Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den
2008-01-01
Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,
This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...
Bersanini, Luca; Allahverdiyeva, Yagut; Battchikova, Natalia; Heinz, Steffen; Lespinasse, Maija; Ruohisto, Essi; Mustila, Henna; Nickelsen, Jörg; Vass, Imre; Aro, Eva-Mari
2017-03-01
In Synechocystis sp. PCC 6803, the flv4-2 operon encodes the flavodiiron proteins Flv2 and Flv4 together with a small protein, Sll0218, providing photoprotection for Photosystem II (PSII). Here, the distinct roles of Flv2/Flv4 and Sll0218 were addressed, using a number of flv4-2 operon mutants. In the ∆sll0218 mutant, the presence of Flv2/Flv4 rescued PSII functionality as compared with ∆sll0218-flv2, where neither Sll0218 nor the Flv2/Flv4 heterodimer are expressed. Nevertheless, both the ∆sll0218 and ∆sll0218-flv2 mutants demonstrated deficiency in accumulation of PSII proteins suggesting a role for Sll0218 in PSII stabilization, which was further supported by photoinhibition experiments. Moreover, the accumulation of PSII assembly intermediates occurred in Sll0218-lacking mutants. The YFP-tagged Sll0218 protein localized in a few spots per cell at the external side of the thylakoid membrane, and biochemical membrane fractionation revealed clear enrichment of Sll0218 in the PratA-defined membranes, where the early biogenesis steps of PSII occur. Further, the characteristic antenna uncoupling feature of the ∆flv4-2 operon mutants is shown to be related to PSII destabilization in the absence of Sll0218. It is concluded that the Flv2/Flv4 heterodimer supports PSII functionality, while the Sll0218 protein assists PSII assembly and stabilization, including optimization of light harvesting. © 2016 The Authors. Plant, Cell & Enviroment Published by John Wiley & Sons Ltd.
Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas
2014-01-01
Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629
Protease of Stenotrophomonas sp. from Indonesian fermented food: gene cloning and analysis
Directory of Open Access Journals (Sweden)
Frans Kurnia
2018-02-01
Full Text Available Screening of proteolytic and fibrinolytic bacteria from Indonesian soy bean based fermented food Oncom revealed several potential isolates. Based on 16s rDNA gene analysis, one particular isolate with the highest proteolytic and fibrinolytic activity was identified as Stenotrophomonas sp. The protease gene was amplified to generate a 1749 bp Polymerase Chain Reaction product and BLAST analysis, revealed 90% homology with gene encoding protease enzyme from Stenotrophomonas maltophilia. The putative amino acid sequence indicated a serine protease enzyme with typical amino acid aspartate, histidine and serine in the catalytic triad. The gene was translated into a pre-pro-protein consisted of cleavage site on its N terminal and Pre-Peptidase Cterminal domain. Cloning of the protease gene in pET22b with Escherichia coli BL21 DE3 as the host showed that the gene was expressed as insoluble protein fraction. This is the first report for analysis of protease gene from food origin Stenotrophomonas sp.
Jørgensen, P L; Tangney, M; Pedersen, P E; Hastrup, S; Diderichsen, B; Jørgensen, S T
2000-02-01
A gene encoding an alkaline protease was cloned from an alkalophilic bacillus, and its nucleotide sequence was determined. The cloned gene was used to increase the copy number of the protease gene on the chromosome by an improved gene amplification technique.
The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements
LENUS (Irish Health Repository)
Thornton, Roibeard F
2010-04-23
Abstract Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota.
The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements
Directory of Open Access Journals (Sweden)
Kagawa Todd F
2010-04-01
Full Text Available Abstract Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota.
Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B
2012-08-01
The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Kang, Sung-Hwan; Atallah, Osama O; Sun, Yong-Duo; Folimonova, Svetlana Y
2018-01-15
Viruses from the family Closteroviridae show an example of intra-genome duplications of more than one gene. In addition to the hallmark coat protein gene duplication, several members possess a tandem duplication of papain-like leader proteases. In this study, we demonstrate that domains encoding the L1 and L2 proteases in the Citrus tristeza virus genome underwent a significant functional divergence at the RNA and protein levels. We show that the L1 protease is crucial for viral accumulation and establishment of initial infection, whereas its coding region is vital for virus transport. On the other hand, the second protease is indispensable for virus infection of its natural citrus host, suggesting that L2 has evolved an important adaptive function that mediates virus interaction with the woody host. Copyright © 2017 Elsevier Inc. All rights reserved.
Zou, Zhi; Liu, Jianting; Yang, Lifu; Xie, Guishui
2017-01-01
Arabidopsis thaliana SAG12, a senescence-specific gene encoding a cysteine protease, is widely used as a molecular marker for the study of leaf senescence. To date, its potential orthologues have been isolated from several plant species such as Brassica napus and Nicotiana tabacum. However, little information is available in rubber tree (Hevea brasiliensis), a rubber-producing plant of the Euphorbiaceae family. This study presents the identification of SAG12-like genes from the rubber tree genome. Results showed that an unexpected high number of 17 rubber orthologues with a single intron were found, contrasting the single copy with two introns in Arabidopsis. The gene expansion was also observed in another two Euphorbiaceae plants, castor bean (Ricinus communis) and physic nut (Jatropha curcas), both of which contain 8 orthologues. In accordance with no occurrence of recent whole-genome duplication (WGD) events, most duplicates in castor and physic nut were resulted from tandem duplications. In contrast, the duplicated HbSAG12H genes were derived from tandem duplications as well as the recent WGD. Expression analysis showed that most HbSAG12H genes were lowly expressed in examined tissues except for root and male flower. Furthermore, HbSAG12H1 exhibits a strictly senescence-associated expression pattern in rubber tree leaves, and thus can be used as a marker gene for the study of senescence mechanism in Hevea.
Tan, Y; Donovan, W P
2001-11-17
The aprA gene encoding alkaline protease A (AprA) was cloned from Bacillus thuringiensis subsp. kurstaki, and the cloned gene was used to construct aprA-deleted (aprA1) strains of B. thuringiensis. An aprA1 strain of B. thuringiensis that contained the wild-type gene for neutral protease A (nprA(+)) displayed levels of extracellular proteolytic activity that were similar to those of an aprA(+)nprA(+) strain. However, when EDTA was included in the protease assay to inhibit NprA activity the aprA1nprA(+) strain displayed only 2% of the extracellular proteolytic activity of the aprA(+)nprA(+) strain. A strain that was deleted for both aprA and nprA (aprA1nprA3 strain) failed to produce detectable levels of proteolytic activity either in the presence or absence of EDTA in the assay. Compared with the aprA(+)nprA(+) strain the aprA1nprA(+) strain yielded 10% more full-length Cry1Bb crystal protein and the aprA1nprA3 strain yielded 25% more full-length Cry1Bb protein. No significant differences were seen in the 50% lethal dose of Cry1Bb protein from aprA(+)nprA(+) and aprA1nprA3 strains against three species of lepidopteran insects. These results suggest that enhanced yield of certain crystal proteins can be obtained by deletion of the genes aprA and nprA which are the major extracellular proteases of B. thuringiensis.
Ma, R C; Oliveira, M M
2000-07-01
A cDNA for an S-like RNase (RNase PD2) has been isolated from a pistil cDNA library of Prunus dulcis cv. Ferragnés. The cDNA encodes an acidic protein of 226 amino acid residues with a molecular weight of 25 kDa. A potential N-glycosylation site is present at the N-terminus in RNase PD2. A signal peptide of 23 amino acid residues and a transmembrane domain are predicted. The two active-site histidines present in enzymes of the T2/S RNase superfamily were detected in RNase PD2. Its amino acid sequence shows 71.2% similarity to RNSI of Arabidopsis and RNase T2 of chickpea, respectively. Northern blotting and RT-PCR analyses indicate that PD2 is expressed predominantly in petals, pistils of open flowers and leaves of the almond tree. Analyses of shoots cultured in vitro suggested that the expression of RNase PD2 is associated with phosphate starvation. Southern analysis detected two sequences related to RNase PD2 in the P. dulcis genome. RFLP analysis showed that S-like RNase genes are polymorphic in different almond cultivars. The PD2 gene sequence was amplified by PCR and two introns were shown to interrupt the coding region. Based on sequence analysis, we have defined three classes of S-like RNase genes, with the PD2 RNase gene representing a distinct class. The significance of the structural divergence of S-like RNase genes is further discussed.
Erlandson, Martin A; Hegedus, Dwayne D; Baldwin, Douglas; Noakes, Amy; Toprak, Umut
2010-10-01
The midgut protease profiles from 5th instar Mamestra configurata larvae fed various diets (standard artificial diet, low protein diet, low protein diet with soybean trypsin inhibitor [SBTI], or Brassica napus) were characterized by one-dimensional enzymography in gelatin gels. The gut protease profile of larvae fed B. napus possessed protease activities of molecular masses of approximately 33 and 55 kDa, which were not present in the guts of larvae fed artificial diet. Similarly, larvae fed artificial diet had protease activities of molecular masses of approximately 21, 30, and 100 kDa that were absent in larvae fed B. napus. Protease profiles changed within 12 to 24 h after switching larvae from artificial diet to plant diet and vice versa. The gut protease profiles from larvae fed various other brassicaceous species and lines having different secondary metabolite profiles did not differ despite significant differences in larval growth rates on the different host plants. Genes encoding putative digestive proteolytic enzymes, including four carboxypeptidases, five aminopeptidases, and 48 serine proteases, were identified in cDNA libraries from 4th instar M. configurata midgut tissue. Many of the protease-encoding genes were expressed at similar levels on all diets; however, three chymoptrypsin-like genes (McSP23, McSP27, and McSP37) were expressed at much higher levels on standard artificial diet and diet containing SBTI as was the trypsin-like gene McSP34. The expression of the trypsin-like gene McSP50 was highest on B. napus. The adaptation of M. configurata digestive biochemistry to different diets is discussed in the context of the flexibility of polyphagous insects to changing diet sources.
International Nuclear Information System (INIS)
Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.
1988-01-01
A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells
International Nuclear Information System (INIS)
Jeudy, Sandra; Lartigue, Audrey; Mansuelle, Pascal; Ogata, Yuki; Abergel, Chantal
2010-01-01
The genome sequence of mimivirus, the largest known double-stranded DNA virus, encodes a putative protease: the R355 gene product. Its expression in E. coli, its crystallization and the preliminary phasing of a MAD data set using the selenium signal present in a crystal of recombinant selenomethionine-substituted protein are reported. The complete genome sequence of the largest known double-stranded DNA virus, mimivirus, reveals the presence of a gene (denoted R355) that potentially encodes a cysteine protease that is expressed late (after 6 h) in the infectious cycle of the virus. In order to verify a sequence-based functional prediction and understand its role during the infectious process, the R355 protein was produced to assay its proteolytic activity and solve its three-dimensional structure. Here, the preliminary crystallographic analysis of the recombinant viral protein is reported. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 , with a monomer in the asymmetric unit. A MAD data set was used for preliminary phasing using the selenium signal from a selenomethionine-substituted protein crystal
He, Xian-hui; Xu, Li-hui; Liu, Yi
2005-04-01
To investigate the expression and regulation of PD-1 ligand 1 (PD-L1) in peripheral blood mononuclear cells (PBMC). The cDNA encoding human PD-L1 precursor was cloned from the total RNA extracted from the resting and phorbol dibutyrate plus ionomycin- or phytohemagglutinin-activated PBMC, by reverse transcription polymerase chain reaction (RT-PCR), and independent clones were sequenced and analyzed. The expression and subcellular localization were examined in transiently transfected cells. The PD-L1 gene expression in different PBMC was also analyzed by RT-PCR. A novel human PD-L1 splice variant was identified from the activated PBMC. It was generated by splicing out exon? encoding an immunoglobulin variable domain (Igv)-like domain but retaining all other exons without a frame-shift. Consequently, the putative translated protein contained all other domains including the transmembrane region except for the Igv-like domain. Furthermore, the conventional isoform was expressed on the plasma surface whereas the novel isoform showed a pattern of intracellular membrane distribution in transiently transfected K562 cells. In addition, the expression pattern of the PD-L1 splice variant was variable in different individuals and in different cellular status. PD-L1 expression may be regulated at the posttranscriptional level through alternative splicing, and modulation of the PD-L1 isoform expression may influence the outcome of specific immune responses in the peripheral tissues.
Human mast cell tryptase: Multiple cDNAs and genes reveal a multigene serine protease family
International Nuclear Information System (INIS)
Vanderslice, P.; Ballinger, S.M.; Tam, E.K.; Goldstein, S.M.; Craik, C.S.; Caughey, G.H.
1990-01-01
Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the ∼1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5' regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family
de Pascale, D.; Giuliani, M.; De Santi, C.; Bergamasco, N.; Amoresano, A.; Carpentieri, A.; Parrilli, E.; Tutino, M. L.
2010-08-01
Cold-adapted proteases have been found to be the dominant activity throughout the cold marine environment, indicating their importance in bacterial acquisition of nitrogen-rich complex organic compounds. However, few extracellular proteases from marine organisms have been characterized so far, and the mechanisms that enable their activity in situ are still largely unknown. Aside from their ecological importance and use as model enzyme for structure/function investigations, cold-active proteolytic enzymes offer great potential for biotechnological applications. Our studies on cold adapted proteases were performed on exo-enzyme produced by the Antarctic marine bacterium Pseudoalteromonas haloplanktis TAC125. By applying a proteomic approach, we identified several proteolytic activities from its culture supernatant. PhAP protease was selected for further investigations. The encoding gene was cloned and the protein was recombinantly produced in E. coli cells. The homogeneous product was biochemically characterised and it turned out that the enzyme is a Zn-dependent aminopeptidase, with an activity dependence from assay temperature typical of psychrophilic enzymes.
van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O
1992-01-01
Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671
Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.
Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G
2004-10-01
The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots
Directory of Open Access Journals (Sweden)
LUCIA KUSUMAWATI
2013-09-01
Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.
Sharma, Vivek; Salwan, Richa; Sharma, Prem N
2016-09-01
In the present study, production of extracellular proteases by Trichoderma harzianum was evaluated based on the relative gene expression and spectrophotometric assay. The fungal isolates were grown in Czapek Dox Broth medium supplemented with deactivated mycelium of plant fungal pathogens such as Fusarium oxysporum, Colletotrichum capsici, Gloeocercospora sorghi, and Colletotrichum truncatum. The maximum protease activity was detected after 48 h of incubation against Colletotrichum spp. Similarly in qRT-PCR, the relative gene expression of four proteases varied from 48 to 96 h against host pathogens in a time-independent manner. Among proteases, statistically significant upregulation of asp, asp, and srp was observed against Colletotrichum spp., followed by F. oxysporum. But in the case of pepM22, maximum upregulation was observed against F. oxysporum. The variation in enzyme assay and qRT-PCR of proteases at different time intervals against various fungal phytopathogens could be due to the limitation of using casein as a substrate for all types of proteases or protease-encoding transcripts selected for qRT-PCR, which may not be true representative of total protease activity.
Raimbault, Astrid-Kim; Zuily-Fodil, Yasmine; Soler, Alain; Cruz de Carvalho, Maria H
2013-11-15
A full-length cDNA encoding a putative aspartic acid protease (AcAP1) was isolated for the first time from the flesh of pineapple (Ananas comosus) fruit. The deduced sequence of AcAP1 showed all the common features of a typical plant aspartic protease phytepsin precursor. Analysis of AcAP1 gene expression under postharvest chilling treatment in two pineapple varieties differing in their resistance to blackheart development revealed opposite trends. The resistant variety showed an up-regulation of AcAP1 precursor gene expression whereas the susceptible showed a down-regulation in response to postharvest chilling treatment. The same trend was observed regarding specific AP enzyme activity in both varieties. Taken together our results support the involvement of AcAP1 in postharvest chilling stress resistance in pineapple fruits. Copyright © 2013 Elsevier GmbH. All rights reserved.
Yoon, Jaewoo; Maruyama, Jun-ichi; Kitamoto, Katsuhiko
2011-02-01
Proteolytic degradation by secreted proteases into the culture medium is one of the significant problems to be solved in heterologous protein production by filamentous fungi including Aspergillus oryzae. Double (tppA, and pepE) and quintuple (tppA, pepE, nptB, dppIV, and dppV) disruption of protease genes enhanced human lysozyme (HLY) and bovine chymosin (CHY) production by A. oryzae. In this study, we used a quintuple protease gene disruptant and performed successive rounds of disruption for five additional protease genes (alpA, pepA, AopepAa, AopepAd, and cpI), which were previously investigated by DNA microarray analyses for their expression. Gene disruption was performed by pyrG marker recycling with a highly efficient gene-targeting background (∆ligD) as previously reported. As a result, the maximum yields of recombinant CHY and HLY produced by a decuple protease gene disruptant were approximately 30% and 35%, respectively, higher than those produced by a quintuple protease gene disruptant. Thus, we successfully constructed a decuple protease gene disruptant possessing highly improved capability of heterologous protein production. This is the first report on decuple protease gene disruption that improved the levels of heterologous protein production by the filamentous fungus A. oryzae.
Directory of Open Access Journals (Sweden)
S. S. Hasson
2010-01-01
Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.
Goldbach, R; Krijt, J
1982-09-01
The protease encoded by the large (B) RNA segment of cowpea mosaic virus was tested for its ability to recognize the in vitro translation products of the small (M) RNA segment from the comoviruses squash mosaic virus, red clover mottle virus, and cowpea severe mosaic virus (CPsMV, strains Dg and Ark), and from the nepovirus tomato black ring virus. Like M RNA from cowpea mosaic virus, the M RNAs from squash mosaic virus, red clover mottle virus, CPsMV-Dg, and CPsMV-Ark were all translated into two large polypeptides with apparent molecular weights which were different for each virus and even for the two CPsMV strains. Neither the in vitro products from squash mosaic virus, red clover mottle virus, and CPsMV M RNAs nor the in vitro product from tomato black ring virus RNA-2 were processed by the cowpea mosaic virus-encoded protease, indicating that the activity of this enzyme is highly specific.
Extreme expansion of NBS-encoding genes in Rosaceae.
Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui
2015-05-03
Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.
Cathepsin F cysteine protease of the human liver fluke, Opisthorchis viverrini.
Directory of Open Access Journals (Sweden)
Porntip Pinlaor
Full Text Available The liver fluke Opisthorchis viverrini is classified as a class I carcinogen due to the association between cholangiocarcinoma and chronic O. viverrini infection. During its feeding activity within the bile duct, the parasite secretes several cathepsin F cysteine proteases that may induce or contribute to the pathologies associated with hepatobiliary abnormalities.Here, we describe the cDNA, gene organization, phylogenetic relationships, immunolocalization, and functional characterization of the cathepsin F cysteine protease gene, here termed Ov-cf-1, from O. viverrini. The full length mRNA of 1020 nucleotides (nt encoded a 326 amino acid zymogen consisting of a predicted signal peptide (18 amino acids, aa, prosegment (95 aa, and mature protease (213 aa. BLAST analysis using the Ov-CF-1 protein as the query revealed that the protease shared identity with cathepsin F-like cysteine proteases of other trematodes, including Clonorchis sinensis (81%, Paragonimus westermani (58%, Schistosoma mansoni and S. japonicum (52%, and with vertebrate cathepsin F (51%. Transcripts encoding the protease were detected in all developmental stages that parasitize the mammalian host. The Ov-cf-1 gene, of approximately 3 kb in length, included seven exons interrupted by six introns; the exons ranged from 69 to 267 bp in length, the introns from 43 to 1,060 bp. The six intron/exon boundaries of Ov-cf-1 were conserved with intron/exon boundaries in the human cathepsin F gene, although the gene structure of human cathepsin F is more complex. Unlike Ov-CF-1, human cathepsin F zymogen includes a cystatin domain in the prosegment region. Phylogenetic analysis revealed that the fluke, human, and other cathepsin Fs branched together in a clade discrete from the cathepsin L cysteine proteases. A recombinant Ov-CF-1 zymogen that displayed low-level activity was expressed in the yeast Pichia pastoris. Although the recombinant protease did not autocatalytically process and
Extracellular proteases of Trichoderma species. A review.
Kredics, L; Antal, Zsuzsanna; Szekeres, A; Hatvani, L; Manczinger, L; Vágvölgyi, Cs; Nagy, Erzsébet
2005-01-01
Cellulolytic, xylanolytic, chitinolytic and beta-1,3-glucanolytic enzyme systems of species belonging to the filamentous fungal genus Trichoderma have been investigated in details and are well characterised. The ability of Trichoderma strains to produce extracellular proteases has also been known for a long time, however, the proteolytic enzyme system is relatively unknown in this genus. Fortunately, in the recent years more and more attention is focused on the research in this field. The role of Trichoderma proteases in the biological control of plant pathogenic fungi and nematodes has been demonstrated, and it is also suspected that they may be important for the competitive saprophytic ability of green mould isolates and may represent potential virulence factors of Trichoderma strains as emerging fungal pathogens of clinical importance. The aim of this review is to summarize the information available about the extracellular proteases of Trichoderma. Numerous studies are available about the extracellular proteolytic enzyme profiles of Trichoderma strains and about the effect of abiotic environmental factors on protease activities. A number of protease enzymes have been purified to homogeneity and some protease encoding genes have been cloned and characterized. These results will be reviewed and the role of Trichoderma proteases in biological control as well as their advantages and disadvantages in biotechnology will be discussed.
Yan, Hong-Bin; Lou, Zhong-Zi; Li, Li; Brindley, Paul J; Zheng, Yadong; Luo, Xuenong; Hou, Junling; Guo, Aijiang; Jia, Wan-Zhong; Cai, Xuepeng
2014-06-04
Cysticercosis remains a major neglected tropical disease of humanity in many regions, especially in sub-Saharan Africa, Central America and elsewhere. Owing to the emerging drug resistance and the inability of current drugs to prevent re-infection, identification of novel vaccines and chemotherapeutic agents against Taenia solium and related helminth pathogens is a public health priority. The T. solium genome and the predicted proteome were reported recently, providing a wealth of information from which new interventional targets might be identified. In order to characterize and classify the entire repertoire of protease-encoding genes of T. solium, which act fundamental biological roles in all life processes, we analyzed the predicted proteins of this cestode through a combination of bioinformatics tools. Functional annotation was performed to yield insights into the signaling processes relevant to the complex developmental cycle of this tapeworm and to highlight a suite of the proteases as potential intervention targets. Within the genome of this helminth parasite, we identified 200 open reading frames encoding proteases from five clans, which correspond to 1.68% of the 11,902 protein-encoding genes predicted to be present in its genome. These proteases include calpains, cytosolic, mitochondrial signal peptidases, ubiquitylation related proteins, and others. Many not only show significant similarity to proteases in the Conserved Domain Database but have conserved active sites and catalytic domains. KEGG Automatic Annotation Server (KAAS) analysis indicated that ~60% of these proteases share strong sequence identities with proteins of the KEGG database, which are involved in human disease, metabolic pathways, genetic information processes, cellular processes, environmental information processes and organismal systems. Also, we identified signal peptides and transmembrane helices through comparative analysis with classes of important regulatory proteases
Directory of Open Access Journals (Sweden)
Shuai Liu
2014-10-01
Full Text Available Blood fluke proteases play pivotal roles in the processes of invasion, nutrition acquisition, immune evasion, and other host-parasite interactions. Hundreds of genes encoding putative proteases have been identified in the recently published schistosome genomes. However, the expression profiles of these proteases in Schistosoma species have not yet been systematically analyzed. We retrieved and culled the redundant protease sequences of Schistosoma japonicum, Schistosoma mansoni, Echinococcus multilocularis, and Clonorchis sinensis from public databases utilizing bioinformatic approaches. The degradomes of the four parasitic organisms and Homo sapiens were then comparatively analyzed. A total of 262 S. japonicum protease sequences were obtained and the expression profiles generated using whole-genome microarray. Four main clusters of protease genes with different expression patterns were identified: proteases up-regulated in hepatic schistosomula and adult worms, egg-specific or predominantly expressed proteases, cercaria-specific or predominantly expressed proteases, and constantly expressed proteases. A subset of protease genes with different expression patterns were further validated using real-time quantitative PCR. The present study represents the most comprehensive analysis of a degradome in Schistosoma species to date. These results provide a firm foundation for future research on the specific function(s of individual proteases and may help to refine anti-proteolytic strategies in blood flukes.
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Understanding serine proteases implications on Leishmania spp lifecycle.
Alves, Carlos Roberto; Souza, Raquel Santos de; Charret, Karen Dos Santos; Côrtes, Luzia Monteiro de Castro; Sá-Silva, Matheus Pereira de; Barral-Veloso, Laura; Oliveira, Luiz Filipe Gonçalves; da Silva, Franklin Souza
2018-01-01
Serine proteases have significant functions over a broad range of relevant biological processes to the Leishmania spp lifecycle. Data gathered here present an update on the Leishmania spp serine proteases and the status of these enzymes as part of the parasite degradome. The serine protease genes (n = 26 to 28) in Leishmania spp, which encode proteins with a wide range of molecular masses (35 kDa-115 kDa), are described along with their degrees of chromosomal and allelic synteny. Amid 17 putative Leishmania spp serine proteases, only ∼18% were experimentally demonstrated, as: signal peptidases that remove the signal peptide from secretory pre-proteins, maturases of other proteins and with metacaspase-like activity. These enzymes include those of clans SB, SC and SF. Classical inhibitors of serine proteases are used as tools for the characterization and investigation of Leishmania spp. Endogenous serine protease inhibitors, which are ecotin-like, can act modulating host actions. However, crude or synthetic based-natural serine protease inhibitors, such as potato tuber extract, Stichodactyla helianthus protease inhibitor I, fukugetin and epoxy-α-lapachone act on parasitic serine proteases and are promising leishmanicidal agents. The functional interrelationship between serine proteases and other Leishmania spp proteins demonstrate essential functions of these enzymes in parasite physiology and therefore their value as targets for leishmaniasis treatment. Copyright © 2017 Elsevier Inc. All rights reserved.
Cursino, Luciana; Athinuwat, Dusit; Patel, Kelly R; Galvani, Cheryl D; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia
2015-01-01
Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases including Pierce's disease of grapevines. X. fastidiosa is thought to induce disease by colonizing and clogging xylem vessels through the formation of cell aggregates and bacterial biofilms. Here we examine the role in X. fastidiosa virulence of an uncharacterized gene, PD1671, annotated as a two-component response regulator with potential GGDEF and EAL domains. GGDEF domains are found in c-di-GMP diguanylate cyclases while EAL domains are found in phosphodiesterases, and these domains are for c-di-GMP production and turnover, respectively. Functional analysis of the PD1671 gene revealed that it affected multiple X. fastidiosa virulence-related phenotypes. A Tn5 PD1671 mutant had a hypervirulent phenotype in grapevines presumably due to enhanced expression of gum genes leading to increased exopolysaccharide levels that resulted in elevated biofilm formation. Interestingly, the PD1671 mutant also had decreased motility in vitro but did not show a reduced distribution in grapevines following inoculation. Given these responses, the putative PD1671 protein may be a negative regulator of X. fastidiosa virulence.
Directory of Open Access Journals (Sweden)
Luciana Cursino
Full Text Available Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases including Pierce's disease of grapevines. X. fastidiosa is thought to induce disease by colonizing and clogging xylem vessels through the formation of cell aggregates and bacterial biofilms. Here we examine the role in X. fastidiosa virulence of an uncharacterized gene, PD1671, annotated as a two-component response regulator with potential GGDEF and EAL domains. GGDEF domains are found in c-di-GMP diguanylate cyclases while EAL domains are found in phosphodiesterases, and these domains are for c-di-GMP production and turnover, respectively. Functional analysis of the PD1671 gene revealed that it affected multiple X. fastidiosa virulence-related phenotypes. A Tn5 PD1671 mutant had a hypervirulent phenotype in grapevines presumably due to enhanced expression of gum genes leading to increased exopolysaccharide levels that resulted in elevated biofilm formation. Interestingly, the PD1671 mutant also had decreased motility in vitro but did not show a reduced distribution in grapevines following inoculation. Given these responses, the putative PD1671 protein may be a negative regulator of X. fastidiosa virulence.
Molecular characterization of 45 kDa aspartic protease of Trichinella spiralis.
Park, Jong Nam; Park, Sang Kyun; Cho, Min Kyoung; Park, Mi-Kyung; Kang, Shin Ae; Kim, Dong-Hee; Yu, Hak Sun
2012-12-21
In a previous study, we identified an aspartic protease gene (Ts-Asp) from the Trichinella spiralis muscle stage larva cDNA library. The gene sequence of Ts-Asp was 1281 bp long and was found to encode a protein consisting of 405 amino acids, with a molecular mass of 45.248 kD and a pI of 5.95. The deduced Ts-Asp has a conserved catalytic motif with catalytic aspartic acid residues in the active site, a common characteristic of aspartic proteases. In addition, the deduced amino acid sequence of Ts-Asp was found to possess significant homology (above 50%) with aspartic proteases from nematode parasites. Results of phylogenetic analysis indicated a close relationship of Ts-Asp with cathepsin D aspartic proteases. For production of recombinant Ts-Asp (rTs-Asp), the pGEX4T expression system was used. Like other proteases, the purified rTs-Asp was able to digest collagen matrix in vitro. Abundant expression of Ts-Asp was observed in muscle stage larva. Ts-Asp was detected in ES proteins, and was able to elicit the production of specific antibodies. It is the first report of molecular characterization of aspartic protease isolated from T. spiralis. Copyright © 2012 Elsevier B.V. All rights reserved.
Siddiqui, Imran Ali; Haas, Dieter; Heeb, Stephan
2005-01-01
In Pseudomonas fluorescens CHA0, mutation of the GacA-controlled aprA gene (encoding the major extracellular protease) or the gacA regulatory gene resulted in reduced biocontrol activity against the root-knot nematode Meloidogyne incognita during tomato and soybean infection. Culture supernatants of strain CHA0 inhibited egg hatching and induced mortality of M. incognita juveniles more strongly than did supernatants of aprA and gacA mutants, suggesting that AprA protease contributes to biocon...
Cursino, Luciana; Athinuwat, Dusit; Patel, Kelly R.; Galvani, Cheryl D.; Zaini, Paulo A.; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C.; Burr, Thomas J.; Mowery, Patricia
2015-01-01
Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases including Pierce’s disease of grapevines. X. fastidiosa is thought to induce disease by colonizing and clogging xylem vessels through the formation of cell aggregates and bacterial biofilms. Here we examine the role in X. fastidiosa virulence of an uncharacterized gene, PD1671, annotated as a two-component response regulator with potential GGDEF and EAL domains. GGDEF domains are found in c-di-GMP diguanylate cyclases while EAL domains are found in phosphodiesterases, and these domains are for c-di-GMP production and turnover, respectively. Functional analysis of the PD1671 gene revealed that it affected multiple X. fastidiosa virulence-related phenotypes. A Tn5 PD1671 mutant had a hypervirulent phenotype in grapevines presumably due to enhanced expression of gum genes leading to increased exopolysaccharide levels that resulted in elevated biofilm formation. Interestingly, the PD1671 mutant also had decreased motility in vitro but did not show a reduced distribution in grapevines following inoculation. Given these responses, the putative PD1671 protein may be a negative regulator of X. fastidiosa virulence. PMID:25811864
Guleria, Shiwani; Walia, Abhishek; Chauhan, Anjali; Shirkot, C K
2016-09-02
An alkaline protease gene was amplified from genomic DNA of Bacillus amyloliquefaciens SP1 which was involved in effective biocontrol of Fusarium oxysporum. We investigated the antagonistic capacity of protease of B. amyloliquifaciens SP1, under in vitro conditions. The 5.62 fold purified enzyme with specific activity of 607.69U/mg reported 24.14% growth inhibition of F. oxysporum. However, no antagonistic activity was found after addition of protease inhibitor i.e. PMSF (15mM) to purified enzyme. An 1149bp nucleotide sequence of protease gene encoded 382 amino acids of 43kDa and calculated isoelectric point of 9.29. Analysis of deduced amino acid sequence revealed high homology (86%) with subtilisin E of Bacillus subtilis. The B. amyloliquefaciens SP1 protease gene was expressed in Escherichiax coli BL21. The expressed protease was secreted into culture medium by E. coli and exhibited optimum activity at pH8.0 and 60°C. The most reliable three dimensional structure of alkaline protease was determined using Phyre 2 server which was validated on the basis of Ramachandran plot and ERRAT value. The expression and structure prediction of the enzyme offers potential value for commercial application in agriculture and industry. Copyright © 2016 Elsevier B.V. All rights reserved.
Coxsackievirus B3 2A protease promotes encephalomyocarditis virus replication.
Song, Qin-Qin; Lu, Ming-Zhi; Song, Juan; Chi, Miao-Miao; Sheng, Lin-Jun; Yu, Jie; Luo, Xiao-Nuan; Zhang, Lu; Yao, Hai-Lan; Han, Jun
2015-10-02
To determine whether 2A protease of the enterovirus genus with type I internal ribosome entry site (IRES) effect on the viral replication of type II IRES, coxsackievirus B3(CVB3)-encoded protease 2A and encephalomyocarditis virus (EMCV) IRES (Type II)-dependent or cap-dependent report gene were transiently co-expressed in eukaryotic cells. We found that CVB3 2A protease not only inhibited translation of cap-dependent reporter genes through the cleavage of eIF4GI, but also conferred high EMCV IRES-dependent translation ability and promoted EMCV replication. Moreover, deletions of short motif (aa13-18 RVVNRH, aa65-70 KNKHYP, or aa88-93 PRRYQSH) resembling the nuclear localization signals (NLS) or COOH-terminal acidic amino acid motif (aa133-147 DIRDLLWLEDDAMEQ) of CVB3 2A protease decreased both its EMCV IRES-dependent translation efficiency and destroy its cleavage on eukaryotic initiation factor 4G (eIF4G) I. Our results may provide better understanding into more effective interventions and treatments for co-infection of viral diseases. Copyright © 2015 Elsevier B.V. All rights reserved.
Smoking, genes encoding dopamine pathway and risk for Parkinson's disease.
Gu, Zhuqin; Feng, Xiuli; Dong, Xiumin; Chan, Piu
2010-09-20
Smoking has been reported to be inversely associated with Parkinson's disease (PD) in many studies, but a recent study in China found that smoking increased the risk of PD. Variants in genes associated with dopamine metabolism found to increase the risk for PD have also been associated with smoking behavior. To investigate the association between smoking and PD in a Chinese population and determine whether the genetic variants of genes involved in dopamine metabolism influence the relationship between smoking and risk for PD. Chinese PD patients were recruited from Xuanwu Hospital. Controls were sampled from community. Detailed information on life-long smoking behavior was collected by face-to-face interview. Genotypes were determined for SLC6A3 VNTR, COMT Val108/158Met and MAO-B intron13 A/G polymorphisms by PCR-RFLP, DHPLC and sequencing. Chi-square and logistic regression model were used in the analysis. 176 PD cases and 354 controls were enrolled in this study. 23.9% cases are smokers, compared to 48.0% in controls. Ever smoking is inversely associated with PD (odds ratio=0.14, 95% CI 0.08-0.26, adjusted for age and gender). None of the above-mentioned genetic polymorphisms was associated with PD risk or smoking. When each variant was included in the logistic regression model, the inverse association between smoking and PD remained the same, and the interactions between smoking and variants were not significant in the model. Our data support a reduction of PD risk associated with smoking in a Chinese population. These variants of genes associated with DA uptake and metabolism do not affect the inverse association between smoking and PD. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.
Siddiqui, Imran Ali; Haas, Dieter; Heeb, Stephan
2005-01-01
In Pseudomonas fluorescens CHA0, mutation of the GacA-controlled aprA gene (encoding the major extracellular protease) or the gacA regulatory gene resulted in reduced biocontrol activity against the root-knot nematode Meloidogyne incognita during tomato and soybean infection. Culture supernatants of strain CHA0 inhibited egg hatching and induced mortality of M. incognita juveniles more strongly than did supernatants of aprA and gacA mutants, suggesting that AprA protease contributes to biocontrol. PMID:16151170
Tjalsma, H.; Koetje, E.J.; Kiewiet, R.; Kuipers, O.P.; Kolkman, M.J.M.; Laan, J.H. van der; Daskin, R.; Ferrari, E.; Bron, S.
2004-01-01
AIM: Engineering of Rap-Phr quorum-sensing systems of Bacillus subtilis and subsequent evaluation of the transcription of the aprE gene, encoding a major extracellular alkaline protease. METHODS AND RESULTS: Addition of synthetic Phr pentapeptides to the growth medium, or overproduction of pre-Phr
Tjalsma, H; Koetje, EJ; Kiewiet, R; Kuipers, OP; Kolkman, M; van der Laan, J; Daskin, R; Ferrari, E; Bron, S
2004-01-01
Aim: Engineering of Rap-Phr quorum-sensing systems of Bacillus subtilis and subsequent evaluation of the transcription of the aprE gene, encoding a major extracellular alkaline protease. Methods and Results: Addition of synthetic Phr pentapeptides to the growth medium, or overproduction of pre-Phr
Cytomegalovirus protease targeted prodrug development.
Sabit, Hairat; Dahan, Arik; Sun, Jing; Provoda, Chester J; Lee, Kyung-Dall; Hilfinger, John H; Amidon, Gordon L
2013-04-01
Human cytomegalovirus (HCMV) is a prevalent virus that infects up to 90% of the population. The goal of this research is to determine if small molecular prodrug substrates can be developed for a specific HCMV encoded protease and thus achieve site-specific activation. HCMV encodes a 256 amino acid serine protease that is responsible for capsid assembly, an essential process for herpes virus production. The esterase activity of the more stable HCMV A143T/A144T protease mutant was evaluated with model p-nitrophenol (ONp) esters, Boc-Xaa-ONp (Ala, Leu, Ile, Val, Gln, Phe at the Xaa position). We demonstrate that the A143T/A144T mutant has esterase activity toward specific small ester compounds, e.g., Boc-L-Ala-ONp. Mono amino acid and dipeptide prodrugs of ganciclovir (GCV) were also synthesized and evaluated for hydrolysis by the A143T/A144T protease mutant in solution. Hydrolysis of these prodrugs was also evaluated in Caco-2 cell homogenates, human liver microsomes (HLMs), and rat and human plasma. For the selectivity potential of the prodrugs, the hydrolysis ratio was evaluated as a percentage of prodrug hydrolyzed by the HCMV protease over the percentages of prodrug hydrolyses by Caco-2 cell homogenates, HLMs, and human/rat plasma. A dipeptide prodrug of ganciclovir, Ac-l-Gln-l-Ala-GCV, emerged as a potential selective prodrug candidate. The results of this research demonstrate that targeting prodrugs for activation by a specific protease encoded by the infectious HCMV pathogen may be achievable.
Effective Nanoparticle-based Gene Delivery by a Protease Triggered Charge Switch
DEFF Research Database (Denmark)
Gjetting, Torben; Jølck, Rasmus Irming; Andresen, Thomas Lars
2014-01-01
Gene carriers made from synthetic materials are of interest in relation to gene therapy but suffer from lack of transfection efficiency upon systemic delivery. To address this problem, a novel lipo-peptide-PEG conjugate constituted by a lipid-anchor, a peptide sensitive to proteases and a poly (e...
DEFF Research Database (Denmark)
2010-01-01
dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...
Ibrahim, Kalibulla Syed; Muniyandi, Jeyaraj; Pandian, Shunmugiah Karutha
2011-10-01
Leather industries release a large amount of pollution-causing chemicals which creates one of the major industrial pollutions. The development of enzyme based processes as a potent alternative to pollution-causing chemicals is useful to overcome this issue. Proteases are enzymes which have extensive applications in leather processing and in several bioremediation processes due to their high alkaline protease activity and dehairing efficacy. In the present study, we report cloning, characterization of a Mn2+ dependent alkaline serine protease gene (MASPT) of Bacillus pumilus TMS55. The gene encoding the protease from B. pumilus TMS55 was cloned and its nucleotide sequence was determined. This gene has an open reading frame (ORF) of 1,149 bp that encodes a polypeptide of 383 amino acid residues. Our analysis showed that this polypeptide is composed of 29 residues N-terminal signal peptide, a propeptide of 79 residues and a mature protein of 275 amino acids. We performed bioinformatics analysis to compare MASPT enzyme with other proteases. Homology modeling was employed to model three dimensional structure for MASPT. Structural analysis showed that MASPT structure is composed of nine α-helices and nine β-strands. It has 3 catalytic residues and 14 metal binding residues. Docking analysis showed that residues S223, A260, N263, T328 and S329 interact with Mn2+. This study allows initial inferences about the structure of the protease and will allow the rational design of its derivatives for structure-function studies and also for further improvement of the enzyme.
Directory of Open Access Journals (Sweden)
Lior Doron
Full Text Available Fusobacterium nucleatum is an oral anaerobe associated with periodontal disease, adverse pregnancy outcomes and colorectal carcinoma. A serine endopeptidase of 61-65 kDa capable of damaging host tissue and of inactivating immune effectors was detected previously in F. nucleatum. Here we describe the identification of this serine protease, named fusolisin, in three oral F. nucleatum sub-species. Gel zymogram revealed fusobacterial proteolytic activity with molecular masses ranging from 55-101 kDa. All of the detected proteases were inhibited by the serine protease inhibitor PMSF. analysis revealed that all of the detected proteases are encoded by genes encoding an open reading frame (ORF with a calculated mass of approximately 115 kDa. Bioinformatics analysis of the identified ORFs demonstrated that they consist of three domains characteristic of autotransporters of the type Va secretion system. Our results suggest that the F. nucleatum fusolisins are derived from a precursor of approximately 115 kDa. After crossing the cytoplasmic membrane and cleavage of the leader sequence, the C-terminal autotransporter domain of the remaining 96-113 kDa protein is embedded in the outer membrane and delivers the N-terminal S8 serine protease passenger domain to the outer cell surface. In most strains the N-terminal catalytic 55-65 kDa domain self cleaves and liberates itself from the autotransporter domain after its transfer across the outer cell membrane. In F. nucleatum ATCC 25586 this autocatalytic activity is less efficient resulting in a full length membrane-anchored serine protease. The mature serine protease was found to cleave after Thr, Gly, Ala and Leu residues at the P1 position. Growth of F. nucleatum in complex medium was inhibited when serine protease inhibitors were used. Additional experiments are needed to determine whether fusolisin might be used as a target for controlling fusobacterial infections.
Hao, Lingyun; Johnson, Kameka; Cursino, Luciana; Mowery, Patricia; Burr, Thomas J
2017-06-01
Xylella fastidiosa causes Pierce's disease (PD) on grapevines, leading to significant economic losses in grape and wine production. To further our understanding of X. fastidiosa virulence on grapevines, we examined the PD1311 gene, which encodes a putative acyl-coenzyme A (acyl-CoA) synthetase, and is highly conserved across Xylella species. It was determined that PD1311 is required for virulence, as the deletion mutant, ΔPD1311, was unable to cause disease on grapevines. The ΔPD1311 strain was impaired in behaviours known to be associated with PD development, including motility, aggregation and biofilm formation. ΔPD1311 also expressed enhanced sensitivity to H 2 O 2 and polymyxin B, and showed reduced survival in grapevine sap, when compared with wild-type X. fastidiosa Temecula 1 (TM1). Following inoculation, ΔPD1311 could not be detected in grape shoots, which may be related to its altered growth and sensitivity phenotypes. Inoculation with ΔPD1311 2 weeks prior to TM1 prevented the development of PD in a significant fraction of vines and eliminated detectable levels of TM1. In contrast, vines inoculated simultaneously with TM1 and ΔPD1311 developed disease at the same level as TM1 alone. In these vines, TM1 populations were distributed similarly to populations in TM1-only inoculated plants. These findings suggest that, through an indirect mechanism, pretreatment of vines with ΔPD1311 suppresses pathogen population and disease. © 2016 BSPP AND JOHN WILEY & SONS LTD.
Krunic, Aleksandar L; Stone, Kristina L; Simpson, Michael A; McGrath, John A
2013-01-01
Acral peeling skin syndrome (APSS) is a clinically and genetically heterogeneous disorder. We used whole-exome sequencing to identify the molecular basis of APSS in a consanguineous Jordanian-American pedigree. We identified a homozygous nonsense mutation (p.Lys22X) in the CSTA gene, encoding cystatin A, that was confirmed using Sanger sequencing. Cystatin A is a protease inhibitor found in the cornified cell envelope, and loss-of-function mutations have previously been reported in two cases of exfoliative ichthyosis. Our study expands the molecular pathology of APSS and demonstrates the value of next-generation sequencing in the genetic characterization of inherited skin diseases. © 2013 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Li, Yunxia; Pan, Yingjie; She, Qunxin
2013-01-01
Carboxyl-terminal protease (CtpA) plays essential functions in posttranslational protein processing in prokaryotic and eukaryotic cells. To date, only a few bacterial ctpA genes have been characterized. Here we cloned and characterized a novel CtpA. The encoding gene, ctpAp (ctpA of Paenibacillus...
Bacterial proteases and virulence
DEFF Research Database (Denmark)
Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne
2013-01-01
signalling to short-circuit host cell processes. Common to both intra- and extracellular proteases is the tight control of their proteolytic activities. In general, substrate recognition by the intracellular proteases is highly selective which is, in part, attributed to the chaperone activity associated...... tolerance to adverse conditions such as those experienced in the host. In the membrane, HtrA performs similar functions whereas the extracellular proteases, in close contact with host components, pave the way for spreading infections by degrading host matrix components or interfering with host cell...... with the proteases either encoded within the same polypeptide or on separate subunits. In contrast, substrate recognition by extracellular proteases is less selective and therefore these enzymes are generally expressed as zymogens to prevent premature proteolytic activity that would be detrimental to the cell...
Petersen, Lauren M; Tisa, Louis S
2014-11-01
A newly recognized Serratia species, termed South African Caenorhabditis briggsae isolate (SCBI), is both a mutualist of the nematode Caenorhabditis briggsae KT0001 and a pathogen of lepidopteran insects. Serratia sp. strain SCBI displays high proteolytic activity, and because secreted proteases are known virulence factors for many pathogens, the purpose of this study was to identify genes essential for extracellular protease activity in Serratia sp. strain SCBI and to determine what role proteases play in insect pathogenesis and cytotoxicity. A bank of 2,100 transposon mutants was generated, and six SCBI mutants with defective proteolytic activity were identified. These mutants were also defective in cytotoxicity. The mutants were found defective in genes encoding the following proteins: alkaline metalloprotease secretion protein AprE, a BglB family transcriptional antiterminator, an inosine/xanthosine triphosphatase, GidA, a methyl-accepting chemotaxis protein, and a PIN domain protein. Gene expression analysis on these six mutants showed significant downregulation in mRNA levels of several different types of predicted protease genes. In addition, transcriptome sequencing (RNA-seq) analysis provided insight into how inactivation of AprE, GidA, and a PIN domain protein influences motility and virulence, as well as protease activity. Using quantitative reverse transcription-PCR (qRT-PCR) to further characterize expression of predicted protease genes in wild-type Serratia sp. SCBI, the highest mRNA levels for the alkaline metalloprotease genes (termed prtA1 to prtA4) occurred following the death of an insect host, while two serine protease and two metalloprotease genes had their highest mRNA levels during active infection. Overall, these results indicate that proteolytic activity is essential for cytotoxicity in Serratia sp. SCBI and that its regulation appears to be highly complex. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
High throughput in vivo protease inhibitor selection platform
DEFF Research Database (Denmark)
2017-01-01
The invention relates to a recombinant microbial cell comprising a selection platform for screening for a protease inhibitor, wherein the platform comprises transgenes encoding a protease having selective peptide bond cleavage activity at a recognition site amino acid sequence; and transgenes...... platform for screening for a protease inhibitor....
Directory of Open Access Journals (Sweden)
Evan L Pannkuk
Full Text Available White nose syndrome (WNS is a cutaneous fungal disease of bats. WNS is responsible for unprecedented mortalities in North American cave bat populations. There have been few descriptions of enzyme activities that may function in WNS host/pathogen interactions, while no study has isolated and described secreted proteases. To address the hypothesis that Pseudogymnoascus destructans secretes extracellular proteases that function in wing necrosis during WNS infection, the object of this study was to culture P. destructans on various media, then isolate and structurally identify those proteases accumulated stably in the culture medium. We found a single dominant protease activity on minimal nutrient broth enriched with protein substrates, which was strongly inhibited by phenylmethylsulfonyl fluoride. This P. destructans serine protease (PdSP1 was isolated by preparative isoelectric focusing and concanavalin A lectin affinity chromatography. PdSP1 showed a molecular weight 27,900 (estimated by SDS-PAGE, broad pH optimum 6-8, and temperature optimum 60°C. Structural characterization of PdSP1 by MALDI-TOF MS, Orbitrap MS/MS, and Edman amino-terminal peptide sequencing matched it directly to a hypothetical protein accession from the sequenced P. destructans genome that is further identified as a MEROPS family S8A subtilisin-like serine peptidase. Two additional isoforms, PdSP2 and PdSP3, were identified in the P. destructans genome with 90% and 53% homology, respectively. P. destructans S8A serine proteases showed closer sequence conservation to P. pannorum and plant pathogenic fungi than to human pathogenic dermatophytes. Peptide-specific polyclonal antibodies developed from the PdSP1 sequence detected the protein in western blots. These subtilisin-like serine proteases are candidates for further functional studies in WNS host-pathogen interaction.
Pannkuk, Evan L; Risch, Thomas S; Savary, Brett J
2015-01-01
White nose syndrome (WNS) is a cutaneous fungal disease of bats. WNS is responsible for unprecedented mortalities in North American cave bat populations. There have been few descriptions of enzyme activities that may function in WNS host/pathogen interactions, while no study has isolated and described secreted proteases. To address the hypothesis that Pseudogymnoascus destructans secretes extracellular proteases that function in wing necrosis during WNS infection, the object of this study was to culture P. destructans on various media, then isolate and structurally identify those proteases accumulated stably in the culture medium. We found a single dominant protease activity on minimal nutrient broth enriched with protein substrates, which was strongly inhibited by phenylmethylsulfonyl fluoride. This P. destructans serine protease (PdSP1) was isolated by preparative isoelectric focusing and concanavalin A lectin affinity chromatography. PdSP1 showed a molecular weight 27,900 (estimated by SDS-PAGE), broad pH optimum 6-8, and temperature optimum 60°C. Structural characterization of PdSP1 by MALDI-TOF MS, Orbitrap MS/MS, and Edman amino-terminal peptide sequencing matched it directly to a hypothetical protein accession from the sequenced P. destructans genome that is further identified as a MEROPS family S8A subtilisin-like serine peptidase. Two additional isoforms, PdSP2 and PdSP3, were identified in the P. destructans genome with 90% and 53% homology, respectively. P. destructans S8A serine proteases showed closer sequence conservation to P. pannorum and plant pathogenic fungi than to human pathogenic dermatophytes. Peptide-specific polyclonal antibodies developed from the PdSP1 sequence detected the protein in western blots. These subtilisin-like serine proteases are candidates for further functional studies in WNS host-pathogen interaction.
Directory of Open Access Journals (Sweden)
Martin Löwer
Full Text Available Exported proteases of Helicobacter pylori (H. pylori are potentially involved in pathogen-associated disorders leading to gastric inflammation and neoplasia. By comprehensive sequence screening of the H. pylori proteome for predicted secreted proteases, we retrieved several candidate genes. We detected caseinolytic activities of several such proteases, which are released independently from the H. pylori type IV secretion system encoded by the cag pathogenicity island (cagPAI. Among these, we found the predicted serine protease HtrA (Hp1019, which was previously identified in the bacterial secretome of H. pylori. Importantly, we further found that the H. pylori genes hp1018 and hp1019 represent a single gene likely coding for an exported protein. Here, we directly verified proteolytic activity of HtrA in vitro and identified the HtrA protease in zymograms by mass spectrometry. Overexpressed and purified HtrA exhibited pronounced proteolytic activity, which is inactivated after mutation of Ser205 to alanine in the predicted active center of HtrA. These data demonstrate that H. pylori secretes HtrA as an active protease, which might represent a novel candidate target for therapeutic intervention strategies.
Directory of Open Access Journals (Sweden)
GangQiang Li
Full Text Available A lumbrokinase gene encoding a blood-clot dissolving protein was cloned from earthworm (Eisenia fetida by RT-PCR amplification. The gene designated as CST1 (GenBank No. AY840996 was sequence analyzed. The cDNA consists of 888 bp with an open reading frame of 729 bp, which encodes 242 amino acid residues. Multiple sequence alignments revealed that CST1 shares similarities and conserved amino acids with other reported lumbrokinases. The amino acid sequence of CST1 exhibits structural features similar to those found in other serine proteases, including human tissue-type (tPA, urokinase (uPA, and vampire bat (DSPAα1 plasminogen activators. CST1 has a conserved catalytic triad, found in the active sites of protease enzymes, which are important residues involved in polypeptide catalysis. CST1 was expressed as inclusion bodies in Escherichia coli BL21(DE3. The molecular mass of recombinant CST1 (rCST was 25 kDa as estimated by SDS-PAGE, and further confirmed by Western Blot analysis. His-tagged rCST1 was purified and renatured using nickel-chelating resin with a recovery rate of 50% and a purity of 95%. The purified, renatured rCST1 showed fibrinolytic activity evaluated by both a fibrin plate and a blood clot lysis assay. rCST1 degraded fibrin on the fibrin plate. A significant percentage (65.7% of blood clot lysis was observed when blood clot was treated with 80 mg/mL of rCST1 in vitro. The antithrombotic activity of rCST1 was 912 units/mg calculated by comparison with the activity of a lumbrokinase standard. These findings indicate that rCST1 has potential as a potent blood-clot treatment. Therefore, the expression and purification of a single lumbrokinase represents an important improvement in the use of lumbrokinases.
Chen, C-M; Liu, J-J; Chou, C-W; Lai, C-H; Wu, L-T
2015-10-01
To investigate the biochemical and functional properties of an extracellular protease, RpA, in Ralstonia pickettii WP1 isolated from water supply systems. An extracellular protease was identified and characterized from R. pickettii WP1. A mutant strain WP1M2 was created from strain WP1 by mini-Tn5 transposition. The culture filtrates from WP1M2 had a lower cytotoxic effect than the parental WP1 on several mammalian cell lines. Cloning and sequence analysis revealed the Tn5 transposon inserted at a protease gene (rpA) which is 81% homologous to prtA and aprX genes of Pseudomonas fluorescens. The rpA gene encodes a 482-residue protein showing sequence similarity to metalloproteases of the serralysin family. The RpA protein was expressed in Escherichia coli using a pET expression vector and purified as a 55 kDa molecular weight protein. Furthermore, the protease activity of RpA was inhibited by protease inhibitor and heat treatment. The in vitro cytotoxic activity of R. pickettii culture filtrates was attributed to RpA protease. An extracellular protease, RpA, was identified from R. pickettii WP1 isolated from water supply system. The RpA metalloproteases is required for the pathogenicity of R. pickettii to mammalian cell lines. © 2015 The Society for Applied Microbiology.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Directory of Open Access Journals (Sweden)
Florine E.M. Scholte
2017-09-01
Full Text Available Antiviral responses are regulated by conjugation of ubiquitin (Ub and interferon-stimulated gene 15 (ISG15 to proteins. Certain classes of viruses encode Ub- or ISG15-specific proteases belonging to the ovarian tumor (OTU superfamily. Their activity is thought to suppress cellular immune responses, but studies demonstrating the function of viral OTU proteases during infection are lacking. Crimean-Congo hemorrhagic fever virus (CCHFV, family Nairoviridae is a highly pathogenic human virus that encodes an OTU with both deubiquitinase and deISGylase activity as part of the viral RNA polymerase. We investigated CCHFV OTU function by inactivating protease catalytic activity or by selectively disrupting its deubiquitinase and deISGylase activity using reverse genetics. CCHFV OTU inactivation blocked viral replication independently of its RNA polymerase activity, while deubiquitinase activity proved critical for suppressing the interferon responses. Our findings provide insights into viral OTU functions and support the development of therapeutics and vaccines.
Sudagidan, Mert; Aydin, Ali
2010-04-15
In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
Rep, M; Nooy, J; Guélin, E; Grivell, L A
1996-08-01
The AFG3 gene of Saccharomyces cerevisiae encodes a mitochondrial inner membrane protein with ATP-dependent protease activity. To gain more insight into the function of this protein, multi-copy suppressors of an afg3-null mutation were isolated. Three genes were found that restored partial growth on non-fermentable carbon sources, all of which affect the biogenesis of respiratory competent mitochondria: PIM1(LON) encodes a matrix-localized ATP-dependent protease involved in the turnover of matrix proteins; OXA1(PET1402) encodes a putative mitochondrial inner membrane protein involved in the biogenesis of the respiratory chain; and MBA1 encodes a mitochondrial protein required for optimal respiratory growth. All three genes also suppressed a null mutation in a related gene, RCA1, as well as in the combination of afg3- and rca1-null.
Directory of Open Access Journals (Sweden)
Gorski Sharon M
2007-07-01
Full Text Available Abstract Background Programmed cell death is used to remove excess cells between ommatidia in the Drosophila pupal retina. This death is required to establish the crystalline, hexagonal packing of ommatidia that characterizes the adult fly eye. In previously described echinus mutants, interommatidial cell sorting, which precedes cell death, occurred relatively normally. Interommatidial cell death was partially suppressed, resulting in adult eyes that contained excess pigment cells, and in which ommatidia were mildly disordered. These results have suggested that echinus functions in the pupal retina primarily to promote interommatidial cell death. Results We generated a number of new echinus alleles, some likely null mutants. Analysis of these alleles provides evidence that echinus has roles in cell sorting as well as cell death. echinus encodes a protein with homology to ubiquitin-specific proteases. These proteins cleave ubiquitin-conjugated proteins at the ubiquitin C-terminus. The echinus locus encodes multiple splice forms, including two proteins that lack residues thought to be critical for deubiquitination activity. Surprisingly, ubiquitous expression in the eye of versions of Echinus that lack residues critical for ubiquitin specific protease activity, as well as a version predicted to be functional, rescue the echinus loss-of-function phenotype. Finally, genetic interactions were not detected between echinus loss and gain-of-function and a number of known apoptotic regulators. These include Notch, EGFR, the caspases Dronc, Drice, Dcp-1, Dream, the caspase activators, Rpr, Hid, and Grim, the caspase inhibitor DIAP1, and Lozenge or Klumpfuss. Conclusion The echinus locus encodes multiple splice forms of a protein with homology to ubiquitin-specific proteases, but protease activity is unlikely to be required for echinus function, at least when echinus is overexpressed. Characterization of likely echinus null alleles and genetic interactions
Alternative splicing, a new target to block cellular gene expression by poliovirus 2A protease
International Nuclear Information System (INIS)
Alvarez, Enrique; Castello, Alfredo; Carrasco, Luis; Izquierdo, Jose M.
2011-01-01
Highlights: → Novel role for poliovirus 2A protease as splicing modulator. → Poliovirus 2A protease inhibits the alternative splicing of pre-mRNAs. → Poliovirus 2A protease blocks the second catalytic step of splicing. -- Abstract: Viruses have developed multiple strategies to interfere with the gene expression of host cells at different stages to ensure their own survival. Here we report a new role for poliovirus 2A pro modulating the alternative splicing of pre-mRNAs. Expression of 2A pro potently inhibits splicing of reporter genes in HeLa cells. Low amounts of 2A pro abrogate Fas exon 6 skipping, whereas higher levels of protease fully abolish Fas and FGFR2 splicing. In vitro splicing of MINX mRNA using nuclear extracts is also strongly inhibited by 2A pro , leading to accumulation of the first exon and the lariat product containing the unspliced second exon. These findings reveal that the mechanism of action of 2A pro on splicing is to selectively block the second catalytic step.
Alternative splicing, a new target to block cellular gene expression by poliovirus 2A protease
Energy Technology Data Exchange (ETDEWEB)
Alvarez, Enrique, E-mail: ealvarez@cbm.uam.es [Centro de Biologia Molecular Severo Ochoa (CSIC-UAM), Nicolas Cabrera, 1 Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain); Castello, Alfredo; Carrasco, Luis; Izquierdo, Jose M. [Centro de Biologia Molecular Severo Ochoa (CSIC-UAM), Nicolas Cabrera, 1 Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain)
2011-10-14
Highlights: {yields} Novel role for poliovirus 2A protease as splicing modulator. {yields} Poliovirus 2A protease inhibits the alternative splicing of pre-mRNAs. {yields} Poliovirus 2A protease blocks the second catalytic step of splicing. -- Abstract: Viruses have developed multiple strategies to interfere with the gene expression of host cells at different stages to ensure their own survival. Here we report a new role for poliovirus 2A{sup pro} modulating the alternative splicing of pre-mRNAs. Expression of 2A{sup pro} potently inhibits splicing of reporter genes in HeLa cells. Low amounts of 2A{sup pro} abrogate Fas exon 6 skipping, whereas higher levels of protease fully abolish Fas and FGFR2 splicing. In vitro splicing of MINX mRNA using nuclear extracts is also strongly inhibited by 2A{sup pro}, leading to accumulation of the first exon and the lariat product containing the unspliced second exon. These findings reveal that the mechanism of action of 2A{sup pro} on splicing is to selectively block the second catalytic step.
Goldbach, Rob; Krijt, Jette
1982-01-01
The protease encoded by the large (B) RNA segment of cowpea mosaic virus was tested for its ability to recognize the in vitro translation products of the small (M) RNA segment from the comoviruses squash mosaic virus, red clover mottle virus, and cowpea severe mosaic virus (CPsMV, strains Dg and Ark), and from the nepovirus tomato black ring virus. Like M RNA from cowpea mosaic virus, the M RNAs from squash mosaic virus, red clover mottle virus, CPsMV-Dg, and CPsMV-Ark were all translated int...
Are TMEM genes potential candidate genes for panic disorder?
DEFF Research Database (Denmark)
NO, Gregersen; Buttenschøn, Henriette Nørmølle; Hedemand, Anne
2014-01-01
We analysed single nucleotide polymorphisms in two transmembrane genes (TMEM98 and TMEM132E) in panic disorder (PD) patients and control individuals from the Faroe Islands, Denmark and Germany. The genes encode single-pass membrane proteins and are located within chromosome 17q11.2-q12...
The Mitochondrial m-AAA Protease Prevents Demyelination and Hair Greying.
Wang, Shuaiyu; Jacquemyn, Julie; Murru, Sara; Martinelli, Paola; Barth, Esther; Langer, Thomas; Niessen, Carien M; Rugarli, Elena I
2016-12-01
The m-AAA protease preserves proteostasis of the inner mitochondrial membrane. It ensures a functional respiratory chain, by controlling the turnover of respiratory complex subunits and allowing mitochondrial translation, but other functions in mitochondria are conceivable. Mutations in genes encoding subunits of the m-AAA protease have been linked to various neurodegenerative diseases in humans, such as hereditary spastic paraplegia and spinocerebellar ataxia. While essential functions of the m-AAA protease for neuronal survival have been established, its role in adult glial cells remains enigmatic. Here, we show that deletion of the highly expressed subunit AFG3L2 in mature mouse oligodendrocytes provokes early-on mitochondrial fragmentation and swelling, as previously shown in neurons, but causes only late-onset motor defects and myelin abnormalities. In contrast, total ablation of the m-AAA protease, by deleting both Afg3l2 and its paralogue Afg3l1, triggers progressive motor dysfunction and demyelination, owing to rapid oligodendrocyte cell death. Surprisingly, the mice showed premature hair greying, caused by progressive loss of melanoblasts that share a common developmental origin with Schwann cells and are targeted in our experiments. Thus, while both neurons and glial cells are dependant on the m-AAA protease for survival in vivo, complete ablation of the complex is necessary to trigger death of oligodendrocytes, hinting to cell-autonomous thresholds of vulnerability to m-AAA protease deficiency.
Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S
2009-01-01
There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483
Czech Academy of Sciences Publication Activity Database
Dvořák, Jan; Beckmann, S.; Lim, K.-C.; Engel, J. C.; Grevelding, C. G.; McKerrow, J. H.; Caffrey, C. R.
2010-01-01
Roč. 170, č. 1 (2010), s. 37-40 ISSN 0166-6851 Institutional research plan: CEZ:AV0Z60220518 Keywords : Schistosoma * Protease * Transgene * Gene promoter * Biolistics * Electroporation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.875, year: 2010
A deep auto-encoder model for gene expression prediction.
Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua
2017-11-17
Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.
Zhang, Shujian; Chakrabarty, Pranjib K; Fleites, Laura A; Rayside, Patricia A; Hopkins, Donald L; Gabriel, Dean W
2015-01-01
Xylella fastidiosa (X. fastidiosa) infects a wide range of plant hosts and causes economically serious diseases, including Pierce's Disease (PD) of grapevines. X. fastidiosa biocontrol strain EB92-1 was isolated from elderberry and is infectious and persistent in grapevines but causes only very slight symptoms under ideal conditions. The draft genome of EB92-1 revealed that it appeared to be missing genes encoding 10 potential PD pathogenicity effectors found in Temecula1. Subsequent PCR and sequencing analyses confirmed that EB92-1 was missing the following predicted effectors found in Temecula1: two type II secreted enzymes, including a lipase (LipA; PD1703) and a serine protease (PD0956); two identical genes encoding proteins similar to Zonula occludens toxins (Zot; PD0915 and PD0928), and at least one relatively short, hemagglutinin-like protein (PD0986). Leaves of tobacco and citrus inoculated with cell-free, crude protein extracts of E. coli BL21(DE3) overexpressing PD1703 exhibited a hypersensitive response (HR) in less than 24 hours. When cloned into shuttle vector pBBR1MCS-5, PD1703 conferred strong secreted lipase activity to Xanthomonas citri, E. coli and X. fastidiosa EB92-1 in plate assays. EB92-1/PD1703 transformants also showed significantly increased disease symptoms on grapevines, characteristic of PD. Genes predicted to encode PD0928 (Zot) and a PD0986 (hemagglutinin) were also cloned into pBBR1MCS-5 and moved into EB92-1; both transformants also showed significantly increased symptoms on V. vinifera vines, characteristic of PD. Together, these results reveal that PD effectors include at least a lipase, two Zot-like toxins and a possibly redundant hemagglutinin, none of which are necessary for parasitic survival of X. fastidiosa populations in grapevines or elderberry.
Directory of Open Access Journals (Sweden)
Shujian Zhang
Full Text Available Xylella fastidiosa (X. fastidiosa infects a wide range of plant hosts and causes economically serious diseases, including Pierce's Disease (PD of grapevines. X. fastidiosa biocontrol strain EB92-1 was isolated from elderberry and is infectious and persistent in grapevines but causes only very slight symptoms under ideal conditions. The draft genome of EB92-1 revealed that it appeared to be missing genes encoding 10 potential PD pathogenicity effectors found in Temecula1. Subsequent PCR and sequencing analyses confirmed that EB92-1 was missing the following predicted effectors found in Temecula1: two type II secreted enzymes, including a lipase (LipA; PD1703 and a serine protease (PD0956; two identical genes encoding proteins similar to Zonula occludens toxins (Zot; PD0915 and PD0928, and at least one relatively short, hemagglutinin-like protein (PD0986. Leaves of tobacco and citrus inoculated with cell-free, crude protein extracts of E. coli BL21(DE3 overexpressing PD1703 exhibited a hypersensitive response (HR in less than 24 hours. When cloned into shuttle vector pBBR1MCS-5, PD1703 conferred strong secreted lipase activity to Xanthomonas citri, E. coli and X. fastidiosa EB92-1 in plate assays. EB92-1/PD1703 transformants also showed significantly increased disease symptoms on grapevines, characteristic of PD. Genes predicted to encode PD0928 (Zot and a PD0986 (hemagglutinin were also cloned into pBBR1MCS-5 and moved into EB92-1; both transformants also showed significantly increased symptoms on V. vinifera vines, characteristic of PD. Together, these results reveal that PD effectors include at least a lipase, two Zot-like toxins and a possibly redundant hemagglutinin, none of which are necessary for parasitic survival of X. fastidiosa populations in grapevines or elderberry.
Gouran, Hossein; Gillespie, Hyrum; Nascimento, Rafael; Chakraborty, Sandeep; Zaini, Paulo A; Jacobson, Aaron; Phinney, Brett S; Dolan, David; Durbin-Johnson, Blythe P; Antonova, Elena S; Lindow, Steven E; Mellema, Matthew S; Goulart, Luiz R; Dandekar, Abhaya M
2016-08-05
Pierce's disease (PD) is a deadly disease of grapevines caused by the Gram-negative bacterium Xylella fastidiosa. Though disease symptoms were formerly attributed to bacteria blocking the plant xylem, this hypothesis is at best overly simplistic. Recently, we used a proteomic approach to characterize the secretome of X. fastidiosa, both in vitro and in planta, and identified LesA as one of the pathogenicity factors of X. fastidiosa in grapevines that leads to leaf scorching and chlorosis. Herein, we characterize another such factor encoded by PD0956, designated as an antivirulence secreted protease "PrtA" that displays a central role in controlling in vitro cell proliferation, length, motility, biofilm formation, and in planta virulence. The mutant in X. fastidiosa exhibited reduced cell length, hypermotility (and subsequent lack of biofilm formation) and hypervirulence in grapevines. These findings are supported by transcriptomic and proteomic analyses with corresponding plant infection data. Of particular interest, is the hypervirulent response in grapevines observed when X. fastidiosa is disrupted for production of PrtA, and that PD-model tobacco plants transformed to express PrtA exhibited decreased symptoms after infection by X. fastidiosa.
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
Zhang, Dianpeng; Spadaro, Davide; Valente, Silvia; Garibaldi, Angelo; Gullino, Maria Lodovica
2012-02-15
An alkaline protease gene was amplified from genomic DNA and cDNA of the antagonistic yeast-like fungus Aureobasidium pullulans PL5, a biocontrol agent effective against Monilinia laxa on stone fruit and Botrytis cinerea and Penicillium expansum on pome fruits. An open reading frame of 1248 bp encoding a 415-amino acid (aa) protein with a calculated molecular weight (M(r)) of 42.9 kDa and an isoelectric point (pI) of 4.5 was characterized. The cDNAALP5 gene had an 18-amino acid signal peptide, one N-gylcosylation, one histidine active site, and one serine active site. The ALP5 gene with a M(r) of 1351 bp contained two introns. One intron was of 54 bp, while the other was of 50 bp. Protein BLAST and phylogenetic tree analysis of the deduced amino sequences from the cDNAALP5 gene showed that the encoded protein had 100% homology to a protease enzyme (ALP2) of a sea strain of A. pullulans, suggesting that the protein ALP5 was an alkaline serine protease. Expression of ALP5 in Escherichia coli BL21 (DE3), followed by identification with Western-blotting, purification with Ni-NTA and analysis of enzymatic activity, yielded an homogeneous recombinant ALP5 which hydrolysed the substrate casein and inhibited the mycelial growth of the pathogens. At its optimal pH of 10.0 and reaction temperature of 50°C, the recombinant protease exhibited the highest activity towards the substrate casein, though the highest stability was at lower temperatures and pH between 7.0 and 9.0. This study provided the direct evidence that extracellular proteases secreted by the antagonist A. pullulans PL5 played a role in the biocontrol activities against some postharvest pathogens of apple and peach. Copyright © 2011 Elsevier B.V. All rights reserved.
Sharma, Ranu; Suresh, C G
2015-01-01
Proteases are a family of enzymes present in almost all living organisms. In plants they are involved in many biological processes requiring stress response in situations such as water deficiency, pathogen attack, maintaining protein content of the cell, programmed cell death, senescence, reproduction and many more. Similarly, protease inhibitors (PIs) are involved in various important functions like suppression of invasion by pathogenic nematodes, inhibition of spores-germination and mycelium growth of Alternaria alternata and response to wounding and fungal attack. As much as we know, no genome-wide study of proteases together with proteinaceous PIs is reported in any of the sequenced genomes till now. Phylogenetic studies and domain analysis of proteases were carried out to understand the molecular evolution as well as gene and protein features. Structural analysis was carried out to explore the binding mode and affinity of PIs for cognate proteases and prolyl oligopeptidase protease with inhibitor ligand. In the study reported here, a significant number of proteases and PIs were identified in chickpea genome. The gene expression profiles of proteases and PIs in five different plant tissues revealed a differential expression pattern in more than one plant tissue. Molecular dynamics studies revealed the formation of stable complex owing to increased number of protein-ligand and inter and intramolecular protein-protein hydrogen bonds. The genome-wide identification, characterization, evolutionary understanding, gene expression, and structural analysis of proteases and PIs provide a framework for future analysis when defining their roles in stress response and developing a more stress tolerant variety of chickpea. Copyright © 2014 Elsevier Ltd. All rights reserved.
Gene array analysis of PD-1H overexpressing monocytes reveals a pro-inflammatory profile
Directory of Open Access Journals (Sweden)
Preeti Bharaj
2018-02-01
Full Text Available We have previously reported that overexpression of Programmed Death -1 Homolog (PD-1H in human monocytes leads to activation and spontaneous secretion of multiple pro inflammatory cytokines. Here we evaluate changes in monocytes gene expression after enforced PD-1H expression by gene array. The results show that there are significant alterations in 51 potential candidate genes that relate to immune response, cell adhesion and metabolism. Genes corresponding to pro-inflammatory cytokines showed the highest upregulation, 7, 3.2, 3.0, 5.8, 4.4 and 3.1 fold upregulation of TNF-α, IL-1 β, IFN-α, γ, λ and IL-27 relative to vector control. The data are in agreement with cytometric bead array analysis showing induction of proinflammatory cytokines, IL-6, IL-1β and TNF-α by PD-1H. Other genes related to inflammation, include transglutaminase 2 (TG2, NF-κB (p65 and p50 and toll like receptors (TLR 3 and 4 were upregulated 5, 4.5 and 2.5 fold, respectively. Gene set enrichment analysis (GSEA also revealed that signaling pathways related to inflammatory response, such as NFκB, AT1R, PYK2, MAPK, RELA, TNFR1, MTOR and proteasomal degradation, were significantly upregulated in response to PD-1H overexpression. We validated the results utilizing a standard inflammatory sepsis model in humanized BLT mice, finding that PD-1H expression was highly correlated with proinflammatory cytokine production. We therefore conclude that PD-1H functions to enhance monocyte activation and the induction of a pro-inflammatory gene expression profile.
Cusick, John K; Hager, Elizabeth; Gill, Ronald E
2015-01-01
The BsgA protease is required for the earliest morphological changes observed in Myxococcus xanthus development. We hypothesize that the BsgA protease is required to cleave an inhibitor of the developmental program, and isolation of genetic bypass suppressors of a bsgA mutant was used to identify signaling components controlling development downstream of the BsgA protease. Strain M955 was created by transposon mutagenesis of a bsgA mutant followed by screening for strains that could develop despite the absence of the BsgA protease. Strain M955 was able to aggregate, form fruiting bodies, and partially restored the production of viable spores in comparison to the parental bsgA mutant. The bsgA Tn5Ω955 strain partially restored developmental expression to a subset of genes normally induced during development, and expressed one developmentally induced fusion at higher amounts during vegetative growth in comparison to wild-type cells. The transposon in strain M955 was localized to a Ribonuclease D homolog that appears to exist in an operon with a downstream aminopeptidase-encoding gene. The identification of a third distinct bypass suppressor of the BsgA protease suggests that the BsgA protease may regulate a potentially complex pathway during the initiation of the M. xanthus developmental program. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Insecticide resistance and intracellular proteases.
Wilkins, Richard M
2017-12-01
Pesticide resistance is an example of evolution in action with mechanisms of resistance arising from mutations or increased expression of intrinsic genes. Intracellular proteases have a key role in maintaining healthy cells and in responding to stressors such as pesticides. Insecticide-resistant insects have constitutively elevated intracellular protease activity compared to corresponding susceptible strains. This increase was shown for some cases originally through biochemical enzyme studies and subsequently putatively by transcriptomics and proteomics methods. Upregulation and expression of proteases have been characterised in resistant strains of some insect species, including mosquitoes. This increase in proteolysis results in more degradation products (amino acids) of intracellular proteins. These may be utilised in the resistant strain to better protect the cell from stress. There are changes in insect intracellular proteases shortly after insecticide exposure, suggesting a role in stress response. The use of protease and proteasome inhibitors or peptide mimetics as synergists with improved application techniques and through protease gene knockdown using RNA interference (possibly expressed in crop plants) may be potential pest management strategies, in situations where elevated intracellular proteases are relevant. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Řičicová Markéta
2010-04-01
Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression
Wang, S Y; Gudas, L J
1990-09-15
We have previously isolated several cDNA clones specific for mRNA species that increase in abundance during the retinoic acid-associated differentiation of F9 teratocarcinoma stem cells. One of these mRNAs, J6, encodes a approximately 40 kDa protein as assayed by hybrid selection and in vitro translation (Wang, S.-Y., LaRosa, G., and Gudas, L. J. (1985) Dev. Biol. 107, 75-86). The time course of J6 mRNA expression is similar to those of both laminin B1 and collagen IV (alpha 1) messages following retinoic acid addition. To address the functional role of this protein, we have isolated a full-length cDNA clone complementary to this approximately 40-kDa protein mRNA. Sequence analysis reveals an open reading frame of 406 amino acids (Mr 45,652). The carboxyl-terminal portion of this predicted protein contains a region that is homologous to the reactive sites found among members of the serpin (serine protease inhibitor) family. The predicted reactive site (P1-P1') of this J6 protein is Arg-Ser, which is the same as that of antithrombin III. Like ovalbumin and human monocyte-derived plasminogen activator inhibitor (mPAI-2), which are members of the serpin gene family, the J6 protein appears to have no typical amino-terminal signal sequence.
Polarization Monitoring of the Lens System JVAS B0218+357
Directory of Open Access Journals (Sweden)
Andrew Biggs
2017-10-01
Full Text Available Monitoring of the lens system JVAS B0218+357 with the Fermi Gamma-ray Space Telescope measured a different time delay to that derived from radio observations. We have re-analysed three months of archival Very Large Array data to produce variability curves with an average sampling of one epoch per day in total flux, polarized flux and polarization position angle (PPA at 15, 8.4 and 5 GHz. The variability is particularly strong in polarized flux. Dense sampling and improved subtraction of the Einstein ring has allowed us to produce superior variability curves and a preliminary analysis has resulted in a time delay (11.5 days which agrees well with the γ -ray value. Both images of 0218+357 are subject to strong Faraday rotation and depolarization as a result of the radio waves passing through the interstellar medium of the spiral lens galaxy. Our data reveal frequency-dependent variations in the PPA that are different in each image and which must therefore result from variable Faraday rotation in the lens galaxy on timescales of a few days. Our analysis has revealed systematic errors in the polarization position angle measurements that strongly correlate with hour angle. Although we have been able to correct for these, we caution that all VLA polarization observations are potentially affected.
Genome-wide identification of structural variants in genes encoding drug targets
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
Iwata, Yuji; Ashida, Makoto; Hasegawa, Chisa; Tabara, Kazuki; Mishiba, Kei-Ichiro; Koizumi, Nozomu
2017-08-01
The unfolded protein response (UPR) is a homeostatic cellular response conserved in eukaryotic cells to alleviate the accumulation of unfolded proteins in the endoplasmic reticulum (ER). Arabidopsis bZIP28 is a membrane-bound transcription factor activated by proteolytic cleavage in response to ER stress, thereby releasing its cytosolic portion containing the bZIP domain from the membrane to translocate into the nucleus where it induces the transcription of genes encoding ER-resident molecular chaperones and folding enzymes. It has been widely recognized that the proteolytic activation of bZIP28 is mediated by the sequential cleavage of site-1 protease (S1P) and site-2 protease (S2P). In the present study we provide evidence that bZIP28 protein is cleaved by S2P, but not by S1P. We demonstrated that wild-type and s1p mutant plants produce the active, nuclear form of bZIP28 in response to the ER stress inducer tunicamycin. In contrast, tunicamycin-treated s2p mutants do not accumulate the active, nuclear form of bZIP28. Consistent with these observations, s2p mutants, but not s1p mutants, exhibited a defective transcriptional response of ER stress-responsive genes and significantly higher sensitivity to tunicamycin. Interestingly, s2p mutants accumulate two membrane-bound bZIP28 fragments with a shorter ER lumen-facing C-terminal domain. Importantly, the predicted cleavage sites are located far from the canonical S1P recognition motif previously described. We propose that ER stress-induced proteolytic activation of bZIP28 is mediated by the sequential actions of as-yet-unidentified protease(s) and S2P, and does not require S1P. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Chen Chaoping
2010-07-01
Full Text Available Abstract Background HIV protease (PR is a virus-encoded aspartic protease that is essential for viral replication and infectivity. The fully active and mature dimeric protease is released from the Gag-Pol polyprotein as a result of precursor autoprocessing. Results We here describe a simple model system to directly examine HIV protease autoprocessing in transfected mammalian cells. A fusion precursor was engineered encoding GST fused to a well-characterized miniprecursor, consisting of the mature protease along with its upstream transframe region (TFR, and small peptide epitopes to facilitate detection of the precursor substrate and autoprocessing products. In HEK 293T cells, the resulting chimeric precursor undergoes effective autoprocessing, producing mature protease that is rapidly degraded likely via autoproteolysis. The known protease inhibitors Darunavir and Indinavir suppressed both precursor autoprocessing and autoproteolysis in a dose-dependent manner. Protease mutations that inhibit Gag processing as characterized using proviruses also reduced autoprocessing efficiency when they were introduced to the fusion precursor. Interestingly, autoprocessing of the fusion precursor requires neither the full proteolytic activity nor the majority of the N-terminal TFR region. Conclusions We suggest that the fusion precursors provide a useful system to study protease autoprocessing in mammalian cells, and may be further developed for screening of new drugs targeting HIV protease autoprocessing.
Energy Technology Data Exchange (ETDEWEB)
Kocab, S.; Erdem, B. [Middle East Technical University, Ankara (Turkey). Dept. of Biological Sciences
2002-08-01
In this study 24 thermoacidophilic archeal and bacterial strains isolated from hot-springs and hot-soils were screened for their ability to produce intracellular alkaline proteases. The protease activities of the strains, based on azocasein hydrolysis, showed a variation from 0.6 to 5.1 U. The cell extracts of three most potent producers were further examined and it was found that their proteases exhibited maximum activity at 60-70{sup o}C and showed a pH optimum over a range of pH 7.0-8.5. Gelatin zymography revealed that two of the selected archeal strains produced multiple active SDS-resistant proteases. On the other hand, PCR amplification of alkaline serine protease gene sequences of total DNA from all isolates yielded four distinct amplification fragments of 650, 450, 400 and 300 bp, which might have been derived from different serine protease genes. (author)
Cloned Bacillus subtilis alkaline protease (aprA) gene showing high level of keratinolytic activity.
Zaghloul, T I
1998-01-01
The Bacillus subtilis alkaline protease(aprA) gene was previously cloned on a pUBHO-derivative plasmid. High levels of expression and gene stability were demonstrated when B. subtilis cells were grown on the laboratory medium 2XSG. B. subtilis cells harboring the multicopy aprA gene were grown on basal medium, supplemented with 1 % chicken feather as a source of energy, carbon, and nitrogen. Proteolytic and keratinolytic activities were monitored throughout the cultivation time. A high level of keratinolytic activity was obtained, and this indicates that alkaline protease is acting as a keratinase. Furthermore, considerable amounts of soluble proteins and free amino acids were obtained as a result of the enzymatic hydrolysis of feather. Biodegradation of feather waste using these cells represents an alternative way to improve the nutritional value of feather, since feather waste is currently utilized on a limited basis as a dietary protein supplement for animal feedstuffs. Moreover, the release of free amino acids from feather and the secreted keratinase enzyme would promote industries based on feather waste.
MBL-associated serine proteases (MASPs) and infectious diseases.
Beltrame, Marcia H; Boldt, Angelica B W; Catarino, Sandra J; Mendes, Hellen C; Boschmann, Stefanie E; Goeldner, Isabela; Messias-Reason, Iara
2015-09-01
The lectin pathway of the complement system has a pivotal role in the defense against infectious organisms. After binding of mannan-binding lectin (MBL), ficolins or collectin 11 to carbohydrates or acetylated residues on pathogen surfaces, dimers of MBL-associated serine proteases 1 and 2 (MASP-1 and MASP-2) activate a proteolytic cascade, which culminates in the formation of the membrane attack complex and pathogen lysis. Alternative splicing of the pre-mRNA encoding MASP-1 results in two other products, MASP-3 and MAp44, which regulate activation of the cascade. A similar mechanism allows the gene encoding MASP-2 to produce the truncated MAp19 protein. Polymorphisms in MASP1 and MASP2 genes are associated with protein serum levels and functional activity. Since the first report of a MASP deficiency in 2003, deficiencies in lectin pathway proteins have been associated with recurrent infections and several polymorphisms were associated with the susceptibility or protection to infectious diseases. In this review, we summarize the findings on the role of MASP polymorphisms and serum levels in bacterial, viral and protozoan infectious diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
Directory of Open Access Journals (Sweden)
Pieper Rembert
2011-05-01
Full Text Available Abstract Background Uncharacterized proteases naturally expressed by bacterial pathogens represents important topic in infectious disease research, because these enzymes may have critical roles in pathogenicity and cell physiology. It has been observed that cloning, expression and purification of proteases often fail due to their catalytic functions which, in turn, cause toxicity in the E. coli heterologous host. Results In order to address this problem systematically, a modified pipeline of our high-throughput protein expression and purification platform was developed. This included the use of a specific E. coli strain, BL21(DE3 pLysS to tightly control the expression of recombinant proteins and various expression vectors encoding fusion proteins to enhance recombinant protein solubility. Proteases fused to large fusion protein domains, maltosebinding protein (MBP, SP-MBP which contains signal peptide at the N-terminus of MBP, disulfide oxidoreductase (DsbA and Glutathione S-transferase (GST improved expression and solubility of proteases. Overall, 86.1% of selected protease genes including hypothetical proteins were expressed and purified using a combination of five different expression vectors. To detect novel proteolytic activities, zymography and fluorescence-based assays were performed and the protease activities of more than 46% of purified proteases and 40% of hypothetical proteins that were predicted to be proteases were confirmed. Conclusions Multiple expression vectors, employing distinct fusion tags in a high throughput pipeline increased overall success rates in expression, solubility and purification of proteases. The combinatorial functional analysis of the purified proteases using fluorescence assays and zymography confirmed their function.
A novel nonsense mutation in cathepsin C gene in an Egyptian ...
African Journals Online (AJOL)
Background: Cathepsin C gene (CTSC) (MIM#602365) is a lysosomal cysteine proteinase coding gene which encodes for CTSC protein that plays a major role in the activation of granule serine proteases, particularly leukocyte elastase and granzymes A and B. This activity was proposed to play a role in epithelial ...
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
Gene-Environment Interaction in Parkinson's Disease
DEFF Research Database (Denmark)
Chuang, Yu-Hsuan; Lill, Christina M; Lee, Pei-Chen
2016-01-01
BACKGROUND AND PURPOSE: Drinking caffeinated coffee has been reported to provide protection against Parkinson's disease (PD). Caffeine is an adenosine A2A receptor (encoded by the gene ADORA2A) antagonist that increases dopaminergic neurotransmission and Cytochrome P450 1A2 (gene: CYP1A2...
Vecerek, B; Venema, G
The expression of the neutral protease gene (npr) from the thermophilic Bacillus sp. BT1 strain was studied in its natural host and in mesophilic Bacillus subtilis. In the thermophilic BT1 strain, the transcription of the protease gene is initiated from its own promoter, just 5' to the gene. In
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
Shaheen, Ranad; Al Tala, Saeed; Almoisheer, Agaadir; Alkuraya, Fowzan S
2014-12-01
Primordial dwarfism (PD) is a heterogeneous clinical entity characterised by severe prenatal and postnatal growth deficiency. Despite the recent wave of disease gene discovery, the causal mutations in many PD patients remain unknown. To describe a PD family that maps to a novel locus. Clinical, imaging and laboratory phenotyping of a new family with PD followed by autozygosity mapping, linkage analysis and candidate gene sequencing. We describe a multiplex consanguineous Saudi family in which two full siblings and one half-sibling presented with classical features of Seckel syndrome in addition to optic nerve hypoplasia. We were able to map the phenotype to a single novel locus on 4q25-q28.2, in which we identified a five base-pair deletion in PLK4, which encodes a master regulator of centriole duplication. Our discovery further confirms the role of genes involved in centriole biology in the pathogenesis of PD. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
A family of related proteins is encoded by the major Drosophila heat shock gene family
International Nuclear Information System (INIS)
Wadsworth, S.C.
1982-01-01
At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Tanaka, T; Kawata, M
1988-08-01
We have isolated a DNA fragment from Bacillus subtilis 168 which, when present in a high-copy plasmid, inhibited production of extracellular alkaline and neutral proteases. The gene responsible for this activity was referred to as iep. The open reading frame of iep was found to be incomplete in the cloned DNA fragment. When the intact iep gene was reconstructed after the missing part of the iep gene had been cloned, it showed an enhancing effect on the production of the extracellular proteases. The open reading frame encodes a polypeptide of 229 amino acids with a molecular weight of ca. 25,866. Deletion of two amino acids from the N-terminal half of the putative iep protein resulted in dual effects, i.e., a decrease in the inhibitory activity shown by the incomplete iep gene and a slight increase in the enhancing activity shown by the complete iep gene. These results show that the iep gene product is a bifunctional protein, containing inhibitory and enhancing activities for the exoprotease production in the N-terminal and C-terminal regions, respectively. It was found by genetic and functional analyses that iep lies very close to sacU.
Cloning of a novel gene, Cymg1, related to family 2 cystatins and ...
Indian Academy of Sciences (India)
We have cloned a novel gene, Cymg1 (GenBank accession number AY600990), from a mouse testis cDNA library. Cymg1 is located in 2G3 of mouse chromosome 2. The cDNA includes an open reading frame that encodes 141 amino acid residues. The encoded polypeptide has a cysteine protease inhibitor domain found ...
Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.
Directory of Open Access Journals (Sweden)
Sher L Hendrickson
2010-09-01
Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.
Directory of Open Access Journals (Sweden)
Srinivas Akula
Full Text Available Serine proteases are among the most abundant granule constituents of several hematopoietic cell lineages including mast cells, neutrophils, cytotoxic T cells and NK cells. These proteases are stored in their active form in the cytoplasmic granules and in mammals are encoded from four different chromosomal loci: the chymase locus, the met-ase locus, the T cell tryptase and the mast cell tryptase locus. In order to study their appearance during vertebrate evolution we have performed a bioinformatic analysis of related genes and gene loci from a large panel of metazoan animals from sea urchins to placental mammals for three of these loci: the chymase, met-ase and granzyme A/K loci. Genes related to mammalian granzymes A and K were the most well conserved and could be traced as far back to cartilaginous fish. Here, the granzyme A and K genes were found in essentially the same chromosomal location from sharks to humans. However in sharks, no genes clearly identifiable as members of the chymase or met-ase loci were found. A selection of these genes seemed to appear with bony fish, but sometimes in other loci. Genes related to mammalian met-ase locus genes were found in bony fish. Here, the most well conserved member was complement factor D. However, genes distantly related to the neutrophil proteases were also identified in this locus in several bony fish species, indicating that this locus is also old and appeared at the base of bony fish. In fish, a few of the chymase locus-related genes were found in a locus with bordering genes other than the mammalian chymase locus and some were found in the fish met-ase locus. This indicates that a convergent evolution rather than divergent evolution has resulted in chymase locus-related genes in bony fish.
DEFF Research Database (Denmark)
Durkin, M E; Wewer, U M; Chung, A E
1995-01-01
of the mouse entactin gene closely corresponds to the organization of the polypeptide into distinct structural and functional domains. The two amino-terminal globular domains are encoded by three exons each. Single exons encode the two protease-sensitive, O-glycosylated linking regions. The six EGF......Entactin is a widespread basement membrane protein of 150 kDa that binds to type IV collagen and laminin. The complete exon-intron structure of the mouse entactin gene has been determined from lambda genomic DNA clones. The gene spans at least 65 kb and contains 20 exons. The exon organization...
Ghidoni, Roberta; Flocco, Rosa; Paterlini, Anna; Glionna, Michela; Caruana, Loredana; Tonoli, Elisa; Binetti, Giuliano; Benussi, Luisa
2014-01-01
The discovery that mutations in the gene encoding for progranulin (GRN) cause frontotemporal lobar degeneration (FTLD) and other neurodegenerative diseases leading to dementia has brought renewed interest in progranulin and its functions in the central nervous system. Full length progranulin is preserved from cleavage by secretory leukocyte protease inhibitor (SLPI), one of the smallest serine protease inhibitor circulating in plasma. Herein, we investigated the relationship between circulating SLPI and progranulin in affected and unaffected subjects belonging to 26 Italian pedigrees carrying GRN null mutations. In GRN null mutation carriers, we demonstrated: i) an increase of circulating SLPI levels in affected subjects; ii) an age-related upregulation of the serine-protease inhibitor in response to lifetime progranulin shortage; and iii) a delay in the age of onset in subjects with the highest SLPI protein levels. The study of SLPI and its relation to progranulin suggests the existence of unexpected molecular players in progranulin-associated neurodegeneration.
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
Senthilkumar, Rajendran; Cheng, Chiu-Ping; Yeh, Kai-Wun
2010-01-01
Protease inhibitors provide a promising means of engineering plant resistance against attack by insects and pathogens. Sporamin (trypsin inhibitor) from sweet potato and CeCPI (phytocystatin) from taro were stacked in a binary vector, using pMSPOA (a modified sporamin promoter) to drive both genes. Transgenic tobacco lines of T0 and T1 generation with varied inhibitory activity against trypsin and papain showed resistance to both insects and phytopathogens. Larvae of Helicoverpa armigera that ingested tobacco leaves either died or showed delayed growth and development relative to control larvae. Transgenic tobacco-overexpressing the stacked genes also exhibited strong resistance against bacterial soft rot disease caused by Erwinia carotovora and damping-off disease caused by Pythium aphanidermatum. Thus, stacking protease-inhibitor genes, driven by the wound and pathogen responsive pMSPOA promoter, is an effective strategy for engineering crops to resistance against insects and phytopathogens.
Zhang, Q; Baldwin, V J; Acland, G M; Parshall, C J; Haskel, J; Aguirre, G D; Ray, K
1999-01-01
Photoreceptor dysplasia (pd) is one of a group of at least six distinct autosomal and one X-linked retinal disorders identified in dogs which are collectively known as progressive retinal atrophy (PRA). It is an early onset retinal disease identified in miniature schnauzer dogs, and pedigree analysis and breeding studies have established autosomal recessive inheritance of the disease. Using a gene-based approach, a number of retina-expressed genes, including some members of the phototransduction pathway, have been causally implicated in retinal diseases of humans and other animals. Here we examined seven such potential candidate genes (opsin, RDS/peripherin, ROM1, rod cGMP-gated cation channel alpha-subunit, and three subunits of transducin) for their causal association with the pd locus by testing segregation of intragenic markers with the disease locus, or, in the absence of informative polymorphisms, sequencing of the coding regions of the genes. Based on these results, we have conclusively excluded four photoreceptor-specific genes as candidates for pd by linkage analysis. For three other photoreceptor-specific genes, we did not find any mutation in the coding sequences of the genes and have excluded them provisionally. Formal exclusion would require investigation of the levels of expression of the candidate genes in pd-affected dogs relative to age-matched controls. At present we are building suitable informative pedigrees for the disease locus with a sufficient number of meiosis to be useful for genomewide screening. This should identify markers linked to the disease locus and eventually permit progress toward the identification of the photoreceptor dysplasia gene and the disease-causing mutation.
A highly divergent gene cluster in honey bees encodes a novel silk family.
Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S
2006-11-01
The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.
PROTEOLYTIC PROCESSING OF VON WILLEBRAND FACTOR BY ADAMTS13 AND LEUKOCYTE PROTEASES
Directory of Open Access Journals (Sweden)
Stefano Lancellotti
2013-09-01
Full Text Available ADAMTS13 is a 190 kDa zinc protease encoded by a gene located on chromosome 9q34. This protease specifically hydrolyzes von Willebrand factor (VWF multimers, thus causing VWF size reduction. ADAMTS13 belongs to the A Disintegrin And Metalloprotease with ThromboSpondin type 1 repeats (ADAMTS family, involved in proteolytic processing of many matrix proteins. ADAMTS13 consists of numerous domains including a metalloprotease domain, a disintegrin domain, several thrombospondin type 1 (TSP1 repeats, a cysteine-rich domain, a spacer domain and 2 CUB (Complement c1r/c1s, sea Urchin epidermal growth factor, and Bone morphogenetic protein domains. ADAMTS13 cleaves a single peptide bond (Tyr1605-Met1606 in the central A2 domain of the VWF molecule. This proteolytic cleavage is essential to reduce the size of ultra-large VWF polymers, which, when exposed to high shear stress in the microcirculation, are prone to form with platelets clumps, which cause severe syndromes called thrombotic microangiopathies (TMAs. In this review, we a discuss the current knowledge of structure-function aspects of ADAMTS13 and its involvement in the pathogenesis of TMAs, b address the recent findings concerning proteolytic processing of VWF multimers by different proteases, such as the leukocyte-derived serine and metallo-proteases and c indicate the direction of future investigations
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
Saidak, Zuzana; Morisse, Mony Chenda; Chatelain, Denis; Sauzay, Chloé; Houessinon, Aline; Guilain, Nelly; Soyez, Marion; Chauffert, Bruno; Dakpé, Stéphanie; Galmiche, Antoine
2018-03-01
The squamous cell carcinoma antigen (SCCA), encoded by the genes SERPINB3/B4, is a tumour marker produced by head and neck squamous cell carcinoma (HNSCC). We aimed to examine SERPINB3/B4 mRNA levels and its clinical significance in the therapeutic context. We retrieved mRNA expression levels, clinical, pathological and genomic data for 520 HNSCC from The Cancer Genome Atlas (TCGA). HNSCC tumours express high levels of SERPINB3/B4 mRNA. SERPINB3 expression differs depending on Human papillomavirus (HPV) infection status, primary tumour location, grade and differentiation, extension to lymph nodes and extracapsular spread. Interestingly, we observed an association between SERPINB3/B4 and the presence of tumour immune infiltrate as well as the expression of the immune checkpoint regulators PD-L1/PD-L2 that depended on HPV status. Our findings point to potential interest of SERPINB3/B4 for the stratification of HNSCC patients in the therapeutic context. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Biesebeke, R. te; Biezen, N. van; Vos, W.M. de; Hondel, C.A.M.J.J. van den; Punt, P.J.
2005-01-01
Solid-state fermentation (SSF) with Aspergillus oryzae results in high levels of secreted protein. However, control mechanisms of gene expression in SSF have been only poorly studied. In this study we show that both glucoamylase (glaB) and protease (alpA, nptB) genes are highly expressed during
Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert
2015-05-01
Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.
Effects of deoxycycline induced lentivirus encoding FasL gene on ...
African Journals Online (AJOL)
Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...
Greco, Valentina; De Marco, Elvira Valeria; Rocca, Francesca Emanuela; Annesi, Ferdinanda; Civitelli, Donatella; Provenzano, Giovanni; Tarantino, Patrizia; Scornaienchi, Vittorio; Pucci, Franco; Salsone, Maria; Novellino, Fabiana; Morelli, Maurizio; Paglionico, Sandra; Gambardella, Antonio; Quattrone, Aldo; Annesi, Grazia
2011-06-01
Iron overload may lead to neurodegenerative disorders such as Parkinson's disease (PD) and alterations of iron-related genes might be involved in the pathogenesis of this disease. The gene of haemochromatosis (HFE) encodes the HFE protein which interacts with the transferrin receptor (TFR), lowering its affinity for iron-bound transferrin (TF). We examined four known polymorphisms, C282Y and H63D in the HFE gene, G258S in the TF gene and S82G in the TFR gene, in 181 sporadic PD patients and 180 controls from Southern Italy to investigate their possible role in susceptibility to PD. No significant differences were found in genotype and allele frequencies between PD and controls for all the polymorphisms studied, suggesting that these variants do not contribute significantly to the risk of PD.
Multifunctional Mitochondrial AAA Proteases.
Glynn, Steven E
2017-01-01
Mitochondria perform numerous functions necessary for the survival of eukaryotic cells. These activities are coordinated by a diverse complement of proteins encoded in both the nuclear and mitochondrial genomes that must be properly organized and maintained. Misregulation of mitochondrial proteostasis impairs organellar function and can result in the development of severe human diseases. ATP-driven AAA+ proteins play crucial roles in preserving mitochondrial activity by removing and remodeling protein molecules in accordance with the needs of the cell. Two mitochondrial AAA proteases, i-AAA and m-AAA, are anchored to either face of the mitochondrial inner membrane, where they engage and process an array of substrates to impact protein biogenesis, quality control, and the regulation of key metabolic pathways. The functionality of these proteases is extended through multiple substrate-dependent modes of action, including complete degradation, partial processing, or dislocation from the membrane without proteolysis. This review discusses recent advances made toward elucidating the mechanisms of substrate recognition, handling, and degradation that allow these versatile proteases to control diverse activities in this multifunctional organelle.
Kihara, A; Akiyama, Y; Ito, K
1997-05-27
The cII gene product of bacteriophage lambda is unstable and required for the establishment of lysogenization. Its intracellular amount is important for the decision between lytic growth and lysogenization. Two genetic loci of Escherichia coli are crucial for these commitments of infecting lambda genome. One of them, hflA encodes the HflKC membrane protein complex, which has been believed to be a protease degrading the cII protein. However, both its absence and overproduction stabilized cII in vivo and the proposed serine protease-like sequence motif in HflC was dispensable for the lysogenization control. Moreover, the HflKC protein was found to reside on the periplasmic side of the plasma membrane. In contrast, the other host gene, ftsH (hflB) encoding an integral membrane ATPase/protease, is positively required for degradation of cII, since loss of its function stabilized cII and its overexpression accelerated the cII degradation. In vitro, purified FtsH catalyzed ATP-dependent proteolysis of cII and HflKC antagonized the FtsH action. These results, together with our previous finding that FtsH and HflKC form a complex, suggest that FtsH is the cII degrading protease and HflKC is a modulator of the FtsH function. We propose that this transmembrane modulation differentiates the FtsH actions to different substrate proteins such as the membrane-bound SecY protein and the cytosolic cII protein. This study necessitates a revision of the prevailing view about the host control over lambda lysogenic decision.
Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.
Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P
2017-11-23
The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In
Escherichia coli contains a soluble ATP-dependent protease (Ti) distinct from protease La
Energy Technology Data Exchange (ETDEWEB)
Hwang, B.J.; Park, W.J.; Chung, C.H.; Goldberg, A.L.
1987-08-01
The energy requirement for protein breakdown in Escherichia coli has generally been attributed to the ATP-dependence of protease La, the lon gene product. The authors have partially purified another ATP-dependent protease from lon/sup -/ cells that lack protease La (as shown by immunoblotting). This enzyme hydrolyzes (/sup 3/H)methyl-casein to acid-soluble products in the presence of ATP and Mg/sup 2 +/. ATP hydrolysis appears necessary for proteolytic activity. Since this enzyme is inhibited by diisopropyl fluorophosphate, it appears to be a serine protease, but it also contains essential thiol residues. They propose to name this enzyme protease Ti. It differs from protease La in nucleotide specificity, inhibitor sensitivity, and subunit composition. On gel filtration, protease Ti has an apparent molecular weight of 370,000. It can be fractionated by phosphocellulose chromatography or by DEAE chromatography into two components with apparent molecular weights of 260,000 and 140,000. When separated, they do not show preteolytic activity. One of these components, by itself, has ATPase activity and is labile in the absence of ATP. The other contains the diisopropyl fluorophosphate-sensitive proteolytic site. These results and the similar findings of Katayama-Fujimura et al. indicate that E. coli contains two ATP-hydrolyzing proteases, which differ in many biochemical features and probably in their physiological roles.
Escherichia coli contains a soluble ATP-dependent protease (Ti) distinct from protease La
International Nuclear Information System (INIS)
Hwang, B.J.; Park, W.J.; Chung, C.H.; Goldberg, A.L.
1987-01-01
The energy requirement for protein breakdown in Escherichia coli has generally been attributed to the ATP-dependence of protease La, the lon gene product. The authors have partially purified another ATP-dependent protease from lon - cells that lack protease La (as shown by immunoblotting). This enzyme hydrolyzes [ 3 H]methyl-casein to acid-soluble products in the presence of ATP and Mg 2+ . ATP hydrolysis appears necessary for proteolytic activity. Since this enzyme is inhibited by diisopropyl fluorophosphate, it appears to be a serine protease, but it also contains essential thiol residues. They propose to name this enzyme protease Ti. It differs from protease La in nucleotide specificity, inhibitor sensitivity, and subunit composition. On gel filtration, protease Ti has an apparent molecular weight of 370,000. It can be fractionated by phosphocellulose chromatography or by DEAE chromatography into two components with apparent molecular weights of 260,000 and 140,000. When separated, they do not show preteolytic activity. One of these components, by itself, has ATPase activity and is labile in the absence of ATP. The other contains the diisopropyl fluorophosphate-sensitive proteolytic site. These results and the similar findings of Katayama-Fujimura et al. indicate that E. coli contains two ATP-hydrolyzing proteases, which differ in many biochemical features and probably in their physiological roles
Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu
2016-09-01
Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.
Directory of Open Access Journals (Sweden)
Elly Munadziroh
2008-09-01
Full Text Available Background: Secretory leukocyte protease inhibitor (SLPI has been found to facilitate epithelialization, maintain a normal epithelial phenotype, reduce inflammation, secrete growth factors such as IL-4, IL-6, IL-10, EGF, FGF, TGF, HGFand 2-microbulin. SLPI is serine protease inhibitor, which found in secretions such as whole saliva, seminal fluid, cervical mucus, synovial fluid, breast milk, tears, amniotic fluid and amniotic membrane. Impaired healing states are characterized by excessive proteolysis and oftenbacterial infection, leading to the hypothesis that SLPI may have a role in the healing process in oral inflammation and contributes to tissue repair in oral mucosa. The oral wound healing response is impaired in the SLPI sufficient mice since matrix synthesis and collagen deposition delayed. The objective of this research is to isolate and identify the amniotic membrane of Java Race SLPI Gene. Methods: SLPI RNA was isolated from Java Race amniotic membrane and the cDNA was amplified by polymerase chain reaction (PCR. Result: Through sequence analyses, SLPI cDNA was 530 nucleotide in length with a predicted molecular mass about 12 kDa. The nucleotide sequence showed that human SLPI from sample was 98% identical with human SLPI from gene bank. PCR analysis revealed that the mRNA of SLPI was highly expressed in the amniotic membrane from Java Race sample. Conclusion: it is demonstrated that human SLPI are highly conserved in sequence content as compared to the human SLPI from gene.
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
An efficient procedure for the expression and purification of HIV-1 protease from inclusion bodies.
Nguyen, Hong-Loan Thi; Nguyen, Thuy Thi; Vu, Quy Thi; Le, Hang Thi; Pham, Yen; Trinh, Phuong Le; Bui, Thuan Phuong; Phan, Tuan-Nghia
2015-12-01
Several studies have focused on HIV-1 protease for developing drugs for treating AIDS. Recombinant HIV-1 protease is used to screen new drugs from synthetic compounds or natural substances. However, large-scale expression and purification of this enzyme is difficult mainly because of its low expression and solubility. In this study, we constructed 9 recombinant plasmids containing a sequence encoding HIV-1 protease along with different fusion tags and examined the expression of the enzyme from these plasmids. Of the 9 plasmids, pET32a(+) plasmid containing the HIV-1 protease-encoding sequence along with sequences encoding an autocleavage site GTVSFNF at the N-terminus and TEV plus 6× His tag at the C-terminus showed the highest expression of the enzyme and was selected for further analysis. The recombinant protein was isolated from inclusion bodies by using 2 tandem Q- and Ni-Sepharose columns. SDS-PAGE of the obtained HIV-1 protease produced a single band of approximately 13 kDa. The enzyme was recovered efficiently (4 mg protein/L of cell culture) and had high specific activity of 1190 nmol min(-1) mg(-1) at an optimal pH of 4.7 and optimal temperature of 37 °C. This procedure for expressing and purifying HIV-1 protease is now being scaled up to produce the enzyme on a large scale for its application. Copyright © 2015 Elsevier Inc. All rights reserved.
Pöggeler, S
2000-06-01
In order to analyze the involvement of pheromones in cell recognition and mating in a homothallic fungus, two putative pheromone precursor genes, named ppg1 and ppg2, were isolated from a genomic library of Sordaria macrospora. The ppg1 gene is predicted to encode a precursor pheromone that is processed by a Kex2-like protease to yield a pheromone that is structurally similar to the alpha-factor of the yeast Saccharomyces cerevisiae. The ppg2 gene encodes a 24-amino-acid polypeptide that contains a putative farnesylated and carboxy methylated C-terminal cysteine residue. The sequences of the predicted pheromones display strong structural similarity to those encoded by putative pheromones of heterothallic filamentous ascomycetes. Both genes are expressed during the life cycle of S. macrospora. This is the first description of pheromone precursor genes encoded by a homothallic fungus. Southern-hybridization experiments indicated that ppg1 and ppg2 homologues are also present in other homothallic ascomycetes.
Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.
Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu
2017-09-01
Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso
2014-03-05
The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.
1996-01-01
Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Mishra, Ratnesh Chandra; Grover, Anil
2014-11-01
In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling. © 2014 American Society of Plant Biologists. All Rights Reserved.
Chandra and RXTE studies of the X-ray/gamma-ray millisecond pulsar PSR J0218+4232
Kuiper, L.; Hermsen, W.; Stappers, B.W.
2004-01-01
We report on high-resolution spatial and timing observations of the millisecond pulsar PSR J0218+4232 performed with the Chandra X-ray Observatory (CXO) and the Rossi X-ray Timing Explorer (RXTE). With these observations we were able to study: (a) the possible spatial extent at X-ray energies of the
The C-terminal sequence of several human serine proteases encodes host defense functions.
Kasetty, Gopinath; Papareddy, Praveen; Kalle, Martina; Rydengård, Victoria; Walse, Björn; Svensson, Bo; Mörgelin, Matthias; Malmsten, Martin; Schmidtchen, Artur
2011-01-01
Serine proteases of the S1 family have maintained a common structure over an evolutionary span of more than one billion years, and evolved a variety of substrate specificities and diverse biological roles, involving digestion and degradation, blood clotting, fibrinolysis and epithelial homeostasis. We here show that a wide range of C-terminal peptide sequences of serine proteases, particularly from the coagulation and kallikrein systems, share characteristics common with classical antimicrobial peptides of innate immunity. Under physiological conditions, these peptides exert antimicrobial effects as well as immunomodulatory functions by inhibiting macrophage responses to bacterial lipopolysaccharide. In mice, selected peptides are protective against lipopolysaccharide-induced shock. Moreover, these S1-derived host defense peptides exhibit helical structures upon binding to lipopolysaccharide and also permeabilize liposomes. The results uncover new and fundamental aspects on host defense functions of serine proteases present particularly in blood and epithelia, and provide tools for the identification of host defense molecules of therapeutic interest. Copyright © 2011 S. Karger AG, Basel.
O’Keeffe, Triona; Hill, Colin; Ross, R. Paul
1999-01-01
Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the
Tunable protease-activatable virus nanonodes.
Judd, Justin; Ho, Michelle L; Tiwari, Abhinav; Gomez, Eric J; Dempsey, Christopher; Van Vliet, Kim; Igoshin, Oleg A; Silberg, Jonathan J; Agbandje-McKenna, Mavis; Suh, Junghae
2014-05-27
We explored the unique signal integration properties of the self-assembling 60-mer protein capsid of adeno-associated virus (AAV), a clinically proven human gene therapy vector, by engineering proteolytic regulation of virus-receptor interactions such that processing of the capsid by proteases is required for infection. We find the transfer function of our engineered protease-activatable viruses (PAVs), relating the degree of proteolysis (input) to PAV activity (output), is highly nonlinear, likely due to increased polyvalency. By exploiting this dynamic polyvalency, in combination with the self-assembly properties of the virus capsid, we show that mosaic PAVs can be constructed that operate under a digital AND gate regime, where two different protease inputs are required for virus activation. These results show viruses can be engineered as signal-integrating nanoscale nodes whose functional properties are regulated by multiple proteolytic signals with easily tunable and predictable response surfaces, a promising development toward advanced control of gene delivery.
MicroRNA regulation of human protease genes essential for influenza virus replication.
Directory of Open Access Journals (Sweden)
Victoria A Meliopoulos
Full Text Available Influenza A virus causes seasonal epidemics and periodic pandemics threatening the health of millions of people each year. Vaccination is an effective strategy for reducing morbidity and mortality, and in the absence of drug resistance, the efficacy of chemoprophylaxis is comparable to that of vaccines. However, the rapid emergence of drug resistance has emphasized the need for new drug targets. Knowledge of the host cell components required for influenza replication has been an area targeted for disease intervention. In this study, the human protease genes required for influenza virus replication were determined and validated using RNA interference approaches. The genes validated as critical for influenza virus replication were ADAMTS7, CPE, DPP3, MST1, and PRSS12, and pathway analysis showed these genes were in global host cell pathways governing inflammation (NF-κB, cAMP/calcium signaling (CRE/CREB, and apoptosis. Analyses of host microRNAs predicted to govern expression of these genes showed that eight miRNAs regulated gene expression during virus replication. These findings identify unique host genes and microRNAs important for influenza replication providing potential new targets for disease intervention strategies.
MicroRNA regulation of human protease genes essential for influenza virus replication.
Meliopoulos, Victoria A; Andersen, Lauren E; Brooks, Paula; Yan, Xiuzhen; Bakre, Abhijeet; Coleman, J Keegan; Tompkins, S Mark; Tripp, Ralph A
2012-01-01
Influenza A virus causes seasonal epidemics and periodic pandemics threatening the health of millions of people each year. Vaccination is an effective strategy for reducing morbidity and mortality, and in the absence of drug resistance, the efficacy of chemoprophylaxis is comparable to that of vaccines. However, the rapid emergence of drug resistance has emphasized the need for new drug targets. Knowledge of the host cell components required for influenza replication has been an area targeted for disease intervention. In this study, the human protease genes required for influenza virus replication were determined and validated using RNA interference approaches. The genes validated as critical for influenza virus replication were ADAMTS7, CPE, DPP3, MST1, and PRSS12, and pathway analysis showed these genes were in global host cell pathways governing inflammation (NF-κB), cAMP/calcium signaling (CRE/CREB), and apoptosis. Analyses of host microRNAs predicted to govern expression of these genes showed that eight miRNAs regulated gene expression during virus replication. These findings identify unique host genes and microRNAs important for influenza replication providing potential new targets for disease intervention strategies.
Bacteriophage-encoded shiga toxin gene in atypical bacterial host
Directory of Open Access Journals (Sweden)
Casas Veronica
2011-07-01
Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.
Institute of Scientific and Technical Information of China (English)
杜珊珊; 王颖; 张东杰
2015-01-01
To obtain the efficient neutral protease gene,the neutral protease gene(npr)was amplifier from Bacillus amyloliquefaciens by using PCR technology. After the double enzyme by BamHⅠand SalⅠ,the gene was linked with the express vecter PET-28a and transformed into Escherichia coliBL21. The gene expression product of gene engineering bacteria was analyzed by SDS-PAGE electrophoresis. The length of the amplified specific gene sequences was 1 566 bp,and the gene encoded 522 amino acids and contained the complete ORF. The sequence homology of the gene reached 100%,and the protein molecular weight was 57.4 kDa. By IPTG induction,the neutral protease gene was expressed highly in recombinant strain. By changing the IPTG induction factors such as concentration,temperature and induction time,the best induction conditions were additive IPTG 0.8 mmol·L-1,temperature 30℃and induction 4 h,and the highest enzyme activity was 450 U·mL-1.%为了获得高效的中性蛋白酶基因,试验用PCR方法从解淀粉芽孢杆菌中扩增中性蛋白酶基因(npr),通过BamHⅠ、SalⅠ双酶切后,将该基因与表达载体PET-28a连接,同时转入到大肠杆菌BL21中表达,通过SDS-PAGE电泳技术对构建的工程菌的基因表达产物进行分析。获得特异 npr基因序列含1566 bp,编码522个氨基酸,含有完整的ORF,同源性达到100%。蛋白酶的分子量为57.4 kDa。IPTG能诱导中性蛋白酶基因在重组菌进行表达,通过改变IPTG诱导浓度、诱导温度及诱导时间等因素,得出在添加剂IPTG至终浓度为0.8 mmol·L-1,30℃诱导4 h为最佳诱导条件,获得最高酶活为450 U·mL-1。
Directory of Open Access Journals (Sweden)
Mercedes Diaz-Mendoza
2017-09-01
Full Text Available Co-evolutionary processes in plant–pathogen/herbivore systems indicate that protease inhibitors have a particular value in biotic interactions. However, little is known about the defensive role of their targets, the plant proteases. C1A cysteine proteases are the most abundant enzymes responsible for the proteolytic activity during different processes like germination, development and senescence in plants. To identify and characterize C1A cysteine proteases of barley with a potential role in defense, mRNA and protein expression patterns were analyzed in response to biotics stresses. A barley cysteine protease, HvPap-1, previously related to abiotic stresses and grain germination, was particularly induced by flagellin or chitosan elicitation, and biotic stresses such as the phytopathogenic fungus Magnaporthe oryzae or the phytophagous mite Tetranychus urticae. To elucidate the in vivo participation of this enzyme in defense, transformed barley plants overexpressing or silencing HvPap-1 encoding gene were subjected to M. oryzae infection or T. urticae infestation. Whereas overexpressing plants were less susceptible to the fungus than silencing plants, the opposite behavior occurred to the mite. This unexpected result highlights the complexity of the regulatory events leading to the response to a particular biotic stress.
Identification and characterization of a gene encoding a putative ...
Indian Academy of Sciences (India)
2012-10-30
Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...
Guo, Zhong-peng; Zhang, Liang; Ding, Zhong-yang; Wang, Zheng-Xiang; Shi, Gui-Yang
2010-12-01
The yeasts used in fuel ethanol manufacture are unable to metabolize soluble proteins. The PEP4 gene, encoding a vacuolar aspartyl protease in Saccharomyces cerevisiae, was either secretively or cell-surface anchored expressed in industrial ethanol-producing S. cerevisiae. The obtained recombinant strains APA (expressing the protease secretively) and APB (expressing the protease on the cell wall) were studied under ethanol fermentation conditions in feed barley cultures. The effects of expression of the protease on product formation, growth and cell protein content were measured. The biomass yield of the wild-type was clearly lower than that of the recombinant strains (0.578 ± 0.12 g biomass/g glucose for APA and 0.582 ± 0.08 g biomass/g glucose for APB). In addition, nearly 98-99% of the theoretical maximum level of ethanol yield was achieved (relative to the amount of substrate consumed) for the recombinant strains, while limiting the nitrogen source resulted in dissatisfactory fermentation for the wild-type and more than 30 g/l residual sugar was detected at the end of fermentation. In addition, higher growth rate, viability and lower yields of byproducts such as glycerol and pyruvic acid for recombinant strains were observed. Expressing acid protease can be expected to lead to a significant increase in ethanol productivity. Copyright © 2010 John Wiley & Sons, Ltd.
Rare variants analysis of cutaneous malignant melanoma genes in Parkinson's disease.
Lubbe, S J; Escott-Price, V; Brice, A; Gasser, T; Pittman, A M; Bras, J; Hardy, J; Heutink, P; Wood, N M; Singleton, A B; Grosset, D G; Carroll, C B; Law, M H; Demenais, F; Iles, M M; Bishop, D T; Newton-Bishop, J; Williams, N M; Morris, H R
2016-12-01
A shared genetic susceptibility between cutaneous malignant melanoma (CMM) and Parkinson's disease (PD) has been suggested. We investigated this by assessing the contribution of rare variants in genes involved in CMM to PD risk. We studied rare variation across 29 CMM risk genes using high-quality genotype data in 6875 PD cases and 6065 controls and sought to replicate findings using whole-exome sequencing data from a second independent cohort totaling 1255 PD cases and 473 controls. No statistically significant enrichment of rare variants across all genes, per gene, or for any individual variant was detected in either cohort. There were nonsignificant trends toward different carrier frequencies between PD cases and controls, under different inheritance models, in the following CMM risk genes: BAP1, DCC, ERBB4, KIT, MAPK2, MITF, PTEN, and TP53. The very rare TYR p.V275F variant, which is a pathogenic allele for recessive albinism, was more common in PD cases than controls in 3 independent cohorts. Tyrosinase, encoded by TYR, is the rate-limiting enzyme for the production of neuromelanin, and has a role in the production of dopamine. These results suggest a possible role for another gene in the dopamine-biosynthetic pathway in susceptibility to neurodegenerative Parkinsonism, but further studies in larger PD cohorts are needed to accurately determine the role of these genes/variants in disease pathogenesis. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.
Significance of Cuscutain, a cysteine protease from Cuscuta reflexa, in host-parasite interactions.
Bleischwitz, Marc; Albert, Markus; Fuchsbauer, Hans-Lothar; Kaldenhoff, Ralf
2010-10-22
Plant infestation with parasitic weeds like Cuscuta reflexa induces morphological as well as biochemical changes in the host and the parasite. These modifications could be caused by a change in protein or gene activity. Using a comparative macroarray approach Cuscuta genes specifically upregulated at the host attachment site were identified. One of the infestation specific Cuscuta genes encodes a cysteine protease. The protein and its intrinsic inhibitory peptide were heterologously expressed, purified and biochemically characterized. The haustoria specific enzyme was named cuscutain in accordance with similar proteins from other plants, e.g. papaya. The role of cuscutain and its inhibitor during the host parasite interaction was studied by external application of an inhibitor suspension, which induced a significant reduction of successful infection events. The study provides new information about molecular events during the parasitic plant--host interaction. Inhibition of cuscutain cysteine proteinase could provide means for antagonizing parasitic plants.
Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.
Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto
2016-06-28
In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.
Directory of Open Access Journals (Sweden)
Erica Bree Rosenblum
Full Text Available Determining the mechanisms of host-pathogen interaction is critical for understanding and mitigating infectious disease. Mechanisms of fungal pathogenicity are of particular interest given the recent outbreaks of fungal diseases in wildlife populations. Our study focuses on Batrachochytrium dendrobatidis (Bd, the chytrid pathogen responsible for amphibian declines around the world. Previous studies have hypothesized a role for several specific families of secreted proteases as pathogenicity factors in Bd, but the expression of these genes has only been evaluated in laboratory growth conditions. Here we conduct a genome-wide study of Bd gene expression under two different nutrient conditions. We compare Bd gene expression profiles in standard laboratory growth media and in pulverized host tissue (i.e., frog skin. A large proportion of genes in the Bd genome show increased expression when grown in host tissue, indicating the importance of studying pathogens on host substrate. A number of gene classes show particularly high levels of expression in host tissue, including three families of secreted proteases (metallo-, serine- and aspartyl-proteases, adhesion genes, lipase-3 encoding genes, and a group of phylogenetically unusual crinkler-like effectors. We discuss the roles of these different genes as putative pathogenicity factors and discuss what they can teach us about Bd's metabolic targets, host invasion, and pathogenesis.
DEFF Research Database (Denmark)
Makarova, Olga; MacLean, Allyson M.; Nicolaisen, Mogens
2015-01-01
a role in host adaptation. 74 genes were up-regulated in insects and included genes involved in stress response, phospholipid synthesis, malate and pyruvate metabolism, hemolysin and transporter genes, multiple copies of thymidylate kinase, sigma factor and Zn-proteases genes. In plants, 34 genes...... encoding an immune dominant membrane protein, membrane-associated proteins, and multidrug resistance ABC-type transporters, were up-regulated. Differential regulation of gene expression thus appears to play an important role in host adaptation of phytoplasmas....
Energy Technology Data Exchange (ETDEWEB)
Eisenmesser, Elan Z.; Capodagli, Glenn; Armstrong, Geoffrey S.; Holliday, Michael; Isern, Nancy G.; Zhang, Fengli; Pegan, Scott D.
2015-05-01
Crimean-Congo Hemorrhagic fever virus (CCHFV) is one of several lethal viruses that encodes for a viral ovarian tumor domain (vOTU), which serves to cleave and remove multiple proteins involved in cellular signaling such as ubiquitin (Ub) and interferon stimulated gene produce 15 (ISG15). Such manipulation of the host cell machinery serves to downregulate the host response and, therefore, complete characterization of these proteases is important. While several structures of the CCHFV vOTU protease have been solved, both free and bound to Ub and ISG15, few structural differences have been found and little insight has been gained as to the dynamic plasticity of this protease. Therefore, we have used NMR relaxation experiments to probe the dynamics of CCHV vOTU, both alone and in complex with Ub, thereby discovering a highly dynamic protease that exhibits conformational exchange within the same regions found to engage its Ub substrate. These experiments reveal a structural plasticity around the N-terminal regions of CCHV vOTU, which are unique to vOTUs, and provide a rationale for engaging multiple substrates with the same binding site.
Uncoupling of Protease trans-Cleavage and Helicase Activities in Pestivirus NS3.
Zheng, Fengwei; Lu, Guoliang; Li, Ling; Gong, Peng; Pan, Zishu
2017-11-01
The nonstructural protein NS3 from the Flaviviridae family is a multifunctional protein that contains an N-terminal protease and a C-terminal helicase, playing essential roles in viral polyprotein processing and genome replication. Here we report a full-length crystal structure of the classical swine fever virus (CSFV) NS3 in complex with its NS4A protease cofactor segment (PCS) at a 2.35-Å resolution. The structure reveals a previously unidentified ∼2,200-Å 2 intramolecular protease-helicase interface comprising three clusters of interactions, representing a "closed" global conformation related to the NS3-NS4A cis -cleavage event. Although this conformation is incompatible with protease trans -cleavage, it appears to be functionally important and beneficial to the helicase activity, as the mutations designed to perturb this conformation impaired both the helicase activities in vitro and virus production in vivo Our work reveals important features of protease-helicase coordination in pestivirus NS3 and provides a key basis for how different conformational states may explicitly contribute to certain functions of this natural protease-helicase fusion protein. IMPORTANCE Many RNA viruses encode helicases to aid their RNA genome replication and transcription by unwinding structured RNA. Being naturally fused to a protease participating in viral polyprotein processing, the NS3 helicases encoded by the Flaviviridae family viruses are unique. Therefore, how these two enzyme modules coordinate in a single polypeptide is of particular interest. Here we report a previously unidentified conformation of pestivirus NS3 in complex with its NS4A protease cofactor segment (PCS). This conformational state is related to the protease cis -cleavage event and is optimal for the function of helicase. This work provides an important basis to understand how different enzymatic activities of NS3 may be achieved by the coordination between the protease and helicase through different
Transcriptional modulation of genes encoding nitrate reductase in ...
African Journals Online (AJOL)
The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...
Directory of Open Access Journals (Sweden)
Erin S Kelleher
2007-08-01
Full Text Available It frequently has been postulated that intersexual coevolution between the male ejaculate and the female reproductive tract is a driving force in the rapid evolution of reproductive proteins. The dearth of research on female tracts, however, presents a major obstacle to empirical tests of this hypothesis. Here, we employ a comparative EST approach to identify 241 candidate female reproductive proteins in Drosophila arizonae, a repleta group species in which physiological ejaculate-female coevolution has been documented. Thirty-one of these proteins exhibit elevated amino acid substitution rates, making them candidates for molecular coevolution with the male ejaculate. Strikingly, we also discovered 12 unique digestive proteases whose expression is specific to the D. arizonae lower female reproductive tract. These enzymes belong to classes most commonly found in the gastrointestinal tracts of a diverse array of organisms. We show that these proteases are associated with recent, lineage-specific gene duplications in the Drosophila repleta species group, and exhibit strong signatures of positive selection. Observation of adaptive evolution in several female reproductive tract proteins indicates they are active players in the evolution of reproductive tract interactions. Additionally, pervasive gene duplication, adaptive evolution, and rapid acquisition of a novel digestive function by the female reproductive tract points to a novel coevolutionary mechanism of ejaculate-female interaction.
Håkansson, Anna; Westberg, Lars; Nilsson, Staffan; Buervenich, Silvia; Carmine, Andrea; Holmberg, Björn; Sydow, Olof; Olson, Lars; Johnels, Bo; Eriksson, Elias; Nissbrandt, Hans
2005-02-05
The multifunctional cytokine interleukin-6 (IL-6) is involved in inflammatory processes in the central nervous system and increased levels of IL-6 have been found in patients with Parkinson's disease (PD). It is known that estrogen inhibits the production of IL-6, via action on estrogen receptors, thereby pointing to an important influence of estrogen on IL-6. In a previous study, we reported an association between a G/A single nucleotide polymorphism (SNP) at position 1730 in the gene coding for estrogen receptor beta (ERbeta) and age of onset of PD. To investigate the influence of a G/C SNP at position 174 in the promoter of the IL-6 gene, and the possible interaction of this SNP and the ERbeta G-1730A SNP on the risk for PD, the G-174C SNP was genotyped, by pyrosequencing, in 258 patients with PD and 308 controls. A significantly elevated frequency of the GG genotype of the IL-6 SNP was found in the patient group and this was most obvious among patients with an early age of onset (=50 years) of PD. When the GG genotypes of the IL-6 and ERbeta SNPs were combined, the combination was much more robustly associated with PD, and especially with PD with an early age of onset, than respective GG genotype when analyzed separately. Our results indicate that the G-174C SNP in the IL-6 promoter may influence the risk for developing PD, particularly regarding early age of onset PD, and that the effect is modified by interaction of the G-1730A SNP in the ERbeta gene. (c) 2004 Wiley-Liss, Inc.
van Lier, Christina J; Sha, Jian; Kirtley, Michelle L; Cao, Anthony; Tiner, Bethany L; Erova, Tatiana E; Cong, Yingzi; Kozlova, Elena V; Popov, Vsevolod L; Baze, Wallace B; Chopra, Ashok K
2014-06-01
Currently, there is no FDA-approved vaccine against Yersinia pestis, the causative agent of bubonic and pneumonic plague. Since both humoral immunity and cell-mediated immunity are essential in providing the host with protection against plague, we developed a live-attenuated vaccine strain by deleting the Braun lipoprotein (lpp) and plasminogen-activating protease (pla) genes from Y. pestis CO92. The Δlpp Δpla double isogenic mutant was highly attenuated in evoking both bubonic and pneumonic plague in a mouse model. Further, animals immunized with the mutant by either the intranasal or the subcutaneous route were significantly protected from developing subsequent pneumonic plague. In mice, the mutant poorly disseminated to peripheral organs and the production of proinflammatory cytokines concurrently decreased. Histopathologically, reduced damage to the lungs and livers of mice infected with the Δlpp Δpla double mutant compared to the level of damage in wild-type (WT) CO92-challenged animals was observed. The Δlpp Δpla mutant-immunized mice elicited a humoral immune response to the WT bacterium, as well as to CO92-specific antigens. Moreover, T cells from mutant-immunized animals exhibited significantly higher proliferative responses, when stimulated ex vivo with heat-killed WT CO92 antigens, than mice immunized with the same sublethal dose of WT CO92. Likewise, T cells from the mutant-immunized mice produced more gamma interferon (IFN-γ) and interleukin-4. These animals had an increasing number of tumor necrosis factor alpha (TNF-α)-producing CD4(+) and CD8(+) T cells than WT CO92-infected mice. These data emphasize the role of TNF-α and IFN-γ in protecting mice against pneumonic plague. Overall, our studies provide evidence that deletion of the lpp and pla genes acts synergistically in protecting animals against pneumonic plague, and we have demonstrated an immunological basis for this protection.
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
A cathepsin L-like protease from Strongylus vulgaris: an orthologue of Caenorhabditis elegans CPL-1.
Ultaigh, Sinéad Nic An; Carolan, James C; Britton, Collette; Murray, Linda; Ryan, Michael F
2009-04-01
Cathespin L-like proteases (CPLs), characterized from a wide range of helminths, are significant in helminth biology. For example, in Caenorhabditis elegans CPL is essential for embryogenesis. Here, we report a cathepsin L-like gene from three species of strongyles that parasitize the horse, and describe the isolation of a cpl gene (Sv-cpl-1) from Strongylus vulgaris, the first such from equine strongyles. It encodes a protein of 354 amino acids with high similarity to other parasitic Strongylida (90-91%), and C.elegans CPL-1 (87%), a member of the same Clade. As S.vulgaris cpl-1 rescued the embryonic lethal phenotype of the C.elegans cpl-1 mutant, these genes may be orthologues, sharing the same function in each species. Targeting Sv-CPL-1 might enable novel control strategies by decreasing parasite development and transmission.
Localization to Chromosomes of Structural Genes for the Major Protease Inhibitors of Barley Grains
DEFF Research Database (Denmark)
Hejgaard, Jørn; Bjørn, S.E.; Nielsen, Gunnar Gissel
1984-01-01
Wheat-barley chromosome addition lines were compared by isoelectric focusing of protein extracts to identify chromosomes carrying loci for the major immunochemically distinct protease inhibitors of barley grains. Structural genes for the following inhibitors were localized: an inhibitor of both...... endogenous α-amylase 2 and subtilisin (ASI) on chromosome 2, two chymotrypsin/subtilisin inhibitors (CI-1 and CI-2) on chromosome 5 (long arm) and the major trypsin inhibitor (TI-1) on chromosome 3....
Tiwari, Lalit Dev; Mittal, Dheeraj; Chandra Mishra, Ratnesh; Grover, Anil
2015-07-01
Protease inhibitors are involved primarily in defense against pathogens. In recent years, these proteins have also been widely implicated in response of plants to diverse abiotic stresses. Rice chymotrypsin protease inhibitor gene OCPI2 is highly induced under salt and osmotic stresses. The construct containing the complete coding sequence of OCPI2 cloned downstream to CaMV35S promoter was transformed in Arabidopsis and single copy, homozygous transgenic lines were produced. The transgenic plants exhibited significantly enhanced tolerance to NaCl, PEG and mannitol stress as compared to wild type plants. Importantly, the vegetative and reproductive growth of transgenic plants under unstressed, control conditions was also enhanced: transgenic plants were more vigorous than wild type, resulting into higher yield in terms of silique number. The RWC values and membrane stability index of transgenic in comparison to wild type plants was higher. Higher proline content was observed in the AtOCPI2 lines, which was associated with higher transcript expression of pyrroline-5-carboxylate synthase and lowered levels of proline dehydrogenase genes. The chymotrypsin protease activities were lower in the transgenic as against wild type plants, under both unstressed, control as well as stressed conditions. It thus appears that rice chymotrypsin protease inhibitor gene OCPI2 is a useful candidate gene for genetic improvement of plants against salt and osmotic stress. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Lermann, Ulrich; Morschhäuser, Joachim
2008-11-01
A well-known virulence attribute of the human-pathogenic yeast Candida albicans is the secretion of aspartic proteases (Saps), which may contribute to colonization and infection of different host niches by degrading tissue barriers, destroying host defence molecules, or digesting proteins for nutrient supply. The role of individual Sap isoenzymes, which are encoded by a large gene family, for the pathogenicity of C. albicans has been investigated by assessing the virulence of mutants lacking specific SAP genes and by studying the expression pattern of the SAP genes in various models of superficial and systemic infections. We used a recombination-based genetic reporter system to detect the induction of the SAP1-SAP6 genes during infection of reconstituted human vaginal epithelium. Only SAP5, but none of the other tested SAP genes, was detectably activated in this in vitro infection model. To directly address the importance of the SAP1-SAP6 genes for invasion of reconstituted human epithelia (RHE), we constructed a set of mutants of the wild-type C. albicans model strain SC5314 in which either single or multiple SAP genes were specifically deleted. Even mutants lacking all of the SAP1-SAP3 or the SAP4-SAP6 genes displayed the same capacity to invade and damage both oral and vaginal RHE as their wild-type parental strain, in contrast to a nonfilamentous efg1Delta mutant that was avirulent under these conditions. We therefore conclude from these results that the secreted aspartic proteases Sap1p-Sap6p are not required for invasion of RHE by C. albicans.
Sheikh, Muhammad Abid; Malik, Yousra Saeed; Xing, Zhenkai; Guo, Zhaopei; Tian, Huayu; Zhu, Xiaojuan; Chen, Xuesi
2017-05-01
Parkinson's Disease (PD) is a chronic neurodegenerative disorder characterized by motor deficits which result from the progressive loss of dopaminergic neurons. Gene therapy using growth factors such as VEGF seems to be a viable approach for potential therapeutic treatment of PD. In this study, we utilized a novel non-viral gene carrier designated as PEI-PLL synthesized by our laboratory to deliver VEGF gene to study its effect by using both cell culture as well as animal models of PD. For cell culture experiments, we utilized 6-hydroxydopamine (6-OHDA) mediated cell death model of MN9D cells following transfection with either a control plasmid or VEGF expressing plasmid. As compared to control transfected cells, PEI-PLL mediated VEGF gene delivery to MN9D cells resulted in increased cell viability, increase in the number of Tyrosine hydroxylase (TH) positive cells and decreased apoptosis following 6-OHDA insult. Next, we studied the therapeutic potential of PEI-PLL mediated VEGF gene delivery in SNPc by using unilateral 6-OHDA Medial forebrain bundle (MFB) lesion model of PD in rats. VEGF administration prevented the loss of motor functions induced by 6-OHDA as determined by behavior analysis. Similarly, VEGF inhibited the 6-OHDA mediated loss of DA neurons in Substantia Nigra Pars Compacta (SNPc) as well as DA nerve fibers in striatum as determined by TH immunostaining. In addition, PEI-PLL mediated VEGF gene delivery also prevented apoptosis and microglial activation in PD rat models. Together, these results clearly demonstrated the beneficial effects of PEI-PLL mediated VEGF gene delivery on dopaminergic system in both cell culture and animal models of PD. In this report, we exploited the potential of PEI-PLL to deliver VEGF gene for the potential therapeutic treatment of PD by using both cell culture and animal models of PD. To the best of our knowledge, this is the first report describing the use of novel polymeric gene carriers for the delivery of VEGF gene
The Cysteine Protease–Cysteine Protease Inhibitor System Explored in Soybean Nodule Development
Directory of Open Access Journals (Sweden)
Marian Dorcas Quain
2013-08-01
Full Text Available Almost all protease families have been associated with plant development, particularly senescence, which is the final developmental stage of every organ before cell death. Proteolysis remobilizes and recycles nitrogen from senescent organs that is required, for example, seed development. Senescence-associated expression of proteases has recently been characterized using large-scale gene expression analysis seeking to identify and characterize senescence-related genes. Increasing activities of proteolytic enzymes, particularly cysteine proteases, are observed during the senescence of legume nodules, in which a symbiotic relationship between the host plant and bacteria (Rhizobia facilitate the fixation of atmospheric nitrogen. It is generally considered that cysteine proteases are compartmentalized to prevent uncontrolled proteolysis in nitrogen-fixing nodules. In addition, the activities of cysteine proteases are regulated by endogenous cysteine protease inhibitors called cystatins. These small proteins form reversible complexes with cysteine proteases, leading to inactivation. However, very little is currently known about how the cysteine protease-cysteine protease inhibitor (cystatin system is regulated during nodule development. Moreover, our current understanding of the expression and functions of proteases and protease inhibitors in nodules is fragmented. To address this issue, we have summarized the current knowledge and techniques used for studying proteases and their inhibitors including the application of “omics” tools, with a particular focus on changes in the cysteine protease-cystatin system during nodule development.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
Significance of Cuscutain, a cysteine protease from Cuscuta reflexa, in host-parasite interactions
Directory of Open Access Journals (Sweden)
Fuchsbauer Hans-Lothar
2010-10-01
Full Text Available Abstract Background Plant infestation with parasitic weeds like Cuscuta reflexa induces morphological as well as biochemical changes in the host and the parasite. These modifications could be caused by a change in protein or gene activity. Using a comparative macroarray approach Cuscuta genes specifically upregulated at the host attachment site were identified. Results One of the infestation specific Cuscuta genes encodes a cysteine protease. The protein and its intrinsic inhibitory peptide were heterologously expressed, purified and biochemically characterized. The haustoria specific enzyme was named cuscutain in accordance with similar proteins from other plants, e.g. papaya. The role of cuscutain and its inhibitor during the host parasite interaction was studied by external application of an inhibitor suspension, which induced a significant reduction of successful infection events. Conclusions The study provides new information about molecular events during the parasitic plant - host interaction. Inhibition of cuscutain cysteine proteinase could provide means for antagonizing parasitic plants.
A de novo variant in the ASPRV1 gene in a dog with ichthyosis.
Bauer, Anina; Waluk, Dominik P; Galichet, Arnaud; Timm, Katrin; Jagannathan, Vidhya; Sayar, Beyza S; Wiener, Dominique J; Dietschi, Elisabeth; Müller, Eliane J; Roosje, Petra; Welle, Monika M; Leeb, Tosso
2017-03-01
Ichthyoses are a heterogeneous group of inherited cornification disorders characterized by generalized dry skin, scaling and/or hyperkeratosis. Ichthyosis vulgaris is the most common form of ichthyosis in humans and caused by genetic variants in the FLG gene encoding filaggrin. Filaggrin is a key player in the formation of the stratum corneum, the uppermost layer of the epidermis and therefore crucial for barrier function. During terminal differentiation of keratinocytes, the precursor profilaggrin is cleaved by several proteases into filaggrin monomers and eventually processed into free amino acids contributing to the hydration of the cornified layer. We studied a German Shepherd dog with a novel form of ichthyosis. Comparing the genome sequence of the affected dog with 288 genomes from genetically diverse non-affected dogs we identified a private heterozygous variant in the ASPRV1 gene encoding "aspartic peptidase, retroviral-like 1", which is also known as skin aspartic protease (SASPase). The variant was absent in both parents and therefore due to a de novo mutation event. It was a missense variant, c.1052T>C, affecting a conserved residue close to an autoprocessing cleavage site, p.(Leu351Pro). ASPRV1 encodes a retroviral-like protease involved in profilaggrin-to-filaggrin processing. By immunofluorescence staining we showed that the filaggrin expression pattern was altered in the affected dog. Thus, our findings provide strong evidence that the identified de novo variant is causative for the ichthyosis in the affected dog and that ASPRV1 plays an essential role in skin barrier formation. ASPRV1 is thus a novel candidate gene for unexplained human forms of ichthyoses.
A de novo variant in the ASPRV1 gene in a dog with ichthyosis.
Directory of Open Access Journals (Sweden)
Anina Bauer
2017-03-01
Full Text Available Ichthyoses are a heterogeneous group of inherited cornification disorders characterized by generalized dry skin, scaling and/or hyperkeratosis. Ichthyosis vulgaris is the most common form of ichthyosis in humans and caused by genetic variants in the FLG gene encoding filaggrin. Filaggrin is a key player in the formation of the stratum corneum, the uppermost layer of the epidermis and therefore crucial for barrier function. During terminal differentiation of keratinocytes, the precursor profilaggrin is cleaved by several proteases into filaggrin monomers and eventually processed into free amino acids contributing to the hydration of the cornified layer. We studied a German Shepherd dog with a novel form of ichthyosis. Comparing the genome sequence of the affected dog with 288 genomes from genetically diverse non-affected dogs we identified a private heterozygous variant in the ASPRV1 gene encoding "aspartic peptidase, retroviral-like 1", which is also known as skin aspartic protease (SASPase. The variant was absent in both parents and therefore due to a de novo mutation event. It was a missense variant, c.1052T>C, affecting a conserved residue close to an autoprocessing cleavage site, p.(Leu351Pro. ASPRV1 encodes a retroviral-like protease involved in profilaggrin-to-filaggrin processing. By immunofluorescence staining we showed that the filaggrin expression pattern was altered in the affected dog. Thus, our findings provide strong evidence that the identified de novo variant is causative for the ichthyosis in the affected dog and that ASPRV1 plays an essential role in skin barrier formation. ASPRV1 is thus a novel candidate gene for unexplained human forms of ichthyoses.
Hays, Shan M; Swanson, Johanna; Selker, Eric U
2002-01-01
We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...
Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes
Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.
Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT
Environmental cycle of antibiotic resistance encoded genes: A systematic review
Directory of Open Access Journals (Sweden)
R. ghanbari
2017-12-01
Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.
Takaya, Akiko; Kubota, Yohsuke; Isogai, Emiko; Yamamoto, Tomoko
2005-02-01
Salmonella pathogenicity island 1 (SPI1) enables infecting Salmonella to cross the small intestinal barrier and to escape phagocytosis by inducing apoptosis. Several environmental signals and transcriptional regulators modulate the expression of hilA, which encodes a protein playing a central role in the regulatory hierarchy of SPI1 gene expression. We have previously shown that Lon, a stress-induced ATP-dependent protease, is a negative regulator of hilA, suggesting that it targets factors required for activating hilA expression. To elucidate the mechanisms by which Lon protease negatively regulates SPI1 transcription, we looked for its substrate proteins. We found that HilC and HilD, which are positive regulators of hilA expression, accumulate in Lon-depleted cells, and that the enhancement of SPI1 expression that occurs in a lon-disrupted mutant is not observed in the lon hilC hilD triple null mutant. Furthermore, we demonstrated that the half-lives of HilC and HilD are, respectively, about 12 times and three times longer in the Lon-depleted mutant, than in the Lon+ cells, suggesting that Lon targets both of HilC and HilD. In view of these findings, we suggest that the regulation of SPI1 expression is negatively controlled through degradation of the HilC and HilD transcriptional regulators by Lon.
Fungicidal activity of peptides encoded by immunoglobulin genes
Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania
2017-01-01
Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...
Expression and Characterization of Coprothermobacter proteolyticus Alkaline Serine Protease
Directory of Open Access Journals (Sweden)
Tanveer Majeed
2013-01-01
Full Text Available A putative protease gene (aprE from the thermophilic bacterium Coprothermobacter proteolyticus was cloned and expressed in Bacillus subtilis. The enzyme was determined to be a serine protease based on inhibition by PMSF. Biochemical characterization demonstrated that the enzyme had optimal activity under alkaline conditions (pH 8–10. In addition, the enzyme had an elevated optimum temperature (60°C. The protease was also stable in the presence of many surfactants and oxidant. Thus, the C. proteolyticus protease has potential applications in industries such as the detergent market.
Coffee, caffeine-related genes, and Parkinson's disease: a case-control study.
Facheris, Maurizio F; Schneider, Nicole K; Lesnick, Timothy G; de Andrade, Mariza; Cunningham, Julie M; Rocca, Walter A; Maraganore, Demetrius M
2008-10-30
An inverse association between coffee and Parkinson's disease (PD) has been reported. However, it remains uncertain why some but not all coffee drinkers are less susceptible to PD. We considered the possibility of a pharmacogenetic effect. In our study, we included 1,208 subjects (446 case-unaffected sibling pairs and 158 case-unrelated control pairs) recruited from an ongoing study of the molecular epidemiology of PD in the Upper Midwest (USA). We collected information on lifetime coffee drinking and we studied two genes: ADORA2A, which encodes the major receptor activity of caffeine in the brain (variants rs5751876 and rs3032740), and CYP1A2, which encodes the major rate-limiting step of caffeine metabolism (variants rs35694136 and rs762551). We did not observe significant associations of coffee drinking or of the genetic variants with PD susceptibility, either independently or jointly, in the sample overall and in most strata. Our study neither supports the hypothesis that coffee protects against PD nor provides evidence for a pharmacogenetic effect. (c) 2008 Movement Disorder Society.
Coffee, Caffeine-Related Genes, and Parkinson's Disease: A Case–Control Study
Facheris, Maurizio F.; Schneider, Nicole K.; Lesnick, Timothy G.; de Andrade, Mariza; Cunningham, Julie M.; Rocca, Walter A.; Maraganore, Demetrius M.
2015-01-01
An inverse association between coffee and Parkinson's disease (PD) has been reported. However, it remains uncertain why some but not all coffee drinkers are less susceptible to PD. We considered the possibility of a pharmaco-genetic effect. In our study, we included 1,208 subjects (446 case-unaffected sibling pairs and 158 case-unrelated control pairs) recruited from an ongoing study of the molecular epidemiology of PD in the Upper Midwest (USA). We collected information on lifetime coffee drinking and we studied two genes: ADORA2A, which encodes the major receptor activity of caffeine in the brain (variants rs5751876 and rs3032740), and CYP1A2, which encodes the major rate-limiting step of caffeine metabolism (variants rs35694136 and rs762551). We did not observe significant associations of coffee drinking or of the genetic variants with PD susceptibility, either independently or jointly, in the sample overall and in most strata. Our study neither supports the hypothesis that coffee protects against PD nor provides evidence for a pharmacogenetic effect. PMID:18759349
Yoshikawa, Rokusuke; Takeuchi, Junko S; Yamada, Eri; Nakano, Yusuke; Misawa, Naoko; Kimura, Yuichi; Ren, Fengrong; Miyazawa, Takayuki; Koyanagi, Yoshio; Sato, Kei
2017-06-01
The interplay between viral and host proteins has been well studied to elucidate virus-host interactions and their relevance to virulence. Mammalian genes encode apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3 (APOBEC3) proteins, which act as intrinsic restriction factors against lentiviruses. To overcome APOBEC3-mediated antiviral actions, lentiviruses have evolutionarily acquired an accessory protein, viral infectivity factor (Vif), and Vif degrades host APOBEC3 proteins via a ubiquitin/proteasome-dependent pathway. Although the Vif-APOBEC3 interaction and its evolutionary significance, particularly those of primate lentiviruses (including HIV) and primates (including humans), have been well investigated, those of nonprimate lentiviruses and nonprimates are poorly understood. Moreover, the factors that determine lentiviral pathogenicity remain unclear. Here, we focus on feline immunodeficiency virus (FIV), a pathogenic lentivirus in domestic cats, and the interaction between FIV Vif and feline APOBEC3 in terms of viral virulence and evolution. We reveal the significantly reduced diversity of FIV subtype B compared to that of other subtypes, which may associate with the low pathogenicity of this subtype. We also demonstrate that FIV subtype B Vif is less active with regard to feline APOBEC3 degradation. More intriguingly, we further reveal that FIV protease cleaves feline APOBEC3 in released virions. Taken together, our findings provide evidence that a lentivirus encodes two types of anti-APOBEC3 factors, Vif and viral protease. IMPORTANCE During the history of mammalian evolution, mammals coevolved with retroviruses, including lentiviruses. All pathogenic lentiviruses, excluding equine infectious anemia virus, have acquired the vif gene via evolution to combat APOBEC3 proteins, which are intrinsic restriction factors against exogenous lentiviruses. Here we demonstrate that FIV, a pathogenic lentivirus in domestic cats, antagonizes feline APOBEC3
CSIR Research Space (South Africa)
Labuschagne, M
2007-01-01
Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...
Laing, E; Pretorius, I S
1993-05-01
A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.
Directory of Open Access Journals (Sweden)
Nicolas Faller
Full Text Available Membrane-bound serine proteases play important roles in different biological processes. Their regulation by endogenous inhibitors is poorly understood. A Y163C mutation in the SPINT2 gene encoding the serine protease inhibitor Hepatocyte Growth Factor Inhibitor HAI-2 is associated with a congenital sodium diarrhea. The functional consequences of this mutation on HAI-2 activity and its physiological targets are unknown. We established a cellular assay in Xenopus laevis oocytes to study functional interactions between HAI-2 and candidate membrane-bound serine proteases expressed in the gastro-intestinal tract. We found that the wild-type form of HAI-2 is a potent inhibitor of nine gastro-intestinal serine proteases. The Y163C mutation in the second Kunitz domain of HAI-2 resulted in a complete loss of inhibitory activity on two intestinal proteases, prostasin and tmprss13. The effect of the mutation of the homologous Y68C in the first Kunitz domain of HAI-2 is consistent with a differential contribution of the two Kunitz domains of HAI-2 in the inhibition of serine proteases. By contrast to the Tyr to Cys, the Tyr to Ser substitution did not change the inhibitory potency of HAI-2, indicating that the thiol-group of the cysteine rather than the Tyr deletion is responsible for the HAI-2 loss of function. Our functional assay allowed us to identify membrane-bound serine proteases as cellular target for inhibition by HAI-2 wild type and mutants, and to better define the role of the Tyr in the second Kunitz domain in the inhibitory activity of HAI-2.
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
Impact of enhancin genes on potency of LdNPV in gypsy moth
Kelli Hoover; Jim McNeil; Alyssa Gendron; James. Slavicek
2011-01-01
Lymantria dispar nucleopolyhedrovirus (LdNPV) contains two enhancin genes (E1 and E2) encoding proteases that degrade key peritrophic matrix (PM) proteins, thereby promoting infection and mortality by the virus. In a previous study, gypsy moth larvae inoculated with LdNPV in which both E1 and E2 were deleted (double deletion virus) resulted in a non-...
Miyaji, T; Otta, Y; Nakagawa, T; Watanabe, T; Niimura, Y; Tomizuka, N
2006-03-01
The present study was conducted by screening zein-degrading bacteria in an attempt to obtain zein-degrading protease. Soil bacteria were screened by formation of a clear zone on zein plates. Characterization of a zein-degrading bacterium indicated a taxonomic affiliation to Bacillus pumilus, and was named MS-1 strain. The strain produced two different types of extracellular proteases, BPP-A and BPP-B. In this study, we purified and characterized BPP-A because it exhibited a higher ability to hydrolyze zein than BPP-B. When casein was used as the substrate, the optimal pH for BPP-A was 11.0. In BPP-A, zein was better substrate than casein at pH 13.0, whereas casein was better one than zein at pH 11.0. The bppA gene encoded a 383-amino acid pre-pro form of BPP-A, and mature BPP-A contained 275 amino acid residues. It was concluded that BPP-A belonged to the subtilisin family. A zein-degrading bacterium assigned to B. pumilus produced two different types of extracellular proteases, BPP-A and BPP-B. BPP-A exhibited an ability to hydrolyze zein in an extreme alkaline condition. This is a first report on screening for zein-degrading micro-organisms. The subtilisin-like protease BPP-A is possible to utilize as an industrial enzyme for the production of zein hydrolysates.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
Alternative splice variants of the human PD-1 gene
DEFF Research Database (Denmark)
Nielsen, Christian; Ohm-Laursen, Line; Barington, Torben
2005-01-01
PD-1 is an immunoregulatory receptor expressed on the surface of activated T cells, B cells, and monocytes. We describe four alternatively spliced PD-1 mRNA transcripts (PD-1Deltaex2, PD-1Deltaex3, PD-1Deltaex2,3, and PD-1Deltaex2,3,4) in addition to the full length isoform. PD-1Deltaex2 and PD-1...... and flPD-1 upon activation suggests an important interplay between the putative soluble PD-1 and flPD-1 possibly involved in maintenance of peripheral self-tolerance and prevention of autoimmunity....
Nagatsu, Toshiharu; Nagatsu, Ikuko
2016-11-01
Tyrosine hydroxylase (TH), which was discovered at the National Institutes of Health (NIH) in 1964, is a tetrahydrobiopterin (BH4)-requiring monooxygenase that catalyzes the first and rate-limiting step in the biosynthesis of catecholamines (CAs), such as dopamine, noradrenaline, and adrenaline. Since deficiencies of dopamine and noradrenaline in the brain stem, caused by neurodegeneration of dopamine and noradrenaline neurons, are mainly related to non-motor and motor symptoms of Parkinson's disease (PD), we have studied human CA-synthesizing enzymes [TH; BH4-related enzymes, especially GTP-cyclohydrolase I (GCH1); aromatic L-amino acid decarboxylase (AADC); dopamine β-hydroxylase (DBH); and phenylethanolamine N-methyltransferase (PNMT)] and their genes in relation to PD in postmortem brains from PD patients, patients with CA-related genetic diseases, mice with genetically engineered CA neurons, and animal models of PD. We purified all human CA-synthesizing enzymes, produced their antibodies for immunohistochemistry and immunoassay, and cloned all human genes, especially the human TH gene and the human gene for GCH1, which synthesizes BH4 as a cofactor of TH. This review discusses the historical overview of TH, BH4-, and other CA-related enzymes and their genes in relation to the pathophysiology of PD, the development of drugs, such as L-DOPA, and future prospects for drug and gene therapy for PD, especially the potential of induced pluripotent stem (iPS) cells.
Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel
2009-01-01
Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds. PMID:19759340
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1994-01-01
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
Directory of Open Access Journals (Sweden)
Jacky Y Suen
Full Text Available Protease-Activated Receptor-2 (PAR2 has been implicated through genetic knockout mice with cytokine regulation and arthritis development. Many studies have associated PAR2 with inflammatory conditions (arthritis, airways inflammation, IBD and key events in tumor progression (angiogenesis, metastasis, but they have relied heavily on the use of single agonists to identify physiological roles for PAR2. However such probes are now known not to be highly selective for PAR2, and thus precisely what PAR2 does and what mechanisms of downstream regulation are truly affected remain obscure. Effects of PAR2 activation on gene expression in Human Embryonic Kidney cells (HEK293, a commonly studied cell line in PAR2 research, were investigated here by comparing 19,000 human genes for intersecting up- or down-regulation by both trypsin (an endogenous protease that activates PAR2 and a PAR2 activating hexapeptide (2f-LIGRLO-NH(2. Among 2,500 human genes regulated similarly by both agonists, there were clear associations between PAR2 activation and cellular metabolism (1,000 genes, the cell cycle, the MAPK pathway, HDAC and sirtuin enzymes, inflammatory cytokines, and anti-complement function. PAR-2 activation up-regulated four genes more than 5 fold (DUSP6, WWOX, AREG, SERPINB2 and down-regulated another six genes more than 3 fold (TXNIP, RARG, ITGB4, CTSD, MSC and TM4SF15. Both PAR2 and PAR1 activation resulted in up-regulated expression of several genes (CD44, FOSL1, TNFRSF12A, RAB3A, COPEB, CORO1C, THBS1, SDC4 known to be important in cancer. This is the first widespread profiling of specific activation of PAR2 and provides a valuable platform for better understanding key mechanistic roles of PAR2 in human physiology. Results clearly support the development of both antagonists and agonists of human PAR2 as potential disease modifying therapeutic agents.
Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them
International Nuclear Information System (INIS)
Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.
1988-01-01
This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated
International Nuclear Information System (INIS)
Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.
1988-01-01
Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment
Dysregulation of protease and protease inhibitors in a mouse model of human pelvic organ prolapse.
Directory of Open Access Journals (Sweden)
Madhusudhan Budatha
Full Text Available Mice deficient for the fibulin-5 gene (Fbln5(-/- develop pelvic organ prolapse (POP due to compromised elastic fibers and upregulation of matrix metalloprotease (MMP-9. Here, we used casein zymography, inhibitor profiling, affinity pull-down, and mass spectrometry to discover additional protease upregulated in the vaginal wall of Fbln5(-/- mice, herein named V1 (25 kDa. V1 was a serine protease with trypsin-like activity similar to protease, serine (PRSS 3, a major extrapancreatic trypsinogen, was optimum at pH 8.0, and predominantly detected in estrogenized vaginal epithelium of Fbln5(-/- mice. PRSS3 was (a localized in epithelial secretions, (b detected in media of vaginal organ culture from both Fbln5(-/- and wild type mice, and (c cleaved fibulin-5 in vitro. Expression of two serine protease inhibitors [Serpina1a (α1-antitrypsin and Elafin] was dysregulated in Fbln5(-/- epithelium. Finally, we confirmed that PRSS3 was expressed in human vaginal epithelium and that SERPINA1 and Elafin were downregulated in vaginal tissues from women with POP. These data collectively suggest that the balance between proteases and their inhibitors contributes to support of the pelvic organs in humans and mice.
Directory of Open Access Journals (Sweden)
Daniel H Haft
Full Text Available The rhomboid family of serine proteases occurs in all domains of life. Its members contain at least six hydrophobic membrane-spanning helices, with an active site serine located deep within the hydrophobic interior of the plasma membrane. The model member GlpG from Escherichia coli is heavily studied through engineered mutant forms, varied model substrates, and multiple X-ray crystal studies, yet its relationship to endogenous substrates is not well understood. Here we describe an apparent membrane anchoring C-terminal homology domain that appears in numerous genera including Shewanella, Vibrio, Acinetobacter, and Ralstonia, but excluding Escherichia and Haemophilus. Individual genomes encode up to thirteen members, usually homologous to each other only in this C-terminal region. The domain's tripartite architecture consists of motif, transmembrane helix, and cluster of basic residues at the protein C-terminus, as also seen with the LPXTG recognition sequence for sortase A and the PEP-CTERM recognition sequence for exosortase. Partial Phylogenetic Profiling identifies a distinctive rhomboid-like protease subfamily almost perfectly co-distributed with this recognition sequence. This protease subfamily and its putative target domain are hereby renamed rhombosortase and GlyGly-CTERM, respectively. The protease and target are encoded by consecutive genes in most genomes with just a single target, but far apart otherwise. The signature motif of the Rhombo-CTERM domain, often SGGS, only partially resembles known cleavage sites of rhomboid protease family model substrates. Some protein families that have several members with C-terminal GlyGly-CTERM domains also have additional members with LPXTG or PEP-CTERM domains instead, suggesting there may be common themes to the post-translational processing of these proteins by three different membrane protein superfamilies.
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Identification of SlpB, a Cytotoxic Protease from Serratia marcescens.
Shanks, Robert M Q; Stella, Nicholas A; Hunt, Kristin M; Brothers, Kimberly M; Zhang, Liang; Thibodeau, Patrick H
2015-07-01
The Gram-negative bacterium and opportunistic pathogen Serratia marcescens causes ocular infections in healthy individuals. Secreted protease activity was characterized from 44 ocular clinical isolates, and a higher frequency of protease-positive strains was observed among keratitis isolates than among conjunctivitis isolates. A positive correlation between protease activity and cytotoxicity to human corneal epithelial cells in vitro was determined. Deletion of prtS in clinical keratitis isolate K904 reduced, but did not eliminate, cytotoxicity and secreted protease production. This indicated that PrtS is necessary for full cytotoxicity to ocular cells and implied the existence of another secreted protease(s) and cytotoxic factors. Bioinformatic analysis of the S. marcescens Db11 genome revealed three additional open reading frames predicted to code for serralysin-like proteases noted here as slpB, slpC, and slpD. Induced expression of prtS and slpB, but not slpC and slpD, in strain PIC3611 rendered the strain cytotoxic to a lung carcinoma cell line; however, only prtS induction was sufficient for cytotoxicity to a corneal cell line. Strain K904 with deletion of both prtS and slpB genes was defective in secreted protease activity and cytotoxicity to human cell lines. PAGE analysis suggests that SlpB is produced at lower levels than PrtS. Purified SlpB demonstrated calcium-dependent and AprI-inhibited protease activity and cytotoxicity to airway and ocular cell lines in vitro. Lastly, genetic analysis indicated that the type I secretion system gene, lipD, is required for SlpB secretion. These genetic data introduce SlpB as a new cytotoxic protease from S. marcescens. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Erwinia carotovora extracellular proteases : characterization and role in soft rot
Kyöstiö, Sirkka R. M.
1990-01-01
Erwinia carotovora subsp. carotovora (Ecc) strain EC14, a Gram-negative bacterium, causes soft rot on several crops, including potato. Maceration of potato tuber tissue is caused by secreted pectolytic enzymes. Other cell-degrading enzymes may also have roles in pathogenesis, including cellulases, phospholipases, and protease(s). The objectives of this research were to (1) characterize Ecc extracellular protease (Prt) and (2) elucidate its role in potato soft rot. A gene enc...
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes
Directory of Open Access Journals (Sweden)
Abbas Ali Imani Fooladi
2014-02-01
Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.
Huang, Ke; Wang, Dekai; Duan, Penggen; Zhang, Baolan; Xu, Ran; Li, Na; Li, Yunhai
2017-09-01
Grain size and shape are two crucial traits that influence grain yield and grain appearance in rice. Although several factors that affect grain size have been described in rice, the molecular mechanisms underlying the determination of grain size and shape are still elusive. In this study we report that WIDE AND THICK GRAIN 1 (WTG1) functions as an important factor determining grain size and shape in rice. The wtg1-1 mutant exhibits wide, thick, short and heavy grains and also shows an increased number of grains per panicle. WTG1 determines grain size and shape mainly by influencing cell expansion. WTG1 encodes an otubain-like protease, which shares similarity with human OTUB1. Biochemical analyses indicate that WTG1 is a functional deubiquitinating enzyme, and the mutant protein (wtg1-1) loses this deubiquitinating activity. WTG1 is expressed in developing grains and panicles, and the GFP-WTG1 fusion protein is present in the nucleus and cytoplasm. Overexpression of WTG1 results in narrow, thin, long grains due to narrow and long cells, further supporting the role of WTG1 in determining grain size and shape. Thus, our findings identify the otubain-like protease WTG1 to be an important factor that determines grain size and shape, suggesting that WTG1 has the potential to improve grain size and shape in rice. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-01-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...
Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression
Directory of Open Access Journals (Sweden)
Leontina GURGU
2012-12-01
Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.
DEFF Research Database (Denmark)
Kjaerulff, S; Davey, William John; Nielsen, O
1994-01-01
We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...
Detailed analysis of putative genes encoding small proteins in legume genomes
Directory of Open Access Journals (Sweden)
Gabriel eGuillén
2013-06-01
Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.
Directory of Open Access Journals (Sweden)
Laura Pirisinu
Full Text Available Although proteinacious in nature, prions exist as strains with specific self-perpetuating biological properties. Prion strains are thought to be associated with different conformers of PrP(Sc, a disease-associated isoform of the host-encoded cellular protein (PrP(C. Molecular strain typing approaches have been developed which rely on the characterization of protease-resistant PrP(Sc. However, PrP(Sc is composed not only of protease-resistant but also of protease-sensitive isoforms. The aim of this work was to develop a protocol for the molecular characterization of both, protease-resistant and protease-sensitive PrP(Sc aggregates. We first set up experimental conditions which allowed the most advantageous separation of PrP(C and PrP(Sc by means of differential centrifugation. The conformational solubility and stability assay (CSSA was then developed by measuring PrP(Sc solubility as a function of increased exposure to GdnHCl. Brain homogenates from voles infected with human and sheep prion isolates were analysed by CSSA and showed strain-specific conformational stabilities, with mean [GdnHCl](1/2 values ranging from 1.6 M for MM2 sCJD to 2.1 for scrapie and to 2.8 M for MM1/MV1 sCJD and E200K gCJD. Interestingly, the rank order of [GdnHCl](1/2 values observed in the human and sheep isolates used as inocula closely matched those found following transmission in voles, being MM1 sCJD the most resistant (3.3 M, followed by sheep scrapie (2.2 M and by MM2 sCJD (1.6 M. In order to test the ability of CSSA to characterise protease-sensitive PrP(Sc, we analysed sheep isolates of Nor98 and compared them to classical scrapie isolates. In Nor98, insoluble PrP(Sc aggregates were mainly protease-sensitive and showed a conformational stability much lower than in classical scrapie. Our results show that CSSA is able to reveal strain-specified PrP(Sc conformational stabilities of protease-resistant and protease-sensitive PrP(Sc and that it is a valuable tool
Lai, Huiguo; Teramoto, Tadahisa; Padmanabhan, Radhakrishnan
2014-01-01
Dengue virus serotypes 1-4 (DENV1-4) are mosquito-borne human pathogens of global significance causing ~390 million cases annually worldwide. The virus infections cause in general a self-limiting disease, known as dengue fever, but occasionally also more severe forms, especially during secondary infections, dengue hemorrhagic fever and dengue shock syndrome causing ~25,000 deaths annually. The DENV genome contains a single-strand positive sense RNA, approximately 11 kb in length. The 5'-end has a type I cap structure. The 3'-end has no poly(A) tail. The viral RNA has a single long open reading frame that is translated by the host translational machinery to yield a polyprotein precursor. Processing of the polyprotein precursor occurs co-translationally by cellular proteases and posttranslationally by the viral serine protease in the endoplasmic reticulum (ER) to yield three structural proteins (capsid (C), precursor membrane (prM), and envelope (E) and seven nonstructural (NS) proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5). The active viral protease consists of both NS2B, an integral membrane protein in the ER, and the N-terminal part of NS3 (180 amino acid residues) that contains the trypsin-like serine protease domain having a catalytic triad of H51, D75, and S135. The C-terminal part of NS3, ~170-618 amino acid residues, encodes an NTPase/RNA helicase and 5'-RNA triphosphatase activities; the latter enzyme is required for the first step in 5'-capping. The cleavage sites of the polyprotein by the viral protease consist of two basic amino acid residues such as KR, RR, or QR, followed by short chain amino acid residues, G, S, or T. Since the cleavage of the polyprotein by the viral protease is absolutely required for assembly of the viral replicase, blockage of NS2B/NS3pro activity provides an effective means for designing dengue virus (DENV) small-molecule therapeutics. Here we describe the screening of small-molecule inhibitors against DENV2 protease.
Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.
Furlan, João Pedro Rueda; Stehling, Eliana Guedes
2018-01-10
β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi
2018-03-01
Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).
Nguyen, Thao Thi; Quyen, Thi Dinh; Le, Hoang Thanh
2013-09-10
Nattokinases/Subtilisins (EC 3.4.21.62) belong to the second large family of serine proteases, which gain significant attention and play important role in many biotechnology processes. Thus, a number of nattokinases/subtilisins from various Bacillus species, especially from B. subtilis strains, extensively have been investigated to understand their biochemical and physical properties as well as to improve the production for industrial application. The purpose of this study was to clone a nattokinase gene from Bacillus subtilis strain VTCC-DVN-12-01, enhance its production in B. subtilis WB800, which is deficient in eight extracellular proteases and characterize its physicochemical properties for potential application in organic synthesis and detergent production. A gene coding for the nattokinase (Nk) from B. subtilis strain VTCC-DVN-12-01 consisted of an ORF of 1146 nucleotides, encoding a pre-pro-protein enzyme (30-aa pre-signal peptide, 76-aa pro-peptide and 275-aa mature protein with a predicted molecular mass of 27.7 kDa and pI 6.6). The nattokinase showed 98-99% identity with other nattokinases/subtilisins from B. subtilis strains in GenBank. Nk was expressed in B. subtilis WB800 under the control of acoA promoter at a high level of 600 mg protein per liter culture medium which is highest yield of proteins expressed in any extracellular-protease-deficient B. subtilis system till date. Nk was purified to homogeneity with 3.25 fold purification, a specific activity of 12.7 U/mg, and a recovery of 54.17%. The purified Nk was identified by MALDI-TOF mass spectrometry through three peptides, which showed 100% identity to corresponding peptides of the B. subtilis nattokinase (CAC41625). An optimal activity for Nk was observed at 65 °C and pH 9. The nattokinase was stable at temperature up to 50 °C and in pH range of 5-11 and retained more than 85% of its initial activity after incubation for 1 h. Mg2+ activated Nk up to 162% of its activity. The addition of
Directory of Open Access Journals (Sweden)
Seabra Ana R
2010-08-01
Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate
Directory of Open Access Journals (Sweden)
Suresh Nair
2011-04-01
Full Text Available The Asian rice gall midge, Orseolia oryzae (Wood-Mason, is a serious pest of rice. Investigations into the gall midge-rice interaction will unveil the underlying molecular mechanisms which, in turn, can be used as a tool to assist in developing suitable integrated pest management strategies. The insect gut is known to be involved in various physiological and biological processes including digestion, detoxification and interaction with the host. We have cloned and identified two genes, OoprotI and OoprotII, homologous to serine proteases with the conserved His87, Asp136 and Ser241 residues. OoProtI shared 52.26% identity with mosquito-type trypsin from Hessian fly whereas OoProtII showed 52.49% identity to complement component activated C1s from the Hessian fly. Quantitative real time PCR analysis revealed that both the genes were significantly upregulated in larvae feeding on resistant cultivar than in those feeding on susceptible cultivar. These results provide an opportunity to understand the gut physiology of the insect under compatible or incompatible interactions with the host. Phylogenetic analysis grouped these genes in the clade containing proteases of phytophagous insects away from hematophagous insects.
Energy Technology Data Exchange (ETDEWEB)
Mita, S; Sadlock, J; Herbert, J; Schon, E A
1988-10-11
Although the ABPP gene give rise to multiple mRNAs, the primary translation product of this gene is unknown. The longest published cDNA sequences predict a 770-aa polypeptide of 87 kDa. However, in immunoblots, ABPP migrated as a single species of >92 kDa in rat brain, and in human, as a species of 95-100 kDa in non-membrane bound form, as multiple species of 110-135 kDa in membrane-associated form and as a 130-kDa species in fibroblasts. The sizes of these larger species relative to the MW of ABPP predicted from the cDNA sequences have been attributed to postranslational modification. However, the authors have isolated a cDNA (lambdaHAP2) from a human fetal muscle lambdagt11 cDNA library encoding an 843-aa polypeptide with a deduced MW of 94,642. This cDNA contains both exons encoding an 843-aa polypeptide with a deduced MW of 94.642. This cDNA contains both exons encoding the protease inhibitor domains. Primer extension analysis indicates that the 5' terminus of this cDNA is 14 nt from a transcriptional start site. This cDNA, encoding the longest ABPP described to date, may explain some of the observations on the sizes of tissue-derived ABPP.
The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression
International Nuclear Information System (INIS)
Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.
2007-01-01
The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation
Koussis, Konstantinos; Goulielmaki, Evi; Chalari, Anna; Withers-Martinez, Chrislaine; Siden-Kiamos, Inga; Matuschewski, Kai; Loukeris, Thanasis G
2017-01-01
Site-2 proteases (S2P) belong to the M50 family of metalloproteases, which typically perform essential roles by mediating activation of membrane-bound transcription factors through regulated intramembrane proteolysis (RIP). Protease-dependent liberation of dormant transcription factors triggers diverse cellular responses, such as sterol regulation, Notch signalling and the unfolded protein response. Plasmodium parasites rely on regulated proteolysis for controlling essential pathways throughout the life cycle. In this study we examine the Plasmodium-encoded S2P in a murine malaria model and show that it is expressed in all stages of Plasmodium development. Localisation studies by endogenous gene tagging revealed that in all invasive stages the protein is in close proximity to the nucleus. Ablation of PbS2P by reverse genetics leads to reduced growth rates during liver and blood infection and, hence, virulence attenuation. Strikingly, absence of PbS2P was compatible with parasite life cycle progression in the mosquito and mammalian hosts under physiological conditions, suggesting redundant or dispensable roles in vivo.
Directory of Open Access Journals (Sweden)
Konstantinos Koussis
Full Text Available Site-2 proteases (S2P belong to the M50 family of metalloproteases, which typically perform essential roles by mediating activation of membrane-bound transcription factors through regulated intramembrane proteolysis (RIP. Protease-dependent liberation of dormant transcription factors triggers diverse cellular responses, such as sterol regulation, Notch signalling and the unfolded protein response. Plasmodium parasites rely on regulated proteolysis for controlling essential pathways throughout the life cycle. In this study we examine the Plasmodium-encoded S2P in a murine malaria model and show that it is expressed in all stages of Plasmodium development. Localisation studies by endogenous gene tagging revealed that in all invasive stages the protein is in close proximity to the nucleus. Ablation of PbS2P by reverse genetics leads to reduced growth rates during liver and blood infection and, hence, virulence attenuation. Strikingly, absence of PbS2P was compatible with parasite life cycle progression in the mosquito and mammalian hosts under physiological conditions, suggesting redundant or dispensable roles in vivo.
Indispensable Role of Proteases in Plant Innate Immunity.
Balakireva, Anastasia V; Zamyatnin, Andrey A
2018-02-23
Plant defense is achieved mainly through the induction of microbe-associated molecular patterns (MAMP)-triggered immunity (MTI), effector-triggered immunity (ETI), systemic acquired resistance (SAR), induced systemic resistance (ISR), and RNA silencing. Plant immunity is a highly complex phenomenon with its own unique features that have emerged as a result of the arms race between plants and pathogens. However, the regulation of these processes is the same for all living organisms, including plants, and is controlled by proteases. Different families of plant proteases are involved in every type of immunity: some of the proteases that are covered in this review participate in MTI, affecting stomatal closure and callose deposition. A large number of proteases act in the apoplast, contributing to ETI by managing extracellular defense. A vast majority of the endogenous proteases discussed in this review are associated with the programmed cell death (PCD) of the infected cells and exhibit caspase-like activities. The synthesis of signal molecules, such as salicylic acid, jasmonic acid, and ethylene, and their signaling pathways, are regulated by endogenous proteases that affect the induction of pathogenesis-related genes and SAR or ISR establishment. A number of proteases are associated with herbivore defense. In this review, we summarize the data concerning identified plant endogenous proteases, their effect on plant-pathogen interactions, their subcellular localization, and their functional properties, if available, and we attribute a role in the different types and stages of innate immunity for each of the proteases covered.
International Nuclear Information System (INIS)
Pestov, Nikolay B.; Zhao, Hao; Basrur, Venkatesha; Modyanov, Nikolai N.
2011-01-01
Highlights: → Structural properties of BetaM and Na,K-ATPase β-subunits are sharply different. → BetaM protein is concentrated in nuclear membrane of skeletal myocytes. → BetaM does not associate with a Na,K-ATPase α-subunit in skeletal muscle. → Polypeptide chain of the native BetaM is highly sensitive to endogenous proteases. → BetaM in neonatal muscle is a product of alternative splice mRNA variant B. -- Abstract: ATP1B4 genes represent a rare instance of the orthologous gene co-option that radically changed functions of encoded BetaM proteins during vertebrate evolution. In lower vertebrates, this protein is a β-subunit of Na,K-ATPase located in the cell membrane. In placental mammals, BetaM completely lost its ancestral role and through acquisition of two extended Glu-rich clusters into the N-terminal domain gained entirely new properties as a muscle-specific protein of the inner nuclear membrane possessing the ability to regulate gene expression. Strict temporal regulation of BetaM expression, which is the highest in late fetal and early postnatal myocytes, indicates that it plays an essential role in perinatal development. Here we report the first structural characterization of the native eutherian BetaM protein. It should be noted that, in contrast to structurally related Na,K-ATPase β-subunits, the polypeptide chain of BetaM is highly sensitive to endogenous proteases that greatly complicated its isolation. Nevertheless, using a complex of protease inhibitors, a sample of authentic BetaM was isolated from pig neonatal skeletal muscle by a combination of ion-exchange and lectin-affinity chromatography followed by SDS-PAGE. Results of the analysis of the BetaM tryptic digest using MALDI-TOF and ESI-MS/MS mass spectrometry have demonstrated that native BetaM in neonatal skeletal muscle is a product of alternative splice mRNA variant B and comprised of 351 amino acid residues. Isolated BetaM protein was also characterized by SELDI-TOF mass
Energy Technology Data Exchange (ETDEWEB)
Pestov, Nikolay B. [Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States); Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Moscow 117997 (Russian Federation); Zhao, Hao [Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States); Basrur, Venkatesha [Department of Pathology, University of Michigan Medical School, Ann Arbor, MI 48109 (United States); Modyanov, Nikolai N., E-mail: nikolai.modyanov@utoledo.edu [Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States)
2011-09-09
Highlights: {yields} Structural properties of BetaM and Na,K-ATPase {beta}-subunits are sharply different. {yields} BetaM protein is concentrated in nuclear membrane of skeletal myocytes. {yields} BetaM does not associate with a Na,K-ATPase {alpha}-subunit in skeletal muscle. {yields} Polypeptide chain of the native BetaM is highly sensitive to endogenous proteases. {yields} BetaM in neonatal muscle is a product of alternative splice mRNA variant B. -- Abstract: ATP1B4 genes represent a rare instance of the orthologous gene co-option that radically changed functions of encoded BetaM proteins during vertebrate evolution. In lower vertebrates, this protein is a {beta}-subunit of Na,K-ATPase located in the cell membrane. In placental mammals, BetaM completely lost its ancestral role and through acquisition of two extended Glu-rich clusters into the N-terminal domain gained entirely new properties as a muscle-specific protein of the inner nuclear membrane possessing the ability to regulate gene expression. Strict temporal regulation of BetaM expression, which is the highest in late fetal and early postnatal myocytes, indicates that it plays an essential role in perinatal development. Here we report the first structural characterization of the native eutherian BetaM protein. It should be noted that, in contrast to structurally related Na,K-ATPase {beta}-subunits, the polypeptide chain of BetaM is highly sensitive to endogenous proteases that greatly complicated its isolation. Nevertheless, using a complex of protease inhibitors, a sample of authentic BetaM was isolated from pig neonatal skeletal muscle by a combination of ion-exchange and lectin-affinity chromatography followed by SDS-PAGE. Results of the analysis of the BetaM tryptic digest using MALDI-TOF and ESI-MS/MS mass spectrometry have demonstrated that native BetaM in neonatal skeletal muscle is a product of alternative splice mRNA variant B and comprised of 351 amino acid residues. Isolated BetaM protein was
Biochemical Analysis of Two Single Mutants that Give Rise to a Polymorphic G6PD A-Double Mutant
Directory of Open Access Journals (Sweden)
Edson Jiovany Ramírez-Nava
2017-10-01
Full Text Available Glucose-6-phosphate dehydrogenase (G6PD is a key regulatory enzyme that plays a crucial role in the regulation of cellular energy and redox balance. Mutations in the gene encoding G6PD cause the most common enzymopathy that drives hereditary nonspherocytic hemolytic anemia. To gain insights into the effects of mutations in G6PD enzyme efficiency, we have investigated the biochemical, kinetic, and structural changes of three clinical G6PD variants, the single mutations G6PD A+ (Asn126AspD and G6PD Nefza (Leu323Pro, and the double mutant G6PD A− (Asn126Asp + Leu323Pro. The mutants showed lower residual activity (≤50% of WT G6PD and displayed important kinetic changes. Although all Class III mutants were located in different regions of the three-dimensional structure of the enzyme and were not close to the active site, these mutants had a deleterious effect over catalytic activity and structural stability. The results indicated that the G6PD Nefza mutation was mainly responsible for the functional and structural alterations observed in the double mutant G6PD A−. Moreover, our study suggests that the G6PD Nefza and G6PD A− mutations affect enzyme functions in a similar fashion to those reported for Class I mutations.
Distinct 3D Architecture and Dynamics of the Human HtrA2(Omi Protease and Its Mutated Variants.
Directory of Open Access Journals (Sweden)
Artur Gieldon
Full Text Available HtrA2(Omi protease controls protein quality in mitochondria and plays a major role in apoptosis. Its HtrA2S306A mutant (with the catalytic serine routinely disabled for an X-ray study to avoid self-degradation is a homotrimer whose subunits contain the serine protease domain (PD and the regulatory PDZ domain. In the inactive state, a tight interdomain interface limits penetration of both PDZ-activating ligands and PD substrates into their respective target sites. We successfully crystalized HtrA2V226K/S306A, whose active counterpart HtrA2V226K has had higher proteolytic activity, suggesting higher propensity to opening the PD-PDZ interface than that of the wild type HtrA2. Yet, the crystal structure revealed the HtrA2V226K/S306A architecture typical of the inactive protein. To get a consistent interpretation of crystallographic data in the light of kinetic results, we employed molecular dynamics (MD. V325D inactivating mutant was used as a reference. Our simulations demonstrated that upon binding of a specific peptide ligand NH2-GWTMFWV-COOH, the PDZ domains open more dynamically in the wild type protease compared to the V226K mutant, whereas the movement is not observed in the V325D mutant. The movement relies on a PDZ vs. PD rotation which opens the PD-PDZ interface in a lid-like (budding flower-like in trimer fashion. The noncovalent hinges A and B are provided by two clusters of interfacing residues, harboring V325D and V226K in the C- and N-terminal PD barrels, respectively. The opening of the subunit interfaces progresses in a sequential manner during the 50 ns MD simulation. In the systems without the ligand only minor PDZ shifts relative to PD are observed, but the interface does not open. Further activation-associated events, e.g. PDZ-L3 positional swap seen in any active HtrA protein (vs. HtrA2, were not observed. In summary, this study provides hints on the mechanism of activation of wtHtrA2, the dynamics of the inactive HtrA2V325D
Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko
2016-01-01
Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723
Yusuf, Y.; Hidayati, W.
2018-01-01
The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.
DEFF Research Database (Denmark)
Reppe, Sjur; Stilgren, Lis; Olstad, Ole K
2006-01-01
to bone and extra-cellular matrix, showed altered expression. Of these were 85 up- and 14 down-regulated before operation. The majority of regulated genes represented structural and adhesion proteins, but included also proteases and protease regulators which promote resorption. Increased expressions...... of collagen type 1 and osteocalcin mRNAs in disease reflecting the PTH anabolic action were paralleled by increased concentrations of these proteins in serum. In addition, genes encoding transcriptional factors and their regulators as well as cellular signal molecules were up-regulated during disease....... The identified genetic signature represents the first extensive description of the ensemble of bone and matrix related mRNAs, which are regulated by chronic PTH action. These results identify the molecular basis for this skeletal disease, and provide new insight into this clinical condition with potential...
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
Effects of TCDD on the expression of nuclear encoded mitochondrial genes
International Nuclear Information System (INIS)
Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy
2010-01-01
Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.
Effects of disruption of heat shock genes on susceptibility of Escherichia coli to fluoroquinolones
Directory of Open Access Journals (Sweden)
Morioka Mizue
2003-08-01
Full Text Available Abstract Background It is well known that expression of certain bacterial genes responds rapidly to such stimuli as exposure to toxic chemicals and physical agents. It is generally believed that the proteins encoded in these genes are important for successful survival of the organism under the hostile conditions. Analogously, the proteins induced in bacterial cells exposed to antibiotics are believed to affect the organisms' susceptibility to these agents. Results We demonstrated that Escherichia coli cells exposed to levofloxacin (LVFX, a fluoroquinolone (FQ, induce the syntheses of heat shock proteins and RecA. To examine whether the heat shock proteins affect the bactericidal action of FQs, we constructed E. coli strains with mutations in various heat shock genes and tested their susceptibility to FQs. Mutations in dnaK, groEL, and lon increased this susceptibility; the lon mutant exhibited the greatest effects. The increased susceptibility of the lon mutant was corroborated by experiments in which the gene encoding the cell division inhibitor, SulA, was subsequently disrupted. SulA is induced by the SOS response and degraded by the Lon protease. The findings suggest that the hypersusceptibility of the lon mutant to FQs could be due to abnormally high levels of SulA protein resulting from the depletion of Lon and the continuous induction of the SOS response in the presence of FQs. Conclusion The present results show that the bactericidal action of FQs is moderately affected by the DnaK and GroEL chaperones and strongly affected by the Lon protease. FQs have contributed successfully to the treatment of various bacterial infections, but their widespread use and often misuse, coupled with emerging resistance, have gradually compromised their utility. Our results suggest that agents capable of inhibiting the Lon protease have potential for combination therapy with FQs.
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.
Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua
2018-04-18
This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Stobart, Christopher C; Sexton, Nicole R; Munjal, Havisha; Lu, Xiaotao; Molland, Katrina L; Tomar, Sakshi; Mesecar, Andrew D; Denison, Mark R
2013-12-01
Human coronaviruses (CoVs) such as severe acute respiratory syndrome CoV (SARS-CoV) and Middle East respiratory syndrome CoV (MERS-CoV) cause epidemics of severe human respiratory disease. A conserved step of CoV replication is the translation and processing of replicase polyproteins containing 16 nonstructural protein domains (nsp's 1 to 16). The CoV nsp5 protease (3CLpro; Mpro) processes nsp's at 11 cleavage sites and is essential for virus replication. CoV nsp5 has a conserved 3-domain structure and catalytic residues. However, the intra- and intermolecular determinants of nsp5 activity and their conservation across divergent CoVs are unknown, in part due to challenges in cultivating many human and zoonotic CoVs. To test for conservation of nsp5 structure-function determinants, we engineered chimeric betacoronavirus murine hepatitis virus (MHV) genomes encoding nsp5 proteases of human and bat alphacoronaviruses and betacoronaviruses. Exchange of nsp5 proteases from HCoV-HKU1 and HCoV-OC43, which share the same genogroup, genogroup 2a, with MHV, allowed for immediate viral recovery with efficient replication albeit with impaired fitness in direct competition with wild-type MHV. Introduction of MHV nsp5 temperature-sensitive mutations into chimeric HKU1 and OC43 nsp5 proteases resulted in clear differences in viability and temperature-sensitive phenotypes compared with MHV nsp5. These data indicate tight genetic linkage and coevolution between nsp5 protease and the genomic background and identify differences in intramolecular networks regulating nsp5 function. Our results also provide evidence that chimeric viruses within coronavirus genogroups can be used to test nsp5 determinants of function and inhibition in common isogenic backgrounds and cell types.
Multiple genes encode the major surface glycoprotein of Pneumocystis carinii
DEFF Research Database (Denmark)
Kovacs, J A; Powell, F; Edman, J C
1993-01-01
hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...
Directory of Open Access Journals (Sweden)
Violeta Morin
Full Text Available Proteolysis of sperm histones in the sea urchin male pronucleus is the consequence of the activation at fertilization of a maternal cysteine protease. We previously showed that this protein is required for male chromatin remodelling and for cell-cycle progression in the newly formed embryos. This enzyme is present in the nucleus of unfertilized eggs and is rapidly recruited to the male pronucleus after insemination. Interestingly, this cysteine-protease remains co-localized with chromatin during S phase of the first cell cycle, migrates to the mitotic spindle in M-phase and is re-located to the nuclei of daughter cells after cytokinesis. Here we identified the protease encoding cDNA and found a high sequence identity to cathepsin proteases of various organisms. A phylogenetical analysis clearly demonstrates that this sperm histone protease (SpHp belongs to the cathepsin L sub-type. After an initial phase of ubiquitous expression throughout cleavage stages, SpHp gene transcripts become restricted to endomesodermic territories during the blastula stage. The transcripts are localized in the invaginating endoderm during gastrulation and a gut specific pattern continues through the prism and early pluteus stages. In addition, a concomitant expression of SpHp transcripts is detected in cells of the skeletogenic lineage and in accordance a pharmacological disruption of SpHp activity prevents growth of skeletal rods. These results further document the role of this nuclear cathepsin L during development.
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Sugimura; Sawabe; Ezura
2000-01-01
The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.
Ellfolk, Ulla; Huurinainen, Salla; Joutsa, Juho; Karrasch, Mira
2012-01-01
Free recall memory deficits are common at early stages of Parkinson's disease (PD). As most studies have used intentional memory tasks, there is little information on how non-intentional, incidental encoding conditions affect memory performance in PD. We studied possible differences between PD patients and controls on free recall using incidental and intentional visual memory tasks. Free recall was examined in relation to attentive/executive functioning and subjective memory complaints. A total of 29 non-demented, medicated PD patients (age 60, disease duration 19 months) and 29 healthy controls (age 61) participated in the study. Incidental free recall was studied using a memory-modification of the Boston naming test (Memo-BNT) and intentional free recall with the 20 Objects test. There was a significant main effect for group due to worse free recall performances in the PD group. No statistically significant interaction between group and encoding condition was observed. The free recall deficit in the PD group was related to cognitive/psychomotor slowing, but not to attentive/executive task demands, or to subjective memory complaints. The results indicate that PD patients are impaired on free recall irrespective of encoding condition.
Cloning and characterization of a novel cysteine protease gene ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
Cysteine proteases can be found in the animal and plant kingdoms as well as in some viruses and bacteria. They have been implemented in many ..... in developing resistance against pathogens and insects in other crops. Acknowledgments.
International Nuclear Information System (INIS)
Nebohacova, M.
2000-01-01
Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on
Shanks, John; Burtnick, Mary N; Brett, Paul J; Waag, David M; Spurgers, Kevin B; Ribot, Wilson J; Schell, Mark A; Panchal, Rekha G; Gherardini, Frank C; Wilkinson, Keith D; Deshazer, David
2009-04-01
Burkholderia mallei, a category B biothreat agent, is a facultative intracellular pathogen that causes the zoonotic disease glanders. The B. mallei VirAG two-component regulatory system activates the transcription of approximately 60 genes, including a large virulence gene cluster encoding a type VI secretion system (T6SS). The B. mallei tssM gene encodes a putative ubiquitin-specific protease that is physically linked to, and transcriptionally coregulated with, the T6SS gene cluster. Mass spectrometry and immunoblot analysis demonstrated that TssM was secreted in a virAG-dependent manner in vitro. Surprisingly, the T6SS was found to be dispensable for the secretion of TssM. The C-terminal half of TssM, which contains Cys and His box motifs conserved in eukaryotic deubiquitinases, was purified and biochemically characterized. Recombinant TssM hydrolyzed multiple ubiquitinated substrates and the cysteine at position 102 was critical for enzymatic activity. The tssM gene was expressed within 1 h after uptake of B. mallei into RAW 264.7 murine macrophages, suggesting that the TssM deubiquitinase is produced in this intracellular niche. Although the physiological substrate(s) is currently unknown, the TssM deubiquitinase may provide B. mallei a selective advantage in the intracellular environment during infection.
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
International Nuclear Information System (INIS)
Tong Xin; Luo Ying; Dong Yan; Sun Zhixian
1998-01-01
Objective: Increasing evidences suggest that Caspase family proteases play an important role in the effector mechanism of apoptotic cell death. Radiation (IR) can induce apoptosis in tumor cells, so it is very important to isolate and identify the member of the Caspase family proteases involved in IR-induced apoptosis, and this would contribute to the understanding of the mechanism responsible for apoptosis execution. Methods: A PCR approach to isolate genes for IR-induced apoptosis was developed. The approach used degenerated oligonucleotide encoding the highly conserved peptides that were present in all known Caspases. Results: Protease inhibitors special for Caspases could block the apoptotic cell death caused by IR, and Caspase-3 was isolated from irradiated human leukemia U937 cells. Conclusion: Caspases involve in IR-induced apoptosis, and Caspase-3 is the pivotal element of IR-induced apoptosis
Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa
2011-03-01
Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.
Shanks, John; Burtnick, Mary N.; Brett, Paul J.; Waag, David M.; Spurgers, Kevin B.; Ribot, Wilson J.; Schell, Mark A.; Panchal, Rekha G.; Gherardini, Frank C.; Wilkinson, Keith D.; DeShazer, David
2009-01-01
Burkholderia mallei, a category B biothreat agent, is a facultative intracellular pathogen that causes the zoonotic disease glanders. The B. mallei VirAG two-component regulatory system activates the transcription of ∼60 genes, including a large virulence gene cluster encoding a type VI secretion system (T6SS). The B. mallei tssM gene encodes a putative ubiquitin-specific protease that is physically linked to, and transcriptionally coregulated with, the T6SS gene cluster. Mass spectrometry and immunoblot analysis demonstrated that TssM was secreted in a virAG-dependent manner in vitro. Surprisingly, the T6SS was found to be dispensable for the secretion of TssM. The C-terminal half of TssM, which contains Cys and His box motifs conserved in eukaryotic deubiquitinases, was purified and biochemically characterized. Recombinant TssM hydrolyzed multiple ubiquitinated substrates and the cysteine at position 102 was critical for enzymatic activity. The tssM gene was expressed within 1 h after uptake of B. mallei into RAW 264.7 murine macrophages, suggesting that the TssM deubiquitinase is produced in this intracellular niche. Although the physiological substrate(s) is currently unknown, the TssM deubiquitinase may provide B. mallei a selective advantage in the intracellular environment during infection. PMID:19168747
Directory of Open Access Journals (Sweden)
Hélène Sanfaçon
2017-04-01
Full Text Available Strawberry mottle virus (SMoV, family Secoviridae, order Picornavirales is one of several viruses found in association with strawberry decline disease in Eastern Canada. The SMoV genome consists of two positive-sense single-stranded RNAs, each encoding one large polyprotein. The RNA1 polyprotein (P1 includes the domains for a putative helicase, a VPg, a 3C-like cysteine protease and an RNA-dependent RNA polymerase at its C-terminus, and one or two protein domains at its N-terminus. The RNA2 polyprotein (P2 is predicted to contain the domains for a movement protein (MP and one or several coat proteins at its N-terminus, and one or more additional domains for proteins of unknown function at its C-terminus. The RNA1-encoded 3C-like protease is presumed to cleave the two polyproteins in cis (P1 and in trans (P2. Using in vitro processing assays, we systematically scanned the two polyproteins for cleavage sites recognized by this protease. We identified five cis-cleavage sites in P1, with cleavage between the putative helicase and VPg domains being the most efficient. The presence of six protein domains in the SMoV P1, including two upstream of the putative helicase domain, is a feature shared with nepoviruses but not with comoviruses. Results from trans-cleavage assays indicate that the RNA1-encoded 3C-like protease recognized a single cleavage site, which was between the predicted MP and coat protein domains in the P2 polyprotein. The cleavage site consensus sequence for the SMoV 3C-like protease is AxE (E or Q/(G or S.
OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2008-12-01
Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
Schistosome serine protease inhibitors: parasite defense or homeostasis?
Directory of Open Access Journals (Sweden)
Landys A. Lopez Quezada
2011-06-01
Full Text Available Serpins are a structurally conserved family of macromolecular inhibitors found in numerous biological systems. The completion and annotation of the genomes of Schistosoma mansoni and Schistosoma japonicum has enabled the identification by phylogenetic analysis of two major serpin clades. S. mansoni shows a greater multiplicity of serpin genes, perhaps reflecting adaptation to infection of a human host. Putative targets of schistosome serpins can be predicted from the sequence of the reactive center loop (RCL. Schistosome serpins may play important roles in both post-translational regulation of schistosome-derived proteases, as well as parasite defense mechanisms against the action of host proteases.Serpinas são uma família de inibidores macromoleculares estruturalmente conservados encontrados em inúmeros sistemas biológicos. O término e a anotação dos genomas de Schistosoma mansoni e de Schistosoma japonicum permitiram a identificação por análise filogenética de dois principais clados de serpinas. S. mansoni mostra uma multiplicidade maior de genes de serpinas, talvez refletindo uma adaptação à infecção de um hospedeiro humano. Alvos putativos das serpinas de esquistossomos podem ser preditos a partir da sequência do "loop" do centro reativo. Serpinas de esquistossomos podem ter importantes papeis tanto na regulação pós-traducional de proteases derivadas do esquistossoma, quanto nos mecanismos de defesa contra a ação de proteases do hospedeiro.
Directory of Open Access Journals (Sweden)
Little Tom J
2009-06-01
Full Text Available Abstract Background Mosquitoes of the Anopheles gambiae species complex are the primary vectors of human malaria in sub-Saharan Africa. Many host genes have been shown to affect Plasmodium development in the mosquito, and so are expected to engage in an evolutionary arms race with the pathogen. However, there is little conclusive evidence that any of these mosquito genes evolve rapidly, or show other signatures of adaptive evolution. Methods Three serine protease inhibitors have previously been identified as candidate immune system genes mediating mosquito-Plasmodium interaction, and serine protease inhibitors have been identified as hot-spots of adaptive evolution in other taxa. Population-genetic tests for selection, including a recent multi-gene extension of the McDonald-Kreitman test, were applied to 16 serine protease inhibitors and 16 other genes sampled from the An. gambiae species complex in both East and West Africa. Results Serine protease inhibitors were found to show a marginally significant trend towards higher levels of amino acid diversity than other genes, and display extensive genetic structuring associated with the 2La chromosomal inversion. However, although serpins are candidate targets for strong parasite-mediated selection, no evidence was found for rapid adaptive evolution in these genes. Conclusion It is well known that phylogenetic and population history in the An. gambiae complex can present special problems for the application of standard population-genetic tests for selection, and this may explain the failure of this study to detect selection acting on serine protease inhibitors. The pitfalls of uncritically applying these tests in this species complex are highlighted, and the future prospects for detecting selection acting on the An. gambiae genome are discussed.
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
Protease and protease inhibitory activity in pregnant and postpartum involuting uterus
International Nuclear Information System (INIS)
Milwidsky, A.; Beller, U.; Palti, Z.; Mayer, M.
1982-01-01
The presence of two distinct proteolytic activities in the rat uterus was confirmed with 14 C-labeled globin used as a sensitive protein substrate and following release of label into the trichloroacetic acid-soluble supernatant fraction. Protease I is a cytoplasmic acid protease while protease II is associated with the pellet fraction, can be extracted by 0.6 M sodium chloride, and is active at pH 7.0. Protease I activity is low during pregnancy and markedly increases at term achieving maximal activity at day 3 post partum with a subsequent decline to preterm activity values. Lactation did not affect the uterine protease I activity. Protease II activity is not significantly different during pregnancy, at term, and post partum. The presence of an inhibitor of protease I was suggested by a decrease in enzyme activity with an increased cytosolic protein concentration. The inhibitor also lessened bovine trypsin activity but had no effect on protease II. Although its inhibitory potency on trypsin fluctuated during the various uterine physiologic stages, these changes appeared to be statistically insignificant. Human uterine samples were also found to contain the two protease activities with similar changes in protease I post partum. It is suggested that, both in the rat and in man, uterine involution post partum is associated with a marked increase in activity of acid cytosolic protease, while a particulate neutral protease and a soluble inhibitor of trypsin, which are also present in uterine cells, do not appear to play a significant role in the dissolution of uterine tissues after parturition
Optimizing HIV-1 protease production in Escherichia coli as fusion protein
Directory of Open Access Journals (Sweden)
Piubelli Luciano
2011-06-01
Full Text Available Abstract Background Human immunodeficiency virus (HIV is the etiological agent in AIDS and related diseases. The aspartyl protease encoded by the 5' portion of the pol gene is responsible for proteolytic processing of the gag-pol polyprotein precursor to yield the mature capsid protein and the reverse transcriptase and integrase enzymes. The HIV protease (HIV-1Pr is considered an attractive target for designing inhibitors which could be used to tackle AIDS and therefore it is still the object of a number of investigations. Results A recombinant human immunodeficiency virus type 1 protease (HIV-1Pr was overexpressed in Escherichia coli cells as a fusion protein with bacterial periplasmic protein dithiol oxidase (DsbA or glutathione S-transferase (GST, also containing a six-histidine tag sequence. Protein expression was optimized by designing a suitable HIV-1Pr cDNA (for E. coli expression and to avoid autoproteolysis and by screening six different E. coli strains and five growth media. The best expression yields were achieved in E. coli BL21-Codon Plus(DE3-RIL host and in TB or M9 medium to which 1% (w/v glucose was added to minimize basal expression. Among the different parameters assayed, the presence of a buffer system (based on phosphate salts and a growth temperature of 37°C after adding IPTG played the main role in enhancing protease expression (up to 10 mg of chimeric DsbA:HIV-1Pr/L fermentation broth. GST:HIVPr was in part (50% produced as soluble protein while the overexpressed DsbA:HIV-1Pr chimeric protein largely accumulated in inclusion bodies as unprocessed fusion protein. A simple refolding procedure was developed on HiTrap Chelating column that yielded a refolded DsbA:HIV-1Pr with a > 80% recovery. Finally, enterokinase digestion of resolubilized DsbA:HIV-1Pr gave more than 2 mg of HIV-1Pr per liter of fermentation broth with a purity ≤ 80%, while PreScission protease cleavage of soluble GST:HIVPr yielded ~ 0.15 mg of pure HIV-1
Directory of Open Access Journals (Sweden)
Kishor Duwadi
Full Text Available Plants are an attractive host system for pharmaceutical protein production. Many therapeutic proteins have been produced and scaled up in plants at a low cost compared to the conventional microbial and animal-based systems. The main technical challenge during this process is to produce sufficient levels of recombinant proteins in plants. Low yield is generally caused by proteolytic degradation during expression and downstream processing of recombinant proteins. The yield of human therapeutic interleukin (IL-10 produced in transgenic tobacco leaves was found to be below the critical level, and may be due to degradation by tobacco proteases. Here, we identified a total of 60 putative cysteine protease genes (CysP in tobacco. Based on their predicted expression in leaf tissue, 10 candidate CysPs (CysP1-CysP10 were selected for further characterization. The effect of CysP gene silencing on IL-10 accumulation was examined in tobacco. It was found that the recombinant protein yield in tobacco could be increased by silencing CysP6. Transient expression of CysP6 silencing construct also showed an increase in IL-10 accumulation in comparison to the control. Moreover, CysP6 localizes to the endoplasmic reticulum (ER, suggesting that ER may be the site of IL-10 degradation. Overall results suggest that CysP6 is important in determining the yield of recombinant IL-10 in tobacco leaves.
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J
1997-06-01
Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E
Wang, Jinshan; Wang, Fenghua; Tan, Yusheng; Chen, Xia; Zhao, Qi; Fu, Sheng; Li, Shuang; Chen, Cheng; Yang, Haitao
2014-12-01
Feline infectious peritonitis virus (FIPV) causes a lethal systemic granulomatous disease in wild and domestic cats around the world. Currently, no effective vaccines or drugs have been developed against it. As a member of the genus Alphacoronavirus, FIPV encodes two polyprotein precursors required for genome replication and transcription. Each polyprotein undergoes extensive proteolytic processing, resulting in functional subunits. This process is mainly mediated by its genome-encoded main protease, which is an attractive target for antiviral drug design. In this study, the main protease of FIPV in complex with a Michael acceptor-type inhibitor was crystallized. The complex crystals diffracted to 2.5 Å resolution and belonged to space group I422, with unit-cell parameters a = 112.3, b = 112.3, c = 102.1 Å. There is one molecule per asymmetric unit.
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
Transcriptional and proteomic analysis of the Aspergillus fumigatus ΔprtT protease-deficient mutant.
Hagag, Shelly; Kubitschek-Barreira, Paula; Neves, Gabriela W P; Amar, David; Nierman, William; Shalit, Itamar; Shamir, Ron; Lopes-Bezerra, Leila; Osherov, Nir
2012-01-01
Aspergillus fumigatus is the most common opportunistic mold pathogen of humans, infecting immunocompromised patients. The fungus invades the lungs and other organs, causing severe damage. Penetration of the pulmonary epithelium is a key step in the infectious process. A. fumigatus produces extracellular proteases to degrade the host structural barriers. The A. fumigatus transcription factor PrtT controls the expression of multiple secreted proteases. PrtT shows similarity to the fungal Gal4-type Zn(2)-Cys(6) DNA-binding domain of several transcription factors. In this work, we further investigate the function of this transcription factor by performing a transcriptional and a proteomic analysis of the ΔprtT mutant. Unexpectedly, microarray analysis revealed that in addition to the expected decrease in protease expression, expression of genes involved in iron uptake and ergosterol synthesis was dramatically decreased in the ΔprtT mutant. A second finding of interest is that deletion of prtT resulted in the upregulation of four secondary metabolite clusters, including genes for the biosynthesis of toxic pseurotin A. Proteomic analysis identified reduced levels of three secreted proteases (ALP1 protease, TppA, AFUA_2G01250) and increased levels of three secreted polysaccharide-degrading enzymes in the ΔprtT mutant possibly in response to its inability to derive sufficient nourishment from protein breakdown. This report highlights the complexity of gene regulation by PrtT, and suggests a potential novel link between the regulation of protease secretion and the control of iron uptake, ergosterol biosynthesis and secondary metabolite production in A. fumigatus.
International Nuclear Information System (INIS)
Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.
1990-01-01
The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
Noar, Roslyn D; Daub, Margaret E
2016-08-30
Mycosphaerella fijiensis, causative agent of the black Sigatoka disease of banana, is considered the most economically damaging banana disease. Despite its importance, the genetics of pathogenicity are poorly understood. Previous studies have characterized polyketide pathways with possible roles in pathogenicity. To identify additional candidate pathogenicity genes, we compared the transcriptome of this fungus during the necrotrophic phase of infection with that during saprophytic growth in medium. Transcriptome analysis was conducted, and the functions of differentially expressed genes were predicted by identifying conserved domains, Gene Ontology (GO) annotation and GO enrichment analysis, Carbohydrate-Active EnZymes (CAZy) annotation, and identification of genes encoding effector-like proteins. The analysis showed that genes commonly involved in secondary metabolism have higher expression in infected leaf tissue, including genes encoding cytochrome P450s, short-chain dehydrogenases, and oxidoreductases in the 2-oxoglutarate and Fe(II)-dependent oxygenase superfamily. Other pathogenicity-related genes with higher expression in infected leaf tissue include genes encoding salicylate hydroxylase-like proteins, hydrophobic surface binding proteins, CFEM domain-containing proteins, and genes encoding secreted cysteine-rich proteins characteristic of effectors. More genes encoding amino acid transporters, oligopeptide transporters, peptidases, proteases, proteinases, sugar transporters, and proteins containing Domain of Unknown Function (DUF) 3328 had higher expression in infected leaf tissue, while more genes encoding inhibitors of peptidases and proteinases had higher expression in medium. Sixteen gene clusters with higher expression in leaf tissue were identified including clusters for the synthesis of a non-ribosomal peptide. A cluster encoding a novel fusicoccane was also identified. Two putative dispensable scaffolds were identified with a large proportion of
Liu, H-W; Wang, L-L; Meng, Z; Tang, X; Li, Y-S; Xia, Q-Y; Zhao, P
2017-10-01
Clip domain serine proteases (CLIPs), characterized by one or more conserved clip domains, are essential components of extracellular signalling cascades in various biological processes, especially in innate immunity and the embryonic development of insects. Additionally, CLIPs may have additional non-immune functions in insect development. In the present study, the clip domain serine protease gene Bombyx mori serine protease 95 (BmSP95), which encodes a 527-residue protein, was cloned from the integument of B. mori. Bioinformatics analysis indicated that BmSP95 is a typical CLIP of the subfamily D and possesses a clip domain at the N terminus, a trypsin-like serine protease (tryp_spc) domain at the C terminus and a conserved proline-rich motif between these two domains. At the transcriptional level, BmSP95 is expressed in the integument during moulting and metamorphosis, and the expression pattern is consistent with the fluctuating 20-hydroxyecdysone (20E) titre in B. mori. At the translational level, BmSP95 protein is synthesized in the epidermal cells, secreted as a zymogen and activated in the moulting fluid. Immunofluorescence revealed that BmSP95 is distributed into the old endocuticle in the moulting stage. The expression of BmSP95 was upregulated by 20E. Moreover, expression of BmSP95 was downregulated by pathogen infection. RNA interference-mediated silencing of BmSP95 led to delayed moulting from pupa to moth. These results suggest that BmSP95 is involved in integument remodelling during moulting and metamorphosis. © 2017 The Royal Entomological Society.
A plastome mutation affects processing of both chloroplast and nuclear DNA-encoded plastid proteins.
Johnson, E M; Schnabelrauch, L S; Sears, B B
1991-01-01
Immunoblotting of a chloroplast mutant (pm7) of Oenothera showed that three proteins, cytochrome f and the 23 kDa and 16 kDa subunits of the oxygen-evolving subcomplex of photosystem II, were larger than the corresponding mature proteins of the wild type and, thus, appear to be improperly processed in pm7. The mutant is also chlorotic and has little or no internal membrane development in the plastids. The improperly processed proteins, and other proteins that are completely missing, represent products of both the plastid and nuclear genomes. To test for linkage of these defects, a green revertant of pm7 was isolated from cultures in which the mutant plastids were maintained in a nuclear background homozygous for the plastome mutator (pm) gene. In this revertant, all proteins analyzed co-reverted to the wild-type condition, indicating that a single mutation in a plastome gene is responsible for the complex phenotype of pm7. These results suggest that the defect in pm7 lies in a gene that affects a processing protease encoded in the chloroplast genome.
DEFF Research Database (Denmark)
Kristensen, Michael; Lok, Finn; Planchot, Véronique
1999-01-01
with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...
Cross genome comparisons of serine proteases in Arabidopsis and rice
Directory of Open Access Journals (Sweden)
Sowdhamini R
2006-08-01
Full Text Available Abstract Background Serine proteases are one of the largest groups of proteolytic enzymes found across all kingdoms of life and are associated with several essential physiological pathways. The availability of Arabidopsis thaliana and rice (Oryza sativa genome sequences has permitted the identification and comparison of the repertoire of serine protease-like proteins in the two plant species. Results Despite the differences in genome sizes between Arabidopsis and rice, we identified a very similar number of serine protease-like proteins in the two plant species (206 and 222, respectively. Nearly 40% of the above sequences were identified as potential orthologues. Atypical members could be identified in the plant genomes for Deg, Clp, Lon, rhomboid proteases and species-specific members were observed for the highly populated subtilisin and serine carboxypeptidase families suggesting multiple lateral gene transfers. DegP proteases, prolyl oligopeptidases, Clp proteases and rhomboids share a significantly higher percentage orthology between the two genomes indicating substantial evolutionary divergence was set prior to speciation. Single domain architectures and paralogues for several putative subtilisins, serine carboxypeptidases and rhomboids suggest they may have been recruited for additional roles in secondary metabolism with spatial and temporal regulation. The analysis reveals some domain architectures unique to either or both of the plant species and some inactive proteases, like in rhomboids and Clp proteases, which could be involved in chaperone function. Conclusion The systematic analysis of the serine protease-like proteins in the two plant species has provided some insight into the possible functional associations of previously uncharacterised serine protease-like proteins. Further investigation of these aspects may prove beneficial in our understanding of similar processes in commercially significant crop plant species.
Pettit, Steven C; Gulnik, Sergei; Everitt, Lori; Kaplan, Andrew H
2003-01-01
Activation of the human immunodeficiency virus type 1 (HIV-1) protease is an essential step in viral replication. As is the case for all retroviral proteases, enzyme activation requires the formation of protease homodimers. However, little is known about the mechanisms by which retroviral proteases become active within their precursors. Using an in vitro expression system, we have examined the determinants of activation efficiency and the order of cleavage site processing for the protease of HIV-1 within the full-length GagPol precursor. Following activation, initial cleavage occurs between the viral p2 and nucleocapsid proteins. This is followed by cleavage of a novel site located in the transframe domain. Mutational analysis of the dimer interface of the protease produced differential effects on activation and specificity. A subset of mutations produced enhanced cleavage at the amino terminus of the protease, suggesting that, in the wild-type precursor, cleavages that liberate the protease are a relatively late event. Replacement of the proline residue at position 1 of the protease dimer interface resulted in altered cleavage of distal sites and suggests that this residue functions as a cis-directed specificity determinant. In summary, our studies indicate that interactions within the protease dimer interface help determine the order of precursor cleavage and contribute to the formation of extended-protease intermediates. Assembly domains within GagPol outside the protease domain also influence enzyme activation.
Directory of Open Access Journals (Sweden)
Rong Pan
2010-01-01
Full Text Available The alimentary tract of earthworm secretes a group of proteases with a relative wide substrate specificity. In 1983, six isozymes were isolated from earthworm with fibrinolytic activities and called fibriniolytic enzymes. So far, more isozymes have been found from different earthworm species such as Lumbricus rubellus and Eisenia fetida. For convenience, the proteases are named on the basis of the earthworm species and the protein function, for instance, Eisenia fetida protease (EfP. The proteases have the abilities not only to hydrolyze fibrin and other protein, but also activate proenzymes such as plasminogen and prothrombin. In the light of recent studies, eight of the EfPs contain oligosaccharides chains which are thought to support the enzyme structure. Interestingly, EfP-II has a broader substrate specificity presenting alkaline trypsin, chymotrypsin and elastase activities, but EfP-III-1 has a stricter specificity. The protein crystal structures show the characteristics in their specificities. Earthworm proteases have been applied in several areas such as clinical treatment of clotting diseases, anti-tumor study, environmental protection and nutritional production. The current clinical utilizations and some potential new applications of the earthworm protease will be discussed in this paper.
International Nuclear Information System (INIS)
Pan, R.; Zhang, Z.; He, R.
2010-01-01
The alimentary tract of earthworm secretes a group of proteases with a relative wide substrate specificity. In 1983, six isozymes were isolated from earthworm with fibrinolytic activities and called fibrinolytic enzymes. So far, more isozymes have been found from different earthworm species such as Lumbricus rubellus and Eisenia fetida. For convenience, the proteases are named on the basis of the earthworm species and the protein function, for instance, Eisenia fetida protease (EfP). The proteases have the abilities not only to hydrolyze fibrin and other protein, but also activate pro enzymes such as plasminogen and prothrombin. In the light of recent studies, eight of the EfPs contain oligosaccharides chains which are thought to support the enzyme structure. Interestingly, EfP-II has a broader substrate specificity presenting alkaline trypsin, chymotrypsin and elastase activities, but EfP-III-1 has a stricter specificity. The protein crystal structures show the characteristics in their specificities. Earthworm proteases have been applied in several areas such as clinical treatment of clotting diseases, anti-tumor study, environmental protection and nutritional production. The current clinical utilizations and some potential new applications of the earthworm protease will be discussed in this paper.
Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd
2015-09-01
Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.
Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong
2016-01-01
Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Huanqiang Zhao
2016-08-01
Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Baiquan Ma
2015-11-01
Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.
The bioenergetic status relates to dopamine neuron loss in familial PD with PINK1 mutations.
Directory of Open Access Journals (Sweden)
Rüediger Hilker
Full Text Available Mutations in the PINK1 gene cause autosomal recessive familial Parkinson's disease (PD. The gene encodes a mitochondrial protein kinase that plays an important role in maintaining mitochondrial function and integrity. However, the pathophysiological link between mutation-related bioenergetic deficits and the degenerative process in dopaminergic neurons remains to be elucidated. We performed phosphorous ((31P and proton ((1H 3-T magnetic resonance spectroscopic imaging (MRSI in 11 members of a German family with hereditary PD due to PINK1 mutations (PARK6 compared to 23 age-matched controls. All family members had prior 18-Fluorodopa (FDOPA positron emission tomography (PET. The striatal FDOPA uptake was correlated with quantified metabolic brain mapping in MRSI. At group level, the heterozygous PINK1 mutation carriers did not show any MRSI abnormalities relative to controls. In contrast, homozygous individuals with manifest PD had putaminal GPC, PCr, HEP and β-ATP levels well above the 2SD range of controls. Across all subjects, the FDOPA K(i values correlated positively with MI (r = 0.879, p<0.001 and inversely with β-ATP (r = -0.784, p = 0.008 and GPC concentrations (r = -0.651, p = 0.030 in the putamen. Our combined imaging data suggest that the dopaminergic deficit in this family with PD due to PINK1 mutations relates to osmolyte dysregulation, while the delivery of high energy phosphates was preserved. Our results corroborate the hypothesis that PINK1 mutations result in reduced neuronal survival, most likely due to impaired cellular stress resistance.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H
1994-05-03
Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)
Directory of Open Access Journals (Sweden)
Nadja Knoll
Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.
Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H
1994-01-01
Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...
Hemmer, O; Greif, C; Dufourcq, P; Reinbolt, J; Fritsch, C
1995-01-10
Translation of tomato black ring virus (TBRV) RNA-1 in a rabbit reticulocyte lysate leads to the synthesis of a 250K polyprotein which cleaves itself into smaller proteins of 50, 60, 120, and 190K. Polypeptides synthesized from synthetic transcripts corresponding to different regions of TBRV RNA-1 are processed only when they encode the 23K protein delimited earlier by sequence homology with the cowpea mosaic virus 24K protease. The proteolytic activity of this protein is completely lost by mutating residues C170 (to I) or L188 (to H), residues which align with conserved residues of the viral serine-like proteases. The 120K protein is generated by cleavage of the dipeptide K/A localized in front of the VPg but is not further cleaved in vitro at the K/S site (at the C terminus of the VPg) or between the protease and polymerase domains. However, both the protein VPgProPol (120K) and the protein ProPol (117K) produced in vitro from synthetic transcripts can cleave in trans the RNA-2-encoded 150K polyprotein, but they cannot cleave in trans polypeptides containing a cleavage site expressed from RNA-1 transcripts in which the protease cistron is absent or modified.
Directory of Open Access Journals (Sweden)
Muscariello Lidia
2006-05-01
Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc
Co-evolution of insect proteases and plant protease inhibitors.
Jongsma, Maarten A; Beekwilder, Jules
2011-08-01
Plants are at the basis of the food chain, but there is no such thing as a "free lunch" for herbivores. To promote reproductive success, plants evolved multi-layered defensive tactics to avoid or discourage herbivory. To the detriment of plants, herbivores, in turn, evolved intricate strategies to find, eat, and successfully digest essential plant parts to raise their own offspring. In this battle the digestive tract is the arena determining final victory or defeat as measured by growth or starvation of the herbivore. Earlier, specific molecular opponents were identified as proteases and inhibitors: digestive proteases of herbivores evolved structural motifs to occlude plant protease inhibitors, or alternatively, the insects evolved proteases capable of specifically degrading the host plant inhibitors. In response plant inhibitors evolved hyper-variable and novel protein folds to remain active against potential herbivores. At the level of protease regulation in herbivorous insects, it was shown that inhibition-insensitive digestive proteases are up-regulated when sensitive proteases are inhibited. The way this regulation operates in mammals is known as negative feedback by gut-luminal factors, so-called 'monitor peptides' that are sensitive to the concentration of active enzymes. We propose that regulation of gut enzymes by endogenous luminal factors has been an open invitation to plants to "hijack" this regulation by evolving receptor antagonists, although yet these plant factors have not been identified. In future research the question of the co-evolution of insect proteases and plant inhibitors should, therefore, be better approached from a systems level keeping in mind that evolution is fundamentally opportunistic and that the plant's fitness is primarily improved by lowering the availability of essential amino acids to an herbivore by any available mechanism.
Radio and optical observations of 0218+357 - The smallest Einstein ring?
O'Dea, Christopher P.; Baum, Stefi A.; Stanghellini, Carlo; Dey, Arjun; Van Breugel, Wil; Deustua, Susana; Smith, Eric P.
1992-01-01
VLA radio observations and optical imaging and spectroscopy of the Einstein radio ring 0218+357 are presented. The ring is detected at 22.4 GHz and shows a basically similar structure at 5, 15, and 22.4 GHz. The B component has varied and was about 15 percent brighter in the 8.4 GHz data than in the data of Patnaik et al. (1992). The ring is highly polarized. A weak jetlike feature extending out roughly 2 arcsec to the southeast of component A is detected at 6 cm. The source has amorphous radio structure extending out to about 11 arcsec from the core. For an adopted redshift of 0.68, the extended radio emission is very powerful. The optical spectrum is rather red and shows no strong features. A redshift of about 0.68 is obtained. The identification is a faint compact m(r) about 20 galaxy which extends to about 4.5 arcsec (about 27 kpc). As much as 50 percent of the total light may be due to a central AGN. The observed double core and ring may be produced by an off-center radio core with extended radio structure.
Structure and chromosomal localization of the human renal kallikrein gene
International Nuclear Information System (INIS)
Evans, B.A.; Yun, Z.X.; Close, J.A.
1988-01-01
Glandular kallikreins are a family of proteases encoded by a variable number of genes in different mammalian species. In all species examined, however, one particular kallikrein is functionally conserved in its capacity to release the vasoactive peptide, Lys-bradykinin, from low molecular weight kininogen. This kallikrein is found in the kidney, pancreas, and salivary gland, showing a unique pattern of tissue-specific expression relative to other members of the family. The authors have isolated a genomic clone carrying the human renal kallikrein gene and compared the nucleotide sequence of its promoter region with those of the mouse renal kallikrein gene and another mouse kallikrein gene expressed in a distinct cell type. They find four sequence elements conserved between renal kallikrein genes from the two species. They have also shown that the human gene is localized to 19q13, a position analogous to that of the kallikrein gene family on mouse chromosome 7
Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing
2016-10-01
Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb
Gene-Environment Interaction in Parkinson's Disease: Coffee, ADORA2A, and CYP1A2.
Chuang, Yu-Hsuan; Lill, Christina M; Lee, Pei-Chen; Hansen, Johnni; Lassen, Christina F; Bertram, Lars; Greene, Naomi; Sinsheimer, Janet S; Ritz, Beate
2016-01-01
Drinking caffeinated coffee has been reported to provide protection against Parkinson's disease (PD). Caffeine is an adenosine A2A receptor (encoded by the gene ADORA2A) antagonist that increases dopaminergic neurotransmission and Cytochrome P450 1A2 (gene: CYP1A2) metabolizes caffeine; thus, gene polymorphisms in ADORA2A and CYP1A2 may influence the effect coffee consumption has on PD risk. In a population-based case-control study (PASIDA) in Denmark (1,556 PD patients and 1,606 birth year- and gender-matched controls), we assessed interactions between lifetime coffee consumption and 3 polymorphisms in ADORA2A and CYP1A2 for all subjects, and incident and prevalent PD cases separately using logistic regression models. We also conducted a meta-analysis combining our results with those from previous studies. We estimated statistically significant interactions for ADORA2A rs5760423 and heavy vs. light coffee consumption in incident (OR interaction = 0.66 [95% CI 0.46-0.94], p = 0.02) but not prevalent PD. We did not observe interactions for CYP1A2 rs762551 and rs2472304 in incident or prevalent PD. In meta-analyses, PD associations with daily coffee consumption were strongest among carriers of variant alleles in both ADORA2A and CYP1A2. We corroborated results from a previous report that described interactions between ADORA2A and CYP1A2 polymorphisms and coffee consumption. Our results also suggest that survivor bias may affect results of studies that enroll prevalent PD cases. © 2017 S. Karger AG, Basel.
Saibi, Walid; Zouari, Nabil; Masmoudi, Khaled; Brini, Faiçal
2016-04-01
Dehydrins are claimed to stabilize macromolecules against freezing damage, dehydration, ionic or osmotic stresses, thermal stress and re-folding yield. However, their precise function remains unknown. In this context, we report the behavior of protease activities in dehydrin transgenic Arabidopsis lines against the wild type plant under salt stress (100mM NaCl). Indeed, proteases play key roles in plants, maintaining strict protein quality control and degrading specific sets of proteins in response to diverse environmental and developmental stimuli. We proved that durum wheat DHN-5 modulates the activity of some proteases, summarized on the promotion of the Cysteinyl protease and the decrease of the Aspartyl protease activity. This fact is also upgraded in salt stress conditions. We conclude that the dehydrin transgenic context encodes salinity tolerance in transgenic lines through the modulation of the interaction not only at transcriptional level but also at protein level and also with the impact of salt stress as an endogenous and exogenous effector on some biocatalysts like proteases. Copyright © 2016 Elsevier B.V. All rights reserved.
2013-01-01
Background Aspartic proteases (APs) are a large family of proteolytic enzymes found in almost all organisms. In plants, they are involved in many biological processes, such as senescence, stress responses, programmed cell death, and reproduction. Prior to the present study, no grape AP gene(s) had been reported, and their research on woody species was very limited. Results In this study, a total of 50 AP genes (VvAP) were identified in the grape genome, among which 30 contained the complete ASP domain. Synteny analysis within grape indicated that segmental and tandem duplication events contributed to the expansion of the grape AP family. Additional analysis between grape and Arabidopsis demonstrated that several grape AP genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grape and Arabidopsis. Phylogenetic relationships of the 30 VvAPs with the complete ASP domain and their Arabidopsis orthologs, as well as their gene and protein features were analyzed and their cellular localization was predicted. Moreover, expression profiles of VvAP genes in six different tissues were determined, and their transcript abundance under various stresses and hormone treatments were measured. Twenty-seven VvAP genes were expressed in at least one of the six tissues examined; nineteen VvAPs responded to at least one abiotic stress, 12 VvAPs responded to powdery mildew infection, and most of the VvAPs responded to SA and ABA treatments. Furthermore, integrated synteny and phylogenetic analysis identified orthologous AP genes between grape and Arabidopsis, providing a unique starting point for investigating the function of grape AP genes. Conclusions The genome-wide identification, evolutionary and expression analyses of grape AP genes provide a framework for future analysis of AP genes in defining their roles during stress response. Integrated synteny and phylogenetic analyses provide novel insight into the
Directory of Open Access Journals (Sweden)
Bingzhi Chen
Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.
Gene-environment interactions linking air pollution and inflammation in Parkinson's disease.
Lee, Pei-Chen; Raaschou-Nielsen, Ole; Lill, Christina M; Bertram, Lars; Sinsheimer, Janet S; Hansen, Johnni; Ritz, Beate
2016-11-01
Both air pollution exposure and systemic inflammation have been linked to Parkinson's disease (PD). In the PASIDA study, 408 incident cases of PD diagnosed in 2006-2009 and their 495 population controls were interviewed and provided DNA samples. Markers of long term traffic related air pollution measures were derived from geographic information systems (GIS)-based modeling. Furthermore, we genotyped functional polymorphisms in genes encoding proinflammatory cytokines, namely rs1800629 in TNFα (tumor necrosis factor alpha) and rs16944 in IL1B (interleukin-1β). In logistic regression models, long-term exposure to NO 2 increased PD risk overall (odds ratio (OR)=1.06 per 2.94μg/m 3 increase, 95% CI=1.00-1.13). The OR for PD in individuals with high NO 2 exposure (≧75th percentile) and the AA genotype of IL1B rs16944 was 3.10 (95% CI=1.14-8.38) compared with individuals with lower NO 2 exposure (<75th percentile) and the GG genotype. The interaction term was nominally significant on the multiplicative scale (p=0.01). We did not find significant gene-environment interactions with TNF rs1800629. Our finds may provide suggestive evidence that a combination of traffic-related air pollution and genetic variation in the proinflammatory cytokine gene IL1B contribute to risk of developing PD. However, as statistical evidence was only modest in this large sample we cannot rule out that these results represent a chance finding, and additional replication efforts are warranted. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Borchardt Stephanie M
2006-07-01
Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.
Zou, Zhi; Huang, Qixing; Xie, Guishui; Yang, Lifu
2018-01-10
Papain-like cysteine proteases (PLCPs) are a class of proteolytic enzymes involved in many plant processes. Compared with the extensive research in Arabidopsis thaliana, little is known in castor bean (Ricinus communis) and physic nut (Jatropha curcas), two Euphorbiaceous plants without any recent whole-genome duplication. In this study, a total of 26 or 23 PLCP genes were identified from the genomes of castor bean and physic nut respectively, which can be divided into nine subfamilies based on the phylogenetic analysis: RD21, CEP, XCP, XBCP3, THI, SAG12, RD19, ALP and CTB. Although most of them harbor orthologs in Arabidopsis, several members in subfamilies RD21, CEP, XBCP3 and SAG12 form new groups or subgroups as observed in other species, suggesting specific gene loss occurred in Arabidopsis. Recent gene duplicates were also identified in these two species, but they are limited to the SAG12 subfamily and were all derived from local duplication. Expression profiling revealed diverse patterns of different family members over various tissues. Furthermore, the evolution characteristics of PLCP genes were also compared and discussed. Our findings provide a useful reference to characterize PLCP genes and investigate the family evolution in Euphorbiaceae and species beyond.
Bossers, A.; Belt, P.B.G.M.; Raymond, G.J.; Caughey, B.; Vries, de R.; Smits, M.
1997-01-01
Prion diseases are natural transmissible neurodegenerative disorders in humans and animals. They are characterized by the accumulation of a protease-resistant scrapie-associated prion protein (PrPSc) of the host-encoded cellular prion protein (PrPC) mainly in the central nervous system.
Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua
2015-08-01
Tilapia is a group of cultured teleost fishes whose production is threatened by some diseases. Identification of DNA markers associated with disease resistance in candidate genes may facilitate to accelerate the selection of disease resistance. The gene encoding a duodenase, which can trigger immune response, has not been studied in fish. We characterized the cDNA of duodenase-1 gene of hybrid tilapia. Its ORF is 759 bp, encoding a serine protease of 252 amino acids. This gene consisted of five exons and four introns. Its expression was detected in all 10 tissues examined, and it was highly expressed in the intestine and kidney. After a challenge with the bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the intestine, liver and spleen. We identified seven SNPs in the gene and found that four of them were significantly associated with the resistance to S. agalactiae (P tilapia. The SNP markers in the duodenase-1 gene associated with resistance to the bacterial pathogen, may facilitate the selection of tilapia resistant to the bacterial disease. Copyright © 2015 Elsevier Ltd. All rights reserved.
A novel protease activity assay using a protease-responsive chaperone protein
International Nuclear Information System (INIS)
Sao, Kentaro; Murata, Masaharu; Fujisaki, Yuri; Umezaki, Kaori; Mori, Takeshi; Niidome, Takuro; Katayama, Yoshiki; Hashizume, Makoto
2009-01-01
Protease activity assays are important for elucidating protease function and for developing new therapeutic agents. In this study, a novel turbidimetric method for determining the protease activity using a protease-responsive chaperone protein is described. For this purpose, a recombinant small heat-shock protein (sHSP) with an introduced Factor Xa protease recognition site was synthesized in bacteria. This recombinant mutant, FXa-HSP, exhibited chaperone-like activity at high temperatures in cell lysates. However, the chaperone-like activity of FXa-HSP decreased dramatically following treatment with Factor Xa. Protein precipitation was subsequently observed in the cell lysates. The reaction was Factor Xa concentration-dependent and was quantitatively suppressed by a specific inhibitor for Factor Xa. Protein aggregation was detected by a simple method based on turbidimetry. The results clearly demonstrate that this assay is an effective, easy-to-use method for determining protease activities without the requirement of labeling procedures and the use of radioisotopes.
A novel protease activity assay using a protease-responsive chaperone protein
Energy Technology Data Exchange (ETDEWEB)
Sao, Kentaro [Graduate School of Systems Life Sciences, Kyushu University, 744 Motooka Nishi-ku, Fukuoka 819-0395 (Japan); Murata, Masaharu, E-mail: m-murata@dem.med.kyushu-u.ac.jp [Department of Advanced Medical Initiatives, Faculty of Medical Science, Kyushu University, 3-1-1 Maidashi, Higashi-ku Fukuoka 812-8582 (Japan); Fujisaki, Yuri; Umezaki, Kaori [Department of Advanced Medical Initiatives, Faculty of Medical Science, Kyushu University, 3-1-1 Maidashi, Higashi-ku Fukuoka 812-8582 (Japan); Mori, Takeshi; Niidome, Takuro; Katayama, Yoshiki [Graduate School of Systems Life Sciences, Kyushu University, 744 Motooka Nishi-ku, Fukuoka 819-0395 (Japan); Department of Applied Chemistry, Faculty of Engineering, Kyushu University, Nishi-ku Fukuoka 819-0395 (Japan); Center for Future Chemistry, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395 (Japan); Hashizume, Makoto [Department of Advanced Medical Initiatives, Faculty of Medical Science, Kyushu University, 3-1-1 Maidashi, Higashi-ku Fukuoka 812-8582 (Japan)
2009-06-05
Protease activity assays are important for elucidating protease function and for developing new therapeutic agents. In this study, a novel turbidimetric method for determining the protease activity using a protease-responsive chaperone protein is described. For this purpose, a recombinant small heat-shock protein (sHSP) with an introduced Factor Xa protease recognition site was synthesized in bacteria. This recombinant mutant, FXa-HSP, exhibited chaperone-like activity at high temperatures in cell lysates. However, the chaperone-like activity of FXa-HSP decreased dramatically following treatment with Factor Xa. Protein precipitation was subsequently observed in the cell lysates. The reaction was Factor Xa concentration-dependent and was quantitatively suppressed by a specific inhibitor for Factor Xa. Protein aggregation was detected by a simple method based on turbidimetry. The results clearly demonstrate that this assay is an effective, easy-to-use method for determining protease activities without the requirement of labeling procedures and the use of radioisotopes.
Gene-environment interaction in Parkinson’s disease: coffee, ADORA2A, and CYP1A2
Chuang, Yu-Hsuan; Lill, Christina M.; Lee, Pei-Chen; Hansen, Johnni; Lassen, Christina Funch; Bertram, Lars; Greene, Naomi; Sinsheimer, Janet S.; Ritz, Beate
2017-01-01
Background and purpose Drinking caffeinated coffee has been reported to protect against Parkinson’s disease (PD). Caffeine is an adenosine A2A receptor (encoded by the gene ADORA2A) antagonist that increases dopaminergic neurotransmission and Cytochrome P450 1A2 (gene: CYP1A2) metabolizes caffeine, thus gene polymorphisms in ADORA2A and CYP1A2 may influence the effect coffee consumption has on PD risk. Methods In a population-based case control study (PASIDA) in Denmark (1,556 PD patients and 1,606 birth year- and sex- matched controls), we assessed interactions between lifetime coffee consumption and three polymorphisms in ADORA2A and CYP1A2 for all subjects and incident and prevalent PD cases separately using logistic regression models. We also conducted a meta-analysis combining our results with those from previous studies. Results We estimated statistically significant interactions for ADORA2A rs5760423 and heavy vs. light coffee consumption in incident (OR interaction=0.66 [0.46–0.94], p=0.02) but not prevalent PD. We did not observe interactions for CYP1A2 rs762551 and rs2472304 in incident or prevalent PD. In meta-analyses, PD associations with daily coffee consumption were strongest among carriers of variant alleles in both ADORA2A and CYP1A2. Conclusion We corroborated results from a previous report that described interactions between ADORA2A and CYP1A2 polymorphisms and coffee consumption. Our results also suggest that survivor bias may affect results of studies that enrol prevalent PD cases. PMID:28135712
International Nuclear Information System (INIS)
Woloschak, G.E.; Chang-Liu, Chin-Mei
1994-01-01
Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Gehringer, Heike; Von der Helm, Klaus; Seelmeir, Sigrid; Weissbrich, Benedikt; Eberle, Josef; Nitschko, Hans
2003-05-01
A novel phenotypic assay, based on recombinant expression of the HIV-1-protease was developed and evaluated; it monitors the formation of resistance to protease inhibitors. The HIV-1 protease-encoding region from the blood sample of patients was amplified, ligated into the expression vector pBD2, and recombinantly expressed in Escherichia coli TG1 cells. The resulting recombinant enzyme was purified by a newly developed one-step acid extraction protocol. The protease activity was determined in presence of five selected HIV protease inhibitors and the 50% inhibitory concentration (IC(50)) to the respective protease inhibitors determined. The degree of resistance was expressed in terms of x-fold increase in IC(50) compared to the IC(50) value of an HIV-1 wild type protease preparation. The established test system showed a reproducible recombinant expression of each individual patients' HIV-1 protease population. Samples of nine clinically well characterised HIV-1-infected patients with varying degrees of resistance were analysed. There was a good correlation between clinical parameters and the results obtained by this phenotypic assay. For the majority of patients a blind genotypic analysis of the patients' protease domain revealed a fair correlation to the results of the phenotypic assay. In a minority of patients our phenotypic results diverged from the genotypic ones. This novel phenotypic assay can be carried out within 8-10 days, and offers a significant advantage in time to the current employed phenotypic tests.
Directory of Open Access Journals (Sweden)
Hui Tian
2018-04-01
Full Text Available The cell-envelope protease PrtS was proved to be efficient in optimal bacterial growth and fast acidification in pure culture, while its positive effect on the performance of mixed-cultures in milk fermentation was not defined. The aim was to analyze effects of the PrtS on the symbiosis between strains during yoghurt production and cold storage. Two Streptococcus thermophilus strains, KLDS3.1012 and KLDS SM, and two different proteolytic strains of Lactobacillus delbrueckii subsp. Bulgaricus, L7 and L12, were used. Technological properties (viability, acid production, and proteolysis were determined. Comparative genomics was used to analyze the proteolytic system (cell-envelope protease, transport system, intracellular peptidase of Streptococcus thermophilus strains. S. thermophilus KLDS SM possesses an intact gene encoding PrtS (A9497_00420, which was not found in the genome of S. thermophilus KLDS3.1012. This gene is the main difference in the proteolytic system between the two genomes. PrtS endowed KLDS SM high levels of viability during fermentation and cold storage. When combined with a weaker lactobacillus strain during fermentation, the acceleration of acid production of mixed-culture by KLDS SM would start at an earlier time. KLDS SM increased the post-acidification of yoghurts during cold storage, but the pH was steadily maintained during 14–28 days. Results suggest that strains of Streptococcus thermophilus with strong proteolytic ability could be used in a wide range of dairy production. The present study provided data for yoghurt starter development from the point of view of proteolysis.
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes
Directory of Open Access Journals (Sweden)
Berkhout Ben
2006-12-01
Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
DEFF Research Database (Denmark)
Abildgaard, L; Engberg, RM; Pedersen, Karl
2009-01-01
The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...
Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato
International Nuclear Information System (INIS)
Hayat, S.; Cheng, Z.; Chen, X.
2016-01-01
The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)
Directory of Open Access Journals (Sweden)
Ghaffari Novin M.
2015-06-01
Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.
Directory of Open Access Journals (Sweden)
Jacqueline Schmuckli-Maurer
Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic
Schwartze, Volker U; Winter, Sascha; Shelest, Ekaterina; Marcet-Houben, Marina; Horn, Fabian; Wehner, Stefanie; Linde, Jörg; Valiante, Vito; Sammeth, Michael; Riege, Konstantin; Nowrousian, Minou; Kaerger, Kerstin; Jacobsen, Ilse D; Marz, Manja; Brakhage, Axel A; Gabaldón, Toni; Böcker, Sebastian; Voigt, Kerstin
2014-08-01
Lichtheimia species are the second most important cause of mucormycosis in Europe. To provide broader insights into the molecular basis of the pathogenicity-associated traits of the basal Mucorales, we report the full genome sequence of L. corymbifera and compared it to the genome of Rhizopus oryzae, the most common cause of mucormycosis worldwide. The genome assembly encompasses 33.6 MB and 12,379 protein-coding genes. This study reveals four major differences of the L. corymbifera genome to R. oryzae: (i) the presence of an highly elevated number of gene duplications which are unlike R. oryzae not due to whole genome duplication (WGD), (ii) despite the relatively high incidence of introns, alternative splicing (AS) is not frequently observed for the generation of paralogs and in response to stress, (iii) the content of repetitive elements is strikingly low (<5%), (iv) L. corymbifera is typically haploid. Novel virulence factors were identified which may be involved in the regulation of the adaptation to iron-limitation, e.g. LCor01340.1 encoding a putative siderophore transporter and LCor00410.1 involved in the siderophore metabolism. Genes encoding the transcription factors LCor08192.1 and LCor01236.1, which are similar to GATA type regulators and to calcineurin regulated CRZ1, respectively, indicating an involvement of the calcineurin pathway in the adaption to iron limitation. Genes encoding MADS-box transcription factors are elevated up to 11 copies compared to the 1-4 copies usually found in other fungi. More findings are: (i) lower content of tRNAs, but unique codons in L. corymbifera, (ii) Over 25% of the proteins are apparently specific for L. corymbifera. (iii) L. corymbifera contains only 2/3 of the proteases (known to be essential virulence factors) in comparison to R. oryzae. On the other hand, the number of secreted proteases, however, is roughly twice as high as in R. oryzae.
... a G6PD deficiency if a male inherits the single X chromosome with an altered gene. Since women have two X sex chromosomes, they inherit two ... deficiency. In addition, a mother may pass the single mutated gene to any male children. Rarely do women have two mutated gene copies ( homozygous ), which could ...
Han, Sejin; Li, Yuk Yin; Chan, Barbara Pui
2016-01-01
Matrix remodeling of cells is highly regulated by proteases and their inhibitors. Nevertheless, how would the chondrogenesis of mesenchymal stem cells (MSCs) be affected, when the balance of the matrix remodeling is disturbed by inhibiting matrix proteases, is incompletely known. Using a previously developed collagen microencapsulation platform, we investigated whether exposing chondrogenically differentiating MSCs to intracellular and extracellular protease inhibitors will affect the extracellular matrix remodeling and hence the outcomes of chondrogenesis. Results showed that inhibition of matrix proteases particularly the extracellular ones favors the phenotype of fibrocartilage rather than hyaline cartilage in chondrogenically differentiating hMSCs by upregulating type I collagen protein deposition and type II collagen gene expression without significantly altering the hypertrophic markers at gene level. This study suggests the potential of manipulating extracellular proteases to alter the outcomes of hMSC chondrogenesis, contributing to future development of differentiation protocols for fibrocartilage tissues for intervertebral disc and meniscus tissue engineering.
Directory of Open Access Journals (Sweden)
Sejin Han
Full Text Available Matrix remodeling of cells is highly regulated by proteases and their inhibitors. Nevertheless, how would the chondrogenesis of mesenchymal stem cells (MSCs be affected, when the balance of the matrix remodeling is disturbed by inhibiting matrix proteases, is incompletely known. Using a previously developed collagen microencapsulation platform, we investigated whether exposing chondrogenically differentiating MSCs to intracellular and extracellular protease inhibitors will affect the extracellular matrix remodeling and hence the outcomes of chondrogenesis. Results showed that inhibition of matrix proteases particularly the extracellular ones favors the phenotype of fibrocartilage rather than hyaline cartilage in chondrogenically differentiating hMSCs by upregulating type I collagen protein deposition and type II collagen gene expression without significantly altering the hypertrophic markers at gene level. This study suggests the potential of manipulating extracellular proteases to alter the outcomes of hMSC chondrogenesis, contributing to future development of differentiation protocols for fibrocartilage tissues for intervertebral disc and meniscus tissue engineering.
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal
2017-01-01
The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...
An evolutionarily conserved gene family encodes proton-selective ion channels.
Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R
2018-03-02
Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Heterogeneity of heat-resistant proteases from milk Pseudomonas species.
Marchand, Sophie; Vandriesche, Gonzalez; Coorevits, An; Coudijzer, Katleen; De Jonghe, Valerie; Dewettinck, Koen; De Vos, Paul; Devreese, Bart; Heyndrickx, Marc; De Block, Jan
2009-07-31
Pseudomonas fragi, Pseudomonas lundensis and members of the Pseudomonas fluorescens group may spoil Ultra High Temperature (UHT) treated milk and dairy products, due to the production of heat-stable proteases in the cold chain of raw milk. Since the aprX gene codes for a heat-resistant protease in P. fluorescens, the presence of this gene has also been investigated in other members of the genus. For this purpose an aprX-screening PCR test has been developed. Twenty-nine representatives of important milk Pseudomonas species and thirty-five reference strains were screened. In 42 out of 55 investigated Pseudomonas strains, the aprX gene was detected, which proves the potential of the aprX-PCR test as a screening tool for potentially proteolytic Pseudomonas strains in milk samples. An extensive study of the obtained aprX-sequences on the DNA and the amino acid level, however, revealed a large heterogeneity within the investigated milk isolates. Although this heterogeneity sets limitations to a general detection method for all proteolytic Pseudomonas strains in milk, it offers a great potential for the development of a multiplex PCR screening test targeting individual aprX-genes. Furthermore, our data illustrated the potential use of the aprX gene as a taxonomic marker, which may help in resolving the current taxonomic deadlock in the P. fluorescens group.
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the
Directory of Open Access Journals (Sweden)
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica
Directory of Open Access Journals (Sweden)
Kouji Shimoda
2002-01-01
Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.
DEFF Research Database (Denmark)
Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.
2018-01-01
The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...
Eliminating anti-nutritional plant food proteins: the case of seed protease inhibitors in pea.
Clemente, Alfonso; Arques, Maria C; Dalmais, Marion; Le Signor, Christine; Chinoy, Catherine; Olias, Raquel; Rayner, Tracey; Isaac, Peter G; Lawson, David M; Bendahmane, Abdelhafid; Domoney, Claire
2015-01-01
Several classes of seed proteins limit the utilisation of plant proteins in human and farm animal diets, while plant foods have much to offer to the sustainable intensification of food/feed production and to human health. Reduction or removal of these proteins could greatly enhance seed protein quality and various strategies have been used to try to achieve this with limited success. We investigated whether seed protease inhibitor mutations could be exploited to enhance seed quality, availing of induced mutant and natural Pisum germplasm collections to identify mutants, whilst acquiring an understanding of the impact of mutations on activity. A mutant (TILLING) resource developed in Pisum sativum L. (pea) and a large germplasm collection representing Pisum diversity were investigated as sources of mutations that reduce or abolish the activity of the major protease inhibitor (Bowman-Birk) class of seed protein. Of three missense mutations, predicted to affect activity of the mature trypsin / chymotrypsin inhibitor TI1 protein, a C77Y substitution in the mature mutant inhibitor abolished inhibitor activity, consistent with an absolute requirement for the disulphide bond C77-C92 for function in the native inhibitor. Two further classes of mutation (S85F, E109K) resulted in less dramatic changes to isoform or overall inhibitory activity. The alternative strategy to reduce anti-nutrients, by targeted screening of Pisum germplasm, successfully identified a single accession (Pisum elatius) as a double null mutant for the two closely linked genes encoding the TI1 and TI2 seed protease inhibitors. The P. elatius mutant has extremely low seed protease inhibitory activity and introgression of the mutation into cultivated germplasm has been achieved. The study provides new insights into structure-function relationships for protease inhibitors which impact on pea seed quality. The induced and natural germplasm variants identified provide immediate potential for either halving
Shao, Huanhuan; Cao, Qinghua; Zhao, Hongyan; Tan, Xuemei; Feng, Hong
2015-01-01
A native plasmid (pSU01) was detected by genome sequencing of Bacillus subtilis strain S1-4. Two pSU01-based shuttle expression vectors pSU02-AP and pSU03-AP were constructed enabling stable replication in B. subtilis WB600. These vectors contained the reporter gene aprE, encoding an alkaline protease from Bacillus pumilus BA06. The expression vector pSU03-AP only possessed the minimal replication elements (rep, SSO, DSO) and exhibited more stability on structure, suggesting that the rest of the genes in pSU01 (ORF1, ORF2, mob, hsp) were unessential for the structural stability of plasmid in B. subtilis. In addition, recombinant production of the alkaline protease was achieved more efficiently with pSU03-AP whose copy number was estimated to be more than 100 per chromosome. Furthermore, pSU03-AP could also be used to transform and replicate in B. pumilus BA06 under selective pressure. In conclusion, pSU03-AP is expected to be a useful tool for gene expression in Bacillus subtilis and B. pumilus.
Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda
The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.
Chaperone-protease networks in mitochondrial protein homeostasis.
Voos, Wolfgang
2013-02-01
As essential organelles, mitochondria are intimately integrated into the metabolism of a eukaryotic cell. The maintenance of the functional integrity of the mitochondrial proteome, also termed protein homeostasis, is facing many challenges both under normal and pathological conditions. First, since mitochondria are derived from bacterial ancestor cells, the proteins in this endosymbiotic organelle have a mixed origin. Only a few proteins are encoded on the mitochondrial genome, most genes for mitochondrial proteins reside in the nuclear genome of the host cell. This distribution requires a complex biogenesis of mitochondrial proteins, which are mostly synthesized in the cytosol and need to be imported into the organelle. Mitochondrial protein biogenesis usually therefore comprises complex folding and assembly processes to reach an enzymatically active state. In addition, specific protein quality control (PQC) processes avoid an accumulation of damaged or surplus polypeptides. Mitochondrial protein homeostasis is based on endogenous enzymatic components comprising a diverse set of chaperones and proteases that form an interconnected functional network. This review describes the different types of mitochondrial proteins with chaperone functions and covers the current knowledge of their roles in protein biogenesis, folding, proteolytic removal and prevention of aggregation, the principal reactions of protein homeostasis. This article is part of a Special Issue entitled: Protein Import and Quality Control in Mitochondria and Plastids. Copyright © 2012 Elsevier B.V. All rights reserved.
Chaya, Etsushi; Suzuki, Tohru; Karita, Shuichi; Hanya, Akira; Yoshino-Yasuda, Shoko; Kitamoto, Noriyuki
2014-06-01
Two protease-like proteins, KrtA and KrtC, were identified in Fusarium oxysporum 26-1. Genes coding these proteins, krtA and krtC, were isolated and characterized. Recombinant KrtA (rKrtA) and KrtC (rKrtC) were successfully expressed in Aspergillus oryzae and secreted. The combination of rKrtA and rKrtC completely removed the cuticle of wool fibers. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Songli Yuan
2016-10-01
Full Text Available Nodulation, nodule development and senescence directly affects nitrogen fixation efficiency, and previous studies have shown that inhibition of some cysteine proteases delay nodule senescence, so their nature inhibitors, cystatin genes, are very important in nodulation, nodule development and senescence. Although several cystatins are actively transcribed in soybean nodules, their exact roles and functional diversities in legume have not been well explored in genome-wide survey studies. In this report, we performed a genome-wide survey of cystatin family genes to explore their relationship to nodulation and nodule development in soybean and identified 20 cystatin genes that encode peptides with 97~245 amino acid residues, different isoelectric points (pI and structure characteristics, and various putative plant regulatory elements in 3000 bp putative promoter fragments upstream of the 20 soybean cystatins in response to different abiotic/biotic stresses, hormone signals and symbiosis signals. The expression profiles of these cystatin genes in soybean symbiosis with rhizobium strain Bradyrhizobium japonicum strain 113-2 revealed that 7 cystatin family genes play different roles in nodulation as well as nodule development and senescence. However, these genes were not root nodule symbiosis (RNS - specific and did not encode special clade cystatin protein with structures related to nodulation and nodule development. Besides, only two of these soybean cystatins were not upregulated in symbiosis after ABA treatment. The functional analysis showed that a candidate gene Glyma.15G227500 (GmCYS16 was likely to play a positive role in soybean nodulation. Besides, evolutionary relationships analysis divided the cystatin genes from Arabidopsis thaliana, Nicotiana tabacum, rice, barley and four legume plants into three groups. Interestingly, Group A cystatins are special in legume plants, but only include one of the above-mentioned 7 cystatin genes related to
The Xylella fastidiosa PD1063 protein is secreted in association with outer membrane vesicles.
Pierce, Brittany K; Voegel, Tanja; Kirkpatrick, Bruce C
2014-01-01
Xylella fastidiosa is a gram-negative, xylem-limited plant pathogenic bacterium that causes disease in a variety of economically important agricultural crops including Pierce's disease of grapevines. Xylella fastidiosa biofilms formed in the xylem vessels of plants play a key role in early colonization and pathogenicity by providing a protected niche and enhanced cell survival. Here we investigate the role of Xylella fastidiosa PD1063, the predicted ortholog of Xanthomonas oryzae pv. oryzae PXO_03968, which encodes an outer membrane protein. To assess the function of the Xylella fastidiosa ortholog, we created Xylella fastidiosa mutants deleted for PD1063 and then assessed biofilm formation, cell-cell aggregation and cell growth in vitro. We also assessed disease severity and pathogen titers in grapevines mechanically inoculated with the Xylella fastidiosa PD1063 mutant. We found a significant decrease in cell-cell aggregation among PD1063 mutants but no differences in cell growth, biofilm formation, disease severity or titers in planta. Based on the demonstration that Xanthomonas oryzae pv. oryzae PXO_03968 encodes an outer membrane protein, secreted in association with outer membrane vesicles, we predicted that PD1063 would also be secreted in a similar manner. Using anti-PD1063 antibodies, we found PD1063 in the supernatant and secreted in association with outer membrane vesicles. PD1063 purified from the supernatant, outer membrane fractions and outer membrane vesicles was 19.2 kD, corresponding to the predicted size of the processed protein. Our findings suggest Xylella fastidiosa PD1063 is not essential for development of Pierce's disease in Vitis vinifera grapevines although further research is required to determine the function of the PD1063 outer membrane protein in Xylella fastidiosa.
Pyne, C; Bognar, A L
1992-03-01
The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.
Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John
2017-12-26
The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.
Hamza, Taye H.; Chen, Honglei; Hill-Burns, Erin M.; Rhodes, Shannon L.; Montimurro, Jennifer; Kay, Denise M.; Tenesa, Albert; Kusel, Victoria I.; Sheehan, Patricia; Eaaswarkhanth, Muthukrishnan; Yearout, Dora; Samii, Ali; Roberts, John W.; Agarwal, Pinky; Bordelon, Yvette; Park, Yikyung; Wang, Liyong; Gao, Jianjun; Vance, Jeffery M.; Kendler, Kenneth S.; Bacanu, Silviu-Alin; Scott, William K.; Ritz, Beate; Nutt, John; Factor, Stewart A.; Zabetian, Cyrus P.; Payami, Haydeh
2011-01-01
Our aim was to identify genes that influence the inverse association of coffee with the risk of developing Parkinson's disease (PD). We used genome-wide genotype data and lifetime caffeinated-coffee-consumption data on 1,458 persons with PD and 931 without PD from the NeuroGenetics Research Consortium (NGRC), and we performed a genome-wide association and interaction study (GWAIS), testing each SNP's main-effect plus its interaction with coffee, adjusting for sex, age, and two principal components. We then stratified subjects as heavy or light coffee-drinkers and performed genome-wide association study (GWAS) in each group. We replicated the most significant SNP. Finally, we imputed the NGRC dataset, increasing genomic coverage to examine the region of interest in detail. The primary analyses (GWAIS, GWAS, Replication) were performed using genotyped data. In GWAIS, the most significant signal came from rs4998386 and the neighboring SNPs in GRIN2A. GRIN2A encodes an NMDA-glutamate-receptor subunit and regulates excitatory neurotransmission in the brain. Achieving P2df = 10−6, GRIN2A surpassed all known PD susceptibility genes in significance in the GWAIS. In stratified GWAS, the GRIN2A signal was present in heavy coffee-drinkers (OR = 0.43; P = 6×10−7) but not in light coffee-drinkers. The a priori Replication hypothesis that “Among heavy coffee-drinkers, rs4998386_T carriers have lower PD risk than rs4998386_CC carriers” was confirmed: ORReplication = 0.59, PReplication = 10−3; ORPooled = 0.51, PPooled = 7×10−8. Compared to light coffee-drinkers with rs4998386_CC genotype, heavy coffee-drinkers with rs4998386_CC genotype had 18% lower risk (P = 3×10−3), whereas heavy coffee-drinkers with rs4998386_TC genotype had 59% lower risk (P = 6×10−13). Imputation revealed a block of SNPs that achieved P2dfcoffee-drinkers. This study is proof of concept that inclusion of environmental factors can help identify genes that
Hamza, Taye H; Chen, Honglei; Hill-Burns, Erin M; Rhodes, Shannon L; Montimurro, Jennifer; Kay, Denise M; Tenesa, Albert; Kusel, Victoria I; Sheehan, Patricia; Eaaswarkhanth, Muthukrishnan; Yearout, Dora; Samii, Ali; Roberts, John W; Agarwal, Pinky; Bordelon, Yvette; Park, Yikyung; Wang, Liyong; Gao, Jianjun; Vance, Jeffery M; Kendler, Kenneth S; Bacanu, Silviu-Alin; Scott, William K; Ritz, Beate; Nutt, John; Factor, Stewart A; Zabetian, Cyrus P; Payami, Haydeh
2011-08-01
Our aim was to identify genes that influence the inverse association of coffee with the risk of developing Parkinson's disease (PD). We used genome-wide genotype data and lifetime caffeinated-coffee-consumption data on 1,458 persons with PD and 931 without PD from the NeuroGenetics Research Consortium (NGRC), and we performed a genome-wide association and interaction study (GWAIS), testing each SNP's main-effect plus its interaction with coffee, adjusting for sex, age, and two principal components. We then stratified subjects as heavy or light coffee-drinkers and performed genome-wide association study (GWAS) in each group. We replicated the most significant SNP. Finally, we imputed the NGRC dataset, increasing genomic coverage to examine the region of interest in detail. The primary analyses (GWAIS, GWAS, Replication) were performed using genotyped data. In GWAIS, the most significant signal came from rs4998386 and the neighboring SNPs in GRIN2A. GRIN2A encodes an NMDA-glutamate-receptor subunit and regulates excitatory neurotransmission in the brain. Achieving P(2df) = 10(-6), GRIN2A surpassed all known PD susceptibility genes in significance in the GWAIS. In stratified GWAS, the GRIN2A signal was present in heavy coffee-drinkers (OR = 0.43; P = 6×10(-7)) but not in light coffee-drinkers. The a priori Replication hypothesis that "Among heavy coffee-drinkers, rs4998386_T carriers have lower PD risk than rs4998386_CC carriers" was confirmed: OR(Replication) = 0.59, P(Replication) = 10(-3); OR(Pooled) = 0.51, P(Pooled) = 7×10(-8). Compared to light coffee-drinkers with rs4998386_CC genotype, heavy coffee-drinkers with rs4998386_CC genotype had 18% lower risk (P = 3×10(-3)), whereas heavy coffee-drinkers with rs4998386_TC genotype had 59% lower risk (P = 6×10(-13)). Imputation revealed a block of SNPs that achieved P(2df)coffee-drinkers. This study is proof of concept that inclusion of environmental factors can help identify
van Lier, Christina J; Tiner, Bethany L; Chauhan, Sadhana; Motin, Vladimir L; Fitts, Eric C; Huante, Matthew B; Endsley, Janice J; Ponnusamy, Duraisamy; Sha, Jian; Chopra, Ashok K
2015-03-01
We recently characterized the Δlpp Δpla double in-frame deletion mutant of Yersinia pestis CO92 molecularly, biologically, and immunologically. While Braun lipoprotein (Lpp) activates toll-like receptor-2 to initiate an inflammatory cascade, plasminogen activator (Pla) protease facilitates bacterial dissemination in the host. The Δlpp Δpla double mutant was highly attenuated in evoking bubonic and pneumonic plague, was rapidly cleared from mouse organs, and generated humoral and cell-mediated immune responses to provide subsequent protection to mice against a lethal challenge dose of wild-type (WT) CO92. Here, we further characterized the Δlpp Δpla double mutant in two murine macrophage cell lines as well as in primary human monocyte-derived macrophages to gauge its potential as a live-attenuated vaccine candidate. We first demonstrated that the Δpla single and the Δlpp Δpla double mutant were unable to survive efficiently in murine and human macrophages, unlike WT CO92. We observed that the levels of Pla and its associated protease activity were not affected in the Δlpp single mutant, and, likewise, deletion of the pla gene from WT CO92 did not alter Lpp levels. Further, our study revealed that both Lpp and Pla contributed to the intracellular survival of WT CO92 via different mechanisms. Importantly, the ability of the Δlpp Δpla double mutant to be phagocytized by macrophages, to stimulate production of tumor necrosis factor-α and interleukin-6, and to activate the nitric oxide killing pathways of the host cells remained unaltered when compared to the WT CO92-infected macrophages. Finally, macrophages infected with either the WT CO92 or the Δlpp Δpla double mutant were equally efficient in their uptake of zymosan particles as determined by flow cytometric analysis. Overall, our data indicated that although the Δlpp Δpla double mutant of Y. pestis CO92 was highly attenuated, it retained the ability to elicit innate and subsequent acquired immune
Directory of Open Access Journals (Sweden)
Brittany A Goods
Full Text Available Immune checkpoint inhibitors targeting programmed cell death protein 1 (PD-1 have been highly successful in the treatment of cancer. While PD-1 expression has been widely investigated, its role in CD4+ effector T cells in the setting of health and cancer remains unclear, particularly in the setting of glioblastoma multiforme (GBM, the most aggressive and common form of brain cancer. We examined the functional and molecular features of PD-1+CD4+CD25-CD127+Foxp3-effector cells in healthy subjects and in patients with GBM. In healthy subjects, we found that PD-1+CD4+ effector cells are dysfunctional: they do not proliferate but can secrete large quantities of IFNγ. Strikingly, blocking antibodies against PD-1 did not rescue proliferation. RNA-sequencing revealed features of exhaustion in PD-1+ CD4 effectors. In the context of GBM, tumors were enriched in PD-1+ CD4+ effectors that were similarly dysfunctional and unable to proliferate. Furthermore, we found enrichment of PD-1+TIM-3+ CD4+ effectors in tumors, suggesting that co-blockade of PD-1 and TIM-3 in GBM may be therapeutically beneficial. RNA-sequencing of blood and tumors from GBM patients revealed distinct differences between CD4+ effectors from both compartments with enrichment in multiple gene sets from tumor infiltrating PD-1-CD4+ effectors cells. Enrichment of these gene sets in tumor suggests a more metabolically active cell state with signaling through other co-receptors. PD-1 expression on CD4 cells identifies a dysfunctional subset refractory to rescue with PD-1 blocking antibodies, suggesting that the influence of immune checkpoint inhibitors may involve recovery of function in the PD-1-CD4+ T cell compartment. Additionally, co-blockade of PD-1 and TIM-3 in GBM may be therapeutically beneficial.
Aspartic Protease Zymography Case Study: Detection of Fungal Acid Proteases by Zymography.
Kernaghan, Gavin; Mayerhofer, Michael
2017-01-01
This chapter describes a method for the production and characterization of fungal acid proteases. Protease production is induced by growth on BSA media over a pH gradient and protein levels are monitored over time with the Bradford assay. Once protein is depleted, the media is purified and proteases are characterized by gelatin zymography using acrylamide and buffers at near-neutral pH. Maintaining pH levels below those found in traditional zymographic systems avoids the potential loss of activity that may occur in aspartic proteases under alkaline conditions.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L
2013-01-01
The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Directory of Open Access Journals (Sweden)
Linda J Savage
Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.
2015-01-01
Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased
Nucleic Acid Aptamers Against Proteases
DEFF Research Database (Denmark)
Dupont, D M; Andersen, L M; Bøtkjær, Kenneth Alrø
2011-01-01
, directed against blood coagulation factors, are in clinical trials as anticoagulant drugs. Several of the studies on protease-binding aptamers have been pioneering and trend-setting in the field. The work with protease-binding aptamers also demonstrates many interesting examples of non-standard selection......Proteases are potential or realized therapeutic targets in a wide variety of pathological conditions. Moreover, proteases are classical subjects for studies of enzymatic and regulatory mechanisms. We here review the literature on nucleic acid aptamers selected with proteases as targets. Designing...... small molecule protease inhibitors of sufficient specificity has proved a daunting task. Aptamers seem to represent a promising alternative. In our review, we concentrate on biochemical mechanisms of aptamer selection, proteinaptamer recognition, protease inhibition, and advantages of aptamers...
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.
2005-01-01
Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691
Integrative characterization of germ cell-specific genes from mouse spermatocyte UniGene library
Directory of Open Access Journals (Sweden)
Eddy Edward M
2007-07-01
Full Text Available Abstract Background The primary regulator of spermatogenesis, a highly ordered and tightly regulated developmental process, is an intrinsic genetic program involving male germ cell-specific genes. Results We analyzed the mouse spermatocyte UniGene library containing 2155 gene-oriented transcript clusters. We predict that 11% of these genes are testis-specific and systematically identified 24 authentic genes specifically and abundantly expressed in the testis via in silico and in vitro approaches. Northern blot analysis disclosed various transcript characteristics, such as expression level, size and the presence of isoform. Expression analysis revealed developmentally regulated and stage-specific expression patterns in all of the genes. We further analyzed the genes at the protein and cellular levels. Transfection assays performed using GC-2 cells provided information on the cellular characteristics of the gene products. In addition, antibodies were generated against proteins encoded by some of the genes to facilitate their identification and characterization in spermatogenic cells and sperm. Our data suggest that a number of the gene products are implicated in transcriptional regulation, nuclear integrity, sperm structure and motility, and fertilization. In particular, we found for the first time that Mm.333010, predicted to contain a trypsin-like serine protease domain, is a sperm acrosomal protein. Conclusion We identify 24 authentic genes with spermatogenic cell-specific expression, and provide comprehensive information about the genes. Our findings establish a new basis for future investigation into molecular mechanisms underlying male reproduction.
DEFF Research Database (Denmark)
Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel
2016-01-01
genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...
Proteases and protease inhibitors of urinary extracellular vesicles in diabetic nephropathy.
Musante, Luca; Tataruch, Dorota; Gu, Dongfeng; Liu, Xinyu; Forsblom, Carol; Groop, Per-Henrik; Holthofer, Harry
2015-01-01
Diabetic nephropathy (DN) is one of the major complications of diabetes mellitus (DM), leads to chronic kidney disease (CKD), and, ultimately, is the main cause for end-stage kidney disease (ESKD). Beyond urinary albumin, no reliable biomarkers are available for accurate early diagnostics. Urinary extracellular vesicles (UEVs) have recently emerged as an interesting source of diagnostic and prognostic disease biomarkers. Here we used a protease and respective protease inhibitor array to profile urines of type 1 diabetes patients at different stages of kidney involvement. Urine samples were divided into groups based on the level of albuminuria and UEVs isolated by hydrostatic dialysis and screened for relative changes of 34 different proteases and 32 protease inhibitors, respectively. Interestingly, myeloblastin and its natural inhibitor elafin showed an increase in the normo- and microalbuminuric groups. Similarly, a characteristic pattern was observed in the array of protease inhibitors, with a marked increase of cystatin B, natural inhibitor of cathepsins L, H, and B as well as of neutrophil gelatinase-associated Lipocalin (NGAL) in the normoalbuminuric group. This study shows for the first time the distinctive alterations in comprehensive protease profiles of UEVs in diabetic nephropathy and uncovers intriguing mechanistic, prognostic, and diagnostic features of kidney damage in diabetes.
Proteases and Protease Inhibitors of Urinary Extracellular Vesicles in Diabetic Nephropathy
Directory of Open Access Journals (Sweden)
Luca Musante
2015-01-01
Full Text Available Diabetic nephropathy (DN is one of the major complications of diabetes mellitus (DM, leads to chronic kidney disease (CKD, and, ultimately, is the main cause for end-stage kidney disease (ESKD. Beyond urinary albumin, no reliable biomarkers are available for accurate early diagnostics. Urinary extracellular vesicles (UEVs have recently emerged as an interesting source of diagnostic and prognostic disease biomarkers. Here we used a protease and respective protease inhibitor array to profile urines of type 1 diabetes patients at different stages of kidney involvement. Urine samples were divided into groups based on the level of albuminuria and UEVs isolated by hydrostatic dialysis and screened for relative changes of 34 different proteases and 32 protease inhibitors, respectively. Interestingly, myeloblastin and its natural inhibitor elafin showed an increase in the normo- and microalbuminuric groups. Similarly, a characteristic pattern was observed in the array of protease inhibitors, with a marked increase of cystatin B, natural inhibitor of cathepsins L, H, and B as well as of neutrophil gelatinase-associated Lipocalin (NGAL in the normoalbuminuric group. This study shows for the first time the distinctive alterations in comprehensive protease profiles of UEVs in diabetic nephropathy and uncovers intriguing mechanistic, prognostic, and diagnostic features of kidney damage in diabetes.
Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H
2015-01-01
This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-12-12
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Meng Sun
2014-12-01
Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-01-01
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...
Molecular cloning and characterization of novel phytocystatin gene from turmeric, Curcuma longa.
Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling; Shaharuddin, Noor Azmi
2014-01-01
Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5'/3' rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis.
A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.
Directory of Open Access Journals (Sweden)
Ashley L Waldron
Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.
Directory of Open Access Journals (Sweden)
Friedt Wolfgang
2009-07-01
Full Text Available Abstract Background Serial analysis of gene expression (LongSAGE was applied for gene expression profiling in seeds of oilseed rape (Brassica napus ssp. napus. The usefulness of this technique for detailed expression profiling in a non-model organism was demonstrated for the highly complex, neither fully sequenced nor annotated genome of B. napus by applying a tag-to-gene matching strategy based on Brassica ESTs and the annotated proteome of the closely related model crucifer A. thaliana. Results Transcripts from 3,094 genes were detected at two time-points of seed development, 23 days and 35 days after pollination (DAP. Differential expression showed a shift from gene expression involved in diverse developmental processes including cell proliferation and seed coat formation at 23 DAP to more focussed metabolic processes including storage protein accumulation and lipid deposition at 35 DAP. The most abundant transcripts at 23 DAP were coding for diverse protease inhibitor proteins and proteases, including cysteine proteases involved in seed coat formation and a number of lipid transfer proteins involved in embryo pattern formation. At 35 DAP, transcripts encoding napin, cruciferin and oleosin storage proteins were most abundant. Over both time-points, 18.6% of the detected genes were matched by Brassica ESTs identified by LongSAGE tags in antisense orientation. This suggests a strong involvement of antisense transcript expression in regulatory processes during B. napus seed development. Conclusion This study underlines the potential of transcript tagging approaches for gene expression profiling in Brassica crop species via EST matching to annotated A. thaliana genes. Limits of tag detection for low-abundance transcripts can today be overcome by ultra-high throughput sequencing approaches, so that tag-based gene expression profiling may soon become the method of choice for global expression profiling in non-model species.
Energy Technology Data Exchange (ETDEWEB)
Goudreau, Nathalie; Brochu, Christian; Cameron, Dale R.; Duceppe, Jean-Simon; Faucher, Anne-Marie; Ferland, Jean-Marie; Grand-Maître, Chantal; Poirier, Martin; Simoneau, Bruno; Tsantrizos, Youla S. (Boehringer)
2008-06-30
The virally encoded NS3 protease is essential to the life cycle of the hepatitis C virus (HCV), an important human pathogen causing chronic hepatitis, cirrhosis of the liver, and hepatocellular carcinoma. The design and synthesis of 15-membered ring {beta}-strand mimics which are capable of inhibiting the interactions between the HCV NS3 protease enzyme and its polyprotein substrate will be described. The binding interactions between a macrocyclic ligand and the enzyme were explored by NMR and molecular dynamics, and a model of the ligand/enzyme complex was developed.
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Veltman, I.M.; Basten-Vreede, L.A.J.; Cheng, J.; Looijenga, L.H.J.; Janssen, H.A.P.; Schoenmakers, E.F.P.M.; Yeh, E.T.; Geurts van Kessel, A.H.M.
2005-01-01
Recently, we identified a patient with an infantile sacrococcygeal teratoma and a constitutional t(12;15)(q13;q25). Here, we show that, as a result of this chromosomal translocation, the SUMO/Sentrin-specific protease 1 gene (SENP1) on chromosome 12 and the embryonic polarity-related mesoderm
Directory of Open Access Journals (Sweden)
Tushar Kanti Dutta
2015-04-01
Full Text Available Root-knot nematodes (Meloidogyne incognita cause substantial yield losses in vegetables worldwide, and are difficult to manage. Continuous withdrawal of environmentally-harmful nematicides from the global market warrants the need for novel nematode management strategies. Utility of host-delivered RNAi has been demonstrated in several plants (Arabidopsis, tobacco and soybean that exhibited resistance against root-knot and cyst nematodes. Herein, a M. incognita-specific protease gene, cathepsin L cysteine proteinase (Mi-cpl-1, was targeted to generate tomato transgenic lines to evaluate the genetically modified nematode resistance. In vitro knockdown of Mi-cpl-1 gene led to the reduced attraction and penetration of M. incognita in tomato, suggesting the involvement of Mi-cpl-1 in nematode parasitism. Transgenic expression of the RNAi construct of Mi-cpl-1 gene resulted in 60-80% reduction in infection and multiplication of M. incognita in tomato. Evidence for in vitro and in vivo silencing of Mi-cpl-1 was confirmed by expression analysis using quantitative PCR. Our study demonstrates that Mi-cpl-1 plays crucial role during plant-nematode interaction and plant-mediated downregulation of this gene elicits detrimental effect on M. incognita development, reinforcing the potential of RNAi technology for management of phytonematodes in crop plants.
Directory of Open Access Journals (Sweden)
Yuepeng eHan
2015-04-01
Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
International Nuclear Information System (INIS)
Reynolds, P.; Weber, S.; Prakash, L.
1985-01-01
The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures
DEFF Research Database (Denmark)
Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah
2004-01-01
Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....
Gene cloning, overexpression, and characterization of a xylanase from Penicillium sp. CGMCC 1669.
Liu, Wanli; Shi, Pengjun; Chen, Qiang; Yang, Peilong; Wang, Guozeng; Wang, Yaru; Luo, Huiying; Yao, Bin
2010-09-01
A xylanase-encoding gene, xyn11F63, was isolated from Penicillium sp. F63 CGMCC1669 using degenerated polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR techniques. The full-length chromosomal gene consists of 724 bp, including a 73-bp intron, and encodes a 217 amino acid polypeptide. The deduced amino acid sequence of xyn11F63 shows the highest identity of 70% to the xylanase from Penicillium sp. strain 40, which belongs to glycosyl hydrolases family 11. The gene was overexpressed in Pichia pastoris, and its activity in the culture medium reached 516 U ml(-1). After purification to electrophoretic homogeneity, the enzyme showed maximal activity at pH 4.5 and 40 degrees C, was stable at acidic buffers of pH 4.5-9.0, and was resistant to proteases (proteinase K, trypsin, subtilisin A, and alpha-chymotrypsin). The specific activity, K (m), and V (max) for oat spelt xylan substrate was 7,988 U mg(-1), 22.2 mg ml(-1), and 15,105.7 micromol min(-1) mg(-1), respectively. These properties make XYN11F63 a potential economical candidate for use in feed and food industrial applications.
Lu, Y P; Li, Z S; Rea, P A
1997-07-22
Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.
Kim, K S; Farrand, S K
1996-06-01
Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.
Directory of Open Access Journals (Sweden)
Elías Trujillo-Esquivel
2017-09-01
Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or
DEFF Research Database (Denmark)
Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel
2015-01-01
at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...
Amelogenesis Imperfecta; Genes, Proteins, and Pathways
Directory of Open Access Journals (Sweden)
Claire E. L. Smith
2017-06-01
Full Text Available Amelogenesis imperfecta (AI is the name given to a heterogeneous group of conditions characterized by inherited developmental enamel defects. AI enamel is abnormally thin, soft, fragile, pitted and/or badly discolored, with poor function and aesthetics, causing patients problems such as early tooth loss, severe embarrassment, eating difficulties, and pain. It was first described separately from diseases of dentine nearly 80 years ago, but the underlying genetic and mechanistic basis of the condition is only now coming to light. Mutations in the gene AMELX, encoding an extracellular matrix protein secreted by ameloblasts during enamel formation, were first identified as a cause of AI in 1991. Since then, mutations in at least eighteen genes have been shown to cause AI presenting in isolation of other health problems, with many more implicated in syndromic AI. Some of the encoded proteins have well documented roles in amelogenesis, acting as enamel matrix proteins or the proteases that degrade them, cell adhesion molecules or regulators of calcium homeostasis. However, for others, function is less clear and further research is needed to understand the pathways and processes essential for the development of healthy enamel. Here, we review the genes and mutations underlying AI presenting in isolation of other health problems, the proteins they encode and knowledge of their roles in amelogenesis, combining evidence from human phenotypes, inheritance patterns, mouse models, and in vitro studies. An LOVD resource (http://dna2.leeds.ac.uk/LOVD/ containing all published gene mutations for AI presenting in isolation of other health problems is described. We use this resource to identify trends in the genes and mutations reported to cause AI in the 270 families for which molecular diagnoses have been reported by 23rd May 2017. Finally we discuss the potential value of the translation of AI genetics to clinical care with improved patient pathways and
Amelogenesis Imperfecta; Genes, Proteins, and Pathways.
Smith, Claire E L; Poulter, James A; Antanaviciute, Agne; Kirkham, Jennifer; Brookes, Steven J; Inglehearn, Chris F; Mighell, Alan J
2017-01-01
Amelogenesis imperfecta (AI) is the name given to a heterogeneous group of conditions characterized by inherited developmental enamel defects. AI enamel is abnormally thin, soft, fragile, pitted and/or badly discolored, with poor function and aesthetics, causing patients problems such as early tooth loss, severe embarrassment, eating difficulties, and pain. It was first described separately from diseases of dentine nearly 80 years ago, but the underlying genetic and mechanistic basis of the condition is only now coming to light. Mutations in the gene AMELX , encoding an extracellular matrix protein secreted by ameloblasts during enamel formation, were first identified as a cause of AI in 1991. Since then, mutations in at least eighteen genes have been shown to cause AI presenting in isolation of other health problems, with many more implicated in syndromic AI. Some of the encoded proteins have well documented roles in amelogenesis, acting as enamel matrix proteins or the proteases that degrade them, cell adhesion molecules or regulators of calcium homeostasis. However, for others, function is less clear and further research is needed to understand the pathways and processes essential for the development of healthy enamel. Here, we review the genes and mutations underlying AI presenting in isolation of other health problems, the proteins they encode and knowledge of their roles in amelogenesis, combining evidence from human phenotypes, inheritance patterns, mouse models, and in vitro studies. An LOVD resource (http://dna2.leeds.ac.uk/LOVD/) containing all published gene mutations for AI presenting in isolation of other health problems is described. We use this resource to identify trends in the genes and mutations reported to cause AI in the 270 families for which molecular diagnoses have been reported by 23rd May 2017. Finally we discuss the potential value of the translation of AI genetics to clinical care with improved patient pathways and speculate on the
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki
2012-01-01
We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID
Directory of Open Access Journals (Sweden)
Crespo Andre LB
2009-06-01
Full Text Available Abstract Background Lepidoptera represents more than 160,000 insect species which include some of the most devastating pests of crops, forests, and stored products. However, the genomic information on lepidopteran insects is very limited. Only a few studies have focused on developing expressed sequence tag (EST libraries from the guts of lepidopteran larvae. Knowledge of the genes that are expressed in the insect gut are crucial for understanding basic physiology of food digestion, their interactions with Bacillus thuringiensis (Bt toxins, and for discovering new targets for novel toxins for use in pest management. This study analyzed the ESTs generated from the larval gut of the European corn borer (ECB, Ostrinia nubilalis, one of the most destructive pests of corn in North America and the western world. Our goals were to establish an ECB larval gut-specific EST database as a genomic resource for future research and to explore candidate genes potentially involved in insect-Bt interactions and Bt resistance in ECB. Results We constructed two cDNA libraries from the guts of the fifth-instar larvae of ECB and sequenced a total of 15,000 ESTs from these libraries. A total of 12,519 ESTs (83.4% appeared to be high quality with an average length of 656 bp. These ESTs represented 2,895 unique sequences, including 1,738 singletons and 1,157 contigs. Among the unique sequences, 62.7% encoded putative proteins that shared significant sequence similarities (E-value ≤ 10-3with the sequences available in GenBank. Our EST analysis revealed 52 candidate genes that potentially have roles in Bt toxicity and resistance. These genes encode 18 trypsin-like proteases, 18 chymotrypsin-like proteases, 13 aminopeptidases, 2 alkaline phosphatases and 1 cadherin-like protein. Comparisons of expression profiles of 41 selected candidate genes between Cry1Ab-susceptible and resistant strains of ECB by RT-PCR showed apparently decreased expressions in 2 trypsin-like and 2
Esser, Karlheinz; Tursun, Baris; Ingenhoven, Martin; Michaelis, Georg; Pratje, Elke
2002-11-08
The yeast protein cytochrome c peroxidase (Ccp1) is nuclearly encoded and imported into the mitochondrial intermembrane space, where it is involved in degradation of reactive oxygen species. It is known, that Ccp1 is synthesised as a precursor with a N-terminal pre-sequence, that is proteolytically removed during transport of the protein. Here we present evidence for a new processing pathway, involving novel signal peptidase activities. The mAAA protease subunits Yta10 (Afg3) and Yta12 (Rca1) were identified both to be essential for the first processing step. In addition, the Pcp1 (Ygr101w) gene product was found to be required for the second processing step, yielding the mature Ccp1 protein. The newly identified Pcp1 protein belongs to the rhomboid-GlpG superfamily of putative intramembrane peptidases. Inactivation of the protease motifs in mAAA and Pcp1 blocks the respective steps of proteolysis. A model of coupled Ccp1 transport and N-terminal processing by the mAAA complex and Pcp1 is discussed. Similar processing mechanisms may exist, because the mAAA subunits and the newly identified Pcp1 protein belong to ubiquitous protein families.
Directory of Open Access Journals (Sweden)
Sandeep Kaur Saggu
Full Text Available Proteases are one of the largest groups of hydrolytic enzymes constituting about 60% of total worldwide sales of industrial enzymes due to their wide applications in detergent, leather, textile, food and pharmaceutical industry. Microbial proteases have been preferred over animal and plant proteases because of their fundamental features and ease in production. Bacillus infantis SKS1, an alkaline protease producing bacteria has been isolated from garden soil of north India and identified using morphological, biochemical and molecular methods. 16S rDNA sequence amplified using universal primers has 99% sequence identity with corresponding gene sequence of Bacillus infantis strain FM 34 and Bacillus sp. Beige. The bacterial culture and its 16S rDNA gene sequence have been deposited to Microbial Culture Collection (Pune, India with accession number MCC 3035 and GenBank with accession number KR092197 respectively. The partially purified extract of Bacillus infantis SKS1 was thermostable and active in presence of Mg2+, acetyl acetone and laundry detergents implicating its application in industry. Production of these enzymes using this strain was maximized by optimization of various parameters including temperature, pH, media components and other growth conditions. Our results show that fructose and dextrose serve as the best carbon sources for production of these enzymes, highlighting the use of this strain for enzyme production utilizing relatively inexpensive substrates like beet molasses and corn steep liquor. Additionally, this strain showed maximum production of enzymes at 40°C similar to bacterial species used for commercial production of alkaline proteases. Characterization of alkaline proteases from this strain of Bacillus infantis and optimization of parameters for its production would help in understanding its industrial application and large-scale production.
Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P
2008-01-01
The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.
Stricker, A.R.; Mach, R.L.; Graaff, de L.H.
2008-01-01
The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.
Directory of Open Access Journals (Sweden)
Aris Haryanto
2016-01-01
Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with
Directory of Open Access Journals (Sweden)
Louise Ford
Full Text Available Cathepsin-like enzymes have been identified as potential targets for drug or vaccine development in many parasites, as their functions appear to be essential in a variety of important biological processes within the host, such as molting, cuticle remodeling, embryogenesis, feeding and immune evasion. Functional analysis of Caenorhabditis elegans cathepsin L (Ce-cpl-1 and cathepsin Z (Ce-cpz-1 has established that both genes are required for early embryogenesis, with Ce-cpl-1 having a role in regulating in part the processing of yolk proteins. Ce-cpz-1 also has an important role during molting.RNA interference assays have allowed us to verify whether the functions of the orthologous filarial genes in Brugia malayi adult female worms are similar. Treatment of B. malayi adult female worms with Bm-cpl-1, Bm-cpl-5, which belong to group Ia of the filarial cpl gene family, or Bm-cpz-1 dsRNA resulted in decreased numbers of secreted microfilariae in vitro. In addition, analysis of the intrauterine progeny of the Bm-cpl-5 or Bm-cpl Pro dsRNA- and siRNA-treated worms revealed a clear disruption in the process of embryogenesis resulting in structural abnormalities in embryos and a varied differential development of embryonic stages.Our studies suggest that these filarial cathepsin-like cysteine proteases are likely to be functional orthologs of the C. elegans genes. This functional conservation may thus allow for a more thorough investigation of their distinct functions and their development as potential drug targets.
Directory of Open Access Journals (Sweden)
Alexandra Dumitriu
2012-06-01
Full Text Available Parkinson disease (PD is a complex neurodegenerative disorder with largely unknown genetic mechanisms. While the degeneration of dopaminergic neurons in PD mainly takes place in the substantia nigra pars compacta (SN region, other brain areas, including the prefrontal cortex, develop Lewy bodies, the neuropathological hallmark of PD. We generated and analyzed expression data from the prefrontal cortex Brodmann Area 9 (BA9 of 27 PD and 26 control samples using the 44K One-Color Agilent 60-mer Whole Human Genome Microarray. All samples were male, without significant Alzheimer disease pathology and with extensive pathological annotation available. 507 of the 39,122 analyzed expression probes were different between PD and control samples at false discovery rate (FDR of 5%. One of the genes with significantly increased expression in PD was the forkhead box O1 (FOXO1 transcription factor. Notably, genes carrying the FoxO1 binding site were significantly enriched in the FDR-significant group of genes (177 genes covered by 189 probes, suggesting a role for FoxO1 upstream of the observed expression changes. Single-nucleotide polymorphisms (SNPs selected from a recent meta-analysis of PD genome-wide association studies (GWAS were successfully genotyped in 50 out of the 53 microarray brains, allowing a targeted expression-SNP (eSNP analysis for 52 SNPs associated with PD affection at genome-wide significance and the 189 probes from FoxO1 regulated genes. A significant association was observed between a SNP in the cyclin G associated kinase (GAK gene and a probe in the spermine oxidase (SMOX gene. Further examination of the FOXO1 region in a meta-analysis of six available GWAS showed two SNPs significantly associated with age at onset of PD. These results implicate FOXO1 as a PD-relevant gene and warrant further functional analyses of its transcriptional regulatory mechanisms.
Directory of Open Access Journals (Sweden)
Lukasz Michal Szafron
Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.
PARP-1 cleavage fragments: signatures of cell-death proteases in neurodegeneration
Directory of Open Access Journals (Sweden)
Alexander Jonathan S
2010-12-01
Full Text Available Abstract The normal function of poly (ADP-ribose polymerase-1 (PARP-1 is the routine repair of DNA damage by adding poly (ADP ribose polymers in response to a variety of cellular stresses. Recently, it has become widely appreciated that PARP-1 also participates in diverse physiological and pathological functions from cell survival to several forms of cell death and has been implicated in gene transcription, immune responses, inflammation, learning, memory, synaptic functions, angiogenesis and aging. In the CNS, PARP inhibition attenuates injury in pathologies like cerebral ischemia, trauma and excitotoxicity demonstrating a central role of PARP-1 in these pathologies. PARP-1 is also a preferred substrate for several 'suicidal' proteases and the proteolytic action of suicidal proteases (caspases, calpains, cathepsins, granzymes and matrix metalloproteinases (MMPs on PARP-1 produces several specific proteolytic cleavage fragments with different molecular weights. These PARP-1 signature fragments are recognized biomarkers for specific patterns of protease activity in unique cell death programs. This review focuses on specific suicidal proteases active towards PARP-1 to generate signature PARP-1 fragments that can identify key proteases and particular forms of cell death involved in pathophysiology. The roles played by some of the PARP-1 fragments and their associated binding partners in the control of different forms of cell death are also discussed.
Directory of Open Access Journals (Sweden)
Anderson F. Santos
2015-03-01
Full Text Available Two psychrophilic bacterial samples were isolated from King George Island soil, in Antarctica. The phylogenetic analysis based on the 16S rRNA (rrs gene led to the correlation with the closest related isolates as Sporosarcina aquimarina (99% and Algoriphagus antarcticus(99%, with query coverage of 99% and 98%, respectively.The spent culture media from both isolates displayed proteolytic activities detected by sodium dodecyl sulfate polyacrylamide gel electrophoresis containing gelatin as protein substrate. Under the employed conditions, S. aquimarina showed a 55 kDa protease with the best activity detected at pH 7.0 and at 27°C. A. antarcticusalso showed a single extracellular protease, however its molecular mass was around 90kDa and its best activity was detected at pH 9.0 and at 37°C. The proteases from both isolates were inhibited by 1,10-phenanthroline and EDTA, two metalloprotease inhibitors. This is the first record of protease detection in both species, and our results may contribute to broaden the basic knowledge of proteases from the Antarctica environment and may help prospecting future biotechnological applications of these enzymes.
Andrade, Fernanda B; Abreu, Afonso G; Nunes, Kamila O; Gomes, Tânia A T; Piazza, Roxane M F; Elias, Waldir P
2017-06-01
Enteroaggregative Escherichia coli (EAEC) is an agent of acute and persistent diarrhea worldwide, categorized in typical or atypical subgroups. Some EAEC virulence factors are members of the serine protease autotransporters of Enterobacteriaceae (SPATE). The presence of SPATE-encoding genes of different E. coli pathotypes was searched in a large collection of EAEC strains, and a possible association between SPATEs and E. coli phylogroups was investigated. Among 108 typical and 85 atypical EAEC, pic was the most prevalent gene, detected in 47.1% of the strains, followed by sat (24.3%), espI (21.2%), pet (19.2%), sepA (13.5%), sigA (4.1%), eatA (4.1%), vat (1.0%), espP and tsh, detected in one strain (0.5%) each; while epeA and espC were not detected. Phylogenetic analysis demonstrated that 39.9% of the strains belonged to group A, 23.3% to B1, 10.9% to B2, 7.8% to D, 8.8% to E and 1.5% to F. The majority of the SPATE genes were distributed in typical and atypical strains without association with any phylogroup. In addition, pic and pet were strongly associated with typical EAEC and sepA was detected in close association with atypical EAEC. Our data indicate that SPATEs may represent important virulence traits in both subgroups of EAEC. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Taye H Hamza
2011-08-01
Full Text Available Our aim was to identify genes that influence the inverse association of coffee with the risk of developing Parkinson's disease (PD. We used genome-wide genotype data and lifetime caffeinated-coffee-consumption data on 1,458 persons with PD and 931 without PD from the NeuroGenetics Research Consortium (NGRC, and we performed a genome-wide association and interaction study (GWAIS, testing each SNP's main-effect plus its interaction with coffee, adjusting for sex, age, and two principal components. We then stratified subjects as heavy or light coffee-drinkers and performed genome-wide association study (GWAS in each group. We replicated the most significant SNP. Finally, we imputed the NGRC dataset, increasing genomic coverage to examine the region of interest in detail. The primary analyses (GWAIS, GWAS, Replication were performed using genotyped data. In GWAIS, the most significant signal came from rs4998386 and the neighboring SNPs in GRIN2A. GRIN2A encodes an NMDA-glutamate-receptor subunit and regulates excitatory neurotransmission in the brain. Achieving P(2df = 10(-6, GRIN2A surpassed all known PD susceptibility genes in significance in the GWAIS. In stratified GWAS, the GRIN2A signal was present in heavy coffee-drinkers (OR = 0.43; P = 6×10(-7 but not in light coffee-drinkers. The a priori Replication hypothesis that "Among heavy coffee-drinkers, rs4998386_T carriers have lower PD risk than rs4998386_CC carriers" was confirmed: OR(Replication = 0.59, P(Replication = 10(-3; OR(Pooled = 0.51, P(Pooled = 7×10(-8. Compared to light coffee-drinkers with rs4998386_CC genotype, heavy coffee-drinkers with rs4998386_CC genotype had 18% lower risk (P = 3×10(-3, whereas heavy coffee-drinkers with rs4998386_TC genotype had 59% lower risk (P = 6×10(-13. Imputation revealed a block of SNPs that achieved P(2df<5×10(-8 in GWAIS, and OR = 0.41, P = 3×10(-8 in heavy coffee-drinkers. This study is proof of
Directory of Open Access Journals (Sweden)
Monesi Nadia
2007-07-01
Full Text Available Abstract Background The sequencing of the D.melanogaster genome revealed an unexpected small number of genes (~ 14,000 indicating that mechanisms acting on generation of transcript diversity must have played a major role in the evolution of complex metazoans. Among the most extensively used mechanisms that accounts for this diversity is alternative splicing. It is estimated that over 40% of Drosophila protein-coding genes contain one or more alternative exons. A recent transcription map of the Drosophila embryogenesis indicates that 30% of the transcribed regions are unannotated, and that 1/3 of this is estimated as missed or alternative exons of previously characterized protein-coding genes. Therefore, the identification of the variety of expressed transcripts depends on experimental data for its final validation and is continuously being performed using different approaches. We applied the Open Reading Frame Expressed Sequence Tags (ORESTES methodology, which is capable of generating cDNA data from the central portion of rare transcripts, in order to investigate the presence of hitherto unnanotated regions of Drosophila transcriptome. Results Bioinformatic analysis of 1,303 Drosophila ORESTES clusters identified 68 sequences derived from unannotated regions in the current Drosophila genome version (4.3. Of these, a set of 38 was analysed by polyA+ northern blot hybridization, validating 17 (50% new exons of low abundance transcripts. For one of these ESTs, we obtained the cDNA encompassing the complete coding sequence of a new serine protease, named SP212. The SP212 gene is part of a serine protease gene cluster located in the chromosome region 88A12-B1. This cluster includes the predicted genes CG9631, CG9649 and CG31326, which were previously identified as up-regulated after immune challenges in genomic-scale microarray analysis. In agreement with the proposal that this locus is co-regulated in response to microorganisms infection, we show
Directory of Open Access Journals (Sweden)
Keith H Turner
2009-12-01
Full Text Available Phenotypic variation within an isogenic bacterial population is thought to ensure the survival of a subset of cells in adverse conditions. The opportunistic pathogen Pseudomonas aeruginosa variably expresses several phenotypes, including antibiotic resistance, biofilm formation, and the production of CupA fimbriae. Here we describe a previously unidentified bistable switch in P. aeruginosa. This switch controls the expression of a diverse set of genes, including aprA, which encodes the secreted virulence factor alkaline protease. We present evidence that bistable expression of PA2432, herein named bexR (bistable expression regulator, which encodes a LysR-type transcription regulator, controls this switch. In particular, using DNA microarrays, quantitative RT-PCR analysis, chromatin immunoprecipitation, and reporter gene fusions, we identify genes directly under the control of BexR and show that these genes are bistably expressed. Furthermore, we show that bexR is itself bistably expressed and positively autoregulated. Finally, using single-cell analyses of a GFP reporter fusion, we present evidence that positive autoregulation of bexR is necessary for bistable expression of the BexR regulon. Our findings suggest that a positive feedback loop involving a LysR-type transcription regulator serves as the basis for an epigenetic switch that controls virulence gene expression in P. aeruginosa.
Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.
2015-01-01
For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.
Directory of Open Access Journals (Sweden)
Hui-Yeng Y Yap
Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.
Machado, Suzy Wider; de Oliveira, Caio Fernando Ramalho; Zério, Neide Graciano; Parra, José Roberto Postali; Macedo, Maria Lígia Rodrigues
2017-08-01
Plant protease inhibitors (PIs) are elements of a common plant defense mechanism induced in response to herbivores. The fall armyworm, Spodoptera frugiperda, a highly polyphagous lepidopteran pest, responds to various PIs in its diet by expressing genes encoding trypsins. This raises the question of whether the PI-induced trypsins are also inhibited by other PIs, which we posed as the hypothesis that Inga laurina trypsin inhibitor (ILTI) inhibits PI-induced trypsins in S. frugiperda. In the process of testing our hypothesis, we compared its properties with those of selected PIs, soybean Kunitz trypsin inhibitor (SKTI), Inga vera trypsin inhibitor (IVTI), Adenanthera pavonina trypsin inhibitor (ApTI), and Entada acaciifolia trypsin inhibitor (EATI). We report that ILTI is more effective in inhibiting the induced S. frugiperda trypsins than SKTI and the other PIs, which supports our hypothesis. ILTI may be more appropriate than SKTI for studies regarding adaptive mechanisms to dietary PIs. © 2017 Wiley Periodicals, Inc.
Santiago, Margarita; Gardner, Richard C
2015-07-01
Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.
Zhao, Guozhong; Yao, Yunping; Hou, Lihua; Wang, Chunling; Cao, Xiaohong
2014-10-01
Aspergillus oryzae is used to produce traditional fermented foods and beverages. A. oryzae 3.042 produces a neutral protease and an alkaline protease but rarely an acid protease, which is unfavourable to soy-sauce fermentation. A. oryzae 100-8 was obtained by N(+) ion implantation mutagenesis of A. oryzae 3.042, and the protease secretions of these two strains are different. Sequencing the genome of A. oryzae 100-8 and comparing it to the genomes of A. oryzae 100-8 and 3.042 revealed some differences, such as single nucleotide polymorphisms, nucleotide deletion or insertion. Some of these differences may reflect the ability of A. oryzae to secrete proteases. Transcriptional sequencing and analysis of the two strains during the same growth processes provided further insights into the genes and pathways involved in protease secretion.
Wong, Fei-Liang; Ithnin, Azlin; Othman, Ainoon; Cheah, Fook-Choe
2017-07-01
Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a recognised cause of severe neonatal hyperbilirubinaemia, and identifying which infants are at risk could optimise care and resources. In this study, we determined if G6PD enzyme activity (EA) and certain gene variants were associated with neonatal hyperbilirubinaemia requiring phototherapy during the first week after birth. Newborn infants with G6PD deficiency and a group with normal results obtained by the fluorescent spot test were selected for analyses of G6PD EA and the 10 commonly encountered G6PD mutations in this region, relating these with whether the infants required phototherapy before discharge from the hospital in the first week. A total of 222 infants with mean gestation and birth weight of 38.3 ± 1.8 weeks and 3.02 ± 0.48 kg, respectively, were enrolled. Of these, n = 121 were deficient with EA ≤6.76 U/g Hb, and approximately half (43%) received phototherapy in the first week after birth. The mean EA level was 3.7 U/g Hb. The EA had good accuracy in predicting phototherapy use, with area under the receiver-operating-characteristic curve of 0.81 ± 0.05. Infants on phototherapy more commonly displayed World Health Organization Class II mutations (deficiency in EA and mutation at c.1388G>A (adjusted odds ratio, 1.5 and 5.7; 95% confidence interval: 1.31-1.76 and 1.30-25.0, respectively) were independent risk factors for phototherapy. Low G6PD EA (G6PD gene variant, c.1388G>A, are risk factors for the need of phototherapy in newborn infants during the first week after birth. © 2017 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).
Chua, Kek Heng; Lian, Lay Hoong; Sim, Xiu Jia; Cheah, Tien Eang; Lau, Tze Pheng
2015-04-29
The programmed cell death 1 (PDCD1) gene encodes for the PD-1 (programmed death 1) molecule, which negatively regulates self-reactive T- and B-cells in the maintenance of peripheral tolerance. A previous report had shown the development of lupus-like phenotypes in PD-1-deficient C57BL/6 mice, was suggestive to the role of PDCD1 in predisposing to systemic lupus erythematosus (SLE). Hence, we aimed to investigate the association between PDCD1 and SLE susceptibility in the Malaysian population. A TaqMan-based real-time PCR was employed to screen for PD1.1, PD1.3, PD1.5 and PD1.6 in both SLE and healthy control groups of 200 samples each. The observed frequency for PD1.5C/C genotype was significantly higher in Indian SLE patients and Malay controls (p population. In conclusion, PD1.5 variant was significantly associated to SLE susceptibility in our Malaysian cohort. Our failure in replicating the association between other investigated PDCD1 variants and risk of getting SLE might due to ethnic and geographic variations in the distribution of these genetic variants.
Directory of Open Access Journals (Sweden)
Volker U Schwartze
2014-08-01
Full Text Available Lichtheimia species are the second most important cause of mucormycosis in Europe. To provide broader insights into the molecular basis of the pathogenicity-associated traits of the basal Mucorales, we report the full genome sequence of L. corymbifera and compared it to the genome of Rhizopus oryzae, the most common cause of mucormycosis worldwide. The genome assembly encompasses 33.6 MB and 12,379 protein-coding genes. This study reveals four major differences of the L. corymbifera genome to R. oryzae: (i the presence of an highly elevated number of gene duplications which are unlike R. oryzae not due to whole genome duplication (WGD, (ii despite the relatively high incidence of introns, alternative splicing (AS is not frequently observed for the generation of paralogs and in response to stress, (iii the content of repetitive elements is strikingly low (<5%, (iv L. corymbifera is typically haploid. Novel virulence factors were identified which may be involved in the regulation of the adaptation to iron-limitation, e.g. LCor01340.1 encoding a putative siderophore transporter and LCor00410.1 involved in the siderophore metabolism. Genes encoding the transcription factors LCor08192.1 and LCor01236.1, which are similar to GATA type regulators and to calcineurin regulated CRZ1, respectively, indicating an involvement of the calcineurin pathway in the adaption to iron limitation. Genes encoding MADS-box transcription factors are elevated up to 11 copies compared to the 1-4 copies usually found in other fungi. More findings are: (i lower content of tRNAs, but unique codons in L. corymbifera, (ii Over 25% of the proteins are apparently specific for L. corymbifera. (iii L. corymbifera contains only 2/3 of the proteases (known to be essential virulence factors in comparison to R. oryzae. On the other hand, the number of secreted proteases, however, is roughly twice as high as in R. oryzae.
Directory of Open Access Journals (Sweden)
Ouali Ahmed
2008-04-01
Full Text Available Abstract Background The superfamily of serine proteinase inhibitors (serpins is involved in numerous fundamental biological processes as inflammation, blood coagulation and apoptosis. Our interest is focused on the SERPINA3 sub-family. The major human plasma protease inhibitor, α1-antichymotrypsin, encoded by the SERPINA3 gene, is homologous to genes organized in clusters in several mammalian species. However, although there is a similar genic organization with a high degree of sequence conservation, the reactive-centre-loop domains, which are responsible for the protease specificity, show significant divergences. Results We provide additional information by analyzing the situation of SERPINA3 in the bovine genome. A cluster of eight genes and one pseudogene sharing a high degree of identity and the same structural organization was characterized. Bovine SERPINA3 genes were localized by radiation hybrid mapping on 21q24 and only spanned over 235 Kilobases. For all these genes, we propose a new nomenclature from SERPINA3-1 to SERPINA3-8. They share approximately 70% of identity with the human SERPINA3 homologue. In the cluster, we described an original sub-group of six members with an unexpected high degree of conservation for the reactive-centre-loop domain, suggesting a similar peptidase inhibitory pattern. Preliminary expression analyses of these bovSERPINA3s showed different tissue-specific patterns and diverse states of glycosylation and phosphorylation. Finally, in the context of phylogenetic analyses, we improved our knowledge on mammalian SERPINAs evolution. Conclusion Our experimental results update data of the bovine genome sequencing, substantially increase the bovSERPINA3 sub-family and enrich the phylogenetic tree of serpins. We provide new opportunities for future investigations to approach the biological functions of this unusual subset of serine proteinase inhibitors.
RISC in PD: The Impact of MicroRNAs in Parkinson’s Disease Cellular and Molecular Pathogenesis
Directory of Open Access Journals (Sweden)
Sabrina Mahalia Heman-Ackah
2013-11-01
Full Text Available Parkinson’s disease (PD is a debilitating neurodegenerative disease characterized primarily by the selective death of dopaminergic (DA neurons in the substantia nigra pars compacta of the midbrain. Although several genetic forms of PD have been identified, the precise molecular mechanisms underlying DA neuron loss in PD remain elusive. In recent years, microRNAs (miRNAs have been recognized as potent post-transcriptional regulators of gene expression with fundamental roles in numerous biological processes. Although their role in PD pathogenesis is still a very active area of investigation, several seminal studies have contributed significantly to our understanding of the roles these small non-coding RNAs play in the disease process. Among these are studies which have demonstrated specific miRNAs that target and down-regulate the expression of PD-related genes as well as those demonstrating a reciprocal relationship in which PD-related genes act to regulate miRNA processing machinery. Concurrently, a wealth of knowledge has become available regarding the molecular mechanisms that unify the underlying etiology of genetic and sporadic PD pathogenesis, including dysregulated protein quality control by the ubiquitin-proteasome system and autophagy pathway, activation of programmed cell death, mitochondrial damage and aberrant DA neurodevelopment and maintenance. Following a discussion of the interactions between PD-related genes and miRNAs, this review highlights those studies which have elucidated the roles of these pathways in PD pathogenesis. We highlight the potential of miRNAs to serve a critical regulatory role in the implicated disease pathways, given their capacity to modulate the expression of entire families of related genes. Although few studies have directly linked miRNA regulation of these pathways to PD, a strong foundation for investigation has been laid and this area holds promise to reveal novel therapeutic targets for PD.
Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji
2009-02-27
All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
Hahn, F M; Baker, J A; Poulter, C D
1996-01-01
Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...
Directory of Open Access Journals (Sweden)
Gunlög Rasmussen
Full Text Available Staphylococcus aureus encodes a remarkable number of virulence factors which may contribute to its pathogenicity and ability to cause invasive disease. The main objective of this study was to evaluate the association between S. aureus invasiveness and bacterial genotype, in terms of the presence of virulence genes and affiliation to clonal complexes. Also, the significance of different virulence genes, mainly adhesins, for the development of infective endocarditis was investigated. DNA microarray technology was used to analyze 134 S. aureus isolates, all methicillin-susceptible, derived from three groups of clinically well-characterized patients: nasal carriers (n=46, bacteremia (n=55, and bacteremia with infective endocarditis (n=33. Invasive isolates were dominant in four of the major clonal complexes: 5, 8, 15, and 25. Of the 170 virulence genes examined, those encoding accessory gene regulator group II (agr II, capsule polysaccharide serotype 5 (cap5, and adhesins such as S. aureus surface protein G (sasG and fibronectin-binding protein B (fnbB were found to be associated with invasive disease. The same was shown for the leukocidin genes lukD/lukE, as well as the genes encoding serine protease A and B (splA/splB, staphylococcal complement inhibitor (scn and the staphylococcal exotoxin-like protein (setC or selX. In addition, there was a trend of higher prevalence of certain genes or gene clusters (sasG, agr II, cap5 among isolates causing infective endocarditis compared to other invasive isolates. In most cases, the presence of virulence genes was linked to clonal complex affiliation. In conclusion, certain S. aureus clonal lineages harboring specific sets of virulence genes seem to be more successful in causing invasive disease.
Molecular Cloning and Characterization of Novel Phytocystatin Gene from Turmeric, Curcuma longa
Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling
2014-01-01
Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5′/3′ rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis. PMID:25853138
Molecular Cloning and Characterization of Novel Phytocystatin Gene from Turmeric, Curcuma longa
Directory of Open Access Journals (Sweden)
Seow-Neng Chan
2014-01-01
Full Text Available Phytocystatin, a type of protease inhibitor (PI, plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5′/3′ rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1. It has a 687 bp long open reading frame (ORF which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis.
Directory of Open Access Journals (Sweden)
Xiao-Chun Yu
2017-09-01
Conclusions: These findings suggest that cloning of microbial protease genes with good physicochemical properties and expressing them in an ideal host such as A. oryzae is a novel strategy to enhance the value of soybean meal.
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Molecular epidemiology and activity of erythrocyte G6PD variants in ...
African Journals Online (AJOL)
G6PD activity decreased significantly with age among non-deficient individuals. The range of enzyme activities was wide and overlapping among the different G6PD variants. Conclusion: G6PD deficiency was very high in the population. The gene frequencies were similar to previous findings. Molecular methods of typing ...
Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.
2002-01-01
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.
van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.
2016-01-01
Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A
2017-03-01
The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.
Directory of Open Access Journals (Sweden)
Mohamed A. Hassan
2013-01-01
Full Text Available Novel keratin-degrading bacteria were isolated from sand soil samples collected from Minia Governorate, Egypt. In this study, the isolates were identified as Bacillus amyloliquefaciens MA20 and Bacillus subtilis MA21 based on morphological and biochemical characteristics as well as 16S rRNA gene sequencing. B. amyloliquefaciens MA20 and B. subtilis MA21 produced alkaline keratinolytic serine protease when cultivated in mineral medium containing 1% of wool straight off sheep as sole carbon and nitrogen source. The two strains were observed to degrade wool completely to powder at pH 7 and 37°C within 5 days. Under these conditions the maximum activity of proteases produced by B. amyloliquefaciens MA20 and B. subtilis MA21 was 922 and 814 U/ml, respectively. The proteases exhibited optimum temperature and pH at 60°C and 9, respectively. However, the keratinolytic proteases were stable in broad range of temperature and pH values towards casein Hammerstein. Furthermore the protease inhibitor studies indicated that the produced proteases belong to serine protease because of their sensitivity to PMSF while they were inhibited partially in presence of EDTA. The two proteases are stable in most of the used organic solvents and enhanced by metals suggesting their potential use in biotechnological applications such as wool industry.
Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K
2016-06-01
The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.
Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine
2003-08-01
ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.
Directory of Open Access Journals (Sweden)
Arastoo Badoei-Dalfard
2012-01-01
Full Text Available Introduction: Organic solvent-tolerant bacteria are relatively novel extermophilic microorganisms, which can produce organic tolerant protease with capacity of being used in industrial biotechnology for producing high-value compounds. Therefore, finding of these bacteria has drawn much researchers attention nowadays. Materials and Methods: In this project, samples were collected from a hot spring, located in Jiroft. Samples were incubated in medium supplemented with cyclohexane and toluene for 3 days. Screening of protease producing bacteria was performed on the specific media, SKM (Skim milk agar, based on clear area diameter. The best bacterium was identified based on 16s rDNA gene. Protease activity was considered in different temperatures, pH and organic solvents.Results: Sequence alignment and phylogenetic tree results showed that this bacteria was closely related to Bacillus niacini, with 97% homology. Enzymatic studies showed that, this enzyme was active at a wide range of temperatures, 20-90 °C and it,s optimal activity was in 60 °C. In addition, maximum protease activity was obtained in the 8-9 range of pH, and optimal stability was also at pH 9.0. Protease activity in the presence of methanol, toluene, isopropanol, cyclohexane and DMF showed that, remaining activity was at least 80% compared to the control (without organic solvent Discussion and Conclusion: Thermopilic capacity, being active in alkaline protease and high protease stability in the presence of organic solvents all herald a remarkable application for using in different industries.
Gogos, J A; Thompson, R; Lowry, W; Sloane, B F; Weintraub, H; Horwitz, M
1996-08-01
To identify genes regulated during skeletal muscle differentiation, we have infected mouse C2C12 myoblasts with retroviral gene trap vectors, containing a promoterless marker gene with a 5' splice acceptor signal. Integration of the vector adjacent to an actively transcribed gene places the marker under the transcriptional control of the endogenous gene, while the adjacent vector sequences facilitate cloning. The vector insertionally mutates the trapped locus and may also form fusion proteins with the endogenous gene product. We have screened several hundred clones, each containing a trapping vector integrated into a different endogenous gene. In agreement with previous estimates based on hybridization kinetics, we find that a large proportion of all genes expressed in myoblasts are regulated during differentiation. Many of these genes undergo unique temporal patterns of activation or repression during cell growth and myotube formation, and some show specific patterns of subcellular localization. The first gene we have identified with this strategy is the lysosomal cysteine protease cathepsin B. Expression from the trapped allele is upregulated during early myoblast fusion and downregulated in myotubes. A direct role for cathepsin B in myoblast growth and fusion is suggested by the observation that the trapped cells deficient in cathepsin B activity have an unusual morphology and reduced survival in low-serum media and undergo differentiation with impaired cellular fusion. The phenotype is reproduced by antisense cathepsin B expression in parental C2C12 myoblasts. The cellular phenotype is similar to that observed in cultured myoblasts from patients with I cell disease, in which there is diminished accumulation of lysosomal enzymes. This suggests that a specific deficiency of cathepsin B could contribute to the myopathic component of this illness.
Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B
2011-01-01
Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
Proteolytic crosstalk in multi-protease networks
Ogle, Curtis T.; Mather, William H.
2016-04-01
Processive proteases, such as ClpXP in E. coli, are conserved enzyme assemblies that can recognize and rapidly degrade proteins. These proteases are used for a number of purposes, including degrading mistranslated proteins and controlling cellular stress response. However, proteolytic machinery within the cell is limited in capacity and can lead to a bottleneck in protein degradation, whereby many proteins compete (‘queue’) for proteolytic resources. Previous work has demonstrated that such queueing can lead to pronounced statistical relationships between different protein counts when proteins compete for a single common protease. However, real cells contain many different proteases, e.g. ClpXP, ClpAP, and Lon in E. coli, and it is not clear how competition between proteins for multiple classes of protease would influence the dynamics of cellular networks. In the present work, we theoretically demonstrate that a multi-protease proteolytic bottleneck can substantially couple the dynamics for both simple and complex (oscillatory) networks, even between substrates with substantially different affinities for protease. For these networks, queueing often leads to strong positive correlations between protein counts, and these correlations are strongest near the queueing theoretic point of balance. Furthermore, we find that the qualitative behavior of these networks depends on the relative size of the absolute affinity of substrate to protease compared to the cross affinity of substrate to protease, leading in certain regimes to priority queue statistics.
Directory of Open Access Journals (Sweden)
Cheng-Gang Zou
Full Text Available BACKGROUND: Soil fungi face a variety of environmental stresses such as UV light, high temperature, and heavy metals. Adaptation of gene expression through transcriptional regulation is a key mechanism in fungal response to environmental stress. In Saccharomyces cerevisiae, the transcription factors Msn2/4 induce stress-mediated gene expression by binding to the stress response element. Previous studies have demonstrated that the expression of extracellular proteases is up-regulated in response to heat shock in fungi. However, the physiological significance of regulation of these extracellular proteases by heat shock remains unclear. The nematophagous fungus Clonostachys rosea can secret an extracellular serine protease PrC during the infection of nematodes. Since the promoter of prC has three copies of the stress response element, we investigated the effect of environmental stress on the expression of prC. METHODOLOGY/PRINCIPAL FINDINGS: Our results demonstrated that the expression of prC was up-regulated by oxidants (H(2O(2 or menadione and heat shock, most likely through the stress response element. After oxidant treatment or heat shock, the germination of conidia in the wild type strain was significantly higher than that in the prC mutant strain in the presence of nematode cuticle. Interestingly, the addition of nematode cuticle significantly attenuated the production of reactive oxygen species (ROS induced by oxidants and heat shock in the wild type strain, but not in prC mutant strain. Moreover, low molecule weight (<3 kD degradation products of nematode cuticle suppressed the inhibitory effect of conidial germination induced by oxidants and heat shock. CONCLUSIONS/SIGNIFICANCE: These results indicate that PrC plays a protective role in oxidative stress in C. rosea. PrC degrades the nematode cuticle to produce degradation products, which in turn offer a protective effect against oxidative stress by scavenging ROS. Our study reveals a novel
Shukla, Avi; Chatterjee, Anirvan
2018-01-01
Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.
Directory of Open Access Journals (Sweden)
Mignon A Keaton
2011-03-01
Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.
Casilag, Fiordiligie; Lorenz, Anne; Krueger, Jonas; Klawonn, Frank; Weiss, Siegfried; Häussler, Susanne
2016-01-01
The opportunistic pathogen Pseudomonas aeruginosa is capable of establishing severe and persistent infections in various eukaryotic hosts. It encodes a wide array of virulence factors and employs several strategies to evade immune detection. In the present study, we screened the Harvard Medical School transposon mutant library of P. aeruginosa PA14 for bacterial factors that modulate interleukin-8 responses in A549 human airway epithelial cells. We found that in addition to the previously identified alkaline protease AprA, the elastase LasB is capable of degrading exogenous flagellin under calcium-replete conditions and prevents flagellin-mediated immune recognition. Our results indicate that the production of two proteases with anti-flagellin activity provides a failsafe mechanism for P. aeruginosa to ensure the maintenance of protease-dependent immune-modulating functions. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
International Nuclear Information System (INIS)
Nakazawa, Hiroshi; Tsuneishi, Eiko; Ponnuvel, Kangayam M.; Furukawa, Seiichi; Asaoka, Ai; Tanaka, Hiromitsu; Ishibashi, Jun; Yamakawa, Minoru
2004-01-01
A protein showing strong antiviral activity against Bombyx mori nucleopolyhedrovirus (BmNPV) was purified from the digestive juice of B. mori larvae. The molecular mass of this protein was 24 271 Da. Partial N-terminal amino acid sequence of the protein was determined and cDNA was cloned based on the amino acid sequence. A homology search of the deduced amino acid sequence of the cDNA showed 94% identity with B. mori serine protease so the protein was designated B. mori serine protease-2 (BmSP-2). Analysis of BmSP-2 gene expression showed that this gene is expressed in the midgut but not in other tissues. In addition, BmSP-2 gene was shown to not be expressed in the molting and wandering stages, indicating that the gene is hormonally regulated. Our results suggest that BmSP-2, an insect digestive enzyme, can be a potential antiviral factor against BmNPV at the initial site of viral infection
Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S
2015-01-01
The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of
A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.
Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos
2015-07-01
The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA- mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA- mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA- mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.
Shukla, Pawan; Singh, Naveen Kumar; Kumar, Dilip; Vijayan, Sambasivam; Ahmed, Israr; Kirti, Pulugurtha Bharadwaja
2014-06-01
Usable male sterility systems have immense potential in developing hybrid varieties in crop plants, which can also be used as a biological safety containment to prevent horizontal transgene flow. Barnase-Barstar system developed earlier was the first approach to engineer male sterility in plants. In an analogous situation, we have evolved a system of inducing pollen abortion and male sterility in transgenic tobacco by expressing a plant gene coding for a protein with known developmental function in contrast to the Barnase-Barstar system, which deploys genes of prokaryotic origin, i.e., from Bacillus amyloliquefaciens. We have used a plant pathogen-induced gene, cysteine protease for inducing male sterility. This gene was identified in the wild peanut, Arachis diogoi differentially expressed when it was challenged with the late leaf spot pathogen, Phaeoisariopsis personata. Arachis diogoi cysteine protease (AdCP) was expressed under the strong tapetum-specific promoter (TA29) and tobacco transformants were generated. Morphological and histological analysis of AdCP transgenic plants showed ablated tapetum and complete pollen abortion in three transgenic lines. Furthermore, transcript analysis displayed the expression of cysteine protease in these male sterile lines and the expression of the protein was identified in western blot analysis using its polyclonal antibody raised in the rabbit system.
Imaging the impact of genes on Parkinson's disease
DEFF Research Database (Denmark)
van der Vegt, J P M; van Nuenen, B F L; Bloem, B R
2009-01-01
by the discovery of mutations in single genes that can cause autosomal dominant (alpha-synuclein (SNCA)) and leucine rich repeat kinase 2 (LRRK2) gene) or recessive (Parkin, PTEN-induced putative kinase 1 (PINK1), DJ-1, and ATP13A2 gene) forms of PD. Here, we review how structural and functional neuroimaging...... of individuals carrying a mutation in one of the PD genes has offered a unique avenue of research into the pathogenesis of PD. In symptomatic mutation carriers (i.e. those with overt disease), brain mapping can help to link the molecular pathogenesis of PD more directly with functional and structural changes...... monogenic forms of PD, common polymorphisms in genes that influence mono-aminergic signaling or synaptic plasticity may have modifying effects on distinct aspects of PD. We also discuss how functional and structural neuroimaging can be used to better characterize these genotype-phenotype correlations....
Natural inhibitors of tumor-associated proteases
International Nuclear Information System (INIS)
Magdolen, U.; Krol, J.; Sato, S.; Schmitt, M.; Magdolen, V.; Krueger, A.; Mueller, M.M.; Sperl, S.
2002-01-01
The turnover and remodelling of extracellular matrix (ECM) is an essential part of many normal biological processes including development, morphogenesis, and wound healing. ECM turnover also occurs in severe pathological situations like artherosclerosis, fibrosis, tumor invasion and metastasis. The major proteases involved in this turnover are serine proteases (especially the urokinase-type plasminogen activator/plasmin system), matrix metalloproteases (a family of about 20 zinc-dependent endopeptidases including collagenases, gelatinases, stromelysins, and membrane-type metalloproteases), and cysteine proteases. In vivo, the activity of these proteases is tightly regulated in the extracellular space by zymogen activation and/or controlled inhibition. In the present review, we give an overview on the structure and biochemical properties of important tumor-associated protease inhibitors such as plasminogen activator inhibitor type 1 and type 2 (PAI-1, PAI-2), tissue inhibitors of metalloproteinases (TIMP-1, -2, -3, and -4), and the cysteine protease inhibitor cystatin C. Interestingly, some of these inhibitors of tumor-associated proteases display multiple functions which rather promote than inhibit tumor progression, when the presence of inhibitors in the tumor tissue is not balanced. (author)
Temporal information encoding in dynamic memristive devices
Energy Technology Data Exchange (ETDEWEB)
Ma, Wen; Chen, Lin; Du, Chao; Lu, Wei D., E-mail: wluee@eecs.umich.edu [Department of Electrical Engineering and Computer Science, University of Michigan, Ann Arbor, Michigan 48109 (United States)
2015-11-09
We show temporal and frequency information can be effectively encoded in memristive devices with inherent short-term dynamics. Ag/Ag{sub 2}S/Pd based memristive devices with low programming voltage (∼100 mV) were fabricated and tested. At weak programming conditions, the devices exhibit inherent decay due to spontaneous diffusion of the Ag atoms. When the devices were subjected to pulse train inputs emulating different spiking patterns, the switching probability distribution function diverges from the standard Poisson distribution and evolves according to the input pattern. The experimentally observed switching probability distributions and the associated cumulative probability functions can be well-explained using a model accounting for the short-term decay effects. Such devices offer an intriguing opportunity to directly encode neural signals for neural information storage and analysis.
Directory of Open Access Journals (Sweden)
Ming-Yang Zhou
Full Text Available Protease-producing bacteria play a vital role in degrading sedimentary organic nitrogen. However, the diversity of these bacteria and their extracellular proteases in most regions remain unknown. In this paper, the diversity of the cultivable protease-producing bacteria and of bacterial extracellular proteases in the sediments of Maxwell Bay, King George Island, Antarctica was investigated. The cultivable protease-producing bacteria reached 10(5 cells/g in all 8 sediment samples. The cultivated protease-producing bacteria were mainly affiliated with the phyla Actinobacteria, Firmicutes, Bacteroidetes, and Proteobacteria, and the predominant genera were Bacillus (22.9%, Flavobacterium (21.0% and Lacinutrix (16.2%. Among these strains, Pseudoalteromonas and Flavobacteria showed relatively high protease production. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria were serine proteases or metalloproteases. These results begin to address the diversity of protease-producing bacteria and bacterial extracellular proteases in the sediments of the Antarctic Sea.
Hereditary pancreatitis for the endoscopist
Patel, Milan R.; Eppolito, Amanda L.; Willingham, Field F.
2013-01-01
Hereditary pancreatitis shares a majority of clinical and morphologic features with chronic alcoholic pancreatitis, but may present at an earlier age. The term hereditary pancreatitis has primarily been associated with mutations in the serine protease 1 gene (PRSS1) which encodes for cationic trypsinogen. PRSS1 mutations account for approximately 68–81% of hereditary pancreatitis. Mutations in other genes, primarily serine protease inhibitor Kazal type 1 (SPINK1) and the cystic fibrosis trans...
International Nuclear Information System (INIS)
Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel
2015-01-01
The X-ray structure of protease-cleaved E. coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macroglobulin, this protease-activation mechanism is likely to operate across the diverse members of this group
Energy Technology Data Exchange (ETDEWEB)
Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja [University of Glasgow, Glasgow G12 8QQ, Scotland (United Kingdom); Roszak, Aleksander W. [University of Glasgow, Glasgow G12 8QQ, Scotland (United Kingdom); University of Glasgow, Glasgow G12 8QQ, Scotland (United Kingdom); Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel, E-mail: daniel.walker@glasgow.ac.uk [University of Glasgow, Glasgow G12 8QQ, Scotland (United Kingdom)
2015-06-30
The X-ray structure of protease-cleaved E. coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macroglobulin, this protease-activation mechanism is likely to operate across the diverse members of this group.
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.
Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis
2017-03-01
The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Pleiotropic Effects of Variants in Dementia Genes in Parkinson Disease
Directory of Open Access Journals (Sweden)
Laura Ibanez
2018-04-01
Full Text Available Background: The prevalence of dementia in Parkinson disease (PD increases dramatically with advancing age, approaching 80% in patients who survive 20 years with the disease. Increasing evidence suggests clinical, pathological and genetic overlap between Alzheimer disease, dementia with Lewy bodies and frontotemporal dementia with PD. However, the contribution of the dementia-causing genes to PD risk, cognitive impairment and dementia in PD is not fully established.Objective: To assess the contribution of coding variants in Mendelian dementia-causing genes on the risk of developing PD and the effect on cognitive performance of PD patients.Methods: We analyzed the coding regions of the amyloid-beta precursor protein (APP, Presenilin 1 and 2 (PSEN1, PSEN2, and Granulin (GRN genes from 1,374 PD cases and 973 controls using pooled-DNA targeted sequence, human exome-chip and whole-exome sequencing (WES data by single variant and gene base (SKAT-O and burden tests analyses. Global cognitive function was assessed using the Mini-Mental State Examination (MMSE or the Montreal Cognitive Assessment (MoCA. The effect of coding variants in dementia-causing genes on cognitive performance was tested by multiple regression analysis adjusting for gender, disease duration, age at dementia assessment, study site and APOE carrier status.Results: Known AD pathogenic mutations in the PSEN1 (p.A79V and PSEN2 (p.V148I genes were found in 0.3% of all PD patients. There was a significant burden of rare, likely damaging variants in the GRN and PSEN1 genes in PD patients when compared with frequencies in the European population from the ExAC database. Multiple regression analysis revealed that PD patients carrying rare variants in the APP, PSEN1, PSEN2, and GRN genes exhibit lower cognitive tests scores than non-carrier PD patients (p = 2.0 × 10−4, independent of age at PD diagnosis, age at evaluation, APOE status or recruitment site.Conclusions: Pathogenic mutations in
International Nuclear Information System (INIS)
Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.
2005-01-01
Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach
Three monoclonal antibodies against the serpin protease nexin-1 prevent protease translocation
DEFF Research Database (Denmark)
Kousted, Tina Mostrup; Skjoedt, K; Petersen, S V
2013-01-01
abolish the protease inhibitory activity of PN-1. In the presence of the antibodies, PN-1 does not form a complex with its target proteases, but is recovered in a reactive centre cleaved form. Using site-directed mutagenesis, we mapped the three overlapping epitopes to an area spanning the gap between...
The ClpXP protease is dispensable for degradation of unfolded proteins in Staphylococcus aureus
DEFF Research Database (Denmark)
Stahlhut, Steen G.; Alqarzaee, Abdulelah A.; Jensen, Camilla
2017-01-01
In living cells intracellular proteolysis is crucial for protein homeostasis, and ClpP proteases are conserved between eubacteria and the organelles of eukaryotic cells. In Staphylococcus aureus, ClpP associates to the substrate specificity factors, ClpX and ClpC forming two ClpP proteases, ClpXP...... cells, highly upregulated loci include the urease operon, the pyrimidine biosynthesis operon, the betA-betB operon, and the pathogenicity island, SaPI5, while virulence genes were dramatically down-regulated....
Maseko, Sibusiso B; Natarajan, Satheesh; Sharma, Vikas; Bhattacharyya, Neelakshi; Govender, Thavendran; Sayed, Yasien; Maguire, Glenn E M; Lin, Johnson; Kruger, Hendrik G
2016-06-01
Human immunodeficiency virus (HIV) infections in sub-Saharan Africa represent about 56% of global infections. Many studies have targeted HIV-1 protease for the development of drugs against AIDS. Recombinant HIV-1 protease is used to screen new drugs from synthetic compounds or natural substances. Along with the wild type (C-SA) we also over-expressed and characterized two mutant forms from patients that had shown resistance to protease inhibitors. Using recombinant DNA technology, we constructed three recombinant plasmids in pGEX-6P-1 and expressed them containing a sequence encoding wild type HIV protease and two mutants (I36T↑T contains 100 amino acids and L38L↑N↑L contains 101 amino acids). These recombinant proteins were isolated from inclusion bodies by using QFF anion exchange and GST trap columns. In SDS-PAGE, we obtained these HIV proteases as single bands of approximately 11.5, 11.6 and 11.7 kDa for the wild type, I36T↑Tand L38L↑N↑L mutants, respectively. The enzyme was recovered efficiently (0.25 mg protein/L of Escherichia coli culture) and had high specific activity of 2.02, 2.20 and 1.33 μmol min(-1) mg(-1) at an optimal pH of 5 and temperature of 37 °C for the wild type, I36T↑T and L38L↑N↑L, respectively. The method employed here provides an easy and rapid purification of the HIV-1(C-SA) protease from the inclusion bodies, with high yield and high specific activities. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Tuffery Pierre
2009-12-01
Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
Directory of Open Access Journals (Sweden)
Moysés Elias-Neto
2013-06-01
Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Stork, Ines; Gartemann, Karl-Heinz; Burger, Annette; Eichenlaub, Rudolf
2008-09-01
Genes for seven putative serine proteases (ChpA-ChpG) belonging to the trypsin subfamily and homologous to the virulence factor pat-1 were identified on the chromosome of Clavibacter michiganensis subsp. michiganensis (Cmm) NCPPB382. All proteases have signal peptides indicating export of these proteins. Their putative function is suggested by two motifs and an aspartate residue typical for serine proteases. Furthermore, six cysteine residues are located at conserved positions. The genes are clustered in a chromosomal region of about 50 kb with a significantly lower G + C content than common for Cmm. The genes chpA, chpB and chpD are pseudogenes as they contain frame shifts and/or in-frame stop codons. The genes chpC and chpG were inactivated by the insertion of an antibiotic resistance cassette. The chpG mutant was not impaired in virulence. However, in planta the titre of the chpC mutant was drastically reduced and only weak disease symptoms were observed. Complementation of the chpC mutant by the wild-type allele restored full virulence. ChpC is the first chromosomal gene of Cmm identified so far that affects the interaction of the pathogen with the host plant.
Mañú Pereira, María Del Mar; Cabot, Anna; Martínez González, Ana; Sitjà Navarro, Eulalia; Cararach, Vicent; Sabrià, Josep; Boixaderas, Jordi; Teixidor, Roser; Bosch, Albert; López Vílchez, M Angeles; Martín Ibáñez, Itziar; Carrión, Teresa; Plaja, Pere; Sánchez, Mario; Vives Corrons, José Luis
2007-06-30
The prevalence of hemoglobinopathies and glucose-6-phosphate dehidrogenase (G6PD) deficiency in the Catalan neonatal population is increasing due to immigration. Coinheritance of more than a single RBC genetic defect is becoming more frequent and diagnostic pitfalls are also increasing. We intended to demonstrate the need to perform an early diagnosis of sickle cell disease (SCD) by means of neonatal screening, to establish the prevalence of SCD associated with alpha thalassemia and G6PD deficiency and to identify genotypes associated with sickle cell disease and G6PD deficiency. 4,020 blood samples from newborns were screened. For the screening of hemoglobinopathies the high performance liquid chromatography method was used and for G6PD deficiency the fluorescent spot test was employed. We studied the association between betaS gene and alpha thalassaemia del-3.7 Kb. SCD and G6PD deficiency genotypes were established. Prevalence of SCD in population at risk was 1/475 newborns. Prevalence of G6PD deficiency in population at risk was 1/43, and in autochthonous population was 1/527 newborns. In all the cases, sickle hemoglobin was confirmed by ARMS (amplification refractory mutation system). Association between betaS gene and alpha thalassaemia del-3.7 Kb was found in 32.2% of the samples, and an association between betaS gene and G6PD deficiency was observed in 7% of the samples. This study confirms the high prevalence of SCD and G6PD deficiency in population at risk as well as their genetic and clinical heterogeneity. The study of genotype/phenotype relationships allows a better knowledge of molecular mechanism and is useful to establish suitable criteria of diagnosis.
Directory of Open Access Journals (Sweden)
Luciana Bonome Zeminian
2013-02-01
Full Text Available The goal of treatment of chronic hepatitis C is to achieve a sustained virological response, which is defined as exhibiting undetectable hepatitis C virus (HCV RNA levels in serum following therapy for at least six months. However, the current treatment is only effective in 50% of patients infected with HCV genotype 1, the most prevalent genotype in Brazil. Inhibitors of the serine protease non-structural protein 3 (NS3 have therefore been developed to improve the responses of HCV-infected patients. However, the emergence of drug-resistant variants has been the major obstacle to therapeutic success. The goal of this study was to evaluate the presence of resistance mutations and genetic polymorphisms in the NS3 genomic region of HCV from 37 patients infected with HCV genotype 1 had not been treated with protease inhibitors. Plasma viral RNA was used to amplify and sequence the HCV NS3 gene. The results indicate that the catalytic triad is conserved. A large number of substitutions were observed in codons 153, 40 and 91; the resistant variants T54A, T54S, V55A, R155K and A156T were also detected. This study shows that resistance mutations and genetic polymorphisms are present in the NS3 region of HCV in patients who have not been treated with protease inhibitors, data that are important in determining the efficiency of this new class of drugs in Brazil.
MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.
Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica
2006-01-24
Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The
Dongre, Arundhati; Clements, Debbie; Fisher, Andrew J; Johnson, Simon R
2017-08-01
Lymphangioleiomyomatosis (LAM) is a rare disease in which LAM cells and fibroblasts form lung nodules and it is hypothesized that LAM nodule-derived proteases cause cyst formation and tissue damage. On protease gene expression profiling in whole lung tissue, cathepsin K gene expression was 40-fold overexpressed in LAM compared with control lung tissue (P ≤ 0.0001). Immunohistochemistry confirmed cathepsin K protein was expressed in LAM but not control lungs. Cathepsin K gene expression and protein and protease activity were detected in LAM-associated fibroblasts but not the LAM cell line 621-101. In lung nodules, cathepsin K immunoreactivity predominantly co-localized with LAM-associated fibroblasts. In vitro, fibroblast extracellular cathepsin K activity was minimal at pH 7.5 but significantly enhanced at pH 7 and 6. 621-101 cells reduced extracellular pH with acidification dependent on 621-101 mechanistic target of rapamycin activity and net hydrogen ion exporters, particularly sodium bicarbonate co-transporters and carbonic anhydrases, which were also expressed in LAM lung tissue. In LAM cell-fibroblast co-cultures, acidification paralleled cathepsin K activity, and both were reduced by sodium bicarbonate co-transporter (P ≤ 0.0001) and carbonic anhydrase inhibitors (P = 0.0021). Our findings suggest that cathepsin K activity is dependent on LAM cell-fibroblast interactions, and inhibitors of extracellular acidification may be potential therapies for LAM. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Naoya Maekawa
Full Text Available Programmed death 1 (PD-1, an immunoinhibitory receptor, and programmed death ligand 1 (PD-L1, its ligand, together induce the "exhausted" status in antigen-specific lymphocytes and are thus involved in the immune evasion of tumor cells. In this study, canine PD-1 and PD-L1 were molecularly characterized, and their potential as therapeutic targets for canine tumors was discussed. The canine PD-1 and PD-L1 genes were conserved among canine breeds. Based on the sequence information obtained, the recombinant canine PD-1 and PD-L1 proteins were constructed; they were confirmed to bind each other. Antibovine PD-L1 monoclonal antibody effectively blocked the binding of recombinant PD-1 with PD-L1-expressing cells in a dose-dependent manner. Canine melanoma, mastocytoma, renal cell carcinoma, and other types of tumors examined expressed PD-L1, whereas some did not. Interestingly, anti-PD-L1 antibody treatment enhanced IFN-γ production from tumor-infiltrating cells. These results showed that the canine PD-1/PD-L1 pathway is also associated with T-cell exhaustion in canine tumors and that its blockade with antibody could be a new therapeutic strategy for canine tumors. Further investigations are needed to confirm the ability of anti-PD-L1 antibody to reactivate canine antitumor immunity in vivo, and its therapeutic potential has to be further discussed.
Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutiérrez, S.; Monte, E.
2011-01-01
The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791
Directory of Open Access Journals (Sweden)
Ying Wang
Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.
Directory of Open Access Journals (Sweden)
DEWI FITRIANI
2010-06-01
Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...
DEFF Research Database (Denmark)
Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua
2014-01-01
OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...
Directory of Open Access Journals (Sweden)
Melanie Brunsch
Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.
DEFF Research Database (Denmark)
Ødum, Anders Sebastian Rosenkrans
-terminal of the scissile bond, leaving C-terminal fusions to have non-native C-termini after processing. A solution yielding native C-termini would allow novel expression and purification systems for therapeutic proteins and peptides.The peptidyl-Lys metallopeptidase (LysN) of the fungus Armillaria mellea (Am) is one...... of few known proteases to have substrate specificity for the C-terminal side of the scissile bond. LysN exhibits specificity for lysine, and has primarily been used to complement trypsin in to proteomic studies. A working hypothesis during this study was the potential of LysN as a processing protease...
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-01-01
Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...
Directory of Open Access Journals (Sweden)
Rhona Kayra Stuart
2014-06-01
Full Text Available Deg-family proteases are a periplasm-associated group of proteins that are known to be involved in envelope stress responses and are found in most microorganisms. Orthologous genes SYNW2176 (in strain WH8102 and sync_2523 (strain CC9311 are predicted members of the Deg-protease family and are among the few genes induced by copper stress in both open ocean and coastal marine Synechococcus strains. In contrast to the lack of a phenotype in a similar knockout in Synechocystis PCC6803, a SYNW2176 knockout mutant in strain WH8102 was much more resistant to copper than the wild-type. The mutant also exhibited a significantly altered outer membrane protein composition which may contribute to copper resistance, longer lag phase after transfer, low-level consistent alkaline phosphatase activity, and an inability to induce high alkaline phosphatase activity in response to phosphate stress. This phenotype suggests a protein-quality-control role for SYNW2176, the absence of which leads to a constitutively activated stress response. Deg-protease family proteins in this ecologically important cyanobacterial group thus help to determine outer membrane responses to both nutrients and toxins.
Vouille, V; Amiche, M; Nicolas, P
1997-09-01
We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.
Rajamani, Sathish; Sayre, Richard T
2011-02-01
Many bacteria produce and secrete proteases during host invasion and pathogenesis. Vibrio harveyi, an opportunistic pathogen of shrimp, is known to use a two-component quorum sensing (QS) mechanism for coordination of gene expression including protease secretion at high population densities. We examined the role of V. harveyi's QS signaling molecules, N-(3-hydroxybutanoyl)-L-homoserine lactone (AI-1) and the boron derivative of autoinducer-2 (BAI-2) in extracellular protease production. A fusion protein, M3CLPY (Rajamani et al., 2007), consisting of a large protease sensitive BAI-2 mutant receptor LuxP (~38kDa) flanked by two protease insensitive cyan and yellow variants of GFP (~28kDa each) was utilized as a substrate to detect secreted protease activity. The M3CLPY fusion, with the addition of wild-type V. harveyi (BB120) cell-free culture filtrate showed a time-dependent loss in fluorescence resonance energy transfer (FRET) associated with the cleavage of the LuxP linker protein and hence separation of the two fluorophores. This cleavage of LuxP linker protein leading to decreased FRET efficiency was further confirmed by immunoblotting using anti-GFP antibody. The addition of cell-free filtrates from strains defective in one or both of the two-component QS pathways: luxN(-) (defective in AI-1), luxS(-) (defective in BAI-2), and luxN(-)/luxS(-) (defective in both AI-1/BAI-2) showed differential levels of protease production. The observed protease activities were most pronounced in wild-type, followed by the AI-1 defective mutant (BB170) and the least for luxS(-) mutant (MM30) and luxN(-)/luxS(-) double mutant (MM32) strains. Incidentally, the lowest protease producing strains MM30 and MM32 were both defective in BAI-2 production. This observation was validated by addition of synthetic BAI-2 to MM30 and MM32 strains to restore protease production. Our results indicate that BAI-2 signaling in the two-component QS pathway plays the key role in regulating
Xu, J; Johnson, R C
1995-01-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...
Directory of Open Access Journals (Sweden)
Riley Laura M
2012-03-01
Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.
Directory of Open Access Journals (Sweden)
Rui Cruz
2014-08-01
Full Text Available Members of the species Rickettsia are obligate intracellular, gram-negative, arthropod-borne pathogens of humans and other mammals. The life-threatening character of diseases caused by many Rickettsia species and the lack of reliable protective vaccine against rickettsioses strengthens the importance of identifying new protein factors for the potential development of innovative therapeutic tools. Herein, we report the identification and characterization of a novel membrane-embedded retropepsin-like homologue, highly conserved in 55 Rickettsia genomes. Using R. conorii gene homologue RC1339 as our working model, we demonstrate that, despite the low overall sequence similarity to retropepsins, the gene product of rc1339 APRc (for Aspartic Protease from Rickettsia conorii is an active enzyme with features highly reminiscent of this family of aspartic proteases, such as autolytic activity impaired by mutation of the catalytic aspartate, accumulation in the dimeric form, optimal activity at pH 6, and inhibition by specific HIV-1 protease inhibitors. Moreover, specificity preferences determined by a high-throughput profiling approach confirmed common preferences between this novel rickettsial enzyme and other aspartic proteases, both retropepsins and pepsin-like. This is the first report on a retropepsin-like protease in gram-negative intracellular bacteria such as Rickettsia, contributing to the analysis of the evolutionary relationships between the two types of aspartic proteases. Additionally, we have also shown that APRc is transcribed and translated in R. conorii and R. rickettsii and is integrated into the outer membrane of both species. Finally, we demonstrated that APRc is sufficient to catalyze the in vitro processing of two conserved high molecular weight autotransporter adhesin/invasion proteins, Sca5/OmpB and Sca0/OmpA, thereby suggesting the participation of this enzyme in a relevant proteolytic pathway in rickettsial life-cycle. As a
A biotechnology perspective of fungal proteases
Directory of Open Access Journals (Sweden)
Paula Monteiro de Souza
2015-06-01
Full Text Available Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications.
Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda
2017-10-01
Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.
Directory of Open Access Journals (Sweden)
Lin Yuan
Full Text Available Three hundred one-day-old male broiler chickens (Ross-308 were fed corn-soybean basal diets containing non-starch polysaccharide (NSP enzyme and different levels of acid protease from 1 to 42 days of age to investigate the effects of exogenous enzymes on growth performance, digestive function, activity of endogenous digestive enzymes in the pancreas and mRNA expression of pancreatic digestive enzymes. For days 1-42, compared to the control chickens, average daily feed intake (ADFI and average daily gain (ADG were significantly enhanced by the addition of NSP enzyme in combination with protease supplementation at 40 or 80 mg/kg (p<0.05. Feed-to-gain ratio (FGR was significantly improved by supplementation with NSP enzymes or NSP enzyme combined with 40 or 80 mg/kg protease compared to the control diet (p<0.05. Apparent digestibility of crude protein (ADCP was significantly enhanced by the addition of NSP enzyme or NSP enzyme combined with 40 or 80 mg/kg protease (p<0.05. Cholecystokinin (CCK level in serum was reduced by 31.39% with NSP enzyme combined with protease supplementation at 160 mg/kg (p<0.05, but the CCK level in serum was increased by 26.51% with NSP enzyme supplementation alone. After 21 days, supplementation with NSP enzyme and NSP enzyme combined with 40 or 80 mg/kg protease increased the activity of pancreatic trypsin by 74.13%, 70.66% and 42.59% (p<0.05, respectively. After 42 days, supplementation with NSP enzyme and NSP enzyme combined with 40 mg/kg protease increased the activity of pancreatic trypsin by 32.45% and 27.41%, respectively (p<0.05. However, supplementation with NSP enzyme and 80 or 160 mg/kg protease decreased the activity of pancreatic trypsin by 10.75% and 25.88%, respectively (p<0.05. The activities of pancreatic lipase and amylase were significantly higher in treated animals than they were in the control group (p<0.05. Supplementation with NSP enzyme, NSP enzyme combined with 40 or 80 mg/kg protease increased
International Nuclear Information System (INIS)
Lin, Ying-Chuan; Perryman, Alexander L.; Olson, Arthur J.; Torbett, Bruce E.; Elder, John H.; Stout, C. David
2011-01-01
Crystal structures of the 6s-98S FIV protease chimera with darunavir and lopinavir bound have been determined at 1.7 and 1.8 Å resolution, respectively. A chimeric feline immunodeficiency virus (FIV) protease (PR) has been engineered that supports infectivity but confers sensitivity to the human immunodeficiency virus (HIV) PR inhibitors darunavir (DRV) and lopinavir (LPV). The 6s-98S PR has five replacements mimicking homologous residues in HIV PR and a sixth which mutated from Pro to Ser during selection. Crystal structures of the 6s-98S FIV PR chimera with DRV and LPV bound have been determined at 1.7 and 1.8 Å resolution, respectively. The structures reveal the role of a flexible 90s loop and residue 98 in supporting Gag processing and infectivity and the roles of residue 37 in the active site and residues 55, 57 and 59 in the flap in conferring the ability to specifically recognize HIV PR drugs. Specifically, Ile37Val preserves tertiary structure but prevents steric clashes with DRV and LPV. Asn55Met and Val59Ile induce a distinct kink in the flap and a new hydrogen bond to DRV. Ile98Pro→Ser and Pro100Asn increase 90s loop flexibility, Gln99Val contributes hydrophobic contacts to DRV and LPV, and Pro100Asn forms compensatory hydrogen bonds. The chimeric PR exhibits a comparable number of hydrogen bonds, electrostatic interactions and hydrophobic contacts with DRV and LPV as in the corresponding HIV PR complexes, consistent with IC 50 values in the nanomolar range
Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor
2013-12-01
The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.
Lim, Moon Sub; Kim, Jeong-A; Lim, Jong Gyu; Kim, Byoung Sik; Jeong, Kwang Cheol; Lee, Kyu-Ho; Choi, Sang Ho
2011-08-01
Little is known about the molecular mechanism for autolysis of Gram-negative bacteria. In the present study, we identified the vvpS gene encoding a serine protease, VvpS, from Vibrio vulnificus, a Gram-negative food-borne pathogen. The amino acid sequence predicted that VvpS consists of two functional domains, an N-terminal protease catalytic domain (PCD) and a C-terminal carbohydrate binding domain (CBD). A null mutation of vvpS significantly enhanced viability during stationary phase, as measured by enumerating CFU and differentially staining viable cells. The vvpS mutant reduced the release of cytoplasmic β-galactosidase and high-molecular-weight extracellular chromosomal DNA into the culture supernatants, indicating that VvpS contributes to the autolysis of V. vulnificus during stationary phase. VvpS is secreted via a type II secretion system (T2SS), and it exerts its effects on autolysis through intracellular accumulation during stationary phase. Consistent with this, a disruption of the T2SS accelerated intracellular accumulation of VvpS and thereby the autolysis of V. vulnificus. VvpS also showed peptidoglycan-hydrolyzing activity, indicating that the autolysis of V. vulnificus is attributed to the self-digestion of the cell wall by VvpS. The functions of the VvpS domains were assessed by C-terminal deletion analysis and demonstrated that the PCD indeed possesses a proteolytic activity and that the CBD is required for hydrolyzing peptidoglycan effectively. Finally, the vvpS mutant exhibited reduced virulence in the infection of mice. In conclusion, VvpS is a serine protease with a modular structure and plays an essential role in the autolysis and pathogenesis of V. vulnificus.
Directory of Open Access Journals (Sweden)
Assaf Shapira
Full Text Available The synthesis of inactive enzyme precursors, also known as "zymogens," serves as a mechanism for regulating the execution of selected catalytic activities in a desirable time and/or site. Zymogens are usually activated by proteolytic cleavage. Many viruses encode proteases that execute key proteolytic steps of the viral life cycle. Here, we describe a proof of concept for a therapeutic approach to fighting viral infections through eradication of virally infected cells exclusively, thus limiting virus production and spread. Using the hepatitis C virus (HCV as a model, we designed two HCV NS3 protease-activated "zymogenized" chimeric toxins (which we denote "zymoxins". In these recombinant constructs, the bacterial and plant toxins diphtheria toxin A (DTA and Ricin A chain (RTA, respectively, were fused to rationally designed inhibitor peptides/domains via an HCV NS3 protease-cleavable linker. The above toxins were then fused to the binding and translocation domains of Pseudomonas exotoxin A in order to enable translocation into the mammalian cells cytoplasm. We show that these toxins exhibit NS3 cleavage dependent increase in enzymatic activity upon NS3 protease cleavage in vitro. Moreover, a higher level of cytotoxicity was observed when zymoxins were applied to NS3 expressing cells or to HCV infected cells, demonstrating a potential therapeutic window. The increase in toxin activity correlated with NS3 protease activity in the treated cells, thus the therapeutic window was larger in cells expressing recombinant NS3 than in HCV infected cells. This suggests that the "zymoxin" approach may be most appropriate for application to life-threatening acute infections where much higher levels of the activating protease would be expected.
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine
2018-02-01
Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
D.G. Healy (Daniel); M. Falchi (Mario); S.S. O'Sullivan (Sean); V. Bonifati (Vincenzo); A. Durr; S. Bressman (Susan); A. Brice; J.O. Aasly (Jan); C.P. Zabetian (Cyrus); S. Goldwurm (Stefano); J.J. Ferreira (Joaquim); E. Tolosa; D.M. Kay (Denise); C. Klein (Christoph); D.R. Williams (David); C. Marras (Connie); A.E. Lang; Z.K. Wszolek (Zbigniew); J. Berciano (José); A.H.V. Schapira (Anthony); T. Lynch (Tim); K.P. Bhatia (Kailash); T. Gasser (Thomas); A.J. Lees (Andrew); N.W. Wood (Nicholas)
2008-01-01
textabstractBackground: Mutations in LRRK2, the gene that encodes leucine-rich repeat kinase 2, are a cause of Parkinson's disease (PD). The International LRRK2 Consortium was established to answer three key clinical questions: can LRRK2-associated PD be distinguished from idiopathic PD; which
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab
2016-07-01
The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.
DEFF Research Database (Denmark)
Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo
2014-01-01
The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...
Hybrid male sterility and genome-wide misexpression of male reproductive proteases.
Gomes, Suzanne; Civetta, Alberto
2015-07-06
Hybrid male sterility is a common barrier to gene flow between species. Previous studies have posited a link between misregulation of spermatogenesis genes in interspecies hybrids and sterility. However, in the absence of fully fertile control hybrids, it is impossible to differentiate between misregulation associated with sterility vs. fast male gene regulatory evolution. Here, we differentiate between these two possibilities using a D. pseudoobscura species pair that experiences unidirectional hybrid sterility. We identify genes uniquely misexpressed in sterile hybrid male reproductive tracts via RNA-seq. The sterile male hybrids had more misregulated and more over or under expressed genes relative to parental species than the fertile male hybrids. Proteases were the only gene ontology class overrepresented among uniquely misexpressed genes, with four located within a previously identified hybrid male sterility locus. This result highlights the potential role of a previously unexplored class of genes in interspecific hybrid male sterility and speciation.
Hempel, Niels; Görisch, Helmut; Mern, Demissew S
2013-09-01
Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.
Ibrahim, Ahmed Ragaa Nour; Kawamoto, Seiji; Aki, Tsunehiro; Shimada, Yayoi; Rikimaru, Satoshi; Onishi, Nobukazu; Babiker, Elfadil Elfadl; Oiso, Isao; Hashimoto, Kunihiko; Hayashi, Takaharu; Ono, Kazuhisa
2010-01-01
Japanese cedar (Cryptomeria japonica) pollen is a major cause of seasonal pollinosis in Japan. Protease activity in the pollen grains may trigger pro-allergic responses but no such proteases have yet been identified as pollen allergens. We report the molecular cloning and immunochemical characterization of a novel C. japonica pollen allergen belonging to the aspartic protease family. We focused on the C. japonica pollen allergen spot No. 63 (CPA63, 47.5% IgE binding frequency) on our 2-dimensional IgE immunoblot map. The internal amino acid sequences were determined using time-of-flight mass spectrometry. Full-length cpa63 cDNA was cloned by rapid amplification of cDNA ends (RACE)-PCR. Recombinant CPA63 (r-CPA63) was expressed using the baculovirus-insect cell culture system and its IgE binding capacity was analyzed by enzyme-linked immunosorbent assay (ELISA). The proteolytic activity of r-CPA63 was also assessed using a putative mature enzyme produced upon autolysis. cpa63 cDNA encoded a 472 amino acid polypeptide showing about 40% sequence identity to members of the plant atypical aspartic protease family. ELISA showed that r-CPA63 was recognized by IgE antibodies in the serum of 58% (18/31) of Japanese cedar pollinosis patients. We also demonstrated an aspartic protease-like enzyme activity of the putative mature r-CPA63. We have identified the first plant aspartic protease allergen from Japanese cedar pollen. The availability of the CPA63 sequence and its recombinant allergen production system are useful not only for pharmaceutical applications but also for further examination of the role of protease activity in the pathogenesis of cedar pollinosis. 2010 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Tiane Martin de Moura
2012-10-01
Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.
A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3
Energy Technology Data Exchange (ETDEWEB)
Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others
1996-03-05
We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.
Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza
2016-01-01
Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
2010-01-01
Background Baculovirus comprise the largest group of insect viruses most studied worldwide, mainly because they efficiently kill agricutural insect pests. In this study, two recombinant baculoviruses containing the ScathL gene from Sarcophaga peregrina (vSynScathL), and the Keratinase gene from the fungus Aspergillus fumigatus (vSynKerat), were constructed. and their insecticidal properties analysed against Spodoptera frugiperda larvae. Results Bioassays of third-instar and neonate S. frugiperda larvae with vSynScathL and vSynKerat showed a decrease in the time needed to kill the infected insects when compared to the wild type virus. We have also shown that both recombinants were able to increase phenoloxidase activity in the hemolymph of S. frugiperda larvae. The expression of proteases in infected larvae resulted in destruction of internal tissues late in infection, which could be the reason for the increased viral speed of kill. Conclusions Baculoviruses and their recombinant forms constitute viable alternatives to chemical insecticides. Recombinant baculoviruses containing protease genes can be added to the list of engineered baculoviruses with great potential to be used in integrated pest management programs. PMID:20587066
The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.
LENUS (Irish Health Repository)
Martin, Ronny
2011-04-01
The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.
Directory of Open Access Journals (Sweden)
Beatriz Moreno
2016-07-01
Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from
Maddur, Ashoka A; Swanson, Richard; Izaguirre, Gonzalo; Gettins, Peter G W; Olson, Steven T
2013-11-01
Serpin protein protease inhibitors inactivate their target proteases through a unique mechanism in which a major serpin conformational change, resulting in a 70-Å translocation of the protease from its initial reactive center loop docking site to the opposite pole of the serpin, kinetically traps the acyl-intermediate complex. Although the initial Michaelis and final trapped acyl-intermediate complexes have been well characterized structurally, the intermediate stages involved in this remarkable transformation are not well understood. To better characterize such intermediate steps, we undertook rapid kinetic studies of the FRET and fluorescence perturbation changes of site-specific fluorophore-labeled derivatives of the serpin, α1-protease inhibitor (α1PI), which report the serpin and protease conformational changes involved in transforming the Michaelis complex to the trapped acyl-intermediate complex in reactions with trypsin. Two kinetically resolvable conformational changes were observed in the reactions, ascribable to (i) serpin reactive center loop insertion into sheet A with full protease translocation but incomplete protease distortion followed by, (ii) full conformational distortion and movement of the protease and coupled serpin conformational changes involving the F helix-sheet A interface. Kinetic studies of calcium effects on the labeled α1PI-trypsin reactions demonstrated both inactive and low activity states of the distorted protease in the final complex that were distinct from the intermediate distorted state. These studies provide new insights into the nature of the serpin and protease conformational changes involved in trapping the acyl-intermediate complex in serpin-protease reactions and support a previously proposed role for helix F in the trapping mechanism.
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-07-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.
Directory of Open Access Journals (Sweden)
Mark J White
2011-03-01
Full Text Available Mycobacterium tuberculosis remains a significant global health concern largely due to its ability to persist for extended periods within the granuloma of the host. While residing within the granuloma, the tubercle bacilli are likely to be exposed to stress that can result in formation of aberrant proteins with altered structures. Bacteria encode stress responsive determinants such as proteases and chaperones to deal with misfolded or unfolded proteins. pepD encodes an HtrA-like serine protease and is thought to process proteins altered following exposure of M. tuberculosis to extra-cytoplasmic stress. PepD functions both as a protease and chaperone in vitro, and is required for aspects of M. tuberculosis virulence in vivo. pepD is directly regulated by the stress-responsive two-component signal transduction system MprAB and indirectly by extracytoplasmic function (ECF sigma factor SigE. Loss of PepD also impacts expression of other stress-responsive determinants in M. tuberculosis. To further understand the role of PepD in stress adaptation by M. tuberculosis, a proteomics approach was taken to identify binding proteins and possible substrates of this protein. Using subcellular fractionation, the cellular localization of wild-type and PepD variants was determined. Purified fractions as well as whole cell lysates from Mycobacterium smegmatis or M. tuberculosis strains expressing a catalytically compromised PepD variant were immunoprecipitated for PepD and subjected to LC-MS/MS analyses. Using this strategy, the 35-kDa antigen encoding a homolog of the PspA phage shock protein was identified as a predominant binding partner and substrate of PepD. We postulate that proteolytic cleavage of the 35-kDa antigen by PepD helps maintain cell wall homeostasis in Mycobacterium and regulates specific stress response pathways during periods of extracytoplasmic stress.
Directory of Open Access Journals (Sweden)
Peter K Busk
Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.
Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad
2016-08-01
The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.
Advances in protease engineering for laundry detergents.
Vojcic, Ljubica; Pitzler, Christian; Körfer, Georgette; Jakob, Felix; Ronny Martinez; Maurer, Karl-Heinz; Schwaneberg, Ulrich
2015-12-25
Proteases are essential ingredients in modern laundry detergents. Over the past 30 years, subtilisin proteases employed in the laundry detergent industry have been engineered by directed evolution and rational design to tailor their properties towards industrial demands. This comprehensive review discusses recent success stories in subtilisin protease engineering. Advances in protease engineering for laundry detergents comprise simultaneous improvement of thermal resistance and activity at low temperatures, a rational strategy to modulate pH profiles, and a general hypothesis for how to increase promiscuous activity towards the production of peroxycarboxylic acids as mild bleaching agents. The three protease engineering campaigns presented provide in-depth analysis of protease properties and have identified principles that can be applied to improve or generate enzyme variants for industrial applications beyond laundry detergents. Copyright © 2015 Elsevier B.V. All rights reserved.
Molecular cloning and functional analysis of the gene encoding ...
African Journals Online (AJOL)
Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...