WorldWideScience

Sample records for protein transgenic line

  1. Cry1Ac Protein expression in tissues of potato (solanumtuberosum spp. andigena) transgenic lines var. Diacol Capiro

    International Nuclear Information System (INIS)

    Vanegas Araujo, Pablo Andres; Blanco Martinez, Jennifer Teresa; Chaparro Giraldo, Alejandro

    2010-01-01

    The potato plant is the fourth most important crop in the world. In Colombia around 2.8 million tons are produced annually economically supporting 90000 families. In the country, the major economic impact in the crop is caused by Tecia solanivora that originates loses up to 100% in the tuber production. The genetic plant breeding related to the introduction of Cry genes which codify insecticidal crystal proteins is an alternative for reducing the insect attack in commercial crops. In this work, the insertion, transcription and expression of Cry1Ac gen was characterized in different tissues and three development stages of two transgenic lines of Solanum tuberosum variety Diacol Capiro that were previously transformed by Agrobacterium tumefaciens method. The characterization was realized by PCR, RT-PCR and ELISA techniques. The gen insertion and transcription was confirmed using primers for Cry1Ac gen that amplified a specific band of 766 bp. The protein expression levels were higher than 45 µg/g and were not significantly different between the analyzed lines or the three development stages. Furthermore, taking into account some relevant phenotypic features, no significant differences were found between transgenic lines and controls. The results suggest that monitoring and biosecurity assays are necessary with this vegetal material because their high level expression inside all the tissues analyzed that could affect non-targeted insects.

  2. Transgenic cassava lines carrying heterologous alternative oxidase ...

    African Journals Online (AJOL)

    Afuape

    2013-07-03

    Jul 3, 2013 ... production of flowers, apomixis (Nassar et al., 2000; ... In order to increase the stress tolerance capacity of ... stress-related procedure due to the activities of auxin ... the evaluation of the transgenic lines for rate of OES .... Some transgenic lines carrying the 35S-AOX fragment amplified using 35S303F1 and.

  3. Establishment and characterization of CAG/EGFP transgenic rabbit line.

    Science.gov (United States)

    Takahashi, Ri-ichi; Kuramochi, Takashi; Aoyagi, Kazuki; Hashimoto, Shu; Miyoshi, Ichiro; Kasai, Noriyuki; Hakamata, Yoji; Kobayashi, Eiji; Ueda, Masatsugu

    2007-02-01

    Cell marking is a very important procedure for identifying donor cells after cell and/or organ transplantation in vivo. Transgenic animals expressing marker proteins such as enhanced green fluorescent protein (EGFP) in their tissues are a powerful tool for research in fields of tissue engineering and regenerative medicine. The purpose of this study was to establish transgenic rabbit lines that ubiquitously express EGFP under the control of the cytomegalovirus immediate early enhancer/beta-actin promoter (CAG) to provide a fluorescent transgenic animal as a bioresource. We microinjected the EGFP expression vector into 945 rabbit eggs and 4 independent transgenic candidate pups were obtained. Two of them died before sexual maturation and one was infertile. One transgenic male candidate founder rabbit was obtained and could be bred by artificial insemination. The rabbit transmitted the transgene in a Mendelian manner. Using fluorescence in situ hybridization analysis, we detected the transgene at 7q11 on chromosome 7 as a large centromeric region in two F1 offspring (one female and one male). Eventually, one transgenic line was established. Ubiquitous EGFP fluorescence was confirmed in all examined organs. There were no gender-related differences in fluorescence. The established CAG/EGFP transgenic rabbit will be an important bioresource and a useful tool for various studies in tissue engineering and regenerative medicine.

  4. [Production of human proteins in the blood of transgenic animals

    NARCIS (Netherlands)

    Massoud, M.; Bischoff, Rainer; Dalemans, W.; Pointu, H.; Attal, J.; Schultz, H.; Clesse, D.; Stinnakre, M.G.; Pavirani, A.; Houdebine, L.M.

    1990-01-01

    The human alpha 1-antitrypsin gene has been microinjected into rabbit embryos. A line of transgenic rabbits has thus been established. Human alpha 1-antitrypsin was found in the blood of transgenic animals at the concentration of 1 mg/ml plasma. The human protein was active and separable from its

  5. Transgenic cassava lines carrying heterologous alternative oxidase ...

    African Journals Online (AJOL)

    Afuape

    2013-07-03

    Jul 3, 2013 ... Organized embryogenic callus development: In our experiment, somatic embryos were developed from leaf lobes collected from transgenic cassava lines carrying the AtAOX1a gene. Immature leaf lobes measuring about 1 to 6 mm obtained from about six weeks old in vitro derived plants were used.

  6. Expression of multiple proteins in transgenic plants

    Science.gov (United States)

    Vierstra, Richard D.; Walker, Joseph M.

    2002-01-01

    A method is disclosed for the production of multiple proteins in transgenic plants. A DNA construct for introduction into plants includes a provision to express a fusion protein of two proteins of interest joined by a linking domain including plant ubiquitin. When the fusion protein is produced in the cells of a transgenic plant transformed with the DNA construction, native enzymes present in plant cells cleave the fusion protein to release both proteins of interest into the cells of the transgenic plant. Since the proteins are produced from the same fusion protein, the initial quantities of the proteins in the cells of the plant are approximately equal.

  7. Line 63-1: A New Virus-resistant Transgenic Papaya

    NARCIS (Netherlands)

    Tennant, P.; Souza, M.T.; Fitch, M.M.; Manshardt, R.; Slightom, J.L.; Gonsalves, D.

    2005-01-01

    The disease resistance of a transgenic line expressing the coat protein (CP) gene of the mild strain of the papaya ringspot virus (PRSV) from Hawaii was further analyzed against PRSV isolates from Hawaii and other geographical regions. Line 63-1 originated from the same transformation experiment

  8. Stability of transgene expression, field performance and recombination breeding of transformed barley lines

    DEFF Research Database (Denmark)

    Horvath, H.; Jensen, L.G.; Wong, O.T.

    2001-01-01

    in homozygous transgenic T-3 plants, and these remained constant over a 3-year period. In micro-malting experiments, the heat-stable enzyme reached levels of up to 1.4 mug.mg(-1) protein and survived kiln drying at levels of 70-100%. In the field trials of 1997 and 1998 the transgenic lines had a reduced 1000...... lines yielded approximately 6 t.ha(-1) and Golden Promise 7.7 t.ha(-1). Cross-breeding was carried out to transfer the transgene into a more suitable genetic background. Crosses of the semi-dwarf ari-e mutant Golden Promise gave rise to the four morphological phenotypes nutans, high erect, erect...... transformants were observed in some F-4 lines homozygous for the morphological phenotypes and for the transgene. In the case of a homozygous nutans line, the transgenic plants had a higher 1000-grain weight than those lacking the transgene. Like mutants providing useful output traits, transgenic plants...

  9. Spatio Temporal Expression Pattern of an Insecticidal Gene (cry2A in Transgenic Cotton Lines

    Directory of Open Access Journals (Sweden)

    Allah BAKHSH

    2012-11-01

    Full Text Available The production of transgenic plants with stable, high-level transgene expression is important for the success of crop improvement programs based on genetic engineering. The present study was conducted to evaluate genomic integration and spatio temporal expression of an insecticidal gene (cry2A in pre-existing transgenic lines of cotton. Genomic integration of cry2A was evaluated using various molecular approaches. The expression levels of cry2A were determined at vegetative and reproductive stages of cotton at regular intervals. These lines showed a stable integration of insecticidal gene in advance lines of transgenic cotton whereas gene expression was found variable with at various growth stages as well as in different plant parts throughout the season. The leaves of transgenic cotton were found to have maximum expression of cry2A gene followed by squares, bolls, anthers and petals. The protein level in fruiting part was less as compared to other parts showing inconsistency in gene expression. It was concluded that for culturing of transgenic crops, strategies should be developed to ensure the foreign genes expression efficient, consistent and in a predictable manner.

  10. Development of putative transgenic lines of cassava variety H-226 ...

    African Journals Online (AJOL)

    CMD) caused by the Indian cassava mosaic virus (ICMV) and Sri Lankan cassava mosaic virus (SLCMV). An attempt was done to develop transgenic cassava lines resistant to SLCMV through RNAi vector targeting a conserved 440 bp of 5' end ...

  11. Adaptability and stability of transgenic soybean lines and cultivars in ...

    African Journals Online (AJOL)

    Subsequently, genotypic adaptability and stability were evaluated by the methods of Eberhart and Russel (1966), Lin and Binns modified by Carneiro, Annicchiarico and Centroid. All methods presented partial coherence on classifying the best genotypes and allowed the identification of the transgenic lines L1 and L4, and ...

  12. Expression of an osmotin-like protein from Solanum nigrum confers drought tolerance in transgenic soybean.

    Science.gov (United States)

    Weber, Ricardo Luís Mayer; Wiebke-Strohm, Beatriz; Bredemeier, Christian; Margis-Pinheiro, Márcia; de Brito, Giovani Greigh; Rechenmacher, Ciliana; Bertagnolli, Paulo Fernando; de Sá, Maria Eugênia Lisei; Campos, Magnólia de Araújo; de Amorim, Regina Maria Santos; Beneventi, Magda Aparecida; Margis, Rogério; Grossi-de-Sa, Maria Fátima; Bodanese-Zanettini, Maria Helena

    2014-12-10

    Drought is by far the most important environmental factor contributing to yield losses in crops, including soybeans [Glycine max (L.) Merr.]. To address this problem, a gene that encodes an osmotin-like protein isolated from Solanum nigrum var. americanum (SnOLP) driven by the UBQ3 promoter from Arabidopsis thaliana was transferred into the soybean genome by particle bombardment. Two independently transformed soybean lines expressing SnOLP were produced. Segregation analyses indicated single-locus insertions for both lines. qPCR analysis suggested a single insertion of SnOLP in the genomes of both transgenic lines, but one copy of the hpt gene was inserted in the first line and two in the second line. Transgenic plants exhibited no remarkable phenotypic alterations in the seven analyzed generations. When subjected to water deficit, transgenic plants performed better than the control ones. Leaf physiological measurements revealed that transgenic soybean plants maintained higher leaf water potential at predawn, higher net CO2 assimilation rate, higher stomatal conductance and higher transpiration rate than non-transgenic plants. Grain production and 100-grain weight were affected by water supply. Decrease in grain productivity and 100-grain weight were observed for both transgenic and non-transgenic plants under water deficit; however, it was more pronounced for non-transgenic plants. Moreover, transgenic lines showed significantly higher 100-grain weight than non-transgenic plants under water shortage. This is the first report showing that expression of SnOLP in transgenic soybeans improved physiological responses and yield components of plants when subjected to water deficit, highlighting the potential of this gene for biotechnological applications.

  13. Post-mortem re-cloning of a transgenic red fluorescent protein dog.

    Science.gov (United States)

    Hong, So Gun; Koo, Ok Jae; Oh, Hyun Ju; Park, Jung Eun; Kim, Minjung; Kim, Geon-A; Park, Eun Jung; Jang, Goo; Lee, Byeong-Chun

    2011-12-01

    Recently, the world's first transgenic dogs were produced by somatic cell nuclear transfer. However, cellular senescence is a major limiting factor for producing more advanced transgenic dogs. To overcome this obstacle, we rejuvenated transgenic cells using a re-cloning technique. Fibroblasts from post-mortem red fluorescent protein (RFP) dog were reconstructed with in vivo matured oocytes and transferred into 10 surrogate dogs. One puppy was produced and confirmed as a re-cloned dog. Although the puppy was lost during birth, we successfully established a rejuvenated fibroblast cell line from this animal. The cell line was found to stably express RFP and is ready for additional genetic modification.

  14. Case Study: Polycystic Livers in a Transgenic Mouse Line

    Energy Technology Data Exchange (ETDEWEB)

    Lovaglio, Jamie A.; Artwohl, James E.; Ward, Christopher J.; Diekwisch, Thomas G. H.; Ito, Yoshihiro; Fortman, Jeffrey D.

    2014-04-01

    Three mice (2 male, 1 female; age, 5 to 16 mo) from a mouse line transgenic for keratin 14 (K14)-driven LacZ expression and on an outbred Crl:CD1(ICR) background, were identified as having distended abdomens and livers that were diffusely enlarged by numerous cysts (diameter, 0.1 to 2.0 cm). Histopathology revealed hepatic cysts lined by biliary type epithelium and mild chronic inflammation, and confirmed the absence of parasites. Among 21 related mice, 5 additional affected mice were identified via laparotomy. Breeding of these 5 mice (after 5 mo of age) did not result in any offspring; the K14 mice with olycystic livers failed to reproduce. Affected male mice had degenerative testicular lesions, and their sperm was immotile. Nonpolycystic K14 control male mice bred well, had no testicular lesions, and had appropriate sperm motility. Genetic analysis did not identify an association of this phenotype with the transgene or insertion site.

  15. Welfare assessment in transgenic pigs expressing green fluorescent protein (GFP)

    DEFF Research Database (Denmark)

    Huber, Reinhard C.; Remuge, Liliana; Carlisle, Ailsa

    2012-01-01

    Since large animal transgenesis has been successfully attempted for the first time about 25 years ago, the technology has been applied in various lines of transgenic pigs. Nevertheless one of the concerns with the technology—animal welfare—has not been approached through systematic assessment...... and statements regarding the welfare of transgenic pigs have been based on anecdotal observations during early stages of transgenic programs. The main aim of the present study was therefore to perform an extensive welfare assessment comparing heterozygous transgenic animals expressing GFP with wildtype animals...... months. The absence of significant differences between GFP and wildtype animals in the parameters observed suggests that the transgenic animals in question are unlikely to suffer from deleterious effects of transgene expression on their welfare and thus support existing anecdotal observations of pigs...

  16. Inheritance and effectiveness of two transgenes determining PVY resistance in progeny from crossing independently transformed tobacco lines.

    Science.gov (United States)

    Czubacka, Anna; Sacco, Ermanno; Olszak-Przybyś, Hanna; Doroszewska, Teresa

    2017-05-01

    Genetic transformation of plants allows us to obtain improved genotypes enriched with the desired traits. However, if transgenic lines were to be used in breeding programs the stability of inserted transgenes is essential. In the present study, we followed the inheritance of transgenes in hybrids originated from crossing two transgenic tobacco lines resistant to Potato virus Y (PVY): MN 944 LMV with the transgene containing Lettuce mosaic virus coat protein gene (LMV CP) and AC Gayed ROKY2 with PVY replicase gene (ROKY2). Progeny populations generated by successive self-pollination were analyzed with respect to the transgene segregation ratio and resistance to Potato virus Y in tests carried out under greenhouse conditions. The presence of the virus in inoculated plants was detected by DAS-ELISA method. The results demonstrated the Mendelian fashion of inheritance of transgenes which were segregated independently and stably. As a result, we obtained T 4 generation of hybrid with both transgenes stacked and which was highly resistant to PVY.

  17. Comparative proteomics of milk fat globule membrane proteins from transgenic cloned cattle.

    Directory of Open Access Journals (Sweden)

    Shunchao Sui

    Full Text Available The use of transgenic livestock is providing new methods for obtaining pharmaceutically useful proteins. However, the protein expression profiles of the transgenic animals, including expression of milk fat globule membrane (MFGM proteins, have not been well characterized. In this study, we compared the MFGM protein expression profile of the colostrum and mature milk from three lines of transgenic cloned (TC cattle, i.e., expressing recombinant human α-lactalbumin (TC-LA, lactoferrin (TC-LF or lysozyme (TC-LZ in the mammary gland, with those from cloned non-transgenic (C and conventionally bred normal animals (N. We identified 1, 225 proteins in milk MFGM, 166 of which were specifically expressed only in the TC-LA group, 265 only in the TC-LF group, and 184 only in the TC-LZ group. There were 43 proteins expressed only in the transgenic cloned animals, but the concentrations of these proteins were below the detection limit of silver staining. Functional analysis also showed that the 43 proteins had no obvious influence on the bovine mammary gland. Quantitative comparison revealed that MFGM proteins were up- or down-regulated more than twofold in the TC and C groups compared to N group: 126 in colostrum and 77 in mature milk of the TC-LA group; 157 in colostrum and 222 in mature milk of the TC-LF group; 49 in colostrum and 98 in mature milk of the TC-LZ group; 98 in colostrum and 132 in mature milk in the C group. These up- and down-regulated proteins in the transgenic animals were not associated with a particular biological function or pathway, which appears that expression of certain exogenous proteins has no general deleterious effects on the cattle mammary gland.

  18. Epigenetic variants of a transgenic petunia line show hypermethylation in transgene DNA: an indication for specific recognition of foreign DNA in transgenic plants.

    Science.gov (United States)

    Meyer, P; Heidmann, I

    1994-05-25

    We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.

  19. Improved protein quality in transgenic soybean expressing a de novo synthetic protein, MB-16.

    Science.gov (United States)

    Zhang, Yunfang; Schernthaner, Johann; Labbé, Natalie; Hefford, Mary A; Zhao, Jiping; Simmonds, Daina H

    2014-06-01

    To improve soybean [Glycine max (L.) Merrill] seed nutritional quality, a synthetic gene, MB-16 was introduced into the soybean genome to boost seed methionine content. MB-16, an 11 kDa de novo protein enriched in the essential amino acids (EAAs) methionine, threonine, lysine and leucine, was originally developed for expression in rumen bacteria. For efficient seed expression, constructs were designed using the soybean codon bias, with and without the KDEL ER retention sequence, and β-conglycinin or cruciferin seed specific protein storage promoters. Homozygous lines, with single locus integrations, were identified for several transgenic events. Transgene transmission and MB-16 protein expression were confirmed to the T5 and T7 generations, respectively. Quantitative RT-PCR analysis of developing seed showed that the transcript peaked in growing seed, 5-6 mm long, remained at this peak level to the full-sized green seed and then was significantly reduced in maturing yellow seed. Transformed events carrying constructs with the rumen bacteria codon preference showed the same transcription pattern as those with the soybean codon preference, but the transcript levels were lower at each developmental stage. MB-16 protein levels, as determined by immunoblots, were highest in full-sized green seed but the protein virtually disappeared in mature seed. However, amino acid analysis of mature seed, in the best transgenic line, showed a significant increase of 16.2 and 65.9 % in methionine and cysteine, respectively, as compared to the parent. This indicates that MB-16 elevated the sulfur amino acids, improved the EAA seed profile and confirms that a de novo synthetic gene can enhance the nutritional quality of soybean.

  20. Effect of transgenic Bacillus thuringiensis rice lines on mortality and feeding behavior of rice stem borers (Lepidoptera: Crambidae).

    Science.gov (United States)

    Chen, Hao; Zhang, Guoan; Zhang, Qifa; Lin, Yongjun

    2008-02-01

    Ten transgenic Bacillus thuringiensis Bt rice, Oryza sativa L., lines with different Bt genes (two Cry1Ac lines, three Cry2A lines, and five Cry9C lines) derived from the same variety Minghui 63 were evaluated in both the laboratory and the field. Bioassays were conducted by using the first instars of two main rice lepidopteran insect species: yellow stem borer, Scirpophaga incertulas (Walker) and Asiatic rice borer, Chilo suppressalis (Walker). All transgenic lines exhibited high toxicity to these two rice borers. Field evaluation results also showed that all transgenic lines were highly insect resistant with both natural infestation and manual infestation of the neonate larvae of S. incertulas compared with the nontransformed Minghui63. Bt protein concentrations in leaves of 10 transgenic rice lines were estimated by the sandwich enzyme-linked immunosorbent assay. The cry9C gene had the highest expression level, next was cry2A gene, and the cry1Ac gene expressed at the lowest level. The feeding behavior of 7-d-old Asiatic rice borer to three classes of Bt transgenic rice lines also was detected by using rice culm cuttings. The results showed that 7-d-old larvae of Asiatic rice borer have the capacity to distinguish Bt and non-Bt culm cuttings and preferentially fed on non-Bt cuttings. When only Bt culm cuttings with three classes of different Bt proteins (CrylAc, Cry2A, and Cry9C) were fed, significant distribution difference of 7-d-old Asiatic rice borer in culm cuttings of different Bt proteins also was found. In the current study, we evaluate different Bt genes in the same rice variety in both the laboratory and the field, and also tested feeding behavior of rice insect to these Bt rice. These data are valuable for the further development of two-toxin Bt rice and establishment of appropriate insect resistance management in the future.

  1. Overexpression of GmDREB1 improves salt tolerance in transgenic wheat and leaf protein response to high salinity

    OpenAIRE

    Qiyan Jiang; Zheng Hu; Hui Zhang; Youzhi Ma

    2014-01-01

    The transcription factor dehydration-responsive element binding protein (DREB) is able to improve tolerance to abiotic stress in plants by regulating the expression of downstream genes involved in environmental stress resistance. The objectives of this study were to evaluate the salt tolerance of GmDREB1 transgenic wheat (Triticum aestivum L.) and to evaluate its physiological and protein responses to salt stress. Compared with the wild type, the transgenic lines overexpressing GmDREB1 showed...

  2. Overexpression of GmDREB1 improves salt tolerance in transgenic wheat and leaf protein response to high salinity

    Directory of Open Access Journals (Sweden)

    Qiyan Jiang

    2014-04-01

    Full Text Available The transcription factor dehydration-responsive element binding protein (DREB is able to improve tolerance to abiotic stress in plants by regulating the expression of downstream genes involved in environmental stress resistance. The objectives of this study were to evaluate the salt tolerance of GmDREB1 transgenic wheat (Triticum aestivum L. and to evaluate its physiological and protein responses to salt stress. Compared with the wild type, the transgenic lines overexpressing GmDREB1 showed longer coleoptiles and radicles and a greater radicle number at the germination stage, as well as greater root length, fresh weight, and tiller number per plant at the seedling stage. The yield-related traits of transgenic lines were also improved compared with the wild type, indicating enhanced salt tolerance in transgenic lines overexpressing GmDREB1. Proteomics analysis revealed that osmotic- and oxidative-stress-related proteins were up-regulated in transgenic wheat leaves under salt stress conditions. Transgenic wheat had higher levels of proline and betaine and lower levels of malondialdehyde and relative electrolyte leakage than the wild type. These results suggest that GmDREB1 regulates the expression of osmotic- and oxidative-stress-related proteins that reduce the occurrence of cell injury caused by high salinity, thus improving the salt tolerance of transgenic wheat.

  3. Construction and Quality Analysis of Transgenic Rehmannia glutinosa Containing TMV and CMV Coat Protein

    Directory of Open Access Journals (Sweden)

    Zhongqiu Teng

    2016-08-01

    Full Text Available Plant viruses, especially tobacco mosaic virus (TMV and cucumber mosaic virus (CMV are serious threats to Rehmannia glutinosa which is a “top grade” herb in China. In the present study, TMV- and CMV-resistant Rehmannia glutinosa Libosch. plants were constructed by transforming the protein (CP genes of TMV and CMV into Rehmannia glutinosa via a modified procedure of Agrobacterium tumefaciens-mediated transformation. Integration and expression of TMV CP and CMV CP transgenes in 2 lines, LBA-1 and LBA-2, were confirmed by PCR, Southern blot and RT-PCR. Both LBA-1 and LBA-2 were resistant to infection of homologous TMV and CMV strains. The quality of transgenic Rehmanniae Radix was evaluated based on fingerprint analysis and components quantitative analysis comparing with control root tubes. These results showed that chemical composition of transgenic Rehmanniae Radix were similar to non-transgenic ones, which demonstrated that the medical quality and biosafety of transgenic Rehmanniae Radix were equivalent to non-transgenic material when consumed as traditional Chinese medicinal (TCM.

  4. Intein-mediated Cre protein assembly for transgene excision in hybrid progeny of transgenic Arabidopsis.

    Science.gov (United States)

    Ge, Jia; Wang, Lijun; Yang, Chen; Ran, Lingyu; Wen, Mengling; Fu, Xianan; Fan, Di; Luo, Keming

    2016-10-01

    An approach for restoring recombination activity of complementation split-Cre was developed to excise the transgene in hybrid progeny of GM crops. Growing concerns about the biosafety of genetically modified (GM) crops has currently become a limited factor affecting the public acceptance. Several approaches have been developed to generate selectable-marker-gene-free GM crops. However, no strategy was reported to be broadly applicable to hybrid crops. Previous studies have demonstrated that complementation split-Cre recombinase restored recombination activity in transgenic plants. In this study, we found that split-Cre mediated by split-intein Synechocystis sp. DnaE had high recombination efficiency when Cre recombinase was split at Asp232/Asp233 (866 bp). Furthermore, we constructed two plant expression vectors, pCA-NCre-In and pCA-Ic-CCre, containing NCre866-In and Ic-CCre866 fragments, respectively. After transformation, parent lines of transgenic Arabidopsis with one single copy were generated and used for hybridization. The results of GUS staining demonstrated that the recombination activity of split-Cre could be reassembled in these hybrid progeny of transgenic plants through hybridization and the foreign genes flanked by two loxP sites were efficiently excised. Our strategy may provide an effective approach for generating the next generation of GM hybrid crops without biosafety concerns.

  5. Transgenic Xenopus laevis Line for In Vivo Labeling of Nephrons within the Kidney

    Directory of Open Access Journals (Sweden)

    Mark E. Corkins

    2018-04-01

    Full Text Available Xenopus laevis embryos are an established model for studying kidney development. The nephron structure and genetic pathways that regulate nephrogenesis are conserved between Xenopus and humans, allowing for the study of human disease-causing genes. Xenopus embryos are also amenable to large-scale screening, but studies of kidney disease-related genes have been impeded because assessment of kidney development has largely been limited to examining fixed embryos. To overcome this problem, we have generated a transgenic line that labels the kidney. We characterize this cdh17:eGFP line, showing green fluorescent protein (GFP expression in the pronephric and mesonephric kidneys and colocalization with known kidney markers. We also demonstrate the feasibility of live imaging of embryonic kidney development and the use of cdh17:eGFP as a kidney marker for secretion assays. Additionally, we develop a new methodology to isolate and identify kidney cells for primary culture. We also use morpholino knockdown of essential kidney development genes to establish that GFP expression enables observation of phenotypes, previously only described in fixed embryos. Taken together, this transgenic line will enable primary kidney cell culture and live imaging of pronephric and mesonephric kidney development. It will also provide a simple means for high-throughput screening of putative human kidney disease-causing genes.

  6. Recombinant protein production from stable mammalian cell lines and pools.

    Science.gov (United States)

    Hacker, David L; Balasubramanian, Sowmya

    2016-06-01

    We highlight recent developments for the production of recombinant proteins from suspension-adapted mammalian cell lines. We discuss the generation of stable cell lines using transposons and lentivirus vectors (non-targeted transgene integration) and site-specific recombinases (targeted transgene integration). Each of these methods results in the generation of cell lines with protein yields that are generally superior to those achievable through classical plasmid transfection that depends on the integration of the transfected DNA by non-homologous DNA end-joining. This is the main reason why these techniques can also be used for the generation of stable cell pools, heterogenous populations of recombinant cells generated by gene delivery and genetic selection without resorting to single cell cloning. This allows the time line from gene transfer to protein production to be reduced. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Development of transgenic Brassica juncea lines for reduced seed sinapine content by perturbing phenylpropanoid pathway genes.

    Directory of Open Access Journals (Sweden)

    Sachin Kajla

    Full Text Available Sinapine is a major anti-nutritive compound that accumulates in the seeds of Brassica species. When ingested, sinapine imparts gritty flavuor in meat and milk of animals and fishy odor to eggs of brown egg layers, thereby compromising the potential use of the valuable protein rich seed meal. Sinapine content in Brassica juncea germplasm ranges from 6.7 to 15.1 mg/g of dry seed weight (DSW which is significantly higher than the prescribed permissible level of 3.0 mg/g of DSW. Due to limited natural genetic variability, conventional plant breeding approach for reducing the sinapine content has largely been unsuccessful. Hence, transgenic approach for gene silencing was adopted by targeting two genes-SGT and SCT, encoding enzymes UDP- glucose: sinapate glucosyltransferase and sinapoylglucose: choline sinapoyltransferase, respectively, involved in the final two steps of sinapine biosynthetic pathway. These two genes were isolated from B. juncea and eight silencing constructs were developed using three different RNA silencing approaches viz. antisense RNA, RNAi and artificial microRNA. Transgenics in B. juncea were developed following Agrobacterium-mediated transformation. From a total of 1232 independent T0 transgenic events obtained using eight silencing constructs, 25 homozygous lines showing single gene inheritance were identified in the T2 generation. Reduction of seed sinapine content in these lines ranged from 15.8% to 67.2%; the line with maximum reduction had sinapine content of 3.79 mg/g of DSW. The study also revealed that RNAi method was more efficient than the other two methods used in this study.

  8. Hybridization of downregulated-COMT transgenic switchgrass lines with field selected switchgrass for improved biomass traits

    Science.gov (United States)

    Transgenic switchgrass (Panicum virgatum L.) has been produced for improved cell walls for biofuels. Downregulated caffeic acid 3-O-methyltransferase (COMT) switchgrass produced significantly more biomass and biofuel than the non-transgenic progenitor line. In the present study we sought to further...

  9. Cardioprotective effects of 70-kDa heat shock protein in transgenic mice.

    Science.gov (United States)

    Radford, N B; Fina, M; Benjamin, I J; Moreadith, R W; Graves, K H; Zhao, P; Gavva, S; Wiethoff, A; Sherry, A D; Malloy, C R; Williams, R S

    1996-03-19

    Heat shock proteins are proposed to limit injury resulting from diverse environmental stresses, but direct metabolic evidence for such a cytoprotective function in vertebrates has been largely limited to studies of cultured cells. We generated lines of transgenic mice to express human 70-kDa heat shock protein constitutively in the myocardium. Hearts isolated from these animals demonstrated enhanced recovery of high energy phosphate stores and correction of metabolic acidosis following brief periods of global ischemia sufficient to induce sustained abnormalities of these variables in hearts from nontransgenic littermates. These data demonstrate a direct cardioprotective effect of 70-kDa heat shock protein to enhance postischemic recovery of the intact heart.

  10. Transgenic soybeans and soybean protein analysis: an overview.

    Science.gov (United States)

    Natarajan, Savithiry; Luthria, Devanand; Bae, Hanhong; Lakshman, Dilip; Mitra, Amitava

    2013-12-04

    To meet the increasing global demand for soybeans for food and feed consumption, new high-yield varieties with improved quality traits are needed. To ensure the safety of the crop, it is important to determine the variation in seed proteins along with unintended changes that may occur in the crop as a result various stress stimuli, breeding, and genetic modification. Understanding the variation of seed proteins in the wild and cultivated soybean cultivars is useful for determining unintended protein expression in new varieties of soybeans. Proteomic technology is useful to analyze protein variation due to various stimuli. This short review discusses transgenic soybeans, different soybean proteins, and the approaches used for protein analysis. The characterization of soybean protein will be useful for researchers, nutrition professionals, and regulatory agencies dealing with soy-derived food products.

  11. Simplified methodology for large scale isolation of homozygous transgenic lines of lettuce

    Directory of Open Access Journals (Sweden)

    Flavia S. Darqui

    2018-01-01

    Conclusions: This protocol allows a simplified scaling-up of the production of multiple homozygous transgenic progeny lines in the early generations avoiding expensive and time-consuming molecular assays.

  12. Two types of Tet-On transgenic lines for doxycycline-inducible gene expression in zebrafish rod photoreceptors and a gateway-based tet-on toolkit.

    Directory of Open Access Journals (Sweden)

    Leah J Campbell

    Full Text Available The ability to control transgene expression within specific tissues is an important tool for studying the molecular and cellular mechanisms of development, physiology, and disease. We developed a Tet-On system for spatial and temporal control of transgene expression in zebrafish rod photoreceptors. We generated two transgenic lines using the Xenopus rhodopsin promoter to drive the reverse tetracycline-controlled transcriptional transactivator (rtTA, one with self-reporting GFP activity and one with an epitope tagged rtTA. The self-reporting line includes a tetracycline response element (TRE-driven GFP and, in the presence of doxycycline, expresses GFP in larval and adult rods. A time-course of doxycycline treatment demonstrates that maximal induction of GFP expression, as determined by the number of GFP-positive rods, is reached within approximately 24 hours of drug treatment. The epitope-tagged transgenic line eliminates the need for the self-reporting GFP activity by expressing a FLAG-tagged rtTA protein. Both lines demonstrate strong induction of TRE-driven transgenes from plasmids microinjected into one-cell embryos. These results show that spatial and temporal control of transgene expression can be achieved in rod photoreceptors. Additionally, system components are constructed in Gateway compatible vectors for the rapid cloning of doxycycline-inducible transgenes and use in other areas of zebrafish research.

  13. Enhanced leaf photosynthesis as a target to increase grain yield: insights from transgenic rice lines with variable Rieske FeS protein content in the cytochrome b6 /f complex.

    Science.gov (United States)

    Yamori, Wataru; Kondo, Eri; Sugiura, Daisuke; Terashima, Ichiro; Suzuki, Yuji; Makino, Amane

    2016-01-01

    Although photosynthesis is the most important source for biomass and grain yield, a lack of correlation between photosynthesis and plant yield among different genotypes of various crop species has been frequently observed. Such observations contribute to the ongoing debate whether enhancing leaf photosynthesis can improve yield potential. Here, transgenic rice plants that contain variable amounts of the Rieske FeS protein in the cytochrome (cyt) b6 /f complex between 10 and 100% of wild-type levels have been used to investigate the effect of reductions of these proteins on photosynthesis, plant growth and yield. Reductions of the cyt b6 /f complex did not affect the electron transport rates through photosystem I but decreased electron transport rates through photosystem II, leading to concomitant decreases in CO2 assimilation rates. There was a strong control of plant growth and grain yield by the rate of leaf photosynthesis, leading to the conclusion that enhancing photosynthesis at the single-leaf level would be a useful target for improving crop productivity and yield both via conventional breeding and biotechnology. The data here also suggest that changing photosynthetic electron transport rates via manipulation of the cyt b6 /f complex could be a potential target for enhancing photosynthetic capacity in higher plants. © 2015 John Wiley & Sons Ltd.

  14. Handling of human short-chain acyl-CoA dehydrogenase (SCAD) variant proteins in transgenic mice

    DEFF Research Database (Denmark)

    Kragh, Peter M; Pedersen, Christina B; Schmidt, Stine P

    2007-01-01

    Abstract To investigate the in vivo handling of human short-chain acyl-CoA dehydrogenase (SCAD) variant proteins, three transgenic mouse lines were produced by pronuclear injection of cDNA encoding the wild-type, hSCAD-wt, and two disease causing folding variants hSCAD-319C > T and hSCAD-625G > A....... The transgenic mice were mated with an SCAD-deficient mouse strain (BALB/cByJ) and, in the second generation, three mouse lines were obtained without endogenous SCAD expression but harboring hSCAD-wt, hSCAD-319C > T, and hSCAD-625G > A transgenes, respectively. All three lines had expression of the transgene...... developed for any of the lines transgenic for the hSCAD folding variants. The indicated remarkable efficiency of the mouse protein quality control system in the degradation of SCAD folding variants should be further substantiated and investigated, since it might indicate ways to prevent disease...

  15. New Wistar Kyoto and spontaneously hypertensive rat transgenic models with ubiquitous expression of green fluorescent protein

    Directory of Open Access Journals (Sweden)

    Ana Isabel Garcia Diaz

    2016-04-01

    Full Text Available The Wistar Kyoto (WKY rat and the spontaneously hypertensive (SHR rat inbred strains are well-established models for human crescentic glomerulonephritis (CRGN and metabolic syndrome, respectively. Novel transgenic (Tg strains add research opportunities and increase scientific value to well-established rat models. We have created two novel Tg strains using Sleeping Beauty transposon germline transgenesis, ubiquitously expressing green fluorescent protein (GFP under the rat elongation factor 1 alpha (EF1a promoter on the WKY and SHR genetic backgrounds. The Sleeping Beauty system functioned with high transgenesis efficiency; 75% of new rats born after embryo microinjections were transgene positive. By ligation-mediated PCR, we located the genome integration sites, confirming no exonic disruption and defining a single or low copy number of the transgenes in the new WKY-GFP and SHR-GFP Tg lines. We report GFP-bright expression in embryos, tissues and organs in both lines and show preliminary in vitro and in vivo imaging data that demonstrate the utility of the new GFP-expressing lines for adoptive transfer, transplantation and fate mapping studies of CRGN, metabolic syndrome and other traits for which these strains have been extensively studied over the past four decades.

  16. Overexpression of rice thaumatin-like protein (Ostlp gene in transgenic cassava results in enhanced tolerance to Colletotrichum gloeosporioides f. sp. manihotis

    Directory of Open Access Journals (Sweden)

    Patroba Odeny Ojola

    2018-06-01

    Full Text Available Cassava (Manihot esculenta Crantz is the most important staple food for more than 300 million people in Africa, and anthracnose disease caused by Colletotrichum gloeosporioides f. sp. manihotis is the most destructive fungal disease affecting cassava production in sub-Saharan Africa. The main objective of this study was to improve anthracnose resistance in cassava through genetic engineering. Transgenic cassava plants harbouring rice thaumatin-like protein (Ostlp gene, driven by the constitutive CaMV35S promoter, were generated using Agrobacterium-mediated transformation of friable embryogenic calli (FEC of cultivar TMS 60444. Molecular analysis confirmed the presence, integration, copy number of the transgene all the independent transgenic events. Semi-quantitative RT-PCR confirmed high expression levels of Ostlp in six transgenic lines tested. The antifungal activity of the transgene against Colletotrichum gloeosporioides pathogen was evaluated using the leaves and stem cuttings bioassay. The results demonstrated significantly delayed disease development and reduced size of necrotic lesions in leaves and stem cuttings of all transgenic lines compared to the leaves and stem cuttingss of non-transgenic control plants. Therefore, constitutive overexpression of rice thaumatin-like protein in transgenic cassava confers enhanced tolerance to the fungal pathogen C. gloeosporioides f. sp. manihotis. These results can therefore serve as an initial step towards genetic engineering of farmer-preffered cassava cultivars for resistance to anthracnose disease. Keywords: Colletotrichum gloeosporioides f. sp. manihotis, Thaumatin-like protein, Transgenic cassava

  17. Role of the durum wheat dehydrin in the function of proteases conferring salinity tolerance in Arabidopsis thaliana transgenic lines.

    Science.gov (United States)

    Saibi, Walid; Zouari, Nabil; Masmoudi, Khaled; Brini, Faiçal

    2016-04-01

    Dehydrins are claimed to stabilize macromolecules against freezing damage, dehydration, ionic or osmotic stresses, thermal stress and re-folding yield. However, their precise function remains unknown. In this context, we report the behavior of protease activities in dehydrin transgenic Arabidopsis lines against the wild type plant under salt stress (100mM NaCl). Indeed, proteases play key roles in plants, maintaining strict protein quality control and degrading specific sets of proteins in response to diverse environmental and developmental stimuli. We proved that durum wheat DHN-5 modulates the activity of some proteases, summarized on the promotion of the Cysteinyl protease and the decrease of the Aspartyl protease activity. This fact is also upgraded in salt stress conditions. We conclude that the dehydrin transgenic context encodes salinity tolerance in transgenic lines through the modulation of the interaction not only at transcriptional level but also at protein level and also with the impact of salt stress as an endogenous and exogenous effector on some biocatalysts like proteases. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Development of transgenic rats producing human β-amyloid precursor protein as a model for Alzheimer's disease: Transgene and endogenous APP genes are regulated tissue-specifically

    Directory of Open Access Journals (Sweden)

    Chan Anthony WS

    2008-02-01

    Full Text Available Abstract Background Alzheimer's disease (AD is a devastating neurodegenerative disorder that affects a large and growing number of elderly individuals. In addition to idiopathic disease, AD is also associated with autosomal dominant inheritance, which causes a familial form of AD (FAD. Some instances of FAD have been linked to mutations in the β-amyloid protein precursor (APP. Although there are numerous mouse AD models available, few rat AD models, which have several advantages over mice, have been generated. Results Fischer 344 rats expressing human APP driven by the ubiquitin-C promoter were generated via lentiviral vector infection of Fischer 344 zygotes. We generated two separate APP-transgenic rat lines, APP21 and APP31. Serum levels of human amyloid-beta (Aβ40 were 298 pg/ml for hemizygous and 486 pg/ml for homozygous APP21 animals. Serum Aβ42 levels in APP21 homozygous rats were 135 pg/ml. Immunohistochemistry in brain showed that the human APP transgene was expressed in neurons, but not in glial cells. These findings were consistent with independent examination of enhanced green fluorescent protein (eGFP in the brains of eGFP-transgenic rats. APP21 and APP31 rats expressed 7.5- and 3-times more APP mRNA, respectively, than did wild-type rats. Northern blots showed that the human APP transgene, driven by the ubiquitin-C promoter, is expressed significantly more in brain, kidney and lung compared to heart and liver. A similar expression pattern was also seen for the endogenous rat APP. The unexpected similarity in the tissue-specific expression patterns of endogenous rat APP and transgenic human APP mRNAs suggests regulatory elements within the cDNA sequence of APP. Conclusion This manuscript describes the generation of APP-transgenic inbred Fischer 344 rats. These are the first human AD model rat lines generated by lentiviral infection. The APP21 rat line expresses high levels of human APP and could be a useful model for AD. Tissue

  19. Expression of hybrid fusion protein (Cry1Ac::ASAL) in transgenic rice plants imparts resistance against multiple insect pests.

    Science.gov (United States)

    Boddupally, Dayakar; Tamirisa, Srinath; Gundra, Sivakrishna Rao; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2018-05-31

    To evolve rice varieties resistant to different groups of insect pests a fusion gene, comprising DI and DII domains of Bt Cry1Ac and carbohydrate binding domain of garlic lectin (ASAL), was constructed. Transgenic rice lines were generated and evaluated to assess the efficacy of Cry1Ac::ASAL fusion protein against three major pests, viz., yellow stem borer (YSB), leaf folder (LF) and brown planthopper (BPH). Molecular analyses of transgenic plants revealed stable integration and expression of the fusion gene. In planta insect bioassays on transgenics disclosed enhanced levels of resistance compared to the control plants. High insect mortality of YSB, LF and BPH was observed on transgenics compared to that of control plants. Furthermore, honeydew assays revealed significant decreases in the feeding ability of BPH on transgenic plants as compared to the controls. Ligand blot analysis, using BPH insects fed on cry1Ac::asal transgenic rice plants, revealed a modified receptor protein-binding pattern owing to its ability to bind to additional receptors in insects. The overall results authenticate that Cry1Ac::ASAL protein is endowed with remarkable entomotoxic effects against major lepidopteran and hemipteran insects. As such, the fusion gene appears promising and can be introduced into various other crops to control multiple insect pests.

  20. Comparison of nutritional value of transgenic peanut expressing bar and rcg3 genes with non-transgenic counterparts

    International Nuclear Information System (INIS)

    Robab, U.E.; )

    2014-01-01

    The transgenic peanut plants expressing bar and rcg3 genes were subjected to assessment of any change in nutritional value of the crop at various locations. The protein and fat contents of transgenic lines were compared with the non-transgenic parent varieties. Protein content in the transgenic lines was higher as compared to that in non-transgenic counterparts and differences among locations for fat and protein content were significant. No differences among fatty acids were recorded for genes, events and locations. Irrespective of small differences, all the values were in range described for this crop and transgenic lines appeared to be substantially equivalent to non-transgenic parent varieties. (author)

  1. Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference

    Directory of Open Access Journals (Sweden)

    Jinlong Guo

    2015-01-01

    Full Text Available As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV and/or Sorghum mosaic virus (SrMV, with additional differences in viral strains. RNA interference (RNAi is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

  2. First molecular identification of the transgene red fluorescent protein (RFP in transgenic ornamental zebrafish (Danio rerio introduced in Peru

    Directory of Open Access Journals (Sweden)

    Carlos Scotto

    2013-09-01

    Full Text Available In this paper the transgenic fluorescent red, orange and pink zebra fish (Danio rerio, found in local aquariums in Peru, were identified using the PCR technique to amplify the transgene RFP sea anemone belonging to Discosoma spp. The gene expression of the red fluorescent protein (RFP transgene was found to determine different gradients-of-bioluminescence (shades in color in each GMO fish analyzed. We performed sequence analysis of the two variants of the RFP along with six variants of the existing fluorescent protein GFP from the Genbank, this could help identify quickly if they are new genes or variants thereof as these novel fluorescent proteins may be introduced in aquatic GMO in the future. Thus, developing and improving biosecurity measures through its timely detection at the molecular genetic level.

  3. [Obtaining the transgenic lines of finger millet Eleusine coracana (L.) Gaertn. With dinitroaniline resistance].

    Science.gov (United States)

    Baer, G Ia; Emets, A I; Blium, Ia B

    2014-01-01

    The current data is dedicated to the study of bioballistic and Agrobacterium-mediated transformation of finger millet with the constructs carrying the mutant alpha-tubulin gene (TUAm 1), isolated from R-biotype goosegrass (Eleusine indica L.), for the decision of problem of dinitroaniline-resistance. It was found that 10 microM of trifluralin is optimal for the selection of transgene plants of finger millet. PCR analysis of transformed lines confirmed the transgene nature of plants. The analysis of seed of T1 oftransgene lines confirmed heterozygous character of inheritance of the resistance.

  4. Generation of doubled haploid transgenic wheat lines by microspore transformation.

    Directory of Open Access Journals (Sweden)

    Rhoda A T Brew-Appiah

    Full Text Available Microspores can be induced to develop homozygous doubled haploid plants in a single generation. In the present experiments androgenic microspores of wheat have been genetically transformed and developed into mature homozygous transgenic plants. Two different transformation techniques were investigated, one employing electroporation and the other co-cultivation with Agrobacterium tumefaciens. Different tissue culture and transfection conditions were tested on nine different wheat cultivars using four different constructs. A total of 19 fertile transformants in five genotypes from four market classes of common wheat were recovered by the two procedures. PCR followed by DNA sequencing of the products, Southern blot analyses and bio/histo-chemical and histological assays of the recombinant enzymes confirmed the presence of the transgenes in the T0 transformants and their stable inheritance in homozygous T1∶2 doubled haploid progenies. Several decisive factors determining the transformation and regeneration efficiency with the two procedures were determined: (i pretreatment of immature spikes with CuSO4 solution (500 mg/L at 4°C for 10 days; (ii electroporation of plasmid DNA in enlarged microspores by a single pulse of ∼375 V; (iii induction of microspores after transfection at 28°C in NPB-99 medium and regeneration at 26°C in MMS5 medium; (iv co-cultivation with Agrobacterium AGL-1 cells for transfer of plasmid T-DNA into microspores at day 0 for <24 hours; and (v elimination of AGL-1 cells after co-cultivation with timentin (200-400 mg/L.

  5. Promoter, transgene, and cell line effects in the transfection of mammalian cells using PDMAEMA-based nano-stars

    Directory of Open Access Journals (Sweden)

    Alexander Raup

    2016-09-01

    Full Text Available Non-viral transfection protocols are typically optimized using standard cells and reporter proteins, potentially underestimating cellular or transgene effects. Here such effects were studied for two human (Jurkat, HEK-293 and two rodent (CHO-K1, L929 cell lines and three fluorescent reporter proteins. Expression of the enhanced green fluorescent protein (EGFP was studied under the control of the human elongation factor 1 alpha promoter and three viral promoters (SV40, SV40/enhancer, CMV, that of ZsYellow1 (yellow fluorescence and mCherry (red fluorescence for the CMV promoter. Results varied with the cell line, in particular for the Jurkat cells. Pair-wise co-transfection of the CMV controlled transgenes resulted in a significant fraction of monochromatic cells (EGFP for EGFP/YFP and EGFP/RFP co-transfections, YFP in case of YFP/RFP co-transfections. Only Jurkat cells were almost incapable of expressing YFP. Dilution of the plasmid DNA with a non-expressed plasmid showed cell line dependent effects on transfection efficiency and/or expression levels.

  6. Lactation Defect in a Widely Used MMTV-Cre Transgenic Line of Mice

    Science.gov (United States)

    Yuan, Taichang; Wang, Yongping; Pao, Lily; Anderson, Steve M.; Gu, Haihua

    2011-01-01

    Background MMTV-Cre mouse lines have played important roles in our understanding about the functions of numerous genes in mouse mammary epithelial cells during mammary gland development and tumorigenesis. However, numerous studies have not included MMTV-Cre mice as controls, and many investigators have not indicated which of the different MMTV-Cre founder lines were used in their studies. Here, we describe a lactation defect that severely limits the use of one of the most commonly used MMTV-Cre founder lines. Methodology/Principal Findings To explore the role of protein tyrosine phosphatase Shp1 in mammary gland development, mice bearing the floxed Shp1 gene were crossed with MMTV-Cre mice and mammary gland development was examined by histological and biochemical techniques, while lactation competency was assessed by monitoring pup growth. Surprisingly, both the Shp1fl/+;MMTV-Cre and MMTV-Cre female mice displayed a severe lactation defect when compared to the Shp1 fl/+ control mice. Histological and biochemical analyses reveal that female mice expressing the MMTV-Cre transgene, either alone or in combination with floxed genes, exhibit defects in lobuloalveolar expansion, presence of large cytoplasmic lipid droplets in luminal alveolar epithelial cells postpartum, and precocious induction of involution. Using a PCR-based genotyping method, the three different founder lines can be distinguished, and we determined that the MMTV-Cre line A, the most widely used MMTV-Cre founder line, exhibits a profound lactation defect that limits its use in studies on mammary gland development. Conclusions/Significance The identification of a lactation defect in the MMTV-Cre line A mice indicates that investigators must use MMTV-Cre alone mice as control in studies that utilize Cre recombinase to excise genes of interest from mammary epithelial cells. Our results also suggest that previous results obtained in studies using the MMTV-Cre line A line should be re-evaluated if the

  7. Both core and F proteins of hepatitis C virus could enhance cell proliferation in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Wen-Ta [Graduate Institute of Medical Biotechnology, Tzu Chi University, Hualien, Taiwan (China); Li, Hui-Chun [Department of Biochemistry, Tzu Chi University, Hualien, Taiwan (China); Lee, Shen-Kao; Ma, Hsin-Chieh; Yang, Chee-Hing; Chen, Hung-Ling [Graduate Institute of Medical Biotechnology, Tzu Chi University, Hualien, Taiwan (China); Lo, Shih-Yen, E-mail: losylo@mail.tcu.edu.tw [Graduate Institute of Medical Biotechnology, Tzu Chi University, Hualien, Taiwan (China); Department of Laboratory Medicine, Buddhist Tzu Chi General Hospital, Hualien, Taiwan (China)

    2013-05-24

    Highlights: •HCV core and F proteins could induce hepatocyte proliferation in the transgenic mice. •β-Catenin signaling pathway was activated by core protein in the transgenic mice. •β-Catenin signaling pathway was activated by myc-F protein in the transgenic mice. •Expression of SMA protein was enhanced by core but not myc-F protein. -- Abstract: The role of the protein encoded by the alternative open reading frame (ARF/F/core+1) of the Hepatitis C virus (HCV) genome in viral pathogenesis remains unknown. The different forms of ARF/F/core+1 protein were labile in cultured cells, a myc-tag fused at the N-terminus of the F protein made it more stable. To determine the role of core and F proteins in HCV pathogenesis, transgenic mice with either protein expression under the control of Albumin promoter were generated. Expression of core protein and F protein with myc tag (myc-F) could be detected by Western blotting analysis in the livers of these mice. The ratio of liver to body weight is increased for both core and myc-F transgenic mice compared to that of wild type mice. Indeed, the proliferating cell nuclear antigen protein, a proliferation marker, was up-regulated in the transgenic mice with core or myc-F protein. Further analyses by microarray and Western blotting suggested that β-catenin signaling pathway was activated by either core or myc-F protein in the transgenic mice. These transgenic mice were further treated with either Diethynitrosamine (a tumor initiator) or Phenobarbital (a tumor promoter). Phenobarbital but not Diethynitrosamine treatment could increase the liver/body weight ratio of these mice. However, no tumor formation was observed in these mice. In conclusion, HCV core and myc-F proteins could induce hepatocyte proliferation in the transgenic mice possibly through β-catenin signaling pathway.

  8. Both core and F proteins of hepatitis C virus could enhance cell proliferation in transgenic mice

    International Nuclear Information System (INIS)

    Hu, Wen-Ta; Li, Hui-Chun; Lee, Shen-Kao; Ma, Hsin-Chieh; Yang, Chee-Hing; Chen, Hung-Ling; Lo, Shih-Yen

    2013-01-01

    Highlights: •HCV core and F proteins could induce hepatocyte proliferation in the transgenic mice. •β-Catenin signaling pathway was activated by core protein in the transgenic mice. •β-Catenin signaling pathway was activated by myc-F protein in the transgenic mice. •Expression of SMA protein was enhanced by core but not myc-F protein. -- Abstract: The role of the protein encoded by the alternative open reading frame (ARF/F/core+1) of the Hepatitis C virus (HCV) genome in viral pathogenesis remains unknown. The different forms of ARF/F/core+1 protein were labile in cultured cells, a myc-tag fused at the N-terminus of the F protein made it more stable. To determine the role of core and F proteins in HCV pathogenesis, transgenic mice with either protein expression under the control of Albumin promoter were generated. Expression of core protein and F protein with myc tag (myc-F) could be detected by Western blotting analysis in the livers of these mice. The ratio of liver to body weight is increased for both core and myc-F transgenic mice compared to that of wild type mice. Indeed, the proliferating cell nuclear antigen protein, a proliferation marker, was up-regulated in the transgenic mice with core or myc-F protein. Further analyses by microarray and Western blotting suggested that β-catenin signaling pathway was activated by either core or myc-F protein in the transgenic mice. These transgenic mice were further treated with either Diethynitrosamine (a tumor initiator) or Phenobarbital (a tumor promoter). Phenobarbital but not Diethynitrosamine treatment could increase the liver/body weight ratio of these mice. However, no tumor formation was observed in these mice. In conclusion, HCV core and myc-F proteins could induce hepatocyte proliferation in the transgenic mice possibly through β-catenin signaling pathway

  9. In vivo import of plastocyanin and a fusion protein into developmentally different plastids of transgenic plants

    NARCIS (Netherlands)

    Boer, Douwe de; Cremers, Fons; Teertstra, Renske; Smits, Lianne; Hille, Jacques; Smeekens, Sjef; Weisbeek, Peter

    1988-01-01

    Transgenic tomato plants that constitutively express a foreign plastocyanin gene were used to study protein transport in different tissues. Normally expression of endogenous plastocyanin genes in plants is restricted to photosynthetic tissues only, whereas this foreign plastocyanin protein is found

  10. Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene

    DEFF Research Database (Denmark)

    Efrat, S; Linde, S; Kofod, Hans

    1988-01-01

    Three pancreatic beta-cell lines have been established from insulinomas derived from transgenic mice carrying a hybrid insulin-promoted simian virus 40 tumor antigen gene. The beta tumor cell (beta TC) lines maintain the features of differentiated beta cells for about 50 passages in culture. The ...... both to immortalize a rare cell type and to provide a selection for the maintenance of its differentiated phenotype....

  11. Transgenic rice plants expressing a fused protein of Cry1Ab/Vip3H has resistance to rice stem borers under laboratory and field conditions.

    Science.gov (United States)

    Chen, Yang; Tian, Jun-Ce; Shen, Zhi-Chen; Peng, Yu-Fa; Hu, Cui; Guo, Yu-Yuan; Ye, Gong-Yin

    2010-08-01

    Six transgenic rice, Oryza sativa L., lines (G6H1, G6H2, G6H3, G6H4, G6H5, and G6H6) expressing a fused Cry1Ab/Vip3H protein, were evaluated for resistance against the Asiatic rice borer, Chilo suppressalis (Walker) (Lepidoptera: Crambidae), and the stem borer Sesamia inferens (Walker) (Lepidoptera: Noctuidae) in the laboratory and field. The bioassay results indicated that the mortality of Asiatic rice borer and S. inferens neonate larvae on six transgenic lines from seedling to filling stage was up to 100% at 168 h after infestation. The cumulative feeding area by Asiatic rice borer neonate larvae on all transgenic lines was significantly reduced compared with the untransformed parental 'Xiushui 110' rice. A 2-yr field evaluation showed that damage during the vegetative stage (deadheart) or during the reproductive stage (whitehead) caused by Asiatic rice borer and S. inferens for transgenic lines was much lower than the control. For three lines (G6H1, G6H2, and G6H6), no damage was found during the entire growing period. Estimation of fused Cry1Ab/Vip3H protein concentrations using PathoScreen kit for Bt-Cry1Ab/1Ac protein indicated that the expression levels of Cry1Ab protein both in main stems (within the average range of 0.006-0.073% of total soluble protein) and their flag leaves (within the average range of 0.001-0.038% of total soluble protein) were significantly different among six transgenic lines at different developmental stages. Both laboratory and field researches suggested that the transgenic rice lines have considerable potential for protecting rice from attack by both stem borers.

  12. Analysis of Quality-Related Parameters in Mature Kernels of Polygalacturonase Inhibiting Protein (PGIP) Transgenic Bread Wheat Infected with Fusarium graminearum.

    Science.gov (United States)

    Masci, Stefania; Laino, Paolo; Janni, Michela; Botticella, Ermelinda; Di Carli, Mariasole; Benvenuto, Eugenio; Danieli, Pier Paolo; Lilley, Kathryn S; Lafiandra, Domenico; D'Ovidio, Renato

    2015-04-22

    Fusarium head blight, caused by the fungus Fusarium graminearum, has a detrimental effect on both productivity and qualitative properties of wheat. To evaluate its impact on wheat flour, we compared its effect on quality-related parameters between a transgenic bread wheat line expressing a bean polygalacturonase inhibiting protein (PGIP) and its control line. We have compared metabolic proteins, the amounts of gluten proteins and their relative ratios, starch content, yield, extent of pathogen contamination, and deoxynivalenol (DON) accumulation. These comparisons showed that Fusarium significantly decreases the amount of starch in infected control plants, but not in infected PGIP plants. The flour of PGIP plants contained also a lower amount of pathogen biomass and DON accumulation. Conversely, both gluten and metabolic proteins were not significantly influenced either by the transgene or by fungal infection. These results indicate that the transgenic PGIP expression reduces the level of infection, without changing significantly the wheat seed proteome and other quality-related parameters.

  13. Quantitative Comparison of Dense-Core Amyloid Plaque Accumulation in Amyloid-β Precursor Protein Transgenic Mice

    Science.gov (United States)

    Liu, Peng; Reichl, John H.; Rao, Eshaan R.; McNellis, Brittany M.; Huang, Eric S.; Hemmy, Laura S.; Forster, Colleen L.; Kuskowski, Michael A.; Borchelt, David R.; Vassar, Robert; Ashe, Karen H.; Zahs, Kathleen R.

    2016-01-01

    There exist several dozen lines of transgenic mice that express human amyloid-β precursor protein (AβPP) with Alzheimer’s disease (AD)-linked mutations. AβPP transgenic mouse lines differ in the types and amounts of Aβ that they generate and in their spatiotemporal patterns of expression of Aβ assemblies, providing a toolkit to study Aβ amyloidosis and the influence of Aβ aggregation on brain function. More complete quantitative descriptions of the types of Aβ assemblies present in transgenic mice and in humans during disease progression should add to our understanding of how Aβ toxicity in mice relates to the pathogenesis of AD. Here, we provide a direct quantitative comparison of amyloid plaque burdens and plaque sizes in four lines of AβPP transgenic mice. We measured the fraction of cortex and hippocampus occupied by dense-core plaques, visualized by staining with Thioflavin S, in mice from young adulthood through advanced age. We found that the plaque burdens among the transgenic lines varied by an order of magnitude: at 15 months of age, the oldest age studied, the median cortical plaque burden in 5XFAD mice was already ~4.5 times that of 21-month Tg2576 mice and ~15 times that of 21–24-month rTg9191 mice. Plaque-size distributions changed across the lifespan in a line- and region-dependent manner. We also compared the dense-core plaque burdens in the mice to those measured in a set of pathologically-confirmed AD cases from the Nun Study. Cortical plaque burdens in Tg2576, APPSwePS1ΔE9, and 5XFAD mice eventually far exceeded those measured in the human cohort. PMID:28059792

  14. Quantitative Comparison of Dense-Core Amyloid Plaque Accumulation in Amyloid-β Protein Precursor Transgenic Mice.

    Science.gov (United States)

    Liu, Peng; Reichl, John H; Rao, Eshaan R; McNellis, Brittany M; Huang, Eric S; Hemmy, Laura S; Forster, Colleen L; Kuskowski, Michael A; Borchelt, David R; Vassar, Robert; Ashe, Karen H; Zahs, Kathleen R

    2017-01-01

    There exist several dozen lines of transgenic mice that express human amyloid-β protein precursor (AβPP) with Alzheimer's disease (AD)-linked mutations. AβPP transgenic mouse lines differ in the types and amounts of Aβ that they generate and in their spatiotemporal patterns of expression of Aβ assemblies, providing a toolkit to study Aβ amyloidosis and the influence of Aβ aggregation on brain function. More complete quantitative descriptions of the types of Aβ assemblies present in transgenic mice and in humans during disease progression should add to our understanding of how Aβ toxicity in mice relates to the pathogenesis of AD. Here, we provide a direct quantitative comparison of amyloid plaque burdens and plaque sizes in four lines of AβPP transgenic mice. We measured the fraction of cortex and hippocampus occupied by dense-core plaques, visualized by staining with Thioflavin S, in mice from young adulthood through advanced age. We found that the plaque burdens among the transgenic lines varied by an order of magnitude: at 15 months of age, the oldest age studied, the median cortical plaque burden in 5XFAD mice was already ∼4.5 times that of 21-month-old Tg2576 mice and ∼15 times that of 21-24-month-old rTg9191 mice. Plaque-size distributions changed across the lifespan in a line- and region-dependent manner. We also compared the dense-core plaque burdens in the mice to those measured in a set of pathologically-confirmed AD cases from the Nun Study. Cortical plaque burdens in Tg2576, APPSwePS1ΔE9, and 5XFAD mice eventually far exceeded those measured in the human cohort.

  15. Germline recombination in a novel Cre transgenic line, Prl3b1-Cre mouse.

    Science.gov (United States)

    Al-Soudy, Al-Sayed; Nakanishi, Tsuyoshi; Mizuno, Seiya; Hasegawa, Yoshikazu; Shawki, Hossam H; Katoh, Megumi C; Basha, Walaa A; Ibrahim, Abdelaziz E; El-Shemy, Hany A; Iseki, Hiroyoshi; Yoshiki, Atsushi; Hiromori, Youhei; Nagase, Hisamitsu; Takahashi, Satoru; Oishi, Hisashi; Sugiyama, Fumihiro

    2016-07-01

    Spermatogenesis is a complex and highly regulated process by which spermatogonial stem cells differentiate into spermatozoa. To better understand the molecular mechanisms of the process, the Cre/loxP system has been widely utilized for conditional gene knockout in mice. In this study, we generated a transgenic mouse line that expresses Cre recombinase under the control of the 2.5 kbp of the Prolactin family 3, subfamily b, member 1 (Prl3b1) gene promoter (Prl3b1-cre). Prl3b1 was initially reported to code for placental lactogen 2 (PL-2) protein in placenta along with increased expression toward the end of pregnancy. PL-2 was found to be expressed in germ cells in the testis, especially in spermatocytes. To analyze the specificity and efficiency of Cre recombinase activity in Prl3b1-cre mice, the mice were mated with reporter R26GRR mice, which express GFP ubiquitously before and tdsRed exclusively after Cre recombination. The systemic examination of Prl3b1-cre;R26GRR mice revealed that tdsRed-positive cells were detected only in the testis and epididymis. Fluorescence imaging of Prl3b1-cre;R26GRR testes suggested that Cre-mediated recombination took place in the germ cells with approximately 74% efficiency determined by in vitro fertilization. In conclusion, our results suggest that the Prl3b1-cre mice line provides a unique resource to understand testicular germ-cell development. genesis 54:389-397, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  16. FLAX OIL FROM TRANSGENIC LINUM USITATISSIMUM SELECTIVELY INHIBITS IN VITRO PROLIFERATION OF HUMAN CANCER CELL LINES.

    Science.gov (United States)

    Gebarowski, Tomasz; Gebczak, Katarzyna; Wiatrak, Benita; Kulma, Anna; Pelc, Katarzyna; Czuj, Tadeusz; Szopa, Jan; Gasiorowski, Kazimierz

    2017-03-01

    Emulsions made of oils from transgenic flaxseeds significantly decreased in vitro proliferation of six tested human cancer cell lines in 48-h cultures, as assessed with the standard sulforhodamine assay. However, the emulsions also increased proliferation rate of normal human dermal fibroblasts and, to a lower extend, of keratinocytes. Both inhibition of in vitro proliferation of human cancer cell lines and stimulation of proliferation of normal dermal fibroblasts and keratinocytes were especially strong with the emulsion type B and with emulsion type M. Oils from seeds of transgenic flax type B and M should be considered as valuable adjunct to standard cytostatic therapy of human cancers and also could be applied to improve the treatment of skin lesions in wound healing.

  17. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    International Nuclear Information System (INIS)

    Wang Tiegu; Huang Qunce; Feng Weisen

    2007-01-01

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning

  18. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    Science.gov (United States)

    Wang, Tiegu; Huang, Qunce; Feng, Weisen

    2007-10-01

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

  19. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    Energy Technology Data Exchange (ETDEWEB)

    Tiegu, Wang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Qunce, Huang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Weisen, Feng [Luoyang Institute of Agricultural Science, Luoyang 471022 (China)

    2007-10-15

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

  20. Extraction and separation of water soluble proteins from Bacillus thuringiensis-transgenic and non-transgenic maize species by CZE

    Czech Academy of Sciences Publication Activity Database

    Sázelová, Petra; Kašička, Václav; Ibanez, E.; Cifuentes, A.

    2009-01-01

    Roč. 32, č. 21 (2009), s. 3801-3808 ISSN 1615-9306 R&D Projects: GA ČR(CZ) GA203/08/1428 Grant - others:GA ČR(CZ) GA203/09/0675 Program:GA Institutional research plan: CEZ:AV0Z40550506 Keywords : Bacillus thuringiensis -transgenic maize * CZE-UV profiling * Maize proteins Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.551, year: 2009

  1. Human plasma phospholipid transfer protein increases the antiatherogenic potential of high density lipoproteins in transgenic mice

    NARCIS (Netherlands)

    M.J. van Haperen (Rien); A. van Tol (Arie); P. Vermeulen; M. Jauhiainen; T. van Gent (Teus); P.M. van den Berg (Paul); S. Ehnholm (Sonja); A.W.M. van der Kamp (Arthur); M.P.G. de Crom (Rini); F.G. Grosveld (Frank)

    2000-01-01

    textabstractPlasma phospholipid transfer protein (PLTP) transfers phospholipids between lipoprotein particles and alters high density lipoprotein (HDL) subfraction patterns in vitro, but its physiological function is poorly understood. Transgenic mice that overexpress

  2. Evaluation of the agronomic performance of atrazine-tolerant transgenic japonica rice parental lines for utilization in hybrid seed production.

    Directory of Open Access Journals (Sweden)

    Luhua Zhang

    Full Text Available Currently, the purity of hybrid seed is a crucial limiting factor when developing hybrid japonica rice (Oryza sativa L.. To chemically control hybrid seed purity, we transferred an improved atrazine chlorohydrolase gene (atzA from Pseudomonas ADP into hybrid japonica parental lines (two maintainers, one restorer, and Nipponbare, by using Agrobacterium-mediated transformation. We subsequently selected several transgenic lines from each genotype by using PCR, RT-PCR, and germination analysis. In the presence of the investigated atrazine concentrations, particularly 150 µM atrazine, almost all of the transgenic lines produced significantly larger seedlings, with similar or higher germination percentages, than did the respective controls. Although the seedlings of transgenic lines were taller and gained more root biomass compared to the respective control plants, their growth was nevertheless inhibited by atrazine treatment compared to that without treatment. When grown in soil containing 2 mg/kg or 5 mg/kg atrazine, the transgenic lines were taller, and had higher total chlorophyll contents than did the respective controls; moreover, three of the strongest transgenic lines completely recovered after 45 days of growth. After treatment with 2 mg/kg or 5 mg/kg of atrazine, the atrazine residue remaining in the soil was 2.9-7.0% or 0.8-8.7% respectively, for transgenic lines, and 44.0-59.2% or 28.1-30.8%, respectively, for control plants. Spraying plants at the vegetative growth stage with 0.15% atrazine effectively killed control plants, but not transgenic lines. Our results indicate that transgenic atzA rice plants show tolerance to atrazine, and may be used as parental lines in future hybrid seed production.

  3. Characterization of gastric adenocarcinoma cell lines established from CEA424/SV40 T antigen-transgenic mice with or without a human CEA transgene

    International Nuclear Information System (INIS)

    Nöckel, Jessica; Engel, Natasja K van den; Winter, Hauke; Hatz, Rudolf A; Zimmermann, Wolfgang; Kammerer, Robert

    2006-01-01

    Gastric carcinoma is one of the most frequent cancers worldwide. Patients with gastric cancer at an advanced disease stage have a poor prognosis, due to the limited efficacy of available therapies. Therefore, the development of new therapies, like immunotherapy for the treatment of gastric cancer is of utmost importance. Since the usability of existing preclinical models for the evaluation of immunotherapies for gastric adenocarcinomas is limited, the goal of the present study was to establish murine in vivo models which allow the stepwise improvement of immunotherapies for gastric cancer. Since no murine gastric adenocarcinoma cell lines are available we established four cell lines (424GC, mGC3, mGC5, mGC8) from spontaneously developing tumors of CEA424/SV40 T antigen (CEA424/Tag) mice and three cell lines derived from double-transgenic offsprings of CEA424/Tag mice mated with human carcinoembryonic antigen (CEA)-transgenic (CEA424/Tag-CEA) mice (mGC2 CEA , mGC4 CEA , mGC11 CEA ). CEA424/Tag is a transgenic C57BL/6 mouse strain harboring the Tag under the control of a -424/-8 bp CEA gene promoter which leads to the development of invasive adenocarcinoma in the glandular stomach. Tumor cell lines established from CEA424/Tag-CEA mice express the well defined tumor antigen CEA under the control of its natural regulatory elements. The epithelial origin of the tumor cells was proven by morphological criteria including the presence of mucin within the cells and the expression of the cell adhesion molecules EpCAM and CEACAM1. All cell lines consistently express the transgenes CEA and/or Tag and MHC class I molecules leading to their susceptibility to lysis by Tag-specific CTL in vitro. Despite the presentation of CTL-epitopes derived from the transgene products the tumor cell lines were tumorigenic when grafted into C57BL/6, CEA424/Tag or CEA424/Tag-CEA-transgenic hosts and no significant differences in tumor take and tumor growth were observed in the different hosts

  4. Overexpression of wheat lipid transfer protein gene TaLTP5 increases resistances to Cochliobolus sativus and Fusarium graminearum in transgenic wheat.

    Science.gov (United States)

    Zhu, Xiuliang; Li, Zhao; Xu, Huijun; Zhou, Miaoping; Du, Lipu; Zhang, Zengyan

    2012-08-01

    The fungus Cochliobolus sativus is the main pathogen of common root rot, a serious soil-borne disease of wheat (Triticum aestivum L.). The fungus Fusarium graminearum is the primary pathogen of Fusarium head blight, a devastating disease of wheat worldwide. In this study, the wheat lipid transfer protein gene, TaLTP5, was cloned and evaluated for its ability to suppress disease development in transgenic wheat. TaLTP5 expression was induced after C. sativus infection. The TaLTP5 expression vector, pA25-TaLTP5, was constructed and bombarded into Chinese wheat variety Yangmai 18. Six TaLTP5 transgenic wheat lines were established and characterized. PCR and Southern blot analyses indicated that the introduced TaLTP5 gene was integrated into the genomes of six transgenic wheat lines by distinct patterns, and heritable. RT-PCR and real-time quantitative RT-PCR revealed that the TaLTP5 gene was over-expressed in the transgenic wheat lines compared to segregants lacking the transgene and wild-type wheat plants. Following challenge with C. sativus or F. graminearum, all six transgenic lines overexpressing TaLTP5 exhibited significantly enhanced resistance to both common root rot and Fusarium head blight compared to the untransformed wheat Yangmai 18.

  5. Expression of cold and drought regulatory protein (CcCDR) of pigeonpea imparts enhanced tolerance to major abiotic stresses in transgenic rice plants.

    Science.gov (United States)

    Sunitha, Mellacheruvu; Srinath, Tamirisa; Reddy, Vudem Dashavantha; Rao, Khareedu Venkateswara

    2017-06-01

    Transgenic rice expressing pigeonpea Cc CDR conferred high-level tolerance to different abiotic stresses. The multiple stress tolerance observed in CcCDR -transgenic lines is attributed to the modulation of ABA-dependent and-independent signalling-pathway genes. Stable transgenic plants expressing Cajanus cajan cold and drought regulatory protein encoding gene (CcCDR), under the control of CaMV35S and rd29A promoters, have been generated in indica rice. Different transgenic lines of CcCDR, when subjected to drought, salt, and cold stresses, exhibited higher seed germination, seedling survival rates, shoot length, root length, and enhanced plant biomass when compared with the untransformed control plants. Furthermore, transgenic plants disclosed higher leaf chlorophyll content, proline, reducing sugars, SOD, and catalase activities, besides lower levels of MDA. Localization studies revealed that the CcCDR-GFP fusion protein was mainly present in the nucleus of transformed cells of rice. The CcCDR transgenics were found hypersensitive to abscisic acid (ABA) and showed reduced seed germination rates as compared to that of control plants. When the transgenic plants were exposed to drought and salt stresses at vegetative and reproductive stages, they revealed larger panicles and higher number of filled grains compared to the untransformed control plants. Under similar stress conditions, the expression levels of P5CS, bZIP, DREB, OsLEA3, and CIPK genes, involved in ABA-dependent and-independent signal transduction pathways, were found higher in the transgenic plants than the control plants. The overall results amply demonstrate that the transgenic rice expressing CcCDR bestows high-level tolerance to drought, salt, and cold stress conditions. Accordingly, the CcCDR might be deployed as a promising candidate gene for improving the multiple stress tolerance of diverse crop plants.

  6. GENETIC TRANSFORMATION AND ANALYSIS OF WHEAT TRANSGENIC CELL LINES BY IRAP-PCR

    Directory of Open Access Journals (Sweden)

    Bavol A. V.

    2013-12-01

    Full Text Available The transgenic wheat cell lines were obtained via biolistic transformation of the callus cultures initiated from the 3-day-old sterile seedling shoot apexes. The pAHC25 vector construction used for 14- and 28-day-old callus cultures transformation carried the selective phosphinothricin-N-acetyltransferase (bar gene and reporter ?-glucuronidase gene. The cell line selection was carried out on the media with phosphinothricin by means of graduated cell selection. The transgenic status of the obtained forms was proved by PCR-analysis. The presence of new relatively high molecular (more than 1 000 bp amplicons were found out for three transformed lines by means of IRAP PCRanalysis with the primers coding for long termainal repeats sequences of SIRE 1 retrotransposon. This fact may prove transposition of this mobile genetic element. The new DNA fragments were detected for three of the seven analyzed lines but for the control callus. It is possible to assume at induction of SIRE 1 transposition bis probably caused by the genomic stress of foreign DNA inserting or associated with the transformation process (mechanical wounding, cultivation on selective media.

  7. Construction and analysis of the transgenic carrot and celery plants expressing the recombinant thaumatin II protein

    Directory of Open Access Journals (Sweden)

    Luchakivska Yu. S.

    2015-08-01

    Full Text Available Aim To obtain the transgenic carrot and celery plants able to express recombinant thaumatin II in order to increase plant stress tolerance. Methods. Agrobacterium-mediated transformation of the carrot and celery seedlings was used for obtaining the transgenic plants. Presence and transcription of the transgene in plant tissues were proved by PCR and RT-PCR analysis. The plants were tested for the biotic stress tolerance by in vitro antifungal and antibacterial activity assays and for the salinity and osmotic stress tolerance by plant survival test in presence of NaCl and PEG in different concentrations. Results. Transgenic plants able to express recombinant thaumatin II gene (transcription proved for 60–100 % were obtained by agrobacterial transformation. The transgenic carrot plant extracts inhibited the growth of the studied phytopathogenic bacteria strains but exhibited no antifungal activity. Survival level of transgenic plants under the salinity and osmotic stress effect was definitely higher comparing to the untransgenic ones. The analysis of the photosynthetic pigment content in the transgenic carrot plants showed no significant difference of this parameter under salinity stress that may indicate a possible protective activity of the recombinant protein. Conclusions. The obtained in our study transgenic carrot and celery plants able to express the recombinant thaumatin II gene were characterized by antibacterial activity and increased tolerance to salinity and osmotic stress factors.

  8. Establishment of a pig fibroblast-derived cell line for locus-directed transgene expression in cell cultures and blastocysts

    DEFF Research Database (Denmark)

    Jakobsen, Jannik E; Li, Juan; Moldt, Brian

    2011-01-01

    We report the establishment of a spontaneously immortalized pig cell line designated Pig Flip-in Visualize (PFV) for locus-directed transgene expression in pig cells and blastocysts. The PFV cell line was isolated from pig ear fibroblasts transfected with a Sleeping Beauty DNA transposon-based do......We report the establishment of a spontaneously immortalized pig cell line designated Pig Flip-in Visualize (PFV) for locus-directed transgene expression in pig cells and blastocysts. The PFV cell line was isolated from pig ear fibroblasts transfected with a Sleeping Beauty DNA transposon...

  9. Transgenic mice produced by retroviral transduction of male germ-line stem cells

    OpenAIRE

    Nagano, Makoto; Brinster, Clayton J.; Orwig, Kyle E.; Ryu, Buom-Yong; Avarbock, Mary R.; Brinster, Ralph L.

    2001-01-01

    Male germ-line stem cells are the only cell type in postnatal mammals that have the capability to self-renew and to contribute genes to the next generation. Genetic modification of these cells would provide an opportunity to study the biology of their complex self-renewal and differentiation processes, as well as enable the generation of transgenic animals in a wide range of species. Although retroviral vectors have been used as an efficient method to introduce genes into a variety of cell ty...

  10. Preparation and Observation of Fresh-frozen Sections of the Green Fluorescent Protein Transgenic Mouse Head

    International Nuclear Information System (INIS)

    Tada, Masahito; Shinohara, Yoshinori; Kato, Ichiro; Hiraga, Koichi; Aizawa, Tomoyasu; Demura, Makoto; Mori, Yoshihiro; Shinoda, Hiroyuki; Mizuguchi, Mineyuki; Kawano, Keiichi

    2006-01-01

    Hard tissue decalcification can cause variation in the constituent protein characteristics. This paper describes a method of preparating of frozen mouse head sections so as to clearly observe the nature of the constituent proteins. Frozen sections of various green fluorescent protein (GFP) transgenic mouse heads were prepared using the film method developed by Kawamoto and Shimizu. This method made specimen dissection without decalcification possible, wherein GFP was clearly observed in an undamaged state. Conversely, using the same method with decalcification made GFP observation in the transgenic mouse head difficult. This new method is suitable for observing GFP marked cells, enabling us to follow the transplanted GFP marked cells within frozen head sections

  11. Secretion of a recombinant protein without a signal peptide by the exocrine glands of transgenic rabbits.

    Directory of Open Access Journals (Sweden)

    Andrea Kerekes

    Full Text Available Transgenic rabbits carrying mammary gland specific gene constructs are extensively used for excreting recombinant proteins into the milk. Here, we report refined phenotyping of previously generated Venus transposon-carrying transgenic rabbits with particular emphasis on the secretion of the reporter protein by exocrine glands, such as mammary, salivary, tear and seminal glands. The Sleeping Beauty (SB transposon transgenic construct contains the Venus fluorophore cDNA, but without a signal peptide for the secretory pathway, driven by the ubiquitous CAGGS (CAG promoter. Despite the absence of a signal peptide, the fluorophore protein was readily detected in milk, tear, saliva and seminal fluids. The expression pattern was verified by Western blot analysis. Mammary gland epithelial cells of SB-CAG-Venus transgenic lactating does also showed Venus-specific expression by tissue histology and fluorescence microscopy. In summary, the SB-CAG-Venus transgenic rabbits secrete the recombinant protein by different glands. This finding has relevance not only for the understanding of the biological function of exocrine glands, but also for the design of constructs for expression of recombinant proteins in dairy animals.

  12. Secretion of a recombinant protein without a signal peptide by the exocrine glands of transgenic rabbits.

    Science.gov (United States)

    Kerekes, Andrea; Hoffmann, Orsolya Ivett; Iski, Gergely; Lipták, Nándor; Gócza, Elen; Kues, Wilfried A; Bősze, Zsuzsanna; Hiripi, László

    2017-01-01

    Transgenic rabbits carrying mammary gland specific gene constructs are extensively used for excreting recombinant proteins into the milk. Here, we report refined phenotyping of previously generated Venus transposon-carrying transgenic rabbits with particular emphasis on the secretion of the reporter protein by exocrine glands, such as mammary, salivary, tear and seminal glands. The Sleeping Beauty (SB) transposon transgenic construct contains the Venus fluorophore cDNA, but without a signal peptide for the secretory pathway, driven by the ubiquitous CAGGS (CAG) promoter. Despite the absence of a signal peptide, the fluorophore protein was readily detected in milk, tear, saliva and seminal fluids. The expression pattern was verified by Western blot analysis. Mammary gland epithelial cells of SB-CAG-Venus transgenic lactating does also showed Venus-specific expression by tissue histology and fluorescence microscopy. In summary, the SB-CAG-Venus transgenic rabbits secrete the recombinant protein by different glands. This finding has relevance not only for the understanding of the biological function of exocrine glands, but also for the design of constructs for expression of recombinant proteins in dairy animals.

  13. A human beta cell line with drug inducible excision of immortalizing transgenes

    Science.gov (United States)

    Benazra, Marion; Lecomte, Marie-José; Colace, Claire; Müller, Andreas; Machado, Cécile; Pechberty, Severine; Bricout-Neveu, Emilie; Grenier-Godard, Maud; Solimena, Michele; Scharfmann, Raphaël; Czernichow, Paul; Ravassard, Philippe

    2015-01-01

    Objectives Access to immortalized human pancreatic beta cell lines that are phenotypically close to genuine adult beta cells, represent a major tool to better understand human beta cell physiology and develop new therapeutics for Diabetes. Here we derived a new conditionally immortalized human beta cell line, EndoC-βH3 in which immortalizing transgene can be efficiently removed by simple addition of tamoxifen. Methods We used lentiviral mediated gene transfer to stably integrate a tamoxifen inducible form of CRE (CRE-ERT2) into the recently developed conditionally immortalized EndoC βH2 line. The resulting EndoC-βH3 line was characterized before and after tamoxifen treatment for cell proliferation, insulin content and insulin secretion. Results We showed that EndoC-βH3 expressing CRE-ERT2 can be massively amplified in culture. We established an optimized tamoxifen treatment to efficiently excise the immortalizing transgenes resulting in proliferation arrest. In addition, insulin expression raised by 12 fold and insulin content increased by 23 fold reaching 2 μg of insulin per million cells. Such massive increase was accompanied by enhanced insulin secretion upon glucose stimulation. We further observed that tamoxifen treated cells maintained a stable function for 5 weeks in culture. Conclusions EndoC βH3 cell line represents a powerful tool that allows, using a simple and efficient procedure, the massive production of functional non-proliferative human beta cells. Such cells are close to genuine human beta cells and maintain a stable phenotype for 5 weeks in culture. PMID:26909308

  14. A comparative study on pathological features of transgenic rat lines expressing either three or four repeat misfolded tau.

    Science.gov (United States)

    Valachova, Bernadeta; Brezovakova, Veronika; Bugos, Ondrej; Jadhav, Santosh; Smolek, Tomas; Novak, Petr; Zilka, Norbert

    2018-08-01

    Human tauopathies represent a heterogeneous group of neurodegenerative disorders characterized by distinct clinical features, typical histopathological structures, and defined ratio(s) of three-repeat and four-repeat tau isoforms within pathological aggregates. How the optional microtubule-binding repeat of tau influences this differentiation of pathologies is understudied. We have previously generated and characterized transgenic rodent models expressing human truncated tau aa151-391 with either three (SHR24) or four microtubule-binding repeats (SHR72). Here, we compare the behavioral and neuropathological hallmarks of these two transgenic lines using a battery of tests for sensorimotor, cognitive, and neurological functions over the age range of 3.5-15 months. Progression of sensorimotor and neurological deficits was similar in both transgenic lines; however, the lifespan of transgenic line SHR72 expressing truncated four-repeat tau was markedly shorter than SHR24. Moreover, the expression of three or four-repeat tau induced distinct neurofibrillary pathology in these lines. Transgenic lines displayed different distribution of tau pathology and different type of neurofibrillary tangles. Our results suggest that three- and four-repeat isoforms of tau may display different modes of action in the diseased brain. © 2018 Wiley Periodicals, Inc.

  15. A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis.

    Science.gov (United States)

    Lu, Pu; Magwanga, Richard Odongo; Lu, Hejun; Kirungu, Joy Nyangasi; Wei, Yangyang; Dong, Qi; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Kunbo; Liu, Fang

    2018-04-12

    Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs) are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 ( TOM1 ), a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum , 9 in Gossypium arboreum , and 11 in Gossypium raimondii . The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY) values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM) was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H₂O₂. The low malondialdehyde (MDA) level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM) can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress-tolerant cotton

  16. A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis

    Directory of Open Access Journals (Sweden)

    Pu Lu

    2018-04-01

    Full Text Available Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 (TOM1, a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum, 9 in Gossypium arboreum, and 11 in Gossypium raimondii. The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H2O2. The low malondialdehyde (MDA level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress

  17. Mushroom body miscellanea: transgenic Drosophila strains expressing anatomical and physiological sensor proteins in Kenyon cells

    Science.gov (United States)

    Pech, Ulrike; Dipt, Shubham; Barth, Jonas; Singh, Priyanka; Jauch, Mandy; Thum, Andreas S.; Fiala, André; Riemensperger, Thomas

    2013-01-01

    The fruit fly Drosophila melanogaster represents a key model organism for analyzing how neuronal circuits regulate behavior. The mushroom body in the central brain is a particularly prominent brain region that has been intensely studied in several insect species and been implicated in a variety of behaviors, e.g., associative learning, locomotor activity, and sleep. Drosophila melanogaster offers the advantage that transgenes can be easily expressed in neuronal subpopulations, e.g., in intrinsic mushroom body neurons (Kenyon cells). A number of transgenes has been described and engineered to visualize the anatomy of neurons, to monitor physiological parameters of neuronal activity, and to manipulate neuronal function artificially. To target the expression of these transgenes selectively to specific neurons several sophisticated bi- or even multipartite transcription systems have been invented. However, the number of transgenes that can be combined in the genome of an individual fly is limited in practice. To facilitate the analysis of the mushroom body we provide a compilation of transgenic fruit flies that express transgenes under direct control of the Kenyon-cell specific promoter, mb247. The transgenes expressed are fluorescence reporters to analyze neuroanatomical aspects of the mushroom body, proteins to restrict ectopic gene expression to mushroom bodies, or fluorescent sensors to monitor physiological parameters of neuronal activity of Kenyon cells. Some of the transgenic animals compiled here have been published already, whereas others are novel and characterized here for the first time. Overall, the collection of transgenic flies expressing sensor and reporter genes in Kenyon cells facilitates combinations with binary transcription systems and might, ultimately, advance the physiological analysis of mushroom body function. PMID:24065891

  18. Heterogeneous transgene expression in the retinas of the TH-RFP, TH-Cre, TH-BAC-Cre and DAT-Cre mouse lines.

    Science.gov (United States)

    Vuong, H E; Pérez de Sevilla Müller, L; Hardi, C N; McMahon, D G; Brecha, N C

    2015-10-29

    Transgenic mouse lines are essential tools for understanding the connectivity, physiology and function of neuronal circuits, including those in the retina. This report compares transgene expression in the retina of a tyrosine hydroxylase (TH)-red fluorescent protein (RFP) mouse line with three catecholamine-related Cre recombinase mouse lines [TH-bacterial artificial chromosome (BAC)-, TH-, and dopamine transporter (DAT)-Cre] that were crossed with a ROSA26-tdTomato reporter line. Retinas were evaluated and immunostained with commonly used antibodies including those directed to TH, GABA and glycine to characterize the RFP or tdTomato fluorescent-labeled amacrine cells, and an antibody directed to RNA-binding protein with multiple splicing to identify ganglion cells. In TH-RFP retinas, types 1 and 2 dopamine (DA) amacrine cells were identified by their characteristic cellular morphology and type 1 DA cells by their expression of TH immunoreactivity. In the TH-BAC-, TH-, and DAT-tdTomato retinas, less than 1%, ∼ 6%, and 0%, respectively, of the fluorescent cells were the expected type 1 DA amacrine cells. Instead, in the TH-BAC-tdTomato retinas, fluorescently labeled AII amacrine cells were predominant, with some medium diameter ganglion cells. In TH-tdTomato retinas, fluorescence was in multiple neurochemical amacrine cell types, including four types of polyaxonal amacrine cells. In DAT-tdTomato retinas, fluorescence was in GABA immunoreactive amacrine cells, including two types of bistratified and two types of monostratified amacrine cells. Although each of the Cre lines was generated with the intent to specifically label DA cells, our findings show a cellular diversity in Cre expression in the adult retina and indicate the importance of careful characterization of transgene labeling patterns. These mouse lines with their distinctive cellular labeling patterns will be useful tools for future studies of retinal function and visual processing. Published by Elsevier

  19. Transgenic biofortification of the starchy staple cassava (Manihot esculenta generates a novel sink for protein.

    Directory of Open Access Journals (Sweden)

    Mohammad Abhary

    Full Text Available Although calorie dense, the starchy, tuberous roots of cassava provide the lowest sources of dietary protein within the major staple food crops (Manihot esculenta Crantz. (Montagnac JA, Davis CR, Tanumihardjo SA. (2009 Compr Rev Food Sci Food Saf 8:181-194. Cassava was genetically modified to express zeolin, a nutritionally balanced storage protein under control of the patatin promoter. Transgenic plants accumulated zeolin within de novo protein bodies localized within the root storage tissues, resulting in total protein levels of 12.5% dry weight within this tissue, a fourfold increase compared to non-transgenic controls. No significant differences were seen for morphological or agronomic characteristics of transgenic and wild type plants in the greenhouse and field trials, but relative to controls, levels of cyanogenic compounds were reduced by up to 55% in both leaf and root tissues of transgenic plants. Data described here represent a proof of concept towards the potential transformation of cassava from a starchy staple, devoid of storage protein, to one capable of supplying inexpensive, plant-based proteins for food, feed and industrial applications.

  20. Influence of Phytase Transgenic Corn on the Intestinal Microflora and the Fate of Transgenic DNA and Protein in Digesta and Tissues of Broilers

    Science.gov (United States)

    Li, Sufen; Li, Ang; Zhang, Liyang; Liu, Zhenhua; Luo, Xugang

    2015-01-01

    An experiment was conducted to investigate the effect of phytase transgenic corn (PTC) on intestinal microflora, and the fate of transgenic DNA and protein in the digesta and tissues of broilers. A total of 160 1-day-old Arbor Acres commercial male broilers were randomly assigned to 20 cages (8 chicks per cage) with 10 cages (replicates) for each treatment. Birds were fed with a diet containing either PTC (54.0% during 1–21 days and 61.0% during 22–42 days) or non-transgenic isogenic control corn (CC) for a duration of 42 days. There were no significant differences (P>0.05) between birds fed with the PTC diets and those fed with the CC diets in the quantities of aerobic bacteria, anaerobic bacteria, colibacillus and lactobacilli, or microbial diversities in the contents of ileum and cecum. Transgenic phyA2 DNA was not detected, but phyA2 protein was detected in the digesta of duodenum and jejunum of broilers fed with the PTC diets. Both transgenic phyA2 DNA and protein fragments were not found in the digesta of the ileum and rectum, heart, liver, kidney, and breast or thigh muscles of broilers fed with the PTC diets. It was concluded that PTC had no adverse effect on the quantity and diversity of gut microorganisms; Transgenic phyA2 DNA or protein was rapidly degraded in the intestinal tract and was not transferred to the tissues of broilers. PMID:26599444

  1. Expression levels of antimicrobial peptide tachyplesin I in transgenic Ornithogalum lines affect the resistance to Pectobacterium infection.

    Science.gov (United States)

    Lipsky, Alexander; Joshi, Janak Raj; Carmi, Nir; Yedidia, Iris

    2016-11-20

    The genus Ornithogalum includes several ornamental species that suffer substantial losses from bacterial soft rot caused by Pectobacteria. The absence of effective control measures for use against soft rot bacteria led to the initiation of a project in which a small antimicrobial peptide from an Asian horseshoe crab, tachyplesin (tpnI), was introduced into two commercial cultivars: O. dubium and O. thyrsoides. Disease severity and bacterial colonization were examined in transgenic lines expressing this peptide. Disease resistance was evaluated in six lines of each species by measuring bacterial proliferation in the plant tissue. Three transgenic lines of each species were subjected to further analysis in which the expression level of the transgene was evaluated using RT-PCR and qRT-PCR. The development of disease symptoms and bacterial colonization of the plant tissue were also examined using GFP-expressing strain of P. carotovorum subsp. brasiliense Pcb3. Confocal-microscopy imaging revealed significantly reduced quantities of bacterial cells in the transgenic plant lines that had been challenged with the bacterium. The results clearly demonstrate that tpnI expression reduces bacterial proliferation, colonization and disease symptom (reduced by 95-100%) in the transgenic plant tissues. The quantity of tpnI transcripts, as measured by qRT-PCR, was negatively correlated with the protection afforded to the plants, as measured by the reduced severity of disease symptoms in the tissue. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Transgenic Chinese hamster V79 cell lines which exhibit variable levels of gpt mutagenesis

    International Nuclear Information System (INIS)

    Klein, C.B.; Rossman, T.G.

    1990-01-01

    The Escherichia coli gpt gene coding for xanthine-guanine phosphoribosyl transferase has been stably transfected into HPRT - Chinese hamster V79 cells. Several gpt - cell lines have been established, which retain the sequence(s) even after long-term culture without selection for gpt. While spontaneous mutagenesis to gpt - occurs rather frequently for most cell lines, it cannot be correlated with either the number of plasmid integration sites or deletion of the plasmid sequence(s). One transgenic cell line (g12), which continuously maintains a low spontaneous mutation frequency was used in comparative mutagenesis studies with wild-type V79 cells (gpt vs. hprt). Alkylating agents such as N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) and β-propiolactone (BPL) are shown to be equally toxic and mutagenic in both g12 and V79 cells. UV and X-rays are also equally toxic to both cell lines. The data presented here suggests that g12 cells may be useful to study mammalian mutagenesis by agents which yield limited response at the hprt locus

  3. Secretory proteins of the pulmonary extracellular lining

    International Nuclear Information System (INIS)

    Gupta, R.P.; Patton, S.E.; Eddy, M.; Smits, H.L.; Jetten, A.M.; Nettesheim, P.; Hook, G.E.R.

    1986-01-01

    The objective of this investigation was to identify proteins in the pulmonary extracellular lining (EL) that are secreted by cells of the pulmonary epithelium. Pulmonary lavage effluents from the lungs of rabbits were centrifuged to remove all cells and particulate materials. Serum proteins were removed by repeatedly passing concentrated lavage effluent fluid through an affinity column containing IgG fraction of goat anti-rabbit (whole serum) antiserum bound to Sepharose-4B. Nonserum proteins accounted for 21.3 +/- 10.3% of the total soluble proteins in pulmonary lavage effluents. Serum free lavage effluents (SFL) contained 25 identifiable proteins as determined by using SDS-PAGE under reducing conditions. Of these proteins approximately 73% was accounted for by a single protein with MW of 66 kd. The secretory nature of the proteins present in SFL was investigated by studying the incorporation of 35 S-methionine into proteins released by lung slices and trachea followed by SDS-PAGE and autoradiography. Many, but not all proteins present in SFL were identified as proteins secreted by pulmonary tissues. The major secretory proteins appeared to have MWs of 59, 53, 48, 43, 24, 14, and 6 kd under reducing conditions. These data demonstrate the presence of several proteins in the pulmonary extracellular lining that appear to be secreted by the pulmonary epithelium

  4. Rapid development of stable transgene CHO cell lines by CRISPR/Cas9-mediated site-specific integration into C12orf35.

    Science.gov (United States)

    Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei

    2018-07-01

    Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.

  5. Aquatic degradation of Cry1Ab protein and decomposition dynamics of transgenic corn leaves under controlled conditions.

    Science.gov (United States)

    Böttger, Rita; Schaller, Jörg; Lintow, Sven; Gert Dudel, E

    2015-03-01

    The increasing cultivation of genetically modified corn plants (Zea mays) during the last decades is suggested as a potential risk to the environment. One of these genetically modified variety expressed the insecticidal Cry1Ab protein originating from Bacillus thuringiensis (Bt), resulting in resistance against Ostrinia nubilalis, the European corn borer. Transgenic litter material is extensively studied regarding the decomposition in soils. However, only a few field studies analyzed the fate of the Cry1Ab protein and the impact of green and senescent leaf litter from corn on the decomposition rate and related ecosystem functions in aquatic environments. Consequently, a microbial litter decomposition experiment was conducted under controlled semi-natural conditions in batch culture using two maize varieties: one variety with Cry1Ab and another one with the appertaining Iso-line as control treatment. The results showed no significant differences between the treatment with Cry1Ab and the Iso-line regarding loss of total mass in dry weight of 43% for Iso-line and 45% for Bt-corn litter, lignin content increased to 137.5% (Iso-line) and 115.7% (Bt-corn), and phenol loss decreased by 53.6% (Iso-line), 62.2% (Bt-corn) during three weeks of the experiment. At the end of the experiment Cry1Ab protein was still detected with 6% of the initial concentration. A slightly but significant lower cellulose content was found for the Cry1Ab treatment compared to the Iso-line litter at the end of the experiment. The significant higher total protein (25%) and nitrogen (25%) content in Bt corn, most likely due to the additionally expression of the transgenic protein, may increase the microbial cellulose degradation and decrease microbial lignin degradation. In conclusion a relevant year by year input of protein and therefore nitrogen rich Bt corn litter into aquatic environments may affect the balanced nutrient turnover in aquatic ecosystems. Copyright © 2014 Elsevier Inc. All rights

  6. Spatial Distribution of Transgenic Protein After Gene Electrotransfer to Porcine Muscle

    DEFF Research Database (Denmark)

    Spanggaard, Iben; Corydon, Thomas; Hojman, Pernille

    2012-01-01

    Abstract Gene electrotransfer is an effective nonviral technique for delivery of plasmid DNA into tissues. From a clinical perspective, muscle is an attractive target tissue as long-term, high-level transgenic expression can be achieved. Spatial distribution of the transgenic protein following gene...... electrotransfer to muscle in a large animal model has not yet been investigated. In this study, 17 different doses of plasmid DNA (1-1500 μg firefly luciferase pCMV-Luc) were delivered in vivo to porcine gluteal muscle using electroporation. Forty-eight hours post treatment several biopsies were obtained from...... each transfection site in order to examine the spatial distribution of the transgenic product. We found a significantly higher luciferase activity in biopsies from the center of the transfection site compared to biopsies taken adjacent to the center, 1 and 2 cm along muscle fiber orientation (p...

  7. Development of transgenic cotton lines expressing Allium sativum agglutinin (ASAL) for enhanced resistance against major sap-sucking pests.

    Science.gov (United States)

    Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2013-01-01

    Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.

  8. Comparative studies focusing on transgenic through cp4EPSPS gene and non-transgenic soybean plants: an analysis of protein species and enzymes.

    Science.gov (United States)

    Arruda, Sandra C C; Barbosa, Herbert S; Azevedo, Ricardo A; Arruda, Marco A Z

    2013-11-20

    This work evaluates the activity of a few key enzymes involved in combating reactive oxygen species (ROS), such as ascorbate peroxidase (EC 1.11.1.11), catalase (EC 1.11.1.6), glutathione reductase (EC 1.6.4.2), and superoxide dismutase (EC 1.15.1.1), as well as the concentration of malondialdehyde and hydrogen peroxide in transgenic and non-transgenic soybean leaves. Additionally, differential protein species from leaves of both genotypes were evaluated by applying a regulation factor of ≥1.8 to further corroborate the hypothesis that genetic modification itself can be a stress factor for these plants. For this task, transgenic soybean plants were obtained from seeds modified with the cp4EPSPS gene. The results revealed higher activities of all evaluated enzymes in transgenic than in non-transgenic soybean leaves (ranging from 13.8 to 70.1%), as well as higher concentrations of malondialdehyde and hydrogen peroxide in transgenic soybean leaves, clearly indicating a condition of oxidative stress established in the transgenic genotype. Additionally, 47 proteins were differentially abundant when comparing the leaves of both plants, with 26 species accurately identified, including the protein involved in the genetic modification (CP4EPSPS). From these results, it is possible to conclude that the plant is searching for a new equilibrium to maintain its metabolism because the stress condition is being maintained within levels that can be tolerated by the plant. The present paper is the first one in the literature where are shown translational aspects involving plant stress and the genetic modification for soybean involving the cp4 EPSPS gene. The main biological importance of this work is to make possible the demystification of the genetic modification, allowing answers for some questions that still remain unknown, and enlarge our knowledge about genetically modified organisms. This article is part of a Special Issue entitled: Translational Plant Proteomics. Copyright

  9. Analysis of T-DNA/Host-Plant DNA Junction Sequences in Single-Copy Transgenic Barley Lines

    Directory of Open Access Journals (Sweden)

    Joanne G. Bartlett

    2014-01-01

    Full Text Available Sequencing across the junction between an integrated transfer DNA (T-DNA and a host plant genome provides two important pieces of information. The junctions themselves provide information regarding the proportion of T-DNA which has integrated into the host plant genome, whilst the transgene flanking sequences can be used to study the local genetic environment of the integrated transgene. In addition, this information is important in the safety assessment of GM crops and essential for GM traceability. In this study, a detailed analysis was carried out on the right-border T-DNA junction sequences of single-copy independent transgenic barley lines. T-DNA truncations at the right-border were found to be relatively common and affected 33.3% of the lines. In addition, 14.3% of lines had rearranged construct sequence after the right border break-point. An in depth analysis of the host-plant flanking sequences revealed that a significant proportion of the T-DNAs integrated into or close to known repetitive elements. However, this integration into repetitive DNA did not have a negative effect on transgene expression.

  10. A transgenic model of transactivation by the Tax protein of HTLV-I.

    Science.gov (United States)

    Bieberich, C J; King, C M; Tinkle, B T; Jay, G

    1993-09-01

    The human T-lymphotropic virus type I (HTLV-I) Tax protein is a transcriptional regulatory protein that has been suggested to play a causal role in the development of several HTLV-I-associated diseases. Tax regulates expression of its own LTR and of certain cellular promoters perhaps by usurping the function of the host transcriptional machinery. We have established a transgenic mouse model system to define the spectrum of tissues in vivo that are capable of supporting Tax-mediated transcriptional transactivation. Transgenic mice carrying the HTLV-I LTR driving expression of the Escherichia coli beta-galactosidase (beta gal) gene were generated, and this LTR-beta gal gene was transcriptionally inactive in all tissues. When LTR-beta gal mice were mated to transgenic mice carrying the same LTR driving expression of the HTLV-I tax gene, mice that carried both transgenes showed restricted expression of the beta gal reporter gene in several tissues including muscle, bone, salivary glands, skin, and nerve. In addition, a dramatic increase in the number of beta gal-expressing cells was seen in response to wounding. These observations provide direct evidence for viral transactivation in vivo, delimit the tissues capable of supporting that transactivation, and provide a model system to study the mechanism of gene regulation by Tax.

  11. Derivation of mouse embryonic stem cell lines from tyrosine hydroxylase reporter mice crossed with a human SNCA transgenic mouse model of Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Margarita Chumarina

    2017-03-01

    Full Text Available Mouse embryonic stem cell (mESC lines were derived by crossing heterozygous transgenic (tg mice expressing green fluorescent protein (GFP under the control of the rat tyrosine hydroxylase (TH promoter, with homozygous alpha-synuclein (aSYN mice expressing human mutant SNCAA53T under the control of the mouse Prion promoter (MoPrP, or wildtype (WT mice. The expression of GFP and human aSYN was validated by immunocytochemistry in midbrain neuron cultures upon differentiation of mESC lines using stromal cell-derived inducing activity. These mESC lines can help to study the impact of human aSYN expression in neurons and oligodendrocytes, and also trace GFP-expressing midbrain neurons.

  12. Zebrafish transgenic line huORFZ is an effective living bioindicator for detecting environmental toxicants.

    Directory of Open Access Journals (Sweden)

    Hung-Chieh Lee

    Full Text Available Reliable animal models are invaluable for monitoring the extent of pollution in the aquatic environment. In this study, we demonstrated the potential of huORFZ, a novel transgenic zebrafish line that harbors a human upstream open reading frame of the chop gene fused with GFP reporter, as an animal model for monitoring environmental pollutants and stress-related cellular processes. When huORFZ embryos were kept under normal condition, no leaked GFP signal could be detected. When treated with hazardous chemicals, including heavy metals and endocrine-disrupting chemicals near their sublethal concentrations (LC50, huORFZ embryos exhibited different tissue-specific GFP expression patterns. For further analysis, copper (Cu2+, cadmium (Cd2+ and Chlorpyrifos were applied. Cu2+ triggered GFP responses in skin and muscle, whereas Cd2+ treatment triggered GFP responses in skin, olfactory epithelium and pronephric ducts. Moreover, fluorescence intensity, as exhibited by huORFZ embryos, was dose-dependent. After surviving treated embryos were returned to normal condition, survival rates, as well as TUNEL signals, returned to pretreatment levels with no significant morphological defects observed. Such results indicated the reversibility of treatment conditions used in this study, as long as embryos survived such conditions. Notably, GFP signals decreased along with recovery, suggesting that GFP signaling of huORFZ embryos likely reflected the overall physiological condition of the individual. To examine the performance of the huORFZ line under real-world conditions, we placed huORFZ embryos in different river water samples. We found that the huORFZ embryos correctly detected the presence of various kinds of pollutants. Based on these findings, we concluded that such uORFchop-based system can be integrated into a first-line water alarm system monitoring the discharge of hazardous pollutants.

  13. Zebrafish Transgenic Line huORFZ Is an Effective Living Bioindicator for Detecting Environmental Toxicants

    Science.gov (United States)

    Chu, Chien; Li, Hong-Ping; Tsai, Huai-Jen

    2014-01-01

    Reliable animal models are invaluable for monitoring the extent of pollution in the aquatic environment. In this study, we demonstrated the potential of huORFZ, a novel transgenic zebrafish line that harbors a human upstream open reading frame of the chop gene fused with GFP reporter, as an animal model for monitoring environmental pollutants and stress-related cellular processes. When huORFZ embryos were kept under normal condition, no leaked GFP signal could be detected. When treated with hazardous chemicals, including heavy metals and endocrine-disrupting chemicals near their sublethal concentrations (LC50), huORFZ embryos exhibited different tissue-specific GFP expression patterns. For further analysis, copper (Cu2+), cadmium (Cd2+) and Chlorpyrifos were applied. Cu2+ triggered GFP responses in skin and muscle, whereas Cd2+ treatment triggered GFP responses in skin, olfactory epithelium and pronephric ducts. Moreover, fluorescence intensity, as exhibited by huORFZ embryos, was dose-dependent. After surviving treated embryos were returned to normal condition, survival rates, as well as TUNEL signals, returned to pretreatment levels with no significant morphological defects observed. Such results indicated the reversibility of treatment conditions used in this study, as long as embryos survived such conditions. Notably, GFP signals decreased along with recovery, suggesting that GFP signaling of huORFZ embryos likely reflected the overall physiological condition of the individual. To examine the performance of the huORFZ line under real-world conditions, we placed huORFZ embryos in different river water samples. We found that the huORFZ embryos correctly detected the presence of various kinds of pollutants. Based on these findings, we concluded that such uORFchop-based system can be integrated into a first-line water alarm system monitoring the discharge of hazardous pollutants. PMID:24594581

  14. Analysis of Recombinant Proteins in Transgenic Rice Seeds: Identity, Localization, Tolerance to Digestion, and Plant Stress Response.

    Science.gov (United States)

    Wakasa, Yuhya; Takaiwa, Fumio

    2016-01-01

    Rice seeds are an ideal production platform for high-value recombinant proteins in terms of economy, scalability, safety, and stability. Strategies for the expression of large amounts of recombinant proteins in rice seeds have been established in the past decade and transgenic rice seeds that accumulate recombinant products such as bioactive peptides and proteins, which promote the health and quality of life of humans, have been generated in many laboratories worldwide. One of the most important advantages is the potential for direct oral delivery of transgenic rice seeds without the need for recombinant protein purification (downstream processing), which has been attributed to the high expression levels of recombinant products. Transgenic rice will be beneficial as a delivery system for pharmaceuticals and nutraceuticals in the future. This chapter introduces the strategy for producing recombinant protein in the edible part (endosperm) of the rice grain and describes methods for the analysis of transgenic rice seeds in detail.

  15. Overexpression of a Plasma Membrane-Localized SbSRP-Like Protein Enhances Salinity and Osmotic Stress Tolerance in Transgenic Tobacco

    Directory of Open Access Journals (Sweden)

    Avinash Mishra

    2017-04-01

    Full Text Available An obligate halophyte, Salicornia brachiata grows in salt marshes and is considered to be a potential resource of salt- and drought-responsive genes. It is important to develop an understanding of the mechanisms behind enhanced salt tolerance. To increase this understanding, a novel SbSRP gene was cloned, characterized, over-expressed, and functionally validated in the model plant Nicotiana tabacum. The genome of the halophyte S. brachiata contains two homologs of an intronless SbSRP gene of 1,262 bp in length that encodes for a stress-related protein. An in vivo localization study confirmed that SbSRP is localized on the plasma membrane. Transgenic tobacco plants (T1 that constitutively over-express the SbSRP gene showed improved salinity and osmotic stress tolerance. In comparison to Wild Type (WT and Vector Control (VC plants, transgenic lines showed elevated relative water and chlorophyll content, lower malondialdehyde content, lower electrolyte leakage and higher accumulation of proline, free amino acids, sugars, polyphenols, and starch under abiotic stress treatments. Furthermore, a lower build-up of H2O2 content and superoxide-radicals was found in transgenic lines compared to WT and VC plants under stress conditions. Transcript expression of Nt-APX (ascorbate peroxidase, Nt-CAT (catalase, Nt-SOD (superoxide dismutase, Nt-DREB (dehydration responsive element binding factor, and Nt-AP2 (apetala2 genes was higher in transgenic lines under stress compared to WT and VC plants. The results suggested that overexpression of membrane-localized SbSRP mitigates salt and osmotic stress in the transgenic tobacco plant. It was hypothesized that SbSRP can be a transporter protein to transmit the environmental stimuli downward through the plasma membrane. However, a detailed study is required to ascertain its exact role in the abiotic stress tolerance mechanism. Overall, SbSRP is a potential candidate to be used for engineering salt and osmotic

  16. Influence of transgenic rice expressing a fused Cry1Ab/1Ac protein on frogs in paddy fields.

    Science.gov (United States)

    Wang, Jia-Mei; Chen, Xiu-Ping; Liang, Yu-Yong; Zhu, Hao-Jun; Ding, Jia-Tong; Peng, Yu-Fa

    2014-11-01

    As genetic engineering in plants is increasingly used to control agricultural pests, it is important to determine whether such transgenic plants adversely affect non-target organisms within and around cultivated fields. The cry1Ab/1Ac fusion gene from Bacillus thuringiensis (Bt) has insecticidal activity and has been introduced into rice line Minghui 63 (MH63). We evaluated the effect of transgenic cry1Ab/1Ac rice (Huahui 1, HH1) on paddy frogs by comparing HH1 and MH63 rice paddies with and without pesticide treatment. The density of tadpoles in rice fields was surveyed at regular intervals, and Cry1Ab/1Ac protein levels were determined in tissues of tadpoles and froglets collected from the paddy fields. In addition, Rana nigromaculata froglets were raised in purse nets placed within these experimental plots. The survival, body weight, feeding habits, and histological characteristics of the digestive tract of these froglets were analyzed. We found that the tadpole density was significantly decreased immediately after pesticide application, and the weight of R. nigromaculata froglets of pesticide groups was significantly reduced compared with no pesticide treatment, but we found no differences between Bt and non-Bt rice groups. Moreover, no Cry1Ab/1Ac protein was detected in tissue samples collected from 192 tadpoles and froglets representing all four experimental groups. In addition, R. nigromaculata froglets raised in purse seines fed primarily on stem borer and non-target insects, and showed no obvious abnormality in the microstructure of their digestive tracts. Based on these results, we conclude that cultivation of transgenic cry1Ab/1Ac rice does not adversely affect paddy frogs.

  17. TaCIPK29, a CBL-interacting protein kinase gene from wheat, confers salt stress tolerance in transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Xiaomin Deng

    Full Text Available Calcineurin B-like protein-interacting protein kinases (CIPKs have been found to be responsive to abiotic stress. However, their precise functions and the related molecular mechanisms in abiotic stress tolerance are not completely understood, especially in wheat. In the present study, TaCIPK29 was identified as a new member of CIPK gene family in wheat. TaCIPK29 transcript increased after NaCl, cold, methyl viologen (MV, abscisic acid (ABA and ethylene treatments. Over-expression of TaCIPK29 in tobacco resulted in increased salt tolerance, which was demonstrated by higher germination rates, longer root lengths and better growth status of transgenic tobacco plants compared to controls when both were treated with salt stress. Physiological measurements indicated that transgenic tobacco seedlings retained high K(+/Na(+ ratios and Ca(2+ content by up-regulating some transporter genes expression and also possessed lower H2O2 levels and reduced membrane injury by increasing the expression and activities of catalase (CAT and peroxidase (POD under salt stress. Moreover, transgenic lines conferred tolerance to oxidative stress by increasing the activity and expression of CAT. Finally, TaCIPK29 was located throughout cells and it preferentially interacted with TaCBL2, TaCBL3, NtCBL2, NtCBL3 and NtCAT1. Taken together, our results showed that TaCIPK29 functions as a positive factor under salt stress and is involved in regulating cations and reactive oxygen species (ROS homeostasis.

  18. Amyloid-like protein inclusions in tobacco transgenic plants.

    Directory of Open Access Journals (Sweden)

    Anna Villar-Piqué

    Full Text Available The formation of insoluble protein deposits in human tissues is linked to the onset of more than 40 different disorders, ranging from dementia to diabetes. In these diseases, the proteins usually self-assemble into ordered β-sheet enriched aggregates known as amyloid fibrils. Here we study the structure of the inclusions formed by maize transglutaminase (TGZ in the chloroplasts of tobacco transplastomic plants and demonstrate that they have an amyloid-like nature. Together with the evidence of amyloid structures in bacteria and fungi our data argue that amyloid formation is likely a ubiquitous process occurring across the different kingdoms of life. The discovery of amyloid conformations inside inclusions of genetically modified plants might have implications regarding their use for human applications.

  19. Cry1Ab protein from Bt transgenic rice does not residue in rhizosphere soil

    International Nuclear Information System (INIS)

    Wang Haiyan; Ye Qingfu; Wang Wei; Wu Licheng; Wu Weixiang

    2006-01-01

    Expression of Cry1Ab protein in Bt transgenic rice (KMD) and its residue in the rhizosphere soil during the whole growth in field, as well as degradation of the protein from KMD straw in five soils under laboratory incubation were studied. The residue of Cry1Ab protein in KMD rhizosphere soil was undetectable (below the limit of 0.5 ng/g air-dried soil). The Cry1Ab protein contents in the shoot and root of KMD were 3.23-8.22 and 0.68-0.89 μg/g (fresh weight), respectively. The half-lives of the Cry1Ab protein in the soils amended with KMD straw (4%, w/w) ranged from 11.5 to 34.3 d. The residence time of the protein varied significantly in a Fluvio-marine yellow loamy soil amended with KMD straw at the rate of 3, 4 and 7%, with half-lives of 9.9, 13.8 and 18 d, respectively. In addition, an extraction method for Cry1Ab protein in soil was developed, with extraction efficiencies of 46.4-82.3%. - Cry1Ab protein was not detected in the rhizosphere soil of field-grown Bt transgenic rice

  20. Investigating the application of a nitroreductase-expressing transgenic zebrafish line for high-throughput toxicity testing

    Directory of Open Access Journals (Sweden)

    Anna C. Chlebowski

    Full Text Available Nitroreductase enzymes are responsible for the reduction of nitro functional groups to amino functional groups, and are found in a range of animal models, zebrafish (Danio rerio excluded. Transgenic zebrafish models have been developed for tissue-specific cell ablation, which use nitroreductase to ablate specific tissues or cell types following exposure to the non-toxic pro-drug metronidazole (MTZ. When metabolized by nitroreductase, MTZ produces a potent cytotoxin, which specifically ablates the tissue in which metabolism occurs. Uses, beyond tissue-specific cell ablation, are possible for the hepatocyte-specific Tg(l-fabp:CFP-NTRs891 zebrafish line, including investigations of the role of nitroreductase in the toxicity of nitrated compounds. The hepatic ablation characteristics of this transgenic line were explored, in order to expand its potential uses. Embryos were exposed at 48, 72, or 96 h post fertilization (hpf to a range of MTZ concentrations, and the ablation profiles were compared. Ablation occurred at a 10-fold lower concentration than previously reported. Embryos were exposed to a selection of other compounds, with and without MTZ, in order to investigate alternative uses for this transgenic line. Test compounds were selected based on: their ability to undergo nitroreduction, known importance of hepatic metabolism to toxicity, and known pharmaceutical hepatotoxins. Selected compounds included nitrated polycyclic aromatic hydrocarbons (nitro-PAHs, the PAHs retene and benzo[a]pyrene, and the pharmaceuticals acetaminophen and flutamide. The results suggest a range of potential roles of the liver in the toxicity of these compounds, and highlight the additional uses of this transgenic model in toxicity testing. Keywords: Zebrafish, Transgenic, Nitroreductase, Nitrated polycyclic aromatic hydrocarbon, Tissue ablation, Pharmaceuticals

  1. Overexpression of a cytosolic abiotic stress responsive universal stress protein (SbUSP mitigates salt and osmotic stress in transgenic tobacco plants

    Directory of Open Access Journals (Sweden)

    Pushpika eUdawat

    2016-04-01

    Full Text Available The Universal Stress Protein (USP is a ubiquitous protein and plays an indispensable role in plant abiotic stress tolerance. The genome of Salicornia brachiata contains two homologues of intron less SbUSP gene which encodes for salt and osmotic responsive universal stress protein. In vivo localization reveals that SbUSP is a membrane bound cytosolic protein. The role of the gene was functionally validated by developing transgenic tobacco and compared with control (wild type and vector control plants under different abiotic stress condition. Transgenic lines (T1 exhibited higher chlorophyll, relative water, proline, total sugar, reducing sugar, free amino acids, polyphenol contents, osmotic potential, membrane stability and lower electrolyte leakage and lipid peroxidation (malondialdehyde content under stress treatments than control (WT and VC plants. Lower accumulation of H2O2 and O2- radicals was also detected in transgenic lines compared to control plants under stress conditions. Present study confers that overexpression of the SbUSP gene enhances plant growth, alleviates ROS buildup, maintains ion homeostasis and improves the physiological status of the plant under salt and osmotic stresses. Principal component analysis (PCA exhibited a statistical distinction of plant response to salinity stress, and a significant response was observed for transgenic lines under stress, which provides stress endurance to the plant. A possible signaling role is proposed that some downstream genes may get activated by abiotic stress responsive cytosolic SbUSP, which leads to the protection of cell from oxidative damages. The study unveils that ectopic expression of the gene mitigates salt or osmotic stress by scavenging ROS and modulating the physiological process of the plant.

  2. A LEA protein for improving abiotic stress tolerance and vaccine production in transgenic plants

    OpenAIRE

    Ling, Huai-Yian

    2017-01-01

    The use of transgenic plants to produce novel products has great biotechnological potential as relatively inexpensive inputs (e.g. light, water, and nutrients) are required in return for potentially valuable outputs (e.g. bioactive metabolites, diagnostic proteins and vaccines). Extensive research is ongoing in this area internationally with the aim of producing plant-made vaccines (PMV) of importance for both animals and humans. Avian influenza (AI) infection is endemic among birds, and al...

  3. Increased liver pathology in hepatitis C virus transgenic mice expressing the hepatitis B virus X protein

    International Nuclear Information System (INIS)

    Keasler, Victor V.; Lerat, Herve; Madden, Charles R.; Finegold, Milton J.; McGarvey, Michael J.; Mohammed, Essam M.A.; Forbes, Stuart J.; Lemon, Stanley M.; Hadsell, Darryl L.; Grona, Shala J.; Hollinger, F. Blaine; Slagle, Betty L.

    2006-01-01

    Transgenic mice expressing the full-length HCV coding sequence were crossed with mice that express the HBV X gene-encoded regulatory protein HBx (ATX mice) to test the hypothesis that HBx expression accelerates HCV-induced liver pathogenesis. At 16 months (mo) of age, hepatocellular carcinoma was identified in 21% of HCV/ATX mice, but in none of the single transgenic animals. Analysis of 8-mo animals revealed that, relative to HCV/WT mice, HCV/ATX mice had more severe steatosis, greater liver-to-body weight ratios, and a significant increase in the percentage of hepatocytes staining for proliferating cell nuclear antigen. Furthermore, primary hepatocytes from HCV, ATX, and HCV/ATX transgenic mice were more resistant to fas-mediated apoptosis than hepatocytes from nontransgenic littermates. These results indicate that HBx expression contributes to increased liver pathogenesis in HCV transgenic mice by a mechanism that involves an imbalance in hepatocyte death and regeneration within the context of severe steatosis

  4. Enhanced disease resistance and drought tolerance in transgenic rice plants overexpressing protein elicitors from Magnaporthe oryzae.

    Science.gov (United States)

    Wang, Zhenzhen; Han, Qiang; Zi, Qian; Lv, Shun; Qiu, Dewen; Zeng, Hongmei

    2017-01-01

    Exogenous application of the protein elicitors MoHrip1 and MoHrip2, which were isolated from the pathogenic fungus Magnaporthe oryzae (M. oryzae), was previously shown to induce a hypersensitive response in tobacco and to enhance resistance to rice blast. In this work, we successfully transformed rice with the mohrip1 and mohrip2 genes separately. The MoHrip1 and MoHrip2 transgenic rice plants displayed higher resistance to rice blast and stronger tolerance to drought stress than wild-type (WT) rice and the vector-control pCXUN rice. The expression of salicylic acid (SA)- and abscisic acid (ABA)-related genes was also increased, suggesting that these two elicitors may trigger SA signaling to protect the rice from damage during pathogen infection and regulate the ABA content to increase drought tolerance in transgenic rice. Trypan blue staining indicated that expressing MoHrip1 and MoHrip2 in rice plants inhibited hyphal growth of the rice blast fungus. Relative water content (RWC), water usage efficiency (WUE) and water loss rate (WLR) were measured to confirm the high capacity for water retention in transgenic rice. The MoHrip1 and MoHrip2 transgenic rice also exhibited enhanced agronomic traits such as increased plant height and tiller number.

  5. Alterations in gene expression in mutant amyloid precursor protein transgenic mice lacking Niemann-Pick type C1 protein.

    Directory of Open Access Journals (Sweden)

    Mahua Maulik

    Full Text Available Niemann-Pick type C (NPC disease, a rare autosomal recessive disorder caused mostly by mutation in NPC1 gene, is pathologically characterized by the accumulation of free cholesterol in brain and other tissues. This is accompanied by gliosis and loss of neurons in selected brain regions, including the cerebellum. Recent studies have shown that NPC disease exhibits intriguing parallels with Alzheimer's disease, including the presence of neurofibrillary tangles and increased levels of amyloid precursor protein (APP-derived β-amyloid (Aβ peptides in vulnerable brain neurons. To evaluate the role of Aβ in NPC disease, we determined the gene expression profile in selected brain regions of our recently developed bigenic ANPC mice, generated by crossing APP transgenic (Tg mice with heterozygous Npc1-deficient mice. The ANPC mice exhibited exacerbated neuronal and glial pathology compared to other genotypes [i.e., APP-Tg, double heterozygous (Dhet, Npc1-null and wild-type mice]. Analysis of expression profiles of 86 selected genes using real-time RT-PCR arrays showed a wide-spectrum of alterations in the four genotypes compared to wild-type controls. The changes observed in APP-Tg and Dhet mice are limited to only few genes involved mostly in the regulation of cholesterol metabolism, whereas Npc1-null and ANPC mice showed alterations in the expression profiles of a number of genes regulating cholesterol homeostasis, APP metabolism, vesicular trafficking and cell death mechanism in both hippocampus and cerebellum compared to wild-type mice. Intriguingly, ANPC and Npc1-null mice, with some exceptions, exhibited similar changes, although more genes were differentially expressed in the affected cerebellum than the relatively spared hippocampus. The altered gene profiles were found to match with the corresponding protein levels. These results suggest that lack of Npc1 protein can alter the expression profile of selected transcripts as well as proteins, and

  6. Overexpression of a Cytosolic Abiotic Stress Responsive Universal Stress Protein (SbUSP) Mitigates Salt and Osmotic Stress in Transgenic Tobacco Plants

    Science.gov (United States)

    Udawat, Pushpika; Jha, Rajesh K.; Sinha, Dinkar; Mishra, Avinash; Jha, Bhavanath

    2016-01-01

    The universal stress protein (USP) is a ubiquitous protein and plays an indispensable role in plant abiotic stress tolerance. The genome of Salicornia brachiata contains two homologs of intron less SbUSP gene which encodes for salt and osmotic responsive USP. In vivo localization reveals that SbUSP is a membrane bound cytosolic protein. The role of the gene was functionally validated by developing transgenic tobacco and compared with control [wild-type (WT) and vector control (VC)] plants under different abiotic stress condition. Transgenic lines (T1) exhibited higher chlorophyll, relative water, proline, total sugar, reducing sugar, free amino acids, polyphenol contents, osmotic potential, membrane stability, and lower electrolyte leakage and lipid peroxidation (malondialdehyde content) under stress treatments than control (WT and VC) plants. Lower accumulation of H2O2 and O2− radicals was also detected in transgenic lines compared to control plants under stress conditions. Present study confers that overexpression of the SbUSP gene enhances plant growth, alleviates ROS buildup, maintains ion homeostasis and improves the physiological status of the plant under salt and osmotic stresses. Principal component analysis exhibited a statistical distinction of plant response to salinity stress, and a significant response was observed for transgenic lines under stress, which provides stress endurance to the plant. A possible signaling role is proposed that some downstream genes may get activated by abiotic stress responsive cytosolic SbUSP, which leads to the protection of cell from oxidative damages. The study unveils that ectopic expression of the gene mitigates salt or osmotic stress by scavenging ROS and modulating the physiological process of the plant. PMID:27148338

  7. Cis-acting sequences from a human surfactant protein gene confer pulmonary-specific gene expression in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Korfhagen, T.R.; Glasser, S.W.; Wert, S.E.; Bruno, M.D.; Daugherty, C.C.; McNeish, J.D.; Stock, J.L.; Potter, S.S.; Whitsett, J.A. (Cincinnati College of Medicine, OH (USA))

    1990-08-01

    Pulmonary surfactant is produced in late gestation by developing type II epithelial cells lining the alveolar epithelium of the lung. Lack of surfactant at birth is associated with respiratory distress syndrome in premature infants. Surfactant protein C (SP-C) is a highly hydrophobic peptide isolated from pulmonary tissue that enhances the biophysical activity of surfactant phospholipids. Like surfactant phospholipid, SP-C is produced by epithelial cells in the distal respiratory epithelium, and its expression increases during the latter part of gestation. A chimeric gene containing 3.6 kilobases of the promoter and 5{prime}-flanking sequences of the human SP-C gene was used to express diphtheria toxin A. The SP-C-diphtheria toxin A fusion gene was injected into fertilized mouse eggs to produce transgenic mice. Affected mice developed respiratory failure in the immediate postnatal period. Morphologic analysis of lungs from affected pups showed variable but severe cellular injury confined to pulmonary tissues. Ultrastructural changes consistent with cell death and injury were prominent in the distal respiratory epithelium. Proximal components of the tracheobronchial tree were not severely affected. Transgenic animals were of normal size at birth, and structural abnormalities were not detected in nonpulmonary tissues. Lung-specific diphtheria toxin A expression controlled by the human SP-C gene injured type II epithelial cells and caused extensive necrosis of the distal respiratory epithelium. The absence of type I epithelial cells in the most severely affected transgenic animals supports the concept that developing type II cells serve as precursors to type I epithelial cells.

  8. Effects of Metformin on Tissue Oxidative and Dicarbonyl Stress in Transgenic Spontaneously Hypertensive Rats Expressing Human C-Reactive Protein.

    Directory of Open Access Journals (Sweden)

    Hana Malínská

    Full Text Available Inflammation and oxidative and dicarbonyl stress play important roles in the pathogenesis of type 2 diabetes. Metformin is the first-line drug of choice for the treatment of type 2 diabetes because it effectively suppresses gluconeogenesis in the liver. However, its "pleiotropic" effects remain controversial. In the current study, we tested the effects of metformin on inflammation, oxidative and dicarbonyl stress in an animal model of inflammation and metabolic syndrome, using spontaneously hypertensive rats that transgenically express human C-reactive protein (SHR-CRP. We treated 8-month-old male transgenic SHR-CRP rats with metformin (5 mg/kg/day mixed as part of a standard diet for 4 weeks. A corresponding untreated control group of male transgenic SHR-CRP rats were fed a standard diet without metformin. In a similar fashion, we studied a group of nontransgenic SHR treated with metformin and an untreated group of nontransgenic SHR controls. In each group, we studied 6 animals. Parameters of glucose and lipid metabolism and oxidative and dicarbonyl stress were measured using standard methods. Gene expression profiles were determined using Affymetrix GeneChip Arrays. Statistical significance was evaluated by two-way ANOVA. In the SHR-CRP transgenic strain, we found that metformin treatment decreased circulating levels of inflammatory response marker IL-6, TNFα and MCP-1 while levels of human CRP remained unchanged. Metformin significantly reduced oxidative stress (levels of conjugated dienes and TBARS and dicarbonyl stress (levels of methylglyoxal in left ventricles, but not in kidneys. No significant effects of metformin on oxidative and dicarbonyl stress were observed in SHR controls. In addition, metformin treatment reduced adipose tissue lipolysis associated with human CRP. Possible molecular mechanisms of metformin action-studied by gene expression profiling in the liver-revealed deregulated genes from inflammatory and insulin signaling

  9. Animal Models of Congenital Cardiomyopathies Associated With Mutations in Z-Line Proteins.

    Science.gov (United States)

    Bang, Marie-Louise

    2017-01-01

    The cardiac Z-line at the boundary between sarcomeres is a multiprotein complex connecting the contractile apparatus with the cytoskeleton and the extracellular matrix. The Z-line is important for efficient force generation and transmission as well as the maintenance of structural stability and integrity. Furthermore, it is a nodal point for intracellular signaling, in particular mechanosensing and mechanotransduction. Mutations in various genes encoding Z-line proteins have been associated with different cardiomyopathies, including dilated cardiomyopathy, hypertrophic cardiomyopathy, arrhythmogenic right ventricular cardiomyopathy, restrictive cardiomyopathy, and left ventricular noncompaction, and mutations even within the same gene can cause widely different pathologies. Animal models have contributed to a great advancement in the understanding of the physiological function of Z-line proteins and the pathways leading from mutations in Z-line proteins to cardiomyopathy, although genotype-phenotype prediction remains a great challenge. This review presents an overview of the currently available animal models for Z-line and Z-line associated proteins involved in human cardiomyopathies with special emphasis on knock-in and transgenic mouse models recapitulating the clinical phenotypes of human cardiomyopathy patients carrying mutations in Z-line proteins. Pros and cons of mouse models will be discussed and a future outlook will be given. J. Cell. Physiol. 232: 38-52, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  10. The trafficking pathway of a wheat storage protein in transgenic rice endosperm.

    Science.gov (United States)

    Oszvald, Maria; Tamas, Laszlo; Shewry, Peter R; Tosi, Paola

    2014-04-01

    The trafficking of proteins in the endoplasmic reticulum (ER) of plant cells is a topic of considerable interest since this organelle serves as an entry point for proteins destined for other organelles, as well as for the ER itself. In the current work, transgenic rice was used to study the pattern and pathway of deposition of the wheat high molecular weight (HMW) glutenin sub-unit (GS) 1Dx5 within the rice endosperm using specific antibodies to determine whether it is deposited in the same or different protein bodies from the rice storage proteins, and whether it is located in the same or separate phases within these. The protein distribution and the expression pattern of HMW sub-unit 1Dx5 in transgenic rice endosperm at different stages of development were determined using light and electron microscopy after labelling with antibodies. The use of HMW-GS-specific antibodies showed that sub-unit 1Dx5 was expressed mainly in the sub-aleurone cells of the endosperm and that it was deposited in both types of protein body present in the rice endosperm: derived from the ER and containing prolamins, and derived from the vacuole and containing glutelins. In addition, new types of protein bodies were also formed within the endosperm cells. The results suggest that the HMW 1Dx5 protein could be trafficked by either the ER or vacuolar pathway, possibly depending on the stage of development, and that its accumulation in the rice endosperm could compromise the structural integrity of protein bodies and their segregation into two distinct populations in the mature endosperm.

  11. Adsorptive loss of secreted recombinant proteins in transgenic rice cell suspension cultures.

    Science.gov (United States)

    Kwon, Jun-Young; Lee, Kyoung-Hoon; Cheon, Su-Hwan; Ryu, Hyun-Nam; Kim, Sun Jin; Kim, Dong-Il

    2012-03-01

    Adsorptive loss of human cytotoxic T-lymphocyte antigen 4-immunoglobulin (hCTLA4Ig) in transgenic rice cell suspension cultures was investigated using glass flasks, plastic flasks, disposable vessels, and stainless steel vessels. When hCTLA4Ig was added to the glass flasks containing sterile AA medium, a rapid decrease in the concentration of hCTLA4Ig, independent on pH, was observed resulting in more than 90% of the protein loss within 1 h due to the surface adsorption. When the same experiments were performed on four different types of culture equipments mentioned above, the lowest adsorption level was observed in the plastic flasks and the highest level was observed in the glass flasks. The use of the plastic flasks retarded the adsorptive loss of hCTLA4Ig at the early stage of the protein production. There was a significant increase in the production of hCTLA4Ig when the flasks were coated with bovine serum albumin. However, the spike test of purified hCTLA4Ig at two different concentrations of 15 and 100 mg L(-1) in 500-mL spinner flasks confirmed that the amount of hCTLA4Ig adsorbed was dependent on the surface area of the flasks but not on the concentrations. In conclusion, although the protein adsorption affected the total amount of the protein yielded to some extent, it could be regarded as a minor factor in transgenic plant cell cultures with higher titer.

  12. Generation of an ABCG2GFPn-puro transgenic line - A tool to study ABCG2 expression in mice

    International Nuclear Information System (INIS)

    Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen; Malas, Stavros

    2009-01-01

    The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.

  13. Generation of an ABCG2{sup GFPn-puro} transgenic line - A tool to study ABCG2 expression in mice

    Energy Technology Data Exchange (ETDEWEB)

    Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Malas, Stavros, E-mail: smalas@cing.ac.cy [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Department of Biological Sciences, University of Cyprus, P.O. Box 20537, 1678 Nicosia (Cyprus)

    2009-06-26

    The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.

  14. Capillary electrophoretic profiling of tryptic digests of water soluble proteins from Bacillus thuringiensis-transgenic and non-transgenic maize species

    Czech Academy of Sciences Publication Activity Database

    Sázelová, Petra; Kašička, Václav; Leon, C.; Ibanez, E.; Cifuentes, A.

    2012-01-01

    Roč. 134, č. 3 (2012), s. 1607-1615 ISSN 0308-8146 R&D Projects: GA ČR(CZ) GA203/08/1428 Grant - others:AV ČR(CZ) 2008CZ0019 Institutional research plan: CEZ:AV0Z40550506 Keywords : Bt-transgenic maize * capillary zone electrophoresis * maize proteins Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 3.334, year: 2012

  15. Immunohistochemical analysis of Clara cell secretory protein expression in a transgenic model of mouse lung carcinogenesis

    International Nuclear Information System (INIS)

    Hicks, Sarah M.; Vassallo, Jeffrey D.; Dieter, Matthew Z.; Lewis, Cindy L.; Whiteley, Laurence O.; Fix, Andrew S.; Lehman-McKeeman, Lois D.

    2003-01-01

    Immunohistochemical methods have been widely used to determine the histogenesis of spontaneous and chemically-induced mouse lung tumors. Typically, antigens for either alveolar Type II cells or bronchiolar epithelial Clara cells are studied. In the present work, the morphological and immunohistochemical phenotype of a transgenic mouse designed to develop lung tumors arising from Clara cells was evaluated. In this model, Clara cell-specific transformation is accomplished by directed expression of the SV40 large T antigen (TAg) under the mouse Clara cell secretory protein (CC10) promoter. In heterozygous mice, early lesions at 1 month of age consisted of hyperplastic bronchiolar epithelial cells. These progressed to adenoma by 2 months as proliferating epithelium extended into adjacent alveolar spaces. By 4 months, a large portion of the lung parenchyma was composed of tumor masses. Expression of constitutive CC10 was diminished in transgenic animals at all time points. Only the occasional cell or segment of the bronchiolar epithelium stained positively for CC10 by immunohistochemistry, and all tumors were found to be uniformly negative for staining. These results were corroborated by Western blotting, where CC10 was readily detectable in whole lung homogenate from nontransgenic animals, but not detected in lung from transgenic animals at any time point. Tumors were also examined for expression of surfactant apoprotein C (SPC), an alveolar Type II cell-specific marker, and found to be uniformly negative for staining. These results indicate that, in this transgenic model, expression of CC10, which is widely used to determine whether lung tumors arise from Clara cells, was reduced and subsequently lost during Clara cell tumor progression

  16. Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them

    Science.gov (United States)

    Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika

    2007-03-13

    The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).

  17. Characterisation of the p53 pathway in cell lines established from TH-MYCN transgenic mouse tumours.

    Science.gov (United States)

    Chen, Lindi; Esfandiari, Arman; Reaves, William; Vu, Annette; Hogarty, Michael D; Lunec, John; Tweddle, Deborah A

    2018-03-01

    Cell lines established from the TH-MYCN transgenic murine model of neuroblastoma are a valuable preclinical, immunocompetent, syngeneic model of neuroblastoma, for which knowledge of their p53 pathway status is important. In this study, the Trp53 status and functional response to Nutlin-3 and ionising radiation (IR) were determined in 6 adherent TH-MYCN transgenic cell lines using Sanger sequencing, western blot analysis and flow cytometry. Sensitivity to structurally diverse MDM2 inhibitors (Nutlin-3, MI-63, RG7388 and NDD0005) was determined using XTT proliferation assays. In total, 2/6 cell lines were Trp53 homozygous mutant (NHO2A and 844MYCN+/+) and 1/6 (282MYCN+/-) was Trp53 heterozygous mutant. For 1/6 cell lines (NHO2A), DNA from the corresponding primary tumour was found to be Trp53 wt. In all cases, the presence of a mutation was consistent with aberrant p53 signalling in response to Nutlin-3 and IR. In comparison to TP53 wt human neuroblastoma cells, Trp53 wt murine control and TH-MYCN cell lines were significantly less sensitive to growth inhibition mediated by MI-63 and RG7388. These murine Trp53 wt and mutant TH-MYCN cell lines are useful syngeneic, immunocompetent neuroblastoma models, the former to test p53-dependent therapies in combination with immunotherapies, such as anti-GD2, and the latter as models of chemoresistant relapsed neuroblastoma when aberrations in the p53 pathway are more common. The spontaneous development of Trp53 mutations in 3 cell lines from TH-MYCN mice may have arisen from MYCN oncogenic driven and/or ex vivo selection. The identified species-dependent selectivity of MI-63 and RG7388 should be considered when interpreting in vivo toxicity studies of MDM2 inhibitors.

  18. T-DNA integration patterns in transgenic maize lines mediated by ...

    African Journals Online (AJOL)

    Jane

    2011-10-03

    Oct 3, 2011 ... locus can have profound effects on the level and stability of transgene ..... Thane N, Henke J, Wang T, Ruppert J, Shah N, Rotter K, Hodges J, ... Chia JM, Deragon JM, Estill JC, Fu Y, Jeddeloh JA, Han YJ, Lee H,. Li PH, Lisch ...

  19. CCL2-ethanol interactions and hippocampal synaptic protein expression in a transgenic mouse model

    Directory of Open Access Journals (Sweden)

    Donna eGruol

    2014-04-01

    Full Text Available Chronic exposure to ethanol produces a number of detrimental effects on behavior. Neuroadaptive changes in brain structure or function underlie these behavioral changes and may be transient or persistent in nature. Central to the functional changes are alterations in the biology of neuronal and glial cells of the brain. Recent data show that ethanol induces glial cells of the brain to produce elevated levels of neuroimmune factors including CCL2, a key innate immune chemokine. Depending on the conditions of ethanol exposure, the upregulated levels of CCL2 can be transient or persistent and outlast the period of ethanol exposure. Importantly, results indicate that the upregulated levels of CCL2 may lead to CCL2-ethanol interactions that mediate or regulate the effects of ethanol on the brain. Glial cells are in close association with neurons and regulate many neuronal functions. Therefore, effects of ethanol on glial cells may underlie some of the effects of ethanol on neurons. To investigate this possibility, we are studying the effects of chronic ethanol on hippocampal synaptic function in a transgenic mouse model that expresses elevated levels of CCL2 in the brain through enhanced glial expression, a situation know to occur in alcoholics. Both CCL2 and ethanol have been reported to alter synaptic function in the hippocampus. In the current study, we determined if interactions are evident between CCL2 and ethanol at level of hippocampal synaptic proteins. Two ethanol exposure paradigms were used; the first involved ethanol exposure by drinking and the second involved ethanol exposure in a paradigm that combines drinking plus ethanol vapor. The first paradigm does not produce dependence on ethanol, whereas the second paradigm is commonly used to produce ethanol dependence. Results show modest effects of both ethanol exposure paradigms on the level of synaptic proteins in the hippocampus of CCL2 transgenic mice compared with their non-transgenic

  20. N. plumbaginifolia zeaxanthin epoxidase transgenic lines have unaltered baseline ABA accumulations in roots and xylem sap, but contrasting sensitivities of ABA accumulation to water deficit.

    Science.gov (United States)

    Borel, C; Audran, C; Frey, A; Marion-Poll, A; Tardieu, F; Simonneau, T

    2001-03-01

    A series of transgenic lines of Nicotiana plumbaginifolia with modified expression of zeaxanthin epoxidase gene (ZEP) provided contrasting ABA accumulation in roots and xylem sap. For mild water stress, concentration of ABA in the xylem sap ([ABA](xylem)) was clearly lower in plants underexpressing ZEP mRNA (complemented mutants and antisense transgenic lines) than in wild-type. In well-watered conditions, all lines presented similar [ABA](xylem) and similar ABA accumulation rates in detached roots. Plants could, therefore, be grown under normal light intensities and evaporative demand. Both ZEP mRNA abundance and ABA accumulation rate in roots increased with water deficit in all transgenic lines, except in complemented aba2-s1 mutants in which the ZEP gene was controlled by a constitutive promoter which does not respond to water deficit. These lines presented no change in root ABA content either with time or dehydration. The increase in ZEP mRNA abundance in roots with decreasing RWC was more pronounced in detached roots than in whole plants, suggesting a difference in mechanism. In all transgenic lines, a linear relationship was observed between predawn leaf water potential and [ABA](xylem), which could be reproduced in several experiments in the greenhouse and in the growth chamber. It is therefore possible to represent the effect of the transformation by a single parameter, thereby allowing the use of a quantitative approach to assist understanding of the behaviour of transgenic lines.

  1. Resistance to chronic wasting disease in transgenic mice expressing a naturally occurring allelic variant of deer prion protein

    NARCIS (Netherlands)

    Meade-White, K.; Race, B.; Trifilo, M.; Bossers, A.; Favara, C.; Lacasse, R.; Miller, M.; Williams, E.; Oldstone, M.; Race, R.; Chesebro, B.

    2007-01-01

    Prion protein (PrP) is a required factor for susceptibility to transmissible spongiform encephalopathy or prion diseases. In transgenic mice, expression of prion protein (PrP) from another species often confers susceptibility to prion disease from that donor species. For example, expression of deer

  2. [Abnormal floral meristem development in transgenic tomato plants do not depend on the expression of genes encoding defense-related PR-proteins and antimicrobial peptides].

    Science.gov (United States)

    Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu

    2014-01-01

    In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial

  3. Expression of plant sweet protein brazzein in the milk of transgenic mice.

    Directory of Open Access Journals (Sweden)

    Sen Yan

    Full Text Available Sugar, the most popular sweetener, is essential in daily food. However, excessive sugar intake has been associated with several lifestyle-related diseases. Finding healthier and more economical alternatives to sugars and artificial sweeteners has received increasing attention to fulfill the growing demand. Brazzein, which comes from the pulp of the edible fruit of the African plant Pentadiplandra brazzeana Baill, is a protein that is 2,000 times sweeter than sucrose by weight. Here we report the production of transgenic mice that carry the optimized brazzein gene driven by the goat Beta-casein promoter, which specifically directs gene expression in the mammary glands. Using western blot analysis and immunohistochemistry, we confirmed that brazzein could be efficiently expressed in mammalian milk, while retaining its sweetness. This study presents the possibility of producing plant protein-sweetened milk from large animals such as cattle and goats.

  4. Transgene inheritances and genetic similarities of near isogenic lines of genetically modified common beans Herança de transgenes e similaridade genética de linhagens quase isogênicas de feijoeiro-comum geneticamente modificado

    Directory of Open Access Journals (Sweden)

    Patrícia Valle Pinheiro

    2009-09-01

    Full Text Available The objective of the present work was to determine the inheritance and stability of transgenes of a transgenic bean line expressing the genes rep-trap-ren from Bean golden mosaic virus and the bar gene. Crosses were done between the transgenic line and four commercial bean cultivars, followed by four backcrosses to the commercial cultivars. Progenies from each cross were evaluated for the presence of the transgenes by brushing the leaves with glufosinate ammonium and by polymerase chain reaction using specific oligonucleotides. Advanced generations were rub-inoculated with an isolate of Bean common mosaic necrosis virus (BCMNV. The transgenes were inherited consistently in a Mendelian pattern in the four crosses studied. The analyzed lines recovered close to 80% of the characteristics of the recurrent parent, as determined by the random amplified DNA markers used, besides maintaining important traits such as resistance to BCMNV. The presence of the transgene did not cause any detectable undesirable effect in the evaluated progenies.O objetivo do presente trabalho foi determinar a herança e a estabilidade de transgenes de uma linhagem de feijoeiro-comum com expressão dos genes rep-trap-ren, do Bean golden mosaic virus, e do gene bar. Foram realizados cruzamentos entre a linhagem transgênica e quatro cultivares comerciais de feijão, seguidos de quatro retrocruzamentos. As progênies de cada cruzamento foram avaliadas quanto à presença dos transgenes, com aplicação do glifosinato de amônia nas folhas e por meio da reação da polimerase em cadeia com uso de oligonucleotídeos específicos. O vírus do mosaico comum necrótico do feijoeiro, Bean common mosaic necrosis virus (BCMNV, foi inoculado mecanicamente nas gerações avançadas. Os transgenes foram herdados em padrão mendeliano nos quatro cruzamentos estudados. As linhagens analisadas apresentaram cerca de 80% das características do parental recorrente, conforme determinado por an

  5. Adsorption, desorption and biodegradation in soil of CrylAb toxin protein from Bt transgenic rice

    International Nuclear Information System (INIS)

    Wang Haiyan; Ye Qingfu

    2004-01-01

    The equilibrium adsorption and binding of CrylAb toxin from Bt transgenic rice, to 7 different soils and the biodegradation of the bound toxin were studied. The adsorption rate of Bt in soils improved with decreasing of the added Bt purified protein concentration. Adsorption rate (125 and 780 nm/ml) in powdery-muddy paddy soil, Fluvio-marine yellow loamy and Coastal saline soil were 24.85% and 40.81%, 9.1% and 31.67%, 12.47% and 30.75%, respectively. Desorption rate in the soils dropped with content of soil-absorbed protein decreased. Its adsorption ratio in powdery-muddy paddy soil was 12.95% and 5.88%, respectively. The relationship between adsorption amount and concentration of Bt purified protein in different soils was notably positive correlation (P 0 e -λt ); Half life of Bt protein in soils was among 15.2-97.6 d; Degradation of pruified Bt protein was rapid at the initial incubation time (30 d), but slow at 150d incubation; The degradation of purified Bt protein in Intertidal sandy soil was the slowest with half-life of 97.6d. The protein in the soil amended with 1.25 μg/g could be still detectable after incubation of 345d; the degradation of purified Bt protein in Coastal saline soil and Aquic light saline sandy soil were faster. Their half-lives were 19.6 d and 15.2 d, respecitvely. The residue time of Bt purified protein in the soils was all more than 150 d. (authors)

  6. Comparison of the rhizosphere bacterial communities of Zigongdongdou soybean and a high-methionine transgenic line of this cultivar.

    Directory of Open Access Journals (Sweden)

    Jingang Liang

    Full Text Available Previous studies have shown that methionine from root exudates affects the rhizosphere bacterial population involved in soil nitrogen fixation. A transgenic line of Zigongdongdou soybean cultivar (ZD91 that expresses Arabidopsis cystathionine γ-synthase resulting in an increased methionine production was examined for its influence to the rhizosphere bacterial population. Using 16S rRNA gene-based pyrosequencing analysis of the V4 region and DNA extracted from bacterial consortia collected from the rhizosphere of soybean plants grown in an agricultural field at the pod-setting stage, we characterized the populational structure of the bacterial community involved. In total, 87,267 sequences (approximately 10,908 per sample were analyzed. We found that Acidobacteria, Proteobacteria, Bacteroidetes, Actinobacteria, Chloroflexi, Planctomycetes, Gemmatimonadetes, Firmicutes, and Verrucomicrobia constitute the dominant taxonomic groups in either the ZD91 transgenic line or parental cultivar ZD, and that there was no statistically significant difference in the rhizosphere bacterial community structure between the two cultivars.

  7. Chronic wasting disease prions are not transmissible to transgenic mice overexpressing human prion protein.

    Science.gov (United States)

    Sandberg, Malin K; Al-Doujaily, Huda; Sigurdson, Christina J; Glatzel, Markus; O'Malley, Catherine; Powell, Caroline; Asante, Emmanuel A; Linehan, Jacqueline M; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John

    2010-10-01

    Chronic wasting disease (CWD) is a prion disease that affects free-ranging and captive cervids, including mule deer, white-tailed deer, Rocky Mountain elk and moose. CWD-infected cervids have been reported in 14 USA states, two Canadian provinces and in South Korea. The possibility of a zoonotic transmission of CWD prions via diet is of particular concern in North America where hunting of cervids is a popular sport. To investigate the potential public health risks posed by CWD prions, we have investigated whether intracerebral inoculation of brain and spinal cord from CWD-infected mule deer transmits prion infection to transgenic mice overexpressing human prion protein with methionine or valine at polymorphic residue 129. These transgenic mice have been utilized in extensive transmission studies of human and animal prion disease and are susceptible to BSE and vCJD prions, allowing comparison with CWD. Here, we show that these mice proved entirely resistant to infection with mule deer CWD prions arguing that the transmission barrier associated with this prion strain/host combination is greater than that observed with classical BSE prions. However, it is possible that CWD may be caused by multiple prion strains. Further studies will be required to evaluate the transmission properties of distinct cervid prion strains as they are characterized.

  8. Systemic and oral immunogenicity of hemagglutinin protein of rinderpest virus expressed by transgenic peanut plants in a mouse model

    International Nuclear Information System (INIS)

    Khandelwal, Abha; Renukaradhya, G.J.; Rajasekhar, M.; Sita, G. Lakshmi; Shaila, M.S.

    2004-01-01

    Rinderpest causes a devastating disease, often fatal, in wild and domestic ruminants. It has been eradicated successfully using a live, attenuated vaccine from most part of the world leaving a few foci of disease in parts of Africa, the Middle East, and South Asia. We have developed transgenic peanut (Arachis hypogaea L.) plants expressing hemagglutinin (H) protein of rinderpest virus (RPV), which is antigenically authentic. In this work, we have evaluated the immunogenicity of peanut-expressed H protein using mouse model, administered parenterally as well as orally. Intraperitoneal immunization of mice with the transgenic peanut extract elicited antibody response specific to H. These antibodies neutralized virus infectivity in vitro. Oral immunization of mice with transgenic peanut induced H-specific serum IgG and IgA antibodies. The systemic and oral immunogenicity of plant-derived H in absence of any adjuvant indicates the potential of edible vaccine for rinderpest

  9. Establishment of a transgenic zebrafish line for superficial skin ablation and functional validation of apoptosis modulators in vivo.

    Directory of Open Access Journals (Sweden)

    Chi-Fang Chen

    Full Text Available BACKGROUND: Zebrafish skin is composed of enveloping and basal layers which form a first-line defense system against pathogens. Zebrafish epidermis contains ionocytes and mucous cells that aid secretion of acid/ions or mucous through skin. Previous studies demonstrated that fish skin is extremely sensitive to external stimuli. However, little is known about the molecular mechanisms that modulate skin cell apoptosis in zebrafish. METHODOLOGY/PRINCIPAL FINDINGS: This study aimed to create a platform to conduct conditional skin ablation and determine if it is possible to attenuate apoptotic stimuli by overexpressing potential apoptosis modulating genes in the skin of live animals. A transgenic zebrafish line of Tg(krt4:NTR-hKikGR(cy17 (killer line, which can conditionally trigger apoptosis in superficial skin cells, was first established. When the killer line was incubated with the prodrug metrodinazole, the superficial skin displayed extensive apoptosis as judged by detection of massive TUNEL- and active caspase 3-positive signals. Great reductions in NTR-hKikGR(+ fluorescent signals accompanied epidermal cell apoptosis. This indicated that NTR-hKikGR(+ signal fluorescence can be utilized to evaluate apoptotic events in vivo. After removal of metrodinazole, the skin integrity progressively recovered and NTR-hKikGR(+ fluorescent signals gradually restored. In contrast, either crossing the killer line with testing lines or transiently injecting the killer line with testing vectors that expressed human constitutive active Akt1, mouse constitutive active Stat3, or HPV16 E6 element displayed apoptosis-resistant phenotypes to cytotoxic metrodinazole as judged by the loss of reduction in NTR-hKikGR(+ fluorescent signaling. CONCLUSION/SIGNIFICANCE: The killer/testing line binary system established in the current study demonstrates a nitroreductase/metrodinazole system that can be utilized to conditionally perform skin ablation in a real-time manner, and

  10. System in biology leading to cell pathology: stable protein-protein interactions after covalent modifications by small molecules or in transgenic cells.

    Science.gov (United States)

    Malina, Halina Z

    2011-01-19

    The physiological processes in the cell are regulated by reversible, electrostatic protein-protein interactions. Apoptosis is such a regulated process, which is critically important in tissue homeostasis and development and leads to complete disintegration of the cell. Pathological apoptosis, a process similar to apoptosis, is associated with aging and infection. The current study shows that pathological apoptosis is a process caused by the covalent interactions between the signaling proteins, and a characteristic of this pathological network is the covalent binding of calmodulin to regulatory sequences. Small molecules able to bind covalently to the amino group of lysine, histidine, arginine, or glutamine modify the regulatory sequences of the proteins. The present study analyzed the interaction of calmodulin with the BH3 sequence of Bax, and the calmodulin-binding sequence of myristoylated alanine-rich C-kinase substrate in the presence of xanthurenic acid in primary retinal epithelium cell cultures and murine epithelial fibroblast cell lines transformed with SV40 (wild type [WT], Bid knockout [Bid-/-], and Bax-/-/Bak-/- double knockout [DKO]). Cell death was observed to be associated with the covalent binding of calmodulin, in parallel, to the regulatory sequences of proteins. Xanthurenic acid is known to activate caspase-3 in primary cell cultures, and the results showed that this activation is also observed in WT and Bid-/- cells, but not in DKO cells. However, DKO cells were not protected against death, but high rates of cell death occurred by detachment. The results showed that small molecules modify the basic amino acids in the regulatory sequences of proteins leading to covalent interactions between the modified sequences (e.g., calmodulin to calmodulin-binding sites). The formation of these polymers (aggregates) leads to an unregulated and, consequently, pathological protein network. The results suggest a mechanism for the involvement of small molecules

  11. Atypical scrapie prions from sheep and lack of disease in transgenic mice overexpressing human prion protein.

    Science.gov (United States)

    Wadsworth, Jonathan D F; Joiner, Susan; Linehan, Jacqueline M; Balkema-Buschmann, Anne; Spiropoulos, John; Simmons, Marion M; Griffiths, Peter C; Groschup, Martin H; Hope, James; Brandner, Sebastian; Asante, Emmanuel A; Collinge, John

    2013-11-01

    Public and animal health controls to limit human exposure to animal prions are focused on bovine spongiform encephalopathy (BSE), but other prion strains in ruminants may also have zoonotic potential. One example is atypical/Nor98 scrapie, which evaded statutory diagnostic methods worldwide until the early 2000s. To investigate whether sheep infected with scrapie prions could be another source of infection, we inoculated transgenic mice that overexpressed human prion protein with brain tissue from sheep with natural field cases of classical and atypical scrapie, sheep with experimental BSE, and cattle with BSE. We found that these mice were susceptible to BSE prions, but disease did not develop after prolonged postinoculation periods when mice were inoculated with classical or atypical scrapie prions. These data are consistent with the conclusion that prion disease is less likely to develop in humans after exposure to naturally occurring prions of sheep than after exposure to epizootic BSE prions of ruminants.

  12. Increased infectivity of anchorless mouse scrapie prions in transgenic mice overexpressing human prion protein.

    Science.gov (United States)

    Race, Brent; Phillips, Katie; Meade-White, Kimberly; Striebel, James; Chesebro, Bruce

    2015-06-01

    Prion protein (PrP) is found in all mammals, mostly as a glycoprotein anchored to the plasma membrane by a C-terminal glycosylphosphatidylinositol (GPI) linkage. Following prion infection, host protease-sensitive prion protein (PrPsen or PrPC) is converted into an abnormal, disease-associated, protease-resistant form (PrPres). Biochemical characteristics, such as the PrP amino acid sequence, and posttranslational modifications, such as glycosylation and GPI anchoring, can affect the transmissibility of prions as well as the biochemical properties of the PrPres generated. Previous in vivo studies on the effects of GPI anchoring on prion infectivity have not examined cross-species transmission. In this study, we tested the effect of lack of GPI anchoring on a species barrier model using mice expressing human PrP. In this model, anchorless 22L prions derived from tg44 mice were more infectious than 22L prions derived from C57BL/10 mice when tested in tg66 transgenic mice, which expressed wild-type anchored human PrP at 8- to 16-fold above normal. Thus, the lack of the GPI anchor on the PrPres from tg44 mice appeared to reduce the effect of the mouse-human PrP species barrier. In contrast, neither source of prions induced disease in tgRM transgenic mice, which expressed human PrP at 2- to 4-fold above normal. Prion protein (PrP) is found in all mammals, usually attached to cells by an anchor molecule called GPI. Following prion infection, PrP is converted into a disease-associated form (PrPres). While most prion diseases are species specific, this finding is not consistent, and species barriers differ in strength. The amino acid sequence of PrP varies among species, and this variability affects prion species barriers. However, other PrP modifications, including glycosylation and GPI anchoring, may also influence cross-species infectivity. We studied the effect of PrP GPI anchoring using a mouse-to-human species barrier model. Experiments showed that prions produced by

  13. Screening of transgenic proteins expressed in transgenic food crops for the presence of short amino acid sequences identical to potential, IgE – binding linear epitopes of allergens

    Directory of Open Access Journals (Sweden)

    Peijnenburg Ad ACM

    2002-12-01

    Full Text Available Abstract Background Transgenic proteins expressed by genetically modified food crops are evaluated for their potential allergenic properties prior to marketing, among others by identification of short identical amino acid sequences that occur both in the transgenic protein and allergenic proteins. A strategy is proposed, in which the positive outcomes of the sequence comparison with a minimal length of six amino acids are further screened for the presence of potential linear IgE-epitopes. This double track approach involves the use of literature data on IgE-epitopes and an antigenicity prediction algorithm. Results Thirty-three transgenic proteins have been screened for identities of at least six contiguous amino acids shared with allergenic proteins. Twenty-two transgenic proteins showed positive results of six- or seven-contiguous amino acids length. Only a limited number of identical stretches shared by transgenic proteins (papaya ringspot virus coat protein, acetolactate synthase GH50, and glyphosate oxidoreductase and allergenic proteins could be identified as (part of potential linear epitopes. Conclusion Many transgenic proteins have identical stretches of six or seven amino acids in common with allergenic proteins. Most identical stretches are likely to be false positives. As shown in this study, identical stretches can be further screened for relevance by comparison with linear IgE-binding epitopes described in literature. In the absence of literature data on epitopes, antigenicity prediction by computer aids to select potential antibody binding sites that will need verification of IgE binding by sera binding tests. Finally, the positive outcomes of this approach warrant further clinical testing for potential allergenicity.

  14. Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

    Science.gov (United States)

    Tang, Wei; Newton, Ronald J; Weidner, Douglas A

    2007-01-01

    An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

  15. Transfection of Eimeria mitis with yellow fluorescent protein as reporter and the endogenous development of the transgenic parasite.

    Directory of Open Access Journals (Sweden)

    Mei Qin

    Full Text Available BACKGROUND: Advancements have been made in the genetic manipulation of apicomplexan parasites. Both the in vitro transient and in vivo stable transfection of Eimeria tenella have been developed successfully. Herein, we report the transient and stable transfection of Eimeria mitis. METHODS AND FINDINGS: Sporozoites of E. mitis transfected with enhanced yellow fluorescent protein (EYFP expression plasmid were inoculated into chickens via the cloacal route. The recovered fluorescent oocysts were sorted by fluorescence activated cell sorting (FACS and then passaged 6 generations successively in chickens. The resulting population was analyzed by genome walking and Western blot. The endogenous development of the transgenic E. mitis was observed and its reproduction potential was tested. The stable transfection of E. mitis was developed. Genome walking confirmed the random integration of plasmid DNA into the genome; while Western blot analysis demonstrated the expression of foreign proteins. Constitutive expression of EYFP was observed in all stages of merogony, gametogony and sporogony. The peak of the transgenic oocyst output was delayed by 24 h and the total oocyst reproduction was reduced by 7-fold when compared to the parental strain. CONCLUSION: Stable transfection of E. mitis was successfully developed. The expression of foreign antigens in the transgenic parasites will facilitate the development of transgenic E. mitis as a vaccine vector.

  16. Generation of the bovine viral diarrhea virus e0 protein in transgenic astragalus and its immunogenicity in sika deer.

    Science.gov (United States)

    Gao, Yugang; Zhao, Xueliang; Zang, Pu; Liu, Qun; Wei, Gongqing; Zhang, Lianxue

    2014-01-01

    The bovine viral diarrhea virus (BVDV), a single-stranded RNA virus, can cause fatal diarrhea syndrome, respiratory problems, and reproductive disorders in herds. Over the past few years, it has become clear that the BVDV infection rates are increasing and it is likely that an effective vaccine for BVDV will be needed. In this study, transgenic Astragalus was used as an alternative productive platform for the expression of glycoprotein E0. The immunogenicity of glycoprotein E0 expressed in transgenic Astragalus was detected in deer. The presence of pBI121-E0 was confirmed by polymerase chain reaction (PCR), transcription was verified by reverse transcription- (RT-) PCR, and recombinant protein expression was confirmed by ELISA and Western blot analyses. Deer that were immunized subcutaneously with the transgenic plant vaccine developed specific humoral and cell-mediated immune responses against BVDV. This study provides a new method for a protein with weak immunogenicity to be used as part of a transgenic plant vaccine.

  17. Generation of the Bovine Viral Diarrhea Virus E0 Protein in Transgenic Astragalus and Its Immunogenicity in Sika Deer

    Directory of Open Access Journals (Sweden)

    Yugang Gao

    2014-01-01

    Full Text Available The bovine viral diarrhea virus (BVDV, a single-stranded RNA virus, can cause fatal diarrhea syndrome, respiratory problems, and reproductive disorders in herds. Over the past few years, it has become clear that the BVDV infection rates are increasing and it is likely that an effective vaccine for BVDV will be needed. In this study, transgenic Astragalus was used as an alternative productive platform for the expression of glycoprotein E0. The immunogenicity of glycoprotein E0 expressed in transgenic Astragalus was detected in deer. The presence of pBI121-E0 was confirmed by polymerase chain reaction (PCR, transcription was verified by reverse transcription- (RT- PCR, and recombinant protein expression was confirmed by ELISA and Western blot analyses. Deer that were immunized subcutaneously with the transgenic plant vaccine developed specific humoral and cell-mediated immune responses against BVDV. This study provides a new method for a protein with weak immunogenicity to be used as part of a transgenic plant vaccine.

  18. Amyotrophic lateral sclerosis mutant vesicle-associated membrane protein-associated protein-B transgenic mice develop TAR-DNA-binding protein-43 pathology.

    LENUS (Irish Health Repository)

    Tudor, E L

    2010-05-19

    Cytoplasmic ubiquitin-positive inclusions containing TAR-DNA-binding protein-43 (TDP-43) within motor neurons are the hallmark pathology of sporadic amyotrophic lateral sclerosis (ALS). TDP-43 is a nuclear protein and the mechanisms by which it becomes mislocalized and aggregated in ALS are not properly understood. A mutation in the vesicle-associated membrane protein-associated protein-B (VAPB) involving a proline to serine substitution at position 56 (VAPBP56S) is the cause of familial ALS type-8. To gain insight into the molecular mechanisms by which VAPBP56S induces disease, we created transgenic mice that express either wild-type VAPB (VAPBwt) or VAPBP56S in the nervous system. Analyses of both sets of mice revealed no overt motor phenotype nor alterations in survival. However, VAPBP56S but not VAPBwt transgenic mice develop cytoplasmic TDP-43 accumulations within spinal cord motor neurons that were first detected at 18 months of age. Our results suggest a link between abnormal VAPBP56S function and TDP-43 mislocalization.

  19. Self-processing 2A-polyproteins--a system for co-ordinate expression of multiple proteins in transgenic plants.

    Science.gov (United States)

    Halpin, C; Cooke, S E; Barakate, A; El Amrani, A; Ryan, M D

    1999-02-01

    Achieving co-ordinate, high-level and stable expression of multiple transgenes in plants is currently difficult. Expression levels are notoriously variable and influenced by factors that act independently on transgenes at different genetic loci. Instability of expression due to loss, re-arrangement or silencing of transgenes may occur, and is exacerbated by increasing numbers of transgenic loci and repeated use of homologous sequences. Even linking two or more genes within a T-DNA does not necessarily result in co-ordinate expression. Linking proteins in a single open reading frame--a polyprotein--is a strategy for co-ordinate expression used by many viruses. After translation, polyproteins are processed into constituent polypeptides, usually by proteinases encoded within the polyprotein itself. However, in foot-and-mouth disease virus (FMDV), a sequence (2A) of just 16-20 amino acids appears to have the unique capability to mediate cleavage at its own C-terminus by an apparently enzyme-independent, novel type of reaction. This sequence can also mediate cleavage in a heterologous protein context in a range of eukaryotic expression systems. We have constructed a plasmid in which the 2A sequence is inserted between the reporter genes chloramphenicol acetyltransferase (CAT) and beta-glucuronidase (GUS), maintaining a single open reading frame. Here we report that expression of this construct in wheatgerm lysate and transgenic plants results in efficient cleavage of the polyprotein and co-ordinate expression of active CAT and GUS. Self-processing polyproteins using the FMDV 2A sequence could therefore provide a system for ensuring co-ordinated, stable expression of multiple introduced proteins in plant cells.

  20. Overexpression of a Medicago truncatula stress-associated protein gene (MtSAP1) leads to nitric oxide accumulation and confers osmotic and salt stress tolerance in transgenic tobacco.

    Science.gov (United States)

    Charrier, Aurélie; Planchet, Elisabeth; Cerveau, Delphine; Gimeno-Gilles, Christine; Verdu, Isabelle; Limami, Anis M; Lelièvre, Eric

    2012-08-01

    The impact of Medicago truncatula stress-associated protein gene (MtSAP1) overexpression has been investigated in Nicotiana tabacum transgenic seedlings. Under optimal conditions, transgenic lines overexpressing MtSAP1 revealed better plant development and higher chlorophyll content as compared to wild type seedlings. Interestingly, transgenic lines showed a stronger accumulation of nitric oxide (NO), a signaling molecule involved in growth and development processes. This NO production seemed to be partially nitrate reductase dependent. Due to the fact that NO has been also reported to play a role in tolerance acquisition of plants to abiotic stresses, the responses of MtSAP1 overexpressors to osmotic and salt stress have been studied. Compared to the wild type, transgenic lines were less affected in their growth and development. Moreover, NO content in MtSAP1 overexpressors was always higher than that detected in wild seedlings under stress conditions. It seems that this better tolerance induced by MtSAP1 overexpression could be associated with this higher NO production that would enable seedlings to reach a high protection level to prepare them to cope with abiotic stresses.

  1. Development of a convenient in vivo hepatotoxin assay using a transgenic zebrafish line with liver-specific DsRed expression.

    Directory of Open Access Journals (Sweden)

    Xiaoyan Zhang

    Full Text Available Previously we have developed a transgenic zebrafish line (LiPan with liver-specific red fluorescent protein (DsRed expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine] caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics and chlorphenamine (pain killer did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry

  2. Development of a Convenient In Vivo Hepatotoxin Assay Using a Transgenic Zebrafish Line with Liver-Specific DsRed Expression

    Science.gov (United States)

    Zhang, Xiaoyan; Li, Caixia; Gong, Zhiyuan

    2014-01-01

    Previously we have developed a transgenic zebrafish line (LiPan) with liver-specific red fluorescent protein (DsRed) expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone) in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate) behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine]) caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics) and chlorphenamine (pain killer) did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry provide a rapid

  3. A transgenic mouse line for molecular genetic analysis of excitatory glutamatergic neurons

    DEFF Research Database (Denmark)

    Borgius, Lotta; Restrepo, C. Ernesto; Leao, Richardson N.

    2010-01-01

    Excitatory glutamatergic neurons are part of most of the neuronal circuits in the mammalian nervous system. We have used BAC-technology to generate a BAC-Vglut2::Cre mouse line where Cre expression is driven by the vesicular glutamate transporter 2 (Vglut2) promotor. This BAC-Vglut2::Cre mouse line...... showed specific expression of Cre in Vglut2 positive cells in the spinal cord with no ectopic expression in GABAergic or glycinergic neurons. This mouse line also showed specific Cre expression in Vglut2 positive structures in the brain such as thalamus, hypothalamus, superior colliculi, inferior...... colliculi and deep cerebellar nuclei together with nuclei in the midbrain and hindbrain. Cre-mediated recombination was restricted to Cre expressing cells in the spinal cord and brain and occurred as early as E 12.5. Known Vglut2 positive neurons showed normal electrophysiological properties in the BAC...

  4. A Phox2b BAC Transgenic Rat Line Useful for Understanding Respiratory Rhythm Generator Neural Circuitry.

    Directory of Open Access Journals (Sweden)

    Keiko Ikeda

    Full Text Available The key role of the respiratory neural center is respiratory rhythm generation to maintain homeostasis through the control of arterial blood pCO2/pH and pO2 levels. The neuronal network responsible for respiratory rhythm generation in neonatal rat resides in the ventral side of the medulla and is composed of two groups; the parafacial respiratory group (pFRG and the pre-Bötzinger complex group (preBötC. The pFRG partially overlaps in the retrotrapezoid nucleus (RTN, which was originally identified in adult cats and rats. Part of the pre-inspiratory (Pre-I neurons in the RTN/pFRG serves as central chemoreceptor neurons and the CO2 sensitive Pre-I neurons express homeobox gene Phox2b. Phox2b encodes a transcription factor and is essential for the development of the sensory-motor visceral circuits. Mutations in human PHOX2B cause congenital hypoventilation syndrome, which is characterized by blunted ventilatory response to hypercapnia. Here we describe the generation of a novel transgenic (Tg rat harboring fluorescently labeled Pre-I neurons in the RTN/pFRG. In addition, the Tg rat showed fluorescent signals in autonomic enteric neurons and carotid bodies. Because the Tg rat expresses inducible Cre recombinase in PHOX2B-positive cells during development, it is a potentially powerful tool for dissecting the entire picture of the respiratory neural network during development and for identifying the CO2/O2 sensor molecules in the adult central and peripheral nervous systems.

  5. Profile of new green fluorescent protein transgenic Jinhua pigs as an imaging source

    Science.gov (United States)

    Kawarasaki, Tatsuo; Uchiyama, Kazuhiko; Hirao, Atsushi; Azuma, Sadahiro; Otake, Masayoshi; Shibata, Masatoshi; Tsuchiya, Seiko; Enosawa, Shin; Takeuchi, Koichi; Konno, Kenjiro; Hakamata, Yoji; Yoshino, Hiroyuki; Wakai, Takuya; Ookawara, Shigeo; Tanaka, Hozumi; Kobayashi, Eiji; Murakami, Takashi

    2009-09-01

    Animal imaging sources have become an indispensable material for biological sciences. Specifically, gene-encoded biological probes serve as stable and high-performance tools to visualize cellular fate in living animals. We use a somatic cell cloning technique to create new green fluorescent protein (GFP)-expressing Jinhua pigs with a miniature body size, and characterized the expression profile in various tissues/organs and ex vivo culture conditions. The born GFP-transgenic pig demonstrate an organ/tissue-dependent expression pattern. Strong GFP expression is observed in the skeletal muscle, pancreas, heart, and kidney. Regarding cellular levels, bone-marrow-derived mesenchymal stromal cells, hepatocytes, and islet cells of the pancreas also show sufficient expression with the unique pattern. Moreover, the cloned pigs demonstrate normal growth and fertility, and the introduced GFP gene is stably transmitted to pigs in subsequent generations. The new GFP-expressing Jinhua pigs may be used as new cellular/tissue light resources for biological imaging in preclinical research fields such as tissue engineering, experimental regenerative medicine, and transplantation.

  6. No direct effects of two transgenic Bt rice lines, T1C-19 and T2A-1, on the arthropod communities.

    Science.gov (United States)

    Lu, Z B; Tian, J C; Han, N S; Hu, C; Peng, Y F; Stanley, David; Ye, G Y

    2014-10-01

    A 2-yr field trial was conducted to assess the impacts of two new transgenic Bt rice lines, T1C-19 expressing Cry1C protein and T2A-1 expressing Cry2A protein, on the arthropod community sampled via vacuum. All the arthropods were classified into five guilds, including herbivores, parasitoids, predators, detritivores, and others. The seasonal density and dominance distribution of each guild and community-level indices (species richness, Shannon-Wiener diversity index, Simpson diversity index, and evenness index) were compared among rice types. Principal response curves were used to investigate the differences of entire arthropod community of Bt rice plots relative to non-Bt rice plots. The results showed no significant difference was detected in the community-level indices and dominance distribution of guilds between Bt and non-Bt rice plots. The seasonal density of herbivores, detritivores, and others as well as density of the arthropod overall community were also not significantly affected by rice types in either year, although the density of predators and parasitoids in Bt rice plots was significantly lower than those in non-Bt rice plots. The lower abundances of Braconidae, Eulophidae, Cyrtorhinus lividipennis (Reuter) (Hemiptera: Miridae), and Theridiidae in Bt rice plots are likely attributed to the lower abundances of prey species or hosts. Principal response curves revealed that arthropod community in Bt was similar with that in non-Bt rice plots. In conclusion, our findings indicate that these two tested Bt rice lines had no marked negative effects on the arthropod community in the paddy fields.

  7. [Progress in transgenic fish techniques and application].

    Science.gov (United States)

    Ye, Xing; Tian, Yuan-Yuan; Gao, Feng-Ying

    2011-05-01

    Transgenic technique provides a new way for fish breeding. Stable lines of growth hormone gene transfer carps, salmon and tilapia, as well as fluorescence protein gene transfer zebra fish and white cloud mountain minnow have been produced. The fast growth characteristic of GH gene transgenic fish will be of great importance to promote aquaculture production and economic efficiency. This paper summarized the progress in transgenic fish research and ecological assessments. Microinjection is still the most common used method, but often resulted in multi-site and multi-copies integration. Co-injection of transposon or meganuclease will greatly improve the efficiency of gene transfer and integration. "All fish" gene or "auto gene" should be considered to produce transgenic fish in order to eliminate misgiving on food safety and to benefit expression of the transferred gene. Environmental risk is the biggest obstacle for transgenic fish to be commercially applied. Data indicates that transgenic fish have inferior fitness compared with the traditional domestic fish. However, be-cause of the genotype-by-environment effects, it is difficult to extrapolate simple phenotypes to the complex ecological interactions that occur in nature based on the ecological consequences of the transgenic fish determined in the laboratory. It is critical to establish highly naturalized environments for acquiring reliable data that can be used to evaluate the environ-mental risk. Efficacious physical and biological containment strategies remain to be crucial approaches to ensure the safe application of transgenic fish technology.

  8. Regeneration of multiple shoots from transgenic potato events facilitates the recovery of phenotypically normal lines: assessing a cry9Aa2 gene conferring insect resistance

    Directory of Open Access Journals (Sweden)

    Jacobs Jeanne ME

    2011-10-01

    Full Text Available Abstract Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.. Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM, Phthorimaea operculella (Zeller. Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event.

  9. Effects of Metformin on Tissue Oxidative and Dicarbonyl Stress in Transgenic Spontaneously Hypertensive Rats Expressing Human C-Reactive Protein

    Czech Academy of Sciences Publication Activity Database

    Malínská, H.; Oliyarnyk, O.; Škop, V.; Šilhavý, Jan; Landa, Vladimír; Zídek, Václav; Mlejnek, Petr; Šimáková, Miroslava; Strnad, Hynek; Kazdová, L.; Pravenec, Michal

    2016-01-01

    Roč. 11, č. 3 (2016), e0150924 E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) LL1204; GA MZd(CZ) NT14325 Institutional support: RVO:67985823 ; RVO:68378050 Keywords : inflammation * spontaneously hypertensive rat * transgenic * C-reactive protein * dicarbonyl stress * metformin Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 2.806, year: 2016

  10. ACCUMULATION OF RECOMBINANT FUSION PROTEIN – SECRETORY ANALOG OF Ag85B AND ESAT6 MYCOBACTERIUM TUBERCULOSIS PROTEINS – IN TRANSGENIC Lemna minor L. PLANTS

    Directory of Open Access Journals (Sweden)

    A.A.Peterson

    2015-10-01

    Full Text Available Determination of the presence of the recombinant fusion protein (ESAT6-Ag85B(ΔTMD-6His and its accumulation level in duckweed plants (Lemna minor L. was the aim of the research. ESAT6 and Ag85B are secretory proteins of Mycobacterium tuberculosis and are considered as potential candidates for development of new vaccine against tuberculosis (TB. Transgenic duckweed plants were obtained previously by Agrobacterium rhizogenes-mediated transformation and possessed fusion gene sequence esxA-fbpBΔTMD. Specific polyclonal antibodies were produced in immunized mice to identify levels of accumulation of TB antigens in plants. Recombinant antigen used for mice immunization was obtained in our laboratory by expression in E. coli. Western blot analysis revealed the recombinant tuberculosis antigen ESAT6-Ag85B(ΔTMD-6His in extracts from transgenic L. minor plants. The level of accumulation of the protein corresponds to 0.4-0.5 µg protein per 1 g of fresh weight of plant. Additionally, the accumulation of recombinant protein was investigated in lyophilized transgenic plants after 1.5 year storage. Duckweed plants accumulating a recombinant analogue of M. tuberculosis secretory proteins can be used for development of plant-based edible vaccines.

  11. Generation of a Homozygous Transgenic Rat Strain Stably Expressing a Calcium Sensor Protein for Direct Examination of Calcium Signaling.

    Science.gov (United States)

    Szebényi, Kornélia; Füredi, András; Kolacsek, Orsolya; Pergel, Enikő; Bősze, Zsuzsanna; Bender, Balázs; Vajdovich, Péter; Tóvári, József; Homolya, László; Szakács, Gergely; Héja, László; Enyedi, Ágnes; Sarkadi, Balázs; Apáti, Ágota; Orbán, Tamás I

    2015-08-03

    In drug discovery, prediction of selectivity and toxicity require the evaluation of cellular calcium homeostasis. The rat is a preferred laboratory animal for pharmacology and toxicology studies, while currently no calcium indicator protein expressing rat model is available. We established a transgenic rat strain stably expressing the GCaMP2 fluorescent calcium sensor by a transposon-based methodology. Zygotes were co-injected with mRNA of transposase and a CAG-GCaMP2 expressing construct, and animals with one transgene copy were pre-selected by measuring fluorescence in blood cells. A homozygous rat strain was generated with high sensor protein expression in the heart, kidney, liver, and blood cells. No pathological alterations were found in these animals, and fluorescence measurements in cardiac tissue slices and primary cultures demonstrated the applicability of this system for studying calcium signaling. We show here that the GCaMP2 expressing rat cardiomyocytes allow the prediction of cardiotoxic drug side-effects, and provide evidence for the role of Na(+)/Ca(2+) exchanger and its beneficial pharmacological modulation in cardiac reperfusion. Our data indicate that drug-induced alterations and pathological processes can be followed by using this rat model, suggesting that transgenic rats expressing a calcium-sensitive protein provide a valuable system for pharmacological and toxicological studies.

  12. Effect of gamma irradiation on nutritional components and Cry1Ab protein in the transgenic rice with a synthetic cry1Ab gene from Bacillus thuringiensis

    International Nuclear Information System (INIS)

    Wu Dianxing; Ye Qingfu; Wang Zhonghua; Xia Yingwu

    2004-01-01

    The effects of gamma irradiation on the transgenic rice containing a synthetic cry1Ab gene from Bacillus thuringiensis were investigated. There was almost no difference in the content of the major nutritional components, i.e. crude protein, crude lipid, eight essential amino acids and total ash between the irradiated grains and the non-irradiated transgenic rice. However, the amounts of Cry1Ab protein and apparent amylose in the irradiated transgenic rice were reduced significantly by the doses higher than 200 Gy. In vivo observation showed that Cry1Ab protein contents also decreased in the fresh leaf tissues of survival seedlings after irradiation with 200 Gy or higher doses and showed inhibition of seedling growth. The results indicate that gamma irradiation might improve the quality of transgenic rice due to removal of the toxic Cry1Ab protein

  13. Effect of catalpol on senile plaques and spatial learning and memory ability in amyloid-β protein precursor/presenilin 1 double transgenic mice

    Institute of Scientific and Technical Information of China (English)

    宋冲

    2013-01-01

    Objective To investigate whether catalpol affects senile plaque formation and spatial learning and memory ability in the amyloid-βprotein precursor/presenilin 1(APP/PS1)double transgenic mice.Methods

  14. Murine transgenic embryonic stem cell lines for the investigation of sinoatrial node-related molecular pathways

    Directory of Open Access Journals (Sweden)

    Stefanie Schmitteckert

    2017-12-01

    Full Text Available The elucidation of molecular mechanisms that restrict the potential of pluripotent stem cells and promote cardiac lineage differentiation is of crucial relevance, since embryonic stem cells (ESCs hold great potential for cell based heart therapies. The homeodomain transcription factor Shox2 is essential for the development and proper function of the native cardiac pacemaker, the sinoatrial node. This prompted us to develop a cardiac differentiation model using ESC lines isolated from blastocysts of Shox2-deficient mice. The established cell model provides a fundamental basis for the investigation of molecular pathways under physiological and pathophysiological conditions for evaluating novel therapeutic approaches.

  15. An α-smooth muscle actin (acta2/αsma zebrafish transgenic line marking vascular mural cells and visceral smooth muscle cells.

    Directory of Open Access Journals (Sweden)

    Thomas R Whitesell

    Full Text Available Mural cells of the vascular system include vascular smooth muscle cells (SMCs and pericytes whose role is to stabilize and/or provide contractility to blood vessels. One of the earliest markers of mural cell development in vertebrates is α smooth muscle actin (acta2; αsma, which is expressed by pericytes and SMCs. In vivo models of vascular mural cell development in zebrafish are currently lacking, therefore we developed two transgenic zebrafish lines driving expression of GFP or mCherry in acta2-expressing cells. These transgenic fish were used to trace the live development of mural cells in embryonic and larval transgenic zebrafish. acta2:EGFP transgenic animals show expression that largely mirrors native acta2 expression, with early pan-muscle expression starting at 24 hpf in the heart muscle, followed by skeletal and visceral muscle. At 3.5 dpf, expression in the bulbus arteriosus and ventral aorta marks the first expression in vascular smooth muscle. Over the next 10 days of development, the number of acta2:EGFP positive cells and the number of types of blood vessels associated with mural cells increases. Interestingly, the mural cells are not motile and remain in the same position once they express the acta2:EGFP transgene. Taken together, our data suggests that zebrafish mural cells develop relatively late, and have little mobility once they associate with vessels.

  16. Aproach study of freedom to operate for transgenic line rice in Colombia

    Directory of Open Access Journals (Sweden)

    Alejandro Chaparro Giraldo

    2016-01-01

    Full Text Available The development of a genetically modified variety (GM is a scientific and legal challenge, by genetic engineering techniques used and the intellectual property rights (IPR involved. Approximate analysis of freedom of operation for a GM line derived from a Colombian rice variety, express an optimized version of the cry1Ac gene; in order to pursue their commercial release in Colombia was made. To do this, a deconstruction of innovation, which potentially protectable elements DPI on which patent searches and patent applications were made in the national and international context, databases were determined public access was performed. 59 patents and patent applications were found in the international arena. The Superintendency of Industry and Trade of Colombia (SIC three applications for patents that may affect the freedom of operation for this innovation were found. It is concluded that the higher the possibility of developing a GM rice line expressing cry1Ac gene without affecting the interest of third parties , as long as it is done in the country to commercialize.

  17. Transgenic plants expressing the AaIT/GNA fusion protein show increased resistance and toxicity to both chewing and sucking pests.

    Science.gov (United States)

    Liu, Shu-Min; Li, Jie; Zhu, Jin-Qi; Wang, Xiao-Wei; Wang, Cheng-Shu; Liu, Shu-Sheng; Chen, Xue-Xin; Li, Sheng

    2016-04-01

    The adoption of pest-resistant transgenic plants to reduce yield losses and decrease pesticide use has been successful. To achieve the goal of controlling both chewing and sucking pests in a given transgenic plant, we generated transgenic tobacco, Arabidopsis, and rice plants expressing the fusion protein, AaIT/GNA, in which an insecticidal scorpion venom neurotoxin (Androctonus australis toxin, AaIT) is fused to snowdrop lectin (Galanthus nivalis agglutinin, GNA). Compared with transgenic tobacco and Arabidopsis plants expressing AaIT or GNA, transgenic plants expressing AaIT/GNA exhibited increased resistance and toxicity to one chewing pest, the cotton bollworm, Helicoverpa armigera. Transgenic tobacco and rice plants expressing AaIT/GNA showed increased resistance and toxicity to two sucking pests, the whitefly, Bemisia tabaci, and the rice brown planthopper, Nilaparvata lugens, respectively. Moreover, in the field, transgenic rice plants expressing AaIT/GNA exhibited a significant improvement in grain yield when infested with N. lugens. This study shows that expressing the AaIT/GNA fusion protein in transgenic plants can be a useful approach for controlling pests, particularly sucking pests which are not susceptible to the toxin in Bt crops. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  18. A transgenic mouse model for trilateral retinoblastoma

    NARCIS (Netherlands)

    O'Brien, J.M.; Marcus, D.M.; Bernards, R.A.; Carpenter, J.L.; Windle, J.J.; Mellon, P.; Albert, D.M.

    1990-01-01

    We present a murine model of trilateral retinoblastoma. Ocular retinoblastoma and central nervous system tumors are observed in a line of mice formed by the transgenic expression of SV40 T-antigen. An oncogenic protein known to bind to the retinoblastoma gene product (p105-Rb) is specifically

  19. Transgenic Mouse Lines Subdivide External Segment of the Globus Pallidus (GPe) Neurons and Reveal Distinct GPe Output Pathways

    Science.gov (United States)

    Mastro, Kevin J.; Bouchard, Rachel S.; Holt, Hiromi A. K.

    2014-01-01

    Cell-type diversity in the brain enables the assembly of complex neural circuits, whose organization and patterns of activity give rise to brain function. However, the identification of distinct neuronal populations within a given brain region is often complicated by a lack of objective criteria to distinguish one neuronal population from another. In the external segment of the globus pallidus (GPe), neuronal populations have been defined using molecular, anatomical, and electrophysiological criteria, but these classification schemes are often not generalizable across preparations and lack consistency even within the same preparation. Here, we present a novel use of existing transgenic mouse lines, Lim homeobox 6 (Lhx6)–Cre and parvalbumin (PV)–Cre, to define genetically distinct cell populations in the GPe that differ molecularly, anatomically, and electrophysiologically. Lhx6–GPe neurons, which do not express PV, are concentrated in the medial portion of the GPe. They have lower spontaneous firing rates, narrower dynamic ranges, and make stronger projections to the striatum and substantia nigra pars compacta compared with PV–GPe neurons. In contrast, PV–GPe neurons are more concentrated in the lateral portions of the GPe. They have narrower action potentials, deeper afterhyperpolarizations, and make stronger projections to the subthalamic nucleus and parafascicular nucleus of the thalamus. These electrophysiological and anatomical differences suggest that Lhx6–GPe and PV–GPe neurons participate in different circuits with the potential to contribute to different aspects of motor function and dysfunction in disease. PMID:24501350

  20. Expression of a truncated receptor protein tyrosine phosphatase kappa in the brain of an adult transgenic mouse

    DEFF Research Database (Denmark)

    Shen, P; Canoll, P D; Sap, J

    1999-01-01

    that goal, we have used this mouse model to map the distribution of the truncated RPTP-kappa/beta-geo fusion protein in the adult mouse brain using beta-galactosidase as a marker enzyme. Visualization of the beta-galactosidase activity revealed a non-random pattern of expression, and identified cells......-6596]. Nevertheless, since the transgene's expression is driven by the endogenous RPTP-kappa promoter, distribution of the truncated RPTP-kappa/beta-geo fusion protein should reflect the regional and cellular expression of wild-type RPTP-kappa, and thus may identify sites where RPTP-kappa is important. Towards...

  1. Split-Cre complementation restores combination activity on transgene excision in hair roots of transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Mengling Wen

    Full Text Available The Cre/loxP system is increasingly exploited for genetic manipulation of DNA in vitro and in vivo. It was previously reported that inactive ''split-Cre'' fragments could restore Cre activity in transgenic mice when overlapping co-expression was controlled by two different promoters. In this study, we analyzed recombination activities of split-Cre proteins, and found that no recombinase activity was detected in the in vitro recombination reaction in which only the N-terminal domain (NCre of split-Cre protein was expressed, whereas recombination activity was obtained when the C-terminal (CCre or both NCre and CCre fragments were supplied. We have also determined the recombination efficiency of split-Cre proteins which were co-expressed in hair roots of transgenic tobacco. No Cre recombination event was observed in hair roots of transgenic tobacco when the NCre or CCre genes were expressed alone. In contrast, an efficient recombination event was found in transgenic hairy roots co-expressing both inactive split-Cre genes. Moreover, the restored recombination efficiency of split-Cre proteins fused with the nuclear localization sequence (NLS was higher than that of intact Cre in transgenic lines. Thus, DNA recombination mediated by split-Cre proteins provides an alternative method for spatial and temporal regulation of gene expression in transgenic plants.

  2. The developmental expression of fluorescent proteins in organotypic hippocampal slice cultures from transgenic mice and its use in the determination of excitotoxic neurodegeneration

    DEFF Research Database (Denmark)

    Noraberg, Jens; Jensen, Carsten V; Bonde, Christian

    2007-01-01

    Transgenic mice, expressing fluorescent proteins in neurons and glia, provide new opportunities for real-time microscopic monitoring of degenerative and regenerative structural changes. We have previously validated and compared a number of quantifiable markers for neuronal damage and cell death...... changes, as well as the opportunity to monitor reversible changes or long-term effects in the event of minor damage. As a first step, we present: a) the developmental expression in organotypic hippocampal brain slice cultures of transgenic fluorescent proteins, useful for the visualisation of neuronal...... transgenic mouse strains which express fluorescent proteins in their neurons and/or astroglial cells. From the time of explantation, and subsequently for up to nine weeks in culture, the transgenic neuronal fluorescence displayed the expected characteristics of a developmental, in vivo-like increase...

  3. Ha-ras oncogene expression directed by a milk protein gene promoter: tissue specificity, hormonal regulation, and tumor induction in transgenic mice

    International Nuclear Information System (INIS)

    Andres, A.C.; Schoenenberger, C.A.; Groner, B.; Henninghausen, L.; LeMeur, M.; Gelinger, P.

    1987-01-01

    The activated human Ha-ras oncogene was subjected to the control of the promoter region of the murine whey acidic protein (Wap) gene, which is expressed in mammary epithelial cells in response to lactogenic hormones. The Wap-ras gene was stably introduced into the mouse germ line of five transgenic mice (one male and four females). Wap-ras expression was observed in the mammary glands of lactating females in two lines derived from female founders. The tissue-directed and hormone-dependent Wap expression was conferred on the Ha-ras oncogene. The signals governing Wap expression are located within 2.5 kilobases of 5' flanking sequence. The other two lines derived from female founders did not express the chimeric gene. In the line derived from the male founder the Wap-ras gene is integrated into the Y chromosome. Expression was found in the salivary gland of male animals only. After a long latency, Wap-ras-expressing mice developed tumors. The tumors arose in tissues expressing Wap-ras - i.e., mammary or salivary glands. Compared to the corresponding nonmalignant tissues, Wap-ras expression was enhanced in the tumors

  4. Efficient genetic transformation of okra (Abelmoschus esculentus (L.) Moench) and generation of insect-resistant transgenic plants expressing the cry1Ac gene.

    Science.gov (United States)

    Narendran, M; Deole, Satish G; Harkude, Satish; Shirale, Dattatray; Nanote, Asaram; Bihani, Pankaj; Parimi, Srinivas; Char, Bharat R; Zehr, Usha B

    2013-08-01

    Agrobacterium -mediated transformation system for okra using embryos was devised and the transgenic Bt plants showed resistance to the target pest, okra shoot, and fruit borer ( Earias vittella ). Okra is an important vegetable crop and progress in genetic improvement via genetic transformation has been impeded by its recalcitrant nature. In this paper, we describe a procedure using embryo explants for Agrobacterium-mediated transformation and tissue culture-based plant regeneration for efficient genetic transformation of okra. Twenty-one transgenic okra lines expressing the Bacillus thuringiensis gene cry1Ac were generated from five transformation experiments. Molecular analysis (PCR and Southern) confirmed the presence of the transgene and double-antibody sandwich ELISA analysis revealed Cry1Ac protein expression in the transgenic plants. All 21 transgenic plants were phenotypically normal and fertile. T1 generation plants from these lines were used in segregation analysis of the transgene. Ten transgenic lines were selected randomly for Southern hybridization and the results confirmed the presence of transgene integration into the genome. Normal Mendelian inheritance (3:1) of cry1Ac gene was observed in 12 lines out of the 21 T0 lines. We selected 11 transgenic lines segregating in a 3:1 ratio for the presence of one transgene for insect bioassays using larvae of fruit and shoot borer (Earias vittella). Fruit from seven transgenic lines caused 100 % larval mortality. We demonstrate an efficient transformation system for okra which will accelerate the development of transgenic okra with novel agronomically useful traits.

  5. Global Conservation of Protein Status between Cell Lines and Xenografts

    Directory of Open Access Journals (Sweden)

    Julian Biau

    2016-08-01

    Full Text Available Common preclinical models for testing anticancer treatment include cultured human tumor cell lines in monolayer, and xenografts derived from these cell lines in immunodeficient mice. Our goal was to determine how similar the xenografts are compared with their original cell line and to determine whether it is possible to predict the stability of a xenograft model beforehand. We studied a selection of 89 protein markers of interest in 14 human cell cultures and respective subcutaneous xenografts using the reverse-phase protein array technology. We specifically focused on proteins and posttranslational modifications involved in DNA repair, PI3K pathway, apoptosis, tyrosine kinase signaling, stress, cell cycle, MAPK/ERK signaling, SAPK/JNK signaling, NFκB signaling, and adhesion/cytoskeleton. Using hierarchical clustering, most cell culture-xenograft pairs cluster together, suggesting a global conservation of protein signature. Particularly, Akt, NFkB, EGFR, and Vimentin showed very stable protein expression and phosphorylation levels highlighting that 4 of 10 pathways were highly correlated whatever the model. Other proteins were heterogeneously conserved depending on the cell line. Finally, cell line models with low Akt pathway activation and low levels of Vimentin gave rise to more reliable xenograft models. These results may be useful for the extrapolation of cell culture experiments to in vivo models in novel targeted drug discovery.

  6. A multiplexed miRNA and transgene expression platform for simultaneous repression and expression of protein coding sequences.

    Science.gov (United States)

    Seyhan, Attila A

    2016-01-01

    Knockdown of single or multiple gene targets by RNA interference (RNAi) is necessary to overcome escape mutants or isoform redundancy. It is also necessary to use multiple RNAi reagents to knockdown multiple targets. It is also desirable to express a transgene or positive regulatory elements and inhibit a target gene in a coordinated fashion. This study reports a flexible multiplexed RNAi and transgene platform using endogenous intronic primary microRNAs (pri-miRNAs) as a scaffold located in the green fluorescent protein (GFP) as a model for any functional transgene. The multiplexed intronic miRNA - GFP transgene platform was designed to co-express multiple small RNAs within the polycistronic cluster from a Pol II promoter at more moderate levels to reduce potential vector toxicity. The native intronic miRNAs are co-transcribed with a precursor GFP mRNA as a single transcript and presumably cleaved out of the precursor-(pre) mRNA by the RNA splicing machinery, spliceosome. The spliced intron with miRNA hairpins will be further processed into mature miRNAs or small interfering RNAs (siRNAs) capable of triggering RNAi effects, while the ligated exons become a mature messenger RNA for the translation of the functional GFP protein. Data show that this approach led to robust RNAi-mediated silencing of multiple Renilla Luciferase (R-Luc)-tagged target genes and coordinated expression of functional GFP from a single transcript in transiently transfected HeLa cells. The results demonstrated that this design facilitates the coordinated expression of all mature miRNAs either as individual miRNAs or as multiple miRNAs and the associated protein. The data suggest that, it is possible to simultaneously deliver multiple negative (miRNA or shRNA) and positive (transgene) regulatory elements. Because many cellular processes require simultaneous repression and activation of downstream pathways, this approach offers a platform technology to achieve that dual manipulation efficiently

  7. Monitoring changes in anthocyanin and steroid alkaloid glycoside content in lines of transgenic potato plants using liquid chromatography/mass spectrometry.

    Science.gov (United States)

    Stobiecki, Maciej; Matysiak-Kata, Iwona; Frański, Rafał; Skała, Jacek; Szopa, Jan

    2003-03-01

    Transgenic potato plants overexpressing and repressing enzymes of flavonoids biosynthesis were created and analyzed. The selected plants clearly showed the expected changes in anthocyanins synthesis level. Overexpression of a DNA encoding dihydroflavonol 4-reductase (DFR) in sense orientation resulted in an increase in tuber anthocyanins, a 4-fold increase in petunidin and pelargonidin derivatives. A significant decrease in anthocyanin level was observed when the plant was transformed with a corresponding antisense construct. The transformation of potato plants was also accompanied by significant changes in steroid alkaloid glycosides (SAG) level in transgenic potato tuber. The changes in SAGs content was not dependent on flavonoid composition in transgenic potato. However, in an extreme situation where the highest (DFR11) or the lowest (DFRa3) anthocyanin level was detected the positive correlation with steroid alkaloid content was clearly visible. It is suggested that the changes in SAGs content resulted from chromatin stressed upon transformation. A liquid chromatography/mass spectrometry (LC/MS) system with electrospray ionization was applied for profiling qualitative and quantitative changes of steroid alkaloid glycosides in tubers of twelve lines of transgenic potato plants. Except alpha-chaconine and alpha-solanine, in the extracts from dried tuber skin alpha-solamargine and alpha-solasonine, triglycosides of solasonine, were identified in minor amounts, triglycosides of solanidine dehydrodimers were also recognized.

  8. High Expression of Cry1Ac Protein in Cotton (Gossypium hirsutum by Combining Independent Transgenic Events that Target the Protein to Cytoplasm and Plastids.

    Directory of Open Access Journals (Sweden)

    Amarjeet Kumar Singh

    Full Text Available Transgenic cotton was developed using two constructs containing a truncated and codon-modified cry1Ac gene (1,848 bp, which was originally characterized from Bacillus thuringiensis subspecies kurstaki strain HD73 that encodes a toxin highly effective against many lepidopteran pests. In Construct I, the cry1Ac gene was cloned under FMVde, a strong constitutively expressing promoter, to express the encoded protein in the cytoplasm. In Construct II, the encoded protein was directed to the plastids using a transit peptide taken from the cotton rbcSIb gene. Genetic transformation experiments with Construct I resulted in a single copy insertion event in which the Cry1Ac protein expression level was 2-2.5 times greater than in the Bacillus thuringiensis cotton event Mon 531, which is currently used in varieties and hybrids grown extensively in India and elsewhere. Another high expression event was selected from transgenics developed with Construct II. The Cry protein expression resulting from this event was observed only in the green plant parts. No transgenic protein expression was observed in the non-green parts, including roots, seeds and non-green floral tissues. Thus, leucoplasts may lack the mechanism to allow entry of a protein tagged with the transit peptide from a protein that is only synthesized in tissues containing mature plastids. Combining the two events through sexual crossing led to near additive levels of the toxin at 4-5 times the level currently used in the field. The two high expression events and their combination will allow for effective resistance management against lepidopteran insect pests, particularly Helicoverpa armigera, using a high dosage strategy.

  9. Transgenic Expression of a Functional Fragment of Harpin Protein Hpa1 in Wheat Represses English Grain Aphid Infestation

    Institute of Scientific and Technical Information of China (English)

    XU Man-yu; ZHOU Ting; ZHAO Yan-ying; LI Jia-bao; XU Heng; DONG Han-song; ZHANG Chun-ling

    2014-01-01

    The harpin protein Hpa1 produced by the rice bacterial blight pathogen promotes plant growth and induces plant resistance to pathogens and insect pests. The region of 10-42 residues (Hpa110-42) in the Hpa1 sequence is critical as the isolated Hpa110-42 fragment is 1.3-7.5-fold more effective than the full length in inducing plant growth and resistance. Here we report that transgenic expression of Hpa110-42 in wheat induces resistance to English grain aphid, a dominant species of wheat aphids. Hpa110-42-induced resistance is effective to inhibit the aphid behavior in plant preference at the initial colonization stage and repress aphid performances in the reproduction, nymph growth, and instar development on transgenic plants. The resistance characters are correlated with enhanced expression of defense-regulatory genes (EIN2, PP2-A, and GSL10) and consistent with induced expression of defense response genes (Hel, PDF1.2, PR-1b, and PR-2b). As a result, aphid infestations are alleviated in transgenic plants. The level of Hpa110-42-induced resistance in regard to repression of aphid infestations is equivalent to the effect of chemical control provided by an insecticide. These results suggested that the defensive role of Hpa110-42 can be integrated into breeding germplasm of the agriculturally signiifcant crop with a great potential of the agricultural application.

  10. Effects of seed mixture sowing with transgenic Bt rice and its parental line on the population dynamics of target stemborers and leafrollers, and non-target planthoppers.

    Science.gov (United States)

    Li, Zhuo; Li, Li-Kun; Liu, Bin; Wang, Long; Parajulee, Megha N; Chen, Fa-Jun

    2018-01-24

    The widespread planting of insect-resistant crops has caused a dramatic shift in agricultural landscapes, thus raising concerns about the potential impacts on both target and non-target pests. In this study, we examined the potential effects of intra-specific seed mixture sowing with transgenic Bt rice (Bt) and its parental non-transgenic line (Nt) (100% Bt rice [Bt 100 ], 5% Nt+95% Bt [Nt 05 Bt 95 ], 10% Nt+90% Bt [Nt 10 Bt 90 ], 20% Nt+80% Bt [Nt 20 Bt 80 ], 40% Nt+60% Bt [Nt 40 Bt 60 ] and 100% Nt rice [Nt 100 ]) on target and non-target pests in a 2-year field trial in southern China. The occurrence of target pests, Sesamia inferens, Chilo suppressalis and Cnaphalocrocis medinalis, decreased with the increased ratio of Bt rice, and the mixture ratios with more than 90% Bt rice (Bt 100 and Nt 05 Bt 95 ) significantly increased the pest suppression efficiency, with the lowest occurrences of non-target planthoppers, Nilaparvata lugens and Sogatella furcifera in Nt 100 and Nt 05 Bt 95 . Furthermore, there were no significant differences in 1000-grain dry weight and grain dry weight per 100 plants between Bt 100 and Nt 05 Bt 95 . Seed mixture sowing of Bt rice with ≤10% (especially 5%) of its parent line was sufficient to overcome potential compliance issues that exist with the use of block or structured refuge to provide most effective control of both target and non-target pests without compromising the grain yield. It is also expected that the strategy of seed mixture sowing with transgenic Bt rice and the non-transgenic parental line would provide rice yield stability while decreasing the insecticide use frequency in rice production. © 2018 Institute of Zoology, Chinese Academy of Sciences.

  11. Transgenic nude mouse with green fluorescent protein expression-based human glioblastoma multiforme animal model with EGFR expression and invasiveness.

    Science.gov (United States)

    Tan, Guo-Wei; Lan, Fo-Lin; Gao, Jian-Guo; Jiang, Cai-Mou; Zhang, Yi; Huang, Xiao-Hong; Ma, Yue-Hong; Shao, He-Dui; He, Xue-Yang; Chen, Jin-Long; Long, Jian-Wu; Xiao, Hui-Sheng; Guo, Zhi-Tong; Diao, Yi

    2012-08-01

    Previously, we developed an orthotopic xenograft model of human glioblastoma multiforme (GBM) with high EGFR expression and invasiveness in Balb/c nu/nu nude mice. Now we also developed the same orthotopic xenograft model in transgenic nude mice with green fluorescent protein (GFP) expression. The present orthotopic xenografts labeled by phycoerythrin fluorescing red showed high EGFR expression profile, and invasive behavior under a bright green-red dual-color fluorescence background. A striking advantage in the present human GBM model is that the change of tumor growth can be observed visually instead of sacrificing animals in our further antitumor therapy studies.

  12. Transgenic soya bean seeds accumulating β-carotene exhibit the collateral enhancements of oleate and protein content traits.

    Science.gov (United States)

    Schmidt, Monica A; Parrott, Wayne A; Hildebrand, David F; Berg, R Howard; Cooksey, Amanda; Pendarvis, Ken; He, Yonghua; McCarthy, Fiona; Herman, Eliot M

    2015-05-01

    Transgenic soya bean (Glycine max) plants overexpressing a seed-specific bacterial phytoene synthase gene from Pantoea ananatis modified to target to plastids accumulated 845 μg β carotene g(-1) dry seed weight with a desirable 12:1 ratio of β to α. The β carotene accumulating seeds exhibited a shift in oil composition increasing oleic acid with a concomitant decrease in linoleic acid and an increase in seed protein content by at least 4% (w/w). Elevated β-carotene accumulating soya bean cotyledons contain 40% the amount of abscisic acid compared to nontransgenic cotyledons. Proteomic and nontargeted metabolomic analysis of the mid-maturation β-carotene cotyledons compared to the nontransgenic did not reveal any significant differences that would account for the altered phenotypes of both elevated oleate and protein content. Transcriptomic analysis, confirmed by RT-PCR, revealed a number of significant differences in ABA-responsive transcripton factor gene expression in the crtB transgenics compared to nontransgenic cotyledons of the same maturation stage. The altered seed composition traits seem to be attributed to altered ABA hormone levels varying transcription factor expression. The elevated β-carotene, oleic acid and protein traits in the β-carotene soya beans confer a substantial additive nutritional quality to soya beans. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  13. Enhanced quantitative resistance against fungal disease by combinatorial expression of different barley antifungal proteins in transgenic tobacco

    DEFF Research Database (Denmark)

    Jach, G; Görnhardt, B; Mundy, J

    1995-01-01

    cDNAs encoding three proteins from barley (Hordeum vulgare), a class-II chitinase (CHI), a class-II beta-1,3-glucanase (GLU) and a Type-I ribosome-inactivating protein (RIP) were expressed in tobacco plants under the control of the CaMV 35S-promoter. High-level expression of the transferred genes...... was detected in the transgenic plants by Northern and Western blot analysis. The leader peptides in CHI and GLU led to accumulation of these proteins in the intercellular space of tobacco leaves. RIP, which is naturally deposited in the cytosol of barley endosperm cells, was expressed either in its original...... cytosolic form or fused to a plant secretion peptide (spRIP). Fungal infection assays revealed that expression of the individual genes in each case resulted in an increased protection against the soilborne fungal pathogen Rhizoctonia solani, which infects a range of plant species including tobacco...

  14. An endoplasmic reticulum-localized Coffea arabica BURP domain-containing protein affects the response of transgenic Arabidopsis plants to diverse abiotic stresses.

    Science.gov (United States)

    Dinh, Sy Nguyen; Kang, Hunseung

    2017-11-01

    The Coffea arabica BURP domain-containing gene plays an important role in the response of transgenic Arabidopsis plants to abiotic stresses via regulating the level of diverse proteins. Although the functions of plant-specific BURP domain-containing proteins (BDP) have been determined for a few plants, their roles in the growth, development, and stress responses of most plant species, including coffee plant (Coffea arabica), are largely unknown. In this study, the function of a C. arabica BDP, designated CaBDP1, was investigated in transgenic Arabidopsis plants. The expression of CaBDP1 was highly modulated in coffee plants subjected to drought, cold, salt, or ABA. Confocal analysis of CaBDP1-GFP fusion proteins revealed that CaBDP1 is localized in the endoplasmic reticulum. The ectopic expression of CaBDP1 in Arabidopsis resulted in delayed germination of the transgenic plants under abiotic stress and in the presence of ABA. Cotyledon greening and seedling growth of the transgenic plants were inhibited in the presence of ABA due to the upregulation of ABA signaling-related genes like ABI3, ABI4, and ABI5. Proteome analysis revealed that the levels of several proteins are modulated in CaBDP1-expressing transgenic plants. The results of this study underscore the importance of BURP domain proteins in plant responses to diverse abiotic stresses.

  15. Cloning of transgenic tobacco BY-2 cells; an efficient method to analyse and reduce high natural heterogeneity of transgene expression.

    Science.gov (United States)

    Nocarova, Eva; Fischer, Lukas

    2009-04-22

    Phenotypic characterization of transgenic cell lines, frequently used in plant biology studies, is complicated because transgene expression in individual cells is often heterogeneous and unstable. To identify the sources and to reduce this heterogeneity, we transformed tobacco (Nicotiana tabacum L.) BY-2 cells with a gene encoding green fluorescent protein (GFP) using Agrobacterium tumefaciens, and then introduced a simple cloning procedure to generate cell lines derived from the individual transformed cells. Expression of the transgene was monitored by analysing GFP fluorescence in the cloned lines and also in lines obtained directly after transformation. The majority ( approximately 90%) of suspension culture lines derived from calli that were obtained directly from transformation consisted of cells with various levels of GFP fluorescence. In contrast, nearly 50% of lines generated by cloning cells from the primary heterogeneous suspensions consisted of cells with homogenous GFP fluorescence. The rest of the lines exhibited "permanent heterogeneity" that could not be resolved by cloning. The extent of fluorescence heterogeneity often varied, even among genetically identical clones derived from the primary transformed lines. In contrast, the offspring of subsequent cloning of the cloned lines was uniform, showing GFP fluorescence intensity and heterogeneity that corresponded to the original clone. The results demonstrate that, besides genetic heterogeneity detected in some lines, the primary lines often contained a mixture of epigenetically different cells that could be separated by cloning. This indicates that a single integration event frequently results in various heritable expression patterns, which are probably accidental and become stabilized in the offspring of the primary transformed cells early after the integration event. Because heterogeneity in transgene expression has proven to be a serious problem, it is highly advisable to use transgenes tagged with

  16. Receptor-mediated oral delivery of a bioencapsulated green fluorescent protein expressed in transgenic chloroplasts into the mouse circulatory system.

    Science.gov (United States)

    Limaye, Arati; Koya, Vijay; Samsam, Mohtashem; Daniell, Henry

    2006-05-01

    Oral delivery of biopharmaceutical proteins expressed in plant cells should reduce their cost of production, purification, processing, cold storage, transportation, and delivery. However, poor intestinal absorption of intact proteins is a major challenge. To overcome this limitation, we investigate here the concept of receptor-mediated oral delivery of chloroplast-expressed foreign proteins. Therefore, the transmucosal carrier cholera toxin B-subunit and green fluorescent protein (CTB-GFP), separated by a furin cleavage site, was expressed via the tobacco chloroplast genome. Polymerase chain reaction (PCR) and Southern blot analyses confirmed site-specific transgene integration and homoplasmy. Immunoblot analysis and ELISA confirmed expression of monomeric and pentameric forms of CTB-GFP, up to 21.3% of total soluble proteins. An in vitro furin cleavage assay confirmed integrity of the engineered furin cleavage site, and a GM1 binding assay confirmed the functionality of CTB-GFP pentamers. Following oral administration of CTB-GFP expressing leaf material to mice, GFP was observed in the mice intestinal mucosa, liver, and spleen in fluorescence and immunohistochemical studies, while CTB remained in the intestinal cell. This report of receptor-mediated oral delivery of a foreign protein into the circulatory system opens the door for low-cost production and delivery of human therapeutic proteins.

  17. A transgenic Drosophila model demonstrates that the Helicobacter pylori CagA protein functions as a eukaryotic Gab adaptor.

    Directory of Open Access Journals (Sweden)

    Crystal M Botham

    2008-05-01

    Full Text Available Infection with the human gastric pathogen Helicobacter pylori is associated with a spectrum of diseases including gastritis, peptic ulcers, gastric adenocarcinoma, and gastric mucosa-associated lymphoid tissue lymphoma. The cytotoxin-associated gene A (CagA protein of H. pylori, which is translocated into host cells via a type IV secretion system, is a major risk factor for disease development. Experiments in gastric tissue culture cells have shown that once translocated, CagA activates the phosphatase SHP-2, which is a component of receptor tyrosine kinase (RTK pathways whose over-activation is associated with cancer formation. Based on CagA's ability to activate SHP-2, it has been proposed that CagA functions as a prokaryotic mimic of the eukaryotic Grb2-associated binder (Gab adaptor protein, which normally activates SHP-2. We have developed a transgenic Drosophila model to test this hypothesis by investigating whether CagA can function in a well-characterized Gab-dependent process: the specification of photoreceptors cells in the Drosophila eye. We demonstrate that CagA expression is sufficient to rescue photoreceptor development in the absence of the Drosophila Gab homologue, Daughter of Sevenless (DOS. Furthermore, CagA's ability to promote photoreceptor development requires the SHP-2 phosphatase Corkscrew (CSW. These results provide the first demonstration that CagA functions as a Gab protein within the tissue of an organism and provide insight into CagA's oncogenic potential. Since many translocated bacterial proteins target highly conserved eukaryotic cellular processes, such as the RTK signaling pathway, the transgenic Drosophila model should be of general use for testing the in vivo function of bacterial effector proteins and for identifying the host genes through which they function.

  18. Experimental sheep BSE prions generate the vCJD phenotype when serially passaged in transgenic mice expressing human prion protein.

    Science.gov (United States)

    Joiner, Susan; Asante, Emmanuel A; Linehan, Jacqueline M; Brock, Lara; Brandner, Sebastian; Bellworthy, Susan J; Simmons, Marion M; Hope, James; Collinge, John; Wadsworth, Jonathan D F

    2018-03-15

    The epizootic prion disease of cattle, bovine spongiform encephalopathy (BSE), causes variant Creutzfeldt-Jakob disease (vCJD) in humans following dietary exposure. While it is assumed that all cases of vCJD attributed to a dietary aetiology are related to cattle BSE, sheep and goats are susceptible to experimental oral challenge with cattle BSE prions and farmed animals in the UK were undoubtedly exposed to BSE-contaminated meat and bone meal during the late 1980s and early 1990s. Although no natural field cases of sheep BSE have been identified, it cannot be excluded that some BSE-infected sheep might have entered the European human food chain. Evaluation of the zoonotic potential of sheep BSE prions has been addressed by examining the transmission properties of experimental brain isolates in transgenic mice that express human prion protein, however to-date there have been relatively few studies. Here we report that serial passage of experimental sheep BSE prions in transgenic mice expressing human prion protein with methionine at residue 129 produces the vCJD phenotype that mirrors that seen when the same mice are challenged with vCJD prions from patient brain. These findings are congruent with those reported previously by another laboratory, and thereby strongly reinforce the view that sheep BSE prions could have acted as a causal agent of vCJD within Europe. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  19. Characterization of amyloid beta peptides from brain extracts of transgenic mice overexpressing the London mutant of human amyloid precursor protein.

    Science.gov (United States)

    Pype, Stefan; Moechars, Dieder; Dillen, Lieve; Mercken, Marc

    2003-02-01

    Alzheimer's disease (AD) is marked by the presence of neurofibrillary tangles and amyloid plaques in the brain of patients. To study plaque formation, we report on further quantitative and qualitative analysis of human and mouse amyloid beta peptides (Abeta) from brain extracts of transgenic mice overexpressing the London mutant of human amyloid precursor protein (APP). Using enzyme-linked immunosorbant assays (ELISAs) specific for either human or rodent Abeta, we found that the peptides from both species aggregated to form plaques. The ratios of deposited Abeta1-42/1-40 were in the order of 2-3 for human and 8-9 for mouse peptides, indicating preferential deposition of Abeta42. We also determined the identity and relative levels of other Abeta variants present in protein extracts from soluble and insoluble brain fractions. This was done by combined immunoprecipitation and mass spectrometry (IP/MS). The most prominent peptides truncated either at the carboxyl- or the amino-terminus were Abeta1-38 and Abeta11-42, respectively, and the latter was strongly enriched in the extracts of deposited peptides. Taken together, our data indicate that plaques of APP-London transgenic mice consist of aggregates of multiple human and mouse Abeta variants, and the human variants that we identified were previously detected in brain extracts of AD patients.

  20. Expression of a truncated receptor protein tyrosine phosphatase kappa in the brain of an adult transgenic mouse

    DEFF Research Database (Denmark)

    Shen, P; Canoll, P D; Sap, J

    1999-01-01

    processes such as axonal growth and target recognition, as has been demonstrated for certain Drosophila RPTPs. The brain distribution of RPTP-kappa-expressing cells has not been determined, however. In a gene-trap mouse model with a beta-gal+neo (beta-geo) insertion in the endogenous RPTP-kappa gene......-6596]. Nevertheless, since the transgene's expression is driven by the endogenous RPTP-kappa promoter, distribution of the truncated RPTP-kappa/beta-geo fusion protein should reflect the regional and cellular expression of wild-type RPTP-kappa, and thus may identify sites where RPTP-kappa is important. Towards...... that goal, we have used this mouse model to map the distribution of the truncated RPTP-kappa/beta-geo fusion protein in the adult mouse brain using beta-galactosidase as a marker enzyme. Visualization of the beta-galactosidase activity revealed a non-random pattern of expression, and identified cells...

  1. Effects of Soil Water Deficit on Insecticidal Protein Expression in Boll Shells of Transgenic Bt Cotton and the Mechanism

    Directory of Open Access Journals (Sweden)

    Xiang Zhang

    2017-12-01

    Full Text Available This study was conducted to investigate the effects of soil water deficit on insecticidal protein expression in boll shells of cotton transgenic for a Bt gene. In 2014, Bt cotton cultivars Sikang 1 (a conventional cultivar and Sikang 3 (a hybrid cultivar were planted in pots and five soil water content treatments were imposed at peak boll stage: 15% (G1, 35% (G2, 40% (G3, 60% (G4, and 75% field capacity (CK, respectively. Four treatments (G2, G3, G4, and CK were repeated in 2015 in the field. Results showed that the insecticidal protein content of boll shells decreased with increasing water deficit. Compared with CK, boll shell insecticidal protein content decreased significantly when soil water content was below 60% of maximum water holding capacity for Sikang 1 and Sikang 3. However, increased Bt gene expression was observed when boll shell insecticidal protein content was significantly reduced. Activity assays of key enzymes in nitrogen metabolism showed that boll shell protease and peptidase increased but nitrogen reductase and glutamic-pyruvic transaminase (GPT decreased. Insecticidal protein content exhibited significant positive correlation with nitrogen reductase and GPT activities; and significant negative correlation with protease and peptidase activities. These findings suggest that the decrease of insecticidal protein content associated with increasing water deficit was a net result of decreased synthesis and increased decomposition.

  2. Generation and phenotypic analysis of a transgenic line of rabbits secreting active recombinant human erythropoietin in the milk

    Czech Academy of Sciences Publication Activity Database

    Mikuš, Tomáš; Poplštein, M.; Sedláková, J.; Landa, Vladimír; Jeníková, Gabriela; Trefil, P.; Lidický, J.; Malý, Petr

    2004-01-01

    Roč. 13, č. 5 (2004), s. 487-498 ISSN 0962-8819 R&D Projects: GA ČR GA304/03/0090 Institutional research plan: CEZ:AV0Z5052915 Keywords : erythropoietin, mammary gland, transgenic rabbit Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.107, year: 2004

  3. A protein interaction map of the kalimantacin biosynthesis assembly line

    Directory of Open Access Journals (Sweden)

    Birgit Uytterhoeven

    2016-11-01

    Full Text Available The antimicrobial secondary metabolite kalimantacin is produced by a hybrid polyketide/ non-ribosomal peptide system in Pseudomonas fluorescens BCCM_ID9359. In this study, the kalimantacin biosynthesis gene cluster is analyzed by yeast two-hybrid analysis, creating a protein-protein interaction map of the entire assembly line. In total, 28 potential interactions were identified, of which 13 could be confirmed further. These interactions include the dimerization of ketosynthase domains, a link between assembly line modules 9 and 10, and a specific interaction between the trans-acting enoyl reductase BatK and the carrier proteins of modules 8 and 10. These interactions reveal fundamental insight into the biosynthesis of secondary metabolites.This study is the first to reveal interactions in a complete biosynthetic pathway. Similar future studies could build a strong basis for engineering strategies in such clusters.

  4. Very bright orange fluorescent plants: endoplasmic reticulum targeting of orange fluorescent proteins as visual reporters in transgenic plants

    Directory of Open Access Journals (Sweden)

    Mann David GJ

    2012-05-01

    Full Text Available Abstract Background The expression of fluorescent protein (FP genes as real-time visual markers, both transiently and stably, has revolutionized plant biotechnology. A palette of colors of FPs is now available for use, but the diversity has generally been underutilized in plant biotechnology. Because of the green and far-red autofluorescent properties of many plant tissues and the FPs themselves, red and orange FPs (RFPs, and OFPs, respectfully appear to be the colors with maximum utility in plant biotechnology. Within the color palette OFPs have emerged as the brightest FP markers in the visible spectra. This study compares several native, near-native and modified OFPs for their “brightness” and fluorescence, therefore, their usability as marker genes in transgenic plant tissues. Results The OFPs DsRed2, tdTomato, mOrange and pporRFP were all expressed under the control of the CaMV 35S promoter in agroinfiltration-mediated transient assays in Nicotiana benthamiana. Each of these, as well as endoplasmic reticulum (ER-targeted versions, were stably expressed in transgenic Nicotiana tabacum and Arabidopsis thaliana. Congruent results were observed between transient and stable assays. Our results demonstrated that there are several adequate OFP genes available for plant transformation, including the new pporRFP, an unaltered tetramer from the hard coral Porites porites. When the tandem dimer tdTomato and the monomeric mOrange were targeted to the ER, dramatic, ca. 3-fold, increase in plant fluorescence was observed. Conclusions From our empirical data, and a search of the literature, it appears that tdTomato-ER and mOrange-ER are the two highest fluorescing FPs available as reporters for transgenic plants. The pporRFP is a brightly fluorescing tetramer, but all tetramer FPs are far less bright than the ER-targeted monomers we report here.

  5. A Protein Aggregation Inhibitor, Leuco-Methylthioninium Bis(Hydromethanesulfonate, Decreases α-Synuclein Inclusions in a Transgenic Mouse Model of Synucleinopathy

    Directory of Open Access Journals (Sweden)

    Karima Schwab

    2018-01-01

    Full Text Available α-Synuclein (α-Syn aggregation is a pathological feature of synucleinopathies, neurodegenerative disorders that include Parkinson’s disease (PD. We have tested whether N,N,N′,N′-tetramethyl-10H-phenothiazine-3,7-diaminium bis(hydromethanesulfonate (leuco-methylthioninium bis(hydromethanesulfonate; LMTM, a tau aggregation inhibitor, affects α-Syn aggregation in vitro and in vivo. Both cellular and transgenic models in which the expression of full-length human α-Syn (h-α-Syn fused with a signal sequence peptide to promote α-Syn aggregation were used. Aggregated α-Syn was observed following differentiation of N1E-115 neuroblastoma cells transfected with h-α-Syn. The appearance of aggregated α-Syn was inhibited by LMTM, with an EC50 of 1.1 μM, with minimal effect on h-α-Syn mRNA levels being observed. Two independent lines of mice (L58 and L62 transgenic for the same fusion protein accumulated neuronal h-α-Syn that, with aging, developed into fibrillary inclusions characterized by both resistance to proteinase K (PK-cleavage and their ability to bind thiazin red. There was a significant decrease in α-Syn-positive neurons in multiple brain regions following oral treatment of male and female mice with LMTM administered daily for 6 weeks at 5 and 15 mg MT/kg. The early aggregates of α-Syn and the late-stage fibrillar inclusions were both susceptible to inhibition by LMTM, a treatment that also resulted in the rescue of movement and anxiety-related traits in these mice. The results suggest that LMTM may provide a potential disease modification therapy in PD and other synucleinopathies through the inhibition of α-Syn aggregation.

  6. Identification and characterization of proteins involved in nuclear organization using Drosophila GFP protein trap lines.

    Directory of Open Access Journals (Sweden)

    Margaret Rohrbaugh

    Full Text Available Strains from a collection of Drosophila GFP protein trap lines express GFP in the normal tissues where the endogenous protein is present. This collection can be used to screen for proteins distributed in the nucleus in a non-uniform pattern.We analyzed four lines that show peripheral or punctate nuclear staining. One of these lines affects an uncharacterized gene named CG11138. The CG11138 protein shows a punctate distribution in the nuclear periphery similar to that of Drosophila insulator proteins but does not co-localize with known insulators. Interestingly, mutations in Lamin proteins result in alterations in CG11138 localization, suggesting that this protein may be a novel component of the nuclear lamina. A second line affects the Decondensation factor 31 (Df31 gene, which encodes a protein with a unique nuclear distribution that appears to segment the nucleus into four different compartments. The X-chromosome of males is confined to one of these compartments. We also find that Drosophila Nucleoplasmin (dNlp is present in regions of active transcription. Heat shock leads to loss of dNlp from previously transcribed regions of polytene chromosome without redistribution to the heat shock genes. Analysis of Stonewall (Stwl, a protein previously found to be necessary for the maintenance of germline stem cells, shows that Stwl is present in a punctate pattern in the nucleus that partially overlaps with that of known insulator proteins. Finally we show that Stwl, dNlp, and Df31 form part of a highly interactive network. The properties of other components of this network may help understand the role of these proteins in nuclear biology.These results establish screening of GFP protein trap alleles as a strategy to identify factors with novel cellular functions. Information gained from the analysis of CG11138 Stwl, dNlp, and Df31 sets the stage for future studies of these proteins.

  7. Expression of the double-stranded RNA of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Tortricidae) ribosomal protein P0 gene enhances the resistance of transgenic soybean plants.

    Science.gov (United States)

    Meng, Fanli; Li, Yang; Zang, Zhenyuan; Li, Na; Ran, Ruixue; Cao, Yingxue; Li, Tianyu; Zhou, Quan; Li, Wenbin

    2017-12-01

    The soybean pod borer [SPB; Leguminivora glycinivorella (Matsumura) (Lepidoptera: Tortricidae)] is the most important soybean pest in northeastern Asia. Silencing genes using plant-mediated RNA-interference is a promising strategy for controlling SPB infestations. The ribosomal protein P0 is important for protein translation and DNA repair in the SPB. Thus, transferring P0 double-stranded RNA (dsRNA) into plants may help prevent SPB-induced damage. We investigated the effects of SpbP0 dsRNA injections and SpbP0 dsRNA-expressing transgenic soybean plants on the SPB. Larval mortality rates were greater for SpbP0 dsRNA-injected larvae (96%) than for the control larvae (31%) at 14 days after injections. Transgenic T 2 soybean plants expressing SpbP0 dsRNA sustained less damage from SPB larvae than control plants. In addition, the expression level of the SpbP0 gene decreased and the mortality rate increased when SPB larvae were fed on T 3 transgenic soybean pods. Moreover, the surviving larvae were deformed and exhibited inhibited growth. Silencing SpbP0 expression is lethal to the SPB. Transgenic soybean plants expressing SpbP0 dsRNA are more resistant to the SPB than wild-type plants. Thus, SpbP0 dsRNA-expressing transgenic plants may be useful for controlling insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  8. Overexpression of a flower-specific aerolysin-like protein from the dioecious plant Rumex acetosa alters flower development and induces male sterility in transgenic tobacco.

    Science.gov (United States)

    Manzano, Susana; Megías, Zoraida; Martínez, Cecilia; García, Alicia; Aguado, Encarnación; Chileh, Tarik; López-Alonso, Diego; García-Maroto, Federico; Kejnovský, Eduard; Široký, Jiří; Kubát, Zdeněk; Králová, Tereza; Vyskot, Boris; Jamilena, Manuel

    2017-01-01

    Sex determination in Rumex acetosa, a dioecious plant with a complex XY 1 Y 2 sex chromosome system (females are XX and males are XY 1 Y 2 ), is not controlled by an active Y chromosome but depends on the ratio between the number of X chromosomes and autosomes. To gain insight into the molecular mechanisms of sex determination, we generated a subtracted cDNA library enriched in genes specifically or predominantly expressed in female floral buds in early stages of development, when sex determination mechanisms come into play. In the present paper, we report the molecular and functional characterization of FEM32, a gene encoding a protein that shares a common architecture with proteins in different plants, animals, bacteria and fungi of the aerolysin superfamily; many of these function as β pore-forming toxins. The expression analysis, assessed by northern blot, RT-PCR and in situ hybridization, demonstrates that this gene is specifically expressed in flowers in both early and late stages of development, although its transcripts accumulate much more in female flowers than in male flowers. The ectopic expression of FEM32 under both the constitutive promoter 35S and the flower-specific promoter AP3 in transgenic tobacco showed no obvious alteration in vegetative development but was able to alter floral organ growth and pollen fertility. The 35S::FEM32 and AP3::FEM32 transgenic lines showed a reduction in stamen development and pollen viability, as well as a diminution in fruit set, fruit development and seed production. Compared with other floral organs, pistil development was, however, enhanced in plants overexpressing FEM32. According to these effects, it is likely that FEM32 functions in Rumex by arresting stamen and pollen development during female flower development. The aerolysin-like pore-forming proteins of eukaryotes are mainly involved in defence mechanisms against bacteria, fungi and insects and are also involved in apoptosis and programmed cell death (PCD

  9. Constitutive expression of a fungus-inducible carboxylesterase improves disease resistance in transgenic pepper plants.

    Science.gov (United States)

    Ko, Moonkyung; Cho, Jung Hyun; Seo, Hyo-Hyoun; Lee, Hyun-Hwa; Kang, Ha-Young; Nguyen, Thai Son; Soh, Hyun Cheol; Kim, Young Soon; Kim, Jeong-Il

    2016-08-01

    Resistance against anthracnose fungi was enhanced in transgenic pepper plants that accumulated high levels of a carboxylesterase, PepEST in anthracnose-susceptible fruits, with a concurrent induction of antioxidant enzymes and SA-dependent PR proteins. A pepper esterase gene (PepEST) is highly expressed during the incompatible interaction between ripe fruits of pepper (Capsicum annuum L.) and a hemibiotrophic anthracnose fungus (Colletotrichum gloeosporioides). In this study, we found that exogenous application of recombinant PepEST protein on the surface of the unripe pepper fruits led to a potentiated state for disease resistance in the fruits, including generation of hydrogen peroxide and expression of pathogenesis-related (PR) genes that encode mostly small proteins with antimicrobial activity. To elucidate the role of PepEST in plant defense, we further developed transgenic pepper plants overexpressing PepEST under the control of CaMV 35S promoter. Molecular analysis confirmed the establishment of three independent transgenic lines carrying single copy of transgenes. The level of PepEST protein was estimated to be approximately 0.002 % of total soluble protein in transgenic fruits. In response to the anthracnose fungus, the transgenic fruits displayed higher expression of PR genes, PR3, PR5, PR10, and PepThi, than non-transgenic control fruits did. Moreover, immunolocalization results showed concurrent localization of ascorbate peroxidase (APX) and PR3 proteins, along with the PepEST protein, in the infected region of transgenic fruits. Disease rate analysis revealed significantly low occurrence of anthracnose disease in the transgenic fruits, approximately 30 % of that in non-transgenic fruits. Furthermore, the transgenic plants also exhibited resistance against C. acutatum and C. coccodes. Collectively, our results suggest that overexpression of PepEST in pepper confers enhanced resistance against the anthracnose fungi by activating the defense signaling

  10. Primary transmission of chronic wasting disease versus scrapie prions from small ruminants to transgenic mice expressing ovine and cervid prion protein

    Science.gov (United States)

    Identifying transmissible spongiform encephalopathy (TSE) reservoirs that could lead to disease re-emergence is imperative to U.S. scrapie eradication efforts. Transgenic mice expressing the cervid (TgElk) or ovine (Tg338) prion protein have aided characterization of chronic wasting disease (CWD) an...

  11. Sterol regulatory element binding protein 2 overexpression is associated with reduced adipogenesis and ectopic fat accumulation in transgenic spontaneously hypertensive rats

    Czech Academy of Sciences Publication Activity Database

    Landa, Vladimír; Zídek, Václav; Mlejnek, Petr; Šimáková, Miroslava; Šilhavý, Jan; Trnovská, J.; Kazdová, L.; Pravenec, Michal

    2014-01-01

    Roč. 63, č. 5 (2014), s. 587-590 ISSN 0862-8408 R&D Projects: GA MŠk(CZ) LH12061 Institutional support: RVO:67985823 Keywords : sterol regulatory element binding protein 2 * transgenic * spontaneously hypertensive rat * lipid metabolism Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.293, year: 2014

  12. A novel cold-inducible zinc finger protein from soybean, SCOF-1, enhances cold tolerance in transgenic plants.

    Science.gov (United States)

    Kim, J C; Lee, S H; Cheong, Y H; Yoo, C M; Lee, S I; Chun, H J; Yun, D J; Hong, J C; Lee, S Y; Lim, C O; Cho, M J

    2001-02-01

    Cold stress on plants induces changes in the transcription of cold response genes. A cDNA clone encoding C2H2-type zinc finger protein, SCOF-1, was isolated from soybean. The transcription of SCOF-1 is specifically induced by low temperature and abscisic acid (ABA) but not by dehydration or high salinity. Constitutive overexpression of SCOF-1 induced cold-regulated (COR) gene expression and enhanced cold tolerance of non-acclimated transgenic Arabidopsis and tobacco plants. SCOF-1 localized to the nucleus but did not bind directly to either C-repeat/dehydration (CRT/DRE) or ABA responsive element (ABRE), cis-acting DNA regulatory elements present in COR gene promoters. However, SCOF-1 greatly enhanced the DNA binding activity of SGBF-1, a soybean G-box binding bZIP transcription factor, to ABRE in vitro. SCOF-1 also interacted with SGBF-1 in a yeast two-hybrid system. The SGBF-1 transactivated the beta-glucuronidase reporter gene driven by the ABRE element in Arabidopsis leaf protoplasts. Furthermore, the SCOF-1 enhanced ABRE-dependent gene expression mediated by SGBF-1. These results suggest that SCOF-1 may function as a positive regulator of COR gene expression mediated by ABRE via protein-protein interaction, which in turn enhances cold tolerance of plants.

  13. Generation of mRx-Cre Transgenic Mouse Line for Efficient Conditional Gene Deletion in Early Retinal Progenitors

    Czech Academy of Sciences Publication Activity Database

    Klímová, Lucie; Láchová, Jitka; Machoň, Ondřej; Sedláček, Radislav; Kozmik, Zbyněk

    2013-01-01

    Roč. 8, č. 5 (2013), e63029 E-ISSN 1932-6203 R&D Projects: GA ČR GAP305/11/2198; GA MŠk(CZ) LK11214; GA MŠk(CZ) LM2011032; GA ČR GAP305/10/2143; GA MŠk ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : eye development * lens * retina * transgenic mice Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013

  14. Field-Evolved Resistance in Corn Earworm to Cry Proteins Expressed by Transgenic Sweet Corn

    Science.gov (United States)

    Dively, Galen P.; Finkenbinder, Chad

    2016-01-01

    Background Transgenic corn engineered with genes expressing insecticidal toxins from the bacterium Bacillus thuringiensis (Berliner) (Bt) are now a major tool in insect pest management. With its widespread use, insect resistance is a major threat to the sustainability of the Bt transgenic technology. For all Bt corn expressing Cry toxins, the high dose requirement for resistance management is not achieved for corn earworm, Helicoverpa zea (Boddie), which is more tolerant to the Bt toxins. Methodology/Major Findings We present field monitoring data using Cry1Ab (1996–2016) and Cry1A.105+Cry2Ab2 (2010–2016) expressing sweet corn hybrids as in-field screens to measure changes in field efficacy and Cry toxin susceptibility to H. zea. Larvae successfully damaged an increasing proportion of ears, consumed more kernel area, and reached later developmental stages (4th - 6th instars) in both types of Bt hybrids (Cry1Ab—event Bt11, and Cry1A.105+Cry2Ab2—event MON89034) since their commercial introduction. Yearly patterns of H. zea population abundance were unrelated to reductions in control efficacy. There was no evidence of field efficacy or tissue toxicity differences among different Cry1Ab hybrids that could contribute to the decline in control efficacy. Supportive data from laboratory bioassays demonstrate significant differences in weight gain and fitness characteristics between the Maryland H. zea strain and a susceptible strain. In bioassays with Cry1Ab expressing green leaf tissue, Maryland H. zea strain gained more weight than the susceptible strain at all concentrations tested. Fitness of the Maryland H. zea strain was significantly lower than that of the susceptible strain as indicated by lower hatch rate, longer time to adult eclosion, lower pupal weight, and reduced survival to adulthood. Conclusions/Significance After ruling out possible contributing factors, the rapid change in field efficacy in recent years and decreased susceptibility of H. zea to Bt

  15. Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus.

    Science.gov (United States)

    Le, Dung Tien; Chu, Ha Duc; Sasaya, Takahide

    2015-01-01

    Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virus-resistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV.

  16. Use of Green Fluorescent Protein-Transgenic Strains to Study Pathogenic and Nonpathogenic Lifestyles in Colletotrichum acutatum.

    Science.gov (United States)

    Horowitz, Sigal; Freeman, Stanley; Sharon, Amir

    2002-07-01

    ABSTRACT Colletotrichum acutatum, which causes anthracnose disease on strawberry, can also persist on several other plant species without causing disease symptoms. The genetic and molecular bases that determine pathogenic and nonpathogenic lifestyles in C. acutatum are unclear. We developed a transformation system for C. acutatum by electroporation of germinating conidia, and transgenic isolates that express the green fluorescent protein (GFP) were produced. Details of the pathogenic and nonpathogenic lifestyles of C. acutatum were determined by using GFP-transgenic isolates. Major differences between colonization-mediating processes of strawberry and of other plants were observed. On the main host, strawberry, the germinating conidia formed branched, thick hyphae, and large numbers of appressoria were produced that were essential for plant penetration. In strawberry, the fungus developed rapidly, filling the mesophyll with dense mycelium that invaded the cells and caused necrosis of the tissue. In nonpathogenic interactions on pepper, eggplant, and tomato, the conidia germinated, producing thin, straight germ tubes. Appressoria were produced but failed to germinate and penetrate leaf tissue, resulting in epiphytic growth without invasion of the plant. Penetration of the plant occurred only several days after inoculation and was restricted to the intercellular spaces of the first cell layers of infected tissue without causing any visible damage. Much of the new fungal biomass continued to develop on the surface of inoculated organs in the nonpathogenic interaction. The differences in fungal development on strawberry compared with the other plant species suggest that signal molecules, which may be present only in strawberry, trigger appressorial germination and penetration of the primary host.

  17. Degradation and detection of transgenic Bacillus thuringiensis DNA and proteins in flour of three genetically modified rice events submitted to a set of thermal processes.

    Science.gov (United States)

    Wang, Xiaofu; Chen, Xiaoyun; Xu, Junfeng; Dai, Chen; Shen, Wenbiao

    2015-10-01

    This study aimed to investigate the degradation of three transgenic Bacillus thuringiensis (Bt) genes (Cry1Ab, Cry1Ac, and Cry1Ab/Ac) and the corresponding encoded Bt proteins in KMD1, KF6, and TT51-1 rice powder, respectively, following autoclaving, cooking, baking, or microwaving. Exogenous Bt genes were more stable than the endogenous sucrose phosphate synthase (SPS) gene, and short DNA fragments were detected more frequently than long DNA fragments in both the Bt and SPS genes. Autoclaving, cooking (boiling in water, 30 min), and baking (200 °C, 30 min) induced the most severe Bt protein degradation effects, and Cry1Ab protein was more stable than Cry1Ac and Cry1Ab/Ac protein, which was further confirmed by baking samples at 180 °C for different periods of time. Microwaving induced mild degradation of the Bt and SPS genes, and Bt proteins, whereas baking (180 °C, 15 min), cooking and autoclaving led to further degradation, and baking (200 °C, 30 min) induced the most severe degradation. The findings of the study indicated that degradation of the Bt genes and proteins somewhat correlated with the treatment intensity. Polymerase chain reaction, enzyme-linked immunosorbent assay, and lateral flow tests were used to detect the corresponding transgenic components. Strategies for detecting transgenic ingredients in highly processed foods are discussed. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Novel Strategy to Control Transgene Expression Mediated by a Sendai Virus-Based Vector Using a Nonstructural C Protein and Endogenous MicroRNAs.

    Directory of Open Access Journals (Sweden)

    Masayuki Sano

    Full Text Available Tissue-specific control of gene expression is an invaluable tool for studying various biological processes and medical applications. Efficient regulatory systems have been utilized to control transgene expression in various types of DNA viral or integrating viral vectors. However, existing regulatory systems are difficult to transfer into negative-strand RNA virus vector platforms because of significant differences in their transcriptional machineries. In this study, we developed a novel strategy for regulating transgene expression mediated by a cytoplasmic RNA vector based on a replication-defective and persistent Sendai virus (SeVdp. Because of the capacity of Sendai virus (SeV nonstructural C proteins to specifically inhibit viral RNA synthesis, overexpression of C protein significantly reduced transgene expression mediated by SeVdp vectors. We found that SeV C overexpression concomitantly reduced SeVdp mRNA levels and genomic RNA synthesis. To control C expression, target sequences for an endogenous microRNA were incorporated into the 3' untranslated region of the C genes. Incorporation of target sequences for miR-21 into the SeVdp vector restored transgene expression in HeLa cells by decreasing C expression. Furthermore, the SeVdp vector containing target sequences for let-7a enabled cell-specific control of transgene expression in human fibroblasts and induced pluripotent stem cells. Our findings demonstrate that SeV C can be used as an effective regulator for controlling transgene expression. This strategy will contribute to efficient and less toxic SeVdp-mediated gene transfer in various biological applications.

  19. Enhanced Salt Tolerance Conferred by the Complete 2.3 kb cDNA of the Rice Vacuolar Na(+)/H(+) Antiporter Gene Compared to 1.9 kb Coding Region with 5' UTR in Transgenic Lines of Rice.

    Science.gov (United States)

    Amin, U S M; Biswas, Sudip; Elias, Sabrina M; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I

    2016-01-01

    Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na(+)/H(+) antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5' UTR with CDS and the other of 2.3 kb, including 5' UTR, CDS, and the 3' UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5' and 3' UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3' UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance.

  20. Generation of Pet1210-Cre Transgenic Mouse Line Reveals Non-Serotonergic Expression Domains of Pet1 Both in CNS and Periphery

    Science.gov (United States)

    Pelosi, Barbara; Migliarini, Sara; Pacini, Giulia; Pratelli, Marta; Pasqualetti, Massimo

    2014-01-01

    Neurons producing serotonin (5-hydroxytryptamine, 5-HT) constitute one of the most widely distributed neuronal networks in the mammalian central nervous system (CNS) and exhibit a profuse innervation throughout the CNS already at early stages of development. Serotonergic neuron specification is controlled by a combination of secreted molecules and transcription factors such as Shh, Fgf4/8, Nkx2.2, Lmx1b and Pet1. In the mouse, Pet1 mRNA expression appears between 10 and 11 days post coitum (dpc) in serotonergic post-mitotic precursors and persists in serotonergic neurons up to adulthood, where it promotes the expression of genes defining the mature serotonergic phenotype such as tryptophan hydroxylase 2 (Tph2) and serotonin transporter (SERT). Hence, the generation of genetic tools based on Pet1 specific expression represents a valuable approach to study the development and function of the serotonergic system. Here, we report the generation of a Pet1210-Cre transgenic mouse line in which the Cre recombinase is expressed under the control of a 210 kb fragment from the Pet1 genetic locus to ensure a reliable and faithful control of somatic recombination in Pet1 cell lineage. Besides Cre-mediated recombination accurately occurred in the serotonergic system as expected and according to previous studies, Pet1210-Cre transgenic mouse line allowed us to identify novel, so far uncharacterized, Pet1 expression domains. Indeed, we showed that in the raphe Pet1 is expressed also in a non-serotonergic neuronal population intermingled with Tph2-expressing cells and mostly localized in the B8 and B9 nuclei. Moreover, we detected Cre-mediated recombination also in the developing pancreas and in the ureteric bud derivatives of the kidney, where it reflected a specific Pet1 expression. Thus, Pet1210-Cre transgenic mouse line faithfully drives Cre-mediated recombination in all Pet1 expression domains representing a valuable tool to genetically manipulate serotonergic and non

  1. Increased tolerance to two oomycete pathogens in transgenic tobacco expressing pathogenesis-related protein 1a.

    OpenAIRE

    Alexander, D; Goodman, R M; Gut-Rella, M; Glascock, C; Weymann, K; Friedrich, L; Maddox, D; Ahl-Goy, P; Luntz, T; Ward, E

    1993-01-01

    Expression of pathogenesis-related protein 1a (PR-1a), a protein of unknown biochemical function, is induced to high levels in tobacco in response to pathogen infection. The induction of PR-1a expression is tightly correlated with the onset of systemic acquired resistance (SAR), a defense response effective against a variety of fungal, viral, and bacterial pathogens. While PR-1a has been postulated to be involved in SAR, and is the most highly expressed of the PR proteins, evidence for its ro...

  2. Intercellular production of tamavidin 1, a biotin-binding protein from Tamogitake mushroom, confers resistance to the blast fungus Magnaporthe oryzae in transgenic rice.

    Science.gov (United States)

    Takakura, Yoshimitsu; Oka, Naomi; Suzuki, Junko; Tsukamoto, Hiroshi; Ishida, Yuji

    2012-05-01

    The blast fungus Magnaporthe oryzae, one of the most devastating rice pathogens in the world, shows biotin-dependent growth. We have developed a strategy for creating disease resistance to M. oryzae whereby intercellular production of tamavidin 1, a biotin-binding protein from Pleurotus cornucopiae occurs in transgenic rice plants. The gene that encodes tamavidin 1, fused to the sequence for a secretion signal peptide derived from rice chitinase gene, was connected to the Cauliflower mosaic virus 35S promoter, and the resultant construct was introduced into rice. The tamavidin 1 was accumulated at levels of 0.1-0.2% of total soluble leaf proteins in the transgenic rice and it was localized in the intercellular space of rice leaves. The tamavidin 1 purified from the transgenic rice was active, it bound to biotin and inhibited in vitro growth of M. oryzae by causing biotin deficiency. The transgenic rice plants showed a significant resistance to M. oryzae. This study shows the possibility of a new strategy to engineer disease resistance in higher plants by taking advantage of a pathogen's auxotrophy.

  3. Overexpression of host plant urease in transgenic silkworms.

    Science.gov (United States)

    Jiang, Liang; Huang, Chunlin; Sun, Qiang; Guo, Huizhen; Peng, Zhengwen; Dang, Yinghui; Liu, Weiqiang; Xing, Dongxu; Xu, Guowen; Zhao, Ping; Xia, Qingyou

    2015-06-01

    Bombyx mori and mulberry constitute a model of insect-host plant interactions. Urease hydrolyzes urea to ammonia and is important for the nitrogen metabolism of silkworms because ammonia is assimilated into silk protein. Silkworms do not synthesize urease and acquire it from mulberry leaves. We synthesized the artificial DNA sequence ureas using the codon bias of B. mori to encode the signal peptide and mulberry urease protein. A transgenic vector that overexpresses ure-as under control of the silkworm midgut-specific P2 promoter was constructed. Transgenic silkworms were created via embryo microinjection. RT-PCR results showed that urease was expressed during the larval stage and qPCR revealed the expression only in the midgut of transgenic lines. Urea concentration in the midgut and hemolymph of transgenic silkworms was significantly lower than in a nontransgenic line when silkworms were fed an artificial diet. Analysis of the daily body weight and food conversion efficiency of the fourth and fifth instar larvae and economic characteristics indicated no differences between transgenic silkworms and the nontransgenic line. These results suggested that overexpression of host plant urease promoted nitrogen metabolism in silkworms.

  4. Chronic administration of R-flurbiprofen attenuates learning impairments in transgenic amyloid precursor protein mice

    Science.gov (United States)

    Kukar, Thomas; Prescott, Sonya; Eriksen, Jason L; Holloway, Vallie; Murphy, M Paul; Koo, Edward H; Golde, Todd E; Nicolle, Michelle M

    2007-01-01

    ability to selectively target Aβ42 production and improve cognitive impairments in transgenic APP mice, as well as promising data from a phase 2 human clinical trial, future studies are needed to investigate the utility of R-flurbiprofen as an AD therapeutic and its possible mechanisms of action. PMID:17650315

  5. Chronic administration of R-flurbiprofen attenuates learning impairments in transgenic amyloid precursor protein mice

    Directory of Open Access Journals (Sweden)

    Koo Edward H

    2007-07-01

    in Tg2576 mice. Given its ability to selectively target Aβ42 production and improve cognitive impairments in transgenic APP mice, as well as promising data from a phase 2 human clinical trial, future studies are needed to investigate the utility of R-flurbiprofen as an AD therapeutic and its possible mechanisms of action.

  6. Production of transgenic brassica juncea with the synthetic chitinase gene (nic) conferring resistance to alternaria brassicicola

    International Nuclear Information System (INIS)

    Munir, I.; Hussan, W.; Kazi, M.; Mian, A.

    2016-01-01

    Brassica juncea is an important oil seed crop throughout the world. The demand and cultivation of oil seed crops has gained importance due to rapid increase in world population and industrialization. Fungal diseases pose a great threat to Brassica productivity worldwide. Absence of resistance genes against fungal infection within crossable germplasms of this crop necessitates deployment of genetic engineering approaches to produce transgenic plants with resistance against fungal infections. In the current study, hypocotyls and cotyledons of Brassica juncea, used as explants, were transformed with Agrobacterium tumefacien strain EHA101 harboring binary vector pEKB/NIC containing synthetic chitinase gene (NIC), an antifungal gene under the control of cauliflower mosaic virus promoter (CaMV35S). Bar genes and nptII gene were used as selectable markers. Presence of chitinase gene in trangenic lines was confirmed by PCR and southern blotting analysis. Effect of the extracted proteins from non-transgenic and transgenic lines was observed on the growth of Alternaria brassicicola, a common disease causing pathogen in brassica crop. In comparison to non-transgenic control lines, the leaf tissue extracts of the transgenic lines showed considerable resistance and antifungal activity against A. brassicicola. The antifungal activity in transgenic lines was observed as corresponding to the transgene copy number. (author)

  7. Development of transgenic wheat (Triticum aestivum L.) expressing avidin gene conferring resistance to stored product insects.

    Science.gov (United States)

    Abouseadaa, Heba H; Osman, Gamal H; Ramadan, Ahmed M; Hassanein, Sameh E; Abdelsattar, Mohamed T; Morsy, Yasser B; Alameldin, Hussien F; El-Ghareeb, Doaa K; Nour-Eldin, Hanan A; Salem, Reda; Gad, Adel A; Elkhodary, Soheir E; Shehata, Maher M; Mahfouz, Hala M; Eissa, Hala F; Bahieldin, Ahmed

    2015-07-22

    Wheat is considered the most important cereal crop all over the world. The wheat weevil Sitophilus granarius is a serious insect pests in much of the wheat growing area worldwide and is responsible for significant loss of yield. Avidin proteins has been proposed to function as plant defense agents against insect pests. A synthetic avidin gene was introduced into spring wheat (Triticum aestivum L.) cv. Giza 168 using a biolistic bombardment protocol. The presence and expression of the transgene in six selected T0 transgenic wheat lines were confirmed at the molecular level. Accumulation of avidin protein was detected in transgenic plants compared to non-transgenic plants. Avidin transgene was stably integrated, transcribed and translated as indicated by Southern blot, ELISA, and dot blot analyses, with a high level of expression in transgenic wheat seeds. However, no expression was detected in untransformed wheat seeds. Functional integrity of avidin was confirmed by insect bioassay. The results of bioassay using transgenic wheat plants challenged with wheat weevil revealed 100 % mortality of the insects reared on transgenic plants after 21 days. Transgenic wheat plants had improved resistance to Sitophilus granarius.

  8. Transgenic expression of an unedited mitochondrial orfB gene product from wild abortive (WA) cytoplasm of rice (Oryza sativa L.) generates male sterility in fertile rice lines.

    Science.gov (United States)

    Chakraborty, Anirban; Mitra, Joy; Bhattacharyya, Jagannath; Pradhan, Subrata; Sikdar, Narattam; Das, Srirupa; Chakraborty, Saikat; Kumar, Sachin; Lakhanpaul, Suman; Sen, Soumitra K

    2015-06-01

    Over-expression of the unedited mitochondrial orfB gene product generates male sterility in fertile indica rice lines in a dose-dependent manner. Cytoplasmic male sterility (CMS) and nuclear-controlled fertility restoration are widespread developmental features in plant reproductive systems. In self-pollinated crop plants, these processes often provide useful tools to exploit hybrid vigour. The wild abortive CMS has been employed in the majority of the "three-line" hybrid rice production since 1970s. In the present study, we provide experimental evidence for a positive functional relationship between the 1.1-kb unedited orfB gene transcript, and its translated product in the mitochondria with male sterility. The generation of the 1.1-kb unedited orfB gene transcripts increased during flowering, resulting in low ATP synthase activity in sterile plants. Following insertion of the unedited orfB gene into the genome of male-fertile plants, the plants became male sterile in a dose-dependent manner with concomitant reduction of ATPase activity of F1F0-ATP synthase (complex V). Fertility of the transgenic lines and normal activity of ATP synthase were restored by down-regulation of the unedited orfB gene expression through RNAi-mediated silencing. The genetic elements deciphered in this study could further be tested for their use in hybrid rice development.

  9. Development of ELISA for the detection of transgenic vegetative insecticidal protein in GM crops/produce.

    Science.gov (United States)

    Kumar, R

    2012-01-11

    In the process of the development of insect-resistant genetically modified (GM) crops and also to evaluate the consistency in the expression of toxin under field conditions, immunological assays are commonly being used. An immunoassay was developed to support the labelling of vegetative insecticidal protein (Vip3A)-based GM produce. The developed ELISA for the measurement of Vip3A is a triple antibody sandwich procedure utilising a polyclonal capture antibody (mouse anti-Vip3A) and a polyclonal detection antibody (rabbit anti-Vip3A) followed by use of a third HRP-conjugated anti-species antibody (goat anti-rabbit IgG). The limit of detection limit of the ELISA assay was 16 ng ml(-1) with a linear quantification range from approximately 31 to 500 ng ml(-1) of Vip3A protein. Furthermore, the assay was in-house validated with GM brinjal samples. The assay was specific, sensitive and reproducible, which can be helpful to detect and track down the spread of unapproved and intentionally/unintentionally released GM produce harbouring Vip protein.

  10. Overexpression of Cholesteryl Ester Transfer Protein Increases Macrophage-Derived Foam Cell Accumulation in Atherosclerotic Lesions of Transgenic Rabbits

    Directory of Open Access Journals (Sweden)

    Shoucui Gao

    2017-01-01

    Full Text Available High levels of plasma high-density lipoprotein-cholesterol (HDL-C are inversely associated with the risk of atherosclerosis and other cardiovascular diseases; thus, pharmacological inhibition of cholesteryl ester transfer protein (CETP is considered to be a therapeutic method of raising HDL-C levels. However, many CETP inhibitors have failed to achieve a clinical benefit despite raising HDL-C. In the study, we generated transgenic (Tg rabbits that overexpressed the human CETP gene to examine the influence of CETP on the development of atherosclerosis. Both Tg rabbits and their non-Tg littermates were fed a high cholesterol diet for 16 weeks. Plasma lipids and body weight were measured every 4 weeks. Gross lesion areas of the aortic atherosclerosis along with lesional cellular components were quantitatively analyzed. Overexpression of human CETP did not significantly alter the gross atherosclerotic lesion area, but the number of macrophages in lesions was significantly increased. Overexpression of human CETP did not change the plasma levels of total cholesterol or low-density lipoprotein cholesterol but lowered plasma HDL-C and increased triglycerides. These data revealed that human CETP may play an important role in the development of atherosclerosis mainly by decreasing HDL-C levels and increasing the accumulation of macrophage-derived foam cells.

  11. Spontaneous generation of rapidly transmissible prions in transgenic mice expressing wild-type bank vole prion protein.

    Science.gov (United States)

    Watts, Joel C; Giles, Kurt; Stöhr, Jan; Oehler, Abby; Bhardwaj, Sumita; Grillo, Sunny K; Patel, Smita; DeArmond, Stephen J; Prusiner, Stanley B

    2012-02-28

    Currently, there are no animal models of the most common human prion disorder, sporadic Creutzfeldt-Jakob disease (CJD), in which prions are formed spontaneously from wild-type (WT) prion protein (PrP). Interestingly, bank voles (BV) exhibit an unprecedented promiscuity for diverse prion isolates, arguing that bank vole PrP (BVPrP) may be inherently prone to adopting misfolded conformations. Therefore, we constructed transgenic (Tg) mice expressing WT BVPrP. Tg(BVPrP) mice developed spontaneous CNS dysfunction between 108 and 340 d of age and recapitulated the hallmarks of prion disease, including spongiform degeneration, pronounced astrogliosis, and deposition of alternatively folded PrP in the brain. Brain homogenates of ill Tg(BVPrP) mice transmitted disease to Tg(BVPrP) mice in ∼35 d, to Tg mice overexpressing mouse PrP in under 100 d, and to WT mice in ∼185 d. Our studies demonstrate experimentally that WT PrP can spontaneously form infectious prions in vivo. Thus, Tg(BVPrP) mice may be useful for studying the spontaneous formation of prions, and thus may provide insight into the etiology of sporadic CJD.

  12. Expression of the neuronal adaptor protein X11alpha protects against memory dysfunction in a transgenic mouse model of Alzheimer's disease.

    LENUS (Irish Health Repository)

    Mitchell, Jacqueline C

    2010-01-01

    X11alpha is a neuronal-specific adaptor protein that binds to the amyloid-beta protein precursor (AbetaPP). Overexpression of X11alpha reduces Abeta production but whether X11alpha also protects against Abeta-related memory dysfunction is not known. To test this possibility, we crossed X11alpha transgenic mice with AbetaPP-Tg2576 mice. AbetaPP-Tg2576 mice produce high levels of brain Abeta and develop age-related defects in memory function that correlate with increasing Abeta load. Overexpression of X11alpha alone had no detectable adverse effect upon behavior. However, X11alpha reduced brain Abeta levels and corrected spatial reference memory defects in aged X11alpha\\/AbetaPP double transgenics. Thus, X11alpha may be a therapeutic target for Alzheimer\\'s disease.

  13. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor.

    Science.gov (United States)

    Dong, Shanshan; Liu, Yan; Yu, Cigang; Zhang, Zhenhua; Chen, Ming; Wang, Changyong

    2016-01-01

    Pollen-mediated gene flow (PMGF) is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV) as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow.

  14. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor.

    Directory of Open Access Journals (Sweden)

    Shanshan Dong

    Full Text Available Pollen-mediated gene flow (PMGF is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow.

  15. Wheat CBL-interacting protein kinase 25 negatively regulates salt tolerance in transgenic wheat

    OpenAIRE

    Jin, Xia; Sun, Tao; Wang, Xiatian; Su, Peipei; Ma, Jingfei; He, Guangyuan; Yang, Guangxiao

    2016-01-01

    CBL-interacting protein kinases are involved in plant responses to abiotic stresses, including salt stress. However, the negative regulating mechanism of this gene family in response to salinity is less reported. In this study, we evaluated the role of TaCIPK25 in regulating salt response in wheat. Under conditions of high salinity, TaCIPK25 expression was markedly down-regulated in roots. Overexpression of TaCIPK25 resulted in hypersensitivity to Na+ and superfluous accumulation of Na+ in tr...

  16. Biological activity of Bt proteins expressed in different structures of transgenic corn against Spodoptera frugiperda

    Directory of Open Access Journals (Sweden)

    Daniel Bernardi

    2016-06-01

    Full Text Available ABSTRACT: Spodoptera frugiperda (J. E. Smith is the main target pest of Bt corn technologies, such as YieldGard VT PRO(tm (Cry1A.105/Cry2Ab2 and PowerCore(tm (Cry1A.105/Cry2Ab2/Cry1F. In this study, it was evaluated the biological activity of Bt proteins expressed in different plant structures of YieldGard VT PRO(tm and PowerCore(tm corn against S. frugiperda . Complete mortality of S. frugiperda neonates was observed on leaf-disc of both Bt corn technologies. However, the mortality in silks and grains was lower than 50 and 6%, respectively. In addition, more than 49% of the surviving larvae in silks and grains completed the biological cycle. However, all life table parameters were negatively affected in insects that developed in silks and grains of both Bt corn events. In summary, the low biological activity of Bt proteins expressed on silks and grains of YieldGard VT PRO(tm and PowerCore(tm corn can contribute to the resistance evolution in S. frugiperda populations.

  17. Compromised mitochondrial fatty acid synthesis in transgenic mice results in defective protein lipoylation and energy disequilibrium.

    Directory of Open Access Journals (Sweden)

    Stuart Smith

    Full Text Available A mouse model with compromised mitochondrial fatty acid synthesis has been engineered in order to assess the role of this pathway in mitochondrial function and overall health. Reduction in the expression of mitochondrial malonyl CoA-acyl carrier protein transacylase, a key enzyme in the pathway encoded by the nuclear Mcat gene, was achieved to varying extents in all examined tissues employing tamoxifen-inducible Cre-lox technology. Although affected mice consumed more food than control animals, they failed to gain weight, were less physically active, suffered from loss of white adipose tissue, reduced muscle strength, kyphosis, alopecia, hypothermia and shortened lifespan. The Mcat-deficient phenotype is attributed primarily to reduced synthesis, in several tissues, of the octanoyl precursors required for the posttranslational lipoylation of pyruvate and α-ketoglutarate dehydrogenase complexes, resulting in diminished capacity of the citric acid cycle and disruption of energy metabolism. The presence of an alternative lipoylation pathway that utilizes exogenous free lipoate appears restricted to liver and alone is insufficient for preservation of normal energy metabolism. Thus, de novo synthesis of precursors for the protein lipoylation pathway plays a vital role in maintenance of mitochondrial function and overall vigor.

  18. Epigenetic control of mammalian LINE-1 retrotransposon by retinoblastoma proteins

    International Nuclear Information System (INIS)

    Montoya-Durango, Diego E.; Liu, Yongqing; Teneng, Ivo; Kalbfleisch, Ted; Lacy, Mary E.; Steffen, Marlene C.; Ramos, Kenneth S.

    2009-01-01

    Long interspersed nuclear elements (LINEs or L1 elements) are targeted for epigenetic silencing during early embryonic development and remain inactive in most cells and tissues. Here we show that E2F-Rb family complexes participate in L1 elements epigenetic regulation via nucleosomal histone modifications and recruitment of histone deacetylases (HDACs) HDAC1 and HDAC2. Our experiments demonstrated that (i) Rb and E2F interact with human and mouse L1 elements, (ii) L1 elements are deficient in both heterochromatin-associated histone marks H3 tri methyl K9 and H4 tri methyl K20 in Rb family triple knock out (Rb, p107, and p130) fibroblasts (TKO), (iii) L1 promoter exhibits increased histone H3 acetylation in the absence of HDAC1 and HDAC2 recruitment, (iv) L1 expression in TKO fibroblasts is upregulated compared to wild type counterparts, (v) L1 expression increases in the presence of the HDAC inhibitor TSA. On the basis of these findings we propose a model in which L1 sequences throughout the genome serve as centers for heterochromatin formation in an Rb family-dependent manner. As such, Rb proteins and L1 elements may play key roles in heterochromatin formation beyond pericentromeric chromosomal regions. These findings describe a novel mechanism of L1 reactivation in mammalian cells mediated by failure of corepressor protein recruitment by Rb, loss of histone epigenetic marks, heterochromatin formation, and increased histone H3 acetylation.

  19. Epigenetic control of mammalian LINE-1 retrotransposon by retinoblastoma proteins

    Energy Technology Data Exchange (ETDEWEB)

    Montoya-Durango, Diego E. [Department of Biochemistry and Molecular Biology and Center for Genetics and Molecular Medicine, University of Louisville School of Medicine Health Sciences Center, Louisville, KY 40202 (United States); Liu, Yongqing [James Graham Brown Cancer Center and Department of Ophthalmology and Visual Sciences, University of Louisville School of Medicine Health Sciences Center, Louisville, KY 40202 (United States); Teneng, Ivo; Kalbfleisch, Ted; Lacy, Mary E.; Steffen, Marlene C. [Department of Biochemistry and Molecular Biology and Center for Genetics and Molecular Medicine, University of Louisville School of Medicine Health Sciences Center, Louisville, KY 40202 (United States); Ramos, Kenneth S., E-mail: kenneth.ramos@louisville.edu [Department of Biochemistry and Molecular Biology and Center for Genetics and Molecular Medicine, University of Louisville School of Medicine Health Sciences Center, Louisville, KY 40202 (United States)

    2009-06-01

    Long interspersed nuclear elements (LINEs or L1 elements) are targeted for epigenetic silencing during early embryonic development and remain inactive in most cells and tissues. Here we show that E2F-Rb family complexes participate in L1 elements epigenetic regulation via nucleosomal histone modifications and recruitment of histone deacetylases (HDACs) HDAC1 and HDAC2. Our experiments demonstrated that (i) Rb and E2F interact with human and mouse L1 elements, (ii) L1 elements are deficient in both heterochromatin-associated histone marks H3 tri methyl K9 and H4 tri methyl K20 in Rb family triple knock out (Rb, p107, and p130) fibroblasts (TKO), (iii) L1 promoter exhibits increased histone H3 acetylation in the absence of HDAC1 and HDAC2 recruitment, (iv) L1 expression in TKO fibroblasts is upregulated compared to wild type counterparts, (v) L1 expression increases in the presence of the HDAC inhibitor TSA. On the basis of these findings we propose a model in which L1 sequences throughout the genome serve as centers for heterochromatin formation in an Rb family-dependent manner. As such, Rb proteins and L1 elements may play key roles in heterochromatin formation beyond pericentromeric chromosomal regions. These findings describe a novel mechanism of L1 reactivation in mammalian cells mediated by failure of corepressor protein recruitment by Rb, loss of histone epigenetic marks, heterochromatin formation, and increased histone H3 acetylation.

  20. Recombinant Promoter (MUASCsV8CP) Driven Totiviral Killer Protein 4 (KP4) Imparts Resistance Against Fungal Pathogens in Transgenic Tobacco

    Science.gov (United States)

    Deb, Debasish; Shrestha, Ankita; Maiti, Indu B.; Dey, Nrisingha

    2018-01-01

    Development of disease-resistant plant varieties achieved by engineering anti-microbial transgenes under the control of strong promoters can suffice the inhibition of pathogen growth and simultaneously ensure enhanced crop production. For evaluating the prospect of such strong promoters, we comprehensively characterized the full-length transcript promoter of Cassava Vein Mosaic Virus (CsVMV; -565 to +166) and identified CsVMV8 (-215 to +166) as the highest expressing fragment in both transient and transgenic assays. Further, we designed a new chimeric promoter ‘MUASCsV8CP’ through inter-molecular hybridization among the upstream activation sequence (UAS) of Mirabilis Mosaic Virus (MMV; -297 to -38) and CsVMV8, as the core promoter (CP). The MUASCsV8CP was found to be ∼2.2 and ∼2.4 times stronger than the CsVMV8 and CaMV35S promoters, respectively, while its activity was found to be equivalent to that of the CaMV35S2 promoter. Furthermore, we generated transgenic tobacco plants expressing the totiviral ‘Killer protein KP4’ (KP4) under the control of the MUASCsV8CP promoter. Recombinant KP4 was found to accumulate both in the cytoplasm and apoplast of plant cells. The agar-based killing zone assays revealed enhanced resistance of plant-derived KP4 against two deuteromycetous foliar pathogenic fungi viz. Alternaria alternata and Phoma exigua var. exigua. Also, transgenic plants expressing KP4 inhibited the growth progression of these fungi and conferred significant fungal resistance in detached-leaf and whole plant assays. Taken together, we establish the potential of engineering “in-built” fungal stress-tolerance in plants by expressing KP4 under a novel chimeric caulimoviral promoter in a transgenic approach. PMID:29556246

  1. Quantification of green fluorescent protein by in vivo imaging, PCR, and flow cytometry: comparison of transgenic strains and relevance for fetal cell microchimerism.

    Science.gov (United States)

    Fujiki, Yutaka; Tao, Kai; Bianchi, Diana W; Giel-Moloney, Maryann; Leiter, Andrew B; Johnson, Kirby L

    2008-02-01

    Animal models are increasingly being used for the assessment of fetal cell microchimerism in maternal tissue. We wished to determine the optimal transgenic mouse strain and analytic technique to facilitate the detection of rare transgenic microchimeric fetal cells amongst a large number of maternal wild-type cells. We evaluated two strains of mice transgenic for the enhanced green fluorescent protein (EGFP): a commercially available, commonly used strain (C57BL/6-Tg(ACTB-EGFP)10sb/J) (CAG) and a newly created strain (ROSA26-EGFP) using three different techniques: in vivo and ex vivo fluorescent imaging (for whole body and dissected organs, respectively), PCR amplification of gfp, and flow cytometry (FCM). By fluorescent imaging, organs from CAG mice were 10-fold brighter than organs from ROSA26-EGFP mice (P characteristics that make it useful under specific experimental circumstances. The CAG mouse model is preferable when experiments require brighter cells, whereas ROSA26-EGFP is more appropriate when uniform or ubiquitous expression is more important than brightness. Investigators must carefully select the transgenic strain most suited to the experimental design to obtain the most consistent and reproducible data. In vivo imaging allows for phenotypic evaluation of whole animals and intact organs; however, we did not evaluate its utility for the detection of rare, fetal microchimeric cells in the maternal organs. Finally, while PCR amplification of a paternally inherited transgene does allow for the quantitative determination of rare microchimeric cells, FCM allows for both quantitative and qualitative evaluations of fetal cells at very high sensitivity in a plethora of maternal organs. (c) 2008 International Society for Analytical Cytology

  2. Increased yield of heterologous viral glycoprotein in the seeds of homozygous transgenic tobacco plants cultivated underground.

    Science.gov (United States)

    Tackaberry, Eilleen S; Prior, Fiona; Bell, Margaret; Tocchi, Monika; Porter, Suzanne; Mehic, Jelica; Ganz, Peter R; Sardana, Ravinder; Altosaar, Illimar; Dudani, Anil

    2003-06-01

    The use of transgenic plants in the production of recombinant proteins for human therapy, including subunit vaccines, is being investigated to evaluate the efficacy and safety of these emerging biopharmaceutical products. We have previously shown that synthesis of recombinant glycoprotein B (gB) of human cytomegalovirus can be targeted to seeds of transgenic tobacco when directed by the rice glutelin 3 promoter, with gB retaining critical features of immunological reactivity (E.S. Tackaberry et al. 1999. Vaccine, 17: 3020-3029). Here, we report development of second generation transgenic plant lines (T1) homozygous for the transgene. Twenty progeny plants from two lines (A23T(1)-2 and A24T(1)-3) were grown underground in an environmentally contained mine shaft. Based on yields of gB in their seeds, the A23T(1)-2 line was then selected for scale-up in the same facility. Analyses of mature seeds by ELISA showedthat gB specific activity in A23T(1)-2 seeds was over 30-fold greater than the best T0 plants from the same transformation series, representing 1.07% total seed protein. These data demonstrate stable inheritance, an absence of transgene inactivation, and enhanced levels of gB expression in a homozygous second generation plant line. They also provide evidence for the suitability of using this environmentally secure facility to grow transgenic plants producing therapeutic biopharmaceuticals.

  3. Point mutation in D8C domain of Tamm-Horsfall protein/uromodulin in transgenic mice causes progressive renal damage and hyperuricemia.

    Directory of Open Access Journals (Sweden)

    Lijie Ma

    Full Text Available Hereditary mutations in Tamm-Horsfall protein (THP/uromodulin gene cause autosomal dominant kidney diseases characterized by juvenile-onset hyperuricemia, gout and progressive kidney failure, although the disease pathogenesis remains unclear. Here we show that targeted expression in transgenic mice of a mutation within the domain of 8 cysteines of THP in kidneys' thick ascending limb (TAL caused unfolded protein response in younger (1-month old mice and apoptosis in older (12-month old mice. While the young mice had urine concentration defects and polyuria, such defects progressively reversed in the older mice to marked oliguria, highly concentrated urine, fibrotic kidneys and reduced creatinine clearance. Both the young and the old transgenic mice had significantly higher serum uric acid and its catabolic product, allantoin, than age-matched wild-type mice. This THP mutation apparently caused primary defects in TAL by compromising the luminal translocation and reabsorptive functions of NKCC2 and ROMK and secondary responses in proximal tubules by upregulating NHE3 and URAT1. Our results strongly suggest that the progressive worsening of kidney functions reflects the accumulation of the deleterious effects of the misfolded mutant THP and the compensatory responses. Transgenic mice recapitulating human THP/uromodulin-associated kidney diseases could be used to elucidate their pathogenesis and test novel therapeutic strategies.

  4. Point mutation in D8C domain of Tamm-Horsfall protein/uromodulin in transgenic mice causes progressive renal damage and hyperuricemia

    Science.gov (United States)

    Landry, Nichole K.; El-Achkar, Tarek M.; Lieske, John C.

    2017-01-01

    Hereditary mutations in Tamm-Horsfall protein (THP/uromodulin) gene cause autosomal dominant kidney diseases characterized by juvenile-onset hyperuricemia, gout and progressive kidney failure, although the disease pathogenesis remains unclear. Here we show that targeted expression in transgenic mice of a mutation within the domain of 8 cysteines of THP in kidneys’ thick ascending limb (TAL) caused unfolded protein response in younger (1-month old) mice and apoptosis in older (12-month old) mice. While the young mice had urine concentration defects and polyuria, such defects progressively reversed in the older mice to marked oliguria, highly concentrated urine, fibrotic kidneys and reduced creatinine clearance. Both the young and the old transgenic mice had significantly higher serum uric acid and its catabolic product, allantoin, than age-matched wild-type mice. This THP mutation apparently caused primary defects in TAL by compromising the luminal translocation and reabsorptive functions of NKCC2 and ROMK and secondary responses in proximal tubules by upregulating NHE3 and URAT1. Our results strongly suggest that the progressive worsening of kidney functions reflects the accumulation of the deleterious effects of the misfolded mutant THP and the compensatory responses. Transgenic mice recapitulating human THP/uromodulin-associated kidney diseases could be used to elucidate their pathogenesis and test novel therapeutic strategies. PMID:29145399

  5. A milk protein gene promoter directs the expression of human tissue plasminogen activator cDNA to the mammary gland in transgenic mice

    International Nuclear Information System (INIS)

    Pittius, C.W.; Hennighausen, L.; Lee, E.; Westphal, H.; Nicols, E.; Vitale, J.; Gordon, K.

    1988-01-01

    Whey acidic protein (WAP) is a major whey protein in mouse milk. Its gene is expressed in the lactating mammary gland and is inducible by steroid and peptide hormones. A series of transgenic mice containing a hybrid gene in which human tissue plasminogen activator (tPA) cDNA is under the control of the murine WAP gene promoter had previously been generated. In this study, 21 tissues from lactating and virgin transgenic female mice containing the WAP-tPA hybrid gene were screened for the distribution of murine WAP and human tPA transcripts. Like the endogenous WAP RNA, WAP-tPA RNA was expressed predominantly in mammary gland tissue and appeared to be inducible by lactation. Whereas WAP transcripts were not detected in 22 tissues of virgin mice, low levels of WAP-tPA RNA, which were not modulated during lactation, were found in tongue, kidney, and sublingual gland. These studies demonstrate that the WAP gene promoter can target the expression of a transgene to the mammary gland and that this expression is inducible during lactation

  6. Transgenic rice plants harboring an introduced potato proteinase inhibitor II gene are insect resistant.

    Science.gov (United States)

    Duan, X; Li, X; Xue, Q; Abo-el-Saad, M; Xu, D; Wu, R

    1996-04-01

    We introduced the potato proteinase inhibitor II (PINII) gene (pin2) into several Japonica rice varieties, and regenerated a large number of transgenic rice plants. Wound-inducible expression of the pin2 gene driven by its own promoter, together with the first intron of the rice actin 1 gene (act1), resulted in high-level accumulation of the PINII protein in the transgenic plants. The introduced pin2 gene was stably inherited in the second, third, and fourth generations, as shown by molecular analyses. Based on data from the molecular analyses, several homozygous transgenic lines were obtained. Bioassay for insect resistance with the fifth-generation transgenic rice plants showed that transgenic rice plants had increased resistance to a major rice insect pest, pink stem borer (Sesamia inferens). Thus, introduction of an insecticidal proteinase inhibitor gene into cereal plants can be used as a general strategy for control of insect pests.

  7. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line using 18S and ITS rDNA Sequences over Four Seasons

    Directory of Open Access Journals (Sweden)

    Xiemin Qi

    2016-07-01

    Full Text Available Long-term growth of genetically modified plants (GMPs has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S and region II (ITS1, 5.8S and ITS2 rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10 and 15-year plantation of various transgenic cotton cultivars (TC-15mix over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC were also compared. No notable differences were observed in soil fertility variables among CC, TC-10 and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line.

  8. Nuclear delivery of recombinant OCT4 by chitosan nanoparticles for transgene-free generation of protein-induced pluripotent stem cells.

    Science.gov (United States)

    Tammam, Salma; Malak, Peter; Correa, Daphne; Rothfuss, Oliver; Azzazy, Hassan M E; Lamprecht, Alf; Schulze-Osthoff, Klaus

    2016-06-21

    Protein-based reprogramming of somatic cells is a non-genetic approach for the generation of induced pluripotent stem cells (iPSCs), whereby reprogramming factors, such as OCT4, SOX2, KLF4 and c-MYC, are delivered as functional proteins. The technique is considered safer than transgenic methods, but, unfortunately, most protein-based protocols provide very low reprogramming efficiencies. In this study, we developed exemplarily a nanoparticle (NP)-based delivery system for the reprogramming factor OCT4. To this end, we expressed human OCT4 in Sf9 insect cells using a baculoviral expression system. Recombinant OCT4 showed nuclear localization in Sf9 cells indicating proper protein folding. In comparison to soluble OCT4 protein, encapsulation of OCT4 in nuclear-targeted chitosan NPs strongly stabilized its DNA-binding activity even under cell culture conditions. OCT4-loaded NPs enabled cell treatment with high micromolar concentrations of OCT4 and successfully delivered active OCT4 into human fibroblasts. Chitosan NPs therefore provide a promising tool for the generation of transgene-free iPSCs.

  9. Enhanced cadmium accumulation and tolerance in transgenic tobacco overexpressing rice metal tolerance protein gene OsMTP1 is promising for phytoremediation.

    Science.gov (United States)

    Das, Natasha; Bhattacharya, Surajit; Maiti, Mrinal K

    2016-08-01

    One of the most grievous heavy metal pollutants in the environment is cadmium (Cd), which is not only responsible for the crop yield loss owing to its phytotoxicity, but also for the human health hazards as the toxic elements usually accumulate in the consumable parts of crop plants. In the present study, we aimed to isolate and functionally characterize the OsMTP1 gene from indica rice (Oryza sativa L. cv. IR64) to study its potential application for efficient phytoremediation of Cd. The 1257 bp coding DNA sequence (CDS) of OsMTP1 encodes a ∼46 kDa protein belonging to the cation diffusion facilitator (CDF) or metal tolerance/transport protein (MTP) family. The OsMTP1 transcript in rice plant was found to respond during external Cd stress. Heterologous expression of OsMTP1 in tobacco resulted in the reduction of Cd stress-induced phytotoxic effects, including growth inhibition, lipid peroxidation, and cell death. Compared to untransformed control, the transgenic tobacco plants showed enhanced vacuolar thiol content, indicating vacuolar localization of the sequestered Cd. The transgenic tobacco plants exhibited significantly higher biomass growth (2.2-2.8-folds) and hyperaccumulation of Cd (1.96-2.22-folds) compared to untransformed control under Cd exposure. The transgenic plants also showed moderate tolerance and accumulation of arsenic (As) upon exogenous As stress, signifying broad substrate specificity of OsMTP1. Together, findings of our research suggest that the transgenic tobacco plants overexpressing OsMTP1 with its hyperaccumulating activity and increased growth rate could be useful for future phytoremediation applications to clean up the Cd-contaminated soil. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  10. Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

    Science.gov (United States)

    Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

    2012-10-01

    Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

  11. Transgene Expression and Repression in Transgenic Rats Bearing the Phosphoenolpyruvate Carboxykinase-Simian Virus 40 T Antigen or the Phosphoenolpyruvate Carboxykinase-Transforming Growth Factor-α Constructs

    Science.gov (United States)

    Haas, Michael J.; Dragan, Yvonne P.; Hikita, Hiroshi; Shimel, Randee; Takimoto, Koichi; Heath, Susan; Vaughan, Jennifer; Pitot, Henry C.

    1999-01-01

    Transgenic Sprague-Dawley rats expressing either human transforming growth factor-α (TGFα) or simian virus 40 large and small T antigen (TAg), each under the control of the phosphoenolpyruvate carboxykinase (PEPCK) promoter, were developed as an approach to the study of the promotion of hepatocarcinogenesis in the presence of a transgene regulatable by diet and/or hormones. Five lines of PEPCK-TGFα transgenic rats were established, each genetic line containing from one to several copies of the transgene per haploid genome. Two PEPCK-TAg transgenic founder rats were obtained, each with multiple copies of the transgene. Expression of the transgene was undetectable in the TGFα transgenic rats and could not be induced when the animals were placed on a high-protein, low-carbohydrate diet. The transgene was found to be highly methylated in all of these lines. No pathological alterations in the liver and intestine were observed at any time (up to 2 years) during the lives of these rats. One line of transgenic rats expressing the PEPCK-TAg transgene developed pancreatic islet cell hyperplasias and carcinomas, with few normal islets evident in the pancreas. This transgene is integrated as a hypomethylated tandem array of 10 to 12 copies on chromosome 8q11. Expression of large T antigen is highest in pancreatic neoplasms, but is also detectable in the normal brain, kidney, and liver. Mortality is most rapid in males, starting at 5 months of age and reaching 100% by 8 months. Morphologically, islet cell differentiation in the tumors ranges from poor to well differentiated, with regions of necrosis and fibrosis. Spontaneous metastasis of TAg-positive tumor cells to regional lymph nodes was observed. These studies indicate the importance of DNA methylation in the repression of specific transgenes in the rat. However, the expression of the PEPCK-TAg induces neoplastic transformation in islet cells, probably late in neuroendocrine cell differentiation. T antigen expression

  12. Expression of bgt gene in transgenic birch (Betula platyphylla Suk ...

    African Journals Online (AJOL)

    Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch plants indicated that the ...

  13. Expression of bgt gene in transgenic birch (Betula platyphylla Suk.)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-08-04

    Aug 4, 2009 ... Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch.

  14. Establishment and characterization of murine small cell lung carcinoma cell lines derived from HPV-16 E6/E7 transgenic mice.

    Science.gov (United States)

    Carraresi, Laura; Martinelli, Rosanna; Vannoni, Alessandro; Riccio, Massimo; Dembic, Maja; Tripodi, Sergio; Cintorino, Marcella; Santi, Spartaco; Bigliardi, Elisa; Carmellini, Mario; Rossini, Mara

    2006-01-08

    We have established two murine cell lines derived from Small Cell Lung Carcinomas (SCLCs) developed by HPV-E6/E7 transgenic mice. These cells named PPAP-9 and PPAP-10 were isolated from mice bearing tumors, 9 and 10 months old, respectively. The cells, 5 microm in diameter, express HPV oncoproteins and sustain tumor formation after subcutaneous injection in syngenic mice. A detailed analysis indicated the epithelial origin and the neuroendocrine differentiation of these cells. We showed by confocal immunofluorescence the expression of the epithelial marker cytokeratin 5, whose gene promoter was used to direct the expression of HPV E6/E. Cells express several neuroendocrine markers such as CGRP, MAP-2, Ash1, CgrA, Scg2. The neuroendocrine differentiation of these cells was further confirmed by electron microscopy demonstrating neuropeptides secreting granules in their cytoplasm. Furthermore, in agreement with the altered expression observed in the majority of human SCLC we showed in these cells the absence of both p53 and pRB and a dramatic reduction in the expression of Caveolin-1.

  15. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  16. Hepatitis C virus core protein targets 4E-BP1 expression and phosphorylation and potentiates Myc-induced liver carcinogenesis in transgenic mice.

    Science.gov (United States)

    Abdallah, Cosette; Lejamtel, Charlène; Benzoubir, Nassima; Battaglia, Serena; Sidahmed-Adrar, Nazha; Desterke, Christophe; Lemasson, Matthieu; Rosenberg, Arielle R; Samuel, Didier; Bréchot, Christian; Pflieger, Delphine; Le Naour, François; Bourgeade, Marie-Françoise

    2017-08-22

    Hepatitis C virus (HCV) is a leading cause of liver diseases including the development of hepatocellular carcinoma (HCC). Particularly, core protein has been involved in HCV-related liver pathologies. However, the impact of HCV core on signaling pathways supporting the genesis of HCC remains largely elusive. To decipher the host cell signaling pathways involved in the oncogenic potential of HCV core, a global quantitative phosphoproteomic approach was carried out. This study shed light on novel differentially phosphorylated proteins, in particular several components involved in translation. Among the eukaryotic initiation factors that govern the translational machinery, 4E-BP1 represents a master regulator of protein synthesis that is associated with the development and progression of cancers due to its ability to increase protein expression of oncogenic pathways. Enhanced levels of 4E-BP1 in non-modified and phosphorylated forms were validated in human hepatoma cells and in mouse primary hepatocytes expressing HCV core, in the livers of HCV core transgenic mice as well as in HCV-infected human primary hepatocytes. The contribution of HCV core in carcinogenesis and the status of 4E-BP1 expression and phosphorylation were studied in HCV core/Myc double transgenic mice. HCV core increased the levels of 4E-BP1 expression and phosphorylation and significantly accelerated the onset of Myc-induced tumorigenesis in these double transgenic mice. These results reveal a novel function of HCV core in liver carcinogenesis potentiation. They position 4E-BP1 as a tumor-specific target of HCV core and support the involvement of the 4E-BP1/eIF4E axis in hepatocarcinogenesis.

  17. Insect resistance to Nilaparvata lugens and Cnaphalocrocis medinalis in transgenic indica rice and the inheritance of gna+sbti transgenes.

    Science.gov (United States)

    Li, Guiying; Xu, Xinping; Xing, Hengtai; Zhu, Huachen; Fan, Qin

    2005-04-01

    Molecular genetic analysis and insect bioassay of transgenic indica rice 'Zhuxian B' plants carrying snowdrop lectin gene (gna) and soybean trypsin inhibitor gene (sbti) were investigated in detail. PCR, 'dot' blot and PCR-Southern blot analysis showed that both transgenes had been incorporated into the rice genome and transmitted up to R3 progeny in most lines tested. Some transgenic lines exhibited Mendelian segregation, but the other showed either 1:1 (positive: negative for the transgenes) or other aberrant segregation patterns. The segregation patterns of gna gene crossed between R2 and R3 progeny. In half of transgenic R3 lines, gna and sbti transgenes co-segregated. Two independent homozygous lines expressing double transgenes were identified in R3 progeny. Southern blot analysis demonstrated that the copy numbers of integrated gna and sbti transgenes varied from one to ten in different lines. Insect bioassay data showed that most transgenic plants had better resistance to both Nilaparvata lugens (Stahl) and Cnaphalocrocis medinalis (Guenee) than wild-type plants. The insect resistance of transgenic lines increased with the increase in transgene positive ratio in most of the transgenic lines. In all, we obtained nine lines of R3 transgenic plants, including one pure line, which had better resistance to both N lugens and C medinalis than wild-type plants. Copyright 2005 Society of Chemical Industry.

  18. Unintended changes in protein expression revealed by proteomic analysis of seeds from transgenic pea expressing a bean alpha-amylase inhibitor gene.

    Science.gov (United States)

    Chen, Hancai; Bodulovic, Greg; Hall, Prudence J; Moore, Andy; Higgins, Thomas J V; Djordjevic, Michael A; Rolfe, Barry G

    2009-09-01

    Seeds of genetically modified (GM) peas (Pisum sativum L.) expressing the gene for alpha-amylase inhibitor-1 (alphaAI1) from the common bean (Phaseolus vulgaris L. cv. Tendergreen) exhibit resistance to the pea weevil (Bruchus pisorum). A proteomic analysis was carried out to compare seeds from GM pea lines expressing the bean alphaAI1 protein and the corresponding alphaAI1-free segregating lines and non-GM parental line to identify unintended alterations to the proteome of GM peas due to the introduction of the gene for alphaAI1. Proteomic analysis showed that in addition to the presence of alphaAI1, 33 other proteins were differentially accumulated in the alphaAI1-expressing GM lines compared with their non-GM parental line and these were grouped into five expression classes. Among these 33 proteins, only three were found to be associated with the expression of alphaAI1 in the GM pea lines. The accumulation of the remaining 30 proteins appears to be associated with Agrobacterium-mediated transformation events. Sixteen proteins were identified after MALDI-TOF-TOF analysis. About 56% of the identified proteins with altered accumulation in the GM pea were storage proteins including legumin, vicilin or convicilin, phaseolin, cupin and valosin-containing protein. Two proteins were uniquely expressed in the alphaAI1-expressing GM lines and one new protein was present in both the alphaAI1-expressing GM lines and their alphaAI1-free segregating lines, suggesting that both transgenesis and transformation events led to demonstrable changes in the proteomes of the GM lines tested.

  19. The Relationship between Insect Resistance and Tree Age of Transgenic Triploid Populus tomentosa Plants.

    Science.gov (United States)

    Ren, Yachao; Zhang, Jun; Wang, Guiying; Liu, Xiaojie; Li, Li; Wang, Jinmao; Yang, Minsheng

    2018-01-01

    To explore the stability of insect resistance during the development of transgenic insect-resistant trees, this study investigated how insect resistance changes as transgenic trees age. We selected 19 transgenic insect-resistant triploid Populus tomentosa lines as plant material. The presence of exogenous genes and Cry1Ac protein expression were verified using polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA) analyses. The toxicity for Clostera anachoreta and Lymantria dispar was evaluated by feeding fresh leaves to first instar larvae after the trees were planted in the field for 2 years and after the sixth year. Results of PCR showed that the exogenous genes had a long-term presence in the poplar genome. ELISA analyses showed significant differences existed on the 6-year-old transgenic lines. The insect-feeding experiment demonstrated significant differences in the mortality rates of C. anachoreta and L. dispar among different transgenic lines. The average corrected mortality rates of C. anachoreta and L. dispar ranged from 5.6-98.7% to 35.4-7.2% respectively. The larval mortality rates differed significantly between the lines at different ages. Up to 52.6% of 1-year-old transgenic lines and 42.1% of 2-year-old transgenic lines caused C. anachoreta larval mortality rates to exceed 80%, whereas only 26.3% of the 6-year-old transgenic lines. The mortality rates of L. dispar exhibited the same trend: 89.5% of 1-year-old transgenic lines and 84.2% of 2-year-old transgenic lines caused L. dispar larval mortality rates to exceed 80%; this number decreased to 63.2% for the 6-year-old plants. The proportion of 6-year-old trees with over 80% larval mortality rates was clearly lower than that of the younger trees. The death distribution of C. anachoreta in different developmental stages also showed the larvae that fed on the leaves of 1-year-old trees were killed mostly during L 1 and L 2 stages, whereas the proportion of larvae that died in L 3

  20. Protein and energy metabolism in two lines of chickens selected for growth on high or low protein diets

    DEFF Research Database (Denmark)

    Chwalibog, André; Eggum, B O; Sørensen, Peter

    1983-01-01

    Genetic adaptation was investigated in broilers selected for seven generations on a normal (A) or a low (B) protein diet. Protein and energy metabolism were studied in males from these selected lines fed on a diet of intermediate protein content. All selected birds retained more nitrogen than those...

  1. Overcoming antigen masking of anti-amyloidbeta antibodies reveals breaking of B cell tolerance by virus-like particles in amyloidbeta immunized amyloid precursor protein transgenic mice

    Directory of Open Access Journals (Sweden)

    Ugen Kenneth E

    2004-06-01

    Full Text Available Abstract Background In prior work we detected reduced anti-Aβ antibody titers in Aβ-vaccinated transgenic mice expressing the human amyloid precursor protein (APP compared to nontransgenic littermates. We investigated this observation further by vaccinating APP and nontransgenic mice with either the wild-type human Aβ peptide, an Aβ peptide containing the "Dutch Mutation", E22Q, or a wild-type Aβ peptide conjugated to papillomavirus virus-like particles (VLPs. Results Anti-Aβ antibody titers were lower in vaccinated APP than nontransgenic mice even when vaccinated with the highly immunogenic Aβ E22Q. One concern was that human Aβ derived from the APP transgene might mask anti-Aβ antibodies in APP mice. To test this possibility, we dissociated antigen-antibody complexes by incubation at low pH. The low pH incubation increased the anti-Aβ antibody titers 20–40 fold in APP mice but had no effect in sera from nontransgenic mice. However, even after dissociation, the anti-Aβ titers were still lower in transgenic mice vaccinated with wild-type Aβ or E22Q Aβ relative to non-transgenic mice. Importantly, the dissociated anti-Aβ titers were equivalent in nontransgenic and APP mice after VLP-based vaccination. Control experiments demonstrated that after acid-dissociation, the increased antibody titer did not cross react with bovine serum albumin nor alpha-synuclein, and addition of Aβ back to the dissociated serum blocked the increase in antibody titers. Conclusions Circulating human Aβ can interfere with ELISA assay measurements of anti-Aβ titers. The E22Q Aβ peptide vaccine is more immunogenic than the wild-type peptide. Unlike peptide vaccines, VLP-based vaccines against Aβ abrogate the effects of Aβ self-tolerance.

  2. Transgenic rice seed expressing flavonoid biosynthetic genes accumulate glycosylated and/or acylated flavonoids in protein bodies

    Science.gov (United States)

    Ogo, Yuko; Mori, Tetsuya; Nakabayashi, Ryo; Saito, Kazuki; Takaiwa, Fumio

    2016-01-01

    Plant-specialized (or secondary) metabolites represent an important source of high-value chemicals. In order to generate a new production platform for these metabolites, an attempt was made to produce flavonoids in rice seeds. Metabolome analysis of these transgenic rice seeds using liquid chromatography-photodiode array-quadrupole time-of-flight mass spectrometry was performed. A total of 4392 peaks were detected in both transgenic and non-transgenic rice, 20–40% of which were only detected in transgenic rice. Among these, 82 flavonoids, including 37 flavonols, 11 isoflavones, and 34 flavones, were chemically assigned. Most of the flavonols and isoflavones were O-glycosylated, while many flavones were O-glycosylated and/or C-glycosylated. Several flavonoids were acylated with malonyl, feruloyl, acetyl, and coumaroyl groups. These glycosylated/acylated flavonoids are thought to have been biosynthesized by endogenous rice enzymes using newly synthesized flavonoids whose biosynthesis was catalysed by exogenous enzymes. The subcellular localization of the flavonoids differed depending on the class of aglycone and the glycosylation/acylation pattern. Therefore, flavonoids with the intended aglycones were efficiently produced in rice seeds via the exogenous enzymes introduced, while the flavonoids were variously glycosylated/acylated by endogenous enzymes. The results suggest that rice seeds are useful not only as a production platform for plant-specialized metabolites such as flavonoids but also as a tool for expanding the diversity of flavonoid structures, providing novel, physiologically active substances. PMID:26438413

  3. Powerful beneficial effects of benfotiamine on cognitive impairment and beta-amyloid deposition in amyloid precursor protein/presenilin-1 transgenic mice.

    Science.gov (United States)

    Pan, Xiaoli; Gong, Neng; Zhao, Jing; Yu, Zhe; Gu, Fenghua; Chen, Jia; Sun, Xiaojing; Zhao, Lei; Yu, Meijing; Xu, Zhiru; Dong, Wenxin; Qin, Yan; Fei, Guoqiang; Zhong, Chunjiu; Xu, Tian-Le

    2010-05-01

    Reduction of glucose metabolism in brain is one of the main features of Alzheimer's disease. Thiamine (vitamin B1)-dependent processes are critical in glucose metabolism and have been found to be impaired in brains from patients with Alzheimer's disease. However, thiamine treatment exerts little beneficial effect in these patients. Here, we tested the effect of benfotiamine, a thiamine derivative with better bioavailability than thiamine, on cognitive impairment and pathology alterations in a mouse model of Alzheimer's disease, the amyloid precursor protein/presenilin-1 transgenic mouse. We show that after a chronic 8 week treatment, benfotiamine dose-dependently enhanced the spatial memory of amyloid precursor protein/presenilin-1 mice in the Morris water maze test. Furthermore, benfotiamine effectively reduced both amyloid plaque numbers and phosphorylated tau levels in cortical areas of the transgenic mice brains. Unexpectedly, these effects were not mimicked by another lipophilic thiamine derivative, fursultiamine, although both benfotiamine and fursultiamine were effective in increasing the levels of free thiamine in the brain. Most notably, benfotiamine, but not fursultiamine, significantly elevated the phosphorylation level of glycogen synthase kinase-3alpha and -3beta, and reduced their enzymatic activities in the amyloid precursor protein/presenilin-1 transgenic brain. Therefore, in the animal Alzheimer's disease model, benfotiamine appears to improve the cognitive function and reduce amyloid deposition via thiamine-independent mechanisms, which are likely to include the suppression of glycogen synthase kinase-3 activities. These results suggest that, unlike many other thiamine-related drugs, benfotiamine may be beneficial for clinical Alzheimer's disease treatment.

  4. Nucleocapsid Gene-Mediated Transgenic Resistance Provides Protection Against Tomato spotted wilt virus Epidemics in the Field.

    Science.gov (United States)

    Herrero, S; Culbreath, A K; Csinos, A S; Pappu, H R; Rufty, R C; Daub, M E

    2000-02-01

    ABSTRACT Transformation of plants with the nucleocapsid (N) gene of Tomato spotted wilt tospovirus (TSWV) provides resistance to disease development; however, information is lacking on the response of plants to natural inoculum in the field. Three tobacco cultivars were transformed with the N gene of a dahlia isolate of TSWV (TSWV-D), and plants were evaluated over several generations in the greenhouse. The resistant phenotype was more frequently observed in 'Burley 21' than in 'KY-14' or 'K-326', but highly resistant 'Burley 21' transgenic lines were resistant to only 44% of the heterologous TSWV isolates tested. Advanced generation (R(3) and R(4)) transgenic resistant lines of 'Burley 21' and a 'K-326' F(1) hybrid containing the N genes of two TSWV isolates were evaluated in the field near Tifton, GA, where TSWV is endemic. Disease development was monitored by symptom expression and enzyme-linked immunosorbent assay (ELISA) analysis. Whereas incidence of TSWV infection in 'Burley 21' susceptible controls was 20% in 1996 and 62% in 1997, the mean incidence in transgenic lines was reduced to 4 and 31%, respectively. Three transgenic 'Burley 21' lines were identified that had significantly lower incidence of disease than susceptible controls over the two years of the study. In addition, the rate of disease increase at the onset of the 1997 epidemic was reduced for all the 'Burley 21' transgenic lines compared with the susceptible controls. The 'K-326' F(1) hybrid was as susceptible as the 'K-326' nontransformed control. ELISA analysis demonstrated that symptomless plants from the most resistant 'Burley 21' transgenic lines accumulated detectable nucleocapsid protein, whereas symptomless plants from more susceptible lines did not. We conclude that transgenic resistance to TSWV is effective in reducing incidence of the disease in the field, and that accumulation of transgene protein may be important in broad-spectrum resistance.

  5. Study of the hydration of globular proteins by broad NMR lines method

    Energy Technology Data Exchange (ETDEWEB)

    Blicharska, B [Uniwersytet Jagiellonski, Krakow (Poland). Instytut Fizyki

    1973-01-01

    Spectra of proteins and polypeptides obtained by means of a NMR broad line spectrometer consist of broad and thin lines. These broad and thin lines are attributed to proteins and to water absorbed on the surfaces of proteins respectively. The behaviour of the thin line in the spectra of lyophilizated albumin of the egg white has been studied in the temperature range from -42 to 20/sup 0/C. The amount of water has been found by the simple method of weighing and has been equal about 7% of the total weight. It has been found that the water absorbed on the surface of the lyophilizated proteins gives a thinner line in comparison to the water absorbed on molecules of proteins in water solutions and that the correlation time is about 10/sup 3/ times greater.

  6. Use of the viral 2A peptide for bicistronic expression in transgenic mice

    Directory of Open Access Journals (Sweden)

    Trichas Georgios

    2008-09-01

    Full Text Available Abstract Background Transgenic animals are widely used in biomedical research and biotechnology. Multicistronic constructs, in which several proteins are encoded by a single messenger RNA, are commonly used in genetically engineered animals. This is currently done by using an internal ribosomal entry site to separate the different coding regions. 2A peptides result in the co-translational 'cleavage' of proteins and are an attractive alternative to the internal ribosomal entry site. They are more reliable than the internal ribosomal entry site and lead to expression of multiple cistrons at equimolar levels. They work in a wide variety of eukaryotic cells, but to date have not been demonstrated to function in transgenic mice in an inheritable manner. Results To test 2A function in transgenic mice and uncover any possible toxicity of widespread expression of the 2A peptide, we made a bicistronic reporter construct containing the coding sequence for a membrane localised red fluorescent protein (Myr-TdTomato and a nuclear localised green fluorescent protein (H2B-GFP, separated by a 2A sequence. When this reporter is transfected into HeLa cells, the two fluorescent proteins correctly localise to mutually exclusive cellular compartments, demonstrating that the bicistronic construct is a reliable readout of 2A function. The two fluorescent proteins also correctly localise when the reporter is electroporated into chick neural tube cells. We made two independent transgenic mouse lines that express the bicistronic reporter ubiquitously. For both lines, transgenic mice are born in Mendelian frequencies and are found to be healthy and fertile. Myr-TdTomato and H2B-GFP segregate to mutually exclusive cellular compartments in all tissues examined from a broad range of developmental stages, ranging from embryo to adult. One transgenic line shows X-linked inheritance of the transgene and mosaic expression in females but uniform expression in males, indicating

  7. Meningococcal factor H-binding protein vaccines with decreased binding to human complement factor H have enhanced immunogenicity in human factor H transgenic mice.

    Science.gov (United States)

    Rossi, Raffaella; Granoff, Dan M; Beernink, Peter T

    2013-11-04

    Factor H-binding protein (fHbp) is a component of a meningococcal vaccine recently licensed in Europe for prevention of serogroup B disease, and a second vaccine in clinical development. The protein specifically binds human factor H (fH), which down-regulates complement activation and enhances resistance to bactericidal activity. There are conflicting data from studies in human fH transgenic mice on whether binding of human fH to fHbp vaccines decreases immunogenicity, and whether mutant fHbp vaccines with decreased fH binding have enhanced immunogenicity. fHbp can be classified into two sub-families based on sequence divergence and immunologic cross-reactivity. Previous studies of mutant fHbp vaccines with low fH binding were from sub-family B, which account for approximately 60% of serogroup B case isolates. In the present study, we evaluated the immunogenicity of two mutant sub-family A fHbp vaccines containing single substitutions, T221A or D211A, which resulted in 15- or 30-fold lower affinity for human fH, respectively, than the corresponding control wild-type fHbp vaccine. In transgenic mice with high serum concentrations of human fH, both mutant vaccines elicited significantly higher IgG titers and higher serum bactericidal antibody responses than the control fHbp vaccine that bound human fH. Thus, mutations introduced into a sub-family A fHbp antigen to decrease fH binding can increase protective antibody responses in human fH transgenic mice. Collectively the data suggest that mutant fHbp antigens with decreased fH binding will result in superior vaccines in humans. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    Directory of Open Access Journals (Sweden)

    Shih Ping Yao

    2002-04-01

    Full Text Available Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal antibody (mAb C, is reactive to a surface antigen on sperm of all tested species including pig, mouse, chicken, cow, goat, sheep, and human. mAb C is a basic protein that binds to DNA through ionic interaction allowing exogenous DNA to be linked specifically to sperm. After fertilization of the egg, the DNA is shown to be successfully integrated into the genome of viable pig and mouse offspring with germ-line transfer to the F1 generation at a highly efficient rate: 37.5% of pigs and 33% of mice. The integration is demonstrated again by FISH analysis and F2 transmission in pigs. Furthermore, expression of the transgene is demonstrated in 61% (35/57 of transgenic pigs (F0 generation. Conclusions Our data suggests that LB-SMGT could be used to generate transgenic animals efficiently in many different species.

  9. Rosuvastatin ameliorates inflammation, renal fat accumulation, and kidney injury in transgenic spontaneously hypertensive rats expressing human C-reactive protein

    Czech Academy of Sciences Publication Activity Database

    Šilhavý, Jan; Zídek, Václav; Landa, Vladimír; Šimáková, Miroslava; Mlejnek, Petr; Oliyarnyk, O.; Malínská, H.; Kazdová, L.; Mancini, M.; Pravenec, Michal

    2015-01-01

    Roč. 64, č. 3 (2015), s. 295-301 ISSN 0862-8408 R&D Projects: GA MŠk(CZ) LH11049; GA MŠk(CZ) LL1204; GA MZd(CZ) NT14325; GA ČR(CZ) GB14-36804G Institutional support: RVO:67985823 Keywords : rosuvastatin * kidney damage * CRP * transgenic * spontaneously hypertensive rat Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.643, year: 2015

  10. Generation of the Bovine Viral Diarrhea Virus E0 Protein in Transgenic Astragalus and Its Immunogenicity in Sika Deer

    OpenAIRE

    Gao, Yugang; Zhao, Xueliang; Zang, Pu; Liu, Qun; Wei, Gongqing; Zhang, Lianxue

    2014-01-01

    The bovine viral diarrhea virus (BVDV), a single-stranded RNA virus, can cause fatal diarrhea syndrome, respiratory problems, and reproductive disorders in herds. Over the past few years, it has become clear that the BVDV infection rates are increasing and it is likely that an effective vaccine for BVDV will be needed. In this study, transgenic Astragalus was used as an alternative productive platform for the expression of glycoprotein E0. The immunogenicity of glycoprotein E0 expressed in tr...

  11. A Novel 1,4-Dihydropyridine Derivative Improves Spatial Learning and Memory and Modifies Brain Protein Expression in Wild Type and Transgenic APPSweDI Mice.

    Directory of Open Access Journals (Sweden)

    Baiba Jansone

    Full Text Available Ca2+ blockers, particularly those capable of crossing the blood-brain barrier (BBB, have been suggested as a possible treatment or disease modifying agents for neurodegenerative disorders, e.g., Alzheimer's disease. The present study investigated the effects of a novel 4-(N-dodecyl pyridinium group-containing 1,4-dihydropyridine derivative (AP-12 on cognition and synaptic protein expression in the brain. Treatment of AP-12 was investigated in wild type C57BL/6J mice and transgenic Alzheimer's disease model mice (Tg APPSweDI using behavioral tests and immunohistochemistry, as well as mass spectrometry to assess the blood-brain barrier (BBB penetration. The data demonstrated the ability of AP-12 to cross the BBB, improve spatial learning and memory in both mice strains, induce anxiolytic action in transgenic mice, and increase expression of hippocampal and cortical proteins (GAD67, Homer-1 related to synaptic plasticity. The compound AP-12 can be seen as a prototype molecule for use in the design of novel drugs useful to halt progression of clinical symptoms (more specifically, anxiety and decline in memory of neurodegenerative diseases, particularly Alzheimer's disease.

  12. TaPP2C1, a Group F2 Protein Phosphatase 2C Gene, Confers Resistance to Salt Stress in Transgenic Tobacco.

    Directory of Open Access Journals (Sweden)

    Wei Hu

    Full Text Available Group A protein phosphatases 2Cs (PP2Cs are essential components of abscisic acid (ABA signaling in Arabidopsis; however, the function of group F2 subfamily PP2Cs is currently less known. In this study, TaPP2C1 which belongs to group F2 was isolated and characterized from wheat. Expression of the TaPP2C1-GFP fusion protein suggested its ubiquitous localization within a cell. TaPP2C1 expression was downregulated by abscisic acid (ABA and NaCl treatments, but upregulated by H2O2 treatment. Overexpression of TaPP2C1 in tobacco resulted in reduced ABA sensitivity and increased salt resistance of transgenic seedlings. Additionally, physiological analyses showed that improved resistance to salt stress conferred by TaPP2C1 is due to the reduced reactive oxygen species (ROS accumulation, the improved antioxidant system, and the increased transcription of genes in the ABA-independent pathway. Finally, transgenic tobacco showed increased resistance to oxidative stress by maintaining a more effective antioxidant system. Taken together, these results demonstrated that TaPP2C1 negatively regulates ABA signaling, but positively regulates salt resistance. TaPP2C1 confers salt resistance through activating the antioxidant system and ABA-independent gene transcription process.

  13. Increasing the production yield of recombinant protein in transgenic seeds by expanding the deposition space within the intracellular compartment

    OpenAIRE

    Takaiwa, Fumio

    2013-01-01

    Seeds must maintain a constant level of nitrogen in order to germinate. When recombinant proteins are produced while endogenous seed protein expression is suppressed, the production levels of the foreign proteins increase to compensate for the decreased synthesis of endogenous proteins. Thus, exchanging the production of endogenous seed proteins for that of foreign proteins is a promising approach to increase the yield of foreign recombinant proteins. Providing a space for the deposition of r...

  14. Enhanced virus resistance in transgenic maize expressing a dsRNA-specific endoribonuclease gene from E. coli.

    Directory of Open Access Journals (Sweden)

    Xiuling Cao

    Full Text Available Maize rough dwarf disease (MRDD, caused by several Fijiviruses in the family Reoviridae, is a global disease that is responsible for substantial yield losses in maize. Although some maize germplasm have low levels of polygenic resistance to MRDD, highly resistant cultivated varieties are not available for agronomic field production in China. In this work, we have generated transgenic maize lines that constitutively express rnc70, a mutant E. coli dsRNA-specific endoribonuclease gene. Transgenic lines were propagated and screened under field conditions for 12 generations. During three years of evaluations, two transgenic lines and their progeny were challenged with Rice black-streaked dwarf virus (RBSDV, the causal agent of MRDD in China, and these plants exhibited reduced levels of disease severity. In two normal years of MRDD abundance, both lines were more resistant than non-transgenic plants. Even in the most serious MRDD year, six out of seven progeny from one line were resistant, whereas non-transgenic plants were highly susceptible. Molecular approaches in the T12 generation revealed that the rnc70 transgene was integrated and expressed stably in transgenic lines. Under artificial conditions permitting heavy virus inoculation, the T12 progeny of two highly resistant lines had a reduced incidence of MRDD and accumulation of RBSDV in infected plants. In addition, we confirmed that the RNC70 protein could bind directly to RBSDV dsRNA in vitro. Overall, our data show that RNC70-mediated resistance in transgenic maize can provide efficient protection against dsRNA virus infection.

  15. TaUBA, a UBA domain-containing protein in wheat (Triticum aestivum L.), is a negative regulator of salt and drought stress response in transgenic Arabidopsis.

    Science.gov (United States)

    Li, Xiao; Zhang, Shuang-shuang; Ma, Jun-xia; Guo, Guang-yan; Zhang, Xue-yong; Liu, Xu; Bi, Cai-li

    2015-05-01

    TaUBA functions as a negative regulator of salt and drought stress response in transgenic Arabidopsis, either the UBA domain or the zinc finger domain is crucial for TaUBA's function. TaUBA (DQ211935), which is a UBA domain-containing protein in wheat, was cloned and functionally characterized. Southern blot suggested that TaUBA is a low copy gene in common wheat. qRT-PCR assay showed that the expression of TaUBA was strongly induced by salt and drought stress. When suffering from drought and salt stresses, lower proline content and much higher MDA content in the TaUBA overexpressors were observed than those of the wild-type control, suggesting TaUBA may function as a negative regulator of salt and drought stress response in plants. To study whether the UBA domain or the zinc finger domain affects the function of TaUBA, TaUBAΔUBA (deletion of UBA domain) and TaUBA-M (Cys464Gly and Cys467Gly) overexpression vectors were constructed and transformed into Arabidopsis. Upon drought and salt stresses, the TaUBAΔUBA-and TaUBA-M-overexpressed plants accumulated much more proline and lower MDA than the wild-type control, the TaUBA-overexpressors lost water more quickly than TaUBAΔUBA-and TaUBA-M-overexpressed plants as well as the wild-type control, suggesting that overexpression of TaUBAΔUBA or TaUBA-M improved the drought and salt tolerance of transgenic Arabidopsis plants and the possibility of ubiquitination role in the regulation of osmolyte synthesis and oxidative stress responses in mediating stress tolerance. qRT-PCR assay of stress-related genes in transgenic plants upon drought and salt stresses suggested that TaUBA may function through down-regulating some stress related-transcription factors and by regulating P5CSs to cope with osmotic stress.

  16. Identification of Secretory Odontoblasts Using DMP1-GFP Transgenic Mice

    Science.gov (United States)

    Balic, Anamaria; Mina, Mina

    2011-01-01

    Terminal differentiation of odontoblasts from dental papilla is a long process involving several intermediate steps and changes in the transcriptional profile and expression of proteins secreted by cells in the odontoblast lineage. Transgenic mouse lines in which GFP expression is under the control of tissue-and stage specific promoters have provided powerful experimental tools for identification and isolation of cells at specific stages of differentiation along a lineage. Our previous studies showed utilization of pOBCol3.6GFP and pOBCol2.3GFP animals for identification of odontoblasts at early and late stages of polarization respectively. In the present study we used the DMP1-GFP transgenic animal as an experimental model to examine its expression during the differentiation of odontoblasts from progenitor cells in vivo and in vitro. Our observations showed that DMP1-GFP transgene is first activated in secretory/functional odontoblasts engaged in secretion of predentin and then transiently expressed at high levels in newly differentiated odontoblasts. Expression of DMP1-GFP was down-regulated in highly differentiated odontoblasts. The temporal and spatial pattern of expression of DMP1-GFP transgene closely mimics the expression of endogenous DMP1. This transgenic animal will facilitate studies of gene expression and biological functions in secretory/functional odontoblasts. PMID:21172466

  17. Characterization of transgenic tobacco plants containing bacterial bphC gene and study of their phytoremediation ability.

    Science.gov (United States)

    Viktorovtá, Jitka; Novakova, Martina; Trbolova, Ladislava; Vrchotova, Blanka; Lovecka, Petra; Mackova, Martina; Macek, Tomas

    2014-01-01

    Genetically modified plants can serve as an efficient tool for remediation of diverse dangerous pollutants of the environment such as pesticides, heavy metals, explosives and persistent organic compounds. Transgenic lines of Nicotiana tabacum containing bacterial bphC gene from the degradation pathway of polychlorinated biphenyls (PCBs) were tested. The product of the bphC gene - enzyme 2,3-dihydroxybiphenyl-1,2-dioxygenase is responsible for cleaving of the biphenyl ring. The presence of bphC gene in transgenic plants was detected on DNA, RNA and protein level. The expression of the bphC/His gene was verified afterpurification of the enzyme from plants by affinity chromatography followed by a Western blot and immunochemical assay. The enzyme activity of isolated protein was detected. Efficient transformation of 2,3-DHB by transgenic plants was achieved and the lines also exhibited high production of biomass. The transgenic plants were more tolerant to the commercial PCBs mixture Delor 103 than non-transgenic tobacco. And finally, the higher decrease of total PCB content and especially congener 28 in real contaminated soil from a dumpsite was determined after cultivation of transgenic plant in comparison with nontransgenic tobacco. The substrate specificity of transgenic plants was the same as substrate specificity of BphC enzyme.

  18. GABAB Receptor Constituents Revealed by Tandem Affinity Purification from Transgenic Mice

    DEFF Research Database (Denmark)

    Bartoi, Tudor; Rigbolt, Kristoffer T G; Du, Dan

    2010-01-01

    lines that allow a straightforward biochemical isolation of GABA(B) receptors. The transgenic mice express GABA(B1) isoforms that contain sequences for a two-step affinity purification, in addition to their endogenous subunit repertoire. Comparative analyses of purified samples from the transgenic mice...... and wild-type control animals revealed two novel components of the GABA(B1) complex. One of the identified proteins, potassium channel tetramerization domain-containing protein 12, associates with heterodimeric GABA(B) receptors via the GABA(B2) subunit. In transfected hippocampal neurons, potassium...

  19. Seed protein electrophoresis for identification of fine fibre cotton line in Gossypium hirsutum L

    International Nuclear Information System (INIS)

    Gao Guoqiang; Lv Tiexin; Su Xuehe; Liu Xiaoyong; Wu Defang; Zhu Doubei

    2003-01-01

    Gel electrophoresis was conducted to test seed ethanol resolvable protein in cotton. 13 lines were used, including a fine fibre cotton line (98301) in G. hirsutum L., 4 varieties in G. barbadense L. and 8 varieties in G. hirsutum L.. In results of the 98301 line, Zhongmiansuo 12 and Shiyuan 321, no different protein electro-phoresis band pattern was shown among different seeds belong to the same variety, respectively. In comparison among the 98301 seeds sampled from seven different growth sets in Shandong province, their protein band patterns were the same. On the gel plate, three special bands were distinctive to all the varieties in G. hirsutum L. and other three special bands were distinctive to all the varieties in G. barbadense L.. The three characteristic bands of G. hirsutum L. appeared in the protein band pattern of the 98301 line. It showed that the seed protein composition of the line was inclined to G. hirsutum L. mainly. And, a characteristic band of G. Barbadense L. in the band pattern of the 98301 line proved that the fine fibre cotton line derived from a hybrid between G. barbadense and G. hirsutum L.. The 98301 line was easily distinguished from other varieties in G. hirsutum L. by its distinctive band, i.e. band No.1, and another island cotton band, i.e. band No.10

  20. Elevation of susceptibility to ozone-induced acute tracheobronchial injury in transgenic mice deficient in Clara cell secretory protein

    International Nuclear Information System (INIS)

    Plopper, C.G.; Mango, G.W.; Hatch, G.E.; Wong, V.J.; Toskala, E.; Reynolds, S.D.; Tarkington, B.K.; Stripp, B.R.

    2006-01-01

    Increases in Clara cell abundance or cellular expression of Clara cell secretory protein (CCSP) may cause increased tolerance of the lung to acute oxidant injury by repeated exposure to ozone (O 3 ). This study defines how disruption of the gene for CCSP synthesis affects the susceptibility of tracheobronchial epithelium to acute oxidant injury. Mice homozygous for a null allele of the CCSP gene (CCSP-/-) and wild type (CCSP+/+) littermates were exposed to ozone (0.2 ppm, 8 h; 1 ppm, 8 h) or filtered air. Injury was evaluated by light and scanning electron microscopy, and the abundance of necrotic, ciliated, and nonciliated cells was estimated by morphometry. Proximal and midlevel intrapulmonary airways and terminal bronchioles were evaluated. There was no difference in airway epithelial composition between CCSP+/+ and CCSP-/- mice exposed to filtered air, and exposure to 0.2 ppm ozone caused little injury to the epithelium of both CCSP+/+ and CCSP-/- mice. After exposure to 1.0 ppm ozone, CCSP-/- mice suffered from a greater degree of epithelial injury throughout the airways compared to CCSP+/+ mice. CCSP-/- mice had both ciliated and nonciliated cell injury. Furthermore, lack of CCSP was associated with a shift in airway injury to include proximal airway generations. Therefore, we conclude that CCSP modulates the susceptibility of the epithelium to oxidant-induced injury. Whether this is due to the presence of CCSP on the acellular lining layer surface and/or its intracellular distribution in the secretory cell population needs to be defined

  1. Comparative proteomics analysis of oral cancer cell lines: identification of cancer associated proteins

    Science.gov (United States)

    2014-01-01

    Background A limiting factor in performing proteomics analysis on cancerous cells is the difficulty in obtaining sufficient amounts of starting material. Cell lines can be used as a simplified model system for studying changes that accompany tumorigenesis. This study used two-dimensional gel electrophoresis (2DE) to compare the whole cell proteome of oral cancer cell lines vs normal cells in an attempt to identify cancer associated proteins. Results Three primary cell cultures of normal cells with a limited lifespan without hTERT immortalization have been successfully established. 2DE was used to compare the whole cell proteome of these cells with that of three oral cancer cell lines. Twenty four protein spots were found to have changed in abundance. MALDI TOF/TOF was then used to determine the identity of these proteins. Identified proteins were classified into seven functional categories – structural proteins, enzymes, regulatory proteins, chaperones and others. IPA core analysis predicted that 18 proteins were related to cancer with involvements in hyperplasia, metastasis, invasion, growth and tumorigenesis. The mRNA expressions of two proteins – 14-3-3 protein sigma and Stress-induced-phosphoprotein 1 – were found to correlate with the corresponding proteins’ abundance. Conclusions The outcome of this analysis demonstrated that a comparative study of whole cell proteome of cancer versus normal cell lines can be used to identify cancer associated proteins. PMID:24422745

  2. Elevated atmospheric ozone increases concentration of insecticidal Bacillus thuringiensis (Bt) Cry1Ac protein in Bt Brassica napus and reduces feeding of a Bt target herbivore on the non-transgenic parent

    International Nuclear Information System (INIS)

    Himanen, Sari J.; Nerg, Anne-Marja; Nissinen, Anne; Stewart, C. Neal; Poppy, Guy M.; Holopainen, Jarmo K.

    2009-01-01

    Sustained cultivation of Bacillus thuringiensis (Bt) transgenic crops requires stable transgene expression under variable abiotic conditions. We studied the interactions of Bt toxin production and chronic ozone exposure in Bt cry1Ac-transgenic oilseed rape and found that the insect resistance trait is robust under ozone elevations. Bt Cry1Ac concentrations were higher in the leaves of Bt oilseed rape grown under elevated ozone compared to control treatment, measured either per leaf fresh weight or per total soluble protein of leaves. The mean relative growth rate of a Bt target herbivore, Plutella xylostella L. larvae was negative on Bt plants in all ozone treatments. On the non-transgenic plants, larval feeding damage was reduced under elevated ozone. Our results indicate the need for monitoring fluctuations in Bt toxin concentrations to reveal the potential of ozone exposure for altering dosing of Bt proteins to target and non-target herbivores in field environments experiencing increasing ozone pollution. - Elevated atmospheric ozone can induce fluctuations in insecticidal protein concentrations in transgenic plants

  3. Elevated atmospheric ozone increases concentration of insecticidal Bacillus thuringiensis (Bt) Cry1Ac protein in Bt Brassica napus and reduces feeding of a Bt target herbivore on the non-transgenic parent

    Energy Technology Data Exchange (ETDEWEB)

    Himanen, Sari J. [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland)], E-mail: sari.himanen@uku.fi; Nerg, Anne-Marja [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland); Nissinen, Anne [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland); MTT Agrifood Research Finland, Plant Protection, FIN-31600 Jokioinen (Finland); Stewart, C. Neal [University of Tennessee, Department of Plant Sciences, Knoxville, TN 37996-4561 (United States); Poppy, Guy M. [University of Southampton, School of Biological Sciences, Southampton SO16 7PX (United Kingdom); Holopainen, Jarmo K. [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland)

    2009-01-15

    Sustained cultivation of Bacillus thuringiensis (Bt) transgenic crops requires stable transgene expression under variable abiotic conditions. We studied the interactions of Bt toxin production and chronic ozone exposure in Bt cry1Ac-transgenic oilseed rape and found that the insect resistance trait is robust under ozone elevations. Bt Cry1Ac concentrations were higher in the leaves of Bt oilseed rape grown under elevated ozone compared to control treatment, measured either per leaf fresh weight or per total soluble protein of leaves. The mean relative growth rate of a Bt target herbivore, Plutella xylostella L. larvae was negative on Bt plants in all ozone treatments. On the non-transgenic plants, larval feeding damage was reduced under elevated ozone. Our results indicate the need for monitoring fluctuations in Bt toxin concentrations to reveal the potential of ozone exposure for altering dosing of Bt proteins to target and non-target herbivores in field environments experiencing increasing ozone pollution. - Elevated atmospheric ozone can induce fluctuations in insecticidal protein concentrations in transgenic plants.

  4. Data on amyloid precursor protein accumulation, spontaneous physical activity, and motor learning after traumatic brain injury in the triple-transgenic mouse model of Alzheimer׳s disease

    Directory of Open Access Journals (Sweden)

    Yasushi Kishimoto

    2016-12-01

    Full Text Available This data article contains supporting information regarding the research article entitled “Traumatic brain injury accelerates amyloid-β deposition and impairs spatial learning in the triple-transgenic mouse model of Alzheimer׳s disease” (H. Shishido, Y. Kishimoto, N. Kawai, Y. Toyota, M. Ueno, T. Kubota, Y. Kirino, T. Tamiya, 2016 [1]. Triple-transgenic (3×Tg-Alzheimer׳s disease (AD model mice exhibited significantly poorer spatial learning than sham-treated 3×Tg-AD mice 28 days after traumatic brain injury (TBI. Correspondingly, amyloid-β (Aβ deposition within the hippocampus was significantly greater in 3×Tg-AD mice 28 days after TBI. However, data regarding the short-term and long-term influences of TBI on amyloid precursor protein (APP accumulation in AD model mice remain limited. Furthermore, there is little data showing whether physical activity and motor learning are affected by TBI in AD model mice. Here, we provide immunocytochemistry data confirming that TBI induces significant increases in APP accumulation in 3×Tg-AD mice at both 7 days and 28 days after TBI. Furthermore, 3×Tg-AD model mice exhibit a reduced ability to acquire conditioned responses (CRs during delay eyeblink conditioning compared to sham-treated 3×Tg-AD model mice 28 days after TBI. However, physical activity and motor performance are not significantly changed in TBI-treated 3×Tg-AD model mice.

  5. Ubiquitous overexpression of a transgene encoding the extracellular portion of the Drosophila roughest-irregular chiasm C protein induces early embryonic lethality.

    Science.gov (United States)

    Moda, L; Machado, R C; Ramos, R G

    2000-09-01

    The cell adhesion molecule Rst-irreC is a transmembrane glycoprotein of the immunoglobulin superfamily involved in several important developmental processes in Drosophila, including axonal pathfinding in the optic lobe and programmed cell death and pigment cell differentiation in the pupal retina. As an initial step towards the "in vivo" functional analysis of this protein we have generated transgenic fly stocks carrying a truncated cDNA construct encoding only the extracellular domain of Rst-IrreC under the transcriptional control of the heat shock inducible promoter hsp70. We show that heat-shocking embryos bearing the transgene during the first 8hs of development lead to a 3-4 fold reduction in their viability compared to wild type controls. The embryonic lethality can already be produced by applying the heat pulse in the first 3hs of embryonic development, does not seem to be suppressed in the absence of wildtype product and is progressively reduced as the heat treatment is applied later in embryogenesis. These results are compatible with the hypothesis of the lethal phenotype being primarily due to heterophilic interactions between Rst-IrreC extracellular domain and an yet unknown ligand.

  6. Extreme resistance to two Brazilian strains of Potato virus Y (PVY in transgenic potato, cv. Achat, expressing the PVYº coat protein Resistência extrema a duas estirpes do Potato virus Y (PVY de batata transgênica, cv. Achat, expressando o gene da capa protéica do PVY O

    Directory of Open Access Journals (Sweden)

    Eduardo Romano

    2001-07-01

    Full Text Available The coat protein (CP gene of the potato virus Y strain "o" (PVY O was introduced into potato, cultivar Achat, via Agrobacterium tumefaciens-mediated transformation. Sixty three putative transgenic lines were challenged against the Brazilian strains PVY-OBR and PVY-NBR. An extremely resistant phenotype, against the two strains, was observed in one line, denominated 1P. No symptoms or positive ELISA results were observed in 16 challenged plants from this line. Another clone, named as 63P, showed a lower level of resistance. Southern blot analysis showed five copies of the CP gene in the extremely resistant line and at least three copies in the other resistant line. The stability of the integrated transgenes in the extreme resistant line was examined during several in vitro multiplications over a period of three years, with no modification in the Southern pattern was observed. The stability of the transgenes, the absence of primary infections and the relatively broad spectrum of resistance suggest that the extremely resistant line obtained in this work can be useful for agricultural purposes.O gene da capa protéica (CP do Potato virus Y estirpe "o", foi introduzido em batata cultivar Achat, via Agrobacterium tumefaciens. Sessenta e três linhas possivelmente transgênicas foram desafiadas com as estirpes brasileiras PVY-OBR e PVY-NBR. Uma linha apresentou extrema resistência às duas estirpes inoculadas, e foi denominado clone 1P. Não foram observados sintomas sistêmicos de infecção e as plantas foram negativas em Elisa. Outra linha, denominada clone 63P, mostrou algum nível de resistência. Análises por Southern blot indicaram a presença de pelo menos cinco cópias do gen CP no clone 1P e pelo menos três cópias no clone 63P. A estabilidade do gene introduzido no clone 1P foi avaliada durante três anos, após várias multiplicações in vitro. Não foram observadas mudanças no padrão do Southern blot. A estabilidade do transgene, na

  7. Enhancement of naphthalene tolerance in transgenic Arabidopsis plants overexpressing the ferredoxin-like protein (ADI1) from rice.

    Science.gov (United States)

    Fu, Xiao-Yan; Zhu, Bo; Han, Hong-Juan; Zhao, Wei; Tian, Yong-Sheng; Peng, Ri-He; Yao, Quan-Hong

    2016-01-01

    The ADI1 Arabidopsis plants enhanced tolerance and degradation efficiency to naphthalene and had great potential for phytoremediation of naphthalene in the plant material before composting or harvesting and removal. Naphthalene is a global environmental concern, because this substance is assumed to contribute considerably to human cancer risk. Cleaning up naphthalene contamination in the environment is crucial. Phytoremediation is an efficient technology to clean up contaminants. However, no gene that can efficiently degrade exogenous recalcitrant naphthalene in plants has yet been discovered. Ferredoxin (Fd) is a key player of biological electron transfer reaction in the PAH degradation process. The biochemical pathway for bacterial degradation of naphthalene has been well investigated. In this study, a rice gene, ADI1, which codes for a putative photosynthetic-type Fd, has been transformed into Arabidopsis thaliana. The transgenic Arabidopsis plants enhanced tolerance and degradation efficiency of naphthalene. Compared with wild-type plants, transgenic plants assimilated naphthalene from the culture media faster and removed more of this substance. When taken together, our findings suggest that breeding plants with overexpressed ADI1 gene is an effective strategy to degrade naphthalene in the environment.

  8. Detailed characterization of Mirafiori lettuce virus-resistant transgenic lettuce.

    Science.gov (United States)

    Kawazu, Yoichi; Fujiyama, Ryoi; Noguchi, Yuji; Kubota, Masaharu; Ito, Hidekazu; Fukuoka, Hiroyuki

    2010-04-01

    Lettuce big-vein disease is caused by Mirafiori lettuce virus (MiLV), which is vectored by the soil-borne fungus Olpidium brassicae. A MiLV-resistant transgenic lettuce line was developed through introducing inverted repeats of the MiLV coat protein (CP) gene. Here, a detailed characterization study of this lettuce line was conducted by comparing it with the parental, non-transformed 'Kaiser' cultivar. There were no significant differences between transgenic and non-transgenic lettuce in terms of pollen fertility, pollen dispersal, seed production, seed dispersal, dormancy, germination, growth of seedlings under low or high temperature, chromatographic patterns of leaf extracts, or effects of lettuce on the growth of broccoli or soil microflora. A significant difference in pollen size was noted, but the difference was small. The length of the cotyledons of the transgenic lettuce was shorter than that of 'Kaiser,' but there were no differences in other morphological characteristics. Agrobacterium tumefaciens used for the production of transgenic lettuce was not detected in transgenic seeds. The transgenic T(3), T(4), and T(5) generations showed higher resistance to MiLV and big-vein symptoms expression than the resistant 'Pacific' cultivar, indicating that high resistance to lettuce big-vein disease is stably inherited. PCR analysis showed that segregation of the CP gene was nearly 3:1 in the T(1) and T(2) generations, and that the transgenic T(3) generation was homozygous for the CP gene. Segregation of the neomycin phosphotransferase II (npt II) gene was about 3:1 in the T(1) generation, but the full length npt II gene was not detected in the T(2) or T(3) generation. The segregation pattern of the CP and npt II genes in the T(1) generation showed the expected 9:3:3:1 ratio. These results suggest that the fragment including the CP gene and that including the npt II gene have been integrated into two unlinked loci, and that the T(1) plant selected in our study did

  9. Analysis of human protein replacement stable cell lines established using snoMEN-PR vector.

    Directory of Open Access Journals (Sweden)

    Motoharu Ono

    Full Text Available The study of the function of many human proteins is often hampered by technical limitations, such as cytotoxicity and phenotypes that result from overexpression of the protein of interest together with the endogenous version. Here we present the snoMEN (snoRNA Modulator of gene ExpressioN vector technology for generating stable cell lines where expression of the endogenous protein can be reduced and replaced by an exogenous protein, such as a fluorescent protein (FP-tagged version. SnoMEN are snoRNAs engineered to contain complementary sequences that can promote knock-down of targeted RNAs. We have established and characterised two such partial protein replacement human cell lines (snoMEN-PR. Quantitative mass spectrometry was used to analyse the specificity of knock-down and replacement at the protein level and also showed an increased pull-down efficiency of protein complexes containing exogenous, tagged proteins in the protein replacement cell lines, as compared with conventional co-expression strategies. The snoMEN approach facilitates the study of mammalian proteins, particularly those that have so far been difficult to investigate by exogenous expression and has wide applications in basic and applied gene-expression research.

  10. The CNS in inbred transgenic models of 4-repeat Tauopathy develops consistent tau seeding capacity yet focal and diverse patterns of protein deposition.

    Science.gov (United States)

    Eskandari-Sedighi, Ghazaleh; Daude, Nathalie; Gapeshina, Hristina; Sanders, David W; Kamali-Jamil, Razieh; Yang, Jing; Shi, Beipei; Wille, Holger; Ghetti, Bernardino; Diamond, Marc I; Janus, Christopher; Westaway, David

    2017-10-04

    MAPT mutations cause neurodegenerative diseases such as frontotemporal dementia but, strikingly, patients with the same mutation may have different clinical phenotypes. Given heterogeneities observed in a transgenic (Tg) mouse line expressing low levels of human (2 N, 4R) P301L Tau, we backcrossed founder stocks of mice to C57BL/6Tac, 129/SvEvTac and FVB/NJ inbred backgrounds to discern the role of genetic versus environmental effects on disease-related phenotypes. Three inbred derivatives of a TgTau P301L founder line had similar quality and steady-state quantity of Tau production, accumulation of abnormally phosphorylated 64-68 kDa Tau species from 90 days of age onwards and neuronal loss in aged Tg mice. Variegation was not seen in the pattern of transgene expression and seeding properties in a fluorescence-based cellular assay indicated a single "strain" of misfolded Tau. However, in other regards, the aged Tg mice were heterogeneous; there was incomplete penetrance for Tau deposition despite maintained transgene expression in aged animals and, for animals with Tau deposits, distinctions were noted even within each subline. Three classes of rostral deposition in the cortex, hippocampus and striatum accounted for 75% of pathology-positive mice yet the mean ages of mice scored as class I, II or III were not significantly different and, hence, did not fit with a predictable progression from one class to another defined by chronological age. Two other patterns of Tau deposition designated as classes IV and V, occurred in caudal structures. Other pathology-positive Tg mice of similar age not falling within classes I-V presented with focal accumulations in additional caudal neuroanatomical areas including the locus coeruleus. Electron microscopy revealed that brains of Classes I, II and IV animals all exhibit straight filaments, but with coiled filaments and occasional twisted filaments apparent in Class I. Most strikingly, Class I, II and IV animals presented

  11. Tetrahydroxystilbene glucoside modulates amyloid precursor protein processing via activation of AKT-GSK3β pathway in cells and in APP/PS1 transgenic mice.

    Science.gov (United States)

    Yin, Xiaomin; Chen, Chen; Xu, Ting; Li, Lin; Zhang, Lan

    2018-01-01

    Alternative splicing of amyloid precursor protein (APP) exon 7 generates the isoforms containing a Kunitz protease inhibitor (KPI) domain. APP-KPI levels in the brain are correlated with amyloid beta (Aβ) production. Here, we determined the effect of Tetrahydroxystilbene glucoside (TSG) on the AKT-GSK3β pathway. We found GSK3β increased APP-KPI inclusion level and interacted with the splicing factor ASF. TSG was intragastrically administered to 5-month-old APP/PS1 transgenic mice for 12 months. We found that the activated the AKT-GSK3β signaling pathway suppressed APP-KPI inclusion. Moreover, TSG treatment attenuated amyloid deposition in APP/PS1 mice. This study demonstrates the neuroprotective effect of TSG on APP expression, suggesting that TSG may be beneficial for AD prevention and treatment. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Accumulation of nickel in transgenic tobacco

    Science.gov (United States)

    Sidik, Nik Marzuki; Othman, Noor Farhan

    2013-11-01

    The accumulation of heavy metal Ni in the roots and leaves of four T1 transgenic lines of tobacco (T(1)20E, T(1)24C, T(1)18B1 and T(1)20B) expressing eiMT1 from E.indica was assessed. The aim of the study was to investigate the level of Ni accumulation in the leaves and roots of each transgenic lines and to evaluate the eligibility of the plants to be classified as a phytoremediation agent. All of the transgenic lines showed different ability in accumulating different metals and has translocation factor (TF) less than 1 (TFtransgenic lines, transgenic line T(1)24C showed the highest accumulation of Ni (251.9 ± 0.014 mg/kg) and the lowest TF value (TFT(1)24C=0.0875) at 60 ppm Ni.

  13. Food safety knowledge on the Bt mutant protein Cry8Ka5 employed in the development of coleopteran-resistant transgenic cotton plants.

    Science.gov (United States)

    Farias, Davi F; Peijnenburg, Ad A C M; Grossi-de-Sá, Maria F; Carvalho, Ana F U

    2015-01-01

    Insecticidal Cry proteins from Bacillus thuringiensis (Bt) have been exploited in the development of genetically modified (GM) crops for pest control. However, several pests are still difficult to control such as the coleopteran boll weevil Anthonomus grandis. By applying in vitro molecular evolution to the cry8Ka1 gene sequence, variants were generated with improved activity against A. grandis. Among them, Cry8Ka5 mutant protein showed coleoptericidal activity 3-fold higher (LC50 2.83 μg/mL) than that of the original protein (Cry8Ka1). Cry8Ka5 has been used in breeding programs in order to obtain coleopteran-resistant cotton plants. Nevertheless, there is some concern in relation to the food safety of transgenic crops, especially to the heterologously expressed proteins. In this context, our research group has performed risk assessment studies on Cry8Ka5, using the tests recommended by Codex as well as tests that we proposed as alternative and/or complementary approaches. Our results on the risk analysis of Cry8Ka5 taken together with those of other Cry proteins, point out that there is a high degree of certainty on their food safety. It is reasonable to emphasize that most safety studies on Cry proteins have essentially used the Codex approach. However, other methodologies would potentially provide additional information such as studies on the effects of Cry proteins and derived peptides on the indigenous gastrointestinal microbiota and on intestinal epithelial cells of humans. Additionally, emerging technologies such as toxicogenomics potentially will offer sensitive alternatives for some current approaches or methods.

  14. Regulation of Expression of the prb-1b / ACC Deaminase gene by UV-B in Transgenic tomatoes

    International Nuclear Information System (INIS)

    Tamot, B.K.; Pauls, K.P.; Glick, R.

    2003-01-01

    Transgenic tomato plants with 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase gene from Enterobacter cloacae UWA4 under the control of a pathogenesis-related promoter (prb-1b) from tobacco were challenged by abiotic stresses to determine the expression patterns of the transgene. No ACC deaminase RNA or protein was detected bu RT-PCR and in western blots prepared from leaf proteins of transgenic plants after wounding or treatment with alpha-amino butyric acid, xylanase, ethephon, salicylic acid, jasmonic acid , ethylene, or ethylene plus jasmonic acid. However, expression of the ACC deaminase transgene was observed in leaves and roots of transformed tomato lines exposed to UV light. The UV response required a minimum of 48 h of exposure and was specific to UV-B light

  15. Protein profile of human hepatocarcinoma cell line SMMC-7721: Identification and functional analysis

    OpenAIRE

    Feng, Yi; Tian, Zhong-Min; Wan, Ming-Xi; Zheng, Zhao-Bin

    2007-01-01

    AIM: To investigate the protein profile of human hepatocarcinoma cell line SMMC-7721, to analyze the specific functions of abundant expressed proteins in the processes of hepatocarcinoma genesis, growth and metastasis, to identify the hepatocarcinoma-specific biomarkers for the early prediction in diagnosis, and to explore the new drug targets for liver cancer therapy.

  16. Circumsporozoite Protein-Specific Kd-Restricted CD8+ T Cells Mediate Protective Antimalaria Immunity in Sporozoite-Immunized MHC-I-Kd Transgenic Mice

    Directory of Open Access Journals (Sweden)

    Jing Huang

    2014-01-01

    Full Text Available Although the roles of CD8+ T cells and a major preerythrocytic antigen, the circumsporozoite (CS protein, in contributing protective antimalaria immunity induced by radiation-attenuated sporozoites, have been shown by a number of studies, the extent to which these players contribute to antimalaria immunity is still unknown. To address this question, we have generated C57BL/6 (B6 transgenic (Tg mice, expressing Kd molecules under the MHC-I promoter, called MHC-I-Kd-Tg mice. In this study, we first determined that a single immunizing dose of IrPySpz induced a significant level of antimalaria protective immunity in MHC-I-Kd-Tg mice but not in B6 mice. Then, by depleting various T-cell subsets in vivo, we determined that CD8+ T cells are the main mediator of the protective immunity induced by IrPySpz. Furthermore, when we immunized (MHC-I-Kd-Tg × CS-Tg F1 mice with IrPySpz after crossing MHC-I-Kd-Tg mice with PyCS-transgenic mice (CS-Tg, which are unable to mount PyCS-specific immunity, we found that IrPySpz immunization failed to induce protective antimalaria immunity in (MHC-I-Kd-Tg × CS-Tg F1 mice, thus indicating the absence of PyCS antigen-dependent immunity in these mice. These results indicate that protective antimalaria immunity induced by IrPySpz in MHC-I-Kd-Tg mice is mediated by CS protein-specific, Kd-restricted CD8+ T cells.

  17. Molecular Basis of Protein Structure in Proanthocyanidin and Anthocyanin-Enhanced Lc-transgenic Alfalfa in Relation to Nutritive Value Using Synchrotron-Radiation FTIR Microspectroscopy: A Novel Approach

    International Nuclear Information System (INIS)

    Yu, P.; Jonker, A.; Gruber, M.

    2009-01-01

    To date there has been very little application of synchrotron radiation-based Fourier transform infrared microspectroscopy (SRFTIRM) to the study of molecular structures in plant forage in relation to livestock digestive behavior and nutrient availability. Protein inherent structure, among other factors such as protein matrix, affects nutritive quality, fermentation and degradation behavior in both humans and animals. The relative percentage of protein secondary structure influences protein value. A high percentage of e-sheets usually reduce the access of gastrointestinal digestive enzymes to the protein. Reduced accessibility results in poor digestibility and as a result, low protein value. The objective of this study was to use SRFTIRM to compare protein molecular structure of alfalfa plant tissues transformed with the maize Lc regulatory gene with non-transgenic alfalfa protein within cellular and subcellular dimensions and to quantify protein inherent structure profiles using Gaussian and Lorentzian methods of multi-component peak modeling. Protein molecular structure revealed by this method included a-helices, e-sheets and other structures such as e-turns and random coils. Hierarchical cluster analysis and principal component analysis of the synchrotron data, as well as accurate spectral analysis based on curve fitting, showed that transgenic alfalfa contained a relatively lower (P 0.05) in the ratio of a-helices to e-sheets (average: 1.4) and higher (P 0.05) in the vibrational intensity of protein amide I (average of 24) and amide II areas (average of 10) and their ratio (average of 2.4) compared with non-transgenic alfalfa. Cluster analysis and principal component analysis showed no significant differences between the two genotypes in the broad molecular fingerprint region, amides I and II regions, and the carbohydrate molecular region, indicating they are highly related to each other. The results suggest that transgenic Lc-alfalfa leaves contain similar

  18. Protein profile of human hepatocarcinoma cell line SMMC-7721: Identification and functional analysis

    Institute of Scientific and Technical Information of China (English)

    Yi Feng; Zhong-Min Tian; Ming-Xi Wan; Zhao-Bin Zheng

    2007-01-01

    AIM: To investigate the protein profile of human hepatocarcinoma cell line SMMC-7721, to analyze the specific functions of abundant expressed proteins in the processes of hepatocarcinoma genesis, growth and metastasis, to identify the hepatocarcinoma-specific biomarkers for the early prediction in diagnosis, and to explore the new drug targets for liver cancer therapy.METHODS: Total proteins from human hepatocarcinomacell line SMMC-7721 were separated by two-dimensional electrophoresis (2DE). The silver-stained gel was analyzed by 2DE software Image Master 2D Elite.Interesting protein spots were identified by peptide mass fingerprinting based on matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS)and database searching.RESULTS: We obtained protein profile of human hepatocarcinoma cell line SMMC-7721. Among the twenty-one successfully identified proteins, mitofilin,endoplasmic reticulum protein ERp29, ubiquinol-cytochrome C reductase complex core protein Ⅰ,peroxisomal enoyl CoA hydratase, peroxiredoxin-4 and probable 3-oxoacid CoA transferase 1 precursor were the six novel proteins identified in human hepatocarcinoma cells or tissues. Specific functions of the identified heat-shock proteins were analyzed in detail, and the results suggested that these proteins might promote tumorigenesis via inhibiting cell death induced by several cancer-related stresses or via inhibiting apoptosis at multiple points in the apoptotic signal pathway. Other identified chaperones and cancer-related proteins were also analyzed.CONCLUSION: Based on the protein profile of SMMC-7721 cells, functional analysis suggests that the identified chaperones and cancer-related proteins have their own pathways to contribute to the tumorigenesis, tumor growth and metastasis of liver cancer. Furthermore, proteomic analysis is indicated to be feasible in the cancer study.

  19. Neutron beam-line shield design for the protein crystallography instrument at the Lujan Center

    International Nuclear Information System (INIS)

    Russell, G.J.; Pitcher, E.J.; Muhrer, G.; Ferguson, P.D.

    2001-01-01

    We have developed a very useful methodology for calculating absolute total (neutron plus gamma-ray) dose equivalent rates for use in the design of neutron beam line shields at a spallation neutron source. We have applied this technique to the design of beam line shields for several new materials science instruments being built at the Manuel Lujan Jr. Neutron Scattering Center. These instruments have a variety of collimation systems and different beam line shielding issues. We show here some specific beam line shield designs for the Protein Crystallography Instrument. (author)

  20. Silencing of omega-5 gliadins in transgenic wheat eliminates a major source of environmental variability and improves dough mixing properties of flour.

    Science.gov (United States)

    Altenbach, Susan B; Tanaka, Charlene K; Seabourn, Bradford W

    2014-12-24

    The end-use quality of wheat flour varies as a result of the growth conditions of the plant. Among the wheat gluten proteins, the omega-5 gliadins have been identified as a major source of environmental variability, increasing in proportion in grain from plants that receive fertilizer or are subjected to high temperatures during grain development. The omega-5 gliadins also have been associated with the food allergy wheat-dependent exercise-induced anaphylaxis (WDEIA). Recently, transgenic lines with reduced levels of omega-5 gliadins were developed using RNA interference (RNAi). These lines make it possible to determine whether changes in the levels of omega-5 gliadins in response to environmental conditions and agronomic inputs may be responsible for changes in flour end-use quality. Two transgenic wheat lines and a non-transgenic control were grown under a controlled temperature regimen with or without post-anthesis fertilizer and the protein composition of the resulting flour was analyzed by quantitative two-dimensional gel electrophoresis (2-DE). In one transgenic line, all 2-DE spots identified as omega-5 gliadins were substantially reduced without effects on other proteins. In the other transgenic line, the omega-5 gliadins were absent and there was a partial reduction in the levels of the omega-1,2 gliadins and the omega-1,2 chain-terminating gliadins as well as small changes in several other proteins. With the exception of the omega gliadins, the non-transgenic control and the transgenic plants showed similar responses to the fertilizer treatment. Protein contents of flour were determined by the fertilizer regimen and were similar in control and transgenic samples produced under each regimen while both mixing time and mixing tolerance were improved in flour from transgenic lines when plants received post-anthesis fertilizer. The data indicate that omega-5 gliadins have a negative effect on flour quality and suggest that changes in quality with the growth

  1. Identification of proteins sensitive to thermal stress in human neuroblastoma and glioma cell lines.

    Directory of Open Access Journals (Sweden)

    Guilian Xu

    Full Text Available Heat-shock is an acute insult to the mammalian proteome. The sudden elevation in temperature has far-reaching effects on protein metabolism, leads to a rapid inhibition of most protein synthesis, and the induction of protein chaperones. Using heat-shock in cells of neuronal (SH-SY5Y and glial (CCF-STTG1 lineage, in conjunction with detergent extraction and sedimentation followed by LC-MS/MS proteomic approaches, we sought to identify human proteins that lose solubility upon heat-shock. The two cell lines showed largely overlapping profiles of proteins detected by LC-MS/MS. We identified 58 proteins in detergent insoluble fractions as losing solubility in after heat shock; 10 were common between the 2 cell lines. A subset of the proteins identified by LC-MS/MS was validated by immunoblotting of similarly prepared fractions. Ultimately, we were able to definitively identify 3 proteins as putatively metastable neural proteins; FEN1, CDK1, and TDP-43. We also determined that after heat-shock these cells accumulate insoluble polyubiquitin chains largely linked via lysine 48 (K-48 residues. Collectively, this study identifies human neural proteins that lose solubility upon heat-shock. These proteins may represent components of the human proteome that are vulnerable to misfolding in settings of proteostasis stress.

  2. Safety evaluation of the phosphinothricin acetyltransferase proteins encoded by the pat and bar sequences that confer tolerance to glufosinate-ammonium herbicide in transgenic plants.

    Science.gov (United States)

    Hérouet, Corinne; Esdaile, David J; Mallyon, Bryan A; Debruyne, Eric; Schulz, Arno; Currier, Thomas; Hendrickx, Koen; van der Klis, Robert-Jan; Rouan, Dominique

    2005-03-01

    Transgenic plant varieties, which are tolerant to glufosinate-ammonium, were developed. The herbicide tolerance is based upon the presence of either the bar or the pat gene, which encode for two homologous phosphinothricin acetyltransferases (PAT), in the plant genome. Based on both a review of published literature and experimental studies, the safety assessment reviews the first step of a two-step-approach for the evaluation of the safety of the proteins expressed in plants. It can be used to support the safety of food or feed products derived from any crop that contains and expresses these PAT proteins. The safety evaluation supports the conclusion that the genes and the donor microorganisms (Streptomyces) are innocuous. The PAT enzymes are highly specific and do not possess the characteristics associated with food toxins or allergens, i.e., they have no sequence homology with any known allergens or toxins, they have no N-glycosylation sites, they are rapidly degraded in gastric and intestinal fluids, and they are devoid of adverse effects in mice after intravenous administration at a high dose level. In conclusion, there is a reasonable certainty of no harm resulting from the inclusion of the PAT proteins in human food or in animal feed.

  3. Microarray analysis of androgen-regulated gene expression in testis: the use of the androgen-binding protein (ABP-transgenic mouse as a model

    Directory of Open Access Journals (Sweden)

    Grossman Gail

    2005-12-01

    Full Text Available Abstract Background Spermatogenesis is an androgen-dependent process, yet the molecular mechanisms of androgens' actions in testis are poorly understood. Transgenic mice overexpressing rat androgen-binding protein (ABP in their testes have reduced levels of intratesticular androgens and, as a result, show a progressive impairment of spermatogenesis. We used this model to characterize changes in global gene expression in testis in response to reduced bioavailability of androgens. Methods Total RNA was extracted from testes of 30-day old transgenic and wild-type control mice, converted to cRNA, labeled with biotin, and hybridized to oligonucleotide microarrays. Microarray results were confirmed by real-time reverse transcription polymerase chain reaction. Results Three-hundred-eighty-one genes (3.05% of all transcripts represented on the chips were up-regulated and 198 genes (1.59% were down-regulated by at least a factor of 2 in the androgen-deficient animals compared to controls. Genes encoding membrane proteins, intracellular signaling molecules, enzymes, proteins participating in the immune response, and those involved in cytoskeleton organization were significantly overrepresented in the up-regulated group. Among the down-regulated transcripts, those coding for extracellular proteins were overrepresented most dramatically, followed by those related to proteolysis, cell adhesion, immune response, and growth factor, cytokine, and ion channel activities. Transcripts with the greatest potential impact on cellular activities included several transcription factors, intracellular signal transducers, secreted signaling molecules and enzymes, and various cell surface molecules. Major nodes in the up-regulated network were IL-6, AGT, MYC, and A2M, those in the down-regulated network were IL-2, -4, and -10, MAPK8, SOCS1, and CREB1. Conclusion Microarray analysis followed by gene ontology profiling and connectivity analysis identified several functional

  4. Overexpression of the IbMYB1 gene in an orange-fleshed sweet potato cultivar produces a dual-pigmented transgenic sweet potato with improved antioxidant activity.

    Science.gov (United States)

    Park, Sung-Chul; Kim, Yun-Hee; Kim, Sun Ha; Jeong, Yu Jeong; Kim, Cha Young; Lee, Joon Seol; Bae, Ji-Yeong; Ahn, Mi-Jeong; Jeong, Jae Cheol; Lee, Haeng-Soon; Kwak, Sang-Soo

    2015-04-01

    The R2R3-type protein IbMYB1 is a key regulator of anthocyanin biosynthesis in the storage roots of sweet potato [Ipomoea batatas (L.) Lam]. Previously, we demonstrated that IbMYB1 expression stimulated anthocyanin pigmentation in tobacco leaves and Arabidopsis. Here, we generated dual-pigmented transgenic sweet potato plants that accumulated high levels of both anthocyanins and carotenoids in a single sweet potato storage root. An orange-fleshed cultivar with high carotenoid levels was transformed with the IbMYB1 gene under the control of either the storage root-specific sporamin 1 (SPO1) promoter or the oxidative stress-inducible peroxidase anionic 2 (SWPA2) promoter. The SPO1-MYB transgenic lines exhibited higher anthocyanin levels in storage roots than empty vector control (EV) or SWPA2-MYB plants, but carotenoid content was unchanged. SWPA2-MYB transgenic lines exhibited higher levels of both anthocyanin and carotenoids than EV plants. Analysis of hydrolyzed anthocyanin extracts indicated that cyanidin and peonidin predominated in both overexpression lines. Quantitative reverse transcription-polymerase chain reaction analysis demonstrated that IbMYB1 expression in both IbMYB1 transgenic lines strongly induced the upregulation of several genes in the anthocyanin biosynthetic pathway, whereas the expression of carotenoid biosynthetic pathway genes varied between transgenic lines. Increased anthocyanin levels in transgenic plants also promoted the elevation of proanthocyanidin and total phenolic levels in fresh storage roots. Consequently, all IbMYB1 transgenic plants displayed much higher antioxidant activities than EV plants. In field cultivations, storage root yields varied between the transgenic lines. Taken together, our results indicate that overexpression of IbMYB1 is a highly promising strategy for the generation of transgenic plants with enhanced antioxidant capacity. © 2014 Scandinavian Plant Physiology Society.

  5. Hepatic oxidative stress in ovariectomized transgenic mice expressing the hepatitis C virus polyprotein is augmented through suppression of adenosine monophosphate-activated protein kinase/proliferator-activated receptor gamma co-activator 1 alpha signaling.

    Science.gov (United States)

    Tomiyama, Yasuyuki; Nishina, Sohji; Hara, Yuichi; Kawase, Tomoya; Hino, Keisuke

    2014-10-01

    Oxidative stress plays an important role in hepatocarcinogenesis of hepatitis C virus (HCV)-related chronic liver diseases. Despite the evidence of an increased proportion of females among elderly patients with HCV-related hepatocellular carcinoma (HCC), it remains unknown whether HCV augments hepatic oxidative stress in postmenopausal women. The aim of this study was to determine whether oxidative stress was augmented in ovariectomized (OVX) transgenic mice expressing the HCV polyprotein and to investigate its underlying mechanisms. OVX and sham-operated female transgenic mice expressing the HCV polyprotein and non-transgenic littermates were assessed for the production of reactive oxygen species (ROS), expression of inflammatory cytokines and antioxidant potential in the liver. Compared with OVX non-transgenic mice, OVX transgenic mice showed marked hepatic steatosis and ROS production without increased induction of inflammatory cytokines, but there was no increase in ROS-detoxifying enzymes such as superoxide dismutase 2 and glutathione peroxidase 1. In accordance with these results, OVX transgenic mice showed less activation of peroxisome proliferator-activated receptor-γ co-activator-1α (PGC-1α), which is required for the induction of ROS-detoxifying enzymes, and no activation of adenosine monophosphate-activated protein kinase-α (AMPKα), which regulates the activity of PGC-1α. Our study demonstrated that hepatic oxidative stress was augmented in OVX transgenic mice expressing the HCV polyprotein by attenuation of antioxidant potential through inhibition of AMPK/PGC-1α signaling. These results may account in part for the mechanisms by which HCV-infected women are at high risk for HCC development when some period has passed after menopause. © 2013 The Japan Society of Hepatology.

  6. Transgenic overexpression of pregnancy-associated plasma protein-A in murine arterial smooth muscle accelerates atherosclerotic lesion development

    DEFF Research Database (Denmark)

    Conover, Cheryl A.; Mason, Megan A.; Bale, Laurie K.

    2010-01-01

    Pregnancy-associated plasma protein-A (PAPP-A) increases local IGF-I bioavailability through cleavage of inhibitory IGF binding protein (IGFBP)-4 in a variety of systems, including the cardiovascular system. To test the hypothesis that expression of PAPP-A promotes the development of atherosclero......Pregnancy-associated plasma protein-A (PAPP-A) increases local IGF-I bioavailability through cleavage of inhibitory IGF binding protein (IGFBP)-4 in a variety of systems, including the cardiovascular system. To test the hypothesis that expression of PAPP-A promotes the development...

  7. In vitro culture may be the major contributing factor for transgenic versus nontransgenic proteomic plant differences.

    Science.gov (United States)

    Fonseca, Cátia; Planchon, Sébastien; Serra, Tânia; Chander, Subhash; Saibo, Nelson J M; Renaut, Jenny; Oliveira, M Margarida; Batista, Rita

    2015-01-01

    Identification of differences between genetically modified plants and their original counterparts plays a central role in risk assessment strategy. Our main goal was to better understand the relevance of transgene presence, genetic, and epigenetic changes induced by transgene insertion, and in vitro culture in putative unintended differences between a transgenic and its comparator. Thus, we have used multiplex fluorescence 2DE coupled with MS to characterize the proteome of three different rice lines (Oryza sativa L. ssp. japonica cv. Nipponbare): a control conventional line (C), an Agrobacterium-transformed transgenic line (Ta) and a negative segregant (NSb). We observed that Ta and NSb appeared identical (with only one spot differentially abundant--fold difference ≥ 1.5), contrasting with the control (49 spots with fold difference ≥ 1.5, in both Ta and NSb vs. control). Given that in vitro culture was the only event in common between Ta and NSb, we hypothesize that in vitro culture stress was the most relevant condition contributing for the observed proteomic differences. MS protein identification support our hypothesis, indicating that Ta and NSb lines adjusted their metabolic pathways and altered the abundance of several stress related proteins in order to cope with in vitro culture. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. 2013 North Dakota Transgenic Barley Research and FHB Nursery Report

    Science.gov (United States)

    Research continues to develop and test new transgenic plants using genes provided by collaborators. As lines are developed in Golden Promise, they are crossed to Conlon for field testing. Transgenic lines developed in Conlon are being crossed to resistant lines developed by the breeding programs. ...

  9. GmPGIP3 enhanced resistance to both take-all and common root rot diseases in transgenic wheat.

    Science.gov (United States)

    Wang, Aiyun; Wei, Xuening; Rong, Wei; Dang, Liang; Du, Li-Pu; Qi, Lin; Xu, Hui-Jun; Shao, Yanjun; Zhang, Zengyan

    2015-05-01

    Take-all (caused by the fungal pathogen Gaeumannomyces graminis var. tritici, Ggt) and common root rot (caused by Bipolaris sorokiniana) are devastating root diseases of wheat (Triticum aestivum L.). Development of resistant wheat cultivars has been a challenge since no resistant wheat accession is available. GmPGIP3, one member of polygalacturonase-inhibiting protein (PGIP) family in soybean (Glycine max), exhibited inhibition activity against fungal endopolygalacturonases (PGs) in vitro. In this study, the GmPGIP3 transgenic wheat plants were generated and used to assess the effectiveness of GmPGIP3 in protecting wheat from the infection of Ggt and B. sorokiniana. Four independent transgenic lines were identified by genomic PCR, Southern blot, and reverse transcription PCR (RT-PCR). The introduced GmPGIP3 was integrated into the genomes of these transgenic lines and could be expressed. The expressing GmPGIP3 protein in these transgenic wheat lines could inhibit the PGs produced by Ggt and B. sorokiniana. The disease response assessments postinoculation showed that the GmPGIP3-expressing transgenic wheat lines displayed significantly enhanced resistance to both take-all and common root rot diseases caused by the infection of Ggt and B. sorokiniana. These data suggested that GmPGIP3 is an attractive gene resource in improving resistance to both take-all and common root rot diseases in wheat.

  10. Liver Growth Factor (LGF Upregulates Frataxin Protein Expression and Reduces Oxidative Stress in Friedreich’s Ataxia Transgenic Mice

    Directory of Open Access Journals (Sweden)

    Lucía Calatrava-Ferreras

    2016-12-01

    Full Text Available Friedreich’s ataxia (FA is a severe disorder with autosomal recessive inheritance that is caused by the abnormal expansion of GAA repeat in intron 1 of FRDA gen. This alteration leads to a partial silencing of frataxin transcription, causing a multisystem disorder disease that includes neurological and non-neurological damage. Recent studies have proven the effectiveness of neurotrophic factors in a number of neurodegenerative diseases. Therefore, we intend to determine if liver growth factor (LGF, which has a demonstrated antioxidant and neuroprotective capability, could be a useful therapy for FA. To investigate the potential therapeutic activity of LGF we used transgenic mice of the FXNtm1MknTg (FXNYG8Pook strain. In these mice, intraperitoneal administration of LGF (1.6 μg/mouse exerted a neuroprotective effect on neurons of the lumbar spinal cord and improved cardiac hypertrophy. Both events could be the consequence of the increment in frataxin expression induced by LGF in spinal cord (1.34-fold and heart (1.2-fold. LGF also upregulated by 2.6-fold mitochondrial chain complex IV expression in spinal cord, while in skeletal muscle it reduced the relation oxidized glutathione/reduced glutathione. Since LGF partially restores motor coordination, we propose LGF as a novel factor that may be useful in the treatment of FA.

  11. The mechanism of thioacetamide-induced apoptosis in the L37 albumin-SV40 T-antigen transgenic rat hepatocyte-derived cell line occurs without DNA fragmentation.

    Science.gov (United States)

    Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C

    1998-10-01

    The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.

  12. Inherited prion disease A117V is not simply a proteinopathy but produces prions transmissible to transgenic mice expressing homologous prion protein.

    Directory of Open Access Journals (Sweden)

    Emmanuel A Asante

    Full Text Available Prions are infectious agents causing fatal neurodegenerative diseases of humans and animals. In humans, these have sporadic, acquired and inherited aetiologies. The inherited prion diseases are caused by one of over 30 coding mutations in the human prion protein (PrP gene (PRNP and many of these generate infectious prions as evidenced by their experimental transmissibility by inoculation to laboratory animals. However, some, and in particular an extensively studied type of Gerstmann-Sträussler-Scheinker syndrome (GSS caused by a PRNP A117V mutation, are thought not to generate infectious prions and instead constitute prion proteinopathies with a quite distinct pathogenetic mechanism. Multiple attempts to transmit A117V GSS have been unsuccessful and typical protease-resistant PrP (PrP(Sc, pathognomonic of prion disease, is not detected in brain. Pathogenesis is instead attributed to production of an aberrant topological form of PrP, C-terminal transmembrane PrP ((CtmPrP. Barriers to transmission of prion strains from one species to another appear to relate to structural compatibility of PrP in host and inoculum and we have therefore produced transgenic mice expressing human 117V PrP. We found that brain tissue from GSS A117V patients did transmit disease to these mice and both the neuropathological features of prion disease and presence of PrP(Sc was demonstrated in the brains of recipient transgenic mice. This PrP(Sc rapidly degraded during laboratory analysis, suggesting that the difficulty in its detection in patients with GSS A117V could relate to post-mortem proteolysis. We conclude that GSS A117V is indeed a prion disease although the relative contributions of (CtmPrP and prion propagation in neurodegeneration and their pathogenetic interaction remains to be established.

  13. Inherited prion disease A117V is not simply a proteinopathy but produces prions transmissible to transgenic mice expressing homologous prion protein.

    Science.gov (United States)

    Asante, Emmanuel A; Linehan, Jacqueline M; Smidak, Michelle; Tomlinson, Andrew; Grimshaw, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Powell, Caroline; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John

    2013-01-01

    Prions are infectious agents causing fatal neurodegenerative diseases of humans and animals. In humans, these have sporadic, acquired and inherited aetiologies. The inherited prion diseases are caused by one of over 30 coding mutations in the human prion protein (PrP) gene (PRNP) and many of these generate infectious prions as evidenced by their experimental transmissibility by inoculation to laboratory animals. However, some, and in particular an extensively studied type of Gerstmann-Sträussler-Scheinker syndrome (GSS) caused by a PRNP A117V mutation, are thought not to generate infectious prions and instead constitute prion proteinopathies with a quite distinct pathogenetic mechanism. Multiple attempts to transmit A117V GSS have been unsuccessful and typical protease-resistant PrP (PrP(Sc)), pathognomonic of prion disease, is not detected in brain. Pathogenesis is instead attributed to production of an aberrant topological form of PrP, C-terminal transmembrane PrP ((Ctm)PrP). Barriers to transmission of prion strains from one species to another appear to relate to structural compatibility of PrP in host and inoculum and we have therefore produced transgenic mice expressing human 117V PrP. We found that brain tissue from GSS A117V patients did transmit disease to these mice and both the neuropathological features of prion disease and presence of PrP(Sc) was demonstrated in the brains of recipient transgenic mice. This PrP(Sc) rapidly degraded during laboratory analysis, suggesting that the difficulty in its detection in patients with GSS A117V could relate to post-mortem proteolysis. We conclude that GSS A117V is indeed a prion disease although the relative contributions of (Ctm)PrP and prion propagation in neurodegeneration and their pathogenetic interaction remains to be established.

  14. Ectopic expression of TaOEP16-2-5B, a wheat plastid outer envelope protein gene, enhances heat and drought stress tolerance in transgenic Arabidopsis plants.

    Science.gov (United States)

    Zang, Xinshan; Geng, Xiaoli; Liu, Kelu; Wang, Fei; Liu, Zhenshan; Zhang, Liyuan; Zhao, Yue; Tian, Xuejun; Hu, Zhaorong; Yao, Yingyin; Ni, Zhongfu; Xin, Mingming; Sun, Qixin; Peng, Huiru

    2017-05-01

    Abiotic stresses, such as heat and drought, are major environmental factors restricting crop productivity and quality worldwide. A plastid outer envelope protein gene, TaOEP16-2, was identified from our previous transcriptome analysis [1,2]. In this study, the isolation and functional characterization of the TaOEP16-2 gene was reported. Three homoeologous sequences of TaOEP16-2 were isolated from hexaploid wheat, which were localized on the chromosomes 5A, 5B and 5D, respectively. These three homoeologues exhibited different expression patterns under heat stress conditions, TaOEP16-2-5B was the dominant one, and TaOEP16-2-5B was selected for further analysis. Compared with wild type (WT) plants, transgenic Arabidopsis plants overexpressing the TaOEP16-2-5B gene exhibited enhanced tolerance to heat stress, which was supported by improved survival rate, strengthened cell membrane stability and increased sucrose content. It was also found that TaOEP16-2 was induced by drought stress and involved in drought stress tolerance. TaOEP16-2-5B has the same function in ABA-controlled seed germination as AtOEP16-2. Our results suggest that TaOEP16-2-5B plays an important role in heat and drought stress tolerance, and could be utilized in transgenic breeding of wheat and other crop plants. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. The bZIP protein from Tamarix hispida, ThbZIP1, is ACGT elements binding factor that enhances abiotic stress signaling in transgenic Arabidopsis.

    Science.gov (United States)

    Ji, Xiaoyu; Liu, Guifeng; Liu, Yujia; Zheng, Lei; Nie, Xianguang; Wang, Yucheng

    2013-10-04

    Tamarix spp. are woody halophyte, which are very tolerant to abiotic stresses such as salinity and drought, but little is known about their specific stress response systems. Basic leucine zipper proteins (bZIPs) play important roles in the ability of plants to withstand adverse environmental conditions. However, their exact roles in abiotic stress tolerance are still not fully known. In the current study, we functionally characterized a bZIP gene (ThbZIP1) from Tamarix hispida in response to abiotic stresses. We addressed the regulatory network of ThbZIP1 in three levels, i.e. its upstream regulators, the cis-acting elements recognized by ThbZIP1, and its downstream target genes. Two MYCs were found to bind to E-box, in the promoter of ThbZIP1 to activate its expression. Expression of ThbZIP1 is induced by ABA, salt, drought, methyl viologen and cold. ThbZIP1 can specifically bind to ACGT elements, with the highest binding affinity to the C-box, followed by the G-box and lastly the A-box. Compared with wild-type (Col-0) Arabidopsis, transgenic plants expressing ThbZIP1 had an increased tolerance to drought and salt, but had an increased sensitivity to ABA during seed germination and root growth; meanwhile, ROS level, cell death and water loss rate in transgenic plants were significantly reduced. Microarray analyses showed that many ROS scavenging genes were up-regulated by ThbZIP1 under salt stress conditions. Based on these data, we suggest that ThbZIP1 confers abiotic stress tolerance through activating stress tolerance genes to modulate ROS scavenging ability and other physiological changes involved in stress tolerance, and plays an important role in the ABA-mediated stress response of T. hispida.

  16. Single-Event Transgene Product Levels Predict Levels in Genetically Modified Breeding Stacks.

    Science.gov (United States)

    Gampala, Satyalinga Srinivas; Fast, Brandon J; Richey, Kimberly A; Gao, Zhifang; Hill, Ryan; Wulfkuhle, Bryant; Shan, Guomin; Bradfisch, Greg A; Herman, Rod A

    2017-09-13

    The concentration of transgene products (proteins and double-stranded RNA) in genetically modified (GM) crop tissues is measured to support food, feed, and environmental risk assessments. Measurement of transgene product concentrations in breeding stacks of previously assessed and approved GM events is required by many regulatory authorities to evaluate unexpected transgene interactions that might affect expression. Research was conducted to determine how well concentrations of transgene products in single GM events predict levels in breeding stacks composed of these events. The concentrations of transgene products were compared between GM maize, soybean, and cotton breeding stacks (MON-87427 × MON-89034 × DAS-Ø15Ø7-1 × MON-87411 × DAS-59122-7 × DAS-40278-9 corn, DAS-81419-2 × DAS-44406-6 soybean, and DAS-21023-5 × DAS-24236-5 × SYN-IR102-7 × MON-88913-8 × DAS-81910-7 cotton) and their component single events (MON-87427, MON-89034, DAS-Ø15Ø7-1, MON-87411, DAS-59122-7, and DAS-40278-9 corn, DAS-81419-2, and DAS-44406-6 soybean, and DAS-21023-5, DAS-24236-5, SYN-IR102-7, MON-88913-8, and DAS-81910-7 cotton). Comparisons were made within a crop and transgene product across plant tissue types and were also made across transgene products in each breeding stack for grain/seed. Scatter plots were generated comparing expression in the stacks to their component events, and the percent of variability accounted for by the line of identity (y = x) was calculated (coefficient of identity, I 2 ). Results support transgene concentrations in single events predicting similar concentrations in breeding stacks containing the single events. Therefore, food, feed, and environmental risk assessments based on concentrations of transgene products in single GM events are generally applicable to breeding stacks composed of these events.

  17. Transgenic Expression of the Anti-parasitic Factor TEP1 in the Malaria Mosquito Anopheles gambiae.

    Directory of Open Access Journals (Sweden)

    Gloria Volohonsky

    2017-01-01

    Full Text Available Mosquitoes genetically engineered to be resistant to Plasmodium parasites represent a promising novel approach in the fight against malaria. The insect immune system itself is a source of anti-parasitic genes potentially exploitable for transgenic designs. The Anopheles gambiae thioester containing protein 1 (TEP1 is a potent anti-parasitic protein. TEP1 is secreted and circulates in the mosquito hemolymph, where its activated cleaved form binds and eliminates malaria parasites. Here we investigated whether TEP1 can be used to create malaria resistant mosquitoes. Using a GFP reporter transgene, we determined that the fat body is the main site of TEP1 expression. We generated transgenic mosquitoes that express TEP1r, a potent refractory allele of TEP1, in the fat body and examined the activity of the transgenic protein in wild-type or TEP1 mutant genetic backgrounds. Transgenic TEP1r rescued loss-of-function mutations, but did not increase parasite resistance in the presence of a wild-type susceptible allele. Consistent with previous reports, TEP1 protein expressed from the transgene in the fat body was taken up by hemocytes upon a challenge with injected bacteria. Furthermore, although maturation of transgenic TEP1 into the cleaved form was impaired in one of the TEP1 mutant lines, it was still sufficient to reduce parasite numbers and induce parasite melanization. We also report here the first use of Transcription Activator Like Effectors (TALEs in Anopheles gambiae to stimulate expression of endogenous TEP1. We found that artificial elevation of TEP1 expression remains moderate in vivo and that enhancement of endogenous TEP1 expression did not result in increased resistance to Plasmodium. Taken together, our results reveal the difficulty of artificially influencing TEP1-mediated Plasmodium resistance, and contribute to further our understanding of the molecular mechanisms underlying mosquito resistance to Plasmodium parasites.

  18. Truncated presequences of mitochondrial F1-ATPase beta subunit from Nicotiana plumbaginifolia transport CAT and GUS proteins into mitochondria of transgenic tobacco.

    Science.gov (United States)

    Chaumont, F; Silva Filho, M de C; Thomas, D; Leterme, S; Boutry, M

    1994-02-01

    The mitochondrial F1-ATPase beta subunit (ATPase-beta) of Nicotiana plumbaginifolia is nucleus-encoded as a precursor containing an NH2-terminal extension. By sequencing the mature N. tabacum ATPase-beta, we determined the length of the presequence, viz. 54 residues. To define the essential regions of this presequence, we produced a series of 3' deletions in the sequence coding for the 90 NH2-terminal residues of ATPase-beta. The truncated sequences were fused with the chloramphenicol acetyl transferase (cat) and beta-glucuronidase (gus) genes and introduced into tobacco plants. From the observed distribution of CAT and GUS activity in the plant cells, we conclude that the first 23 amino-acid residues of ATPase-beta remain capable of specifically targeting reporter proteins into mitochondria. Immunodetection in transgenic plants and in vitro import experiments with various CAT fusion proteins show that the precursors are processed at the expected cleavage site but also at a cryptic site located in the linker region between the presequence and the first methionine of native CAT.

  19. Alterations in endocytic protein expression with increasing age in the transgenic APP695 V717I London mouse model of amyloid pathology: implications for Alzheimer's disease.

    Science.gov (United States)

    Thomas, Rhian S; Alsaqati, Mouhamed; Bice, Justin S; Hvoslef-Eide, Martha; Good, Mark A; Kidd, Emma J

    2017-10-18

    A major risk factor for the development of Alzheimer's disease (AD) is increasing age, but the reason behind this association has not been identified. It is thought that the changes in endocytosis seen in AD patients are causal for this condition. Thus, we hypothesized that the increased risk of developing AD associated with ageing may be because of changes in endocytosis. We investigated using Western blotting whether the expression of endocytic proteins involved in clathrin-mediated and clathrin-independent endocytosis are altered by increasing age in a mouse model of amyloid pathology. We used mice transgenic for human amyloid precursor protein containing the V717I London mutation. We compared the London mutation mice with age-matched wild-type (WT) controls at three ages, 3, 9 and 18 months, representing different stages in the development of pathology in this model. Having verified that the London mutation mice overexpressed amyloid precursor protein and β-amyloid, we found that the expression of the smallest isoform of PICALM, a key protein involved in the regulation of clathrin-coated pit formation, was significantly increased in WT mice, but decreased in the London mutation mice with age. PICALM levels in WT 18-month mice and clathrin levels in WT 9-month mice were significantly higher than those in the London mutation mice of the same ages. The expression of caveolin-1, involved in clathrin-independent endocytosis, was significantly increased with age in all mice. Our results suggest that endocytic processes could be altered by the ageing process and such changes could partly explain the association between ageing and AD.

  20. Population dynamics of Sesamia inferens on transgenic rice expressing Cry1Ac and CpTI in southern China.

    Science.gov (United States)

    Han, Lanzhi; Liu, Peilei; Wu, Kongming; Peng, Yufa; Wang, Feng

    2008-10-01

    Genetically modified insect-resistant rice lines containing the cry1Ac gene from Bacillus thuringiensis (Bt) or the CpTI (cowpea trypsin inhibitor) gene developed for the management of lepidopterous pests are highly resistant to the major target pests, Chilo suppressalis (Walker), Cnaphalocrocis medinalis (Guenée), and Scirpophaga incertulas (Walker), in the main rice-growing areas of China. However, the effects of these transgenic lines on Sesamia inferens (Walker), an important lepidopterous rice pest, are currently unknown. Because different insect species have varying susceptibility to Bt insecticidal proteins that may affect population dynamics, research into the effects of these transgenic rice lines on the population dynamics of S. inferens was conducted in Fuzhou, southern China, in 2005 and 2006. The results of laboratory, field cage, and field plot experiments show that S. inferens has comparatively high susceptibility to the transgenic line during the early growing season, with significant differences observed in larval density and infestation levels between transgenic and control lines. Because of a decrease in Cry1Ac levels in the plant as it ages, the transgenic line provided only a low potential for population suppression late in the growing season. There is a correlation between the changing expression of Cry1Ac and the impact of transgenic rice on the population dynamics of S. inferens during the season. These results indicate that S. inferens may become a major pest in fields of prospective commercially released transgenic rice, and more attention should be paid to developing an effective alternative management strategy.

  1. Protein Adsorption to In-Line Filters of Intravenous Administration Sets.

    Science.gov (United States)

    Besheer, Ahmed

    2017-10-01

    Ensuring compatibility of administered therapeutic proteins with intravenous administration sets is an important regulatory requirement. A low-dose recovery during administration of low protein concentrations is among the commonly observed incompatibilities, and it is mainly due to adsorption to in-line filters. To better understand this phenomenon, we studied the adsorption of 4 different therapeutic proteins (2 IgG1s, 1 IgG4, and 1 Fc fusion protein) diluted to 0.01 mg/mL in 5% glucose (B. Braun EcoFlac; B. Braun Melsungen AG, Melsungen, Germany) or 0.9% sodium chloride (NaCl; Freeflex; Fresenius Kabi, Friedberg, Germany) solutions to 8 in-line filters (5 positively charged and 3 neutral filters made of different polymers and by different suppliers). The results show certain patterns of protein adsorption, which depend to a large extent on the dilution solution and filter material, and to a much lower extent on the proteins' biophysical properties. Investigation of the filter membranes' zeta potential showed a correlation between the observed adsorption pattern in 5% glucose solution and the filter's surface charge, with higher protein adsorption for the strongly negatively charged membranes. In 0.9% NaCl solution, the surface charges are masked, leading to different adsorption patterns. These results contribute to the general understanding of the protein adsorption to IV infusion filters and allow the design of more efficient compatibility studies. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  2. A rice chloroplast transit peptide sequence does not alter the cytoplasmic localization of sheep serotonin N-acetyltransferase expressed in transgenic rice plants.

    Science.gov (United States)

    Byeon, Yeong; Lee, Hyoung Yool; Lee, Kyungjin; Back, Kyoungwhan

    2014-09-01

    Ectopic overexpression of melatonin biosynthetic genes of animal origin has been used to generate melatonin-rich transgenic plants to examine the functional roles of melatonin in plants. However, the subcellular localization of these proteins expressed in the transgenic plants remains unknown. We studied the localization of sheep (Ovis aries) serotonin N-acetyltransferase (OaSNAT) and a translational fusion of a rice SNAT transit peptide to OaSNAT (TS:OaSNAT) in plants. Laser confocal microscopy analysis revealed that both OaSNAT and TS:OaSNAT proteins were localized to the cytoplasm even with the addition of the transit sequence to OaSNAT. Transgenic rice plants overexpressing the TS:OaSNAT fusion transgene exhibited high SNAT enzyme activity relative to untransformed wild-type plants, but lower activity than transgenic rice plants expressing the wild-type OaSNAT gene. Melatonin levels in both types of transgenic rice plant corresponded well with SNAT enzyme activity levels. The TS:OaSNAT transgenic lines exhibited increased seminal root growth relative to wild-type plants, but less than in the OaSNAT transgenic lines, confirming that melatonin promotes root growth. Seed-specific OaSNAT expression under the control of a rice prolamin promoter did not confer high levels of melatonin production in transgenic rice seeds compared with seeds from transgenic plants expressing OaSNAT under the control of the constitutive maize ubiquitin promoter. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Characterization of Agronomy, Grain Physicochemical Quality, and Nutritional Property of High-Lysine 35R Transgenic Rice with Simultaneous Modification of Lysine Biosynthesis and Catabolism.

    Science.gov (United States)

    Yang, Qingqing; Wu, Hongyu; Li, Qianfeng; Duan, Ruxu; Zhang, Changquan; Sun, Samuel Saiming; Liu, Qiaoquan

    2017-05-31

    Lysine is the first limiting essential amino acid in rice. We previously constructed a series of transgenic rice lines to enhance lysine biosynthesis (35S), down-regulate its catabolism (Ri), or simultaneously achieve both metabolic effects (35R). In this study, nine transgenic lines, three from each group, were selected for both field and animal feeding trials. The results showed that the transgene(s) caused no obvious effects on field performance and main agronomic traits. Mature seeds of transgenic line 35R-17 contained 48-60-fold more free lysine than in wild type and had slightly lower apparent amylose content and softer gel consistency. Moreover, a 35-day feeding experiment showed that the body weight gain, food efficiency, and protein efficiency ratio of rats fed the 35R-17 transgenic rice diet were improved when compared with those fed wild-type rice diet. These data will be useful for further evaluation and potential commercialization of 35R high-lysine transgenic rice.

  4. AN APPROACH TO TRANSGENIC CROP MONITORING

    Science.gov (United States)

    Remote sensing by aerial or satellite images may provide a method of identifying transgenic pesticidal crop distribution in the landscape. Genetically engineered crops containing bacterial gene(s) that express an insecticidal protein from Bacillus thuringiensis (Bt) are regulated...

  5. Analysis of T-DNA integration and generative segregation in transgenic winter triticale (x Triticosecale Wittmack

    Directory of Open Access Journals (Sweden)

    Hensel Goetz

    2012-09-01

    Full Text Available Abstract Background While the genetic transformation of the major cereal crops has become relatively routine, to date only a few reports were published on transgenic triticale, and robust data on T-DNA integration and segregation have not been available in this species. Results Here, we present a comprehensive analysis of stable transgenic winter triticale cv. Bogo carrying the selectable marker gene HYGROMYCIN PHOSPHOTRANSFERASE (HPT and a synthetic green fluorescent protein gene (gfp. Progeny of four independent transgenic plants were comprehensively investigated with regard to the number of integrated T-DNA copies, the number of plant genomic integration loci, the integrity and functionality of individual T-DNA copies, as well as the segregation of transgenes in T1 and T2 generations, which also enabled us to identify homozygous transgenic lines. The truncation of some integrated T-DNAs at their left end along with the occurrence of independent segregation of multiple T-DNAs unintendedly resulted in a single-copy segregant that is selectable marker-free and homozygous for the gfp gene. The heritable expression of gfp driven by the maize UBI-1 promoter was demonstrated by confocal laser scanning microscopy. Conclusions The used transformation method is a valuable tool for the genetic engineering of triticale. Here we show that comprehensive molecular analyses are required for the correct interpretation of phenotypic data collected from the transgenic plants.

  6. [Induced expression of Serratia marcescens ribonuclease III gene in transgenic Nicotiana tabacum L. cv. SR1 tobacco plants].

    Science.gov (United States)

    Zhirnov, I V; Trifonova, E A; Romanova, A V; Filipenko, E A; Sapotsky, M V; Malinovsky, V I; Kochetov, A V; Shumny, V K

    2016-11-01

    Transgenic Nicotiana tabacum L. cv. SR1 plants, characterized by an increase in the level of dsRNA-specific hydrolytic activity after induction by wounding, were obtained. The Solanum lycopersicum anionic peroxidase gene promoter (new for plant genetic engineering) was for the first time used for the induced expression of the target Serratia marcescens RNase III gene. Upon infection with the tobacco mosaic virus (TMV), the transgenic plants of the obtained lines did not differ significantly from the control group in the level of TMV capsid protein accumulation. In general, no delay in the development of the infection symptoms was observed in transgenic plants as compared with the control group. The obtained transgenic plants represent a new model for the study of the biological role of endoribonucleases from the RNase III family, including in molecular mechanisms of resistance to pathogens.

  7. Induction of the arginine vasopressin-enhanced green fluorescent protein fusion transgene in the rat locus coeruleus

    Czech Academy of Sciences Publication Activity Database

    Todoroki, M.; Ueta, Y.; Fujihara, H.; Otsubo, H.; Shibata, M.; Hashimoto, H.; Kabayashi, M.; Sakamoto, H.; Kawata, M.; Dayanithi, Govindan; Murphy, D.; Hiro, H.; Takahashi, E.; Nagata, S.

    2010-01-01

    Roč. 13, č. 4 (2010), s. 281-292 ISSN 1025-3890 Institutional research plan: CEZ:AV0Z50390703 Keywords : colchicine * green fluorescent protein * hypothalamus Subject RIV: FH - Neurology Impact factor: 2.553, year: 2010

  8. Recombinant Vaccinia Viruses Coding Transgenes of Apoptosis-Inducing Proteins Enhance Apoptosis But Not Immunogenicity of Infected Tumor Cells

    Science.gov (United States)

    Tkachenko, Anastasiya; Richter, Vladimir

    2017-01-01

    Genetic modifications of the oncolytic vaccinia virus (VV) improve selective tumor cell infection and death, as well as activation of antitumor immunity. We have engineered a double recombinant VV, coding human GM-CSF, and apoptosis-inducing protein apoptin (VV-GMCSF-Apo) for comparing with the earlier constructed double recombinant VV-GMCSF-Lact, coding another apoptosis-inducing protein, lactaptin, which activated different cell death pathways than apoptin. We showed that both these recombinant VVs more considerably activated a set of critical apoptosis markers in infected cells than the recombinant VV coding GM-CSF alone (VV-GMCSF-dGF): these were phosphatidylserine externalization, caspase-3 and caspase-7 activation, DNA fragmentation, and upregulation of proapoptotic protein BAX. However, only VV-GMCSF-Lact efficiently decreased the mitochondrial membrane potential of infected cancer cells. Investigating immunogenic cell death markers in cancer cells infected with recombinant VVs, we demonstrated that all tested recombinant VVs were efficient in calreticulin and HSP70 externalization, decrease of cellular HMGB1, and ATP secretion. The comparison of antitumor activity against advanced MDA-MB-231 tumor revealed that both recombinants VV-GMCSF-Lact and VV-GMCSF-Apo efficiently delay tumor growth. Our results demonstrate that the composition of GM-CSF and apoptosis-inducing proteins in the VV genome is very efficient tool for specific killing of cancer cells and for activation of antitumor immunity. PMID:28951871

  9. Advances in Mammalian Cell Line Development Technologies for Recombinant Protein Production

    Directory of Open Access Journals (Sweden)

    Say Kong Ng

    2013-04-01

    Full Text Available From 2006 to 2011, an average of 15 novel recombinant protein therapeutics have been approved by US Food and Drug Administration (FDA annually. In addition, the expiration of blockbuster biologics has also spurred the emergence of biosimilars. The increasing numbers of innovator biologic products and biosimilars have thus fuelled the demand of production cell lines with high productivity. Currently, mammalian cell line development technologies used by most biopharmaceutical companies are based on either the methotrexate (MTX amplification technology or the glutamine synthetase (GS system. With both systems, the cell clones obtained are highly heterogeneous, as a result of random genome integration by the gene of interest and the gene amplification process. Consequently, large numbers of cell clones have to be screened to identify rare stable high producer cell clones. As such, the cell line development process typically requires 6 to 12 months and is a time, capital and labour intensive process. This article reviews established advances in protein expression and clone screening which are the core technologies in mammalian cell line development. Advancements in these component technologies are vital to improve the speed and efficiency of generating robust and highly productive cell line for large scale production of protein therapeutics.

  10. Thesis Abstract Bean (Phaseolus vulgaris L.) lines: chemical composition and protein digestibility.

    Science.gov (United States)

    Mesquita, F R; Silva, M I A; Corrêa, A D

    2016-05-09

    The bean represents the main source of proteins for the low income populations, although the digestibility of those proteins is relatively low. Consequently, the programs of plant genetic breeding have been working on the search for new lines with higher protein levels. Thus, with the purpose of supplying information to the researchers, in this study, 21 bean (Phaseolus vulgaris L.) lines were analyzed for the centesimal and mineral composition, protein digestibility, phenolic compounds, and trypsin inhibitor. The entirely randomized experimental design was used with 21 treatments (lines) and three repetitions. All values were within the following ranges: 22.34 to 36.28 g crude protein/100 g dry matter (DM); 7.56 to 20.91 g neutral detergent fiber/100 g DM; 0.53 to 2.55 g fat/100 g DM and 2.97 to 4.87 g ashes/100 g DM. The levels of phosphorus, potassium, calcium, magnesium, and sulfur, in g/100 g DM, varied from 0.45 to 0.72; 1.51 to 2.48; 0.03 to 0.28; 0.18 to 0.34 and 0.28 to 0.45, respectively. Regarding copper, manganese, zinc and iron, the levels, in mg/kg DM, varied from 11.37 to 17.73; 14.93 to 28.90; 36.67 to 69.90 and 71.37 to 126.90, respectively. The in vitro protein digestibility varied from 18.03 to 48.32%. The levels of phenolic compounds varied from 0.28 to 1.08 mg acid tanic/100 g DM and the one of trypsin inhibitor from 59.93 to 151.07 trypsin inhibited units/mg DM. Among the lines with higher protein contents, "ESAL 569" (beige with brown stripe) presented the largest protein digestibility and considerable levels of minerals. "P-180" (beige with brown stripe) was one of the lines with higher crude protein contents and digestibilities, and also presented high levels for most of the minerals. No relation between protein digestibility and the contents of phenolic compounds or trypsin inhibitor was observed.

  11. [The role of Cd-binding proteins and phytochelatins in the formation of cadmium resistance in Nicotiana plumbaginifolia cell lines].

    Science.gov (United States)

    Fenik, S I; Solodushko, V G; Kaliniak, T B; Blium, Ia B

    2007-01-01

    Nicotiana plumbaginifolia callus lines with the equal resistance to cadmium have been produced under different selective conditions--either without inhibition of the phytochelatin synthesis (line Cd-R) or in the presence of the inhibitor butionine sulfoximine (line Cd-Ri). The level of phytochelatin synthesis in the line Cd-R five-fold exceeded the control value and in the line Cd-Ri it was twice as much as in the control. It was shown that in the control line mainly three cadmium-binding proteins are expressed of the molecular weihgts 41, 34 and 19 kD. The common feature of the both resistant lines is the expression of the cadmium-binding proteins of 40, 37 and 19 kD. The resistant lines differ with respect to the synthesis of relatively low-molecular cadmium-binding proteins. The proteins of the molecular weights 12.5, 11.5 and 9 kD are expressed in the line Cd-R, while the proteins of 13 and 10 kD are expressed in the line Cd-Ri. It was supposed that both the phytochelatins and the Cd-binding proteins contribute to the resisitance of N. plumbaginifolia callus lines to cadmium and the lack of the phytochelatins can be equilibrated by the changes in the low-molecular Cd-binding protein synthesis.

  12. Acceleration of leaf senescence is slowed down in transgenic barley plants deficient in the DNA/RNA-binding protein WHIRLY1.

    Science.gov (United States)

    Kucharewicz, Weronika; Distelfeld, Assaf; Bilger, Wolfgang; Müller, Maren; Munné-Bosch, Sergi; Hensel, Götz; Krupinska, Karin

    2017-02-01

    WHIRLY1 in barley was isolated as a potential regulator of the senescence-associated gene HvS40. In order to investigate whether the plastid-nucleus-located DNA/RNA-binding protein WHIRLY1 plays a role in regulation of leaf senescence, primary foliage leaves from transgenic barley plants with an RNAi-mediated knockdown of the WHIRLY1 gene were characterized by typical senescence parameters, namely pigment contents, function and composition of the photosynthetic apparatus, as well as expression of selected genes known to be either down- or up-regulated during leaf senescence. When the plants were grown at low light intensity, senescence progression was similar between wild-type and RNAi-W1 plants. Likewise, dark-induced senescence of detached leaves was not affected by reduction of WHIRLY1. When plants were grown at high light intensity, however, senescence was induced prematurely in wild-type plants but was delayed in RNAi-W1 plants. This result suggests that WHIRLY1 plays a role in light sensing and/or stress communication between chloroplasts and the nucleus. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  13. Transgenic Parasites Stably Expressing Full-Length Plasmodium falciparum Circumsporozoite Protein as a Model for Vaccine Down-Selection in Mice Using Sterile Protection as an Endpoint

    Science.gov (United States)

    Porter, Michael D.; Nicki, Jennifer; Pool, Christopher D.; DeBot, Margot; Illam, Ratish M.; Brando, Clara; Bozick, Brooke; De La Vega, Patricia; Angra, Divya; Spaccapelo, Roberta; Crisanti, Andrea; Murphy, Jittawadee R.; Bennett, Jason W.; Schwenk, Robert J.; Ockenhouse, Christian F.

    2013-01-01

    Circumsporozoite protein (CSP) of Plasmodium falciparum is a protective human malaria vaccine candidate. There is an urgent need for models that can rapidly down-select novel CSP-based vaccine candidates. In the present study, the mouse-mosquito transmission cycle of a transgenic Plasmodium berghei malaria parasite stably expressing a functional full-length P. falciparum CSP was optimized to consistently produce infective sporozoites for protection studies. A minimal sporozoite challenge dose was established, and protection was defined as the absence of blood-stage parasites 14 days after intravenous challenge. The specificity of protection was confirmed by vaccinating mice with multiple CSP constructs of differing lengths and compositions. Constructs that induced high NANP repeat-specific antibody titers in enzyme-linked immunosorbent assays were protective, and the degree of protection was dependent on the antigen dose. There was a positive correlation between antibody avidity and protection. The antibodies in the protected mice recognized the native CSP on the parasites and showed sporozoite invasion inhibitory activity. Passive transfer of anti-CSP antibodies into naive mice also induced protection. Thus, we have demonstrated the utility of a mouse efficacy model to down-select human CSP-based vaccine formulations. PMID:23536694

  14. Transgenic rice plants expressing synthetic cry2AX1 gene exhibits resistance to rice leaffolder (Cnaphalocrosis medinalis).

    Science.gov (United States)

    Manikandan, R; Balakrishnan, N; Sudhakar, D; Udayasuriyan, V

    2016-06-01

    Bacillus thuringiensis is a major source of insecticidal genes imparting insect resistance in transgenic plants. Level of expression of transgenes in transgenic plants is important to achieve desirable level of resistance against target insects. In order to achieve desirable level of expression, rice chloroplast transit peptide sequence was fused with synthetic cry2AX1 gene to target its protein in chloroplasts. Sixteen PCR positive lines of rice were generated by Agrobacterium mediated transformation using immature embryos. Southern blot hybridization analysis of T 0 transgenic plants confirmed the integration of cry2AX1 gene in two to five locations of rice genome and ELISA demonstrated its expression. Concentration of Cry2AX1 in transgenic rice events ranged 5.0-120 ng/g of fresh leaf tissue. Insect bioassay of T 0 transgenic rice plants against neonate larvae of rice leaffolder showed larval mortality ranging between 20 and 80 % in comparison to control plant. Stable inheritance and expression of cry2AX1 gene was demonstrated in T 1 progenies through Southern and ELISA. In T 1 progenies, the highest concentration of Cry2AX1 and mortality of rice leaffolder larvae were recorded as 150 ng/g of fresh leaf tissue and 80 %, respectively. The Cry2AX1 expression even at a very low concentration (120-150 ng/g) in transgenic rice plants was found effective against rice leaffolder larvae.

  15. Expression of a radish defensin in transgenic wheat confers increased resistance to Fusarium graminearum and Rhizoctonia cerealis.

    Science.gov (United States)

    Li, Zhao; Zhou, Miaoping; Zhang, Zengyan; Ren, Lijuan; Du, Lipu; Zhang, Boqiao; Xu, Huijun; Xin, Zhiyong

    2011-03-01

    Fusarium head blight (scab), primarily caused by Fusarium graminearum, is a devastating disease of wheat (Triticum aestivum L.) worldwide. Wheat sharp eyespot, mainly caused by Rhizoctonia cerealis, is one of the major diseases of wheat in China. The defensin RsAFP2, a small cyteine-rich antifungal protein from radish (Raphanus sativus), was shown to inhibit growth in vitro of agronomically important fungal pathogens, such as F. graminearum and R. cerealis. The RsAFP2 gene was transformed into Chinese wheat variety Yangmai 12 via biolistic bombardment to assess the effectiveness of the defensin in protecting wheat from the fungal pathogens in multiple locations and years. The genomic PCR and Southern blot analyses indicated that RsAFP2 was integrated into the genomes of the transgenic wheat lines and heritable. RT-PCR and Western blot proved that the RsAFP2 was expressed in these transgenic wheat lines. Disease tests showed that four RsAFP2 transgenic lines (RA1-RA4) displayed enhanced resistance to F. graminearum compared to the untransformed Yangmai 12 and the null-segregated plants. Assays on Q-RT-PCR and disease severity showed that the express level of RsAFP2 was associated with the enhanced resistance degree. Two of these transgenic lines (RA1 and RA2) also exhibited enhanced resistance to R. cerealis. These results indicated that the expression of RsAFP2 conferred increased resistance to F. graminearum and R. cerealis in transgenic wheat.

  16. The pepper Bs4C proteins are localized to the endoplasmic reticulum (ER) membrane and confer disease resistance to bacterial blight in transgenic rice.

    Science.gov (United States)

    Wang, Jun; Zeng, Xuan; Tian, Dongsheng; Yang, Xiaobei; Wang, Lanlan; Yin, Zhongchao

    2018-03-30

    Transcription activator-like effector (TALE)-dependent dominant disease resistance (R) genes in plants, also referred to as executor R genes, are induced on infection by phytopathogenic bacteria of the genus Xanthomonas harbouring the corresponding TALE genes. Unlike the traditional R proteins, the executor R proteins do not determine the resistance specificity and may function broadly in different plant species. The executor R gene Bs4C-R in the resistant genotype PI 235047 of the pepper species Capsicum pubescens (CpBs4C-R) confers disease resistance to Xanthomonas campestris pv. vesicatoria (Xcv) harbouring the TALE genes avrBsP/avrBs4. In this study, the synthetic genes of CpBs4C-R and two other Bs4C-like genes, the susceptible allele in the genotype PI585270 of C. pubescens (CpBs4C-S) and the CaBs4C-R homologue gene in the cultivar 'CM334' of Capsicum annum (CaBs4C), were characterized in tobacco (Nicotiana benthamiana) and rice (Oryza sativa). The Bs4C genes induced cell death in N. benthamiana. The functional Bs4C-eCFP fusion proteins were localized to the endoplasmic reticulum (ER) membrane in the leaf epidermal cells of N. benthamiana. The Xa10 promoter-Bs4C fusion genes in transgenic rice conferred strain-specific disease resistance to Xanthomonas oryzae pv. oryzae (Xoo), the causal agent of bacterial blight in rice, and were specifically induced by the Xa10-incompatible Xoo strain PXO99 A (pHM1avrXa10). The results indicate that the Bs4C proteins from pepper species function broadly in rice and the Bs4C protein-mediated cell death from the ER is conserved between dicotyledonous and monocotyledonous plants, which can be utilized to engineer novel and enhanced disease resistance in heterologous plants. © 2018 TEMASEK LIFE SCIENCES LABORATORY. MOLECULAR PLANT PATHOLOGY © 2018 JOHN WILEY & SONS LTD.

  17. Scaffold preferences of mesenchymal stromal cells and adipose-derived stem cells from green fluorescent protein transgenic mice influence the tissue engineering of bone.

    Science.gov (United States)

    Wittenburg, Gretel; Flade, Viktoria; Garbe, Annette I; Lauer, Günter; Labudde, Dirk

    2014-05-01

    We have analysed the growth and differentiation of mesenchymal stromal cells (MSC) from bone marrow, and of adipose derived stem cells (ASC) from murine abdominal fat tissue, of green fluorescent protein (GFP) transgenic animals grown directly on two types of hydroxyapatite ceramic bone substitutes. BONITmatrix® and NanoBone® have specific mechanical and physiochemical properties such as porosity and an inner surface that influence cellular growth. Both MSC and ASC were separately seeded on 200mg of each biomaterial and cultured for 3 weeks under osteogenic differentiation conditions. The degree of mineralisation was assessed by alizarin red dye and the specific alkaline phosphatase activity of the differentiated cells. The morphology of the cells was examined by scanning electron microscopy and confocal microscopy. The osteoblastic phenotype of the cells was confirmed by analysing the expression of bone-specific genes (Runx2, osteocalcin, osteopontin, and osteonectin) by semiquantitative reverse transcriptase polymerase chain reaction (PCR). Comparison of BONITmatrix® and NanoBone® showed cell type-specific preferences in terms of osteogenic differentiation. MSC-derived osteoblast-like cells spread optimally on the surface of NanoBone® but not BONITmatrix® granules. In contrast BONITmatrix® granules conditioned the growth of osteoblast-like cells derived from ASC. The osteoblastic phenotype of the cultured cells on all matrices was confirmed by specific gene expression. Our results show that the in vitro growth and osteogenic differentiation of murine MSC or ASC of GFP transgenic mice are distinctly influenced by the ceramic substratum. While NanoBone® granules support the proliferation and differentiation of murine MSC isolated from bone marrow, the growth of murine ASC is supported by BONITmatrix® granules. NanoBone® is therefore recommended for use as scaffold in tissue engineering that requires MSC, whereas ASC can be combined with BONITmatrix® for

  18. 5-Azacytidine mediated reactivation of silenced transgenes in potato (Solanum tuberosum) at the whole plant level.

    Science.gov (United States)

    Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš

    2017-08-01

    Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.

  19. Bt-transgenic oilseed rape hybridization with its weedy relative, Brassica rapa.

    Science.gov (United States)

    Halfhill, Matthew D; Millwood, Reginald J; Raymer, Paul L; Stewart, C Neal

    2002-10-01

    The movement of transgenes from crops to weeds and the resulting consequences are concerns of modern agriculture. The possible generation of "superweeds" from the escape of fitness-enhancing transgenes into wild populations is a risk that is often discussed, but rarely studied. Oilseed rape, Brassica napus (L.), is a crop with sexually compatible weedy relatives, such as birdseed rape (Brassica rapa (L.)). Hybridization of this crop with weedy relatives is an extant risk and an excellent interspecific gene flow model system. In laboratory crosses, T3 lines of seven independent transformation events of Bacillus thuringiensis (Bt) oilseed rape were hybridized with two weedy accessions of B. rapa. Transgenic hybrids were generated from six of these oilseed rape lines, and the hybrids exhibited an intermediate morphology between the parental species. The Bt transgene was present in the hybrids, and the protein was synthesized at similar levels to the corresponding independent oilseed rape lines. Insect bioassays were performed and confirmed that the hybrid material was insecticidal. The hybrids were backcrossed with the weedy parent, and only half the oilseed rape lines were able to produce transgenic backcrosses. After two backcrosses, the ploidy level and morphology of the resultant plants were indistinguishable from B. rapa. Hybridization was monitored under field conditions (Tifton, GA, USA) with four independent lines of Bt oilseed rape with a crop to wild relative ratio of 1200:1. When B. rapa was used as the female parent, hybridization frequency varied among oilseed rape lines and ranged from 16.9% to 0.7%.

  20. Acyl-CoA binding protein is an essential protein in mammalian cell lines

    DEFF Research Database (Denmark)

    Knudsen, Jens; Færgeman, Nils J.

    2002-01-01

    In the present work, small interference RNA was used to knock-down acyl-CoA binding protein (ACBP) in HeLa, HepG2 and Chang cells. Transfection with ACBP-specific siRNA stopped growth, detached cells from the growth surface and blocked thymidine and acetate incorporation. The results show...

  1. The better growth phenotype of DvGS1-transgenic arabidopsis thaliana is attributed to the improved efficiency of nitrogen assimilation

    Directory of Open Access Journals (Sweden)

    Zhu Chenguang

    2015-01-01

    Full Text Available The overexpression of the algal glutamine synthetase (GS gene DvGS1 in Arabidopsis thaliana resulted in higher plant biomass and better growth phenotype. The purpose of this study was to recognize the biological mechanism for the growth improvement of DvGS1-transgenic Arabidopsis. A series of molecular and biochemical investigations related to nitrogen and carbon metabolism in the DvGS1-transgenic line was conducted. Analysis of nitrogen use efficiency (NUE-related gene transcription and enzymatic activity revealed that the transcriptional level and enzymatic activity of the genes encoding GS, glutamate synthase, glutamate dehydrogenase, alanine aminotransferase and aspartate aminotransferase, were significantly upregulated, especially from leaf tissues of the DvGS1-transgenic line under two nitrate conditions. The DvGS1-transgenic line showed increased total nitrogen content and decreased carbon: nitrogen ratio compared to wild-type plants. Significant reduced concentrations of free nitrate, ammonium, sucrose, glucose and starch, together with higher concentrations of total amino acids, individual amino acids (glutamate, aspartate, asparagine, methionine, soluble proteins and fructose in leaf tissues confirmed that the DvGS1-transgenic line demonstrated a higher efficiency of nitrogen assimilation, which subsequently affected carbon metabolism. These improved metabolisms of nitrogen and carbon conferred the DvGS1-transgenic Arabidopsis higher NUE, more biomass and better growth phenotype compared with the wild-type plants.

  2. NMRKIN: Simulating line shapes from two-dimensional spectra of proteins upon ligand binding

    International Nuclear Information System (INIS)

    Guenther, Ulrich L.; Schaffhausen, Brian

    2002-01-01

    The analysis of the shape of signals in NMR spectra is a powerful tool to study exchange and reaction kinetics. Line shapes in two-dimensional spectra of proteins recorded for titrations with ligands provide information about binding rates observed at individual residues. Here we describe a fast method to simulate a series of line shapes derived from two-dimensional spectra of a protein during a ligand titration. This procedure, which takes the mutual effects of two dimensions into account, has been implemented in MATLAB as an add-on to NMRLab (Guenther et al., 2000). In addition, more complex kinetic models, including sequential and parallel reactions, were simulated to demonstrate common features of more complex line shapes which could be encountered in protein-ligand interactions. As an example of this method, we describe its application to line shapes obtained for a titration of the p85 N-SH2 domain of PI3-kinase with a peptide derived from polyomavirus middle T antigen (MT)

  3. Expression profiling of Ribosomal Protein gene family in dehydration stress responses and characterization of transgenic rice plants overexpressing RPL23A for water-use efficiency and tolerance to drought and salt stresses

    Science.gov (United States)

    Moin, Mazahar; Bakshi, Achala; Madhav, M. S.; Kirti, P. B.

    2017-11-01

    Our previous findings on the screening of a large-pool of activation tagged rice plants grown under limited water conditions revealed the activation of Ribosomal Protein Large (RPL) subunit genes, RPL6 and RPL23A in two mutants that exhibited high water-use efficiency (WUE) with the genes getting activated by the integrated 4x enhancers (Moin et al., 2016a). In continuation of these findings, we have comprehensively characterized the Ribosomal Protein (RP) gene family including both small (RPS) and large (RPL) subunits, which have been identified to be encoded by at least 70 representative genes; RP-genes exist as multiple expressed copies with high nucleotide and amino acid sequence similarity. The differential expression of all the representative genes in rice was performed under limited water and drought conditions at progressive time intervals in the present study. More than 50% of the RP genes were upregulated in both shoot and root tissues. Some of them exhibited an overlap in the upregulation under both the treatments indicating that they might have a common role in inducing tolerance under limited water and drought conditions. Among the genes that became significantly upregulated in both the tissues and under both the treatments are RPL6, 7, 23A, 24 and 31 and RPS4, 10 and 18a. To further validate the role of RP genes in WUE and inducing tolerance to other stresses, we have raised transgenic plants overexpressing RPL23A in rice. The high expression lines of RPL23A exhibited low Δ13C, increased quantum efficiency along with suitable growth and yield parameters with respect to negative control under the conditions of limited water availability. The constitutive expression of RPL23A was also associated with transcriptional upregulation of many other RPL and RPS genes. The seedlings of RPL23A high expression lines also showed a significant increase in fresh weight, root length, proline and chlorophyll contents under simulated drought and salt stresses. Taken

  4. Correlations between RNA and protein expression profiles in 23 human cell lines

    Directory of Open Access Journals (Sweden)

    Pontén Fredrik

    2009-08-01

    Full Text Available Abstract Background The Central Dogma of biology holds, in famously simplified terms, that DNA makes RNA makes proteins, but there is considerable uncertainty regarding the general, genome-wide correlation between levels of RNA and corresponding proteins. Therefore, to assess degrees of this correlation we compared the RNA profiles (determined using both cDNA- and oligo-based microarrays and protein profiles (determined immunohistochemically in tissue microarrays of 1066 gene products in 23 human cell lines. Results A high mean correlation coefficient (0.52 was obtained from the pairwise comparison of RNA levels determined by the two platforms. Significant correlations, with correlation coefficients exceeding 0.445, between protein and RNA levels were also obtained for a third of the specific gene products. However, the correlation coefficients between levels of RNA and protein products of specific genes varied widely, and the mean correlations between the protein and corresponding RNA levels determined using the cDNA- and oligo-based microarrays were 0.25 and 0.20, respectively. Conclusion Significant correlations were found in one third of the examined RNA species and corresponding proteins. These results suggest that RNA profiling might provide indirect support to antibodies' specificity, since whenever a evident correlation between the RNA and protein profiles exists, this can sustain that the antibodies used in the immunoassay recognized their cognate antigens.

  5. Transgenic mice display hair loss and regrowth overexpressing mutant Hr gene.

    Science.gov (United States)

    Zhu, Kuicheng; Xu, Cunshuan; Zhang, Jintao; Chen, Yingying; Liu, Mengduan

    2017-10-30

    Mutations in the hairless (Hr) gene in both mice and humans have been implicated in the development of congenital atrichia, but the role of Hr in skin and hair follicle (HF) biology remains unknown. Here, we established transgenic mice (TG) overexpressing mutant Hr to investigate its specific role in the development of HF. Three transgenic lines were successfully constructed, and two of them (TG3 and TG8) displayed a pattern of hair loss and regrowth with alternation in the expression of HR protein. The mutant Hr gene inhibited the expression of the endogenous gene in transgenic individuals, which led to the development of alopecia. Interestingly, the hair regrew with the increase in the endogenous expression levels resulting from decreased mutant Hr expression. The findings of our study indicate that the changes in the expression of Hr result in hair loss or regrowth.

  6. Neuroanatomy and transgenic technologies

    Science.gov (United States)

    This is a short review that introduces recent advances of neuroanatomy and transgenic technologies. The anatomical complexity of the nervous system remains a subject of tremendous fascination among neuroscientists. In order to tackle this extraordinary complexity, powerful transgenic technologies a...

  7. Expression of G-protein inwardly rectifying potassium channels (GIRKs in lung cancer cell lines

    Directory of Open Access Journals (Sweden)

    Schuller Hildegard M

    2005-08-01

    Full Text Available Abstract Background Previous data from our laboratory has indicated that there is a functional link between the β-adrenergic receptor signaling pathway and the G-protein inwardly rectifying potassium channel (GIRK1 in human breast cancer cell lines. We wanted to determine if GIRK channels were expressed in lung cancers and if a similar link exists in lung cancer. Methods GIRK1-4 expression and levels were determined by reverse transcription polymerase chain reaction (RT-PCR and real-time PCR. GIRK protein levels were determined by western blots and cell proliferation was determined by a 5-bromo-2'-deoxyuridine (BrdU assay. Results GIRK1 mRNA was expressed in three of six small cell lung cancer (SCLC cell lines, and either GIRK2, 3 or 4 mRNA expression was detected in all six SCLC cell lines. Treatment of NCI-H69 with β2-adrenergic antagonist ICI 118,551 (100 μM daily for seven days led to slight decreases of GIRK1 mRNA expression levels. Treatment of NCI-H69 with the β-adrenergic agonist isoproterenol (10 μM decreased growth rates in these cells. The GIRK inhibitor U50488H (2 μM also inhibited proliferation, and this decrease was potentiated by isoproterenol. In the SCLC cell lines that demonstrated GIRK1 mRNA expression, we also saw GIRK1 protein expression. We feel these may be important regulatory pathways since no expression of mRNA of the GIRK channels (1 & 2 was found in hamster pulmonary neuroendocrine cells, a suggested cell of origin for SCLC, nor was GIRK1 or 2 expression found in human small airway epithelial cells. GIRK (1,2,3,4 mRNA expression was also seen in A549 adenocarcinoma and NCI-H727 carcinoid cell lines. GIRK1 mRNA expression was not found in tissue samples from adenocarcinoma or squamous cancer patients, nor was it found in NCI-H322 or NCI-H441 adenocarcinoma cell lines. GIRK (1,3,4 mRNA expression was seen in three squamous cell lines, GIRK2 was only expressed in one squamous cell line. However, GIRK1 protein

  8. Comparative proteomic analysis of plasma membrane proteins between human osteosarcoma and normal osteoblastic cell lines

    International Nuclear Information System (INIS)

    Zhang, Zhiyu; Ma, Fang; Cai, Zhengdong; Zhang, Lijun; Hua, Yingqi; Jia, Xiaofang; Li, Jian; Hu, Shuo; Peng, Xia; Yang, Pengyuan; Sun, Mengxiong

    2010-01-01

    Osteosarcoma (OS) is the most common primary malignant tumor of bone in children and adolescents. However, the knowledge in diagnostic modalities has progressed less. To identify new biomarkers for the early diagnosis of OS as well as for potential novel therapeutic candidates, we performed a sub-cellular comparative proteomic research. An osteosarcoma cell line (MG-63) and human osteoblastic cells (hFOB1.19) were used as our comparative model. Plasma membrane (PM) was obtained by aqueous two-phase partition. Proteins were analyzed through iTRAQ-based quantitative differential LC/MS/MS. The location and function of differential proteins were analyzed through GO database. Protein-protein interaction was examined through String software. One of differentially expressed proteins was verified by immunohistochemistry. 342 non-redundant proteins were identified, 68 of which were differentially expressed with 1.5-fold difference, with 25 up-regulated and 43 down-regulated. Among those differential proteins, 69% ware plasma membrane, which are related to the biological processes of binding, cell structure, signal transduction, cell adhesion, etc., and interaction with each other. One protein--CD151 located in net nodes was verified to be over-expressed in osteosarcoma tissue by immunohistochemistry. It is the first time to use plasma membrane proteomics for studying the OS membrane proteins according to our knowledge. We generated preliminary but comprehensive data about membrane protein of osteosarcoma. Among these, CD151 was further validated in patient samples, and this small molecule membrane might be a new target for OS research. The plasma membrane proteins identified in this study may provide new insight into osteosarcoma biology and potential diagnostic and therapeutic biomarkers

  9. Analysis of transcript and protein overlap in a human osteosarcoma cell line

    Directory of Open Access Journals (Sweden)

    Emanuelsson Olof

    2010-12-01

    Full Text Available Abstract Background An interesting field of research in genomics and proteomics is to compare the overlap between the transcriptome and the proteome. Recently, the tools to analyse gene and protein expression on a whole-genome scale have been improved, including the availability of the new generation sequencing instruments and high-throughput antibody-based methods to analyze the presence and localization of proteins. In this study, we used massive transcriptome sequencing (RNA-seq to investigate the transcriptome of a human osteosarcoma cell line and compared the expression levels with in situ protein data obtained in-situ from antibody-based immunohistochemistry (IHC and immunofluorescence microscopy (IF. Results A large-scale analysis based on 2749 genes was performed, corresponding to approximately 13% of the protein coding genes in the human genome. We found the presence of both RNA and proteins to a large fraction of the analyzed genes with 60% of the analyzed human genes detected by all three methods. Only 34 genes (1.2% were not detected on the transcriptional or protein level with any method. Our data suggest that the majority of the human genes are expressed at detectable transcript or protein levels in this cell line. Since the reliability of antibodies depends on possible cross-reactivity, we compared the RNA and protein data using antibodies with different reliability scores based on various criteria, including Western blot analysis. Gene products detected in all three platforms generally have good antibody validation scores, while those detected only by antibodies, but not by RNA sequencing, generally consist of more low-scoring antibodies. Conclusion This suggests that some antibodies are staining the cells in an unspecific manner, and that assessment of transcript presence by RNA-seq can provide guidance for validation of the corresponding antibodies.

  10. Cloning and functional characterization of MusaVND1 using transgenic banana plants.

    Science.gov (United States)

    Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

    2015-06-01

    Vascular related NAC (NAM, ATAF and CUC) domain-containing genes regulate secondary wall deposition and differentiation of xylem vessel elements. MusaVND1 is an ortholog of Arabidopsis VND1 and contains the highly conserved NAC domain. The expression of MusaVND1 is highest in developing corm and during lignification conditions, the increase in expression of MusaVND1 coincides with the expression of PAL, COMT and C4H genes. MusaVND1 encodes a nuclear localized protein as MusaVND1-GFP fusion protein gets localized to nucleus. Transient overexpression of MusaVND1 converts banana embryogenic cells to xylem vessel elements, with a final differentiation frequency of 33.54% at the end of tenth day. Transgenic banana plants overexpressing MusaVND1 showed stunted growth and were characterized by PCR and Southern blot analysis. Transgenic banana plants showed transdifferentiation of various types of cells into xylem vessel elements and ectopic deposition of lignin in cells of various plant organs such as leaf and corm. Tracheary element formation was seen in the cortical region of transgenic corm as well as in epidermal cells of leaves. Biochemical analysis indicates significantly higher levels of lignin and cellulose content in transgenic banana lines than control plants. MusaVND1 overexpressing transgenic banana plants showed elevated expression levels of genes involved in lignin and cellulose biosynthesis pathway. Further expression of different MYB transcription factors positively regulating secondary wall deposition was also up regulated in MusaVND1 transgenic lines.

  11. LINES

    Directory of Open Access Journals (Sweden)

    Minas Bakalchev

    2015-10-01

    Full Text Available The perception of elements in a system often creates their interdependence, interconditionality, and suppression. The lines from a basic geometrical element have become the model of a reductive world based on isolation according to certain criteria such as function, structure, and social organization. Their traces are experienced in the contemporary world as fragments or ruins of a system of domination of an assumed hierarchical unity. How can one release oneself from such dependence or determinism? How can the lines become less “systematic” and forms more autonomous, and less reductive? How is a form released from modernistic determinism on the new controversial ground? How can these elements or forms of representation become forms of action in the present complex world? In this paper, the meaning of lines through the ideas of Le Corbusier, Leonidov, Picasso, and Hitchcock is presented. Spatial research was made through a series of examples arising from the projects of the architectural studio “Residential Transformations”, which was a backbone for mapping the possibilities ranging from playfulness to exactness, as tactics of transformation in the different contexts of the contemporary world.

  12. Immunohistochemistry of connexin 43 throughout anterior pituitary gland in a transgenic rat with green fluorescent protein-expressing folliculo-stellate cells.

    Science.gov (United States)

    Horiguchi, Kotaro; Fujiwara, Ken; Kouki, Tom; Kikuchi, Motoshi; Yashiro, Takashi

    2008-12-01

    Folliculo-stellate (FS) cells in the anterior pituitary gland have been speculated to possess multifunctional properties. Because gap junctions (GJ) have been identified between FS cells, FS cells may be interconnected electrophysiologically by GJ and serve as signal transmission networks to modulate hormone release in the anterior pituitary gland. But whether GJ are localized among FS cells from the pars tuberalis through the pars distalis is unclear. The S100b-GFP transgenic rat has recently been generated, which expresses green fluorescent protein (GFP) specifically in FS cells in the anterior pituitary. This model is expected to be a powerful tool for studies of FS cells. The purpose of the present paper was therefore to examine the localization of GJ on connexin 43 immunohistochemistry throughout the anterior pituitary gland of S100b-GFP rats under confocal laser microscopy. The localization patterns of FS cells was also observed in primary culture of anterior pituitary cells and the question of whether GJ between FS cells are reconstructed in vitro was investigated. In vivo studies showed that GJ were present specifically between FS cells from the pars tuberalis to the pars distalis in the anterior pituitary gland. The appearance of FS cells was distinguished into two types, with localization of GJ differing between types. In vitro, it was observed for the first time that FS cells in primary culture could be categorized into two types. In vivo localization of GJ between FS cells was reconstructed in vitro. These morphological observations are consistent with the hypothesis that FS cells form an electrophysiological network throughout the anterior pituitary for signal transmission.

  13. Impact of transgenic soybean expressing Cry1Ac and Cry1F proteins on the non-target arthropod community associated with soybean in Brazil.

    Science.gov (United States)

    Marques, Luiz H; Santos, Antonio C; Castro, Boris A; Storer, Nicholas P; Babcock, Jonathan M; Lepping, Miles D; Sa, Verissimo; Moscardini, Valéria F; Rule, Dwain M; Fernandes, Odair A

    2018-01-01

    Field-scale studies that examine the potential for adverse effects of Bt crop technology on non-target arthropods may supplement data from laboratory studies to support an environmental risk assessment. A three year field study was conducted in Brazil to evaluate potential for adverse effects of cultivating soybean event DAS-81419-2 that produces the Cry1Ac and Cry1F proteins. To do so, we examined the diversity and abundance of non-target arthropods (NTAs) in Bt soybean in comparison with its non-Bt near isoline, with and without conventional insecticide applications, in three Brazilian soybean producing regions. Non-target arthropod abundance was surveyed using Moericke traps (yellow pan) and pitfall trapping. Total abundance (N), richness (S), Shannon-Wiener (H'), Simpson's (D) and Pielou's evenness (J) values for arthropod samples were calculated for each treatment and sampling period (soybean growth stages). A faunistic analysis was used to select the most representative NTAs which were used to describe the NTA community structure associated with soybean, and to test for effects due to the treatments effects via application of the Principal Response Curve (PRC) method. Across all years and sites, a total of 254,054 individuals from 190 taxa were collected by Moericke traps, while 29,813 individuals from 100 taxa were collected using pitfall traps. Across sites and sampling dates, the abundance and diversity measurements of representative NTAs were not significantly affected by Bt soybean as compared with non-sprayed non-Bt soybean. Similarly, community analyses and repeated measures ANOVA, when applicable, indicated that neither Bt soybean nor insecticide sprays altered the structure of the NTA communities under study. These results support the conclusion that transgenic soybean event DAS-81419-2 producing Cry1Ac and Cry1F toxins does not adversely affect the NTA community associated with soybean.

  14. Use of sperm plasmid DNA lipofection combined with REMI (restriction enzyme-mediated insertion) for production of transgenic chickens expressing eGFP (enhanced green fluorescent protein) or human follicle-stimulating hormone.

    Science.gov (United States)

    Harel-Markowitz, Eliane; Gurevich, Michael; Shore, Laurence S; Katz, Adi; Stram, Yehuda; Shemesh, Mordechai

    2009-05-01

    Linearized p-eGFP (plasmid-enhanced green fluorescent protein) or p-hFSH (plasmid human FSH) sequences with the corresponding restriction enzyme were lipofected into sperm genomic DNA. Sperm transfected with p-eGFP were used for artificial insemination in hens, and in 17 out of 19 of the resultant chicks, the exogenous DNA was detected in their lymphocytes as determined by PCR and expressed in tissues as determined by (a) PCR, (b) specific emission of green fluorescence by the eGFP, and (c) Southern blot analysis. A complete homology was found between the Aequorea Victoria eGFP DNA and a 313-bp PCR product of extracted DNA from chick blood cells. Following insemination with sperm lipofected with p-hFSH, transgenic offspring were obtained for two generations as determined by detection of the transgene for human FSH (PCR) and expression of the gene (RT-PCR and quantitative real-time PCR) and the presence of the protein in blood (radioimmunoassay). Data demonstrate that lipofection of plasmid DNA with restriction enzyme is a highly efficient method for the production of transfected sperm to produce transgenic offspring by direct artificial insemination.

  15. Coat protein-mediated resistance against an Indian isolate of the ...

    Indian Academy of Sciences (India)

    Coat protein (CP)-mediated resistance against an Indian isolate of the Cucumber mosaic virus (CMV) subgroup IB was demonstrated in transgenic lines of Nicotiana benthamiana through Agrobacterium tumefaciens-mediated transformation. Out of the fourteen independently transformed lines developed, two lines were ...

  16. Age and lesion-induced increases of GDNF transgene expression in brain following intracerebral injections of DNA nanoparticles.

    Science.gov (United States)

    Yurek, D M; Hasselrot, U; Cass, W A; Sesenoglu-Laird, O; Padegimas, L; Cooper, M J

    2015-01-22

    In previous studies that used compacted DNA nanoparticles (DNP) to transfect cells in the brain, we observed higher transgene expression in the denervated striatum when compared to transgene expression in the intact striatum. We also observed that long-term transgene expression occurred in astrocytes as well as neurons. Based on these findings, we hypothesized that the higher transgene expression observed in the denervated striatum may be a function of increased gliosis. Several aging studies have also reported an increase of gliosis as a function of normal aging. In this study we used DNPs that encoded for human glial cell line-derived neurotrophic factor (hGDNF) and either a non-specific human polyubiquitin C (UbC) or an astrocyte-specific human glial fibrillary acidic protein (GFAP) promoter. The DNPs were injected intracerebrally into the denervated or intact striatum of young, middle-aged or aged rats, and glial cell line-derived neurotrophic factor (GDNF) transgene expression was subsequently quantified in brain tissue samples. The results of our studies confirmed our earlier finding that transgene expression was higher in the denervated striatum when compared to intact striatum for DNPs incorporating either promoter. In addition, we observed significantly higher transgene expression in the denervated striatum of old rats when compared to young rats following injections of both types of DNPs. Stereological analysis of GFAP+ cells in the striatum confirmed an increase of GFAP+ cells in the denervated striatum when compared to the intact striatum and also an age-related increase; importantly, increases in GFAP+ cells closely matched the increases in GDNF transgene levels. Thus neurodegeneration and aging may lay a foundation that is actually beneficial for this particular type of gene therapy while other gene therapy techniques that target neurons are actually targeting cells that are decreasing as the disease progresses. Copyright © 2014 IBRO. Published by

  17. Thy1.2 driven expression of transgenic His₆-SUMO2 in the brain of mice alters a restricted set of genes.

    Science.gov (United States)

    Rossner, Moritz J; Tirard, Marilyn

    2014-08-05

    Protein SUMOylation is a post-translational protein modification with a key regulatory role in nerve cell development and function, but its function in mammals in vivo has only been studied cursorily. We generated two new transgenic mouse lines that express His6-tagged SUMO1 and SUMO2 driven by the Thy1.2 promoter. The brains of mice of the two lines express transgenic His6-SUMO peptides and conjugate them to substrates in vivo but cytoarchitecture and synaptic organization of adult transgenic mouse brains are indistinguishable from the wild-type situation. We investigated the impact of transgenic SUMO expression on gene transcription in the hippocampus by performing genome wide analyses using microarrays. Surprisingly, no changes were observed in Thy1.2::His6-SUMO1 transgenic mice and only a restricted set of genes were upregulated in Thy1.2::His6-SUMO2 mice. Among these, Penk1 (Preproenkephalin 1), which encodes Met-enkephalin neuropeptides, showed the highest degree of alteration. Accordingly, a significant increase in Met-enkephalin peptide levels in the hippocampus of Thy1.2::His6-SUMO2 was detected, but the expression levels and cellular localization of Met-enkephalin receptors were not changed. Thus, transgenic neuronal expression of His6-SUMO1 or His6-SUMO2 only induces very minor phenotypical changes in mice. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. The Overexpression of TDP-43 Protein in the Neuron and Oligodendrocyte Cells Causes the Progressive Motor Neuron Degeneration in the SOD1 G93A Transgenic Mouse Model of Amyotrophic Lateral Sclerosis.

    Science.gov (United States)

    Lu, Yi; Tang, Chunyan; Zhu, Lei; Li, Jiao; Liang, Huiting; Zhang, Jie; Xu, Renshi

    2016-01-01

    The recent investigation suggested that the TDP-43 protein was closely related to the motor neuron degeneration in amyotrophic lateral sclerosis (ALS), but the pathogenesis contributed to motor neuron degeneration largely remained unknown. Therefore, we detected the alteration of TDP-43 expression and distribution in the adult spinal cord of the SOD1 G93A transgenic mouse model for searching the possible pathogenesis of ALS. We examined the TDP-43 expression and distribution in the different anatomic regions, segments and neural cells in the adult spinal cord at the different stages of the SOD1 wild-type and G93A transgenic model by the fluorescent immunohistochemical technology. We revealed that the amount of TDP-43 positive cell was cervical>lumbar>thoracic segment, that in the ventral horn was more than that in the dorsal horn, a few of TDP-43 protein sparsely expressed and distributed in the other regions, the TDP-43 protein weren't detected in the white matter and the central canal. The TDP-43 protein was mostly expressed and distributed in the nuclear of neuron cells and the cytoplasm of oligodendrocyte cells of the gray matter surrounding the central canal of spinal cord by the granular shape in the SOD1 wild-type and G93A transgenic mice. The amount of TDP-43 positive cell significantly increased at the onset and progression stages of ALS following with the increase of neuron death in spinal cord, particularly in the ventral horn of cervical segment at the progression stage. Our results suggested that the overexpression of TDP-43 protein in the neuron and oligodendrocyte cell causes the progressive motor neuron degeneration in the ALS-like mouse model.

  19. Enhanced Missing Proteins Detection in NCI60 Cell Lines Using an Integrative Search Engine Approach.

    Science.gov (United States)

    Guruceaga, Elizabeth; Garin-Muga, Alba; Prieto, Gorka; Bejarano, Bartolomé; Marcilla, Miguel; Marín-Vicente, Consuelo; Perez-Riverol, Yasset; Casal, J Ignacio; Vizcaíno, Juan Antonio; Corrales, Fernando J; Segura, Victor

    2017-12-01

    The Human Proteome Project (HPP) aims deciphering the complete map of the human proteome. In the past few years, significant efforts of the HPP teams have been dedicated to the experimental detection of the missing proteins, which lack reliable mass spectrometry evidence of their existence. In this endeavor, an in depth analysis of shotgun experiments might represent a valuable resource to select a biological matrix in design validation experiments. In this work, we used all the proteomic experiments from the NCI60 cell lines and applied an integrative approach based on the results obtained from Comet, Mascot, OMSSA, and X!Tandem. This workflow benefits from the complementarity of these search engines to increase the proteome coverage. Five missing proteins C-HPP guidelines compliant were identified, although further validation is needed. Moreover, 165 missing proteins were detected with only one unique peptide, and their functional analysis supported their participation in cellular pathways as was also proposed in other studies. Finally, we performed a combined analysis of the gene expression levels and the proteomic identifications from the common cell lines between the NCI60 and the CCLE project to suggest alternatives for further validation of missing protein observations.

  20. Stable Skin-specific Overexpression of Human CTLA4-Ig in Transgenic Mice through Seven Generations

    Institute of Scientific and Technical Information of China (English)

    Yong WANG; Yong NI; Hong WEI; Feng-Chao WANG; Liang-Peng GE; Xiang GAO

    2006-01-01

    Skin graft rejection is a typical cellular immune response, mainly mediated by T cells. Cytotoxic T lymphocyte associated antigen 4-immunoglobin (CTLA4-Ig) extends graft survival by blocking the T cell co-stimulation pathway and inhibiting T cell activation. To investigate the efficacy of CTLA4-Ig in prolonging skin graft survival, human CTLA4-Ig (hCTLA4-Ig) was engineered to overexpress in mouse skin by transgenesis using the K14 promoter. Reverse transcription-polymerase chain reaction (RT-PCR) and Western blot assay indicated that the expression of CTLA4-Ig remained skin-specific and relatively constant compared to the internal control protein, AKT, through seven generations. The presence and concentration of the hCTLA4-Ig protein in transgenic mouse sera was determined by enzyme-linked immunosorbent assay (ELISA), and the results indicated that the serum CTLA4-Ig concentration also remained constant through generations. Survival of transgenic mouse skins grafted onto rat wounds was remarkably prolonged compared to that of wild-type skins from the same mouse strain, and remained comparable among all seven generations. This suggested that the bioactive hCTLA4-Ig protein was stably expressed in transgenical mice through at least seven generations, which was consistent with the stable skin-specific CTLA4-Ig expression.The results demonstrated that the transgenic expression of hCTLA4-Ig in skin driven by the K14 promoter remained constant through generations, and a transgenic line can be established to provide transgenic skin with extended survival reproducibly.

  1. Transgenic Arabidopsis Gene Expression System

    Science.gov (United States)

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  2. Transgenic chickens expressing human urokinase-type plasminogen activator.

    Science.gov (United States)

    Lee, Sung Ho; Gupta, Mukesh Kumar; Ho, Young Tae; Kim, Teoan; Lee, Hoon Taek

    2013-09-01

    Urokinase-type plasminogen activator is a serine protease that is clinically used in humans for the treatment of thrombolytic disorders and vascular diseases such as acute ischemic stroke and acute peripheral arterial occlusion. This study explored the feasibility of using chickens as a bioreactor for producing human urokinase-type plasminogen activator (huPA). Recombinant huPA gene, under the control of a ubiquitous Rous sarcoma virus promoter, was injected into the subgerminal cavity of freshly laid chicken eggs at stage X using the replication-defective Moloney murine leukemia virus (MoMLV)-based retrovirus vectors encapsidated with VSV-G (vesicular stomatitis virus G) glycoprotein. A total of 38 chicks, out of 573 virus-injected eggs, hatched and contained the huPA gene in their various body parts. The mRNA transcript of the huPA gene was present in various organs, including blood and egg, and was germ-line transmitted to the next generation. The level of active huPA protein was 16-fold higher in the blood of the transgenic chicken than in the nontransgenic chicken (P huPA protein in eggs increased from 7.82 IU/egg in the G0 generation to 17.02 IU/egg in the G1 generation. However, huPA-expressing embryos had reduced survival and hatchability at d 18 and 21 of incubation, respectively, and the blood clotting time was significantly higher in transgenic chickens than their nontransgenic counterparts (P huPA transgenic chickens could be successfully produced by the retroviral vector system. Transgenic chickens, expressing the huPA under the control of a ubiquitous promoter, may not only be used as a bioreactor for pharming of the huPA drug but also be useful for studying huPA-induced bleeding and other disorders.

  3. Salt-induced root protein profile changes in seedlings of maize inbred lines with differing salt tolerances

    Directory of Open Access Journals (Sweden)

    Yujing Cheng

    2014-12-01

    Full Text Available Salt stress is one of the severest growth limited-factors to agriculture production. To gain in-depth knowledge of salt-stress response mechanisms, the proteomics analysis from two maize (Zea mays L. inbred lines was carried out using two-dimensional gel electrophoresis (2-DGE and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF/TOF-MS. There were 57 salt-regulated proteins identified, 21 and 36 proteins were differentially regulated in inbred lines 'Nongda 1145' (salt-resistant and 'D340' (salt-sensitive, respectively. The identified proteins were distributed in 11 biological processes and seven molecular functions. Under salt stress, proteins related to antioxidation and lignin synthesis were increased in both inbred lines. The relative abundance of proteins involved in translation initiation, elongation, and protein proteolysis increased in 'Nongda 1145' and decreased in 'D340'. In addition, the abundance of proteins involved in carbohydrate metabolism, protein refolding, ATP synthase and transcription differed between the two inbred lines. Our results suggest that the enhanced ability of salt-tolerant inbred line 'Nongda 1145' to combat salt stress occurs via regulation of transcription factors promoting increased antioxidation and lignin biosynthesis, enhanced energy production, and acceleration of protein translation and protein proteolysis.

  4. Expression of Finger Millet EcDehydrin7 in Transgenic Tobacco Confers Tolerance to Drought Stress.

    Science.gov (United States)

    Singh, Rajiv Kumar; Singh, Vivek Kumar; Raghavendrarao, Sanagala; Phanindra, Mullapudi Lakshmi Venkata; Venkat Raman, K; Solanke, Amolkumar U; Kumar, Polumetla Ananda; Sharma, Tilak Raj

    2015-09-01

    One of the critical alarming constraints for agriculture is water scarcity. In the current scenario, global warming due to climate change and unpredictable rainfall, drought is going to be a master player and possess a big threat to stagnating gene pool of staple food crops. So it is necessary to understand the mechanisms that enable the plants to cope with drought stress. In this study, effort was made to prospect the role of EcDehydrin7 protein from normalized cDNA library of drought tolerance finger millet in transgenic tobacco. Biochemical and molecular analyses of T0 transgenic plants were done for stress tolerance. Leaf disc assay, seed germination test, dehydration assay, and chlorophyll estimation showed EcDehydrin7 protein directly link to drought tolerance. Northern and qRT PCR analyses shows relatively high expression of EcDehydrin7 protein compare to wild type. T0 transgenic lines EcDehydrin7(11) and EcDehydrin7(15) shows superior expression among all lines under study. In summary, all results suggest that EcDehydrin7 protein has a remarkable role in drought tolerance and may be used for sustainable crop breeding program in other food crops.

  5. Transgenic plants with enhanced growth characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2018-01-09

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  6. Transgenic plants with enhanced growth characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2016-09-06

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  7. Nestin Reporter Transgene Labels Multiple Central Nervous System Precursor Cells

    Directory of Open Access Journals (Sweden)

    Avery S. Walker

    2010-01-01

    Full Text Available Embryonic neuroepithelia and adult subventricular zone (SVZ stem and progenitor cells express nestin. We characterized a transgenic line that expresses enhanced green fluorescent protein (eGFP specified to neural tissue by the second intronic enhancer of the nestin promoter that had several novel features. During embryogenesis, the dorsal telencephalon contained many and the ventral telencephalon few eGFP+ cells. eGFP+ cells were found in postnatal and adult neurogenic regions. eGFP+ cells in the SVZ expressed multiple phenotype markers, glial fibrillary acidic protein, Dlx, and neuroblast-specific molecules suggesting the transgene is expressed through the lineage. eGFP+ cell numbers increased in the SVZ after cortical injury, suggesting this line will be useful in probing postinjury neurogenesis. In non-neurogenic regions, eGFP was strongly expressed in oligodendrocyte progenitors, but not in astrocytes, even when they were reactive. This eGFP+ mouse will facilitate studies of proliferative neuroepithelia and adult neurogenesis, as well as of parenchymal oligodendrocytes.

  8. Focal glomerulosclerosis in proviral and c-fms transgenic mice links Vpr expression to HIV-associated nephropathy

    International Nuclear Information System (INIS)

    Dickie, Peter; Roberts, Amanda; Uwiera, Richard; Witmer, Jennifer; Sharma, Kirti; Kopp, Jeffrey B.

    2004-01-01

    Clinical and morphologic features of human immunodeficiency virus (HIV)-associated nephropathy (HIVAN), such as proteinuria, sclerosing glomerulopathy, tubular degeneration, and interstitial disease, have been modeled in mice bearing an HIV proviral transgene rendered noninfectious through a deletion in gag/pol. Exploring the genetic basis of HIVAN, HIV transgenic mice bearing mutations in either or both of the accessory genes nef and vpr were created. Proteinuria and focal glomerulosclerosis (FGS) only developed in mice with an intact vpr gene. Transgenic mice bearing a simplified proviral DNA (encoding only Tat and Vpr) developed renal disease characterized by FGS in which Vpr protein was localized to glomerular and tubular epithelia by immunohistochemistry. The dual transgenic progeny of HIV[Tat/Vpr] mice bred to HIV[ΔVpr] proviral transgenic mice displayed a more severe nephropathy with no apparent increase in Vpr expression, implying that multiple viral genes contribute to HIVAN. However, the unique contribution of macrophage-specific Vpr expression in the development of glomerular disease was underscored by the induction of FGS in multiple murine lines bearing a c-fms/vpr transgene

  9. Competitive Expression of Endogenous Wheat CENH3 May Lead to Suppression of Alien ZmCENH3 in Transgenic Wheat × Maize Hybrids.

    Science.gov (United States)

    Chen, Wei; Zhu, Qilin; Wang, Haiyan; Xiao, Jin; Xing, Liping; Chen, Peidu; Jin, Weiwei; Wang, Xiu-E

    2015-11-20

    Uniparental chromosome elimination in wheat × maize hybrid embryos is widely used in double haploid production of wheat. Several explanations have been proposed for this phenomenon, one of which is that the lack of cross-species CENH3 incorporation may act as a barrier to interspecies hybridization. However, it is unknown if this mechanism applies universally. To study the role of CENH3 in maize chromosome elimination of wheat × maize hybrid embryos, maize ZmCENH3 and wheat αTaCENH3-B driven by the constitutive CaMV35S promoter were transformed into wheat variety Yangmai 158. Five transgenic lines for ZmCENH3 and six transgenic lines for αTaCENH3-B were identified. RT-PCR analysis showed that the transgene could be transcribed at a low level in all ZmCENH3 transgenic lines, whereas transcription of endogenous wheat CENH3 was significantly up-regulated. Interestingly, the expression levels of both wheat CENH3 and ZmCENH3 in the ZmCENH3 transgenic wheat × maize hybrid embryos were higher than those in the non-transformed Yangmai 158 × maize hybrid embryos. This indicates that the alien ZmCENH3 in wheat may induce competitive expression of endogenous wheat CENH3, leading to suppression of ZmCENH3 over-expression. Eliminations of maize chromosomes in hybrid embryos of ZmCENH3 transgenic wheat × maize and Yangmai 158 × maize were compared by observations on micronuclei presence, by marker analysis using maize SSRs (simple sequence repeats), and by FISH (fluorescence in situ hybridization) using 45S rDNA as a probe. The results indicate that maize chromosome elimination events in the two crosses are not significantly different. Fusion protein ZmCENH3-YFP could not be detected in ZmCENH3 transgenic wheat by either Western blotting or immnunostaining, whereas accumulation and loading of the αTaCENH3-B-GFP fusion protein was normal in αTaCENH3-B transgenic lines. As ZmCENH3-YFP did not accumulate after AM114 treatment, we speculate that low levels of Zm

  10. Cellular, molecular and functional characterisation of YAC transgenic mouse models of Friedreich ataxia.

    Directory of Open Access Journals (Sweden)

    Sara Anjomani Virmouni

    Full Text Available Friedreich ataxia (FRDA is an autosomal recessive neurodegenerative disorder, caused by a GAA repeat expansion mutation within intron 1 of the FXN gene. We have previously established and performed preliminary characterisation of several human FXN yeast artificial chromosome (YAC transgenic FRDA mouse models containing GAA repeat expansions, Y47R (9 GAA repeats, YG8R (90 and 190 GAA repeats and YG22R (190 GAA repeats.We now report extended cellular, molecular and functional characterisation of these FXN YAC transgenic mouse models. FXN transgene copy number analysis of the FRDA mice demonstrated that the YG22R and Y47R lines each have a single copy of the FXN transgene while the YG8R line has two copies. Single integration sites of all transgenes were confirmed by fluorescence in situ hybridisation (FISH analysis of metaphase and interphase chromosomes. We identified significant functional deficits, together with a degree of glucose intolerance and insulin hypersensitivity, in YG8R and YG22R FRDA mice compared to Y47R and wild-type control mice. We also confirmed increased somatic GAA repeat instability in the cerebellum and brain of YG22R and YG8R mice, together with significantly reduced levels of FXN mRNA and protein in the brain and liver of YG8R and YG22R compared to Y47R.Together these studies provide a detailed characterisation of our GAA repeat expansion-based YAC transgenic FRDA mouse models that will help investigations of FRDA disease mechanisms and therapy.

  11. Comparison of semen variables, sperm DNA damage and sperm membrane proteins in two male layer breeder lines.

    Science.gov (United States)

    M, Shanmugam; T R, Kannaki; A, Vinoth

    2016-09-01

    Semen variables are affected by the breed and strain of chicken. The present study was undertaken to compare the semen quality in two lines of adult chickens with particular reference to sperm chromatin condensation, sperm DNA damage and sperm membrane proteins. Semen from a PD3 and White Leghorn control line was collected at 46 and 47 weeks and 55 weeks of age. The semen was evaluated for gross variables and sperm chromatin condensation by aniline blue staining. Sperm DNA damage was assessed by using the comet assay at 47 weeks of age and sperm membrane proteins were assessed at 55 weeks of age. The duration of fertility was studied by inseminating 100 million sperm once into the hens of the same line as well as another line. The eggs were collected after insemination for 15days and incubated. The eggs were candled on 18th day of incubation for observing embryonic development. The White Leghorn control line had a greater sperm concentration and lesser percentage of morphologically abnormal sperm at the different ages where assessments occurred. There was no difference in sperm chromatin condensation, DNA damage and membrane proteins between the lines. Only low molecular weight protein bands of less than 95kDa were observed in samples of both lines. The line from which semen was used had no effect on the duration over which fertility was sustained after insemination either when used in the same line or another line. Thus, from the results of the present study it may be concluded that there was a difference in gross semen variables between the lines that were studied, however, the sperm chromatin condensation, DNA damage, membrane proteins and duration over which fertility was sustained after insemination did not differ between the lines. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Heterologous Expression of Two Jatropha Aquaporins Imparts Drought and Salt Tolerance and Improves Seed Viability in Transgenic Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Kasim Khan

    Full Text Available Drought and high salinity are environmental conditions that cause adverse effects on the growth and productivity of crops. Aquaporins are small integral membrane proteins that belong to the family of the major intrinsic proteins (MIPs, with members in animals, plants and microbes, where they facilitate the transport of water and/or small neutral solutes thereby affecting water balance. In this study we characterized two aquaporin genes namely, plasma membrane intrinsic protein (PIP2;7 and tonoplast intrinsic protein TIP1;3 from Jatropha curcas that are localised to the plasma membrane and vacuole respectively. Transgenic Arabidopsis thaliana lines over-expressing JcPIP2;7 and JcTIP1;3 under a constitutive promoter show improved germination under high salt and mannitol compared to control seeds. These transgenic plants also show increased root length under abiotic stress conditions compared to wild type Col-0 plants. Transgenic lines exposed to drought conditions by withholding water for 20 days, were able to withstand water stress and attained normal growth after re-watering unlike control plants which could not survive. Transgenic lines also had better seed yield than control under salt stress. Importantly, seed viability of transgenic plants grown under high salt concentration was 35%-45% compared to less than 5% for control seeds obtained from plants growing under salt stress. The effect of JcPIP2;7 and JcTIP1;3 on improving germination and seed viability in drought and salinity make these important candidates for genetic manipulation of plants for growth in saline soils.

  13. Mechanism and DNA-based detection of field-evolved resistance to transgenic Bt corn in fall armyworm (Spodoptera frugiperda)

    Science.gov (United States)

    Evolution of resistance threatens sustainability of transgenic crops producing insecticidal proteins from the bacterium Bacillus thuringiensis (Bt). The fall armyworm is a devastating pest controlled by transgenic Bt corn producing the Cry1Fa insecticidal protein. However, fall armyworm populations ...

  14. [Apoptosis-modulating effects of heat shock proteins: the influence of Hsp27 chaperone on TBA Bcl-2 family proteins in Jurkat cell line].

    Science.gov (United States)

    Riazantseva, N V; Kaĭgorodova, E V; Maroshkina, A N; Belkina, M V; Novitskiĭ, V V

    2012-01-01

    The in vitro phosphorylated and non-phosphorylated Hsp27 forms concentrations and Bcl-2 proteins affected by Hsp27 inhibition were studied in Jurkat-line tumor cells and healthy donor mononuclear lymphocytes by Western blotting technique. The Hsp27 inhibition causes the increase of intracellular Bax protein concentration and the decrease of Bcl-2 level leading to an increase of apoptotic changes in Jurkat line cells.

  15. Quantitative analysis of lentiviral transgene expression in mice over seven generations.

    Science.gov (United States)

    Wang, Yong; Song, Yong-tao; Liu, Qin; Liu, Cang'e; Wang, Lu-lu; Liu, Yu; Zhou, Xiao-yang; Wu, Jun; Wei, Hong

    2010-10-01

    Lentiviral transgenesis is now recognized as an extremely efficient and cost-effective method to produce transgenic animals. Transgenes delivered by lentiviral vectors exhibited inheritable expression in many species including those which are refractory to genetic modification such as non-human primates. However, epigenetic modification was frequently observed in lentiviral integrants, and transgene expression found to be inversely correlated with methylation density. Recent data showed that about one-third lentiviral integrants exhibited hypermethylation and low expression, but did not demonstrate whether those integrants with high expression could remain constant expression and hypomethylated during long term germline transmission. In this study, using lentiviral eGFP transgenic mice as the experimental animals, lentiviral eGFP expression levels and its integrant numbers in genome were quantitatively analyzed by fluorescent quantitative polymerase-chain reaction (FQ-PCR), using the house-keeping gene ribosomal protein S18 (Rps18) and the single copy gene fatty acid binding protein of the intestine (Fabpi) as the internal controls respectively. The methylation densities of the integrants were quantitatively analyzed by bisulfite sequencing. We found that the lentiviral integrants with high expression exhibited a relative constant expression level per integrant over at least seven generations. Besides, the individuals containing these integrants exhibited eGFP expression levels which were positively and almost linearly correlated with the integrant numbers in their genomes, suggesting that no remarkable position effect on transgene expression of the integrants analyzed was observed. In addition, over seven generations the methylation density of these integrants did not increase, but rather decreased remarkably, indicating that these high expressing integrants were not subjected to de novo methylation during at least seven generations of germline transmission. Taken

  16. Determination of Endosperm Protein Secondary Structure in Hard Wheat Breeding Lines using Synchrotron Infrared Microspectroscopy

    International Nuclear Information System (INIS)

    Bonwell, E.; Fisher, T.; Fritz, A.; Wetzel, D.

    2008-01-01

    One molecular aspect of mature hard wheat protein quality for breadmaking is the relative amount of endosperm protein in the a-helix form compared with that in other secondary structure forms including β-sheet. Modeling of a-helix and β-sheet absorption bands that contribute to the amide I band at 1650 cm-1 was applied to more than 1500 spectra in this study. The microscopic view of wheat endosperm is dominated by many large starch granules with protein in between. The spectrum produced from in situ microspectroscopy of this mixture is dominated by carbohydrate bands from the large starch granules that fill up the field. The high spatial resolution achievable with synchrotron infrared microspectroscopy enables revealing good in situ spectra of the protein located interstitially. Synchrotron infrared microspectroscopic mapping of 4 μm thick frozen sections of endosperm in the subaleurone region provides spectra from a large number of pixels. Pixels with protein-dominated spectra are sorted out from among adjacent pixels to minimize the starch absorption and scattering contributions. Subsequent data treatment to extract information from the amide I band requires a high signal to noise ratio. Although spectral interference of the carbohydrate band on the amide band is not a problem, the scattering produced by the large starch granules diminishes the signal to noise ratio throughout the spectrum. High density mapping was done on beamlines U2B and U10B at the National Synchrotron Light Source at Brookhaven National Laboratory, Upton, NY. Mapping with a single masked spot size of 5.5 μm diameter or confocal 5 μm x 5 μm spot size, respectively, on the two beamlines used produced spectra for new breeding lines under current consideration. Appropriate data treatment allows calculation of a numerical estimate of the a-helix population relative to other secondary protein structures from the position and shape of the amide I absorption band. Current breeding lines show a

  17. Transgenic tools to characterize neuronal properties of discrete populations of zebrafish neurons.

    Science.gov (United States)

    Satou, Chie; Kimura, Yukiko; Hirata, Hiromi; Suster, Maximiliano L; Kawakami, Koichi; Higashijima, Shin-ichi

    2013-09-01

    The developing nervous system consists of a variety of cell types. Transgenic animals expressing reporter genes in specific classes of neuronal cells are powerful tools for the study of neuronal network formation. We generated a wide variety of transgenic zebrafish that expressed reporter genes in specific classes of neurons or neuronal progenitors. These include lines in which neurons of specific neurotransmitter phenotypes expressed fluorescent proteins or Gal4, and lines in which specific subsets of the dorsal progenitor domain in the spinal cord expressed fluorescent proteins. Using these, we examined domain organization in the developing dorsal spinal cord, and found that there are six progenitor domains in zebrafish, which is similar to the domain organization in mice. We also systematically characterized neurotransmitter properties of the neurons that are produced from each domain. Given that reporter gene expressions occurs in a wide area of the nervous system in the lines generated, these transgenic fish should serve as powerful tools for the investigation of not only the neurons in the dorsal spinal cord but also neuronal structures and functions in many other regions of the nervous system.

  18. Specific spatial learning deficits become severe with age in beta -amyloid precursor protein transgenic mice that harbor diffuse beta -amyloid deposits but do not form plaques

    Czech Academy of Sciences Publication Activity Database

    Koistinaho, M.; Ort, Michael; Cimadevilla, Jose Maria; Vondrous, R.; Cordell, B.; Koistinaho, J.; Bureš, Jan; Higgins, L.

    2001-01-01

    Roč. 98, č. 4 (2001), s. 14675-14680 ISSN 0027-8424 R&D Projects: GA ČR GA309/00/1656 Institutional research plan: CEZ:AV0Z5011922 Keywords : spatial memory * transgenic mice * alzheimer Subject RIV: FH - Neurology Impact factor: 10.890, year: 2001

  19. GhZFP1, a novel CCCH-type zinc finger protein from cotton, enhances salt stress tolerance and fungal disease resistance in transgenic tobacco by interacting with GZIRD21A and GZIPR5.

    Science.gov (United States)

    Guo, Ying-Hui; Yu, Yue-Ping; Wang, Dong; Wu, Chang-Ai; Yang, Guo-Dong; Huang, Jin-Guang; Zheng, Cheng-Chao

    2009-01-01

    * Zinc finger proteins are a superfamily involved in many aspects of plant growth and development. However, CCCH-type zinc finger proteins involved in plant stress tolerance are poorly understood. * A cDNA clone designated Gossypium hirsutum zinc finger protein 1 (GhZFP1), which encodes a novel CCCH-type zinc finger protein, was isolated from a salt-induced cotton (G. hirsutum) cDNA library using differential hybridization screening and further studied in transgenic tobacco Nicotiana tabacum cv. NC89. Using yeast two-hybrid screening (Y2H), proteins GZIRD21A (GhZFP1 interacting and responsive to dehydration protein 21A) and GZIPR5 (GhZFP1 interacting and pathogenesis-related protein 5), which interacted with GhZFP1, were isolated. * GhZFP1 contains two typical zinc finger motifs (Cx8Cx5Cx3H and Cx5Cx4Cx3H), a putative nuclear export sequence (NES) and a potential nuclear localization signal (NLS). Transient expression analysis using a GhZFP1::GFP fusion gene in onion epidermal cells indicated a nuclear localization for GhZFP1. RNA blot analysis showed that the GhZFP1 transcript was induced by salt (NaCl), drought and salicylic acid (SA). The regions in GhZFP1 that interact with GZIRD21A and GZIPR5 were identified using truncation mutations. * Overexpression of GhZFP1 in transgenic tobacco enhanced tolerance to salt stress and resistance to Rhizoctonia solani. Therefore, it appears that GhZFP1 might be involved as an important regulator in plant responses to abiotic and biotic stresses.

  20. Generation and characterization of neurogenin1-GFP transgenic medaka with potential for rapid developmental neurotoxicity screening

    International Nuclear Information System (INIS)

    Fan Chunyang; Simmons, Steven O.; Law, Sheran H.W.; Jensen, Karl; Cowden, John; Hinton, David; Padilla, Stephanie; Ramabhadran, Ram

    2011-01-01

    Fish models such as zebrafish and medaka are increasingly used as alternatives to rodents in developmental and toxicological studies. These developmental and toxicological studies can be facilitated by the use of transgenic reporters that permit the real-time, noninvasive observation of the fish. Here we report the construction and characterization of transgenic medaka lines expressing green fluorescent protein (GFP) under the control of the zebrafish neurogenin 1 (ngn1) gene promoter. Neurogenin (ngn1) is a helix-loop-helix transcription factor expressed in proliferating neuronal progenitor cells early in neuronal differentiation and plays a crucial role in directing neurogenesis. GFP expression was detected from 24 h post-fertilization until hatching, in a spatial pattern consistent with the previously reported zebrafish ngn1 expression. Temporal expression of the transgene parallels the expression profile of the endogenous medaka ngn1 transcript. Further, we demonstrate that embryos from the transgenic line permit the non-destructive, real-time screening of ngn1 promoter-directed GFP expression in a 96-well format, enabling higher throughput studies of developmental neurotoxicants. This strain has been deposited with and maintained by the National BioResource Project and is available on request ( (http://www.shigen.nig.ac.jp/medaka/strainDetailAction.do?quickSearch=true and strainId=5660)).

  1. Comparative Genomic Analysis of Transgenic Poplar Dwarf Mutant Reveals Numerous Differentially Expressed Genes Involved in Energy Flow

    Directory of Open Access Journals (Sweden)

    Su Chen

    2014-09-01

    Full Text Available In our previous research, the Tamarix androssowii LEA gene (Tamarix androssowii late embryogenesis abundant protein Mrna, GenBank ID: DQ663481 was transferred into Populus simonii × Populus nigra. Among the eleven transgenic lines, one exhibited a dwarf phenotype compared to the wild type and other transgenic lines, named dwf1. To uncover the mechanisms underlying this phenotype, digital gene expression libraries were produced from dwf1, wild-type, and other normal transgenic lines, XL-5 and XL-6. Gene expression profile analysis indicated that dwf1 had a unique gene expression pattern in comparison to the other two transgenic lines. Finally, a total of 1246 dwf1-unique differentially expressed genes were identified. These genes were further subjected to gene ontology and pathway analysis. Results indicated that photosynthesis and carbohydrate metabolism related genes were significantly affected. In addition, many transcription factors genes were also differentially expressed in dwf1. These various differentially expressed genes may be critical for dwarf mutant formation; thus, the findings presented here might provide insight for our understanding of the mechanisms of tree growth and development.

  2. Genome-Wide Analysis of a TaLEA-Introduced Transgenic Populus simonii × Populus nigra Dwarf Mutant

    Directory of Open Access Journals (Sweden)

    Jing Jiang

    2012-03-01

    Full Text Available A dwarf mutant (dwf1 was obtained among 15 transgenic lines, when TaLEA (Tamarix androssowii late embryogenesis abundant gene was introduced into Populus simonii × Populus nigra by Agrobacterium tumefaciens-mediated transformation. Under the same growth conditions, dwf1 height was significantly reduced compared with the wild type and the other transgenic lines. Because only one transgenic line (dwf1 displayed the dwarf phenotype, we considered that T-DNA insertion sites may play a role in the mutant formation. The mechanisms underlying this effect were investigated using TAIL-PCR (thermal asymmetric interlaced PCR and microarrays methods. According to the TAIL-PCR results, two flanking sequences located on chromosome IV and VIII respectively, were cloned. The results indicated the integration of two independent T-DNA copies. We searched for the potential genes near to the T-DNA insertions. The nearest gene was a putative poplar AP2 transcription factor (GI: 224073210. Expression analysis showed that AP2 was up-regulated in dwf1 compared with the wild type and the other transgenic lines. According to the microarrays results, a total of 537 genes involved in hydrolase, kinase and transcription factor activities, as well as protein and nucleotide binding, showed significant alterations in gene expression. These genes were expressed in more than 60 metabolic pathways, including starch, sucrose, galactose and glycerolipid metabolism and phenylpropanoids and flavonoid biosyntheses. Our transcriptome and T-DNA insertion sites analyses might provide some useful insights into the dwarf mutant formation.

  3. In Vivo Screening Using Transgenic Zebrafish Embryos Reveals New Effects of HDAC Inhibitors Trichostatin A and Valproic Acid on Organogenesis.

    Directory of Open Access Journals (Sweden)

    Ling Li

    Full Text Available The effects of endocrine disrupting chemicals (EDCs on reproduction are well known, whereas their developmental effects are much less characterized. However, exposure to endocrine disruptors during organogenesis may lead to deleterious and permanent problems later in life. Zebrafish (Danio rerio transgenic lines expressing the green fluorescent protein (GFP in specific organs and tissues are powerful tools to uncover developmental defects elicited by EDCs. Here, we used seven transgenic lines to visualize in vivo whether a series of EDCs and other pharmaceutical compounds can alter organogenesis in zebrafish. We used transgenic lines expressing GFP in pancreas, liver, blood vessels, inner ear, nervous system, pharyngeal tooth and pectoral fins. This screen revealed that four of the tested chemicals have detectable effects on different organs, which shows that the range of effects elicited by EDCs is wider than anticipated. The endocrine disruptor tetrabromobisphenol-A (TBBPA, as well as the three drugs diclofenac, trichostatin A (TSA and valproic acid (VPA induced abnormalities in the embryonic vascular system of zebrafish. Moreover, TSA and VPA induced specific alterations during the development of pancreas, an observation that was confirmed by in situ hybridization with specific markers. Developmental delays were also induced by TSA and VPA in the liver and in pharyngeal teeth, resulting in smaller organ size. Our results show that EDCs can induce a large range of developmental alterations during embryogenesis of zebrafish and establish GFP transgenic lines as powerful tools to screen for EDCs effects in vivo.

  4. Introgression of leginsulin, a cysteine-rich protein, and high-protein trait from an Asian soybean plant introduction genotype into a North American experimental soybean line.

    Science.gov (United States)

    Krishnan, Hari B; Kim, Won-Seok; Oehrle, Nathan W; Alaswad, Alaa A; Baxter, Ivan; Wiebold, William J; Nelson, Randall L

    2015-03-25

    Soybean is an important protein source for both humans and animals. However, soybean proteins are relatively poor in the sulfur-containing amino acids, cysteine and methionine. Improving the content of endogenous proteins rich in sulfur-containing amino acids could enhance the nutritive value of soybean meal. Leginsulin, a cysteine-rich peptide, predominantly accumulates in Asian soybean accessions but not in most North American cultivars. By screening diverse soybean accessions from the USDA Soybean Germplasm Collection, we were able to identify one plant introduction, PI 427138, as a high-protein line with relatively high amounts of both elemental sulfur and leginsulin. We introgressed these desirable traits from PI 427138 into an experimental line with the aim of improving the overall protein content and quality of seed proteins. Biochemical characterization of inbred progenies from the cross of LD00-3309 with PI 427138 grown at six locations revealed stable ingression of high protein, high elemental sulfur, and high leginsulin accumulation. Comparison of soybean seed proteins resolved by high-resolution 2-D gel electrophoresis in combination with Delta2D image analysis software revealed preferential accumulation of a few glycinin subunits contributed to the increased protein content in the introgressed lines. Amino acid analysis revealed that even though the leginsulin introgressed lines had higher protein, leginsulin, and elemental sulfur, the overall concentration of sulfur-containing amino acids was not significantly altered when compared with the parental lines. The experimental soybean lines developed during this study (Leg-3, Leg-7, and Leg-8) lack A5, A4, and B3 glycinin subunits and could be utilized in breeding programs to develop high-quality tofu cultivars.

  5. A CBL-Interacting Protein Kinase TaCIPK2 Confers Drought Tolerance in Transgenic Tobacco Plants through Regulating the Stomatal Movement.

    Science.gov (United States)

    Wang, Yan; Sun, Tao; Li, Tingting; Wang, Meng; Yang, Guangxiao; He, Guangyuan

    2016-01-01

    In plants, the CBL-CIPK signaling pathways play key roles in the response to abiotic stresses. However, functional studies of CIPKs in the important staple crop wheat are very rare. In this study, we identified a CIPK gene from wheat, designated TaCIPK2. Expression analysis results showed that TaCIPK2 could be up-regulated in wheat leaves by polyethylene glycol, abscisic acid and H2O2 treatments. Subcellular localization analyses revealed that TaCIPK2 was present in whole wheat epidermal cells. A yeast two-hybrid assay indicated that TaCIPK2 interacted with TaCBL1, 2, 3 and 4 in vitro. Transgenic tobacco plants over-expressing TaCIPK2 exhibited increased drought tolerance, indicated by a larger proportion of green cotyledons and higher survival rates under the osmotic and drought stress conditions compared with control plants. Additionally, physiological index analyses revealed that the transgenic tobacco plants had lower water loss rates and ion leakage, accumulated less malondialdehyde and H2O2, and had higher catalase and superoxide dismutase activities than the control plants. The transgenic plants also exhibited faster stomatal closure following exposure to osmotic stress conditions. The seed germination rates and stomatal aperture of TaCIPK2-overexpressing tobacco plants decreased after exogenous abscisic acid treatment was applied, implying that the transgenic tobacco plants were more sensitive to exogenous abscisic acid than the control plants. Our results indicate that TaCIPK2 plays a positive regulatory role in drought stress responses in transgenic tobacco plants.

  6. Distinct transmissibility features of TSE sources derived from ruminant prion diseases by the oral route in a transgenic mouse model (TgOvPrP4 overexpressing the ovine prion protein.

    Directory of Open Access Journals (Sweden)

    Jean-Noël Arsac

    Full Text Available Transmissible spongiform encephalopathies (TSEs are a group of fatal neurodegenerative diseases associated with a misfolded form of host-encoded prion protein (PrP. Some of them, such as classical bovine spongiform encephalopathy in cattle (BSE, transmissible mink encephalopathy (TME, kuru and variant Creutzfeldt-Jakob disease in humans, are acquired by the oral route exposure to infected tissues. We investigated the possible transmission by the oral route of a panel of strains derived from ruminant prion diseases in a transgenic mouse model (TgOvPrP4 overexpressing the ovine prion protein (A136R154Q171 under the control of the neuron-specific enolase promoter. Sources derived from Nor98, CH1641 or 87V scrapie sources, as well as sources derived from L-type BSE or cattle-passaged TME, failed to transmit by the oral route, whereas those derived from classical BSE and classical scrapie were successfully transmitted. Apart from a possible effect of passage history of the TSE agent in the inocula, this implied the occurrence of subtle molecular changes in the protease-resistant prion protein (PrPres following oral transmission that can raises concerns about our ability to correctly identify sheep that might be orally infected by the BSE agent in the field. Our results provide proof of principle that transgenic mouse models can be used to examine the transmissibility of TSE agents by the oral route, providing novel insights regarding the pathogenesis of prion diseases.

  7. Constitutive over-expression of rice chymotrypsin protease inhibitor gene OCPI2 results in enhanced growth, salinity and osmotic stress tolerance of the transgenic Arabidopsis plants.

    Science.gov (United States)

    Tiwari, Lalit Dev; Mittal, Dheeraj; Chandra Mishra, Ratnesh; Grover, Anil

    2015-07-01

    Protease inhibitors are involved primarily in defense against pathogens. In recent years, these proteins have also been widely implicated in response of plants to diverse abiotic stresses. Rice chymotrypsin protease inhibitor gene OCPI2 is highly induced under salt and osmotic stresses. The construct containing the complete coding sequence of OCPI2 cloned downstream to CaMV35S promoter was transformed in Arabidopsis and single copy, homozygous transgenic lines were produced. The transgenic plants exhibited significantly enhanced tolerance to NaCl, PEG and mannitol stress as compared to wild type plants. Importantly, the vegetative and reproductive growth of transgenic plants under unstressed, control conditions was also enhanced: transgenic plants were more vigorous than wild type, resulting into higher yield in terms of silique number. The RWC values and membrane stability index of transgenic in comparison to wild type plants was higher. Higher proline content was observed in the AtOCPI2 lines, which was associated with higher transcript expression of pyrroline-5-carboxylate synthase and lowered levels of proline dehydrogenase genes. The chymotrypsin protease activities were lower in the transgenic as against wild type plants, under both unstressed, control as well as stressed conditions. It thus appears that rice chymotrypsin protease inhibitor gene OCPI2 is a useful candidate gene for genetic improvement of plants against salt and osmotic stress. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  8. Hepatic steatosis in transgenic mice overexpressing human histone deacetylase 1

    International Nuclear Information System (INIS)

    Wang, Ai-Guo; Seo, Sang-Beom; Moon, Hyung-Bae; Shin, Hye-Jun; Kim, Dong Hoon; Kim, Jin-Man; Lee, Tae-Hoon; Kwon, Ho Jeong; Yu, Dae-Yeul; Lee, Dong-Seok

    2005-01-01

    It is generally thought that histone deacetylases (HDACs) play important roles in the transcriptional regulation of genes. However, little information is available concerning the specific functions of individual HDACs in disease states. In this study, two transgenic mice lines were established which harbored the human HDAC1 gene. Overexpressed HDAC1 was detected in the nuclei of transgenic liver cells, and HDAC1 enzymatic activity was significantly higher in the transgenic mice than in control littermates. The HDAC1 transgenic mice exhibited a high incidence of hepatic steatosis and nuclear pleomorphism. Molecular studies showed that HDAC1 may contribute to nuclear pleomorphism through the p53/p21 signaling pathway

  9. Competitive performance of transgenic wheat resistant to powdery mildew.

    Directory of Open Access Journals (Sweden)

    Olena Kalinina

    Full Text Available Genetically modified (GM plants offer an ideal model system to study the influence of single genes that confer constitutive resistance to pathogens on the ecological behaviour of plants. We used phytometers to study competitive interactions between GM lines of spring wheat Triticum aestivum carrying such genes and control lines. We hypothesized that competitive performance of GM lines would be reduced due to enhanced transgene expression under pathogen levels typically encountered in the field. The transgenes pm3b from wheat (resistance against powdery mildew Blumeria graminis or chitinase and glucanase genes from barley (resistance against fungi in general were introduced with the ubiquitin promoter from maize (pm3b and chitinase genes or the actin promoter from rice (glucanase gene. Phytometers of 15 transgenic and non-transgenic wheat lines were transplanted as seedlings into plots sown with the same 15 lines as competitive environments and subject to two soil nutrient levels. Pm3b lines had reduced mildew incidence compared with control lines. Chitinase and chitinase/glucanase lines showed the same high resistance to mildew as their control in low-nutrient treatment and slightly lower mildew rates than the control in high-nutrient environment. Pm3b lines were weaker competitors than control lines. This resulted in reduced yield and seed number. The Pm3b line with the highest transgene expression had 53.2% lower yield than the control whereas the Pm3b line which segregated in resistance and had higher mildew rates showed only minor costs under competition. The line expressing both chitinase and glucanase genes also showed reduced yield and seed number under competition compared with its control. Our results suggest that single transgenes conferring constitutive resistance to pathogens can have ecological costs and can weaken plant competitiveness even in the presence of the pathogen. The magnitude of these costs appears related to the degree

  10. Tetracycline-inducible system for regulation of skeletal muscle-specific gene expression in transgenic mice

    Science.gov (United States)

    Grill, Mischala A.; Bales, Mark A.; Fought, Amber N.; Rosburg, Kristopher C.; Munger, Stephanie J.; Antin, Parker B.

    2003-01-01

    Tightly regulated control of over-expression is often necessary to study one aspect or time point of gene function and, in transgenesis, may help to avoid lethal effects and complications caused by ubiquitous over-expression. We have utilized the benefits of an optimized tet-on system and a modified muscle creatine kinase (MCK) promoter to generate a skeletal muscle-specific, doxycycline (Dox) controlled over-expression system in transgenic mice. A DNA construct was generated in which the codon optimized reverse tetracycline transactivator (rtTA) was placed under control of a skeletal muscle-specific version of the mouse MCK promoter. Transgenic mice containing this construct expressed rtTA almost exclusively in skeletal muscles. These mice were crossed to a second transgenic line containing a bi-directional promoter centered on a tet responder element driving both a luciferase reporter gene and a tagged gene of interest; in this case the calpain inhibitor calpastatin. Compound hemizygous mice showed high level, Dox dependent muscle-specific luciferase activity often exceeding 10,000-fold over non-muscle tissues of the same mouse. Western and immunocytochemical analysis demonstrated similar Dox dependent muscle-specific induction of the tagged calpastatin protein. These findings demonstrate the effectiveness and flexibility of the tet-on system to provide a tightly regulated over-expression system in adult skeletal muscle. The MCKrtTA transgenic lines can be combined with other transgenic responder lines for skeletal muscle-specific over-expression of any target gene of interest.

  11. Analysis of Protein–Protein Interactions in MCF-7 and MDA-MB-231 Cell Lines Using Phthalic Acid Chemical

    Directory of Open Access Journals (Sweden)

    Shih-Shin Liang

    2014-11-01

    Full Text Available Phthalates are a class of plasticizers that have been characterized as endocrine disrupters, and are associated with genital diseases, cardiotoxicity, hepatotoxicity, and nephrotoxicity in the GeneOntology gene/protein database. In this study, we synthesized phthalic acid chemical probes and demonstrated differing protein–protein interactions between MCF-7 cells and MDA-MB-231 breast cancer cell lines. Phthalic acid chemical probes were synthesized using silicon dioxide particle carriers, which were modified using the silanized linker 3-aminopropyl triethoxyslane (APTES. Incubation with cell lysates from breast cancer cell lines revealed interactions between phthalic acid and cellular proteins in MCF-7 and MDA-MB-231 cells. Subsequent proteomics analyses indicated 22 phthalic acid-binding proteins in both cell types, including heat shock cognate 71-kDa protein, ATP synthase subunit beta, and heat shock protein HSP 90-beta. In addition, 21 MCF-7-specific and 32 MDA-MB-231 specific phthalic acid-binding proteins were identified, including related proteasome proteins, heat shock 70-kDa protein, and NADPH dehydrogenase and ribosomal correlated proteins, ras-related proteins, and members of the heat shock protein family, respectively.

  12. On-line NIR analysis of fat, water and protein in industrial scale ground meat batches.

    Science.gov (United States)

    Tøgersen, G; Isaksson, T; Nilsen, B N; Bakker, E A; Hildrum, K I

    1999-01-01

    Fat, water and protein contents in industrial scale meat batches were determined on-line by near infrared (NIR) reflectance spectroscopy. The NIR instrument was mounted at the outlet of a large meat grinder, and the measurements were performed in an industrial environment. Beef and pork samples, with chemical compositions of 7-26% fat, 58-75% water and 15-21% protein, were processed with hole diameters of 13mm in the grinder plate. Calibrations were made both for a combined set of beef and pork samples, and for separate sets of beef and pork samples. Validations were either done by full cross validation of the calibration set, or by bias corrected prediction of a test set. Prediction errors for the two sample sets, expressed as root mean square errors of cross validation or standard error of prediction, were in the ranges 0.82-1.49% fat, 0.94-1.33% water and 0.35-0.70% protein, depending of sample set and species of animal. The presented application is an improvement to the existing manual meat standardisation procedure, and has been implemented for regular use in a Norwegian meat manufacturing plant.

  13. Energy and protein relations in the broiler chicken. 4. Role of sex, line and substrate on in vitro lipogenesis

    International Nuclear Information System (INIS)

    Rosebrough, R.W.; Steele, N.C.; McMurtry, J.P.; Richards, M.P.; Mitchell, A.D.; Calvert, C.C.

    1986-01-01

    Experiments were conducted with dwarf (dw) and normal lines of chickens to determine the effect of sex, diet and line on lipogenesis in the 28-day-old chick. The chicks were fed diets containing 12, 18, 23 and 30% protein. In the first experiment, in vitro lipogenesis (incorporation of [2- 14 C] sodium acetate into hepatic fatty acids) as well as growth from 7 to 28 days of age were determined in males and females of both lines. In the second experiment, only males and females of the dwarf line were fed to determine the relative contribution of acetate and pyruvate to in vitro lipogenesis (incorporation of either [2- 14 C] sodium acetate or [2- 14 C) pyruvate into hepatic fatty acids). Chicks of the dwarf line were smaller than were those of the normal line. Females of both lines were smaller than males. In vitro lipogenesis was lower in the dwarf line; however the rate for both sexes within a given line was equal. An increase in the dietary protein decreased in vitro lipogenesis in both lines. The use of pyruvate as an in vitro precursor indicated that the regulation of lipid and carbohydrate metabolism may be an integrated process involving pyruvate carboxylation and subsequent flux of pyruvate carbon into either glucose or fatty acids. Based on the data presented, there is no evidence to assume, that the dwarf gene per se influences lipogenesis

  14. Transgenic expression of a functional fragment of harpin protein Hpa1 in wheat induces the phloem-based defence against English grain aphid

    Science.gov (United States)

    Fu, Maoqiang; Xu, Manyu; Zhang, Chunling

    2014-01-01

    The harpin protein Hpa1 has multiple beneficial effects in plants, promoting plant growth and development, increasing crop yield, and inducing resistance to pathogens and insect pests. For these effects, the 10–40 residue fragment (Hpa110–42) isolated from the Hpa1 sequence is 1.3- to 7.5-fold more effective than the full-length protein. Here it is reported that the expression of Hpa110–42 under the direction of an insect-induced promoter induces the phloem-based defence to English grain aphid, a dominant species of wheat aphids. The expression of Hpa110–42 was found to compromise the colonization preference of aphids on the plant and further inhibit aphid reproduction in leaf colonies. In Hpa110–42-expressing wheat lines, moreover, aphid feeding from the phloem was repressed in correlation with the phloem-based defence. This defensive mechanism was shown as enhanced expression of wheat genes encoding phloem lectin proteins (PP2-A1 and PP2-A2) and β-1,3-glucan synthase-like enzymes (GSL2, GSL10, and GSL12). Both PP2-A and β-1,3-glucan formed high molecular mass polymers to block phloem sieve plate pores and therefore impede aphid feeding from the phloem. However, the phloem-based defence was impaired by treating plants with ethylene signalling inhibitors, suggesting the requirement for the ethylene signalling pathway. In addition, if Hpa110–42-expressing plants were subjected to attack by a small number of aphids, they newly acquired agriculturally beneficial characters, such as enhanced vegetative growth and increased tiller numbers and grain output values. These results suggest that the defensive and developmental roles of Hpa110–42 can be integrated into the germplasm of this agriculturally significant crop. PMID:24676030

  15. Transgenic expression of a functional fragment of harpin protein Hpa1 in wheat induces the phloem-based defence against English grain aphid.

    Science.gov (United States)

    Fu, Maoqiang; Xu, Manyu; Zhou, Ting; Wang, Defu; Tian, Shan; Han, Liping; Dong, Hansong; Zhang, Chunling

    2014-04-01

    The harpin protein Hpa1 has multiple beneficial effects in plants, promoting plant growth and development, increasing crop yield, and inducing resistance to pathogens and insect pests. For these effects, the 10-40 residue fragment (Hpa1₁₀₋₄₂) isolated from the Hpa1 sequence is 1.3- to 7.5-fold more effective than the full-length protein. Here it is reported that the expression of Hpa1₁₀₋₄₂ under the direction of an insect-induced promoter induces the phloem-based defence to English grain aphid, a dominant species of wheat aphids. The expression of Hpa1₁₀₋₄₂ was found to compromise the colonization preference of aphids on the plant and further inhibit aphid reproduction in leaf colonies. In Hpa1₁₀₋₄₂-expressing wheat lines, moreover, aphid feeding from the phloem was repressed in correlation with the phloem-based defence. This defensive mechanism was shown as enhanced expression of wheat genes encoding phloem lectin proteins (PP2-A1 and PP2-A2) and β-1,3-glucan synthase-like enzymes (GSL2, GSL10, and GSL12). Both PP2-A and β-1,3-glucan formed high molecular mass polymers to block phloem sieve plate pores and therefore impede aphid feeding from the phloem. However, the phloem-based defence was impaired by treating plants with ethylene signalling inhibitors, suggesting the requirement for the ethylene signalling pathway. In addition, if Hpa1₁₀₋₄₂-expressing plants were subjected to attack by a small number of aphids, they newly acquired agriculturally beneficial characters, such as enhanced vegetative growth and increased tiller numbers and grain output values. These results suggest that the defensive and developmental roles of Hpa1₁₀₋₄₂ can be integrated into the germplasm of this agriculturally significant crop.

  16. Accurate measure of transgene copy number in crop plants using droplet digital PCR

    Science.gov (United States)

    Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy numb...

  17. Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice

    DEFF Research Database (Denmark)

    Fromont-Racine, M; Bucchini, D; Madsen, O

    1990-01-01

    Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific...... of the transgene was observed in cell types other than beta-islet cells....

  18. High level expression of Acidothermus cellulolyticus β-1, 4-endoglucanase in transgenic rice enhances the hydrolysis of its straw by cultured cow gastric fluid

    Energy Technology Data Exchange (ETDEWEB)

    Chou, Hong L.; Dai, Ziyu; Hsieh, Chia W.; Ku, Maurice S.

    2011-12-10

    Large-scale production of effective cellulose hydrolytic enzymes is the key to the bioconversion of agricultural residues to ethanol. The goal of this study was to develop a rice plant as a bioreactor for the large-scale production of cellulose hydrolytic enzymes via genetic transformation, and to simultaneously improve rice straw as an efficient biomass feedstock for conversion of cellulose to glucose. In this study, the cellulose hydrolytic enzyme {beta}-1, 4-endoglucanase (E1) from the thermophilic bacterium Acidothermus cellulolyticus was overexpressed in rice through Agrobacterium-mediated transformation. The expression of the bacterial gene in rice was driven by the constitutive Mac promoter, a hybrid promoter of Ti plasmid mannopine synthetase promoter and cauliflower mosaic virus 35S promoter enhancer with the signal peptide of tobacco pathogenesis-related protein for targeting the protein to the apoplastic compartment for storage. A total of 52 transgenic rice plants from six independent lines expressing the bacterial enzyme were obtained, which expressed the gene at high levels with a normal phenotype. The specific activities of E1 in the leaves of the highest expressing transgenic rice lines were about 20 fold higher than those of various transgenic plants obtained in previous studies and the protein amounts accounted for up to 6.1% of the total leaf soluble protein. Zymogram and temperature-dependent activity analyses demonstrated the thermostability of the enzyme and its substrate specificity against cellulose, and a simple heat treatment can be used to purify the protein. In addition, hydrolysis of transgenic rice straw with cultured cow gastric fluid yielded almost twice more reducing sugars than wild type straw. Taken together, these data suggest that transgenic rice can effectively serve as a bioreactor for large-scale production of active, thermostable cellulose hydrolytic enzymes. As a feedstock, direct expression of large amount of cellulases in

  19. Overexpression of cotton RAV1 gene in Arabidopsis confers transgenic plants high salinity and drought sensitivity.

    Science.gov (United States)

    Li, Xiao-Jie; Li, Mo; Zhou, Ying; Hu, Shan; Hu, Rong; Chen, Yun; Li, Xue-Bao

    2015-01-01

    RAV (related to ABI3/VP1) protein containing an AP2 domain in the N-terminal region and a B3 domain in the C-terminal region, which belongs to AP2 transcription factor family, is unique in higher plants. In this study, a gene (GhRAV1) encoding a RAV protein of 357 amino acids was identified in cotton (Gossypium hirsutum). Transient expression analysis of the eGFP:GhRAV1 fusion genes in tobacco (Nicotiana tabacum) epidermal cells revealed that GhRAV1 protein was localized in the cell nucleus. Quantitative RT-PCR analysis indicated that expression of GhRAV1 in cotton is induced by abscisic acid (ABA), NaCl and polyethylene glycol (PEG). Overexpression of GhRAV1 in Arabidopsis resulted in plant sensitive to ABA, NaCl and PEG. With abscisic acid (ABA) treatment, seed germination and green seedling rates of the GhRAV1 transgenic plants were remarkably lower than those of wild type. In the presence of NaCl, the seed germination and seedling growth of the GhRAV1 transgenic lines were inhibited greater than those of wild type. And chlorophyll content and maximum photochemical efficiency of the transgenic plants were significantly lower than those of wild type. Under drought stress, the GhRAV1 transgenic plants displayed more severe wilting than wild type. Furthermore, expressions of the stress-related genes were altered in the GhRAV1 transgenic Arabidopsis plants under high salinity and drought stresses. Collectively, our data suggested that GhRAV1 may be involved in response to high salinity and drought stresses through regulating expressions of the stress-related genes during cotton development.

  20. Usefulness of high-resolution sonography for assessement of hepatocellular carcinoma in the transgenic mice expressing hepatitis B virus X-protein; A preliminary study

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Kwon-Ha; Park, Sung Hoon; Kim, Chang Guhn; Won, Jong Jin; Moon, Hyung Bae [Wonkwang Univ. School of Medicine, Iksan (Korea, Republic of); Yu, Dae Yeul [Korea Advanced Institute of Science and Technology, Taejon (Korea, Republic of)

    2000-11-01

    To determine the value of high resolution ultrasonography (US) for the detection of hepatocellular carcinoma in the HBx transgenic mice. Forty-two HBx transgenic mice aged 8-20 (mean, 14) months underwent high-resolution ultrasound using a 10-12 MHz linear transducer. US findings indication the presence or absence, number, size and echogenicity of each hepatic tumor were analyzed, and in addition, color or power Doppler US was used to analyse tumoral vascularity. In each animal, sacrificed less than five hours after US examination, sonographic and pathologic findings were correlated. On gross pathologic examination, 20 hepatocellular carcinomas measuring 1.5-15 (mean, 4.7) mm in diameter were found in 16 mice; US revealed that 17 of the tumors were homogeneous hypoechoic nodules. With regard to tumor detection, sensitivity was 85%, specificity 96%, positive predictive value 0.944, negative predictive value 0.897, and overall accuracy 90%. Doppler US revealed that in three nodules, intratumoral vessels were present. In the other 26 mice, gross examination showed that no mass was present; microscopically, however, four nodules measuring 0.3-1.2 mm were found in four of these animals. Tumoral vascularity detected by color Doppler US corresponded to the intratumoral vessel within the nodules. One peritoneal nodule, confirmed as a metastatic tumor, was found at the greater omentum. In HBx transgenic mice, high-resolution US is valuable for the detection of hepatocellular carcinoma.

  1. Variations in seed protein content of cotton (Gossypium hirsutum L.) mutant lines by in vivo and in vitro mutagenesis.

    Science.gov (United States)

    Muthusamy, Annamalai; Jayabalan, Narayanasamy

    2013-01-01

    The present work describes the influence of gamma irradiation (GR), ethyl methane sulphonate (EMS) and sodium azide (SA) treatment on yield and protein content of selected mutant lines of cotton. Seeds of MCU 5 and MCU 11 were exposed to gamma rays (GR), ethyl methane sulphonate (EMS) and sodium azide (SA). Lower dose of gamma irradiation (100-500 Gy), 10-50 mM EMS and SA at lower concentration effectively influences in improving the yield and protein content. Significant increase in yield (258.9 g plant(-1)) and protein content (18.63 mg g(-1) d. wt.) as compared to parental lines was noted in M2 generations. During the subsequent field trials, number of mutant lines varied morphologically in terms of yield as well as biochemical characters such as protein. The selected mutant lines were bred true to their characters in M3 and M4 generations. The significant increase in protein content and profiles of the mutant lines with range of 10.21-18.63 mg g(-1). The SDS-PAGE analysis of mutant lines revealed 9 distinct bands of different intensities with range of 26-81 kDa. The difference in intensity of bands was more (41, 50 and 58 kDa) in the mutant lines obtained from in vitro mutation than in vivo mutation. Significance of such stimulation in protein content correlated with yielding ability of the mutant lines of cotton in terms of seed weight per plant. The results confirm that in cotton it is possible to enhance the both yield and biochemical characters by in vivo and in vitro mutagenic treatments.

  2. Effects of water management practices on residue decomposition and degradation of Cry1Ac protein from crop-wild Bt rice hybrids and parental lines during winter fallow season.

    Science.gov (United States)

    Xiao, Manqiu; Dong, Shanshan; Li, Zhaolei; Tang, Xu; Chen, Yi; Yang, Shengmao; Wu, Chunyan; Ouyang, Dongxin; Fang, Changming; Song, Zhiping

    2015-12-01

    Rice is the staple diet of over half of the world's population and Bacillus thuringiensis (Bt) rice expressing insecticidal Cry proteins is ready for deployment. An assessment of the potential impact of Bt rice on the soil ecosystem under varied field management practices is urgently required. We used litter bags to assess the residue (leaves, stems and roots) decomposition dynamics of two transgenic rice lines (Kefeng6 and Kefeng8) containing stacked genes from Bt and sck (a modified CpTI gene encoding a cowpea trypsin inhibitor) (Bt/CpTI), a non-transgenic rice near-isoline (Minghui86), wild rice (Oryza rufipogon) and crop-wild Bt rice hybrid under contrasting conditions (drainage or continuous flooding) in the field. No significant difference was detected in the remaining mass, total C and total N among cultivars under aerobic conditions, whereas significant differences in the remaining mass and total C were detected between Kefeng6 and Kefeng8 and Minghui86 under the flooded condition. A higher decomposition rate constant (km) was measured under the flooded condition compared with the aerobic condition for leaf residues, whereas the reverse was observed for root residues. The enzyme-linked immunosorbent assay (ELISA), which was used to monitor the changes in the Cry1Ac protein in Bt rice residues, indicated that (1) the degradation of the Cry1Ac protein under both conditions best fit first-order kinetics, and the predicted DT50 (50% degradation time) of the Cry1Ac protein ranged from 3.6 to 32.5 days; (2) the Cry1Ac protein in the residue degraded relatively faster under aerobic conditions; and (3) by the end of the study (~154 days), the protein was present at a low concentration in the remaining residues under both conditions. The degradation rate constant was negatively correlated with the initial carbon content and positively correlated with the initial Cry1Ac protein concentration, but it was only correlated with the mass decomposition rate constants under

  3. Overview on the investigations of transgenic plums in Romania

    Science.gov (United States)

    Transgenic plums of Prunus domestica L. transformed with the Plum pox virus coat protein gene (PPV-CP) were the subjects of three experiments undertaken in Romania. In the first experiment, PPV-CP transgenic clones C2, C3, C4, C5, C6, PT3 and PT5 were evaluated for Sharka resistance under high natu...

  4. Overview of the investigation of transgenic plums in Romania

    Science.gov (United States)

    Transgenic plums of Prunus domestica L. transformed with the Plum pox virus coat protein gene (PPV-CP) were the subjects of three experiments undertaken in Romania. In the first experiment, PPV-CP transgenic clones C2, C3, C4, C5, C6 and PT3 were evaluated for Sharka resistance under high natural i...

  5. Expression of a pathogen-induced cysteine protease (AdCP) in tapetum results in male sterility in transgenic tobacco.

    Science.gov (United States)

    Shukla, Pawan; Singh, Naveen Kumar; Kumar, Dilip; Vijayan, Sambasivam; Ahmed, Israr; Kirti, Pulugurtha Bharadwaja

    2014-06-01

    Usable male sterility systems have immense potential in developing hybrid varieties in crop plants, which can also be used as a biological safety containment to prevent horizontal transgene flow. Barnase-Barstar system developed earlier was the first approach to engineer male sterility in plants. In an analogous situation, we have evolved a system of inducing pollen abortion and male sterility in transgenic tobacco by expressing a plant gene coding for a protein with known developmental function in contrast to the Barnase-Barstar system, which deploys genes of prokaryotic origin, i.e., from Bacillus amyloliquefaciens. We have used a plant pathogen-induced gene, cysteine protease for inducing male sterility. This gene was identified in the wild peanut, Arachis diogoi differentially expressed when it was challenged with the late leaf spot pathogen, Phaeoisariopsis personata. Arachis diogoi cysteine protease (AdCP) was expressed under the strong tapetum-specific promoter (TA29) and tobacco transformants were generated. Morphological and histological analysis of AdCP transgenic plants showed ablated tapetum and complete pollen abortion in three transgenic lines. Furthermore, transcript analysis displayed the expression of cysteine protease in these male sterile lines and the expression of the protein was identified in western blot analysis using its polyclonal antibody raised in the rabbit system.

  6. Development of marker-free transgenic lettuce resistant to Mirafiori lettuce big-vein virus.

    Science.gov (United States)

    Kawazu, Yoichi; Fujiyama, Ryoi; Imanishi, Shunsuke; Fukuoka, Hiroyuki; Yamaguchi, Hirotaka; Matsumoto, Satoru

    2016-10-01

    Lettuce big-vein disease caused by Mirafiori lettuce big-vein virus (MLBVV) is found in major lettuce production areas worldwide, but highly resistant cultivars have not yet been developed. To produce MLBVV-resistant marker-free transgenic lettuce that would have a transgene with a promoter and terminator of lettuce origin, we constructed a two T-DNA binary vector, in which the first T-DNA contained the selectable marker gene neomycin phosphotransferase II, and the second T-DNA contained the lettuce ubiquitin gene promoter and terminator and inverted repeats of the coat protein (CP) gene of MLBVV. This vector was introduced into lettuce cultivars 'Watson' and 'Fuyuhikari' by Agrobacterium tumefaciens-mediated transformation. Regenerated plants (T0 generation) that were CP gene-positive by PCR analysis were self-pollinated, and 312 T1 lines were analyzed for resistance to MLBVV. Virus-negative plants were checked for the CP gene and the marker gene, and nine lines were obtained which were marker-free and resistant to MLBVV. Southern blot analysis showed that three of the nine lines had two copies of the CP gene, whereas six lines had a single copy and were used for further analysis. Small interfering RNAs, which are indicative of RNA silencing, were detected in all six lines. MLBVV infection was inhibited in all six lines in resistance tests performed in a growth chamber and a greenhouse, resulting in a high degree of resistance to lettuce big-vein disease. Transgenic lettuce lines produced in this study could be used as resistant cultivars or parental lines for breeding.

  7. Expression and activity of multidrug resistance protein 1 in a murine thymoma cell line

    Science.gov (United States)

    Echevarria-Lima, Juliana; Kyle-Cezar, Fernanda; Leite, Daniela F P; Capella, Luiz; Capella, Márcia A M; Rumjanek, Vivian M

    2005-01-01

    Multidrug resistance proteins [MRPs and P-glycoprotein (Pgp)] are members of the family of ATP-binding cassette (ABC) transport proteins, originally described as being involved in the resistance against anti-cancer agents in tumour cells. These proteins act as ATP-dependent efflux pumps and have now been described in normal cells where they exert physiological roles. The aim of this work was to investigate the expression and activity of MRP and Pgp in the thymoma cell line, EL4. It was observed that EL4 cells expressed mRNA for MRP1, but not for MRP2, MRP3 or Pgp. The activity of ABC transport proteins was evaluated by using the efflux of the fluorescent probes carboxy-2′-7′-dichlorofluorescein diacetate (CFDA) and rhodamine 123 (Rho 123). EL4 cells did not retain CFDA intracellularly, and MRP inhibitors (probenecid, indomethacin and MK 571) decreased MRP1 activity in a concentration-dependent manner. As expected, EL4 cells accumulated Rho 123, and the presence of cyclosporin A and verapamil did not modify this accumulation. Most importantly, when EL4 cells were incubated in the presence of the MRP1 inhibitors indomethacin and MK 571 for 6 days, they started to express CD4 and CD8 molecules on their surface, producing double-positive cells and CD8 single-positive cells. Our results suggest that MRP activity is important for the maintenance of the undifferentiated state in this cell type. This finding might have implications in the physiological process of normal thymocyte maturation. PMID:15804283

  8. Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.

    Directory of Open Access Journals (Sweden)

    Vinciane Régnier

    Full Text Available The cystathionine β-synthase (CBS gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA metabolism, a pathway important for several brain physiological processes.Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1 expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line.We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.

  9. Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.

    Science.gov (United States)

    Régnier, Vinciane; Billard, Jean-Marie; Gupta, Sapna; Potier, Brigitte; Woerner, Stéphanie; Paly, Evelyne; Ledru, Aurélie; David, Sabrina; Luilier, Sabrina; Bizot, Jean-Charles; Vacano, Guido; Kraus, Jan P; Patterson, David; Kruger, Warren D; Delabar, Jean M; London, Jaqueline

    2012-01-01

    The cystathionine β-synthase (CBS) gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS) cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA) metabolism, a pathway important for several brain physiological processes. Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1) expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line. We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.

  10. Generation and characterization of a transgenic pig carrying a DsRed-monomer reporter gene.

    Directory of Open Access Journals (Sweden)

    Chih-Jen Chou

    Full Text Available Pigs are an optimal animal for conducting biomedical research because of their anatomical and physiological resemblance to humans. In contrast to the abundant resources available in the study of mice, few fluorescent protein-harboring porcine models are available for preclinical studies. In this paper, we report the successful generation and characterization of a transgenic DsRed-Monomer porcine model.The transgene comprised a CMV enhancer/chicken-beta actin promoter and DsRed monomeric cDNA. Transgenic pigs were produced by using pronuclear microinjection. PCR and Southern blot analyses were applied for identification of the transgene. Histology, blood examinations and computed tomography were performed to study the health conditions. The pig amniotic fluid progenitor/stem cells were also isolated to examine the existence of red fluorescence and differentiation ability.Transgenic pigs were successfully generated and transmitted to offspring at a germ-line transmission rate of 43.59% (17/39. Ubiquitous expression of red fluorescence was detected in the brain, eye, tongue, heart, lung, liver, pancreas, spleen, stomach, small intestine, large intestine, kidney, testis, and muscle; this was confirmed by histology and western blot analyses. In addition, we confirmed the differentiation potential of amniotic fluid progenitor stem cells isolated from the transgenic pig.This red fluorescent pig can serve as a host for other fluorescent-labeled cells in order to study cell-microenvironment interactions, and can provide optimal red-fluorescent-labeled cells and tissues for research in developmental biology, regenerative medicine, and xenotransplantation.

  11. Protein degradation rate is the dominant mechanism accounting for the differences in protein abundance of basal p53 in a human breast and colorectal cancer cell line.

    Directory of Open Access Journals (Sweden)

    Eszter Lakatos

    Full Text Available We determine p53 protein abundances and cell to cell variation in two human cancer cell lines with single cell resolution, and show that the fractional width of the distributions is the same in both cases despite a large difference in average protein copy number. We developed a computational framework to identify dominant mechanisms controlling the variation of protein abundance in a simple model of gene expression from the summary statistics of single cell steady state protein expression distributions. Our results, based on single cell data analysed in a Bayesian framework, lends strong support to a model in which variation in the basal p53 protein abundance may be best explained by variations in the rate of p53 protein degradation. This is supported by measurements of the relative average levels of mRNA which are very similar despite large variation in the level of protein.

  12. Protein degradation rate is the dominant mechanism accounting for the differences in protein abundance of basal p53 in a human breast and colorectal cancer cell line.

    Science.gov (United States)

    Lakatos, Eszter; Salehi-Reyhani, Ali; Barclay, Michael; Stumpf, Michael P H; Klug, David R

    2017-01-01

    We determine p53 protein abundances and cell to cell variation in two human cancer cell lines with single cell resolution, and show that the fractional width of the distributions is the same in both cases despite a large difference in average protein copy number. We developed a computational framework to identify dominant mechanisms controlling the variation of protein abundance in a simple model of gene expression from the summary statistics of single cell steady state protein expression distributions. Our results, based on single cell data analysed in a Bayesian framework, lends strong support to a model in which variation in the basal p53 protein abundance may be best explained by variations in the rate of p53 protein degradation. This is supported by measurements of the relative average levels of mRNA which are very similar despite large variation in the level of protein.

  13. Ectopic expression of wheat expansin gene TaEXPA2 improved the salt tolerance of transgenic tobacco by regulating Na+ /K+ and antioxidant competence.

    Science.gov (United States)

    Chen, Yanhui; Han, Yangyang; Kong, Xiangzhu; Kang, Hanhan; Ren, Yuanqing; Wang, Wei

    2017-02-01

    High salinity is one of the most serious environmental stresses that limit crop growth. Expansins are cell wall proteins that regulate plant development and abiotic stress tolerance by mediating cell wall expansion. We studied the function of a wheat expansin gene, TaEXPA2, in salt stress tolerance by overexpressing it in tobacco. Overexpression of TaEXPA2 enhanced the salt stress tolerance of transgenic tobacco plants as indicated by the presence of higher germination rates, longer root length, more lateral roots, higher survival rates and more green leaves under salt stress than in the wild type (WT). Further, when leaf disks of WT plants were incubated in cell wall protein extracts from the transgenic tobacco plants, their chlorophyll content was higher under salt stress, and this improvement from TaEXPA2 overexpression in transgenic tobacco was inhibited by TaEXPA2 protein antibody. The water status of transgenic tobacco plants was improved, perhaps by the accumulation of osmolytes such as proline and soluble sugar. TaEXPA2-overexpressing tobacco lines exhibited lower Na + but higher K + accumulation than WT plants. Antioxidant competence increased in the transgenic plants because of the increased activity of antioxidant enzymes. TaEXPA2 protein abundance in wheat was induced by NaCl, and ABA signaling was involved. Gene expression regulation was involved in the enhanced salt stress tolerance of the TaEXPA2 transgenic plants. Our results suggest that TaEXPA2 overexpression confers salt stress tolerance on the transgenic plants, and this is associated with improved water status, Na + /K + homeostasis, and antioxidant competence. ABA signaling participates in TaEXPA2-regulated salt stress tolerance. © 2016 Scandinavian Plant Physiology Society.

  14. Expression Analysis of CB2-GFP BAC Transgenic Mice.

    Science.gov (United States)

    Schmöle, Anne-Caroline; Lundt, Ramona; Gennequin, Benjamin; Schrage, Hanna; Beins, Eva; Krämer, Alexandra; Zimmer, Till; Limmer, Andreas; Zimmer, Andreas; Otte, David-Marian

    2015-01-01

    The endocannabinoid system (ECS) is a retrograde messenger system, consisting of lipid signaling molecules that bind to at least two G-protein-coupled receptors, Cannabinoid receptor 1 and 2 (CB1 and 2). As CB2 is primarily expressed on immune cells such as B cells, T cells, macrophages, dendritic cells, and microglia, it is of great interest how CB2 contributes to immune cell development and function in health and disease. Here, understanding the mechanisms of CB2 involvement in immune-cell function as well as the trafficking and regulation of CB2 expressing cells are crucial issues. Up to now, CB2 antibodies produce unclear results, especially those targeting the murine protein. Therefore, we have generated BAC transgenic GFP reporter mice (CB2-GFPTg) to trace CB2 expression in vitro and in situ. Those mice express GFP under the CB2 promoter and display GFP expression paralleling CB2 expression on the transcript level in spleen, thymus and brain tissue. Furthermore, by using fluorescence techniques we show that the major sources for GFP-CB2 expression are B cells in spleen and blood and microglia in the brain. This novel CB2-GFP transgenic reporter mouse line represents a powerful resource to study CB2 expression in different cell types. Furthermore, it could be used for analyzing CB2-mediated mobilization and trafficking of immune cells as well as studying the fate of recruited immune cells in models of acute and chronic inflammation.

  15. Expression Analysis of CB2-GFP BAC Transgenic Mice.

    Directory of Open Access Journals (Sweden)

    Anne-Caroline Schmöle

    Full Text Available The endocannabinoid system (ECS is a retrograde messenger system, consisting of lipid signaling molecules that bind to at least two G-protein-coupled receptors, Cannabinoid receptor 1 and 2 (CB1 and 2. As CB2 is primarily expressed on immune cells such as B cells, T cells, macrophages, dendritic cells, and microglia, it is of great interest how CB2 contributes to immune cell development and function in health and disease. Here, understanding the mechanisms of CB2 involvement in immune-cell function as well as the trafficking and regulation of CB2 expressing cells are crucial issues. Up to now, CB2 antibodies produce unclear results, especially those targeting the murine protein. Therefore, we have generated BAC transgenic GFP reporter mice (CB2-GFPTg to trace CB2 expression in vitro and in situ. Those mice express GFP under the CB2 promoter and display GFP expression paralleling CB2 expression on the transcript level in spleen, thymus and brain tissue. Furthermore, by using fluorescence techniques we show that the major sources for GFP-CB2 expression are B cells in spleen and blood and microglia in the brain. This novel CB2-GFP transgenic reporter mouse line represents a powerful resource to study CB2 expression in different cell types. Furthermore, it could be used for analyzing CB2-mediated mobilization and trafficking of immune cells as well as studying the fate of recruited immune cells in models of acute and chronic inflammation.

  16. Glycinebetaine synthesizing transgenic potato plants exhibit enhanced tolerance to salt and cold stresses

    International Nuclear Information System (INIS)

    Ahmad, R.; Hussain, J.

    2014-01-01

    Abiotic stresses are the most important contributors towards low productivity of major food crops. Various attempts have been made to enhance abiotic stress tolerance of crop plants by classical breeding and genetic transformation. Genetic transformation with glycinebetaine (GB) synthesizing enzymes' gene(s) in naturally non accumulating plants has resulted in enhanced tolerance against variety of abiotic stresses. Present study was aimed to evaluate the performance of GB synthesizing transgenic potato plants against salt and cold stresses. Transgenic potato plants were challenged against salt and cold stresses at whole plant level. Transgenic lines were characterized to determine the transgene copy number. Different parameters like integrity, chlorophyll contents, tuber yield and vegetative biomass were studied to monitor the stress tolerance of transgenic potato plants. The results were compared with Non-transgenic (NT) plants and statistically analyzed to evaluate significant differences. Multi-copy insertion of expression cassette was found in both transgenic lines. Upon salt stress, transgenic plants maintained better growth as compared to NT plants. The tuber yield of transgenic plants was significantly greater than NT plants in salt stress. Transgenic plants showed improved membrane integrity against cold stress by depicting appreciably reduced ion leakage as compared to NT plants. Moreover, transgenic plants showed significantly less chlorophyll bleaching than NT plants upon cold stress. In addition, NT plants accumulated significantly less biomass, and yielded fewer tubers as compared to transgenic plants after cold stress treatment. The study will be a committed step for field evaluation of transgenic plants with the aim of commercialization. (author)

  17. [Establishment and identification of mouse lymphoma cell line EL4 expressing red fluorescent protein].

    Science.gov (United States)

    Li, Yan-Jie; Cao, Jiang; Chen, Chong; Wang, Dong-Yang; Zeng, Ling-Yu; Pan, Xiu-Ying; Xu, Kai-Lin

    2010-02-01

    This study was purposed to construct a lentiviral vector encoding red fluorescent protein (DsRed) and transfect DsRed into EL4 cells for establishing mouse leukemia/lymphoma model expressing DsRed. The bicistronic SIN lentiviral transfer plasmid containing the genes encoding neo and internal ribosomal entry site-red fluorescent protein (IRES-DsRed) was constructed. Human embryonic kidney 293FT cells were co-transfected with the three plasmids by liposome method. The viral particles were collected and used to transfect EL4 cells, then the cells were selected by G418. The results showed that the plasmid pXZ208-neo-IRES-DsRed was constructed successfully, and the viral titer reached to 10(6) U/ml. EL4 cells were transfected by the viral solution efficiently. The transfected EL4 cells expressing DsRed survived in the final concentration 600 microg/ml of G418. The expression of DsRed in the transfected EL4 cells was demonstrated by fluorescence microscopy and flow cytometry. In conclusion, the EL4/DsRed cell line was established successfully.

  18. Comparison of herpes simplex (HSV) proteins synthesized in Vero, HEP-2 and human megakaryocyte-like cell lines

    International Nuclear Information System (INIS)

    Soslau, G.; Pastorino, M.B.; Morgan, D.A.; Brodsky, I.; Howett, M.K.

    1986-01-01

    The natural human host blood cell capable of supporting herpes virus replication has yet to be defined. They found that a recently cultured human megakaryocyte-like (Meg) cell line can support HSV 1 and 2 replication as demonstrated by growth inhibition, CPE, virus production and HSV DNA synthesis. The HSV proteins synthesized and post-translationally modified in Vero and HEp-2 infected cells were compared to the protein species produced in the infected Meg cell since differences may influence antigenic properties and host range. Host cell protein synthesis was greatly reduced in all three cell lines within hours post infection (pi). However, maximum viral protein synthesis occurs between 4 and 24 hrs pi with the Meg cells as compared to 24-48 hrs pi with the other cell lines. The immunoprecipitated 35 S-methionine labeled HSV protein gel patterns for each infected cell line are qualitatively and quantitatively very different from each other. Dramatic differences were also observed when infected cells were labeled with 32 P-ATP (in vitro method) or 32 Pi (in vivo method). Finally, analysis of 3 H-mannose labeled HSV glycoproteins demonstrates that the post-translational modifications of these proteins are significantly altered in the Meg cell as compared to the Vero and HEp-2 cells

  19. Glucocorticoids regulate surfactant protein synthesis in a pulmonary adenocarcinoma cell line

    International Nuclear Information System (INIS)

    O'Reilly, M.A.; Gazdar, A.F.; Clark, J.C.; Pilot-Matias, T.J.; Wert, S.E.; Hull, W.M.; Whitsett, J.A.

    1989-01-01

    Synthesis of pulmonary surfactant proteins SP-A, SP-B, and SP-C was demonstrated in a cell line derived from a human adenocarcinoma of the lung. The cells contained numerous lamellar inclusion bodies and formed organized groups of cells containing well-developed junctional complexes and apical microvillous membranes. Synthesis of SP-A was detected in the cells by enzyme-linked immunoabsorbent assay and by immunoprecipitation of [35S]methionine-labeled protein. SP-A was identified as an Mr 31,000-36,000 polypeptide containing asparagine-linked carbohydrate. Northern blot analysis detected SP-A mRNA of 2.2 kb. Dexamethasone (1-10 nM) enhanced the relative abundance of SP-A mRNA. Despite stimulation of SP-A mRNA, intracellular SP-A content was unaltered or inhibited by dexamethasone. SP-B and SP-C mRNAs and synthesis of the SP-B and SP-C precursors were markedly induced by dexamethasone. ProSP-B was synthesized and secreted primarily as an Mr 42,000-46,000 polypeptide. Proteolysis of the proSP-B resulted in the generation of endoglycosidase F-sensitive Mr = 19,000-21,000 and 25,000-27,000 peptides, which were detected both intra- and extracellularly. SP-C proprotein of Mr = 22,000 and smaller SP-C fragments were detected intracellularly but were not detected in the media. Mature forms of SP-B (Mr = 8,000) and SP-C (Mr = 4,000) were not detected. Glucocorticoids directly enhance the relative synthesis and mRNA of the surfactant proteins SP-A, SP-B, and SP-C. Discrepancies among SP-A mRNA, its de novo synthesis, and cell content suggest that glucocorticoid may alter both pre- and posttranslational factors modulating SP-A expression

  20. Liver tumor formation by a mutant retinoblastoma protein in the transgenic mice is caused by an upregulation of c-Myc target genes

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Bo; Hikosaka, Keisuke; Sultana, Nishat; Sharkar, Mohammad Tofael Kabir [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Noritake, Hidenao [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Department of Internal Medicine, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Kimura, Wataru; Wu, Yi-Xin [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Kobayashi, Yoshimasa [Department of Internal Medicine, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Uezato, Tadayoshi [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Miura, Naoyuki, E-mail: nmiura@hama-med.ac.jp [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan)

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Fifty percent of the mutant Rb transgenic mice produced liver tumors. Black-Right-Pointing-Pointer In the tumor, Foxm1, Skp2, Bmi1 and AP-1 mRNAs were up-regulated. Black-Right-Pointing-Pointer No increase in expression of the Myc-target genes was observed in the non-tumorous liver. Black-Right-Pointing-Pointer Tumor formation depends on up-regulation of the Myc-target genes. -- Abstract: The retinoblastoma (Rb) tumor suppressor encodes a nuclear phosphoprotein that regulates cellular proliferation, apoptosis and differentiation. In order to adapt itself to these biological functions, Rb is subjected to modification cycle, phosphorylation and dephosphorylation. To directly determine the effect of phosphorylation-resistant Rb on liver development and function, we generated transgenic mice expressing phosphorylation-resistant human mutant Rb (mt-Rb) under the control of the rat hepatocyte nuclear factor-1 gene promoter/enhancer. Expression of mt-Rb in the liver resulted in macroscopic neoplastic nodules (adenomas) with {approx}50% incidence within 15 months old. Interestingly, quantitative reverse transcriptase-PCR analysis showed that c-Myc was up-regulated in the liver of mt-Rb transgenic mice irrespective of having tumor tissues or no tumor. In tumor tissues, several c-Myc target genes, Foxm1, c-Jun, c-Fos, Bmi1 and Skp2, were also up-regulated dramatically. We determined whether mt-Rb activated the Myc promoter in the HTP9 cells and demonstrated that mt-Rb acted as an inhibitor of wild-type Rb-induced repression on the Myc promoter. Our results suggest that continued upregulation of c-Myc target genes promotes the liver tumor formation after about 1 year of age.

  1. Transgenic Overexpression of the Proprotein Convertase Furin Enhances Skin Tumor Growth

    Directory of Open Access Journals (Sweden)

    Jian Fu

    2012-04-01

    Full Text Available Furin, one of the members of the family of proprotein convertases (PCs, ubiquitously expressed as a type I membrane-bound proteinase, activates several proteins that contribute to tumor progression. In vitro studies using cancer cell lines and clinical specimens demonstrated that furin processes important substrates such as insulin-like growth factor 1 receptor (IGF-1R and transforming growth factor β, leading to increased tumor growth and progression. Despite the numerous studies associating furin with tumor development, its effects in preclinical models has not been comprehensively studied. In this study, we sought to determine the protumorigenic role of furin in vivo after a two-stage chemical carcinogenesis protocol in transgenic mice in which furin expression was targeted to the epidermal basal layer. We found that processing of the PC substrate IGF-1R and the proliferation rate of mouse epidermis was enhanced in transgenic mice when compared with their WT counterparts. Histopathologic diagnoses of the tumors demonstrated that furin transgenic mice (line F47 developed twice as many squamous carcinomas as the control, WT mice (P < .002. Similarly, tumors cells from transgenic mice were able to process PC substrates more efficiently than tumor cells from WT mice. Furthermore, furin expression resulted in a higher SCC volume in transgenic mice as well as an increase in the percentage of high-grade SCC, including poorly differentiated and spindle cell carcinomas. In conclusion, expression of furin in the basal layer of the epidermis increased tumor development and enhanced tumor growth, supporting the consideration of furin as a potential target for cancer treatment.

  2. Optimization of codon composition and regulatory elements for expression of human insulin like growth factor-1 in transgenic chloroplasts and evaluation of structural identity and function.

    Science.gov (United States)

    Daniell, Henry; Ruiz, Gricel; Denes, Bela; Sandberg, Laurence; Langridge, William

    2009-04-03

    Transgenic chloroplasts are potential bioreactors for recombinant protein production, especially for achievement of high levels of protein expression and proper folding. Production of therapeutic proteins in leaves provides transgene containment by elimination of reproductive structures. Therefore, in this study, human Insulin like Growth Factor-1 is expressed in transgenic chloroplasts for evaluation of structural identity and function. Expression of the synthetic Insulin like Growth Factor 1 gene (IGF-1s, 60% AT) was observed in transformed E. coli. However, no native IGF-1 gene (IGF-1n, 41% AT) product was detected in the western blots in E. coli. Site-specific integration of the transgenes into the tobacco chloroplast genome was confirmed after transformation using PCR. Southern blot analysis confirmed that the transgenic lines were homoplasmic. The transgenic plant lines had IGF-1s expression levels of 11.3% of total soluble protein (TSP). The IGF-1n plants contained 9.5% TSP as IGF-1n, suggesting that the chloroplast translation machinery is more flexible than E. coli in codon preference and usage. The expression of IGF-1 was increased up to 32% TSP under continuous illumination by the chloroplast light regulatory elements. IgG-Sepharose affinity column chromatographic separation of Z domain containing chloroplast derived IGF-1 protein, single and two dimensional electrophoresis methods and mass spectrometer analysis confirmed the identity of human IGF-1 in transgenic chloroplasts. Two spots analyzed from 2-D focusing/phoresis acrylamide gel showed the correct amino acid sequence of human IGF-1 and the S. aureus Z-tag. Cell proliferation assays in human HU-3 cells demonstrated the biological activity of chloroplast derived IGF-1 even in the presence of the S. aureus Z tag. This study demonstrates that the human Insulin like Growth Factor-1 expressed in transgenic chloroplasts is identical to the native protein and is fully functional. The ability to use plant

  3. Optimization of codon composition and regulatory elements for expression of human insulin like growth factor-1 in transgenic chloroplasts and evaluation of structural identity and function

    Directory of Open Access Journals (Sweden)

    Sandberg Laurence

    2009-04-01

    Full Text Available Abstract Background Transgenic chloroplasts are potential bioreactors for recombinant protein production, especially for achievement of high levels of protein expression and proper folding. Production of therapeutic proteins in leaves provides transgene containment by elimination of reproductive structures. Therefore, in this study, human Insulin like Growth Factor-1 is expressed in transgenic chloroplasts for evaluation of structural identity and function. Results Expression of the synthetic Insulin like Growth Factor 1 gene (IGF-1s, 60% AT was observed in transformed E. coli. However, no native IGF-1 gene (IGF-1n, 41% AT product was detected in the western blots in E. coli. Site-specific integration of the transgenes into the tobacco chloroplast genome was confirmed after transformation using PCR. Southern blot analysis confirmed that the transgenic lines were homoplasmic. The transgenic plant lines had IGF-1s expression levels of 11.3% of total soluble protein (TSP. The IGF-1n plants contained 9.5% TSP as IGF-1n, suggesting that the chloroplast translation machinery is more flexible than E. coli in codon preference and usage. The expression of IGF-1 was increased up to 32% TSP under continuous illumination by the chloroplast light regulatory elements. IgG-Sepharose affinity column chromatographic separation of Z domain containing chloroplast derived IGF-1 protein, single and two dimensional electrophoresis methods and mass spectrometer analysis confirmed the identity of human IGF-1 in transgenic chloroplasts. Two spots analyzed from 2-D focusing/phoresis acrylamide gel showed the correct amino acid sequence of human IGF-1 and the S. aureus Z-tag. Cell proliferation assays in human HU-3 cells demonstrated the biological activity of chloroplast derived IGF-1 even in the presence of the S. aureus Z tag. Conclusion This study demonstrates that the human Insulin like Growth Factor-1 expressed in transgenic chloroplasts is identical to the native

  4. in transgenic cucumber

    African Journals Online (AJOL)

    Jane

    2011-07-18

    Jul 18, 2011 ... College of Horticulture, South China Agriculture University, Guangzhou 510642, Guangdong ... The pattern of expression vector pBI-PacPAP. ..... Disease scale ... These transgenic T0 plants were self-pollinated and the.

  5. Functional imaging of interleukin 1 beta expression in inflammatory process using bioluminescence imaging in transgenic mice

    Directory of Open Access Journals (Sweden)

    Liu Zhihui

    2008-08-01

    Full Text Available Abstract Background Interleukin 1 beta (IL-1β plays an important role in a number of chronic and acute inflammatory diseases. To understand the role of IL-1β in disease processes and develop an in vivo screening system for anti-inflammatory drugs, a transgenic mouse line was generated which incorporated the transgene firefly luciferase gene driven by a 4.5-kb fragment of the human IL-1β gene promoter. Luciferase gene expression was monitored in live mice under anesthesia using bioluminescence imaging in a number of inflammatory disease models. Results In a LPS-induced sepsis model, dramatic increase in luciferase activity was observed in the mice. This transgene induction was time dependent and correlated with an increase of endogenous IL-1β mRNA and pro-IL-1β protein levels in the mice. In a zymosan-induced arthritis model and an oxazolone-induced skin hypersensitivity reaction model, luciferase expression was locally induced in the zymosan injected knee joint and in the ear with oxazolone application, respectively. Dexamethasone suppressed the expression of luciferase gene both in the acute sepsis model and in the acute arthritis model. Conclusion Our data suggest that the transgenic mice model could be used to study transcriptional regulation of the IL-1β gene expression in the inflammatory process and evaluation the effect of anti-inflammatory drug in vivo.

  6. Genomic localization of the Z/EG transgene in the mouse genome.

    Science.gov (United States)

    Colombo, Sophie; Kumasaka, Mayuko; Lobe, Corrinne; Larue, Lionel

    2010-02-01

    The Z/EG transgenic mouse line, produced by Novak et al., displays tissue-specific EGFP expression after Cre-mediated recombination. The autofluorescence of EGFP allows the visualization of cells of interest displaying Cre recombination. The initial construct was designed such that cells without Cre recombination express the beta-galactosidase marker, facilitating counterselection. We used inverse PCR to identify the site of integration of the Z/EG transgene, to improve the efficiency of homozygous Z/EG mouse production. Recombined cells produced large amounts of EGFP protein, resulting in higher levels of fluorescence and therefore greater contrast with nonrecombined cells. We mapped the transgene to the G1 region of chromosome 5. This random insertion was found to have occurred 230-bp upstream from the start codon of the Rasa4 gene. The insertion of the Z/EG transgene in the C57BL/6 genetic background had no effect on Rasa4 expression. Homozygous Z/EG mice therefore had no obvious phenotype. (c) 2009 Wiley-Liss, Inc.

  7. Transgene mus som sygdomsmodeller

    DEFF Research Database (Denmark)

    Schuster, Mikkel Bruhn; Porse, Bo Torben

    2003-01-01

    Transgenic animal models have proven to be useful tools in understanding both basic biology and the events associated with disease. Recent technical advances in the area of genomic manipulation in combination with the availability of the human and murine genomic sequences now allow the precise...... tailoring of the mouse genome. In this review we describe a few systems in which transgenic animal models have been employed for the purpose of studying the etiology of human diseases. Udgivelsesdato: 2003-Feb-17...

  8. Stable expression and phenotypic impact of attacin E transgene in orchard grown apple trees over a 12 year period.

    Science.gov (United States)

    Borejsza-Wysocka, Ewa; Norelli, John L; Aldwinckle, Herb S; Malnoy, Mickael

    2010-06-03

    Transgenic trees currently are being produced by Agrobacterium-mediated transformation and biolistics. The future use of transformed trees on a commercial basis depends upon thorough evaluation of the potential environmental and public health risk of the modified plants, transgene stability over a prolonged period of time and the effect of the gene on tree and fruit characteristics. We studied the stability of expression and the effect on resistance to the fire blight disease of the lytic protein gene, attacin E, in the apple cultivar 'Galaxy' grown in the field for 12 years. Using Southern and western blot analysis, we compared transgene copy number and observed stability of expression of this gene in the leaves and fruit in several transformed lines during a 12 year period. No silenced transgenic plant was detected. Also the expression of this gene resulted in an increase in resistance to fire blight throughout 12 years of orchard trial and did not affect fruit shape, size, acidity, firmness, weight or sugar level, tree morphology, leaf shape or flower morphology or color compared to the control. Overall, these results suggest that transgene expression in perennial species, such as fruit trees, remains stable in time and space, over extended periods and in different organs. This report shows that it is possible to improve a desirable trait in apple, such as the resistance to a pathogen, through genetic engineering, without adverse alteration of fruit characteristics and tree shape.

  9. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    OpenAIRE

    Chang, Keejong; Qian, Jin; Jiang, MeiSheng; Liu, Yi-Hsin; Wu, Ming-Che; Chen, Chi-Dar; Lai, Chao-Kuen; Lo, Hsin-Lung; Hsiao, Chin-Ton; Brown, Lucy; Bolen, James; Huang, Hsiao-I; Ho, Pei-Yu; Shih, Ping Yao; Yao, Chen-Wen

    2002-01-01

    Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT) that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal ...

  10. Glucose-6-phosphate dehydrogenase is required for hpa1xoo (harpin protein fragment)-mediated salt stress tolerance in transgenic arabidopsis thaliana

    International Nuclear Information System (INIS)

    Sang, S.L.; Xie, L.L.; Cui, X.W.; Wang, Z.Y.

    2018-01-01

    Harpin induces salicylic acid and abscisic acid signaling in plants under biotic and abiotic stress, respectively. Our previous report showed that the effective harpin fragment Hpa1xoo enhanced H2O2 production and pathogen resistance in a transgenic Arabidopsis mutant. In this study, we examined contents of thiobarbituric acid reactive substance (TBARS), H2O2 and glutathione, and glucose-6-phosphate dehydrogenase (G6PDH), glutathione reductase (GR) and glutathione peroxidase (GPX) enzyme activity in Hpa1xoo-expressing Arabidopsis under salt stress. The results revealed increased amounts of TBARS and H2O2 in wild-type (WT) compared to mutant plants under salt stress conditions. In contrast, increased levels were observed in the mutant under stress-free conditions. Moreover, a higher reduced glutathione (GSH) content and ratio of GSH/oxidized glutathione (GSSG) was observed in mutant compared to WT plants under both stress-free and salt stress conditions. In addition, mutant plants exhibited significantly higher G6PDH, GR and GPX activity than WT plants under salt stress. Suppression of G6PDH activity via 6-aminonicotinamide (6-AN, a specific inhibitor of G6PDH) was partly reversed by L-buthionine-sulfoximine (BSO, a specific inhibitor of GSH regeneration) and aggravated by GSH. Combined with previous reports, these findings suggest that the G6PDH enzyme plays a key role in harpin fragment (Hpa1xoo)-mediated salt stress tolerance in transgenic Arabidopsis. (author)

  11. Transgene transmission in South American catfish (Rhamdia quelen ...

    Indian Academy of Sciences (India)

    Prakash

    in this study was to evaluate different sperm-mediated gene transfer (SMGT) methods to obtain transgenic silver catfish. .... by the critical point method, they were observed under a ..... protein is important for the maintenance of sperm quality in.

  12. Transgenic overexpression of BAFF regulates the expression of ...

    Indian Academy of Sciences (India)

    To investigate whether transgenic overexpression of the zebrafish BAFF leads to ... and BAFF proteins were expressed separately and confirmed in HeLa cells. ... body homogenate of zebrafish and demonstrated a significant increase in ...

  13. Expression of p53-regulated proteins in human cultured lymphoblastoid TSCE5 and WTK1 cell lines during spaceflight

    International Nuclear Information System (INIS)

    Takahashi, Akihisa; Suzuki, Hiromi; Shimazu, Toru; Omori, Katsunori; Ishioka, Noriaki; Ohnishi, Takeo; Seki, Masaya; Hashizume, Toko

    2012-01-01

    The aim of this study was to determine the biological effects of space radiations, microgravity, and the interaction of them on the expression of p53-regulated proteins. Space experiments were performed with two human cultured lymphoblastoid cell lines: one line (TSCE5) bears a wild-type p53 gene status, and another line (WTK1) bears a mutated p53 gene status. Under 1 gravity or microgravity conditions, the cells were grown in the cell biology experimental facility (CBEF) of the International Space Station for 8 days without experiencing the stress during launching and landing because the cells were frozen during these periods. Ground control samples were simultaneously cultured for 8 days in the CBEF on the ground for 8 days. After spaceflight, protein expression was analyzed using a Panorama TM Ab MicroArray protein chips. It was found that p53-dependent up-regulated proteins in response to space radiations and space environment were MeCP2 (methyl CpG binding protein 2), and Notch1 (Notch homolog 1), respectively. On the other hand, p53-dependent down-regulated proteins were TGF-β, TWEAKR (tumor necrosis factor-like weak inducer of apoptosis receptor), phosho-Pyk2 (Proline-rich tyrosine kinase 2), and 14-3-3θ/τ which were affected by microgravity, and DR4 (death receptor 4), PRMT1 (protein arginine methyltransferase 1) and ROCK-2 (Rho-associated, coiled-coil containing protein kinase 2) in response to space radiations. ROCK-2 was also suppressed in response to the space environment. The data provides the p53-dependent regulated proteins by exposure to space radiations and/or microgravity during spaceflight. Our expression data revealed proteins that might help to advance the basic space radiation biology. (author)

  14. Cathepsin H indirectly regulates morphogenetic protein-4 (BMP-4) in various human cell lines

    Science.gov (United States)

    Rojnik, Matija; Jevnikar, Zala; Mirkovic, Bojana; Janes, Damjan; Zidar, Nace; Kikelj, Danijel; Kos, Janko

    2011-01-01

    Background Cathepsin H is a cysteine protease considered to play a major role in tumor progression, however, its precise function in tumorigenesis is unclear. Cathepsin H was recently proposed to be involved in processing of bone morphogenetic protein 4 (BMP-4) in mice. In order to clarify whether cathepsin H also regulates BMP-4 in humans, its impact on BMP-4 expression, processing and degradation was investigated in prostate cancer (PC-3), osteosarcoma (HOS) and pro-monocytic (U937) human cell lines. Materials and methods BMP-4 expression was founded to be regulated by cathepsin H using PCR array technology and confirmed by real time PCR. Immunoassays including Western blot and confocal microscopy were used to evaluate the influence of cathepsin H on BMP-4 processing. Results In contrast to HOS, the expression of BMP-4 mRNA in U937 and PC3 cells was significantly decreased by cathepsin H. The different regulation of BMP-4 synthesis could be associated with the absence of the mature 28 kDa cathepsin H form in HOS cells, where only the intermediate 30 kDa form was observed. No co-localization of BMP-4 and cathepsin H was observed in human cell lines and the multistep processing of BMP-4 was not altered in the presence of specific cathepsin H inhibitor. Isolated cathepsin H does not cleave mature recombinant BMP-4, neither with its amino- nor its endopeptidase activity. Conclusions Our results exclude direct proteolytic processing of BMP-4 by cathepsin H, however, they provide support for its involvement in the regulation of BMP-4 expression. PMID:22933963

  15. Primary transmission of chronic wasting disease versus scrapie prions from small ruminants to transgenic mice expressing ovine or cervid prion protein.

    Science.gov (United States)

    Madsen-Bouterse, Sally A; Schneider, David A; Zhuang, Dongyue; Dassanayake, Rohana P; Balachandran, Aru; Mitchell, Gordon B; O'Rourke, Katherine I

    2016-09-01

    Development of mice expressing either ovine (Tg338) or cervid (TgElk) prion protein (PrP) have aided in characterization of scrapie and chronic wasting disease (CWD), respectively. Experimental inoculation of sheep with CWD prions has demonstrated the potential for interspecies transmission but, infection with CWD versus classical scrapie prions may be difficult to differentiate using validated diagnostic platforms. In this study, mouse bioassay in Tg338 and TgElk was utilized to evaluate transmission of CWD versus scrapie prions from small ruminants. Mice (≥5 per homogenate) were inoculated with brain homogenates from clinically affected sheep or goats with naturally acquired classical scrapie, white-tailed deer with naturally acquired CWD (WTD-CWD) or sheep with experimentally acquired CWD derived from elk (sheep-passaged-CWD). Survival time (time to clinical disease) and attack rates (brain accumulation of protease resistant PrP, PrPres) were determined. Inoculation with classical scrapie prions resulted in clinical disease and 100 % attack rates in Tg338, but no clinical disease at endpoint (>300 days post-inoculation, p.i.) and low attack rates (6.8 %) in TgElk. Inoculation with WTD-CWD prions yielded no clinical disease or brain PrPres accumulation in Tg338 at endpoint (>500 days p.i.), but rapid onset of clinical disease (~121 days p.i.) and 100 % attack rate in TgElk. Sheep-passaged-CWD resulted in transmission to both mouse lines with 100 % attack rates at endpoint in Tg338 and an attack rate of ~73 % in TgElk with some culled due to clinical disease. These primary transmission observations demonstrate the potential of bioassay in Tg338 and TgElk to help differentiate possible infection with CWD versus classical scrapie prions in sheep and goats.

  16. TaCPK2-A, a calcium-dependent protein kinase gene that is required for wheat powdery mildew resistance enhances bacterial blight resistance in transgenic rice.

    Science.gov (United States)

    Geng, Shuaifeng; Li, Aili; Tang, Lichuan; Yin, Lingjie; Wu, Liang; Lei, Cailin; Guo, Xiuping; Zhang, Xin; Jiang, Guanghuai; Zhai, Wenxue; Wei, Yuming; Zheng, Youliang; Lan, Xiujin; Mao, Long

    2013-08-01

    Calcium-dependent protein kinases (CPKs) are important Ca2+ signalling components involved in complex immune and stress signalling networks; but the knowledge of CPK gene functions in the hexaploid wheat is limited. Previously, TaCPK2 was shown to be inducible by powdery mildew (Blumeria graminis tritici, Bgt) infection in wheat. Here, its functions in disease resistance are characterized further. This study shows the presence of defence-response and cold-response cis-elements on the promoters of the A subgenome homoeologue (TaCPK2-A) and D subgenome homoeologue (TaCPK2-D), respectively. Their expression patterns were then confirmed by quantitative real-time PCR (qRT-PCR) using genome-specific primers, where TaCPK2-A was induced by Bgt treatment while TaCPK2-D mainly responded to cold treatment. Downregulation of TaCPK2-A by virus-induced gene silencing (VIGS) causes loss of resistance to Bgt in resistant wheat lines, indicating that TaCPK2-A is required for powdery mildew resistance. Furthermore, overexpression of TaCPK2-A in rice enhanced bacterial blight (Xanthomonas oryzae pv. oryzae, Xoo) resistance. qRT-PCR analysis showed that overexpression of TaCPK2-A in rice promoted the expression of OsWRKY45-1, a transcription factor involved in both fungal and bacterial resistance by regulating jasmonic acid and salicylic acid signalling genes. The opposite effect was found in wheat TaCPK2-A VIGS plants, where the homologue of OsWRKY45-1 was significantly repressed. These data suggest that modulation of WRKY45-1 and associated defence-response genes by CPK2 genes may be the common mechanism for multiple disease resistance in grass species, which may have undergone subfunctionalization in promoters before the formation of hexaploid wheat.

  17. The ecological risks of transgenic plants.

    Science.gov (United States)

    Giovannetti, Manuela

    2003-01-01

    Biotechnologies have been utilized "ante litteram" for thousands of years to produce food and drink and genetic engineering techniques have been widely applied to produce many compounds for human use, from insulin to other medicines. The debate on genetically modified (GM) organisms broke out all over the world only when GM crops were released into the field. Plant ecologists, microbiologists and population geneticists carried out experiments aimed at evaluating the environmental impact of GM crops. The most significant findings concern: the spread of transgenes through GM pollen diffusion and its environmental impact after hybridisation with closely related wild species or subspecies; horizontal gene transfer from transgenic plants to soil microbes; the impact of insecticide proteins released into the soil by transformed plants on non-target microbial soil communities. Recent developments in genetic engineering produced a technology, dubbed "Terminator", which protects patented genes introduced in transgenic plants by killing the seeds in the second generation. This genetic construct, which interferes so heavily with fundamental life processes, is considered dangerous and should be ex-ante evaluated taking into account the data on "unexpected events", as here discussed, instead of relying on the "safe until proven otherwise" claim. Awareness that scientists, biotechnologists and genetic engineers cannot answer the fundamental question "how likely is that transgenes will be transferred from cultivated plants into the natural environment?" should foster long-term studies on the ecological risks and benefits of transgenic crops.

  18. Interdependence of DNA mismatch repair proteins MLH1 and MSH2 in apoptosis in human colorectal carcinoma cell lines.

    Science.gov (United States)

    Hassen, Samar; Ali, Akhtar A; Kilaparty, Surya P; Al-Anbaky, Qudes A; Majeed, Waqar; Boman, Bruce M; Fields, Jeremy Z; Ali, Nawab

    2016-01-01

    The mammalian DNA mismatch repair (MMR) system consists of a number of proteins that play important roles in repair of base pair mismatch mutations and in maintenance of genomic integrity. A defect in this system can cause genetic instability, which can lead to carcinogenesis. For instance, a germline mutation in one of the mismatch repair proteins, especially MLH1 or MSH2, is responsible for hereditary non-polyposis colorectal cancer. These MMR proteins also play an important role in the induction of apoptosis. Accordingly, altered expression of or a defect in MLH1 or MSH2 may confer resistance to anti-cancer drugs used in chemotherapy. We hypothesized that the ability of these two MMR proteins to regulate apoptosis are interdependent. Moreover, a defect in either one may confer resistance to chemotherapy by an inability to trigger apoptosis. To this end, we studied three cell lines-SW480, LoVo, and HTC116. These cell lines were selected based on their differential expression of MLH1 and MSH2 proteins. SW480 expresses both MLH1 and MSH2; LoVo expresses only MLH1 but not MSH2; HCT116 expresses only MSH2 but not MLH1 protein. MTT assays, a measure of cytotoxicity, showed that there were different cytotoxic effects of an anti-cancer drug, etoposide, on these cell lines, effects that were correlated with the MMR status of the cells. Cells that are deficient in MLH1 protein (HCT116 cells) were resistant to the drug. Cells that express both MLH1 and MSH2 proteins (SW480 cells) showed caspase-3 cleavage, an indicator of apoptosis. Cells that lack MLH1 (HCT116 cells) did not show any caspase-3 cleavage. Expression of full-length MLH1 protein was decreased in MMR proficient (SW480) cells during apoptosis; it remained unchanged in cells that lack MSH2 (LoVo cells). The expression of MSH2 protein remained unchanged during apoptosis both in MMR proficient (SW480) and deficient (HCT116) cells. Studies on translocation of MLH1 protein from nucleus to cytosolic fraction, an

  19. Transgenic wheat expressing Thinopyrum intermedium MYB transcription factor TiMYB2R-1 shows enhanced resistance to the take-all disease.

    Science.gov (United States)

    Liu, Xin; Yang, Lihua; Zhou, Xianyao; Zhou, Miaoping; Lu, Yan; Ma, Lingjian; Ma, Hongxiang; Zhang, Zengyan

    2013-05-01

    The disease take-all, caused by the fungus Gaeumannomyces graminis, is one of the most destructive root diseases of wheat worldwide. Breeding resistant cultivars is an effective way to protect wheat from take-all. However, little progress has been made in improving the disease resistance level in commercial wheat cultivars. MYB transcription factors play important roles in plant responses to environmental stresses. In this study, an R2R3-MYB gene in Thinopyrum intermedium, TiMYB2R-1, was cloned and characterized. The gene sequence includes two exons and an intron. The expression of TiMYB2R-1 was significantly induced following G. graminis infection. An in vitro DNA binding assay proved that TiMYB2R-1 protein could bind to the MYB-binding site cis-element ACI. Subcellular localization assays revealed that TiMYB2R-1 was localized in the nucleus. TiMYB2R-1 transgenic wheat plants were generated, characterized molecularly, and evaluated for take-all resistance. PCR and Southern blot analyses confirmed that TiMYB2R-1 was integrated into the genomes of three independent transgenic wheat lines by distinct patterns and the transgene was heritable. Reverse transcription-PCR and western blot analyses revealed that TiMYB2R-1 was highly expressed in the transgenic wheat lines. Based on disease response assessments for three successive generations, the significantly enhanced resistance to take-all was observed in the three TiMYB2R-1-overexpressing transgenic wheat lines. Furthermore, the transcript levels of at least six wheat defence-related genes were significantly elevated in the TiMYB2R-1 transgenic wheat lines. These results suggest that engineering and overexpression of TiMYB2R-1 may be used for improving take-all resistance of wheat and other cereal crops.

  20. Transgenic approach to improve wheat (Triticum aestivum L.) nutritional quality.

    Science.gov (United States)

    Tamás, Cecília; Kisgyörgy, Boglárka N; Rakszegi, Mariann; Wilkinson, Mark D; Yang, Moon-Sik; Láng, László; Tamás, László; Bedo, Zoltán

    2009-07-01

    An amaranth (Amaranthus hypochondriacus) albumin gene, encoding the 35-kDa AmA1 protein of the seed, with a high content of essential amino acids, was used in the biolistic transformation of bread wheat (Triticum aestivum L.) variety Cadenza. The transformation cassette carried the ama1 gene under the control of a powerful wheat endosperm-specific promoter (1Bx17 HMW-GS). Southern-blot analysis of T(1) lines confirmed the integration of the foreign gene, while RT-PCR and Western-blot analyses of the samples confirmed the transcription and translation of the transgene. The effects of the extra albumin protein on the properties of flour, produced from bulked T(2) seeds, were calculated using total protein and essential amino acid content analysis, polymeric/monomeric protein and HMW/LMW glutenin subunit ratio measurements. The results indicated that not only can essential amino acid content be increased, but some parameters associated with functional quality may also be improved because of the expression of the AmA1 protein.

  1. Diagnostic tools used in the calibration and verification of protein crystallography synchrotron beam lines and apparatus

    International Nuclear Information System (INIS)

    Rotella, F.J.; Alkire, R.W.; Duke, N.E.C.; Molitsky, M.J.

    2011-01-01

    Diagnostic tools have been developed for use at the Structural Biology Center beam lines at the Advanced Photon Source. These tools are used in the calibration and operating verification of these synchrotron X-ray beam lines and constituent equipment.

  2. Introgression of the SbASR-1 Gene Cloned from a Halophyte Salicornia brachiata Enhances Salinity and Drought Endurance in Transgenic Groundnut (Arachis hypogaea) and Acts as a Transcription Factor

    Science.gov (United States)

    Tiwari, Vivekanand; Chaturvedi, Amit Kumar; Mishra, Avinash; Jha, Bhavanath

    2015-01-01

    The SbASR-1 gene, cloned from a halophyte Salicornia brachiata, encodes a plant-specific hydrophilic and stress responsive protein. The genome of S. brachiata has two paralogs of the SbASR-1 gene (2549 bp), which is comprised of a single intron of 1611 bp, the largest intron of the  abscisic acid stress ripening [ASR] gene family yet reported. In silico analysis of the 843-bp putative promoter revealed the presence of ABA, biotic stress, dehydration, phytohormone, salinity, and sugar responsive cis-regulatory motifs. The SbASR-1 protein belongs to Group 7 LEA protein family with different amino acid composition compared to their glycophytic homologs. Bipartite Nuclear Localization Signal (NLS) was found on the C-terminal end of protein and localization study confirmed that SbASR-1 is a nuclear protein. Furthermore, transgenic groundnut (Arachis hypogaea) plants over-expressing the SbASR-1 gene constitutively showed enhanced salinity and drought stress tolerance in the T1 generation. Leaves of transgenic lines exhibited higher chlorophyll and relative water contents and lower electrolyte leakage, malondialdehyde content, proline, sugars, and starch accumulation under stress treatments than wild-type (Wt) plants. Also, lower accumulation of H2O2 and O2.- radicals was detected in transgenic lines compared to Wt plants under stress conditions. Transcript expression of APX (ascorbate peroxidase) and CAT (catalase) genes were higher in Wt plants, whereas the SOD (superoxide dismutase) transcripts were higher in transgenic lines under stress. Electrophoretic mobility shift assay (EMSA) confirmed that the SbASR-1 protein binds at the consensus sequence (C/G/A)(G/T)CC(C/G)(C/G/A)(A/T). Based on results of the present study, it may be concluded that SbASR-1 enhances the salinity and drought stress tolerance in transgenic groundnut by functioning as a LEA (late embryogenesis abundant) protein and a transcription factor. PMID:26158616

  3. Generation of FGF reporter transgenic zebrafish and their utility in chemical screens

    Directory of Open Access Journals (Sweden)

    Tsang Michael

    2007-06-01

    Full Text Available Abstract Background Fibroblast Growth Factors (FGFs represent a large family of secreted proteins that are required for proper development and physiological processes. Mutations in mouse and zebrafish FGFs result in abnormal embryogenesis and lethality. A key to understanding the precise role for these factors is to determine their spatial and temporal activity during embryogenesis. Results Expression of Dual Specificity Phosphatase 6 (dusp6, also known as Mkp3 is controlled by FGF signalling throughout development. The Dusp6 promoter was isolated from zebrafish and used to drive expression of destabilized green fluorescent protein (d2EGFP in transgenic embryos (Tg(Dusp6:d2EGFP. Expression of d2EGFP is initiated as early as 4 hours post-fertilization (hpf within the future dorsal region of the embryo, where fgf3 and fgf8 are initially expressed. At later stages, d2EGFP is detected within structures that correlate with the expression of Fgf ligands and their receptors. This includes the mid-hindbrain boundary (MHB, pharyngeal endoderm, otic vesicle, hindbrain, and Kupffer's vesicle. The expression of d2EGFP is under the control of FGF signalling as treatment with FGF Receptor (FGFR inhibitors results in the suppression of d2EGFP expression. In a pilot screen of commercially available small molecules we have evaluated the effectiveness of the transgenic lines to identify specific FGF inhibitors within the class of indolinones. These compounds were counter screened with the transgenic line Tg(Fli1:EGFPy1, that serves as an indirect read-out for Vascular Endothelial Growth Factor (VEGF signalling in order to determine the specificity between related receptor tyrosine kinases (RTKs. From these assays it is possible to determine the specificity of these indolinones towards specific RTK signalling pathways. This has enabled the identification of compounds that can block specifically the VEGFR or the FGFR signalling pathway. Conclusion The generation of

  4. Global Screening of Antiviral Genes that Suppress Baculovirus Transgene Expression in Mammalian Cells.

    Science.gov (United States)

    Wang, Chia-Hung; Naik, Nenavath Gopal; Liao, Lin-Li; Wei, Sung-Chan; Chao, Yu-Chan

    2017-09-15

    Although baculovirus has been used as a safe and convenient gene delivery vector in mammalian cells, baculovirus-mediated transgene expression is less effective in various mammalian cell lines. Identification of the negative regulators in host cells is necessary to improve baculovirus-based expression systems. Here, we performed high-throughput shRNA library screening, targeting 176 antiviral innate immune genes, and identified 43 host restriction factor genes in a human A549 lung carcinoma cell line. Among them, suppression of receptor interaction protein kinase 1 (RIP1, also known as RIPK1) significantly increased baculoviral transgene expression without resulting in significant cell death. Silencing of RIP1 did not affect viral entry or cell viability, but it did inhibit nuclear translocation of the IRF3 and NF-κB transcription factors. Also, activation of downstream signaling mediators (such as TBK1 and IRF7) was affected, and subsequent interferon and cytokine gene expression levels were abolished. Further, Necrostatin-1 (Nec-1)-an inhibitor of RIP1 kinase activity-dramatically increased baculoviral transgene expression in RIP1-silenced cells. Using baculovirus as a model system, this study presents an initial investigation of large numbers of human cell antiviral innate immune response factors against a "nonadaptive virus." In addition, our study has made baculovirus a more efficient gene transfer vector for some of the most frequently used mammalian cell systems.

  5. Analysis of the regulation of fatty acid binding protein 7 expression in human renal carcinoma cell lines

    Directory of Open Access Journals (Sweden)

    Sugiyama Takayuki

    2011-07-01

    Full Text Available Abstract Background Improving the treatment of renal cell carcinoma (RCC will depend on the development of better biomarkers for predicting disease progression and aiding the design of appropriate therapies. One such marker may be fatty acid binding protein 7 (FABP7, also known as B-FABP and BLBP, which is expressed normally in radial glial cells of the developing central nervous system and cells of the mammary gland. Melanomas, glioblastomas, and several types of carcinomas, including RCC, overexpress FABP7. The abundant expression of FABP7 in primary RCCs compared to certain RCC-derived cell lines may allow the definition of the molecular components of FABP7's regulatory system. Results We determined FABP7 mRNA levels in six RCC cell lines. Two were highly expressed, whereas the other and the embryonic kidney cell line (HEK293 were weakly expressed FABP7 transcripts. Western blot analysis of the cell lines detected strong FABP7 expression only in one RCC cell line. Promoter activity in the RCC cell lines was 3- to 21-fold higher than that of HEK293. Deletion analysis demonstrated that three FABP7 promoter regions contributed to upregulated expression in RCC cell lines, but not in the HEK293 cell. Competition analysis of gel shifts indicated that OCT1, OCT6, and nuclear factor I (NFI bound to the FABP7 promoter region. Supershift experiments indicated that BRN2 (POU3F2 and NFI bound to the FABP7 promoter region as well. There was an inverse correlation between FABP7 promoter activity and BRN2 mRNA expression. The FABP7-positive cell line's NFI-DNA complex migrated faster than in other cell lines. Levels of NFIA mRNA were higher in the HEK293 cell line than in any of the six RCC cell lines. In contrast, NFIC mRNA expression was lower in the HEK293 cell line than in the six RCC cell lines. Conclusions Three putative FABP7 promoter regions drive reporter gene expression in RCC cell lines, but not in the HEK293 cell line. BRN2 and NFI may be key

  6. Transgenic modification of potato pectic polysaccharides also affects type and level of cell wall xyloglucan

    NARCIS (Netherlands)

    Huang, Jie Hong; Jiang, Rui; Kortstee, Anne; Dees, Dianka C.T.; Trindade, Luisa M.; Gruppen, Harry; Schols, Henk A.

    2017-01-01

    BACKGROUND: Genes encoding pectic enzymes were introduced into wild-type potato Karnico. Cell wall materials were extracted from Karnico and transgenic lines expressing β-galactosidase (β-Gal-14) or rhamnogalacturonan lyase (RGL-18). Pectic polysaccharides from the β-Gal-14 transgenic line exhibited

  7. Transgenic cells with increased plastoquinone levels and methods of use

    Energy Technology Data Exchange (ETDEWEB)

    Sayre, Richard T.; Subramanian, Sowmya; Cahoon, Edgar

    2016-12-27

    Disclosed herein are transgenic cells expressing a heterologous nucleic acid encoding a prephenate dehydrogenase (PDH) protein, a heterologous nucleic acid encoding a homogentisate solanesyl transferase (HST) protein, a heterologous nucleic acid encoding a deoxyxylulose phosphate synthase (DXS) protein, or a combination of two or more thereof. In particular examples, the disclosed transgenic cells have increased plastoquinone levels. Also disclosed are methods of increasing cell growth rates or production of biomass by cultivating transgenic cells expressing a heterologous nucleic acid encoding a PDH protein, a heterologous nucleic acid encoding an HST protein, a heterologous nucleic acid encoding a DXS protein, or a combination of two or more thereof under conditions sufficient to produce cell growth or biomass.

  8. Recent advances in the development of new transgenic animal technology.

    Science.gov (United States)

    Miao, Xiangyang

    2013-03-01

    Transgenic animal technology is one of the fastest growing biotechnology areas. It is used to integrate exogenous genes into the animal genome by genetic engineering technology so that these genes can be inherited and expressed by offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors in the production of transgenic animals. A variety of transgenic technologies are available. Each has its own advantages and disadvantages and needs further study because of unresolved technical and safety issues. Further studies will allow transgenic technology to explore gene function, animal genetic improvement, bioreactors, animal disease models, and organ transplantation. This article reviews the recently developed animal transgenic technologies, including the germ line stem cell-mediated method to improve efficiency, gene targeting to improve accuracy, RNA interference-mediated gene silencing technology, zinc-finger nuclease gene targeting technology and induced pluripotent stem cell technology. These new transgenic techniques can provide a better platform to develop transgenic animals for breeding new animal varieties and promote the development of medical sciences, livestock production, and other fields.

  9. Alterations to the protein profile of bladder carcinoma cell lines induced by plant extract MINA-05 in vitro.

    Science.gov (United States)

    Nguyen-Khuong, Terry; White, Melanie Y; Hung, Tzong-Tyng; Seeto, Shona; Thomas, Melissa L; Fitzgerald, Anna M; Martucci, Carlos E; Luk, Sharon; Pang, Shiu-Fu; Russell, Pamela J; Walsh, Bradley J

    2009-04-01

    Bladder cancer (BLCa) is a severe urological cancer of both men and women that commonly recurs and once invasive, is difficult to treat. MINA-05 (CK Life Sciences Int'l, Hong Kong) is a derivative of complex botanical extracts, shown to reduce cellular proliferation of bladder and prostate carcinomas. We tested the effects of MINA-05 against human BLCa cell sublines, B8, B8-RSP-GCK, B8-RSP-LN and C3, from a transitional cell carcinoma, grade IV, to determine the molecular targets of treatment by observing the cellular protein profile. Cells were acclimatised for 48 h then treated for 72 h with concentrations of MINA-05 reflecting 1/2 IC(50), IC(50) and 2 x IC(50) (n = 3) or with vehicle, (0.5% DMSO). Dose-dependant changes in protein abundance were detected and characterised using 2-dimensional electrophoresis and MS. We identified 10 proteins that underwent changes in abundance, pI and/or molecular mass in response to treatment. MINA-05 was shown to influence proteins across numerous functional classes including cytoskeletal proteins, energy metabolism proteins, protein degradation proteins and tumour suppressors, suggesting a global impact on these cell lines. This study implies that the ability of MINA-05 to retard cellular proliferation is attributed to its ability to alter cell cycling, metabolism, protein degradation and the cancer cell environment.

  10. UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

    Directory of Open Access Journals (Sweden)

    Emanuela Chiarella

    Full Text Available Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6 where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in

  11. UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

    Science.gov (United States)

    Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni

    2014-01-01

    Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and

  12. Gene flow from transgenic common beans expressing the bar gene.

    Science.gov (United States)

    Faria, Josias C; Carneiro, Geraldo E S; Aragão, Francisco J L

    2010-01-01

    Gene flow is a common phenomenon even in self-pollinated plant species. With the advent of genetically modified plants this subject has become of the utmost importance due to the need for controlling the spread of transgenes. This study was conducted to determine the occurrence and intensity of outcrossing in transgenic common beans. In order to evaluate the outcross rates, four experiments were conducted in Santo Antonio de Goiás (GO, Brazil) and one in Londrina (PR, Brazil), using transgenic cultivars resistant to the herbicide glufosinate ammonium and their conventional counterparts as recipients of the transgene. Experiments with cv. Olathe Pinto and the transgenic line Olathe M1/4 were conducted in a completely randomized design with ten replications for three years in one location, whereas the experiments with cv. Pérola and the transgenic line Pérola M1/4 were conducted at two locations for one year, with the transgenic cultivar surrounded on all sides by the conventional counterpart. The outcross occurred at a negligible rate of 0.00741% in cv. Pérola, while none was observed (0.0%) in cv. Olathe Pinto. The frequency of gene flow was cultivar dependent and most of the observed outcross was within 2.5 m from the edge of the pollen source. Index terms: Phaseolus vulgaris, outcross, glufosinate ammonium.

  13. Design and Management of Field Trials of Transgenic Cereals

    Science.gov (United States)

    Bedő, Zoltán; Rakszegi, Mariann; Láng, László

    The development of gene transformation systems has allowed the introgression of alien genes into plant genomes, thus providing a mechanism for broadening the genetic resources available to plant breeders. The design and the management of field trials vary according to the purpose for which transgenic cereals are developed. Breeders study the phenotypic and genotypic stability of transgenic plants, monitor the increase in homozygosity of transgenic genotypes under field conditions, and develop backcross generations to transfer the introduced genes into secondary transgenic cereal genotypes. For practical purposes, they may also multiply seed of the transgenic lines to produce sufficient amounts of grain for the detailed analysis of trait(s) of interest, to determine the field performance of transgenic lines, and to compare them with the non-transformed parental genotypes. Prior to variety registration, the Distinctness, Uniformity and Stability (DUS) tests and Value for Cultivation and Use (VCU) experiments are carried out in field trials. Field testing includes specific requirements for transgenic cereals to assess potential environmental risks. The capacity of the pollen to survive, establish and disseminate in the field test environment, the potential for gene transfer, the effects of products expressed by the introduced sequences and phenotypic and genotypic instability that might cause deleterious effects must all be specifically monitored, as required by EU Directives 2003/701/EC (1) on the release of genetically modified higher plants in the environment.

  14. Metal resistance sequences and transgenic plants

    Science.gov (United States)

    Meagher, Richard Brian; Summers, Anne O.; Rugh, Clayton L.

    1999-10-12

    The present invention provides nucleic acid sequences encoding a metal ion resistance protein, which are expressible in plant cells. The metal resistance protein provides for the enzymatic reduction of metal ions including but not limited to divalent Cu, divalent mercury, trivalent gold, divalent cadmium, lead ions and monovalent silver ions. Transgenic plants which express these coding sequences exhibit increased resistance to metal ions in the environment as compared with plants which have not been so genetically modified. Transgenic plants with improved resistance to organometals including alkylmercury compounds, among others, are provided by the further inclusion of plant-expressible organometal lyase coding sequences, as specifically exemplified by the plant-expressible merB coding sequence. Furthermore, these transgenic plants which have been genetically modified to express the metal resistance coding sequences of the present invention can participate in the bioremediation of metal contamination via the enzymatic reduction of metal ions. Transgenic plants resistant to organometals can further mediate remediation of organic metal compounds, for example, alkylmetal compounds including but not limited to methyl mercury, methyl lead compounds, methyl cadmium and methyl arsenic compounds, in the environment by causing the freeing of mercuric or other metal ions and the reduction of the ionic mercury or other metal ions to the less toxic elemental mercury or other metals.

  15. Transgenic plants with increased calcium stores

    Science.gov (United States)

    Wyatt, Sarah (Inventor); Tsou, Pei-Lan (Inventor); Robertson, Dominique (Inventor); Boss, Wendy (Inventor)

    2004-01-01

    The present invention provides transgenic plants over-expressing a transgene encoding a calcium-binding protein or peptide (CaBP). Preferably, the CaBP is a calcium storage protein and over-expression thereof does not have undue adverse effects on calcium homeostasis or biochemical pathways that are regulated by calcium. In preferred embodiments, the CaBP is calreticulin (CRT) or calsequestrin. In more preferred embodiments, the CaBP is the C-domain of CRT, a fragment of the C-domain, or multimers of the foregoing. In other preferred embodiments, the CaBP is localized to the endoplasmic reticulum by operatively associating the transgene encoding the CaBP with an endoplasmic reticulum localization peptide. Alternatively, the CaBP is targeted to any other sub-cellular compartment that permits the calcium to be stored in a form that is biologically available to the plant. Also provided are methods of producing plants with desirable phenotypic traits by transformation of the plant with a transgene encoding a CaBP. Such phenotypic traits include increased calcium storage, enhanced resistance to calcium-limiting conditions, enhanced growth and viability, increased disease and stress resistance, enhanced flower and fruit production, reduced senescence, and a decreased need for fertilizer production. Further provided are plants with enhanced nutritional value as human food or animal feed.

  16. Nematode neuropeptides as transgenic nematicides.

    Directory of Open Access Journals (Sweden)

    Neil D Warnock

    2017-02-01

    Full Text Available Plant parasitic nematodes (PPNs seriously threaten global food security. Conventionally an integrated approach to PPN management has relied heavily on carbamate, organophosphate and fumigant nematicides which are now being withdrawn over environmental health and safety concerns. This progressive withdrawal has left a significant shortcoming in our ability to manage these economically important parasites, and highlights the need for novel and robust control methods. Nematodes can assimilate exogenous peptides through retrograde transport along the chemosensory amphid neurons. Peptides can accumulate within cells of the central nerve ring and can elicit physiological effects when released to interact with receptors on adjoining cells. We have profiled bioactive neuropeptides from the neuropeptide-like protein (NLP family of PPNs as novel nematicides, and have identified numerous discrete NLPs that negatively impact chemosensation, host invasion and stylet thrusting of the root knot nematode Meloidogyne incognita and the potato cyst nematode Globodera pallida. Transgenic secretion of these peptides from the rhizobacterium, Bacillus subtilis, and the terrestrial microalgae Chlamydomonas reinhardtii reduce tomato infection levels by up to 90% when compared with controls. These data pave the way for the exploitation of nematode neuropeptides as a novel class of plant protective nematicide, using novel non-food transgenic delivery systems which could be deployed on farmer-preferred cultivars.

  17. The role of Rad 51 protein in radioresistance of spheroid model of Du 145 prostate carcinoma cell line

    International Nuclear Information System (INIS)

    Taghizadeh, M.; Khoei, S.; Nikoofar, A. R.; Ghamsari, L.; Goliaei, B.

    2009-01-01

    Rad 51 is a protein with critical role in double strand break repair. Down-regulation of this protein has a significant effect in radiosensitivity of some cell lines like prostate carcinoma. Compared to monolayer cell culture model, the spheroids are more resistant to radiation. The aim of the current study was to determine the Rad 51 protein level in Du 145 spheroids, and monolayer cells before and after exposure to gamma irradiation. Materials and Methods: In the present study, western blot was used to determine the level of Rad 51 protein in Du 145 cell line grown as monolayer and spheroid. Results: Western blot analysis showed that in the spheroid cells, Rad 51 had an elevated level before and after radiation in comparison with monolayer cells. Higher doses of radiation induced elevated expression of Rad 51 protein in both culture models.The level of at protein after exposure to gamma rays had been time-dependent. Conclusion: Rad 51 might act as a mediator of radiation resistance in tumor cells. Repression of Rad 51 activity could be a prominent strategy to overcome radiation resistance of tumors.

  18. Transgenic cotton plants expressing Cry1Ia12 toxin confer resistance to fall armyworm (Spodoptera frugiperda and cotton boll weevil (Anthonomus grandis

    Directory of Open Access Journals (Sweden)

    Raquel Sampaio Oliveira

    2016-02-01

    Full Text Available Gossypium hirsutum (commercial cooton is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized with PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold. Also, a significant reduction of Anthonomus grandis emerging adults (up to 60% was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda and the Coleopteran (A. grandis insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

  19. Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis).

    Science.gov (United States)

    de Oliveira, Raquel S; Oliveira-Neto, Osmundo B; Moura, Hudson F N; de Macedo, Leonardo L P; Arraes, Fabrício B M; Lucena, Wagner A; Lourenço-Tessutti, Isabela T; de Deus Barbosa, Aulus A; da Silva, Maria C M; Grossi-de-Sa, Maria F

    2016-01-01

    Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

  20. Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis)

    Science.gov (United States)

    de Oliveira, Raquel S.; Oliveira-Neto, Osmundo B.; Moura, Hudson F. N.; de Macedo, Leonardo L. P.; Arraes, Fabrício B. M.; Lucena, Wagner A.; Lourenço-Tessutti, Isabela T.; de Deus Barbosa, Aulus A.; da Silva, Maria C. M.; Grossi-de-Sa, Maria F.

    2016-01-01

    Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests. PMID:26925081

  1. Harpin-induced expression and transgenic overexpression of the phloem protein gene AtPP2-A1 in Arabidopsis repress phloem feeding of the green peach aphid Myzus persicae.

    Science.gov (United States)

    Zhang, Chunling; Shi, Haojie; Chen, Lei; Wang, Xiaomeng; Lü, Beibei; Zhang, Shuping; Liang, Yuan; Liu, Ruoxue; Qian, Jun; Sun, Weiwei; You, Zhenzhen; Dong, Hansong

    2011-01-13

    Treatment of plants with HrpNEa, a protein of harpin group produced by Gram-negative plant pathogenic bacteria, induces plant resistance to insect herbivores, including the green peach aphid Myzus persicae, a generalist phloem-feeding insect. Under attacks by phloem-feeding insects, plants defend themselves using the phloem-based defense mechanism, which is supposed to involve the phloem protein 2 (PP2), one of the most abundant proteins in the phloem sap. The purpose of this study was to obtain genetic evidence for the function of the Arabidopsis thaliana (Arabidopsis) PP2-encoding gene AtPP2-A1 in resistance to M. persicae when the plant was treated with HrpNEa and after the plant was transformed with AtPP2-A1. The electrical penetration graph technique was used to visualize the phloem-feeding activities of apterous agamic M. persicae females on leaves of Arabidopsis plants treated with HrpNEa and an inactive protein control, respectively. A repression of phloem feeding was induced by HrpNEa in wild-type (WT) Arabidopsis but not in atpp2-a1/E/142, the plant mutant that had a defect in the AtPP2-A1 gene, the most HrpNEa-responsive of 30 AtPP2 genes. In WT rather than atpp2-a1/E/142, the deterrent effect of HrpNEa treatment on the phloem-feeding activity accompanied an enhancement of AtPP2-A1 expression. In PP2OETAt (AtPP2-A1-overexpression transgenic Arabidopsis thaliana) plants, abundant amounts of the AtPP2-A1 gene transcript were detected in different organs, including leaves, stems, calyces, and petals. All these organs had a deterrent effect on the phloem-feeding activity compared with the same organs of the transgenic control plant. When a large-scale aphid population was monitored for 24 hours, there was a significant decrease in the number of aphids that colonized leaves of HrpNEa-treated WT and PP2OETAt plants, respectively, compared with control plants. The repression in phloem-feeding activities of M. persicae as a result of AtPP2-A1 overexpression, and

  2. The use of transgenic fruit trees as a resistance strategy for virus epidemics: the plum pox (sharka) model.

    Science.gov (United States)

    Ravelonandro, M; Scorza, R; Callahan, A; Levy, L; Jacquet, C; Monsion, M; Damsteegt, V

    2000-11-01

    Sharka or plum pox, caused by Plum pox virus (PPV: genus Potyvirus; Family Potyviridae), is the most serious disease of Prunus. Most cultivated Prunus species are highly susceptible and conventional breeding has not produced highly resistant and commercially acceptable varieties. Success in developing virus-resistant herbaceous crops through genetic engineering led us to investigate this approach for resistance to PPV. Our programme aims to develop a biotechnological approach to PPV control that is effective and shown to be environmentally safe. The programme began with the cloning of the PPV coat protein (CP) gene and the development of a transformation system for plum (Prunus domestica). The CP construct was first tested in Nicotiana benthamiana in which it proved effective in producing transgenic plants with varying levels of CP expression. Some of these plants, particularly low PPV CP expressers, were resistant to PPV, or recovered from initial infection. Based on these results plum was transformed using the Agrobacterium tumefaciens system and both low and high PPV CP-expressing transgenic plum lines were obtained. These were inoculated with PPV by bud grafts in the greenhouse. Line C-5 proved to be highly resistant. It contained multiple copies of the insert, produced low levels of PPV CP mRNA, no detectable CP and the insert appeared to be methylated. These characteristics all suggest that the resistance of the C-5 clone is based on post-transcriptional gene silencing (PTGS). Field tests of C-5 and other transgenic lines in Poland, Romania and Spain have demonstrated that such trees when inoculated by bud-grafts allow a low level of PPV multiplication, from which they rapidly recover. C-5 plants exposed to natural infection for 3 years did not become infected, whereas control trees were infected in the first year. Hybrid plums having the C-5 PPV CP insert inherited from C-5 are virus-resistant, demonstrating the usefulness of C-5 as a parent in developing

  3. A proteomic study to identify soya allergens--the human response to transgenic<