of the c.463G>A mutation. The aberrant intron 3-retaining transcript generated a truncated protein (p.G155fsX203 containing the first 154 AIRE amino acids and followed by 48 aberrant amino acids. Therefore, our study represents the first functional characterization of the alternatively spliced AIRE mutation that may explain the pathogenetic role in APS-1.

[Novel nonsense mutation (p.Y113X) in the human growth hormone receptor gene in a Brazilian patient with Laron syndrome].

Science.gov (United States)

Diniz, Erik Trovão; Jorge, Alexander A L; Arnhold, Ivo J P; Rosenbloom, Arlan L; Bandeira, Francisco

2008-11-01

To date, about sixty different mutations within GH receptor (GHR) gene have been described in patients with GH insensitivity syndrome (GHI). In this report, we described a novel nonsense mutation of GHR. The patient was evaluated at the age of 6 yr, for short stature associated to clinical phenotype of GHI. GH, IGF-1, and GHBP levels were determined. The PCR products from exons 2-10 were sequenced. The patient had high GH (26 microg/L), low IGF-1 (22.5 ng/ml) and undetectable GHBP levels. The sequencing of GHR exon 5 disclosed adenine duplication at nucleotide 338 of GHR coding sequence (c.338dupA) in homozygous state. We described a novel mutation that causes a truncated GHR and a loss of receptor function due to the lack of amino acids comprising the transmembrane and intracellular regions of GHR protein, leading to GHI.

Two Mutations in Surfactant Protein C Gene Associated with Neonatal Respiratory Distress

Directory of Open Access Journals (Sweden)

Anna Tarocco

2015-01-01

Full Text Available Multiple mutations of surfactant genes causing surfactant dysfunction have been described. Surfactant protein C (SP-C deficiency is associated with variable clinical manifestations ranging from neonatal respiratory distress syndrome to lethal lung disease. We present an extremely low birth weight male infant with an unusual course of respiratory distress syndrome associated with two mutations in the SFTPC gene: C43-7G>A and 12T>A. He required mechanical ventilation for 26 days and was treated with 5 subsequent doses of surfactant with temporary and short-term efficacy. He was discharged at 37 weeks of postconceptional age without any respiratory support. During the first 16 months of life he developed five respiratory infections that did not require hospitalization. Conclusion. This mild course in our patient with two mutations is peculiar because the outcome in patients with a single SFTPC mutation is usually poor.

Charge neutralization as the major factor for the assembly of nucleocapsid-like particles from C-terminal truncated hepatitis C virus core protein

Directory of Open Access Journals (Sweden)

Theo Luiz Ferraz de Souza

2016-11-01

Full Text Available Background Hepatitis C virus (HCV core protein, in addition to its structural role to form the nucleocapsid assembly, plays a critical role in HCV pathogenesis by interfering in several cellular processes, including microRNA and mRNA homeostasis. The C-terminal truncated HCV core protein (C124 is intrinsically unstructured in solution and is able to interact with unspecific nucleic acids, in the micromolar range, and to assemble into nucleocapsid-like particles (NLPs in vitro. The specificity and propensity of C124 to the assembly and its implications on HCV pathogenesis are not well understood. Methods Spectroscopic techniques, transmission electron microscopy and calorimetry were used to better understand the propensity of C124 to fold or to multimerize into NLPs when subjected to different conditions or in the presence of unspecific nucleic acids of equivalent size to cellular microRNAs. Results The structural analysis indicated that C124 has low propensity to self-folding. On the other hand, for the first time, we show that C124, in the absence of nucleic acids, multimerizes into empty NLPs when subjected to a pH close to its isoelectric point (pH ≈ 12, indicating that assembly is mainly driven by charge neutralization. Isothermal calorimetry data showed that the assembly of NLPs promoted by nucleic acids is enthalpy driven. Additionally, data obtained from fluorescence correlation spectroscopy show that C124, in nanomolar range, was able to interact and to sequester a large number of short unspecific nucleic acids into NLPs. Discussion Together, our data showed that the charge neutralization is the major factor for the nucleocapsid-like particles assembly from C-terminal truncated HCV core protein. This finding suggests that HCV core protein may physically interact with unspecific cellular polyanions, which may correspond to microRNAs and mRNAs in a host cell infected by HCV, triggering their confinement into infectious particles.

A novel CDKL5 mutation in a 47,XXY boy with the early-onset seizure variant of Rett syndrome.

Science.gov (United States)

Sartori, Stefano; Di Rosa, Gabriella; Polli, Roberta; Bettella, Elisa; Tricomi, Giovanni; Tortorella, Gaetano; Murgia, Alessandra

2009-02-01

Mutations of the cyclin-dependent kinase-like 5 gene (CDKL5), reported almost exclusively in female subjects, have been recently found to be the cause of a phenotype overlapping Rett syndrome with early-onset epileptic encephalopathy. We describe the first CDKL5 mutation detected in a male individual with 47,XXY karyotype. This previously unreported, de novo, mutation truncates the large CDKL5 COOH-terminal region, thought to be crucial for the proper sub-cellular localization of the CDKL5 protein. The resulting phenotype is characterized by a severe early-onset epileptic encephalopathy, global developmental delay, and profound intellectual and motor impairment with features reminiscent of Rett syndrome. In light of the data presented we discuss the possible phenotypic modulatory effects of the supernumerary wild type X allele and pattern of X chromosome inactivation and stress the importance of considering the causal involvement of CDKL5 in developmentally delayed males with early-onset seizures. (c) 2009 Wiley-Liss, Inc.

A Founder Mutation in VPS11 Causes an Autosomal Recessive Leukoencephalopathy Linked to Autophagic Defects.

Directory of Open Access Journals (Sweden)

Jinglan Zhang

2016-04-01

Full Text Available Genetic leukoencephalopathies (gLEs are a group of heterogeneous disorders with white matter abnormalities affecting the central nervous system (CNS. The causative mutation in ~50% of gLEs is unknown. Using whole exome sequencing (WES, we identified homozygosity for a missense variant, VPS11: c.2536T>G (p.C846G, as the genetic cause of a leukoencephalopathy syndrome in five individuals from three unrelated Ashkenazi Jewish (AJ families. All five patients exhibited highly concordant disease progression characterized by infantile onset leukoencephalopathy with brain white matter abnormalities, severe motor impairment, cortical blindness, intellectual disability, and seizures. The carrier frequency of the VPS11: c.2536T>G variant is 1:250 in the AJ population (n = 2,026. VPS11 protein is a core component of HOPS (homotypic fusion and protein sorting and CORVET (class C core vacuole/endosome tethering protein complexes involved in membrane trafficking and fusion of the lysosomes and endosomes. The cysteine 846 resides in an evolutionarily conserved cysteine-rich RING-H2 domain in carboxyl terminal regions of VPS11 proteins. Our data shows that the C846G mutation causes aberrant ubiquitination and accelerated turnover of VPS11 protein as well as compromised VPS11-VPS18 complex assembly, suggesting a loss of function in the mutant protein. Reduced VPS11 expression leads to an impaired autophagic activity in human cells. Importantly, zebrafish harboring a vps11 mutation with truncated RING-H2 domain demonstrated a significant reduction in CNS myelination following extensive neuronal death in the hindbrain and midbrain. Thus, our study reveals a defect in VPS11 as the underlying etiology for an autosomal recessive leukoencephalopathy disorder associated with a dysfunctional autophagy-lysosome trafficking pathway.

Perspective on rainbow-ladder truncation

International Nuclear Information System (INIS)

Eichmann, G.; Alkofer, R.; Krassnigg, A.; Cloeet, I. C.; Roberts, C. D.

2008-01-01

Prima facie the systematic implementation of corrections to the rainbow-ladder truncation of QCD's Dyson-Schwinger equations will uniformly reduce in magnitude those calculated mass-dimensioned results for pseudoscalar and vector meson properties that are not tightly constrained by symmetries. The aim and interpretation of studies employing rainbow-ladder truncation are reconsidered in this light

Phenotype and genotype in 52 patients with Rubinstein-Taybi syndrome caused by EP300 mutations.

Science.gov (United States)

Fergelot, Patricia; Van Belzen, Martine; Van Gils, Julien; Afenjar, Alexandra; Armour, Christine M; Arveiler, Benoit; Beets, Lex; Burglen, Lydie; Busa, Tiffany; Collet, Marie; Deforges, Julie; de Vries, Bert B A; Dominguez Garrido, Elena; Dorison, Nathalie; Dupont, Juliette; Francannet, Christine; Garciá-Minaúr, Sixto; Gabau Vila, Elisabeth; Gebre-Medhin, Samuel; Gener Querol, Blanca; Geneviève, David; Gérard, Marion; Gervasini, Cristina Giovanna; Goldenberg, Alice; Josifova, Dragana; Lachlan, Katherine; Maas, Saskia; Maranda, Bruno; Moilanen, Jukka S; Nordgren, Ann; Parent, Philippe; Rankin, Julia; Reardon, Willie; Rio, Marlène; Roume, Joëlle; Shaw, Adam; Smigiel, Robert; Sojo, Amaia; Solomon, Benjamin; Stembalska, Agnieszka; Stumpel, Constance; Suarez, Francisco; Terhal, Paulien; Thomas, Simon; Touraine, Renaud; Verloes, Alain; Vincent-Delorme, Catherine; Wincent, Josephine; Peters, Dorien J M; Bartsch, Oliver; Larizza, Lidia; Lacombe, Didier; Hennekam, Raoul C

2016-12-01

Rubinstein-Taybi syndrome (RSTS) is a developmental disorder characterized by a typical face and distal limbs abnormalities, intellectual disability, and a vast number of other features. Two genes are known to cause RSTS, CREBBP in 60% and EP300 in 8-10% of clinically diagnosed cases. Both paralogs act in chromatin remodeling and encode for transcriptional co-activators interacting with >400 proteins. Up to now 26 individuals with an EP300 mutation have been published. Here, we describe the phenotype and genotype of 42 unpublished RSTS patients carrying EP300 mutations and intragenic deletions and offer an update on another 10 patients. We compare the data to 308 individuals with CREBBP mutations. We demonstrate that EP300 mutations cause a phenotype that typically resembles the classical RSTS phenotype due to CREBBP mutations to a great extent, although most facial signs are less marked with the exception of a low-hanging columella. The limb anomalies are more similar to those in CREBBP mutated individuals except for angulation of thumbs and halluces which is very uncommon in EP300 mutated individuals. The intellectual disability is variable but typically less marked whereas the microcephaly is more common. All types of mutations occur but truncating mutations and small rearrangements are most common (86%). Missense mutations in the HAT domain are associated with a classical RSTS phenotype but otherwise no genotype-phenotype correlation is detected. Pre-eclampsia occurs in 12/52 mothers of EP300 mutated individuals versus in 2/59 mothers of CREBBP mutated individuals, making pregnancy with an EP300 mutated fetus the strongest known predictor for pre-eclampsia. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

N-terminally truncated forms of human cathepsin F accumulate in aggresome-like inclusions.

Science.gov (United States)

Jerič, Barbara; Dolenc, Iztok; Mihelič, Marko; Klarić, Martina; Zavašnik-Bergant, Tina; Gunčar, Gregor; Turk, Boris; Turk, Vito; Stoka, Veronika

2013-10-01

The contribution of individual cysteine cathepsins as positive mediators of programmed cell death is dependent on several factors, such as the type of stimuli, intensity and duration of the stimulus, and cell type involved. Of the eleven human cysteine cathepsins, cathepsin F is the only cathepsin that exhibits an extended N-terminal proregion, which contains a cystatin-like domain. We predicted that the wild-type human cathepsin F contains three natively disordered regions within the enzyme's propeptide and various amino acid stretches with high fibrillation propensity. Wild-type human cathepsin F and its N-terminally truncated forms, Ala(20)-Asp(484) (Δ(19)CatF), Pro(126)-Asp(484) (Δ(125)CatF), and Met(147)-Asp(484) (Δ(146)CatF) were cloned into the pcDNA3 vector and overexpressed in HEK 293T cells. Wild-type human cathepsin F displayed a clear vesicular labeling and colocalized with the LAMP2 protein, a lysosomal marker. However, all three N-terminally truncated forms of human cathepsin F were recovered as insoluble proteins, suggesting that the deletion of at least the signal peptides (Δ(19)CatF), results in protein aggregation. Noteworthy, they concentrated large perinuclear-juxtanuclear aggregates that accumulated within aggresome-like inclusions. These inclusions showed p62-positive immunoreactivity and were colocalized with the autophagy marker LC3B, but not with the LAMP2 protein. In addition, an approximately 2-3 fold increase in DEVDase activity was not sufficient to induce apoptotic cell death. These results suggested the clearance of the N-terminally truncated forms of human cathepsin F via the autophagy pathway, underlying its protective and prosurvival mechanisms. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

Vacuolar Protein Sorting Genes in Parkinson's Disease: A Re-appraisal of Mutations Detection Rate and Neurobiology of Disease.

Science.gov (United States)

Gambardella, Stefano; Biagioni, Francesca; Ferese, Rosangela; Busceti, Carla L; Frati, Alessandro; Novelli, Giuseppe; Ruggieri, Stefano; Fornai, Francesco

2016-01-01

Mammalian retromers play a critical role in protein trans-membrane sorting from endosome to the trans-Golgi network (TGN). Recently, retromer alterations have been related to the onset of Parkinson's Disease (PD) since the variant p.Asp620Asn in VPS35 (Vacuolar Protein Sorting 35) was identified as a cause of late onset PD. This variant causes a primary defect in endosomal trafficking and retromers formation. Other mutations in VPS genes have been reported in both sporadic and familial PD. These mutations are less defined. Understanding the specific prevalence of all VPS gene mutations is key to understand the relevance of retromers impairment in the onset of PD. A number of PD-related mutations despite affecting different biochemical systems (autophagy, mitophagy, proteasome, endosomes, protein folding), all converge in producing an impairment in cell clearance. This may explain how genetic predispositions to PD may derive from slightly deleterious VPS mutations when combined with environmental agents overwhelming the clearance of the cell. This manuscript reviews genetic data produced in the last 5 years to re-define the actual prevalence of VPS gene mutations in the onset of PD. The prevalence of p.Asp620Asn mutation in VPS35 is 0.286 of familial PD. This increases up to 0.548 when considering mutations affecting all VPS genes. This configures mutations in VPS genes as the second most frequent autosomal dominant PD genotype. This high prevalence, joined with increased awareness of the role played by retromers in the neurobiology of PD, suggests environmentally-induced VPS alterations as crucial in the genesis of PD.

Visualizing Mutation-Specific Differences in the Trafficking-Deficient Phenotype of Kv11.1 Proteins Linked to Long QT Syndrome Type 2.

Science.gov (United States)

Hall, Allison R; Anderson, Corey L; Smith, Jennifer L; Mirshahi, Tooraj; Elayi, Claude S; January, Craig T; Delisle, Brian P

2018-01-01

KCNH2 encodes the Kv11.1 α-subunit that underlies the rapidly activating delayed-rectifier K + current in the heart. Loss-of-function KCNH2 mutations cause long QT syndrome type 2 (LQT2), and most LQT2-linked missense mutations inhibit the trafficking of Kv11.1 channel protein to the cell surface membrane. Several trafficking-deficient LQT2 mutations (e.g., G601S) generate Kv11.1 proteins that are sequestered in a microtubule-dependent quality control (QC) compartment in the transitional endoplasmic reticulum (ER). We tested the hypothesis that the QC mechanisms that regulate LQT2-linked Kv11.1 protein trafficking are mutation-specific. Confocal imaging analyses of HEK293 cells stably expressing the trafficking-deficient LQT2 mutation F805C showed that, unlike G601S-Kv11.1 protein, F805C-Kv11.1 protein was concentrated in several transitional ER subcompartments. The microtubule depolymerizing drug nocodazole differentially affected G601S- and F805C-Kv11.1 protein immunostaining. Nocodazole caused G601S-Kv11.1 protein to distribute into peripheral reticular structures, and it increased the diffuse immunostaining of F805C-Kv11.1 protein around the transitional ER subcompartments. Proteasome inhibition also affected the immunostaining of G601S- and F805C-Kv11.1 protein differently. Incubating cells in MG132 minimally impacted G601S-Kv11.1 immunostaining, but it dramatically increased the diffuse immunostaining of F805C-Kv11.1 protein in the transitional ER. Similar results were seen after incubating cells in the proteasome inhibitor lactacystin. Differences in the cellular distribution of G601S-Kv11.1 and F805C-Kv11.1 protein persisted in transfected human inducible pluripotent stem cell derived cardiomyocytes. These are the first data to visually demonstrate mutation-specific differences in the trafficking-deficient LQT2 phenotype, and this study has identified a novel way to categorize trafficking-deficient LQT2 mutations based on differences in intracellular

Mutational analysis of the genome-linked protein of cowpea mosaic virus

NARCIS (Netherlands)

Carette, J.E.; Kujawa, A.; Gühl, K.; Verver, J.; Wellink, J.; Kammen, van A.

2001-01-01

In this study we have performed a mutational analysis of the cowpea mosaic comovirus (CPMV) genome-linked protein VPg to discern the structural requirements necessary for proper functioning of VPg. Either changing the serine residue linking VPg to RNA at a tyrosine or a threonine or changing the

A novel truncating AIP mutation, p.W279*, in a familial isolated pituitary adenoma (FIPA) kindred.

Science.gov (United States)

Cansu, Güven Barış; Taşkıran, Bengür; Trivellin, Giampaolo; Faucz, Fabio R; Stratakis, Constantine A

2016-07-01

Familial isolated pituitary adenomas (FIPA) constitute 2-3% of pituitary tumours. AIP is the most commonly mutated gene in FIPA. We herein report a novel germline mutation of the AIP gene in a family with FIPA. We present two patients, a father and his 12-year-old daughter, diagnosed clinically and using laboratory measures with acromegaly-gigantism. Both underwent transsphenoidal hypophyseal surgery for macroadenomas. We initially detected a novel heterozygous germline AIP mutation, c.836G>A (p.W279*), in the father's DNA. We then found the same mutation in his affected daughter. Pituitary adenomas associated with AIP mutations mostly present as FIPA (68%) at an early age (78% occur at treatment success, and genetic counseling.

Instability of buried hydration sites increases protein subdomains fluctuations in the human prion protein by the pathogenic mutation T188R

Directory of Open Access Journals (Sweden)

Katsufumi Tomobe

2016-05-01

Full Text Available The conformational change from the cellular prion protein (PrPc to scrapie prion protein (PrPsc is a key process in prion diseases. The prion protein has buried water molecules which significantly contribute to the stability of the protein; however, there has been no report investigating the influence on the buried hydration sites by a pathogenic mutation not adjacent to the buried hydration sites. Here, we perform molecular dynamics simulations of wild type (WT PrPc and pathogenic point mutant T188R to investigate conformational changes and the buried hydration sites. In WT-PrPc, four buried hydration sites are identified by residence time and rotational relaxation analysis. However, there are no stable buried hydration sites in one of T188R simulations, which indicates that T188R sometimes makes the buried hydration sites fragile. We also find that fluctuations of subdomains S1-H1-S2 and H1-H2 increase in T188R when the buried hydration sites become unstable. Since the side chain of arginine which is replaced from threonine in T188R is larger than of threonine, the side chain cannot be embedded in the protein, which is one of the causes of the instability of subdomains. These results show correlations between the buried hydration sites and the mutation which is far from them, and provide a possible explanation for the instability by mutation.

Instability of buried hydration sites increases protein subdomains fluctuations in the human prion protein by the pathogenic mutation T188R

Science.gov (United States)

Tomobe, Katsufumi; Yamamoto, Eiji; Akimoto, Takuma; Yasui, Masato; Yasuoka, Kenji

2016-05-01

The conformational change from the cellular prion protein (PrPc) to scrapie prion protein (PrPsc) is a key process in prion diseases. The prion protein has buried water molecules which significantly contribute to the stability of the protein; however, there has been no report investigating the influence on the buried hydration sites by a pathogenic mutation not adjacent to the buried hydration sites. Here, we perform molecular dynamics simulations of wild type (WT) PrPc and pathogenic point mutant T188R to investigate conformational changes and the buried hydration sites. In WT-PrPc, four buried hydration sites are identified by residence time and rotational relaxation analysis. However, there are no stable buried hydration sites in one of T188R simulations, which indicates that T188R sometimes makes the buried hydration sites fragile. We also find that fluctuations of subdomains S1-H1-S2 and H1-H2 increase in T188R when the buried hydration sites become unstable. Since the side chain of arginine which is replaced from threonine in T188R is larger than of threonine, the side chain cannot be embedded in the protein, which is one of the causes of the instability of subdomains. These results show correlations between the buried hydration sites and the mutation which is far from them, and provide a possible explanation for the instability by mutation.

Mutation of exposed hydrophobic amino acids to arginine to increase protein stability

OpenAIRE

Strub, Caroline; Alies, Carole; Lougarre, Andrée; Ladurantie, Caroline; Czaplicki, Jerzy; Fournier, Didier

2004-01-01

Abstract Background One strategy to increase the stability of proteins is to reduce the area of water-accessible hydrophobic surface. Results In order to test it, we replaced 14 solvent-exposed hydrophobic residues of acetylcholinesterase by arginine. The stabilities of the resulting proteins were tested using denaturation by high temperature, organic solvents, urea and by proteolytic digestion. Conclusion Altough the mutational effects were rather small, this strategy proved to be successful...

Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome

Directory of Open Access Journals (Sweden)

Srivastava Satish

2003-07-01

Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.

A plastome mutation affects processing of both chloroplast and nuclear DNA-encoded plastid proteins.

Science.gov (United States)

Johnson, E M; Schnabelrauch, L S; Sears, B B

1991-01-01

Immunoblotting of a chloroplast mutant (pm7) of Oenothera showed that three proteins, cytochrome f and the 23 kDa and 16 kDa subunits of the oxygen-evolving subcomplex of photosystem II, were larger than the corresponding mature proteins of the wild type and, thus, appear to be improperly processed in pm7. The mutant is also chlorotic and has little or no internal membrane development in the plastids. The improperly processed proteins, and other proteins that are completely missing, represent products of both the plastid and nuclear genomes. To test for linkage of these defects, a green revertant of pm7 was isolated from cultures in which the mutant plastids were maintained in a nuclear background homozygous for the plastome mutator (pm) gene. In this revertant, all proteins analyzed co-reverted to the wild-type condition, indicating that a single mutation in a plastome gene is responsible for the complex phenotype of pm7. These results suggest that the defect in pm7 lies in a gene that affects a processing protease encoded in the chloroplast genome.

Clustered survival data with left-truncation

DEFF Research Database (Denmark)

Eriksson, Frank; Martinussen, Torben; Scheike, Thomas H.

2015-01-01

Left-truncation occurs frequently in survival studies, and it is well known how to deal with this for univariate survival times. However, there are few results on how to estimate dependence parameters and regression effects in semiparametric models for clustered survival data with delayed entry....... Surprisingly, existing methods only deal with special cases. In this paper, we clarify different kinds of left-truncation and suggest estimators for semiparametric survival models under specific truncation schemes. The large-sample properties of the estimators are established. Small-sample properties...

The effect of driving force on intramolecular electron transfer in proteins. Studies on single-site mutated azurins

DEFF Research Database (Denmark)

Farver, O; Skov, L K; van de Kamp, M

1992-01-01

-6972]. To further investigate the nature of this long-range electron transfer (LRET) proceeding within the protein matrix, we have now investigated it in two azurins where amino acids have been substituted by single-site mutation of the wild-type Pseudomonas aeruginosa azurin. In one mutated protein, a methionine...... the reorganization energy, lambda and electronic coupling factor, beta. The calculated values fit very well with a through-bond LRET mechanism....

Identification of a novel mutation in a Chinese family with Nance-Horan syndrome by whole exome sequencing*

Science.gov (United States)

Hong, Nan; Chen, Yan-hua; Xie, Chen; Xu, Bai-sheng; Huang, Hui; Li, Xin; Yang, Yue-qing; Huang, Ying-ping; Deng, Jian-lian; Qi, Ming; Gu, Yang-shun

2014-01-01

Objective: Nance-Horan syndrome (NHS) is a rare X-linked disorder characterized by congenital nuclear cataracts, dental anomalies, and craniofacial dysmorphisms. Mental retardation was present in about 30% of the reported cases. The purpose of this study was to investigate the genetic and clinical features of NHS in a Chinese family. Methods: Whole exome sequencing analysis was performed on DNA from an affected male to scan for candidate mutations on the X-chromosome. Sanger sequencing was used to verify these candidate mutations in the whole family. Clinical and ophthalmological examinations were performed on all members of the family. Results: A combination of exome sequencing and Sanger sequencing revealed a nonsense mutation c.322G>T (E108X) in exon 1 of NHS gene, co-segregating with the disease in the family. The nonsense mutation led to the conversion of glutamic acid to a stop codon (E108X), resulting in truncation of the NHS protein. Multiple sequence alignments showed that codon 108, where the mutation (c.322G>T) occurred, was located within a phylogenetically conserved region. The clinical features in all affected males and female carriers are described in detail. Conclusions: We report a nonsense mutation c.322G>T (E108X) in a Chinese family with NHS. Our findings broaden the spectrum of NHS mutations and provide molecular insight into future NHS clinical genetic diagnosis. PMID:25091991

Identification of a novel mutation in a Chinese family with Nance-Horan syndrome by whole exome sequencing.

Science.gov (United States)

Hong, Nan; Chen, Yan-hua; Xie, Chen; Xu, Bai-sheng; Huang, Hui; Li, Xin; Yang, Yue-qing; Huang, Ying-ping; Deng, Jian-lian; Qi, Ming; Gu, Yang-shun

2014-08-01

Nance-Horan syndrome (NHS) is a rare X-linked disorder characterized by congenital nuclear cataracts, dental anomalies, and craniofacial dysmorphisms. Mental retardation was present in about 30% of the reported cases. The purpose of this study was to investigate the genetic and clinical features of NHS in a Chinese family. Whole exome sequencing analysis was performed on DNA from an affected male to scan for candidate mutations on the X-chromosome. Sanger sequencing was used to verify these candidate mutations in the whole family. Clinical and ophthalmological examinations were performed on all members of the family. A combination of exome sequencing and Sanger sequencing revealed a nonsense mutation c.322G>T (E108X) in exon 1 of NHS gene, co-segregating with the disease in the family. The nonsense mutation led to the conversion of glutamic acid to a stop codon (E108X), resulting in truncation of the NHS protein. Multiple sequence alignments showed that codon 108, where the mutation (c.322G>T) occurred, was located within a phylogenetically conserved region. The clinical features in all affected males and female carriers are described in detail. We report a nonsense mutation c.322G>T (E108X) in a Chinese family with NHS. Our findings broaden the spectrum of NHS mutations and provide molecular insight into future NHS clinical genetic diagnosis.

Carboxyl-terminal Truncations of ClC-Kb Abolish Channel Activation by Barttin Via Modified Common Gating and Trafficking.

Science.gov (United States)

Stölting, Gabriel; Bungert-Plümke, Stefanie; Franzen, Arne; Fahlke, Christoph

2015-12-18

ClC-K chloride channels are crucial for auditory transduction and urine concentration. Mutations in CLCNKB, the gene encoding the renal chloride channel hClC-Kb, cause Bartter syndrome type III, a human genetic condition characterized by polyuria, hypokalemia, and alkalosis. In recent years, several Bartter syndrome-associated mutations have been described that result in truncations of the intracellular carboxyl terminus of hClC-Kb. We here used a combination of whole-cell patch clamp, confocal imaging, co-immunoprecipitation, and surface biotinylation to study the functional consequences of a frequent CLCNKB mutation that creates a premature stop codon at Trp-610. We found that W610X leaves the association of hClC-Kb and the accessory subunit barttin unaffected, but impairs its regulation by barttin. W610X attenuates hClC-Kb surface membrane insertion. Moreover, W610X results in hClC-Kb channel opening in the absence of barttin and prevents further barttin-mediated activation. To describe how the carboxyl terminus modifies the regulation by barttin we used V166E rClC-K1. V166E rClC-K1 is active without barttin and exhibits prominent, barttin-regulated voltage-dependent gating. Electrophysiological characterization of truncated V166E rClC-K1 demonstrated that the distal carboxyl terminus is necessary for slow cooperative gating. Since barttin modifies this particular gating process, channels lacking the distal carboxyl-terminal domain are no longer regulated by the accessory subunit. Our results demonstrate that the carboxyl terminus of hClC-Kb is not part of the binding site for barttin, but functionally modifies the interplay with barttin. The loss-of-activation of truncated hClC-Kb channels in heterologous expression systems fully explains the reduced basolateral chloride conductance in affected kidneys and the clinical symptoms of Bartter syndrome patients. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Carboxyl-terminal Truncations of ClC-Kb Abolish Channel Activation by Barttin Via Modified Common Gating and Trafficking*

Science.gov (United States)

Stölting, Gabriel; Bungert-Plümke, Stefanie; Franzen, Arne; Fahlke, Christoph

2015-01-01

ClC-K chloride channels are crucial for auditory transduction and urine concentration. Mutations in CLCNKB, the gene encoding the renal chloride channel hClC-Kb, cause Bartter syndrome type III, a human genetic condition characterized by polyuria, hypokalemia, and alkalosis. In recent years, several Bartter syndrome-associated mutations have been described that result in truncations of the intracellular carboxyl terminus of hClC-Kb. We here used a combination of whole-cell patch clamp, confocal imaging, co-immunoprecipitation, and surface biotinylation to study the functional consequences of a frequent CLCNKB mutation that creates a premature stop codon at Trp-610. We found that W610X leaves the association of hClC-Kb and the accessory subunit barttin unaffected, but impairs its regulation by barttin. W610X attenuates hClC-Kb surface membrane insertion. Moreover, W610X results in hClC-Kb channel opening in the absence of barttin and prevents further barttin-mediated activation. To describe how the carboxyl terminus modifies the regulation by barttin we used V166E rClC-K1. V166E rClC-K1 is active without barttin and exhibits prominent, barttin-regulated voltage-dependent gating. Electrophysiological characterization of truncated V166E rClC-K1 demonstrated that the distal carboxyl terminus is necessary for slow cooperative gating. Since barttin modifies this particular gating process, channels lacking the distal carboxyl-terminal domain are no longer regulated by the accessory subunit. Our results demonstrate that the carboxyl terminus of hClC-Kb is not part of the binding site for barttin, but functionally modifies the interplay with barttin. The loss-of-activation of truncated hClC-Kb channels in heterologous expression systems fully explains the reduced basolateral chloride conductance in affected kidneys and the clinical symptoms of Bartter syndrome patients. PMID:26453302

Human truncated thioredoxin (Trx80) as a novel mitogenic cytokine for white blood cells

OpenAIRE

Pekkari, Klas

2001-01-01

Thioredoxin (Trx) is a 12 kDa protein present in all species with a well-conserved active site sequence comprising -Cys-Gly-Pro-Cys-, which catalyzes oxido-reductase reactions. Trx regulates the activity of transcription factors and intracellular signalling pathways, and secreted Trx is a co-cytokine with several interleukins. In addition to full-length Trx a 10 kDa C-terminally truncated form of the protein is produced mainly by monocytes. This protein has unique eosinophil...

Pro-protein convertases control the maturation and processing of the iron-regulatory protein, RGMc/hemojuvelin

Directory of Open Access Journals (Sweden)

Rotwein Peter

2008-04-01

Full Text Available Abstract Background Repulsive guidance molecule c (RGMc or hemojuvelin, a glycosylphosphatidylinositol-linked glycoprotein expressed in liver and striated muscle, plays a central role in systemic iron balance. Inactivating mutations in the RGMc gene cause juvenile hemochromatosis (JH, a rapidly progressing iron storage disorder with severe systemic manifestations. RGMc undergoes complex biosynthetic steps leading to membrane-bound and soluble forms of the protein, including both 50 and 40 kDa single-chain species. Results We now show that pro-protein convertases (PC are responsible for conversion of 50 kDa RGMc to a 40 kDa protein with a truncated COOH-terminus. Unlike related molecules RGMa and RGMb, RGMc encodes a conserved PC recognition and cleavage site, and JH-associated RGMc frame-shift mutants undergo COOH-terminal cleavage only if this site is present. A cell-impermeable peptide PC inhibitor blocks the appearance of 40 kDa RGMc in extra-cellular fluid, as does an engineered mutation in the conserved PC recognition sequence, while the PC furin cleaves 50 kDa RGMc in vitro into a 40 kDa molecule with an intact NH2-terminus. Iron loading reduces release of RGMc from the cell membrane, and diminishes accumulation of the 40 kDa species in cell culture medium. Conclusion Our results define a role for PCs in the maturation of RGMc that may have implications for the physiological actions of this critical iron-regulatory protein.

Ancestral mutations as a tool for solubilizing proteins: The case of a hydrophobic phosphate-binding protein

Directory of Open Access Journals (Sweden)

Daniel Gonzalez

2014-01-01

Full Text Available Stable and soluble proteins are ideal candidates for functional and structural studies. Unfortunately, some proteins or enzymes can be difficult to isolate, being sometimes poorly expressed in heterologous systems, insoluble and/or unstable. Numerous methods have been developed to address these issues, from the screening of various expression systems to the modification of the target protein itself. Here we use a hydrophobic, aggregation-prone, phosphate-binding protein (HPBP as a case study. We describe a simple and fast method that selectively uses ancestral mutations to generate a soluble, stable and functional variant of the target protein, here named sHPBP. This variant is highly expressed in Escherichia coli, is easily purified and its structure was solved at much higher resolution than its wild-type progenitor (1.3 versus 1.9 Å, respectively.

A truncated receptor-binding domain of MERS-CoV spike protein potently inhibits MERS-CoV infection and induces strong neutralizing antibody responses: implication for developing therapeutics and vaccines.

Directory of Open Access Journals (Sweden)

Lanying Du

Full Text Available An emerging respiratory infectious disease with high mortality, Middle East respiratory syndrome (MERS, is caused by a novel coronavirus (MERS-CoV. It was first reported in 2012 in Saudi Arabia and has now spread to eight countries. Development of effective therapeutics and vaccines is crucial to save lives and halt the spread of MERS-CoV. Here, we show that a recombinant protein containing a 212-amino acid fragment (residues 377-588 in the truncated receptor-binding domain (RBD: residues 367-606 of MERS-CoV spike (S protein fused with human IgG Fc fragment (S377-588-Fc is highly expressed in the culture supernatant of transfected 293T cells. The purified S377-588-Fc protein efficiently binds to dipeptidyl peptidase 4 (DPP4, the receptor of MERS-CoV, and potently inhibited MERS-CoV infection, suggesting its potential to be further developed as a therapeutic modality for treating MERS-CoV infection and saving the patients' lives. The recombinant S377-588-Fc is able to induce in the vaccinated mice strong MERS-CoV S-specific antibodies, which blocks the binding of RBD to DPP4 receptor and effectively neutralizes MERS-CoV infection. These findings indicate that this truncated RBD protein shows promise for further development as an effective and safe vaccine for the prevention of MERS-CoV infection.

AIP mutations in Brazilian patients with sporadic pituitary adenomas: a single-center evaluation

Science.gov (United States)

Kasuki, Leandro; de Azeredo Lima, Carlos Henrique; Ogino, Liana; Camacho, Aline H S; Chimelli, Leila; Korbonits, Márta

2017-01-01

Aryl hydrocarbon receptor-interacting protein (AIP) gene mutations (AIPmut) are the most frequent germline mutations found in apparently sporadic pituitary adenomas (SPA). Our aim was to evaluate the frequency of AIPmut among young Brazilian patients with SPA. We performed an observational cohort study between 2013 and 2016 in a single referral center. AIPmut screening was carried out in 132 SPA patients with macroadenomas diagnosed up to 40 years or in adenomas of any size diagnosed until 18 years of age. Twelve tumor samples were also analyzed. Leukocyte DNA and tumor tissue DNA were sequenced for the entire AIP-coding region for evaluation of mutations. Eleven (8.3%) of the 132 patients had AIPmut, comprising 9/74 (12%) somatotropinomas, 1/38 (2.6%) prolactinoma, 1/10 (10%) corticotropinoma and no non-functioning adenomas. In pediatric patients (≤18 years), AIPmut frequency was 13.3% (2/15). Out of the 5 patients with gigantism, two had AIPmut, both truncating mutations. The Y268* mutation was described in Brazilian patients and the K273Rfs*30 mutation is a novel mutation in our patient. No somatic AIP mutations were found in the 12 tumor samples. A tumor sample from an acromegaly patient harboring the A299V AIPmut showed loss of heterozygosity. In conclusion, AIPmut frequency in SPA Brazilian patients is similar to other populations. Our study identified two mutations exclusively found in Brazilians and also shows, for the first time, loss of heterozygosity in tumor DNA from an acromegaly patient harboring the A299V AIPmut. Our findings corroborate previous observations that AIPmut screening should be performed in young patients with SPA. PMID:29074612

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

Science.gov (United States)

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-07-15

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

Science.gov (United States)

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

Inactivating mutations in ESCO2 cause SC phocomelia and Roberts syndrome: no phenotype-genotype correlation.

Science.gov (United States)

Schüle, Birgitt; Oviedo, Angelica; Johnston, Kathreen; Pai, Shashidhar; Francke, Uta

2005-12-01

The rare, autosomal recessive Roberts syndrome (RBS) is characterized by tetraphocomelia, profound growth deficiency of prenatal onset, craniofacial anomalies, microcephaly, and mental deficiency. SC phocomelia (SC) has a milder phenotype, with a lesser degree of limb reduction and with survival to adulthood. Since heterochromatin repulsion (HR) is characteristic for both disorders and is not complemented in somatic-cell hybrids, it has been hypothesized that the disorders are allelic. Recently, mutations in ESCO2 (establishment of cohesion 1 homolog 2) on 8p21.1 have been reported in RBS. To determine whether ESCO2 mutations are also responsible for SC, we studied three families with SC and two families in which variable degrees of limb and craniofacial abnormalities, detected by fetal ultrasound, led to pregnancy terminations. All cases were positive for HR. We identified seven novel mutations in exons 3-8 of ESCO2. In two families, affected individuals were homozygous--for a 5-nucleotide deletion in one family and a splice-site mutation in the other. In three nonconsanguineous families, probands were compound heterozygous for a single-nucleotide insertion or deletion, a nonsense mutation, or a splice-site mutation. Abnormal splice products were characterized at the RNA level. Since only protein-truncating mutations were identified, regardless of clinical severity, we conclude that genotype does not predict phenotype. Having established that RBS and SC are caused by mutations in the same gene, we delineated the clinical phenotype of the tetraphocomelia spectrum that is associated with HR and ESCO2 mutations and differentiated it from other types of phocomelia that are negative for HR.

Molecular Diagnostics of Copper-Transporting Protein Mutations Allows Early Onset Individual Therapy of Menkes Disease.

Science.gov (United States)

Králík, L; Flachsová, E; Hansíková, H; Saudek, V; Zeman, J; Martásek, P

2017-01-01

Menkes disease is a severe X-linked recessive disorder caused by a defect in the ATP7A gene, which encodes a membrane copper-transporting ATPase. Deficient activity of the ATP7A protein results in decreased intestinal absorption of copper, low copper level in serum and defective distribution of copper in tissues. The clinical symptoms are caused by decreased activities of copper-dependent enzymes and include neurodegeneration, connective tissue disorders, arterial changes and hair abnormalities. Without therapy, the disease is fatal in early infancy. Rapid diagnosis of Menkes disease and early start of copper therapy is critical for the effectiveness of treatment. We report a molecular biology-based strategy that allows early diagnosis of copper transport defects and implementation of individual therapies before the full development of pathological symptoms. Low serum copper and decreased activity of copperdependent mitochondrial cytochrome c oxidase in isolated platelets found in three patients indicated a possibility of functional defects in copper-transporting proteins, especially in the ATPA7 protein, a copper- transporting P-type ATPase. Rapid mutational screening of the ATP7A gene using high-resolution melting analysis of DNA indicated presence of mutations in the patients. Molecular investigation for mutations in the ATP7A gene revealed three nonsense mutations: c.2170C>T (p.Gln724Ter); c.3745G>T (p.Glu1249Ter); and c.3862C>T (p.Gln1288Ter). The mutation c.3745G>T (p.Glu1249Ter) has not been identified previously. Molecular analysis of the ATOX1 gene as a possible modulating factor of Menkes disease did not reveal presence of pathogenic mutations. Molecular diagnostics allowed early onset of individual therapies, adequate genetic counselling and prenatal diagnosis in the affected families.

Identification and functional analysis of SOX10 missense mutations in different subtypes of Waardenburg syndrome.

Science.gov (United States)

Chaoui, Asma; Watanabe, Yuli; Touraine, Renaud; Baral, Viviane; Goossens, Michel; Pingault, Veronique; Bondurand, Nadege

2011-12-01

Waardenburg syndrome (WS) is a rare disorder characterized by pigmentation defects and sensorineural deafness, classified into four clinical subtypes, WS1-S4. Whereas the absence of additional features characterizes WS2, association with Hirschsprung disease defines WS4. WS is genetically heterogeneous, with six genes already identified, including SOX10. About 50 heterozygous SOX10 mutations have been described in patients presenting with WS2 or WS4, with or without myelination defects of the peripheral and central nervous system (PCWH, Peripheral demyelinating neuropathy-Central dysmyelinating leukodystrophy-Waardenburg syndrome-Hirschsprung disease, or PCW, PCWH without HD). The majority are truncating mutations that most often remove the main functional domains of the protein. Only three missense mutations have been thus far reported. In the present study, novel SOX10 missense mutations were found in 11 patients and were examined for effects on SOX10 characteristics and functions. The mutations were associated with various phenotypes, ranging from WS2 to PCWH. All tested mutations were found to be deleterious. Some mutants presented with partial cytoplasmic redistribution, some lost their DNA-binding and/or transactivation capabilities on various tissue-specific target genes. Intriguingly, several mutants were redistributed in nuclear foci. Whether this phenomenon is a cause or a consequence of mutation-associated pathogenicity remains to be determined, but this observation could help to identify new SOX10 modes of action. © 2011 Wiley-Liss, Inc.

Mutation in WNT10A is associated with an autosomal recessive ectodermal dysplasia: the odonto-onycho-dermal dysplasia.

Science.gov (United States)

Adaimy, Lynn; Chouery, Eliane; Megarbane, Hala; Mroueh, Salman; Delague, Valerie; Nicolas, Elsa; Belguith, Hanen; de Mazancourt, Philippe; Megarbane, Andre

2007-10-01

Odonto-onycho-dermal dysplasia is a rare autosomal recessive syndrome in which the presenting phenotype is dry hair, severe hypodontia, smooth tongue with marked reduction of fungiform and filiform papillae, onychodysplasia, keratoderma and hyperhidrosis of palms and soles, and hyperkeratosis of the skin. We studied three consanguineous Lebanese Muslim Shiite families that included six individuals affected with odonto-onycho-dermal dysplasia. Using a homozygosity-mapping strategy, we assigned the disease locus to an ~9-cM region at chromosome 2q35-q36.2, located between markers rs16853834 and D2S353, with a maximum multipoint LOD score of 5.7. Screening of candidate genes in this region led us to identify the same c.697G-->T (p.Glu233X) homozygous nonsense mutation in exon 3 of the WNT10A gene in all patients. At the protein level, the mutation is predicted to result in a premature truncated protein of 232 aa instead of 417 aa. This is the first report to our knowledge of a human phenotype resulting from a mutation in WNT10A, and it is the first demonstration of an ectodermal dysplasia caused by an altered WNT signaling pathway, expanding the list of WNT-related diseases.

Vacuolar Protein Sorting Genes in Parkinson's Disease: A Re-appraisal of Mutations Detection Rate and Neurobiology of Disease

Science.gov (United States)

Gambardella, Stefano; Biagioni, Francesca; Ferese, Rosangela; Busceti, Carla L.; Frati, Alessandro; Novelli, Giuseppe; Ruggieri, Stefano; Fornai, Francesco

2016-01-01

Mammalian retromers play a critical role in protein trans-membrane sorting from endosome to the trans-Golgi network (TGN). Recently, retromer alterations have been related to the onset of Parkinson's Disease (PD) since the variant p.Asp620Asn in VPS35 (Vacuolar Protein Sorting 35) was identified as a cause of late onset PD. This variant causes a primary defect in endosomal trafficking and retromers formation. Other mutations in VPS genes have been reported in both sporadic and familial PD. These mutations are less defined. Understanding the specific prevalence of all VPS gene mutations is key to understand the relevance of retromers impairment in the onset of PD. A number of PD-related mutations despite affecting different biochemical systems (autophagy, mitophagy, proteasome, endosomes, protein folding), all converge in producing an impairment in cell clearance. This may explain how genetic predispositions to PD may derive from slightly deleterious VPS mutations when combined with environmental agents overwhelming the clearance of the cell. This manuscript reviews genetic data produced in the last 5 years to re-define the actual prevalence of VPS gene mutations in the onset of PD. The prevalence of p.Asp620Asn mutation in VPS35 is 0.286 of familial PD. This increases up to 0.548 when considering mutations affecting all VPS genes. This configures mutations in VPS genes as the second most frequent autosomal dominant PD genotype. This high prevalence, joined with increased awareness of the role played by retromers in the neurobiology of PD, suggests environmentally-induced VPS alterations as crucial in the genesis of PD. PMID:27932943

Expression of G(alpha)(s) proteins and TSH receptor signalling in hyperfunctioning thyroid nodules with TSH receptor mutations.

Science.gov (United States)

Holzapfel, Hans-Peter; Bergner, Beate; Wonerow, Peter; Paschke, Ralf

2002-07-01

Constitutively activating mutations of the thyrotrophin receptor (TSHR) are the main molecular cause of hyperfunctioning thyroid nodules (HTNs). The G protein coupling is an important and critical step in the TSHR signalling which mainly includes G(alpha)(s), G(alpha)(i) and G(alpha)(q)/11 proteins. We investigated the in vitro consequences of overexpressing G(alpha) proteins on signalling of the wild-type (WT) or mutated TSHR. Moreover, we investigated whether changes in G(alpha) protein expression are pathophysiologically relevant in HTNs or cold thyroid nodules (CTNs). Wild-type TSH receptor and mutated TSH receptors were coexpressed with G(alpha)(s), G(alpha)(i) or G(alpha)(q)/11, and cAMP and inositol phosphate (IP) production was measured after stimulation with TSH. The expression of G(alpha)(s), G(alpha)(i) and G(alpha)(q)/11 proteins was examined by Western blotting in 28 HTNs and 14 CTNs. Coexpression of G(alpha)(s) with the WT TSH receptor in COS 7 cells significantly increased the basal and TSH-stimulated cAMP accumulation while coexpression of the G(alpha)(q) or G(alpha)11 protein significantly increased the production of cAMP and inositol triphosphate (IP(3)). The coexpression of the TSH receptor mutants (I486F, DEL613-621), known to couple constitutively to G(alpha)(s) and G(alpha)(q) with G(alpha)(s) and G(alpha)(q)/11, significantly increased the basal and stimulated cAMP and IP(3) accumulation. Coexpression of the TSH receptor mutant V556F with G(alpha)(s) only increased the basal and stimulated cAMP production while its coexpression with G(alpha)(q)/11 increased the basal and stimulated IP(3) signalling. The expression of G(alpha)(s) protein subunits determined by Western blotting was significantly decreased in 14 HTNs with a constitutively activating TSH receptor mutation in comparison with the corresponding surrounding tissue, while in 14 HTNs without TSH receptor or G(alpha)(s) protein mutation and in 14 CTNs the expression of G

Homology-guided mutational analysis reveals the functional requirements for antinociceptive specificity of collapsin response mediator protein 2-derived peptides.

Science.gov (United States)

Moutal, Aubin; Li, Wennan; Wang, Yue; Ju, Weina; Luo, Shizhen; Cai, Song; François-Moutal, Liberty; Perez-Miller, Samantha; Hu, Jackie; Dustrude, Erik T; Vanderah, Todd W; Gokhale, Vijay; Khanna, May; Khanna, Rajesh

2017-02-05

N-type voltage-gated calcium (Ca v 2.2) channels are critical determinants of increased neuronal excitability and neurotransmission accompanying persistent neuropathic pain. Although Ca v 2.2 channel antagonists are recommended as first-line treatment for neuropathic pain, calcium-current blocking gabapentinoids inadequately alleviate chronic pain symptoms and often exhibit numerous side effects. Collapsin response mediator protein 2 (CRMP2) targets Ca v 2.2 channels to the sensory neuron membrane and allosterically modulates their function. A 15-amino-acid peptide (CBD3), derived from CRMP2, disrupts the functional protein-protein interaction between CRMP2 and Ca v 2.2 channels to inhibit calcium influx, transmitter release and acute, inflammatory and neuropathic pain. Here, we have mapped the minimal domain of CBD3 necessary for its antinociceptive potential. Truncated as well as homology-guided mutant versions of CBD3 were generated and assessed using depolarization-evoked calcium influx in rat dorsal root ganglion neurons, binding between CRMP2 and Ca v 2.2 channels, whole-cell voltage clamp electrophysiology and behavioural effects in two models of experimental pain: post-surgical pain and HIV-induced sensory neuropathy induced by the viral glycoprotein 120. The first six amino acids within CBD3 accounted for all in vitro activity and antinociception. Spinal administration of a prototypical peptide (TAT-CBD3-L5M) reversed pain behaviours. Homology-guided mutational analyses of these six amino acids identified at least two residues, Ala1 and Arg4, as being critical for antinociception in two pain models. These results identify an antinociceptive scaffold core in CBD3 that can be used for development of low MW mimetics of CBD3. © 2017 The British Pharmacological Society.

Insect Resistance to Bacillus thuringiensis Toxin Cry2Ab Is Conferred by Mutations in an ABC Transporter Subfamily A Protein.

Directory of Open Access Journals (Sweden)

Wee Tek Tay

2015-11-01

Full Text Available The use of conventional chemical insecticides and bacterial toxins to control lepidopteran pests of global agriculture has imposed significant selection pressure leading to the rapid evolution of insecticide resistance. Transgenic crops (e.g., cotton expressing the Bt Cry toxins are now used world wide to control these pests, including the highly polyphagous and invasive cotton bollworm Helicoverpa armigera. Since 2004, the Cry2Ab toxin has become widely used for controlling H. armigera, often used in combination with Cry1Ac to delay resistance evolution. Isolation of H. armigera and H. punctigera individuals heterozygous for Cry2Ab resistance in 2002 and 2004, respectively, allowed aspects of Cry2Ab resistance (level, fitness costs, genetic dominance, complementation tests to be characterised in both species. However, the gene identity and genetic changes conferring this resistance were unknown, as was the detailed Cry2Ab mode of action. No cross-resistance to Cry1Ac was observed in mutant lines. Biphasic linkage analysis of a Cry2Ab-resistant H. armigera family followed by exon-primed intron-crossing (EPIC marker mapping and candidate gene sequencing identified three independent resistance-associated INDEL mutations in an ATP-Binding Cassette (ABC transporter gene we named HaABCA2. A deletion mutation was also identified in the H. punctigera homolog from the resistant line. All mutations truncate the ABCA2 protein. Isolation of further Cry2Ab resistance alleles in the same gene from field H. armigera populations indicates unequal resistance allele frequencies and the potential for Bt resistance evolution. Identification of the gene involved in resistance as an ABC transporter of the A subfamily adds to the body of evidence on the crucial role this gene family plays in the mode of action of the Bt Cry toxins. The structural differences between the ABCA2, and that of the C subfamily required for Cry1Ac toxicity, indicate differences in the

Truncation correction for oblique filtering lines

International Nuclear Information System (INIS)

Hoppe, Stefan; Hornegger, Joachim; Lauritsch, Guenter; Dennerlein, Frank; Noo, Frederic

2008-01-01

State-of-the-art filtered backprojection (FBP) algorithms often define the filtering operation to be performed along oblique filtering lines in the detector. A limited scan field of view leads to the truncation of those filtering lines, which causes artifacts in the final reconstructed volume. In contrast to the case where filtering is performed solely along the detector rows, no methods are available for the case of oblique filtering lines. In this work, the authors present two novel truncation correction methods which effectively handle data truncation in this case. Method 1 (basic approach) handles data truncation in two successive preprocessing steps by applying a hybrid data extrapolation method, which is a combination of a water cylinder extrapolation and a Gaussian extrapolation. It is independent of any specific reconstruction algorithm. Method 2 (kink approach) uses similar concepts for data extrapolation as the basic approach but needs to be integrated into the reconstruction algorithm. Experiments are presented from simulated data of the FORBILD head phantom, acquired along a partial-circle-plus-arc trajectory. The theoretically exact M-line algorithm is used for reconstruction. Although the discussion is focused on theoretically exact algorithms, the proposed truncation correction methods can be applied to any FBP algorithm that exposes oblique filtering lines.

A search for mutations affecting protein structure in children of proximally and distally exposed atomic bomb survivors

International Nuclear Information System (INIS)

Neel, J.V.; Satoh, Chiyoko; Hamilton, H.B.; Otake, Masanori; Goriki, Kazuaki; Kageoka, Takeshi; Fujita, Mikio; Neriishi, Shotaro; Asakawa, Jun-ichi.

1981-07-01

A total of 289,868 locus tests based on 28 different protein phenotypes, employing one-dimensional electrophoresis to detect variant proteins, has yielded one probable mutation in the offspring of 'proximally exposed' parents, who received an estimated average gonadal exposure dose of between 31 and 39 rem from the atomic bombs in Hiroshima and Nagasaki. There were no mutations in 208,196 locus tests involving children of 'distally exposed' parents, who had essentially no radiation exposure. (author)

AIP mutations in Brazilian patients with sporadic pituitary adenomas: a single-center evaluation

Directory of Open Access Journals (Sweden)

Paula Bruna Araujo

2017-11-01

Full Text Available Aryl hydrocarbon receptor-interacting protein (AIP gene mutations (AIPmut are the most frequent germline mutations found in apparently sporadic pituitary adenomas (SPA. Our aim was to evaluate the frequency of AIPmut among young Brazilian patients with SPA. We performed an observational cohort study between 2013 and 2016 in a single referral center. AIPmut screening was carried out in 132 SPA patients with macroadenomas diagnosed up to 40 years or in adenomas of any size diagnosed until 18 years of age. Twelve tumor samples were also analyzed. Leukocyte DNA and tumor tissue DNA were sequenced for the entire AIP-coding region for evaluation of mutations. Eleven (8.3% of the 132 patients had AIPmut, comprising 9/74 (12% somatotropinomas, 1/38 (2.6% prolactinoma, 1/10 (10% corticotropinoma and no non-functioning adenomas. In pediatric patients (≤18 years, AIPmut frequency was 13.3% (2/15. Out of the 5 patients with gigantism, two had AIPmut, both truncating mutations. The Y268* mutation was described in Brazilian patients and the K273Rfs*30 mutation is a novel mutation in our patient. No somatic AIP mutations were found in the 12 tumor samples. A tumor sample from an acromegaly patient harboring the A299V AIPmut showed loss of heterozygosity. In conclusion, AIPmut frequency in SPA Brazilian patients is similar to other populations. Our study identified two mutations exclusively found in Brazilians and also shows, for the first time, loss of heterozygosity in tumor DNA from an acromegaly patient harboring the A299V AIPmut. Our findings corroborate previous observations that AIPmut screening should be performed in young patients with SPA.

Molecular diagnosis of analbuminemia: a new case caused by a nonsense mutation in the albumin gene.

Science.gov (United States)

Dagnino, Monica; Caridi, Gianluca; Haenni, Ueli; Duss, Adrian; Aregger, Fabienne; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo

2011-01-01

Analbuminemia is a rare autosomal recessive disorder manifested by the absence, or severe reduction, of circulating serum albumin (ALB). We report here a new case diagnosed in a 45 years old man of Southwestern Asian origin, living in Switzerland, on the basis of his low ALB concentration (0.9 g/L) in the absence of renal or gastrointestinal protein loss, or liver dysfunction. The clinical diagnosis was confirmed by a mutational analysis of the albumin (ALB) gene, carried out by single-strand conformational polymorphism (SSCP), heteroduplex analysis (HA), and DNA sequencing. This screening of the ALB gene revealed that the proband is homozygous for two mutations: the insertion of a T in a stretch of eight Ts spanning positions c.1289 + 23-c.1289 + 30 of intron 10 and a c.802 G > T transversion in exon 7. Whereas the presence of an additional T in the poly-T tract has no direct deleterious effect, the latter nonsense mutation changes the codon GAA for Glu244 to the stop codon TAA, resulting in a premature termination of the polypeptide chain. The putative protein product would have a length of only 243 amino acid residues instead of the normal 585 found in the mature serum albumin, but no evidence for the presence in serum of such a truncated polypeptide chain could be obtained by two dimensional electrophoresis and western blotting analysis.

Allelic mutations of KITLG, encoding KIT ligand, cause asymmetric and unilateral hearing loss and Waardenburg syndrome type 2

NARCIS (Netherlands)

Zazo Seco, C. (Celia); Serrão De Castro, L. (Luciana); J.W.I. van Nierop; Morín, M. (Matías); S.N. Jhangiani (Shalini N.); E.J.J. Verver (Eva J. J.); M. Schraders (Margit); Maiwald, N. (Nadine); Wesdorp, M. (Mieke); H. Venselaar (Hanka); L. Spruijt (Liesbeth); Oostrik, J. (Jaap); J. Schoots (Jeroen); J. van Reeuwijk (Jeroen); Lelieveld, S.H. (Stefan H.); P.L.M. Huygen (Patrick); Insenser, M. (María); R.J. Admiraal (Ronald); R.J.E. Pennings (Ronald J.E.); E.H. Hoefsloot (Lies); A. Arias-Vásquez (Alejandro); J. de Ligt (Joep); H.G. Yntema; Jansen, J.H. (Joop H.); D. Muzny (Donna); G. Huls (Gerwin); M.M. van Rossum (Michelle); J.R. Lupski (James R.); Moreno-Pelayo, M.A. (Miguel Angel); H.P.M. Kunst (Henricus P.M.); H. Kremer (Hannie)

2015-01-01

textabstractLinkage analysis combined with whole-exome sequencing in a large family with congenital and stable non-syndromic unilateral and asymmetric hearing loss (NS-UHL/AHL) revealed a heterozygous truncating mutation, c.286-303delinsT (p.Ser96Ter), in KITLG. This mutation co-segregated with

USP7 Is a Tumor-Specific WNT Activator for APC-Mutated Colorectal Cancer by Mediating β-Catenin Deubiquitination.

Science.gov (United States)

Novellasdemunt, Laura; Foglizzo, Valentina; Cuadrado, Laura; Antas, Pedro; Kucharska, Anna; Encheva, Vesela; Snijders, Ambrosius P; Li, Vivian S W

2017-10-17

The tumor suppressor gene adenomatous polyposis coli (APC) is mutated in most colorectal cancers (CRCs), resulting in constitutive Wnt activation. To understand the Wnt-activating mechanism of the APC mutation, we applied CRISPR/Cas9 technology to engineer various APC-truncated isogenic lines. We find that the β-catenin inhibitory domain (CID) in APC represents the threshold for pathological levels of Wnt activation and tumor transformation. Mechanistically, CID-deleted APC truncation promotes β-catenin deubiquitination through reverse binding of β-TrCP and USP7 to the destruction complex. USP7 depletion in APC-mutated CRC inhibits Wnt activation by restoring β-catenin ubiquitination, drives differentiation, and suppresses xenograft tumor growth. Finally, the Wnt-activating role of USP7 is specific to APC mutations; thus, it can be used as a tumor-specific therapeutic target for most CRCs. Copyright © 2017 The Francis Crick Institute. Published by Elsevier Inc. All rights reserved.

Single Molecule Effects of Osteogenesis Imperfecta Mutations in Tropocollagen Protein Domains

Science.gov (United States)

2008-12-02

Single molecule effects of osteogenesis imperfecta mutations in tropocollagen protein domains Alfonso Gautieri,1,2 Simone Vesentini,2 Alberto...2008 proteinscience.org Abstract: Osteogenesis imperfecta (OI) is a genetic disease characterized by fragile bones, skeletal deformities and, in severe...diagnosis and treatment, an effort referred to as materiomics. Keywords: steered molecular dynamics; osteogenesis imperfecta ; Young’s modulus; collagen

Epigenetics and autism spectrum disorder: A report of an autism case with mutation in H1 linker histone HIST1H1e and literature review.

Science.gov (United States)

Duffney, Lara J; Valdez, Purnima; Tremblay, Martine W; Cao, Xinyu; Montgomery, Sarah; McConkie-Rosell, Allyn; Jiang, Yong-Hui

2018-04-27

Genetic mutations in genes encoding proteins involved in epigenetic machinery have been reported in individuals with autism spectrum disorder (ASD), intellectual disability, congenital heart disease, and other disorders. H1 histone linker protein, the basic component in nucleosome packaging and chromatin organization, has not been implicated in human disease until recently. We report a de novo deleterious mutation of histone cluster 1 H1 family member e (HIST1H1E; c.435dupC; p.Thr146Hisfs*50), encoding H1 histone linker protein H1.4, in a 10-year-old boy with autism and intellectual disability diagnosed through clinical whole exome sequencing. The c.435dupC at the 3' end of the mRNA leads to a frameshift and truncation of the positive charge in the carboxy-terminus of the protein. An expression study demonstrates the mutation leads to reduced protein expression, supporting haploinsufficiency of HIST1H1E protein and loss of function as an underlying mechanism of dysfunction in the brain. Taken together with other recent cases with mutations of HIST1H1E in intellectual disability, the evidence supporting the link to causality in disease is strong. Our finding implicates the deficiency of H1 linker histone protein in autism. The systematic review of candidate genes implicated in ASD revealed that 42 of 215 (19.5%) genes are directly involved in epigenetic regulations and the majority of these genes belong to histone writers, readers, and erasers. While the mechanism of how haploinsufficiency of HIST1H1E causes autism is entirely unknown, our report underscores the importance of further study of the function of this protein and other histone linker proteins in brain development. © 2018 Wiley Periodicals, Inc.

Targeted Exon Skipping to Address “Leaky” Mutations in the Dystrophin Gene

Directory of Open Access Journals (Sweden)

Sue Fletcher

2012-01-01

Full Text Available Protein-truncating mutations in the dystrophin gene lead to the progressive muscle wasting disorder Duchenne muscular dystrophy, whereas in-frame deletions typically manifest as the milder allelic condition, Becker muscular dystrophy. Antisense oligomer-induced exon skipping can modify dystrophin gene expression so that a disease-associated dystrophin pre-mRNA is processed into a Becker muscular dystrophy-like mature transcript. Despite genomic deletions that may encompass hundreds of kilobases of the gene, some dystrophin mutations appear “leaky”, and low levels of high molecular weight, and presumably semi-functional, dystrophin are produced. A likely causative mechanism is endogenous exon skipping, and Duchenne individuals with higher baseline levels of dystrophin may respond more efficiently to the administration of splice-switching antisense oligomers. We optimized excision of exons 8 and 9 in normal human myoblasts, and evaluated several oligomers in cells from eight Duchenne muscular dystrophy patients with deletions in a known “leaky” region of the dystrophin gene. Inter-patient variation in response to antisense oligomer induced skipping in vitro appeared minimal. We describe oligomers targeting exon 8, that unequivocally increase dystrophin above baseline in vitro, and propose that patients with leaky mutations are ideally suited for participation in antisense oligomer mediated splice-switching clinical studies.

Compound heterozygous ASPM mutations in Pakistani MCPH families

DEFF Research Database (Denmark)

Muhammad, Farooq; Mahmood Baig, Shahid; Hansen, Lars

2009-01-01