WorldWideScience

Sample records for prostacyclin synthase expression

  1. Prostacyclin Synthase: Upregulation during Renal Development and in Glomerular Disease as well as Its Constitutive Expression in Cultured Human Mesangial Cells

    Directory of Open Access Journals (Sweden)

    Thomas Klein

    2015-01-01

    Full Text Available Prostacyclin (PGI2 plays a critical role in nephrogenesis and renal physiology. However, our understanding of how prostacyclin release in the kidney is regulated remains poorly defined. We studied expression of prostacyclin synthase (PGIS in developing and adult human kidneys, and also in selected pediatric renal diseases. We also examined PGI2 formation in human mesangial cells in vitro. We observed abundant expression of PGIS in the nephrogenic cortex in humans and in situ hybridization revealed an identical pattern in mice. In the normal adult kidney, PGIS-immunoreactive protein and mRNA appear to localize to mesangial fields and endothelial and smooth muscle cells of arteries and peritubular capillaries. In kidney biopsies taken from pediatric patients, enhanced expression of PGIS-immunoreactive protein was noted mainly in endothelial cells of patients with IgA-nephropathy. Cultured human mesangial cells produce primarily PGI2 and prostaglandin E2, followed by prostaglandin F2α Cytokine stimulation increased PGI2 formation 24-fold. Under these conditions expression of PGIS mRNA and protein remained unaltered whereas mRNA for cyclooxygenase-2 was markedly induced. In contrast to its constitutive expression in vitro, renal expression of prostacyclin-synthase appears to be regulated both during development and in glomerular disease. Further research is needed to identify the factors involved in regulation of PGIS-expression.

  2. Prostacyclin synthase expression and epigenetic regulation in nonsmall cell lung cancer.

    LENUS (Irish Health Repository)

    Cathcart, Mary-Clare

    2012-02-01

    BACKGROUND: Prostacyclin synthase (PGIS) metabolizes prostaglandin H(2), into prostacyclin. This study aimed to determine the expression profile of PGIS in nonsmall cell lung cancer (NSCLC) and examine potential mechanisms involved in PGIS regulation. METHODS: PGIS expression was examined in human NSCLC and matched controls by reverse transcriptase polymerase chain reaction (RT-PCR), Western analysis, and immunohistochemistry. A 204-patient NSCLC tissue microarray was stained for PGIS and cyclooxygenase 2 (COX2) expression. Staining intensity was correlated with clinical parameters. Epigenetic mechanisms underpinning PGIS promoter expression were examined using RT-PCR, methylation-specific PCR, and chromatin immunoprecipitation analysis. RESULTS: PGIS expression was reduced\\/absent in human NSCLC protein samples (P < .0001), but not mRNA relative to matched controls. PGIS tissue expression was higher in squamous cell carcinoma (P = .004) and in male patients (P < .05). No significant correlation of PGIS or COX2 expression with overall patient survival was observed, although COX2 was prognostic for short-term (2-year) survival (P < .001). PGIS mRNA expression was regulated by DNA CpG methylation and histone acetylation in NSCLC cell lines, with chromatin remodeling taking place directly at the PGIS gene. PGIS mRNA expression was increased by both demethylation agents and histone deacetylase inhibitors. Protein levels were unaffected by demethylation agents, whereas PGIS protein stability was negatively affected by histone deacetylase inhibitors. CONCLUSIONS: PGIS protein expression is reduced in NSCLC, and does not correlate with overall patient survival. PGIS expression is regulated through epigenetic mechanisms. Differences in expression patterns between mRNA and protein levels suggest that PGIS expression and protein stability are regulated post-translationally. PGIS protein stability may have an important therapeutic role in NSCLC.

  3. Expression of Prostacyclin-Synthase in Human Breast Cancer: Negative Prognostic Factor and Protection against Cell Death In Vitro

    Directory of Open Access Journals (Sweden)

    Thomas Klein

    2015-01-01

    Full Text Available Endogenously formed prostacyclin (PGI2 and synthetic PGI2 analogues have recently been shown to regulate cell survival in various cell lines. To elucidate the significance of PGI2 in human breast cancer, we performed immunohistochemistry to analyze expression of prostacyclin-synthase (PGIS in 248 human breast cancer specimens obtained from surgical pathology files. We examined patients’ 10-year survival retrospectively by sending a questionnaire to their general practitioners and performed univariate analysis to determine whether PGIS expression correlated with patient survival. Lastly, the effects of PGI2 and its analogues on cell death were examined in a human breast cancer cell line (MCF-7 and a human T-cell leukemia cell line (CCRF-CEM. PGIS expression was observed in tumor cells in 48.7% of samples and was associated with a statistically significant reduction in 10-year survival (P=0.038; n=193. Transient transfection of PGIS into MCF-7 cells exposed to sulindac increased cell viability by 50% and exposure to carbaprostacyclin protected against sulindac sulfone induced apoptosis in CCRF-CEM cells. Expression of PGIS is correlated with a reduced patient survival and protects against cell death in vitro, suggesting that PGIS is a potential therapeutic target in breast cancer.

  4. Retinal expression, regulation, and functional bioactivity of prostacyclin-stimulating factor

    OpenAIRE

    Hata, Yasuaki; Clermont, Allen Charles; Yamauchi, Teruaki; Pierce, Eric Adam; Suzuma, Izumi; Kagokawa, Hiroyuki; Yoshikawa, Hiroshi; Robinson, Gregory S.; Ishibashi, Tatsuro; Hashimoto, Toshihiko; Umeda, Fumio; Bursell, Sven E.; Aiello, Lloyd Paul

    2000-01-01

    Prostacyclin-stimulating factor (PSF) acts on vascular endothelial cells to stimulate the synthesis of the vasodilatory molecule prostacyclin (PGI2). We have examined the expression, regulation, and hemodynamic bioactivity of PSF both in whole retina and in cultured cells derived from this tissue. PSF was expressed in all retinal cell types examined in vitro, but immunohistochemical analysis revealed PSF mainly associated with retinal vessels. PSF expression was constitutive in retinal pericy...

  5. Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

    International Nuclear Information System (INIS)

    Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.

    1991-01-01

    Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate

  6. Elevated prostacyclin biosynthesis in mice impacts memory and anxiety-like behavior.

    Science.gov (United States)

    Vollert, Craig; Ohia, Odochi; Akasaka, Hironari; Berridge, Casey; Ruan, Ke-He; Eriksen, Jason L

    2014-01-01

    Prostacyclin is an endogenous lipid metabolite with properties of vasodilation and anti-platelet aggregation. While the effects of prostacyclin on the vascular protection have been well-documented, the role of this eicosanoid in the central nervous system has not been extensively studied. Recently, a transgenic mouse containing a hybrid enzyme, of cyclooxygenase-1 linked to prostacyclin synthase, was developed that produces elevated levels of prostacyclin in vivo. The goal of this study was to investigate whether increased prostacyclin biosynthesis could affect behavioral phenotypes in mice. Our results uncovered that elevated levels of prostacyclin broadly affect both cognitive and non-cognitive behaviors, including decreased anxiety-like behavior and improved learning in the fear-conditioning memory test. This study demonstrates that prostacyclin plays an important, but previously unrecognized, role in central nervous system function and behavior. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia.

    Science.gov (United States)

    Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W

    2012-06-01

    Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

  8. Milrinone enhances relaxation to prostacyclin and iloprost in pulmonary arteries isolated from lambs with persistent pulmonary hypertension of the newborn

    Science.gov (United States)

    Lakshminrusimha, Satyan; Porta, Nicolas F. M.; Farrow, Kathryn N.; Chen, Bernadette; Gugino, Sylvia F.; Kumar, Vasanth H.; Russell, James A.; Steinhorn, Robin H.

    2009-01-01

    Prostacyclin is a pulmonary vasodilator and is produced by prostacyclin synthase and stimulates adenylate cyclase (AC) via the prostacyclin receptor (IP) to produce cAMP. Forskolin is a direct stimulant of AC. Phosphodiesterase 3 hydrolyzes cAMP and is inhibited by milrinone. Objective To characterize the prostacyclin-AC-cAMP pathway in the ovine ductal ligation model of persistent pulmonary hypertension of the newborn (PPHN). Setting University-based laboratory animal facility. Subjects Lambs delivered to time-dated pregnant ewes. Interventions Fifth generation pulmonary arteries (PA) and lung parenchyma were isolated from control fetal lambs (n = 8) and fetal lambs with PPHN induced by antenatal ductal ligation (n = 9). We studied relaxation responses to various agonists (milrinone, forskolin, prostacyclin, and iloprost, a prostacyclin analog) that increase cAMP in PA after half-maximal constriction with norepinephrine and pretreatment with propranolol ± indo-methacin. Lung protein levels of prostacyclin synthase, IP, AC2, and phosphodiesterase 3A were analyzed by Western blot and cAMP by enzyme-linked immunoassay. Main Results Milrinone relaxed control and PPHN PA and pretreatment with indomethacin significantly impaired this response. Relaxation to milrinone, prostacyclin, and iloprost were significantly impaired in PA from PPHN lambs. Pretreatment with milrinone markedly enhanced relaxation to prostacyclin and iloprost in PPHN PA, similar to relaxation in control PA. Relaxation to forskolin was similar in control and PPHN PAs indicating normal AC activity. Protein levels of prostacyclin synthase and IP were decreased in PPHN lungs compared with control, but AC2, cAMP, and phosphodiesterase 3A remained unchanged. Conclusions Prostacyclin and iloprost are dilators of PAs from PPHN lambs and their effect is enhanced by milrinone. This combination therapy may be an effective strategy in the management of patients with PPHN. PMID:19057444

  9. LC-MS/MS confirms that COX-1 drives vascular prostacyclin whilst gene expression pattern reveals non-vascular sites of COX-2 expression.

    Directory of Open Access Journals (Sweden)

    Nicholas S Kirkby

    Full Text Available There are two schools of thought regarding the cyclooxygenase (COX isoform active in the vasculature. Using urinary prostacyclin markers some groups have proposed that vascular COX-2 drives prostacyclin release. In contrast, we and others have found that COX-1, not COX-2, is responsible for vascular prostacyclin production. Our experiments have relied on immunoassays to detect the prostacyclin breakdown product, 6-keto-PGF1α and antibodies to detect COX-2 protein. Whilst these are standard approaches, used by many laboratories, antibody-based techniques are inherently indirect and have been criticized as limiting the conclusions that can be drawn. To address this question, we measured production of prostanoids, including 6-keto-PGF1α, by isolated vessels and in the circulation in vivo using liquid chromatography tandem mass spectrometry and found values essentially identical to those obtained by immunoassay. In addition, we determined expression from the Cox2 gene using a knockin reporter mouse in which luciferase activity reflects Cox2 gene expression. Using this we confirm the aorta to be essentially devoid of Cox2 driven expression. In contrast, thymus, renal medulla, and regions of the brain and gut expressed substantial levels of luciferase activity, which correlated well with COX-2-dependent prostanoid production. These data are consistent with the conclusion that COX-1 drives vascular prostacyclin release and puts the sparse expression of Cox2 in the vasculature in the context of the rest of the body. In doing so, we have identified the thymus, gut, brain and other tissues as target organs for consideration in developing a new understanding of how COX-2 protects the cardiovascular system.

  10. Paracrine effects of bone marrow-derived endothelial progenitor cells: cyclooxygenase-2/prostacyclin pathway in pulmonary arterial hypertension.

    Directory of Open Access Journals (Sweden)

    Dong-Mei Jiang

    Full Text Available BACKGROUND: Endothelial dysfunction is the pathophysiological characteristic of pulmonary arterial hypertension (PAH. Some paracrine factors secreted by bone marrow-derived endothelial progenitor cells (BMEPCs have the potential to strengthen endothelial integrity and function. This study investigated whether BMEPCs have the therapeutic potential to improve monocrotaline (MCT-induced PAH via producing vasoprotective substances in a paracrine fashion. METHODS AND RESULTS: Bone marrow-derived mononuclear cells were cultured for 7 days to yield BMEPCs. 24 hours or 3 weeks after exposure to BMEPCs in vitro or in vivo, the vascular reactivity, cyclooxygenase-2 (COX-2 expression, prostacyclin (PGI2 and cAMP release in isolated pulmonary arteries were examined respectively. Treatment with BMEPCs could improve the relaxation of pulmonary arteries in MCT-induced PAH and BMEPCs were grafted into the pulmonary bed. The COX-2/prostacyclin synthase (PGIS and its progenies PGI2/cAMP were found to be significantly increased in BMEPCs treated pulmonary arteries, and this action was reversed by a selective COX-2 inhibitor, NS398. Moreover, the same effect was also observed in conditioned medium obtained from BMEPCs culture. CONCLUSIONS: Implantation of BMEPCs effectively ameliorates MCT-induced PAH. Factors secreted in a paracrine fashion from BMEPCs promote vasoprotection by increasing the release of PGI2 and level of cAMP.

  11. Spectroscopic characterization of the oxyferrous complex of prostacyclin synthase in solution and in trapped sol–gel matrix

    Science.gov (United States)

    Yeh, Hui-Chun; Hsu, Pei-Yung; Tsai, Ah-Lim; Wang, Lee-Ho

    2010-01-01

    Prostacyclin synthase (PGIS) is a member of the cytochrome P450 family in which the oxyferrous complexes are generally labile in the absence of substrate. At 4 °C, the on-rate constants and off-rate constants of oxygen binding to PGIS in solution are 5.9 × 105 m−1 ·s−1 and 29 s−1, respectively. The oxyferrous complex decays to a ferric form at a rate of 12 s−1. We report, for the first time, a stable oxyferrous complex of PGIS in a transparent sol–gel monolith. The encapsulated ferric PGIS retained the same spectroscopic features as in solution. The binding capabilities of the encapsulated PGIS were demonstrated by spectral changes upon the addition of O-based, N-based and C-based ligands. The peroxidase activity of PGIS in sol–gel was three orders of magnitude slower than that in solution owing to the restricted diffusion of the substrate in sol–gel. The oxyferrous complex in sol–gel was observable for 24 h at room temperature and displayed a much red-shifted Soret peak. Stabilization of the ferrous–carbon monoxide complex in sol–gel was observed as an enrichment of the 450-nm species over the 420-nm species. This result suggests that the sol–gel method may be applied to other P450s to generate a stable intermediate in the di-oxygen activation. PMID:18397321

  12. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  13. Effects of prostacyclin on cerebral blood flow and vasospasm after subarachnoid hemorrhage

    DEFF Research Database (Denmark)

    Rasmussen, Rune; Wetterslev, Jørn; Stavngaard, Trine

    2015-01-01

    and blood flow regulation, on factors related to DIND. METHODS: This trial is a single-center, randomized, blinded, clinical, pilot trial with 3 arms. Ninety patients were randomized to continuous infusion of prostacyclin 1 ng/kg per minute, prostacyclin 2 ng/kg per minute, or placebo. The intervention...... parameters or clinical outcome were found between the 3 groups. CONCLUSIONS: Administration of prostacyclin to patients with subarachnoid hemorrhage may be safe and feasible. Global cerebral blood flow after subarachnoid hemorrhage is not markedly affected by administration of prostacyclin in the tested dose...

  14. Effect of preoperative antiplatelet drugs on vascular prostacyclin synthesis.

    Science.gov (United States)

    Karwande, S V; Weksler, B B; Gay, W A; Subramanian, V A

    1987-03-01

    Patients undergoing aortocoronary bypass using autogenous saphenous veins were randomly divided into three comparable groups. Group 1 (n = 10) acted as a control, Group 2 (n = 14) received 80 mg of aspirin at midnight before the operation, and Group 3 (n = 12) received 80 mg of aspirin and 75 mg of dipyridamole at midnight and an additional 75-mg dose of dipyridamole at 6 AM. The purpose was to determine which regimen would maximally inhibit platelet function without depressing vascular prostacyclin synthesis. Serum thromboxane A2, saphenous vein wall and aortic wall prostacyclin, platelet aggregation, and bleeding time were measured in all patients. None was restarted on a regimen of aspirin or dipyridamole postoperatively. Aspirin alone and in combination with dipyridamole significantly inhibited thromboxane A2 and platelet aggregation in all treated patients but spared venous prostacyclin synthesis. Aortic prostacyclin synthesis was partially inhibited in both treated groups. Chest tube drainage was comparable in all three groups. These results indicate that the combination of aspirin and dipyridamole offers no measurable advantage over aspirin alone in the perioperative period.

  15. Prostacyclin infusion may prevent secondary damage in pericontusional brain tissue

    DEFF Research Database (Denmark)

    Reinstrup, Peter; Nordström, Carl-Henrik

    2011-01-01

    Prostacyclin is a potent vasodilator, inhibitor of leukocyte adhesion, and platelet aggregation, and has been suggested as therapy for cerebral ischemia. A case of focal traumatic brain lesion that was monitored using intracerebral microdialysis, and bedside analysis and display is reported here........ When biochemical signs of cerebral ischemia progressed, i.v. infusion of prostacyclin was started....

  16. Reduced saphenous vein prostacyclin production in the absence of endothelial detachment

    International Nuclear Information System (INIS)

    De Caterina, R.; Cruz-Bracho, M.R.; Alonso, D.R.; Subramanian, V.A.; Weksler, B.B.

    1988-01-01

    High-potassium cardioplegic solutions have been suspected of inducing vascular damage at coronary bypass surgery. In this study the authors compared prostacyclin production and endothelial morphology in saphenous vein segments perfused either with cardioplegic solutions with a potassium concentration of 20, 40 and 80 mEq/1, or with a control buffer (1) at 4 grade centigrades for 30 min; (2) at 37 grade centigrades for 15 min; (3) at 37 grade centigrades for 15 min after the addition of arachidonic acid. Prostacyclin production (6-keto-PGF 1α , pg/ml cm 2 endothelial surface area) in control treated segments was a function of temperature and of substrute availability, being (mean±SEM) 62.4±8.2 in setting (1); 309±34.7 in setting (2); and 1515.4±205.2 in setting (3). Cardioplegic solution containing 20 mEq/1 potassium did not alter prostacyclin production in any of these settings, whereas exposure of tissue to the 40 mEq/1 potassium solution decreased prostacyclin production in setting (21) and (2), and the solution containing 80 mEq/1 potassium decreased prostacyclin production in all three experimental conditions. Absence of endothelial detachment in all experimental settings was documented by immunoperoxidase staining of vascular cross-sections for the specific endothelial marker Factor VIII - related antigen and staining of ''en face'' preparations of endothelial surface with silver nitrate and silver nitrate-hematoxylin. These data indicate that cardioplegic solutions with a potassium concentration equal or greater than 40 mEq/1 can induce morphologically silent endothelial damage manifested by decreased prostacyclin production. The use of these solutions may predispose to possible thrombogenicity after coronary bypass surgery

  17. Molecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohlii Briq

    Directory of Open Access Journals (Sweden)

    Kawamukai Makoto

    2004-11-01

    Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.

  18. 111-Indium-labelled platelets for diagnosis of acute kidney transplant rejection and monitoring of prostacyclin anti-rejection treatment

    International Nuclear Information System (INIS)

    Leithner, C.; Pohanka, E.; Schwarz, M.; Sinzinger, H.; Syre, G.

    1984-01-01

    33 patients were examined daily under a gamma camera after weekly injections of 111-In-labelled autologous platelets over a period of at least 4 weeks after transplantation. A group of 33 patients with long-term stable and well-functioning grafts served as controls. By means of a computerized recording technique, platelet trapping in the graft was measured and expressed as platelet-uptake index (PUI). The method worked well for the early diagnosis of acute rejection signified by an increase in PUI, accompanied by a shortening of platelet half life (t/2). 6 patients suffering from acute rejection received infusions of prostacyclin in addition to conventional high-dose methylprednisolone therapy. In 4 cases the PUI decreased again and an improvement in graft function was observed. Prostacyclin infusion treatment was applied also in 12 patients with histologically-proven chronic transplant rejection. Decreased platelet consumption by the graft and a temporary improvement in transplant function were achieved. We suggest that prostacyclin could enrich the possibilities of anti-rejection treatment by providing a tool for the suppression of platelet trapping in the graft. The platelet scan served as a useful method for the early detection of acute rejection, as well as the monitoring of prostacyclin anti-rejection treatment. (Autor)

  19. Cloning and expression of pineapple sucrose- phosphate synthase ...

    African Journals Online (AJOL)

    hope&shola

    2010-12-06

    Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.

  20. Characterization of biosynthesis and modes of action of prostaglandin E2 and prostacyclin in guinea pig mesenteric lymphatic vessels.

    Science.gov (United States)

    Rehal, Sonia; Blanckaert, Pauline; Roizes, Simon; von der Weid, Pierre-Yves

    2009-12-01

    Rhythmical transient constrictions of the lymphatic vessels provide the means for efficient lymph drainage and interstitial tissue fluid balance. This activity is critical during inflammation, to avoid or limit oedema resulting from increased vascular permeability, mediated by the release of various inflammatory mediators. In this study, we investigated the mechanisms by which prostaglandin E(2) (PGE(2)) and prostacyclin modulate lymphatic contractility in isolated guinea pig mesenteric lymphatic vessels. Quantitative RT-PCR was used to assess the expression of mRNA for enzymes and receptors involved in the production and action of PGE(2) and prostacyclin in mesenteric collecting lymphatic vessels. Frequency and amplitude of lymphatic vessel constriction were measured in the presence of these prostaglandins and the role of their respective EP and IP receptors assessed. Prostaglandin E(2) and prostacyclin decreased concentration-dependently the frequency, without affecting the amplitude, of lymphatic constriction. Data obtained in the presence of the EP(4) receptor antagonists, GW627368x (1 microM) and AH23848B (30 microM) and the IP receptor antagonist CAY10441 (0.1 microM) suggest that PGE(2) predominantly activates EP(4), whereas prostacyclin mainly stimulates IP receptors. Inhibition of responses to either prostaglandin with H89 (10 microM) or glibenclamide (1 microM) suggested a role for the activation of protein kinase A and ATP-sensitive K(+) channels. Our findings characterized the inhibition of lymphatic pumping induced by PGE(2) or prostacyclin in guinea pig mesenteric lymphatics. This action is likely to impair oedema resolution and to contribute to the pro-inflammatory actions of these prostaglandins.

  1. Prostacyclin Inhibits Non-Small Cell Lung Cancer Growth by a Frizzled 9-Dependent Pathway That Is Blocked by Secreted Frizzled-Related Protein 1

    Directory of Open Access Journals (Sweden)

    Meredith A. Tennis

    2010-03-01

    Full Text Available The goal of this study was to assess the ability of iloprost, an orally active prostacyclin analog, to inhibit transformed growth of human non-small cell lung cancer (NSCLC and to define the mechanism of iloprost's tumor suppressive effects. In a panel of NSCLC cell lines, the ability of iloprost to inhibit transformed cell growth was not correlated with the expression of the cell surface receptor for prostacyclin, but instead was correlated with the presence of Frizzled 9 (Fzd 9 and the activation of peroxisome proliferator-activated receptor-γ (PPARγ. Silencing of Fzd 9 blocked PPARγ activation by iloprost, and expression of Fzd 9 in cells lacking the protein resulted in iloprost's activation of PPARγ and inhibition of transformed growth. Interestingly, soluble Frizzled-related protein-1, a well-known inhibitor of Wnt/Fzd signaling, also blocked the effects of iloprost and Fzd 9. Moreover, mice treated with iloprost had reduced lung tumors and increased Fzd 9 expression. These studies define a novel paradigm, linking the eicosanoid pathway and Wnt signaling. In addition, these data also suggest that prostacyclin analogs may represent a new class of therapeutic agents in the treatment of NSCLC where the restoration of noncanonical Wnt signaling maybe important for the inhibition of transformed cell growth.

  2. Expression of prostaglandin synthases (pgds and pges) during zebrafish gonadal differentiation

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John E; Nielsen, Betina Frydenlund

    2010-01-01

    The present study aimed at elucidating whether the expression pattern of the membrane bound form of prostaglandin E2 synthase (pges) and especially the lipocalin-type prostaglandin D2 synthase (pgds) indicates involvement in gonadal sex differentiation in zebrafish as has previously been found....... In this study, a sexually dimorphic expression of pgds was found in gonads of adult zebrafish with expression in testis but not in ovaries. To determine whether the sex-specific expression pattern of pgds was present in gonads of juvenile zebrafish and therefore could be an early marker of sex in zebrafish, we...... microdissected gonads from four randomly selected individual zebrafish for every second day in the period 2-20 days post hatch (dph) and 0-1 dph. The temporal expression of pgds and pges was investigated in the microdissected gonads, however, no differential expression that could indicate sex-specific difference...

  3. Prostacyclin Suppresses Twist Expression in the Presence of Indomethacin in Bone Marrow-Derived Mesenchymal Stromal Cells

    OpenAIRE

    Kemper, Oliver; Herten, Monika; Fischer, Johannes; Haversath, Marcel; Beck, Sascha; Classen, Tim; Warwas, Sebastian; Tassemeier, Tjark; Landgraeber, Stefan; Lensing-Höhn, Sabine; Krauspe, Rüdiger; Jäger, Marcus

    2014-01-01

    Background Iloprost, a stable prostacyclin I2 analogue, seems to have an osteoblast-protective potential, whereas indomethacin suppresses new bone formation. The aim of this study was to investigate human bone marrow stromal cell (BMSC) proliferation and differentiation towards the osteoblastic lineage by administration of indomethacin and/or iloprost. Material/Methods Human bone marrow cells were obtained from 3 different donors (A=26 yrs/m; B=25 yrs/f, C=35 yrs/m) via vacuum aspiration of t...

  4. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

    Science.gov (United States)

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

    2012-03-01

    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.

  5. Aerosolized prostacyclin for acute lung injury (ALI) and acute respiratory distress syndrome (ARDS)

    DEFF Research Database (Denmark)

    Afshari, Arash; Brok, Jesper; Møller, Ann

    2010-01-01

    Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) are critical conditions that are associated with high mortality and morbidity. Aerosolized prostacyclin has been used to improve oxygenation despite the limited evidence available so far.......Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) are critical conditions that are associated with high mortality and morbidity. Aerosolized prostacyclin has been used to improve oxygenation despite the limited evidence available so far....

  6. 2-Methyl-3-buten-2-ol (MBO) synthase expression in Nostoc punctiforme leads to over production of phytols.

    Science.gov (United States)

    Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak

    2015-01-01

    Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.

  7. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf

    2009-01-01

    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  8. Expression of prostaglandin synthases (pgds and pges) duringzebrafishgonadal differentiation

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John E.; Nielsen, Betina F.

    2010-01-01

    The present study aimed at elucidating whether the expression pattern of the membrane bound form of prostaglandin E-2 synthase (pges) and especially the lipocalin-type prostaglandin D-2 synthase (pgds) indicates involvement in gonadal sex differentiation in zebrafish as has previously been found...... In this study, a sexually dimorphic expression of pgds was found in gonads of adult zebrafish with expression in testis but not in ovaries. To determine whether the sex-specific expression pattern of pgds was present in gonads of juvenile zebrafish and therefore could be an early marker of sex in zebrafish, we...... microdissected gonads from four randomly selected individual zebrafish for every second day in the period 2-20 days post hatch (dph) and 0-1 dph The temporal expression of pgds and pges was investigated in the microdissected gonads, however, no differential expression that could indicate sex-specific difference...

  9. Cost effectiveness of prostacyclins in pulmonary arterial hypertension.

    Science.gov (United States)

    Roman, Antonio; Barberà, Joan A; Escribano, Pilar; Sala, Maria L; Febrer, Laia; Oyagüez, Itziar; Sabater, Eliazar; Casado, Miguel A

    2012-05-01

    Pulmonary arterial hypertension (PAH) is considered an orphan disease. Prostacyclins are the keystone for PAH treatment. Choosing between the three available prostacyclin therapies could be complicated because there are no comparison studies, so the final decision must be driven by factors such as efficacy, administration route, safety profile and economic aspects. This study provides a cost-effectiveness and cost-utility comparison of initiating prostacyclin therapy with three different treatment alternatives (inhaled iloprost [ILO], intravenous epoprostenol [EPO] and subcutaneous treprostinil [TRE]) for patients with PAH. The goal of this work is to help physicians with their therapeutic decision-making. A Markov model was built to simulate a patient cohort with class III PAH according to the classification of the New York Heart Association (NYHA). Four health states corresponding with the NYHA classes plus death were allowed for patients in the model. Changing the treatment was possible when patients worsened from functional class III to IV. The time horizon was 3 years, allowing patients to transition between health states on a 12-week cycle basis. The study perspective was that of the National Health System (NHS) [only direct medical costs were included]. Unitary costs were obtained from the Drug Catalogue and e-Salud Database in 2009 and are given in euros (€). Data on health resources and treatment pathways were informed by a four-member expert panel. Efficacy was obtained from pivotal clinical trials of ILO, EPO and TRE, the latter used in Spain as a foreign medication. Utilities for each health state were obtained from the literature. The final efficacy measure was life-years gained (LYG), and utilities were used to obtain quality-adjusted life-years (QALYs). Costs and effects were discounted at a 3% rate. To check for the robustness of the results, sensitivity analyses were performed. At the end of the 3 years, in the base case of the deterministic

  10. Use of heterologous expressed polyketide synthase and small molecule foldases to make aromatic and cyclic compounds

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell.......A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell....

  11. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    DEFF Research Database (Denmark)

    Edman, U; Edman, J C; Lundgren, B

    1989-01-01

    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

  12. Monoterpene synthases from common sage (Salvia officinalis)

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)

    1999-01-01

    cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

  13. Roxicam pharmacological modulation of the prostacyclin-thromboxane system in heart failure-complicated acute myocardial infarction

    International Nuclear Information System (INIS)

    Shushlyapin, O.I.; Shelest, A.N.; Khossejn Shakhavat, A.F.M.

    1991-01-01

    The prostaglandin-thromboxane system, platelet hemostasis and central hemodynamics were evaluated in 51 patients with heart failure-complicated acute myocardial infarction. The concentration of active metabolites of thromboxane-prostacyclin system was determined by means of radioimmunoassay. The new non-steroidal antiinflammatory agent roxicam was shown to selectively inhibit thromboxane, without affecting prostacyclin levels. The agent may be use in therapy in patients with myocardial infarction concurrent with heart failure

  14. Nitric oxide synthase expression and enzymatic activity in multiple sclerosis

    DEFF Research Database (Denmark)

    Broholm, H; Andersen, B; Wanscher, B

    2004-01-01

    We used post-mortem magnetic resonance imaging (MRI) guidance to obtain paired biopsies from the brains of four patients with clinical definite multiple sclerosis (MS). Samples were analyzed for the immunoreactivity (IR) of the three nitric oxide (NO) synthase isoforms [inducible, neuronal......NOS expressing cells in active lesions. NOS IR expressing cells were widely distributed in plaques, in white and gray matter that appeared normal macroscopically, and on MR. Endothelial NOS (eNOS) was highly expressed in intraparenchymal vascular endothelial cells of MS patients. A control group matched for age...

  15. Impact of drought stress on specialised metabolism: Biosynthesis and the expression of monoterpene synthases in sage (Salvia officinalis).

    Science.gov (United States)

    Radwan, Alzahraa; Kleinwächter, Maik; Selmar, Dirk

    2017-09-01

    In previous experiments, we demonstrated that the amount of monoterpenes in sage is increased massively by drought stress. Our current study is aimed to elucidate whether this increase is due, at least in part, to elevated activity of the monoterpene synthases responsible for the biosynthesis of essential oils in sage. Accordingly, the transcription rates of the monoterpene synthases were analyzed. Salvia officinalis plants were cultivated under moderate drought stress. The concentrations of monoterpenes as well as the expression of the monoterpene synthases were analyzed. The amount of monoterpenes massively increased in response to drought stress; it doubled after just two days of drought stress. The observed changes in monoterpene content mostly match with the patterns of monoterpene synthase expressions. The expression of bornyl diphosphate synthase was strongly up-regulated; its maximum level was reached after two days. Sabinene synthase increased gradually and reached a maximum after two weeks. In contrast, the transcript level of cineole synthase continuously declined. This study revealed that the stress related increase of biosynthesis is not only due to a "passive" shift caused by the stress related over-reduced status, but also is due - at least in part-to an "active" up-regulation of the enzymes involved. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Lack of Thromboxane Synthase Prevents Hypertension and Fetal Growth Restriction after High Salt Treatment during Pregnancy.

    Directory of Open Access Journals (Sweden)

    Chen-Hsueh Pai

    Full Text Available Preeclampsia (PE is a potentially fatal pregnancy-related hypertensive disorder characterized by poor placenta development that can cause fetal growth restriction. PE-associated pathologies, including thrombosis, hypertension, and impaired placental development, may result from imbalances between thromboxane A2 (TXA2 and prostacyclin. Low-dose aspirin, which selectively inhibits TXA2 production, is used to prevent high-risk PE. However, the role of TXA2 in aspirin-mediated protective effects in women with PE is not understood fully. In this study, we examined the role of prostanoids in PE using human samples and an induced PE mouse model. We demonstrated that the administration of salted drinking water (2.7% NaCl to wild-type mice resulted in elevated placental TXA2 synthase (TXAS and plasma TXA2, but not prostacyclin, levels, which was also found in our clinical PE placenta samples. The high salt-treated wild-type pregnant mice had shown unchanged maternal body weight, hypertension (MAP increase 15 mmHg, and decreased pup weight (~50% and size (~24%, but these adverse effects were ameliorated in TXAS knockout (KO mice. Moreover, increased expression of interleukin-1β and downstream phosphorylated-p38-mitogen-activated protein kinase were concordant with apoptosis induction in the placentas of salt water-treated wild-type mice. These alterations were not observed in TXAS KO mice. Together, our data suggest that TXA2 depletion has anti-PE effects due to the prevention of hypertension and placental damage through downregulation of the interleukin-1β pathway.

  17. Molecular Mechanisms Regulating the Vascular Prostacyclin Pathways and Their Adaptation during Pregnancy and in the Newborn

    Science.gov (United States)

    Majed, Batoule H.

    2012-01-01

    Prostacyclin (PGI2) is a member of the prostanoid group of eicosanoids that regulate homeostasis, hemostasis, smooth muscle function and inflammation. Prostanoids are derived from arachidonic acid by the sequential actions of phospholipase A2, cyclooxygenase (COX), and specific prostaglandin (PG) synthases. There are two major COX enzymes, COX1 and COX2, that differ in structure, tissue distribution, subcellular localization, and function. COX1 is largely constitutively expressed, whereas COX2 is induced at sites of inflammation and vascular injury. PGI2 is produced by endothelial cells and influences many cardiovascular processes. PGI2 acts mainly on the prostacyclin (IP) receptor, but because of receptor homology, PGI2 analogs such as iloprost may act on other prostanoid receptors with variable affinities. PGI2/IP interaction stimulates G protein-coupled increase in cAMP and protein kinase A, resulting in decreased [Ca2+]i, and could also cause inhibition of Rho kinase, leading to vascular smooth muscle relaxation. In addition, PGI2 intracrine signaling may target nuclear peroxisome proliferator-activated receptors and regulate gene transcription. PGI2 counteracts the vasoconstrictor and platelet aggregation effects of thromboxane A2 (TXA2), and both prostanoids create an important balance in cardiovascular homeostasis. The PGI2/TXA2 balance is particularly critical in the regulation of maternal and fetal vascular function during pregnancy and in the newborn. A decrease in PGI2/TXA2 ratio in the maternal, fetal, and neonatal circulation may contribute to preeclampsia, intrauterine growth restriction, and persistent pulmonary hypertension of the newborn (PPHN), respectively. On the other hand, increased PGI2 activity may contribute to patent ductus arteriosus (PDA) and intraventricular hemorrhage in premature newborns. These observations have raised interest in the use of COX inhibitors and PGI2 analogs in the management of pregnancy-associated and neonatal

  18. High throughput mutagenesis for identification of residues regulating human prostacyclin (hIP) receptor expression and function.

    Science.gov (United States)

    Bill, Anke; Rosethorne, Elizabeth M; Kent, Toby C; Fawcett, Lindsay; Burchell, Lynn; van Diepen, Michiel T; Marelli, Anthony; Batalov, Sergey; Miraglia, Loren; Orth, Anthony P; Renaud, Nicole A; Charlton, Steven J; Gosling, Martin; Gaither, L Alex; Groot-Kormelink, Paul J

    2014-01-01

    The human prostacyclin receptor (hIP receptor) is a seven-transmembrane G protein-coupled receptor (GPCR) that plays a critical role in vascular smooth muscle relaxation and platelet aggregation. hIP receptor dysfunction has been implicated in numerous cardiovascular abnormalities, including myocardial infarction, hypertension, thrombosis and atherosclerosis. Genomic sequencing has discovered several genetic variations in the PTGIR gene coding for hIP receptor, however, its structure-function relationship has not been sufficiently explored. Here we set out to investigate the applicability of high throughput random mutagenesis to study the structure-function relationship of hIP receptor. While chemical mutagenesis was not suitable to generate a mutagenesis library with sufficient coverage, our data demonstrate error-prone PCR (epPCR) mediated mutagenesis as a valuable method for the unbiased screening of residues regulating hIP receptor function and expression. Here we describe the generation and functional characterization of an epPCR derived mutagenesis library compromising >4000 mutants of the hIP receptor. We introduce next generation sequencing as a useful tool to validate the quality of mutagenesis libraries by providing information about the coverage, mutation rate and mutational bias. We identified 18 mutants of the hIP receptor that were expressed at the cell surface, but demonstrated impaired receptor function. A total of 38 non-synonymous mutations were identified within the coding region of the hIP receptor, mapping to 36 distinct residues, including several mutations previously reported to affect the signaling of the hIP receptor. Thus, our data demonstrates epPCR mediated random mutagenesis as a valuable and practical method to study the structure-function relationship of GPCRs.

  19. High throughput mutagenesis for identification of residues regulating human prostacyclin (hIP receptor expression and function.

    Directory of Open Access Journals (Sweden)

    Anke Bill

    Full Text Available The human prostacyclin receptor (hIP receptor is a seven-transmembrane G protein-coupled receptor (GPCR that plays a critical role in vascular smooth muscle relaxation and platelet aggregation. hIP receptor dysfunction has been implicated in numerous cardiovascular abnormalities, including myocardial infarction, hypertension, thrombosis and atherosclerosis. Genomic sequencing has discovered several genetic variations in the PTGIR gene coding for hIP receptor, however, its structure-function relationship has not been sufficiently explored. Here we set out to investigate the applicability of high throughput random mutagenesis to study the structure-function relationship of hIP receptor. While chemical mutagenesis was not suitable to generate a mutagenesis library with sufficient coverage, our data demonstrate error-prone PCR (epPCR mediated mutagenesis as a valuable method for the unbiased screening of residues regulating hIP receptor function and expression. Here we describe the generation and functional characterization of an epPCR derived mutagenesis library compromising >4000 mutants of the hIP receptor. We introduce next generation sequencing as a useful tool to validate the quality of mutagenesis libraries by providing information about the coverage, mutation rate and mutational bias. We identified 18 mutants of the hIP receptor that were expressed at the cell surface, but demonstrated impaired receptor function. A total of 38 non-synonymous mutations were identified within the coding region of the hIP receptor, mapping to 36 distinct residues, including several mutations previously reported to affect the signaling of the hIP receptor. Thus, our data demonstrates epPCR mediated random mutagenesis as a valuable and practical method to study the structure-function relationship of GPCRs.

  20. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Bechard Matthew E.

    2003-01-01

    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  1. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

    Science.gov (United States)

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  2. Identification of a novel CoA synthase isoform, which is primarily expressed in Brain

    International Nuclear Information System (INIS)

    Nemazanyy, Ivan; Panasyuk, Ganna; Breus, Oksana; Zhyvoloup, Alexander; Filonenko, Valeriy; Gout, Ivan T.

    2006-01-01

    CoA and its derivatives Acetyl-CoA and Acyl-CoA are important players in cellular metabolism and signal transduction. CoA synthase is a bifunctional enzyme which mediates the final stages of CoA biosynthesis. In previous studies, we have reported molecular cloning, biochemical characterization, and subcellular localization of CoA synthase (CoASy). Here, we describe the existence of a novel CoA synthase isoform, which is the product of alternative splicing and possesses a 29aa extension at the N-terminus. We termed it CoASy β and originally identified CoA synthase, CoASy α. The transcript specific for CoASy β was identified by electronic screening and by RT-PCR analysis of various rat tissues. The existence of this novel isoform was further confirmed by immunoblot analysis with antibodies directed to the N-terminal peptide of CoASy β. In contrast to CoASy α, which shows ubiquitous expression, CoASy β is primarily expressed in Brain. Using confocal microscopy, we demonstrated that both isoforms are localized on mitochondria. The N-terminal extension does not affect the activity of CoA synthase, but possesses a proline-rich sequence which can bring the enzyme into complexes with signalling proteins containing SH3 or WW domains. The role of this novel isoform in CoA biosynthesis, especially in Brain, requires further elucidation

  3. Ethamsylate reduces immunoreactive prostacyclin metabolite in low birthweight infants with respiratory distress syndrome.

    Science.gov (United States)

    Rennie, J M; Doyle, J; Cooke, R W

    1986-12-01

    Measurement of 6 ketoprostaglandin F1 alpha was made by radioimmunoassay during the first 3 days of life in 33 infants with respiratory distress syndrome who were subjects in a double blind controlled trial of ethamsylate for the prevention of intraventricular haemorrhage. Levels of 6-ketoprostaglandin F1 alpha were significantly lower on the first and second days of life in babies receiving ethamsylate. There was a reduction in the incidence of intraventricular haemorrhage in the treated group. High levels of prostacyclin metabolite are found in babies who develop haemorrhage, and reduction of prostacyclin synthetase activity may be the mode of action of this drug in vivo.

  4. Oxide Synthase Expression by p38 MAP Kinase

    Directory of Open Access Journals (Sweden)

    Tuija Turpeinen

    2011-01-01

    Full Text Available The role of dual specificity phosphatase 1 (DUSP1 in inducible nitric oxide synthase (iNOS expression in A549 human pulmonary epithelial cells, J774 mouse macrophages and primary mouse bone marrow-derived macrophages (BMMs was investigated. iNOS expression was induced by a cytokine mixture (TNF, IFNγ and IL-1β in A549 cells and by LPS in J774 cells, and it was inhibited by p38 MAPK inhibitors SB202190 and BIRB 796. Stimulation with cytokine mixture or LPS enhanced also DUSP1 expression. Down-regulation of DUSP1 by siRNA increased p38 MAPK phosphorylation and iNOS expression in A549 and J774 cells. In addition, LPS-induced iNOS expression was enhanced in BMMs from DUSP1(−/− mice as compared to that in BMMs from wild-type mice. The results indicate that DUSP1 suppresses iNOS expression by limiting p38 MAPK activity in human and mouse cells. Compounds that enhance DUSP1 expression or modulate its function may be beneficial in diseases complicated with increased iNOS-mediated NO production.

  5. Exercise training alters the balance between vasoactive compounds in skeletal muscle of individuals with essential hypertension

    DEFF Research Database (Denmark)

    Hansen, Ane Håkansson; Nyberg, Michael Permin; Bangsbo, Jens

    2011-01-01

    The effects of physical training on the formation of vasodilating and vasoconstricting compounds, as well as on related proteins important for vascular function, were examined in skeletal muscle of individuals with essential hypertension (n=10). Muscle microdialysis samples were obtained from...... subjects with hypertension before and after 16 weeks of physical training. Muscle dialysates were analyzed for thromboxane A(2), prostacyclin, nucleotides, and nitrite/nitrate. Protein levels of thromboxane synthase, prostacyclin synthase, cyclooxygenase 1 and 2, endothelial nitric oxide synthase (e...

  6. Preliminary experience with combined inhaled milrinone and prostacyclin in cardiac surgical patients with pulmonary hypertension.

    Science.gov (United States)

    Laflamme, Maxime; Perrault, Louis P; Carrier, Michel; Elmi-Sarabi, Mahsa; Fortier, Annik; Denault, André Y

    2015-02-01

    To retrospectively evaluate the effects of combined inhaled prostacyclin and milrinone to reduce the severity of pulmonary hypertension when administered prior to cardiopulmonary bypass. Retrospective case control analysis of high-risk patients undergoing cardiac surgery. Single cardiac center. Sixty one adult cardiac surgical patients with pulmonary hypertension, 40 of whom received inhalation therapy. Inhaled milrinone and inhaled prostacyclin were administered before cardiopulmonary bypass (CPB). Administration of both inhaled prostacyclin and milrinone was associated with reductions in central venous pressure, and mean pulmonary artery pressure, increases in cardiac index, heart rate, and the mean arterial-to-mean pulmonary artery pressure ratio (p milrinone before CPB was associated with a reduction in the severity of pulmonary hypertension. In addition, a significant reduction in vasoactive support in the intensive care unit during the first 24 hours after cardiac surgery was observed. The impact of this strategy on postoperative survival needs to be determined. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Microsatellite instability in colorectal cancer and association with thymidylate synthase and dihydropyrimidine dehydrogenase expression

    DEFF Research Database (Denmark)

    Jensen, Søren A; Vainer, Ben; Kruhøffer, Mogens

    2009-01-01

    unclarified. The association of MSI and MMR status with outcome and with thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) expression in colorectal cancer were evaluated. METHODS: MSI in five reference loci, MMR enzymes (hMSH2, hMSH6, hMLH1 and hPMS2), thymidylate synthase (TS....... Absence of repair protein expression was assessed in 52 (17.0%) tumors, which had primarily lost hMLH1 in 39 (12.7%), hMSH2 in 5 (1.6%), and hMSH6 in 8 (2.6%) tumors. In multivariate analysis MSI (instable) compared to MSS (stable) tumors were significantly associated with lower risk of recurrence (hazard...

  8. Cerebral blood flow and metabolism during cardiopulmonary bypass with special reference to effects of hypotension induced by prostacyclin

    International Nuclear Information System (INIS)

    Feddersen, K.; Aren, C.; Nilsson, N.J.; Radegran, K.

    1986-01-01

    Cerebral blood flow and metabolism of oxygen, glucose, and lactate were studied in 43 patients undergoing aortocoronary bypass. Twenty-five patients received prostacyclin infusion, 50 ng per kilogram of body weight per minute, during cardiopulmonary bypass (CPB), and 18 patients served as a control group. Regional cerebral blood flow (CBF) was studied by intraarterially injected xenon 133 and a single scintillation detector. Oxygen tension, carbon dioxide tension, oxygen saturation, glucose, and lactate were measured in arterial and cerebral venous blood. Mean arterial blood pressure decreased during hypothermia and prostacyclin infusion to less than 30 mm Hg. The regional CBF was, on average, 22 (standard deviation [SD] 4) ml/100 gm/min before CPB. It increased in the control group during hypothermia to 34 (SD 12) ml/100 gm/min, but decreased in the prostacyclin group to 15 (SD 5) ml/100 gm/min. It increased during rewarming in the prostacyclin group. After CPB, regional CBF was about 40 ml/100 gm/min in both groups. The cerebral arteriovenous oxygen pressure difference decreased more in the control group than in the prostacyclin group during hypothermia. The cerebral metabolic rate of oxygen decreased in both groups from approximately 2 ml/100 gm/min to about 1 ml/100 gm/min during hypothermia, increased again during rewarming, and after CPB was at the levels measured before bypass in both groups. There was no difference between the groups in regard to glucose and lactate metabolism

  9. Inducible expression of trehalose synthase in Bacillus licheniformis.

    Science.gov (United States)

    Li, Youran; Gu, Zhenghua; Zhang, Liang; Ding, Zhongyang; Shi, Guiyang

    2017-02-01

    Trehalose synthase (TreS) could transform maltose into trehalose via isomerization. It is a crucial enzyme in the process of trehalose enzymatical transformation. In this study, plasmid-based inducible expression systems were constructed to produce Thermomonospora curvata TreS in B. licheniformis. Xylose operons from B. subtilis, B. licheniformis and B. megaterium were introduced to regulate the expression of the gene encoding TreS. It was functionally expressed, and the BlsTs construct yielded the highest enzyme activity (12.1 U/mL). Furthermore, the effect of different cultural conditions on the inducible expression of BlsTs was investigated, and the optimal condition was as follows: 4% maltodextrin, 0.4% soybean powder, 1% xylose added after 10 h of growth and an induction time of 12 h at 37 °C. As a result, the maximal yield reached 24.7 U/mL. This study contributes to the industrial application of B. licheniformis, a GRAS workhorse for enzyme production. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C

    1995-01-01

    We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....

  11. The evolution of prostacyclins in pulmonary arterial hypertension: from classical treatment to modern management.

    Science.gov (United States)

    Burger, Charles D; D'Albini, Lesley; Raspa, Susan; Pruett, Janis A

    2016-01-01

    Prostacyclins for the treatment of pulmonary arterial hypertension (PAH) have historically been covered under the insurance medical benefit because they require durable medical equipment and are administered by an intravenous, subcutaneous, or inhalation route. However, more treatment options that target the prostacyclin pathway have become available. As the number and type of options expand, an improved understanding of these drugs will aid managed care decision makers in evaluating new treatment options and making clinically sound and cost-effective treatment decisions. PAH is a progressive disease of pulmonary vascular remodeling that increases pulmonary vascular resistance and often results in right-side heart failure and death if left untreated. Adverse event profiles, the complexity of administration modalities, and potential complications must be considered when administering prostacyclin therapy. Traditional modes of administration, with their potential challenges and complications, may have contributed to the unmet need for an oral agent. Another consideration for managed care decision makers is that oral agents are generally covered under the insurance pharmacy benefit. Access to oral medications with long-term outcomes data, as well as the improved convenience of oral therapy, may help patients with PAH maximize function by maintaining a more convenient and consistent therapeutic regimen.

  12. Cloning, expression, purification and crystallization of dihydrodipicolinate synthase from Agrobacterium tumefaciens

    International Nuclear Information System (INIS)

    Atkinson, Sarah C.; Dogovski, Con; Dobson, Renwick C. J.; Perugini, Matthew A.

    2012-01-01

    Dihydrodipicolinate synthase from the plant pathogen A. tumefaciens has been cloned, expressed, purified and crystallized in its unliganded form, in the presence of its substrate pyruvate and in the presence of pyruvate and the allosteric inhibitor lysine. Diffraction data for the crystals were collected to a maximum resolution of 1.40 Å. Dihydrodipicolinate synthase (DHDPS) catalyzes the first committed step of the lysine-biosynthesis pathway in bacteria, plants and some fungi. This study describes the cloning, expression, purification and crystallization of DHDPS (NP-354047.1) from the plant pathogen Agrobacterium tumefaciens (AgT-DHDPS). Enzyme-kinetics studies demonstrate that AgT-DHDPS possesses DHDPS activity in vitro. Crystals of AgT-DHDPS were grown in the unliganded form and in forms with substrate bound and with substrate plus allosteric inhibitor (lysine) bound. X-ray diffraction data sets were subsequently collected to a maximum resolution of 1.40 Å. Determination of the structure with and without substrate and inhibitor will offer insight into the design of novel pesticide agents

  13. Co-expression of peppermint geranyl diphosphate synthase small subunit enhances monoterpene production in transgenic tobacco plants.

    Science.gov (United States)

    Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai

    2017-02-01

    Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  14. Gibberellin overproduction promotes sucrose synthase expression and secondary cell wall deposition in cotton fibers.

    Directory of Open Access Journals (Sweden)

    Wen-Qin Bai

    Full Text Available Bioactive gibberellins (GAs comprise an important class of natural plant growth regulators and play essential roles in cotton fiber development. To date, the molecular base of GAs' functions in fiber development is largely unclear. To address this question, the endogenous bioactive GA levels in cotton developing fibers were elevated by specifically up-regulating GA 20-oxidase and suppressing GA 2-oxidase via transgenic methods. Higher GA levels in transgenic cotton fibers significantly increased micronaire values, 1000-fiber weight, cell wall thickness and cellulose contents of mature fibers. Quantitative RT-PCR and biochemical analysis revealed that the transcription of sucrose synthase gene GhSusA1 and sucrose synthase activities were significantly enhanced in GA overproducing transgenic fibers, compared to the wild-type cotton. In addition, exogenous application of bioactive GA could promote GhSusA1 expression in cultured fibers, as well as in cotton hypocotyls. Our results suggested that bioactive GAs promoted secondary cell wall deposition in cotton fibers by enhancing sucrose synthase expression.

  15. Controlling Citrate Synthase Expression by CRISPR/Cas9 Genome Editing for n-Butanol Production in Escherichia coli

    DEFF Research Database (Denmark)

    Heo, Min-Ji; Jung, Hwi-Min; Um, Jaeyong

    2017-01-01

    Genome editing using CRISPR/Cas9 was successfully demonstrated in Esherichia coli to effectively produce n-butanol in a defined medium under microaerobic condition. The butanol synthetic pathway genes including those encoding oxygen-tolerant alcohol dehydrogenase were overexpressed in metabolically...... prediction program, UTR designer, and modified using the CRISPR/Cas9 genome editing method to reduce its expression level. E. coli strains with decreased citrate synthase expression produced more butanol and the citrate synthase activity was correlated with butanol production. These results demonstrate...

  16. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

    Directory of Open Access Journals (Sweden)

    Yan Yang

    2017-04-01

    Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  17. Bifunctional effects of fucoidan on the expression of inducible nitric oxide synthase

    International Nuclear Information System (INIS)

    Yang, Jin Won; Yoon, Se Young; Oh, Soo Jin; Kim, Sang Kyum; Kang, Keon Wook

    2006-01-01

    Algal fucoidan is a marine sulfated polysaccharide with a wide variety of biological activities including anti-thrombotic and anti-inflammatory effects. This study evaluated the effect of fucoidan on the expression of inducible nitric oxide synthase (iNOS) in a macrophage cell line, RAW264.7. Low concentration range of fucoidan (10 μg/ml) increased the basal expression level of iNOS in quiescent macrophages. However, we found for the first time that fucoidan inhibited the release of nitric oxide (NO) in RAW264.7 cells stimulated with lipopolysaccharide (LPS). Western blot analysis revealed that fucoidan suppressed the LPS-induced expression of the inducible nitric oxide synthase (iNOS) gene. Moreover, the activation of both nuclear factor-κB (NF-κB) and activator protein 1 (AP-1) are key steps in the transcriptional activation of the iNOS gene. Here, it was revealed that fucoidan selectively suppressed AP-1 activation, and that the activation of AP-1 appears to be essential for the induction of iNOS in activated macrophages. This inhibitory effect on AP-1 activation by fucoidan might be associated with its NO blocking and anti-inflammatory effects

  18. Optimization of expression and properties of the recombinant acetohydroxyacid synthase of Thermotoga maritima

    Directory of Open Access Journals (Sweden)

    Mohammad S. Eram

    2015-12-01

    Full Text Available The data provide additional support of the characterization of the biophysical and biochemical properties of the enzyme acetohydroxyacid synthase from the hyperthermophilic bacterium Thermotoga maritima (Eram et al., 2015 [1]. The genes encoding the enzyme subunits have been cloned and expressed in the mesophilic host Escherichia coli. Detailed data include information about the optimization of the expression conditions, biophysical properties of the enzyme and reconstitution of the holoenzyme from individually expressed and purified subunits.

  19. Prostacyclin Suppresses Twist Expression in the Presence of Indomethacin in Bone Marrow-Derived Mesenchymal Stromal Cells

    Science.gov (United States)

    Kemper, Oliver; Herten, Monika; Fischer, Johannes; Haversath, Marcel; Beck, Sascha; Classen, Tim; Warwas, Sebastian; Tassemeier, Tjark; Landgraeber, Stefan; Lensing-Höhn, Sabine; Krauspe, Rüdiger; Jäger, Marcus

    2014-01-01

    Background Iloprost, a stable prostacyclin I2 analogue, seems to have an osteoblast-protective potential, whereas indomethacin suppresses new bone formation. The aim of this study was to investigate human bone marrow stromal cell (BMSC) proliferation and differentiation towards the osteoblastic lineage by administration of indomethacin and/or iloprost. Material/Methods Human bone marrow cells were obtained from 3 different donors (A=26 yrs/m; B=25 yrs/f, C=35 yrs/m) via vacuum aspiration of the iliac crest followed by density gradient centrifugation and flow cytometry with defined antigens (CD105+/73+/45−/14−). The cells were seeded and incubated as follows: without additives (Group 0; donor A/B/C), with 10−7 M iloprost only (Group 0+ilo; A/B), with indomethacin only in concentrations of 10−6 M (Group 1, A), 10−5 M (Group 2, B), 10−4 M (Group 3, A/B), and together with 10−7 M iloprost (Groups 4–6, A/B/C). On Day 10 and 28, UV/Vis spectrometric and immunocytochemical assays (4 samples per group and donor) were performed to investigate cell proliferation (cell count measurement) and differentiation towards the osteoblastic lineage (CD34−, CD45−, CD105+, type 1 collagen (Col1), osteocalcin (OC), alkaline phosphatase (ALP), Runx2, Twist, specific ALP-activity). Results Indomethacin alone suppressed BMSC differentiation towards the osteoblastic lineage by downregulation of Runx2, Col1, and ALP. In combination with indomethacin, iloprost increased cell proliferation and differentiation and it completely suppressed Twist expression at Day 10 and 28. Iloprost alone did not promote cell proliferation, but moderately enhanced Runx2 and Twist expression. However, the proliferative effects and the specific ALP-activity varied donor-dependently. Conclusions Iloprost partially antagonized the suppressing effects of indomethacin on BMSC differentiation towards the osteoblast lineage. It enhanced the expression of Runx2 and, only in the presence of indomethacin

  20. Regulation of galactan synthase expression to modify galactan content in plants

    Science.gov (United States)

    None

    2017-08-22

    The disclosure provides methods of engineering plants to modulate galactan content. Specifically, the disclosure provides methods for engineering a plant to increase the galactan content in a plant tissue by inducing expression of beta-1,4-galactan synthase (GALS), modulated by a heterologous promoter. Further disclosed are the methods of modulating expression level of GALS under the regulation of a transcription factor, as well as overexpression of UDP-galactose epimerse in the same plant tissue. Tissue specific promoters and transcription factors can be used in the methods are also provided.

  1. Cell-Specific Expression of Homospermidine Synthase, the Entry Enzyme of the Pyrrolizidine Alkaloid Pathway in Senecio vernalis, in Comparison with Its Ancestor, Deoxyhypusine Synthase1

    Science.gov (United States)

    Moll, Stefanie; Anke, Sven; Kahmann, Uwe; Hänsch, Robert; Hartmann, Thomas; Ober, Dietrich

    2002-01-01

    Pyrrolizidine alkaloids (PAs) are constitutive plant defense compounds with a sporadic taxonomic occurrence. The first committed step in PA biosynthesis is catalyzed by homospermidine synthase (HSS). Recent evidence confirmed that HSS evolved by gene duplication from deoxyhypusine synthase (DHS), an enzyme involved in the posttranslational activation of the eukaryotic translation initiation factor 5A. To better understand the evolutionary relationship between these two enzymes, which are involved in completely different biological processes, we studied their tissue-specific expression. RNA-blot analysis, reverse transcriptase-PCR, and immunolocalization techniques demonstrated that DHS is constitutively expressed in shoots and roots of Senecio vernalis (Asteraceae), whereas HSS expression is root specific and restricted to distinct groups of endodermis and neighboring cortex cells located opposite to the phloem. All efforts to detect DHS by immunolocalization failed, but studies with promoter-β-glucuronidase fusions confirmed a general expression pattern, at least in young seedlings of tobacco (Nicotiana tabacum). The expression pattern for HSS differs completely from its ancestor DHS due to the adaptation of HSS to the specific requirements of PA biosynthesis. PMID:12226485

  2. Expression, crystallization and preliminary crystallographic study of octaprenyl pyrophosphate synthase from Helicobacter pylori

    International Nuclear Information System (INIS)

    Zhang, Jinyong; Zhang, Xiaoli; Mao, Xuhu; Zou, Quanming; Li, Defeng

    2011-01-01

    Octaprenyl pyrophosphate synthase from H. pylori has been expressed, purified and crystallized, and a diffraction data set was collected to 2.00 Å resolution. Octaprenyl pyrophosphate synthase (OPPs) is involved in the synthesis of the side chains of ubiquinone and menaquinone and catalyzes consecutive condensation reactions of farnesyl pyrophosphate with isopentenyl pyrophosphate to generate polyprenyl pyrophosphate and pyrophosphate. In order to investigate the roles played by OPPs in the metabolism of ubiquinone and menaquinone and the enzymatic mechanisms of these enzymes, analysis of the structure–function relationship of OPPs from Helicobacter pylori was initiated. The gene for OPPs was cloned, the protein was expressed, purified and crystallized and a diffraction data set was collected to 2.00 Å resolution. The crystals belonged to space group P4 1 2 1 2 or P4 3 2 1 2, with unit-cell parameters a = b = 109.33, c = 103.41 Å

  3. Enhanced Toxic Metal Accumulation in Engineered Bacterial Cells Expressing Arabidopsis thaliana Phytochelatin Synthase

    Science.gov (United States)

    Sauge-Merle, Sandrine; Cuiné, Stéphan; Carrier, Patrick; Lecomte-Pradines, Catherine; Luu, Doan-Trung; Peltier, Gilles

    2003-01-01

    Phytochelatins (PCs) are metal-binding cysteine-rich peptides, enzymatically synthesized in plants and yeasts from glutathione in response to heavy metal stress by PC synthase (EC 2.3.2.15). In an attempt to increase the ability of bacterial cells to accumulate heavy metals, the Arabidopsis thaliana gene encoding PC synthase (AtPCS) was expressed in Escherichia coli. A marked accumulation of PCs was observed in vivo together with a decrease in the glutathione cellular content. When bacterial cells expressing AtPCS were placed in the presence of heavy metals such as cadmium or the metalloid arsenic, cellular metal contents were increased 20- and 50-fold, respectively. We discuss the possibility of using genes of the PC biosynthetic pathway to design bacterial strains or higher plants with increased abilities to accumulate toxic metals, and also arsenic, for use in bioremediation and/or phytoremediation processes. PMID:12514032

  4. Prostacyclin influences the pressure reactivity in patients with severe traumatic brain injury treated with an ICP-targeted therapy.

    Science.gov (United States)

    Koskinen, Lars-Owe D; Eklund, Anders; Sundström, Nina; Olivecrona, Magnus

    2015-02-01

    This prospective consecutive double-blinded randomized study investigated the effect of prostacyclin on pressure reactivity (PR) in severe traumatic brain injured patients. Other aims were to describe PR over time and its relation to outcome. Blunt head trauma patients, Glasgow coma scale ≤8, age 15-70 years were included and randomized to prostacyclin treatment (n = 23) or placebo (n = 25). Outcome was assessed using the extended Glasgow outcome scale (GOSE) at 3 months. PR was calculated as the regression coefficient between the hourly mean values of ICP versus MAP. Pressure active/stable was defined as PR ≤0. Mean PR over 96 h (PRtot) was 0.077 ± 0.168, in the prostacyclin group 0.030 ± 0.153 and in the placebo group 0.120 ± 0.173 (p GOSE score (p GOSE 1-4) and 0.029 ± 0.140 in the favorable outcome group (GOSE 5-8). Area under the curve for prediction of death (ROC) was 0.742 and for favorable outcome 0.628. Prostacyclin influenced the PR in a direction of increased pressure stability and a lower PRtot was associated with improved outcome. The individual PR varied substantially over time. The predictive value of PRtot for outcome was not solid enough to be used in the clinical situation.

  5. Germacrene A Synthase in Yarrow (Achillea millefolium Is an Enzyme with Mixed Substrate Specificity: Gene Cloning, Functional Characterization and Expression Analysis

    Directory of Open Access Journals (Sweden)

    Leila ePazouki

    2015-03-01

    Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

  6. Influence of gibberellin and daminozide on the expression of terpene synthases and on monoterpenes in common sage (Salvia officinalis).

    Science.gov (United States)

    Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes

    2010-07-01

    Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta

  7. Effects of acetoacetyl-CoA synthase expression on production of farnesene in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Tippmann, Stefan; Ferreira, Raphael; Siewers, Verena

    2017-01-01

    to overcome the thermodynamic constraint imposed on the first reaction, in which acetoacetyl-CoA is produced from two moles of acetyl-CoA by acetoacetyl-CoA thiolase. Recently, a novel acetoacetyl-CoA synthase (nphT7) has been identified from Streptomyces sp. strain CL190, which catalyzes the irreversible...... functionality of the bypass was limited by the efficiency of acetoacetyl-CoA synthase (nphT7). Besides modulation of the expression level, which could be used as a means to partially restore the phenotype, nphT7 from Streptomyces glaucescens showed clearly higher efficiency compared to Streptomyces sp. strain...

  8. CTP limitation increases expression of CTP synthase in Lactococcus lactis

    DEFF Research Database (Denmark)

    Jørgensen, C.M.; Hammer, Karin; Martinussen, Jan

    2003-01-01

    CTP synthase is encoded by the pyrG gene and catalyzes the conversion of UTP to CTP. A Lactococcus lactis pyrG mutant with a cytidine requirement was constructed, in which beta-galactosidase activity in a pyrG-lacLM transcriptional fusion was used to monitor gene expression of pyrG. A 10-fold...... decrease in the CTP pool induced by cytidine limitation was found to immediately increase expression of the L. lactis pyrG gene. The final level of expression of pyrG is 37-fold higher than the uninduced level. CTP limitation has pronounced effects on central cellular metabolism, and both RNA and protein...... for regulation of the pyrG gene. It is possible to fold the pyrG leader in an alternative structure that would prevent the formation of the terminator. We suggest a model for pyrG regulation in L. lactis, and probably in other gram-positive bacteria as well, in which pyrG expression is directly dependent...

  9. Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Directory of Open Access Journals (Sweden)

    Xiudao Yu

    2013-10-01

    Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  10. Prostacyclin therapy increases right ventricular capillarisation in a model for flow-associated pulmonary hypertension

    NARCIS (Netherlands)

    van Albada, Mirjam E.; Berger, Rolf M. F.; Niggebrugge, Marnix; van Veghel, Richard; Cromme-Dijkhuis, Adri H.; Schoemaker, Regien G.

    2006-01-01

    Pulmonary hypertension, and consequently right ventricular failure, complicates several congenital heart defects. Although intervention in the prostacyclin-thromboxane ratio is known to improve outcome, the underlying mechanism is not clear. Therefore, effects of acetyl salicylic acid and iloprost

  11. Cloning, expression, purification and crystallization of dihydrodipicolinate synthase from the grapevine Vitis vinifera

    International Nuclear Information System (INIS)

    Atkinson, Sarah C.; Dogovski, Con; Newman, Janet; Dobson, Renwick C. J.; Perugini, Matthew A.

    2011-01-01

    Dihydrodipicolinate synthase from the common grapevine V. vinifera has been cloned, expressed, purified and crystallized in the presence of the substrate pyruvate by in-drop hexahistidine-tag cleavage. A diffraction data set has been collected to a resolution of 2.2 Å. Dihydrodipicolinate synthase (DHDPS) catalyses the first committed step of the lysine-biosynthesis pathway in bacteria, plants and some fungi. This study describes the cloning, expression, purification and crystallization of DHDPS from the grapevine Vitis vinifera (Vv-DHDPS). Following in-drop cleavage of the hexahistidine tag, cocrystals of Vv-DHDPS with the substrate pyruvate were grown in 0.1 M Bis-Tris propane pH 8.2, 0.2 M sodium bromide, 20%(w/v) PEG 3350. X-ray diffraction data in space group P1 at a resolution of 2.2 Å are presented. Preliminary diffraction data analysis indicated the presence of eight molecules per asymmetric unit (V M = 2.55 Å 3 Da −1 , 52% solvent content). The pending crystal structure of Vv-DHDPS will provide insight into the molecular evolution in quaternary structure of DHDPS enzymes

  12. (+)-(10R)-Germacrene A synthase from goldenrod, Solidago canadensis; cDNA isolation, bacterial expression and functional analysis.

    Science.gov (United States)

    Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H

    2002-08-01

    Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.

  13. Cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from Thalictrum flavum

    International Nuclear Information System (INIS)

    Pasquo, Alessandra; Bonamore, Alessandra; Franceschini, Stefano; Macone, Alberto; Boffi, Alberto; Ilari, Andrea

    2008-01-01

    The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to the trigonal space group P3 1 21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction

  14. Intermittent pneumatic compression regulates expression of nitric oxide synthases in skeletal muscles.

    Science.gov (United States)

    Tan, Xiangling; Qi, Wen-Ning; Gu, Xiaosong; Urbaniak, James R; Chen, Long-En

    2006-01-01

    This study investigated the effects of intermittent pneumatic compression (IPC) on expression of nitric oxide synthase (NOS) isoforms in compressed (anterior tibialis, AT) and uncompressed (cremaster muscles, CM) skeletal muscles. Following IPC application of 0.5, 1, and 5h on both legs of rats, the endothelial NOS (eNOS) mRNA expression was significantly up-regulated to 1.2-, 1.8, and 2.7-fold from normal, respectively, in both AT and CM, and protein expression increased more than 1.5-fold of normal at each time point. Similarly, neuronal NOS expression was up-regulated, but to a lesser degree. In contrast, inducible NOS expression was significantly and time-dependently down-regulated in both muscles. After IPC cessation, eNOS levels returned to normal in both AT and CM. The results confirm our hypothesis that IPC-induced vasodilation is mediated by regulating expression of NOS isoforms, in particular eNOS, in both compressed and uncompressed skeletal muscles. The results also suggest the importance of precisely characterizing expression of each NOS isoform in tissue pathophysiology.

  15. The Regulation of Nitric Oxide Synthase Isoform Expression in Mouse and Human Fallopian Tubes: Potential Insights for Ectopic Pregnancy

    Directory of Open Access Journals (Sweden)

    Junting Hu

    2014-12-01

    Full Text Available Nitric oxide (NO is highly unstable and has a half-life of seconds in buffer solutions. It is synthesized by NO-synthase (NOS, which has been found to exist in the following three isoforms: neuro nitric oxide synthase (nNOS, inducible nitric oxide synthase (iNOS, and endothelial nitric oxide synthase (eNOS. NOS activity is localized in the reproductive tracts of many species, although direct evidence for NOS isoforms in the Fallopian tubes of mice is still lacking. In the present study, we investigated the expression and regulation of NOS isoforms in the mouse and human Fallopian tubes during the estrous and menstrual cycles, respectively. We also measured isoform expression in humans with ectopic pregnancy and in mice treated with lipopolysaccharide (LPS. Our results confirmed the presence of different NOS isoforms in the mouse and human Fallopian tubes during different stages of the estrous and menstrual cycles and showed that iNOS expression increased in the Fallopian tubes of women with ectopic pregnancy and in LPS-treated mice. Elevated iNOS activity might influence ovulation, cilia beats, contractility, and embryo transportation in such a manner as to increase the risk of ectopic pregnancy. This study has provided morphological and molecular evidence that NOS isoforms are present and active in the human and mouse Fallopian tubes and suggests that iNOS might play an important role in both the reproductive cycle and infection-induced ectopic pregnancies.

  16. Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer

    International Nuclear Information System (INIS)

    Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju

    2010-01-01

    We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco

  17. Expression of inducible nitric oxide synthase in trigeminal ganglion cells during culture

    DEFF Research Database (Denmark)

    Jansen-Olesen, Inger; Zhou, MingFang; Zinck, Tina Jovanovic

    2005-01-01

    RNA and protein could be detected. The data suggest that iNOS expression may be a molecular mechanism mediating the adaptive response of trigeminal ganglia cells to the serum free stressful stimulus the culture environment provides. It may act as a cellular signalling molecule that is expressed after cell......Nitric oxide (NO) is an important signalling molecule that has been suggested to be a key molecule for induction and maintenance of migraine attacks based on clinical studies, animal experimental studies and the expression of nitric oxide synthase (NOS) immunoreactivity within the trigeminovascular......, reverse transcriptase polymerase chain reaction (RT-PCR) and Western blotting. In trigeminal ganglia cells not subjected to culture, endothelial (e) and neuronal (n) but not inducible (i) NOS mRNA and protein were detected. Culture of rat neurones resulted in a rapid axonal outgrowth of NOS positive...

  18. Expression analysis of cellulose synthase and main cytoskeletal protein genes in flax (Linum usitatissimum L.).

    Science.gov (United States)

    Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav

    2017-08-09

    Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.

  19. Aerobic exercise training lowers platelet reactivity and improves platelet sensitivity to prostacyclin in pre- and postmenopausal women

    DEFF Research Database (Denmark)

    Lundberg Slingsby, Martina Helena; Nyberg, Michael Permin; Egelund, Jon

    2017-01-01

    BACKGROUND: The risk of atherothrombotic events increases after menopause. Regular physical activity has been shown to reduce platelet reactivity in younger women, but it is unknown how regular exercise affects platelet function after menopause. OBJECTIVES: To examine the effects of regular aerobic...... exercise in late pre- and recent postmenopausal women by testing basal platelet reactivity and platelet sensitivity to prostacyclin and nitric oxide. METHODS: 25 sedentary, but healthy, late premenopausal and 24 matched recently postmenopausal women, mean (95% confidence interval) 49.1 (48.2-49.9) and 53...... postmenopausal women, platelet reactivity was tested ex vivo after femoral arterial infusion of prostacyclin, acetylcholine, a cyclooxygenase inhibitor and after acute one-leg knee extensor exercise. RESULTS: Basal platelet reactivity (%aggregation) to TRAP-6(1μM) was higher in the postmenopausal; 59% (50...

  20. Isolation and functional characterization of a τ-cadinol synthase, a new sesquiterpene synthase from Lavandula angustifolia.

    Science.gov (United States)

    Jullien, Frédéric; Moja, Sandrine; Bony, Aurélie; Legrand, Sylvain; Petit, Cécile; Benabdelkader, Tarek; Poirot, Kévin; Fiorucci, Sébastien; Guitton, Yann; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis

    2014-01-01

    In this paper we characterize three sTPSs: a germacrene D (LaGERDS), a (E)-β-caryophyllene (LaCARS) and a τ-cadinol synthase (LaCADS). τ-cadinol synthase is reported here for the first time and its activity was studied in several biological models including transiently or stably transformed tobacco species. Three dimensional structure models of LaCADS and Ocimum basilicum γ-cadinene synthase were built by homology modeling using the template structure of Gossypium arboreum δ-cadinene synthase. The depiction of their active site organization provides evidence of the global influence of the enzymes on the formation of τ-cadinol: instead of a unique amino-acid, the electrostatic properties and solvent accessibility of the whole active site in LaCADS may explain the stabilization of the cadinyl cation intermediate. Quantitative PCR performed from leaves and inflorescences showed two patterns of expression. LaGERDS and LaCARS were mainly expressed during early stages of flower development and, at these stages, transcript levels paralleled the accumulation of the corresponding terpene products (germacrene D and (E)-β-caryophyllene). By contrast, the expression level of LaCADS was constant in leaves and flowers. Phylogenetic analysis provided informative results on potential duplication process leading to sTPS diversification in lavender.

  1. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  2. Microsatellite instability in colorectal cancer and association with thymidylate synthase and dihydropyrimidine dehydrogenase expression

    International Nuclear Information System (INIS)

    Jensen, Søren A; Vainer, Ben; Kruhøffer, Mogens; Sørensen, Jens B

    2009-01-01

    Microsatellite instability (MSI) refers to mutations in short motifs of tandemly repeated nucleotides resulting from replication errors and deficient mismatch repair (MMR). Colorectal cancer with MSI has characteristic biology and chemosensitivity, however the molecular basis remains unclarified. The association of MSI and MMR status with outcome and with thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) expression in colorectal cancer were evaluated. MSI in five reference loci, MMR enzymes (hMSH2, hMSH6, hMLH1 and hPMS2), thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) expression were assessed in paraffin embedded tumor specimens, and associated with outcome in 340 consecutive patients completely resected for colorectal cancer stages II-IV and subsequently receiving adjuvant 5-fluorouracil therapy. MSI was found in 43 (13.8%) tumors. Absence of repair protein expression was assessed in 52 (17.0%) tumors, which had primarily lost hMLH1 in 39 (12.7%), hMSH2 in 5 (1.6%), and hMSH6 in 8 (2.6%) tumors. In multivariate analysis MSI (instable) compared to MSS (stable) tumors were significantly associated with lower risk of recurrence (hazard ratio (HR) = 0.3; 95% CI: 0.2–0.7; P = 0.0007) and death (HR = 0.4; 95% CI: 0.2–0.9; P = 0.02) independently of the TS and DPD expressions. A direct relationship between MSI and TS intensity (P = 0.001) was found, while there was no significant association with DPD intensity (P = 0.1). The favourable outcome of MSI colorectal carcinomas is ascribed mainly to the tumor biology and to a lesser extent to antitumor response to 5-fluorouracil therapy. There is no evidence that differential TS or DPD expression may account for these outcome characteristics

  3. An In Planta-Expressed Polyketide Synthase Produces (R)-Mellein in the Wheat Pathogen Parastagonospora nodorum

    Science.gov (United States)

    Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.

    2014-01-01

    Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302

  4. A phycocyanin·phellandrene synthase fusion enhances recombinant protein expression and β-phellandrene (monoterpene) hydrocarbons production in Synechocystis (cyanobacteria).

    Science.gov (United States)

    Formighieri, Cinzia; Melis, Anastasios

    2015-11-01

    Cyanobacteria can be exploited as photosynthetic platforms for heterologous generation of terpene hydrocarbons with industrial applications. Transformation of Synechocystis and heterologous expression of the β-phellandrene synthase (PHLS) gene alone is necessary and sufficient to confer to Synechocystis the ability to divert intermediate terpenoid metabolites and to generate the monoterpene β-phellandrene during photosynthesis. However, terpene synthases, including the PHLS, have a slow Kcat (low Vmax) necessitating high levels of enzyme concentration to enable meaningful rates and yield of product formation. Here, a novel approach was applied to increase the PHLS protein expression alleviating limitations in the rate and yield of β-phellandrene product generation. Different PHLS fusion constructs were generated with the Synechocystis endogenous cpcB sequence, encoding for the abundant in cyanobacteria phycocyanin β-subunit, expressed under the native cpc operon promoter. In one of these constructs, the CpcB·PHLS fusion protein accumulated to levels approaching 20% of the total cellular protein, i.e., substantially higher than expressing the PHLS protein alone under the same endogenous cpc promoter. The CpcB·PHLS fusion protein retained the activity of the PHLS enzyme and catalyzed β-phellandrene synthesis, yielding an average of 3.2 mg product g(-1) dry cell weight (dcw) versus the 0.03 mg g(-1)dcw measured with low-expressing constructs, i.e., a 100-fold yield improvement. In conclusion, the terpene synthase fusion-protein approach is promising, as, in this case, it substantially increased the amount of the PHLS in cyanobacteria, and commensurately improved rates and yield of β-phellandrene hydrocarbons production in these photosynthetic microorganisms. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  5. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  6. Stable expression of lipocalin-type prostaglandin D synthase in cultured preadipocytes impairs adipogenesis program independently of endogenous prostanoids

    Energy Technology Data Exchange (ETDEWEB)

    Hossain, Mohammad Salim; Chowdhury, Abu Asad; Rahman, Mohammad Sharifur [Department of Life Science and Biotechnology, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan); Nishimura, Kohji [Department of Molecular and Functional Genomics, Center for Integrated Research in Science, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan); Jisaka, Mitsuo; Nagaya, Tsutomu [Department of Life Science and Biotechnology, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan); Shono, Fumiaki [Department of Clinical Pharmacy, Faculty of Pharmaceutical Sciences, Tokushima Bunri University, 180 Yamashiro-cho, Tokushima-shi, Tokushima 770-8514 (Japan); Yokota, Kazushige, E-mail: yokotaka@life.shimane-u.ac.jp [Department of Life Science and Biotechnology, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan)

    2012-02-15

    Lipocalin-type prostaglandin D synthase (L-PGDS) expressed preferentially in adipocytes is responsible for the synthesis of PGD{sub 2} and its non-enzymatic dehydration products, PGJ{sub 2} series, serving as pro-adipogenic factors. However, the role of L-PGDS in the regulation of adipogenesis is complex because of the occurrence of several derivatives from PGD{sub 2} and their distinct receptor subtypes as well as other functions such as a transporter of lipophilic molecules. To manipulate the expression levels of L-PGDS in cultured adipocytes, cultured preadipogenic 3T3-L1 cells were transfected stably with a mammalian expression vector having cDNA encoding murine L-PGDS oriented in the sense direction. The isolated cloned stable transfectants with L-PGDS expressed higher levels of the transcript and protein levels of L-PGDS, and synthesized PGD{sub 2} from exogenous arachidonic acid at significantly higher levels. By contrast, the synthesis of PGE{sub 2} remained unchanged, indicating no influence on the reactions of cyclooxygenase (COX) and PGE synthase. Furthermore, the ability of those transfectants to synthesize {Delta}{sup 12}-PGJ{sub 2} increased more greatly during the maturation phase. The sustained expression of L-PGDS in cultured stable transfectants hampered the storage of fats during the maturation phase of adipocytes, which was accompanied by the reduced gene expression of adipocyte-specific markers reflecting the down-regulation of the adipogenesis program. The suppressed adipogenesis was not rescued by either exogenous aspirin or peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) agonists including troglitazone and {Delta}{sup 12}-PGJ{sub 2}. Taken together, the results indicate the negative regulation of the adipogenesis program by the enhanced expression of L-PGDS through a cellular mechanism involving the interference of the PPAR{gamma} signaling pathway without the contribution of endogenous pro-adipogenic prostanoids

  7. Thymidylate synthase protein expression levels remain stable during paclitaxel and carboplatin treatment in non-small cell lung cancer

    DEFF Research Database (Denmark)

    Jakobsen, Jan Nyrop; Santoni-Rugiu, Eric; Sørensen, Jens Benn

    2014-01-01

    BACKGROUND: Thymidylate synthase (TS) is a potential predictive marker for efficacy of treatment with pemetrexed. The current study aimed at investigating whether TS expression changes during non-pemetrexed chemotherapy of non-small cell lung cancer (NSCLC), thus making rebiopsy necessary for dec...

  8. Aerosolized prostacyclins for acute respiratory distress syndrome (ARDS)

    DEFF Research Database (Denmark)

    Afshari, Arash; Bastholm Bille, Anders; Allingstrup, Mikkel

    2017-01-01

    BACKGROUND: Acute respiratory distress syndrome (ARDS) is a critical condition that is associated with high mortality and morbidity. Aerosolized prostacyclin has been used to improve oxygenation despite the limited evidence available so far.This review was originally published in 2010 and updated...... (very low quality of evidence), and one RCT involved 67 critically ill adults (very low quality evidence).Only one RCT (paediatric trial) provided data on mortality and found no difference between intervention and control. However, this trial was eligible for meta-analysis due to a cross-over design...... low quality evidence).There were no adverse events such as bleeding or organ dysfunction in any of the included trials. Due to the limited number of RCTs, we were unable to perform the prespecified subgroup and sensitivity analyses or trial sequential analysis. AUTHORS' CONCLUSIONS: We are unable...

  9. Cloning, expression, purification and crystallization of dihydrodipicolinate synthase from the psychrophile Shewanella benthica

    International Nuclear Information System (INIS)

    Wubben, Jacinta M.; Dogovski, Con; Dobson, Renwick C. J.; Codd, Rachel; Gerrard, Juliet A.; Parker, Michael W.; Perugini, Matthew A.

    2010-01-01

    Dihydrodipicolinate synthase (DHDPS) is an essential oligomeric enzyme of interest to antibiotic discovery research and studies probing the importance of quaternary structure to protein function, stability and dynamics. The cloning, expression, purification and crystallization of DHDPS from the psychrophilic (cold-dwelling) bacterium Shewanella benthica are described. Dihydrodipicolinate synthase (DHDPS) is an oligomeric enzyme that catalyzes the first committed step of the lysine-biosynthesis pathway in plants and bacteria, which yields essential building blocks for cell-wall and protein synthesis. DHDPS is therefore of interest to drug-discovery research as well as to studies that probe the importance of quaternary structure to protein function, stability and dynamics. Accordingly, DHDPS from the psychrophilic (cold-dwelling) organism Shewanella benthica (Sb-DHDPS) was cloned, expressed, purified and crystallized. The best crystals of Sb-DHDPS were grown in 200 mM ammonium sulfate, 100 mM bis-tris pH 5.0–6.0, 23–26%(w/v) PEG 3350, 0.02%(w/v) sodium azide and diffracted to beyond 2.5 Å resolution. Processing of diffraction data to 2.5 Å resolution resulted in a unit cell with space group P2 1 2 1 2 1 and dimensions a = 73.1, b = 84.0, c = 143.7 Å. These studies of the first DHDPS enzyme to be characterized from a bacterial psychrophile will provide insight into the molecular evolution of enzyme structure and dynamics

  10. Expression Patterns, Activities and Carbohydrate-Metabolizing Regulation of Sucrose Phosphate Synthase, Sucrose Synthase and Neutral Invertase in Pineapple Fruit during Development and Ripening

    Science.gov (United States)

    Zhang, Xiu-Mei; Wang, Wei; Du, Li-Qing; Xie, Jiang-Hui; Yao, Yan-Li; Sun, Guang-Ming

    2012-01-01

    Differences in carbohydrate contents and metabolizing-enzyme activities were monitored in apical, medial, basal and core sections of pineapple (Ananas comosus cv. Comte de paris) during fruit development and ripening. Fructose and glucose of various sections in nearly equal amounts were the predominant sugars in the fruitlets, and had obvious differences until the fruit matured. The large rise of sucrose/hexose was accompanied by dramatic changes in sucrose phosphate synthase (SPS) and sucrose synthase (SuSy) activities. By contrast, neutral invertase (NI) activity may provide a mechanism to increase fruit sink strength by increasing hexose concentrations. Furthermore, two cDNAs of Ac-sps (accession no. GQ996582) and Ac-ni (accession no. GQ996581) were first isolated from pineapple fruits utilizing conserved amino-acid sequences. Homology alignment reveals that the amino acid sequences contain some conserved function domains. Transcription expression analysis of Ac-sps, Ac-susy and Ac-ni also indicated distinct patterns related to sugar accumulation and composition of pineapple fruits. It suggests that differential expressions of multiple gene families are necessary for sugar metabolism in various parts and developmental stages of pineapple fruit. A cycle of sucrose breakdown in the cytosol of sink tissues could be mediated through both Ac-SuSy and Ac-NI, and Ac-NI could be involved in regulating crucial steps by generating sugar signals to the cells in a temporally and spatially restricted fashion. PMID:22949808

  11. High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

    Directory of Open Access Journals (Sweden)

    Mariela V Catone

    Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

  12. Cloning and expression of pineapple sucrosephosphate synthase ...

    African Journals Online (AJOL)

    A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...

  13. Effects and mechanism of acid rain on plant chloroplast ATP synthase.

    Science.gov (United States)

    Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua

    2016-09-01

    Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.

  14. The primary defect in glycogen synthase activity is not based on increased glycogen synthase kinase-3a activity in diabetic myotubes

    DEFF Research Database (Denmark)

    Gaster, Michael; Brusgaard, Klaus; Handberg, Aa.

    2004-01-01

    The mechanism responsible for the diminished activation of glycogen synthase (GS) in diabetic myotubes remains unclear, but may involve increased activity and/or expression of glycogen synthase kinase-3 (GSK-3). In myotubes established from type 2 diabetic and healthy control subjects we determined...

  15. Alternative splicing of the porcine glycogen synthase kinase 3β (GSK-3β gene with differential expression patterns and regulatory functions.

    Directory of Open Access Journals (Sweden)

    Linjie Wang

    Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.

  16. Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

    Science.gov (United States)

    Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

    2011-10-01

    Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

  17. Fish Oil Supplementation and Fatty Acid Synthase Expression in the Prostate: A Randomized Controlled Trial. Addendum

    Science.gov (United States)

    2011-07-01

    controls, Menendez et al demonstrated that addition of omega-3 fatty acids (-3 FA), docosahexanoic acid ( DHA ), alpha- linolenic acid , and -6 FA, γ...AD_________________ Award Number: W81XWH-04-1-0296 TITLE: Fish Oil Supplementation and Fatty Acid ...COVERED 1 March 2010 – 30 June 2011 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Fish Oil Supplementation and Fatty Acid Synthase Expression in the

  18. Extracellular histones disarrange vasoactive mediators release through a COX-NOS interaction in human endothelial cells.

    Science.gov (United States)

    Pérez-Cremades, Daniel; Bueno-Betí, Carlos; García-Giménez, José Luis; Ibañez-Cabellos, José Santiago; Hermenegildo, Carlos; Pallardó, Federico V; Novella, Susana

    2017-08-01

    Extracellular histones are mediators of inflammation, tissue injury and organ dysfunction. Interactions between circulating histones and vascular endothelial cells are key events in histone-mediated pathologies. Our aim was to investigate the implication of extracellular histones in the production of the major vasoactive compounds released by human endothelial cells (HUVECs), prostanoids and nitric oxide (NO). HUVEC exposed to increasing concentrations of histones (0.001 to 100 μg/ml) for 4 hrs induced prostacyclin (PGI2) production in a dose-dependent manner and decreased thromboxane A2 (TXA2) release at 100 μg/ml. Extracellular histones raised cyclooxygenase-2 (COX-2) and prostacyclin synthase (PGIS) mRNA and protein expression, decreased COX-1 mRNA levels and did not change thromboxane A2 synthase (TXAS) expression. Moreover, extracellular histones decreased both, eNOS expression and NO production in HUVEC. The impaired NO production was related to COX-2 activity and superoxide production since was reversed after celecoxib (10 μmol/l) and tempol (100 μmol/l) treatments, respectively. In conclusion, our findings suggest that extracellular histones stimulate the release of endothelial-dependent mediators through an up-regulation in COX-2-PGIS-PGI2 pathway which involves a COX-2-dependent superoxide production that decreases the activity of eNOS and the NO production. These effects may contribute to the endothelial cell dysfunction observed in histone-mediated pathologies. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  19. Localization of nitric oxide synthase in human skeletal muscle

    DEFF Research Database (Denmark)

    Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva

    1996-01-01

    The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed...

  20. Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids.

    Science.gov (United States)

    Xiang, Lin; Zhao, Kaige; Chen, Longqing

    2010-01-01

    Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  1. Optimization of the expression of phaC2 encoding poly (3-hydroxyalkanoate synthase from Pseudomonas aeruginosa PTCC1310 in Fad B deleted Escherichia coli

    Directory of Open Access Journals (Sweden)

    Daryoush Abedi

    2016-01-01

    Conclusion: We obtained functional expression of the phaC2 gene and investigated various conditions that could influence the expression of protein to optimize production of PHA synthase enzymes. This would allow us to study PHA production in large quantities.

  2. Down regulation by a low-zinc diet in gene expression of rat prostatic thymidylate synthase and thymidine kinase

    Directory of Open Access Journals (Sweden)

    Sassa Shuji

    2008-05-01

    Full Text Available Abstract Background Zinc has a wide spectrum of biological activities and its deficiency is related to various abnormalities of cell metabolism. Methods Wistar male rats, at age of 4 weeks, were fed a low-zinc diet for six weeks. The levels of bromodeoxyuridine incorporated into the prostatic DNA and the mRNA expression levels of prostate thymidylate synthase and thymidine kinase were examined. Result The low-zinc diet caused a marked reduction in the body growth and organ weights, resulted in a low hematopoiesis, hypo-albuminemia and hypocholesterolemia. Although there were few differences in plasma biochemical markers, plasma levels of luteinizing hormone and testosterone were reduced by the low-zinc diet. Bromodeoxyuridine-immunoreactive (S-phase cells and mRNA expression levels of thymidylate synthase and thymidine kinase in the prostate cells were markedly affected by the low-zinc diet. Conclusion A low-zinc diet appears to reduce the body growth and organ weights including prostate, causing low plasma levels of luteinizing hormone and testosterone and reduction in prostate DNA replication in growing-rats.

  3. Zinc affects differently growth, photosynthesis, antioxidant enzyme activities and phytochelatin synthase expression of four marine diatoms.

    Science.gov (United States)

    Nguyen-Deroche, Thi Le Nhung; Caruso, Aurore; Le, Thi Trung; Bui, Trang Viet; Schoefs, Benoît; Tremblin, Gérard; Morant-Manceau, Annick

    2012-01-01

    Zinc-supplementation (20 μM) effects on growth, photosynthesis, antioxidant enzyme activities (superoxide dismutase, ascorbate peroxidase, catalase), and the expression of phytochelatin synthase gene were investigated in four marine diatoms (Amphora acutiuscula, Nitzschia palea, Amphora coffeaeformis and Entomoneis paludosa). Zn-supplementation reduced the maximum cell density. A linear relationship was found between the evolution of gross photosynthesis and total chlorophyll content. The Zn treatment decreased the electron transport rate except in A. coffeaeformis and in E. paludosa at high irradiance. A linear relationship was found between the efficiency of light to evolve oxygen and the size of the light-harvesting antenna. The external carbonic anhydrase activity was stimulated in Zn-supplemented E. paludosa but was not correlated with an increase of photosynthesis. The total activity of the antioxidant enzymes did not display any clear increase except in ascorbate peroxidase activity in N. palea. The phytochelatin synthase gene was identified in the four diatoms, but its expression was only revealed in N. palea, without a clear difference between control and Zn-supplemented cells. Among the four species, A. paludosa was the most sensitive and A. coffeaeformis, the most tolerant. A. acutiuscula seemed to be under metal starvation, whereas, to survive, only N. palea developed several stress responses.

  4. Zinc Affects Differently Growth, Photosynthesis, Antioxidant Enzyme Activities and Phytochelatin Synthase Expression of Four Marine Diatoms

    Directory of Open Access Journals (Sweden)

    Thi Le Nhung Nguyen-Deroche

    2012-01-01

    Full Text Available Zinc-supplementation (20 μM effects on growth, photosynthesis, antioxidant enzyme activities (superoxide dismutase, ascorbate peroxidase, catalase, and the expression of phytochelatin synthase gene were investigated in four marine diatoms (Amphora acutiuscula, Nitzschia palea, Amphora coffeaeformis and Entomoneis paludosa. Zn-supplementation reduced the maximum cell density. A linear relationship was found between the evolution of gross photosynthesis and total chlorophyll content. The Zn treatment decreased the electron transport rate except in A. coffeaeformis and in E. paludosa at high irradiance. A linear relationship was found between the efficiency of light to evolve oxygen and the size of the light-harvesting antenna. The external carbonic anhydrase activity was stimulated in Zn-supplemented E. paludosa but was not correlated with an increase of photosynthesis. The total activity of the antioxidant enzymes did not display any clear increase except in ascorbate peroxidase activity in N. palea. The phytochelatin synthase gene was identified in the four diatoms, but its expression was only revealed in N. palea, without a clear difference between control and Zn-supplemented cells. Among the four species, A. paludosa was the most sensitive and A. coffeaeformis, the most tolerant. A. acutiuscula seemed to be under metal starvation, whereas, to survive, only N. palea developed several stress responses.

  5. Chlorophyll Synthase under Epigenetic Surveillance Is Critical for Vitamin E Synthesis, and Altered Expression Affects Tocopherol Levels in Arabidopsis.

    Science.gov (United States)

    Zhang, Chunyu; Zhang, Wei; Ren, Guodong; Li, Delin; Cahoon, Rebecca E; Chen, Ming; Zhou, Yongming; Yu, Bin; Cahoon, Edgar B

    2015-08-01

    Chlorophyll synthase catalyzes the final step in chlorophyll biosynthesis: the esterification of chlorophyllide with either geranylgeranyl diphosphate or phytyl diphosphate (PDP). Recent studies have pointed to the involvement of chlorophyll-linked reduction of geranylgeranyl by geranylgeranyl reductase as a major pathway for the synthesis of the PDP precursor of tocopherols. This indirect pathway of PDP synthesis suggests a key role of chlorophyll synthase in tocopherol production to generate the geranylgeranyl-chlorophyll substrate for geranylgeranyl reductase. In this study, contributions of chlorophyll synthase to tocopherol formation in Arabidopsis (Arabidopsis thaliana) were explored by disrupting and altering expression of the corresponding gene CHLOROPHYLL SYNTHASE (CHLSYN; At3g51820). Leaves from the homozygous chlysyn1-1 null mutant were nearly devoid of tocopherols, whereas seeds contained only approximately 25% of wild-type tocopherol levels. Leaves of RNA interference lines with partial suppression of CHLSYN displayed marked reductions in chlorophyll but up to a 2-fold increase in tocopherol concentrations. Cauliflower mosaic virus35S-mediated overexpression of CHLSYN unexpectedly caused a cosuppression phenotype at high frequencies accompanied by strongly reduced chlorophyll content and increased tocopherol levels. This phenotype and the associated detection of CHLSYN-derived small interfering RNAs were reversed with CHLSYN overexpression in rna-directed rna polymerase6 (rdr6), which is defective in RNA-dependent RNA polymerase6, a key enzyme in sense transgene-induced small interfering RNA production. CHLSYN overexpression in rdr6 had little effect on chlorophyll content but resulted in up to a 30% reduction in tocopherol levels in leaves. These findings show that altered CHLSYN expression impacts tocopherol levels and also, show a strong epigenetic surveillance of CHLSYN to control chlorophyll and tocopherol synthesis. © 2015 American Society of

  6. [Effect of adaptation to hypoxia on expression of NO synthase isoforms in rat myocardium].

    Science.gov (United States)

    Goryacheva, A V; Terekhina, O L; Abramochkin, D V; Budanova, O P; Belkina, L M; Smirin, B V; Downey, H F; Malyshev, I Yu; Manukhina, E B

    2015-01-01

    Previously we have shown that adaptation to hypoxia (AH) is cardio- and vasoprotective in myocardial ischemic and reperfusion injury and this protection is associated with restriction of nitrosative stress. The present study was focused on further elucidation of NO-dependent mechanisms of AH by identifying specific NO synthases (NOS) that could play the major role in AH protection. AH was performed in a normobaric hypoxic chamber by breathing hypoxic gas mixture (9.5-10% O2) for 5-10 min with intervening 4 min normoxia (5-8 cycles daily for 21 days). Expression of neuronal (nNOS), inducible (iNOS), and endothelial (eNOS) protein was measured in the left ventricular myocardium using Western blot analysis with respective antibodies. AH educed iNOS protein expression by 71% (p < 0.05) whereas eNOS protein expression tended to be reduced by 41% compared to control (p < 0.05). nNOS protein expression remained unchanged after AH. Selective iNOS inhibition can mimic the AH-induced protection. Therefore protective effects of AH could be at least partially due to restriction of iNOS and, probably, eNOS expression.

  7. Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.

    Science.gov (United States)

    Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M

    2008-07-01

    Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

  8. Effect of quercetin on metallothionein, nitric oxide synthases and cyclooxygenase-2 expression on experimental chronic cadmium nephrotoxicity in rats

    International Nuclear Information System (INIS)

    Morales, Ana I.; Vicente-Sanchez, Cesar; Jerkic, Mirjana; Santiago, Jose M.; Sanchez-Gonzalez, Penelope D.; Perez-Barriocanal, Fernando; Lopez-Novoa, Jose M.

    2006-01-01

    Inflammation can play a key role in Cd-induced dysfunctions. Quercetin is a potent oxygen free radical scavenger and a metal chelator. Our aim was to study the effect of quercetin on Cd-induced kidney damage and metallothionein expression. The study was performed in Wistar rats that were administered during 9 weeks with either cadmium (1.2 mg Cd/kg/day, s.c.), quercetin (50 mg/kg/day, i.p.) or cadmium + quercetin. Renal toxicity was evaluated by measuring blood urea nitrogen concentration and urinary excretion of enzymes marker of tubular damage. Endothelial nitric oxide synthase (eNOS), inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) renal expression were assessed by Western blot. Renal expression of metallothionein 1 and 2 (MT-1, MT-2) and eNOS mRNA was assessed by Northern blot. Our data demonstrated that Cd-induced renal toxicity was markedly reduced in rats that also received quercetin. MT-1 and MT-2 mRNA levels in kidney were substantially increased during treatment with Cd, being even higher when the animals received Cd and quercetin. Renal eNOS expression was significantly higher in rats receiving Cd and quercetin than in animals receiving Cd alone or in control rats. In the group that received Cd, COX-2 and iNOS expression was markedly higher than in control rats. In the group Cd + quercetin, no changes in COX-2 and iNOS expression were observed compared with the control group. Our results demonstrate that quercetin treatment prevents Cd-induced overexpression of iNOS and COX-2, and increases MT expression. These effects can explain the protection by quercetin of Cd-induced nephrotoxicity

  9. A single center, open, randomized study investigating the clinical safety and the endothelial modulating effects of a prostacyclin analog in combination with eptifibatide in patients having undergone primary percutaneous coronary intervention (PCI) for ST-segment elevation myocardial infarction

    DEFF Research Database (Denmark)

    Holmvang, Lene; Ostrowski, Sisse Rye; Dridi, Nadia Paarup

    2012-01-01

    Treatment with the endothelial modulator prostacyclin may be beneficial in patients with endothelial dysfunction. The primary aim of the present pilot study was to evaluate the safety and the potential endothelial modulating affect of the prostacyclin analog iloprost in patients with a recent ST ...

  10. Recombinant expression of a functional myo-inositol-1-phosphate synthase (MIPS) in Mycobacterium smegmatis.

    Science.gov (United States)

    Huang, Xinyi; Hernick, Marcy

    2015-10-01

    Myo-inositol-1-phosphate synthase (MIPS, E.C. 5.5.1.4) catalyzes the first step in inositol production-the conversion of glucose-6-phosphate (Glc-6P) to myo-inositol-1-phosphate. While the three dimensional structure of MIPS from Mycobacterium tuberculosis has been solved, biochemical studies examining the in vitro activity have not been reported to date. Herein we report the in vitro activity of mycobacterial MIPS expressed in E. coli and Mycobacterium smegmatis. Recombinant expression in E. coli yields a soluble protein capable of binding the NAD(+) cofactor; however, it has no significant activity with the Glc-6P substrate. In contrast, recombinant expression in M. smegmatis mc(2)4517 yields a functionally active protein. Examination of structural data suggests that MtMIPS expressed in E. coli adopts a fold that is missing a key helix containing two critical (conserved) Lys side chains, which likely explains the inability of the E. coli expressed protein to bind and turnover the Glc-6P substrate. Recombinant expression in M. smegmatis may yield a protein that adopts a fold in which this key helix is formed enabling proper positioning of important side chains, thereby allowing for Glc-6P substrate binding and turnover. Detailed mechanistic studies may be feasible following optimization of the recombinant MIPS expression protocol in M. smegmatis.

  11. Generation and Functional Evaluation of Designer Monoterpene Synthases.

    Science.gov (United States)

    Srividya, N; Lange, I; Lange, B M

    2016-01-01

    Monoterpene synthases are highly versatile enzymes that catalyze the first committed step in the pathways toward terpenoids, the structurally most diverse class of plant natural products. Recent advancements in our understanding of the reaction mechanism have enabled engineering approaches to develop mutant monoterpene synthases that produce specific monoterpenes. In this chapter, we are describing protocols to introduce targeted mutations, express mutant enzyme catalysts in heterologous hosts, and assess their catalytic properties. Mutant monoterpene synthases have the potential to contribute significantly to synthetic biology efforts aimed at producing larger amounts of commercially attractive monoterpenes. © 2016 Elsevier Inc. All rights reserved.

  12. Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

    Directory of Open Access Journals (Sweden)

    Ro Dae-Kyun

    2009-07-01

    Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

  13. Expression of Clarkia S-linalool synthase in transgenic petunia plant results in the accumulation of S-linalyl-b-D-glucopyranoside

    NARCIS (Netherlands)

    Lücker, J.; Bouwmeester, H.J.; Schwab, W.; Blaas, J.; Plas, van der L.H.W.; Verhoeven, H.A.

    2001-01-01

    Petunia hybrida W115 was transformed with a Clarkia breweri S-linalool synthase cDNA (lis). Lis was expressed in all tissues analysed, and linalool was detected in leaves, sepals, corolla, stem and ovary, but not in nectaries, roots, pollen and style. However, the S-linalool produced by the plant in

  14. Dynamic modulation of thymidylate synthase gene expression and fluorouracil sensitivity in human colorectal cancer cells.

    Directory of Open Access Journals (Sweden)

    Kentaro Wakasa

    Full Text Available Biomarkers have revolutionized cancer chemotherapy. However, many biomarker candidates are still in debate. In addition to clinical studies, a priori experimental approaches are needed. Thymidylate synthase (TS expression is a long-standing candidate as a biomarker for 5-fluorouracil (5-FU treatment of cancer patients. Using the Tet-OFF system and a human colorectal cancer cell line, DLD-1, we first constructed an in vitro system in which TS expression is dynamically controllable. Quantitative assays have elucidated that TS expression in the transformant was widely modulated, and that the dynamic range covered 15-fold of the basal level. 5-FU sensitivity of the transformant cells significantly increased in response to downregulated TS expression, although being not examined in the full dynamic range because of the doxycycline toxicity. Intriguingly, our in vitro data suggest that there is a linear relationship between TS expression and the 5-FU sensitivity in cells. Data obtained in a mouse model using transformant xenografts were highly parallel to those obtained in vitro. Thus, our in vitro and in vivo observations suggest that TS expression is a determinant of 5-FU sensitivity in cells, at least in this specific genetic background, and, therefore, support the possibility of TS expression as a biomarker for 5-FU-based cancer chemotherapy.

  15. Influence of thymidylate synthase expression on survival in patients with colorectal cancer

    Directory of Open Access Journals (Sweden)

    Kinjal K Gajjar

    2017-01-01

    Full Text Available Background: Thymidylate synthase (TS plays a critical role in nucleotide metabolism and is an important target for 5-fluorouracil (5-FU, the standard chemotherapeutic drug for treatment of colorectal cancer (CRC. Aims and Methods: The present study aimed to evaluate TS variable number tandem repeat sequences (VNTR polymorphism by polymerase chain reaction and TS protein expression by immunohistochemistry and its association with clinicopathological parameters in untreated CRC patients (n = 100. Further, the prognostic and predictive role of TS has been evaluated. Results: For TS VNTR polymorphism, the observed frequencies of 2R/2R, 2R/3R, and 3R/3R genotypes were 22%, 51%, and 27%, respectively. When immunohistochemical localization was studied, cytoplasmic staining for TS was observed in 70% of patients. A significant inverse correlation was noted between TS protein expression and tumor, node, metastasis staging (P = 0.027, Dukes' staging (P = 0.039, and lymph node status (P = 0.012 of CRC patients. However, there was no significant correlation between TS VNTR polymorphism and TS protein expression. On survival analysis, a significantly shorter overall survival (OS was seen in CRC patients with negative protein expression (P = 0.031. Moreover, the subgroup of CRC patients treated only with surgery also showed a trend of poor OS in patients with negative TS protein expression (P = 0.058. However, neither TS polymorphism nor its protein expression was able to predict relapse-free survival. Conclusion: Negative TS protein expression may be related to unfavorable clinical outcome in CRC patients. However, further studies in a larger set of patients are necessary to better assess TS as a prognostic and predictive marker for 5-FU response in CRC patients.

  16. Cytidine triphosphate synthase activity and mRNA expression in normal human blood cells

    NARCIS (Netherlands)

    Verschuur, A. C.; van Gennip, A. H.; Muller, E. J.; Voûte, P. A.; Vreken, P.; van Kuilenburg, A. B.

    1999-01-01

    Cytidine triphosphate (CTP) synthase is one of the key enzymes in pyrimidine nucleotide anabolic pathways. The activity of this enzyme is elevated in various malignancies including acute lymphocytic leukemia (ALL). In this study we investigated the activity of CTP synthase in various human blood

  17. Nitric oxide synthase-I containing cortical interneurons co-express antioxidative enzymes and anti-apoptotic Bcl-2 following focal ischemia: evidence for direct and indirect mechanisms towards their resistance to neuropathology.

    Science.gov (United States)

    Bidmon, H J; Emde, B; Kowalski, T; Schmitt, M; Mayer, B; Kato, K; Asayama, K; Witte, O W; Zilles, K

    2001-09-01

    Neuronal nitric oxide-I is constitutively expressed in approximately 2% of cortical interneurons and is co-localized with gamma-amino butric acid, somatostatin or neuropeptide Y. These interneurons additionally express high amounts of glutamate receptors which mediate the glutamate-induced hyperexcitation following cerebral injury, under these conditions nitric oxide production increases contributing to a potentiation of oxidative stress. However, perilesional nitric oxide synthase-I containing neurons are known to be resistant to ischemic and excitotoxic injury. In vitro studies show that nitrosonium and nitroxyl ions inactivate N-methyl-D-aspartate receptors, resulting in neuroprotection. The question remains of how these cells are protected against their own high intracellular nitric oxide production after activation. In this study, we investigated immunocytochemically nitric oxide synthase-I containing cortical neurons in rats after unilateral, cortical photothrombosis. In this model of focal ischemia, perilesional, constitutively nitric oxide synthase-I containing neurons survived and co-expressed antioxidative enzymes, such as manganese- and copper-zinc-dependent superoxide dismutases, heme oxygenase-2 and cytosolic glutathione peroxidase. This enhanced antioxidant expression was accompanied by a strong perinuclear presence of the antiapoptotic Bcl-2 protein. No colocalization was detectable with upregulated heme oxygenase-1 in glia and the superoxide and prostaglandin G(2)-producing cyclooxygenase-2 in neurons. These results suggest that nitric oxide synthase-I containing interneurons are protected against intracellular oxidative damage and apoptosis by Bcl-2 and several potent antioxidative enzymes. Since nitric oxide synthase-I positive neurons do not express superoxide-producing enzymes such as cyclooxygenase-1, xanthine oxidase and cyclooxygenase-2 in response to injury, this may additionally contribute to their resistance by reducing their internal

  18. Cyclooxygenase 2 and neuronal nitric oxide synthase expression in the renal cortex are not interdependent in states of salt deficiency

    DEFF Research Database (Denmark)

    Castrop, H; Kammerl, M; Mann, Birgitte

    2000-01-01

    Neuronal nitric oxide synthase (nNOS) and cyclooxygenase-2 (COX-2) expression in the kidney are localized to the cortical thick ascending limb of the loop of Henle (cTALH), including the macula region, and increase after salt restriction. Because of the similar localization and regulation of n...... excretion. These findings suggest that under these conditions the control of nNOS and COX-2 gene expression in the macula densa regions of the kidney cortex are not dependent on each other....

  19. Chlorophyll Synthase under Epigenetic Surveillance Is Critical for Vitamin E Synthesis, and Altered Expression Affects Tocopherol Levels in Arabidopsis1[OPEN

    Science.gov (United States)

    Zhang, Chunyu; Zhang, Wei; Ren, Guodong; Li, Delin; Cahoon, Rebecca E.; Chen, Ming; Zhou, Yongming; Yu, Bin

    2015-01-01

    Chlorophyll synthase catalyzes the final step in chlorophyll biosynthesis: the esterification of chlorophyllide with either geranylgeranyl diphosphate or phytyl diphosphate (PDP). Recent studies have pointed to the involvement of chlorophyll-linked reduction of geranylgeranyl by geranylgeranyl reductase as a major pathway for the synthesis of the PDP precursor of tocopherols. This indirect pathway of PDP synthesis suggests a key role of chlorophyll synthase in tocopherol production to generate the geranylgeranyl-chlorophyll substrate for geranylgeranyl reductase. In this study, contributions of chlorophyll synthase to tocopherol formation in Arabidopsis (Arabidopsis thaliana) were explored by disrupting and altering expression of the corresponding gene CHLOROPHYLL SYNTHASE (CHLSYN; At3g51820). Leaves from the homozygous chlysyn1-1 null mutant were nearly devoid of tocopherols, whereas seeds contained only approximately 25% of wild-type tocopherol levels. Leaves of RNA interference lines with partial suppression of CHLSYN displayed marked reductions in chlorophyll but up to a 2-fold increase in tocopherol concentrations. Cauliflower mosaic virus35S-mediated overexpression of CHLSYN unexpectedly caused a cosuppression phenotype at high frequencies accompanied by strongly reduced chlorophyll content and increased tocopherol levels. This phenotype and the associated detection of CHLSYN-derived small interfering RNAs were reversed with CHLSYN overexpression in rna-directed rna polymerase6 (rdr6), which is defective in RNA-dependent RNA polymerase6, a key enzyme in sense transgene-induced small interfering RNA production. CHLSYN overexpression in rdr6 had little effect on chlorophyll content but resulted in up to a 30% reduction in tocopherol levels in leaves. These findings show that altered CHLSYN expression impacts tocopherol levels and also, show a strong epigenetic surveillance of CHLSYN to control chlorophyll and tocopherol synthesis. PMID:26048882

  20. Calcium-mediated signaling and calmodulin-dependent kinase regulate hepatocyte-inducible nitric oxide synthase expression.

    Science.gov (United States)

    Zhang, Baochun; Crankshaw, Will; Nesemeier, Ryan; Patel, Jay; Nweze, Ikenna; Lakshmanan, Jaganathan; Harbrecht, Brian G

    2015-02-01

    Induced nitric oxide synthase (iNOS) is induced in hepatocytes by shock and inflammatory stimuli. Excessive NO from iNOS mediates shock-induced hepatic injury and death, so understanding the regulation of iNOS will help elucidate the pathophysiology of septic shock. In vitro, cytokines induce iNOS expression through activation of signaling pathways including mitogen-activated protein kinases and nuclear factor κB. Cytokines also induce calcium (Ca(2+)) mobilization and activate calcium-mediated intracellular signaling pathways, typically through activation of calmodulin-dependent kinases (CaMK). Calcium regulates NO production in macrophages but the role of calcium and calcium-mediated signaling in hepatocyte iNOS expression has not been defined. Primary rat hepatocytes were isolated, cultured, and induced to produce NO with proinflammatory cytokines. Calcium mobilization and Ca(2+)-mediated signaling were altered with ionophore, Ca(2+) channel blockers, and inhibitors of CaMK. The Ca(2+) ionophore A23187 suppressed cytokine-stimulated NO production, whereas Ethylene glycol tetraacetic acid and nifedipine increased NO production, iNOS messenger RNA, and iNOS protein expression. Inhibition of CaMK with KN93 and CBD increased NO production but the calcineurin inhibitor FK 506 decreased iNOS expression. These data demonstrate that calcium-mediated signaling regulates hepatocyte iNOS expression and does so through a mechanism independent of calcineurin. Changes in intracellular calcium levels may regulate iNOS expression during hepatic inflammation induced by proinflammatory cytokines. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Upregulation of cyclooxygenase-2 expression in porcine macula densa with chronic nitric oxide synthase inhibition.

    Science.gov (United States)

    Kommareddy, M; McAllister, R M; Ganjam, V K; Turk, J R; Laughlin, M Harold

    2011-11-01

    The objective of this study was to investigate the effects of chronic inhibition of nitric oxide synthase (NOS) on cyclooxygenase-2 (COX-2) expression in the macula densa (MD) of swine, as well as the effects on expression of related proteins. Adult female Yucatan swine were given either tap water (control, n = 6) or water with N (G)-nitro-L-arginine methyl ester (L-NAME, 100 mg/liter, n = 5) for a minimum of 30 days. Duplicate samples of kidney were fixed or snap frozen. There was a significant (P = .0082) upregulation of COX-2 mRNA expression in the MD of L-NAME, as well as an apparent increase in COX-2 protein. Plasma renin activity also increased with L-NAME treatment (control, 0.34 ± 0.08 ng/ml; L-NAME, 1.26 ± 0.03 ng/ml; P = .00000003). There were no differences between groups in expression of either inducible NOS or renin protein or in serum electrolyte concentrations. In conclusion, with chronic inhibition of NOS, COX-2 in MD is upregulated, perhaps to compensate for loss of nitric oxide. Increases in COX-2 products may counteract renal arteriolar constriction and sustain renin release.

  2. Canine placental prostaglandin E2 synthase: expression, localization, and biological functions in providing substrates for prepartum PGF2alpha synthesis.

    Science.gov (United States)

    Gram, Aykut; Fox, Barbara; Büchler, Urs; Boos, Alois; Hoffmann, Bernd; Kowalewski, Mariusz P

    2014-12-01

    The prepartum output of PGF2alpha in the bitch is associated with increased placental PGE2-synthase (PTGES) mRNA levels. Contrasting with this is a decreased expression of PGF2alpha-synthase (PGFS/AKR1C3) in uteroplacental compartments during prepartum luteolysis, suggesting an involvement of alternative synthetic pathways in PGF2alpha synthesis, for example, conversion of PGE2 to PGF2alpha. However, because the expression and possible functions of the respective PTGES proteins remained unknown, no further conclusion could be drawn. Therefore, a canine-specific PTGES antibody was generated and used to investigate the expression, cellular localization, and biochemical activities of canine uteroplacental PTGES throughout pregnancy and at prepartum luteolysis. Additionally, the biochemical activities of these tissues involved in the conversion of PGE2 to PGF2alpha were investigated. The endometrial PTGES was localized in the uterine surface epithelium at preimplantation and in superficial and deep uterine glands, endothelial cells, and myometrium throughout pregnancy and at parturition. Placental signals were mostly in the trophoblast. The biochemical properties of recombinant PTGES protein were confirmed. Additionally, expression of two PGE2-receptors, PTGER2/EP2 and PTGER4/EP4, revealed their decreasing expression during luteolysis. In contrast, the uteroplacental expression of prostaglandin transporter (PGT) was strongly elevated prior to parturition. These localization patterns resembled that of PTGES. The increased expression of PTGES and PGT at parturition, together with the accompanying decreased levels of PGE2-receptors and the capability of canine uterine and placental homogenates to take part in the conversion of PGE2 to PGF2alpha, as found in this study, suggest that PGE2 could be used locally as a substrate for prepartum PGF2alpha synthesis in the dog. © 2014 by the Society for the Study of Reproduction, Inc.

  3. SUMO-fusion, purification, and characterization of a (+)-zizaene synthase from Chrysopogon zizanioides

    International Nuclear Information System (INIS)

    Hartwig, S.; Frister, T.; Alemdar, S.; Li, Z.; Scheper, T.; Beutel, S.

    2015-01-01

    An uncharacterized plant cDNA coding for a polypeptide presumably having sesquiterpene synthase activity, was expressed in soluble and active form. Two expression strategies were evaluated in Escherichia coli. The enzyme was fused to a highly soluble SUMO domain, in addition to being produced in an unfused form by a cold-shock expression system. Yields up to ∼325 mg/L −1 were achieved in batch cultivations. The 6x-His-tagged enzyme was purified employing an Ni 2+ -IMAC-based procedure. Identity of the protein was established by Western Blot analysis as well as peptide mass fingerprinting. A molecular mass of 64 kDa and an isoelectric point of pI 4.95 were determined by 2D gel electrophoresis. Cleavage of the fusion domain was possible by digestion with specific SUMO protease. The synthase was active in Mg 2+ containing buffer and catalyzed the production of (+)-zizaene (syn. khusimene), a precursor of khusimol, from farnesyl diphosphate. Product identity was confirmed by GC–MS and comparison of retention indices. Enzyme kinetics were determined by measuring initial reaction rates for the product, using varying substrate concentrations. By assuming a Michaelis–Menten model, kinetic parameters of K M  = 1.111 μM (±0.113), v max  = 0.3245 μM min −1 (±0.0035), k cat  = 2.95 min −1 , as well as a catalytic efficiency k cat /K M  = 4.43 × 10 4  M −1 s −1 were calculated. Fusion to a SUMO moiety can substantially increase soluble expression levels of certain hard to express terpene synthases in E. coli. The kinetic data determined for the recombinant synthase are comparable to other described plant sesquiterpene synthases and in the typical range of enzymes belonging to the secondary metabolism. This leaves potential for optimizing catalytic parameters through methods like directed evolution. - Highlights: • Uncharacterized (+)-zizaene synthase from C. zizanoides was cloned and expressed. • Fusion to SUMO and cold-shock induction

  4. SUMO-fusion, purification, and characterization of a (+)-zizaene synthase from Chrysopogon zizanioides

    Energy Technology Data Exchange (ETDEWEB)

    Hartwig, S.; Frister, T.; Alemdar, S.; Li, Z.; Scheper, T.; Beutel, S., E-mail: beutel@iftc.uni-hannover.de

    2015-03-20

    An uncharacterized plant cDNA coding for a polypeptide presumably having sesquiterpene synthase activity, was expressed in soluble and active form. Two expression strategies were evaluated in Escherichia coli. The enzyme was fused to a highly soluble SUMO domain, in addition to being produced in an unfused form by a cold-shock expression system. Yields up to ∼325 mg/L{sup −1} were achieved in batch cultivations. The 6x-His-tagged enzyme was purified employing an Ni{sup 2+}-IMAC-based procedure. Identity of the protein was established by Western Blot analysis as well as peptide mass fingerprinting. A molecular mass of 64 kDa and an isoelectric point of pI 4.95 were determined by 2D gel electrophoresis. Cleavage of the fusion domain was possible by digestion with specific SUMO protease. The synthase was active in Mg{sup 2+} containing buffer and catalyzed the production of (+)-zizaene (syn. khusimene), a precursor of khusimol, from farnesyl diphosphate. Product identity was confirmed by GC–MS and comparison of retention indices. Enzyme kinetics were determined by measuring initial reaction rates for the product, using varying substrate concentrations. By assuming a Michaelis–Menten model, kinetic parameters of K{sub M} = 1.111 μM (±0.113), v{sub max} = 0.3245 μM min{sup −1} (±0.0035), k{sub cat} = 2.95 min{sup −1}, as well as a catalytic efficiency k{sub cat}/K{sub M} = 4.43 × 10{sup 4} M{sup −1} s{sup −1} were calculated. Fusion to a SUMO moiety can substantially increase soluble expression levels of certain hard to express terpene synthases in E. coli. The kinetic data determined for the recombinant synthase are comparable to other described plant sesquiterpene synthases and in the typical range of enzymes belonging to the secondary metabolism. This leaves potential for optimizing catalytic parameters through methods like directed evolution. - Highlights: • Uncharacterized (+)-zizaene synthase from C. zizanoides was cloned

  5. Air pollution alters brain and pituitary endothelin-1 and inducible nitric oxide synthase gene expression.

    Science.gov (United States)

    Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud

    2007-10-01

    Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.

  6. Developmental evolution of flowering plant pollen tube cell walls: callose synthase (CalS gene expression patterns

    Directory of Open Access Journals (Sweden)

    Abercrombie Jason M

    2011-07-01

    Full Text Available Abstract Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan walls and septae (callose plugs of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS. Of 12 CalS gene family members in Arabidopsis, only one (CalS5 has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5 (Nymphaeales. Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression

  7. Cloning, expression, purification, crystallization and preliminary X-ray crystallographic study of molybdopterin synthase from Thermus thermophilus HB8

    International Nuclear Information System (INIS)

    Kanaujia, Shankar Prasad; Ranjani, Chellamuthu Vasuki; Jeyakanthan, Jeyaraman; Ohmori, Miwa; Agari, Kazuko; Kitamura, Yoshiaki; Baba, Seiki; Ebihara, Akio; Shinkai, Akeo; Kuramitsu, Seiki; Shiro, Yoshitsugu; Sekar, Kanagaraj; Yokoyama, Shigeyuki

    2007-01-01

    The molybdopterin synthase from T. thermophilus HB8 was cloned, expressed, purified and crystallized. The crystals belong to space group P2 1 and diffracted to a resolution of 1.64 Å. Thermus thermophilus is a Gram-negative aerobic thermophilic eubacterium which can grow at temperatures ranging from 323 to 355 K. In addition to their importance in thermostability or adaptation strategies for survival at high temperatures, the thermostable enzymes in thermophilic organisms contribute to a wide range of biotechnological applications. The molybdenum cofactor in all three kingdoms consists of a tricyclic pyranopterin termed molybdopterin that bears the cis-dithiolene group responsible for molybdenum ligation. The crystals of molybdopterin synthase from T. thermophilus HB8 belong to the primitive monoclinic space group P2 1 , with unit-cell parameters a = 33.94, b = 103.32, c = 59.59 Å, β = 101.3°. Preliminary studies and molecular-replacement calculations reveal the presence of three monomers in the asymmetric unit

  8. Expression of Cyclic GMP-AMP Synthase in Patients With Systemic Lupus Erythematosus.

    Science.gov (United States)

    An, Jie; Durcan, Laura; Karr, Reynold M; Briggs, Tracy A; Rice, Gillian I; Teal, Thomas H; Woodward, Joshua J; Elkon, Keith B

    2017-04-01

    Type I interferon (IFN) is implicated in the pathogenesis of systemic lupus erythematosus (SLE) and interferonopathies such as Aicardi-Goutières syndrome. A recently discovered DNA-activated type I IFN pathway, cyclic GMP-AMP synthase (cGAS), has been linked to Aicardi-Goutières syndrome and mouse models of lupus. The aim of this study was to determine whether the cGAS pathway contributes to type I IFN production in patients with SLE. SLE disease activity was measured by the Safety of Estrogens in Lupus Erythematosus National Assessment version of the Systemic Lupus Erythematosus Disease Activity Index. Expression of messenger RNA for cGAS and IFN-stimulated genes (ISGs) was determined by quantitative polymerase chain reaction analysis. Cyclic GMP-AMP (cGAMP) levels were examined by multiple reaction monitoring with ultra-performance liquid chromatography tandem mass spectrometry. Expression of cGAS in peripheral blood mononuclear cells (PBMCs) was significantly higher in SLE patients than in normal controls (n = 51 and n = 20 respectively; P < 0.01). There was a positive correlation between cGAS expression and the IFN score (P < 0.001). The expression of cGAS in PBMCs showed a dose response to type I IFN stimulation in vitro, consistent with it being an ISG. Targeted measurement of cGAMP by tandem mass spectrometry detected cGAMP in 15% of the SLE patients (7 of 48) but none of the normal (0 of 19) or rheumatoid arthritis (0 of 22) controls. Disease activity was higher in SLE patients with cGAMP versus those without cGAMP. Increased cGAS expression and cGAMP in a proportion of SLE patients indicates that the cGAS pathway should be considered as a contributor to type I IFN production. Whereas higher cGAS expression may be a consequence of exposure to type I IFN, detection of cGAMP in patients with increased disease activity indicates potential involvement of this pathway in disease expression. © 2016, American College of Rheumatology.

  9. In vivo inhibition of the mitochondrial H+-ATP synthase in neurons promotes metabolic preconditioning.

    Science.gov (United States)

    Formentini, Laura; Pereira, Marta P; Sánchez-Cenizo, Laura; Santacatterina, Fulvio; Lucas, José J; Navarro, Carmen; Martínez-Serrano, Alberto; Cuezva, José M

    2014-04-01

    A key transducer in energy conservation and signaling cell death is the mitochondrial H(+)-ATP synthase. The expression of the ATPase inhibitory factor 1 (IF1) is a strategy used by cancer cells to inhibit the activity of the H(+)-ATP synthase to generate a ROS signal that switches on cellular programs of survival. We have generated a mouse model expressing a mutant of human IF1 in brain neurons to assess the role of the H(+)-ATP synthase in cell death in vivo. The expression of hIF1 inhibits the activity of oxidative phosphorylation and mediates the shift of neurons to an enhanced aerobic glycolysis. Metabolic reprogramming induces brain preconditioning affording protection against quinolinic acid-induced excitotoxicity. Mechanistically, preconditioning involves the activation of the Akt/p70S6K and PARP repair pathways and Bcl-xL protection from cell death. Overall, our findings provide the first in vivo evidence highlighting the H(+)-ATP synthase as a target to prevent neuronal cell death.

  10. Cloning and expression analysis of two dehydrodolichyl diphosphate synthase genes from Tripterygium wilfordii

    Directory of Open Access Journals (Sweden)

    Lin-Hui Gao

    2018-01-01

    Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.

  11. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

    Directory of Open Access Journals (Sweden)

    Bua-In Saowaluck

    2014-01-01

    Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

  12. Pu-erh Tea Reduces Nitric Oxide Levels in Rats by Inhibiting Inducible Nitric Oxide Synthase Expression through Toll-Like Receptor 4

    Science.gov (United States)

    Xu, Yang; Wang, Guan; Li, Chunjie; Zhang, Min; Zhao, Hang; Sheng, Jun; Shi, Wei

    2012-01-01

    Pu-erh tea undergoes a unique fermentation process and contains theabrownins, polysaccharides and caffeine; although it is unclear about which component is associated with the down regulation of nitric oxide levels or how this process is mediated. To address this question we examined the effects of pu-erh tea on nitric oxide synthase (NOS) genes. Cohorts of rats were separately given four-week treatments of water as control, pu-erh tea, or the tea components: theabrownins, caffeine or polysaccharides. Five experimental groups were injected with lipopolysaccharides (LPS) to induce nitric oxide (NO) production, while the corresponding five control groups were injected with saline as a negative control. The serum and liver NO concentrations were examined and the NOS expression of both mRNA and protein was measured in liver. The results showed that the rats which were fed pu-erh tea or polysaccharides had lower levels of NO which corresponded with the down-regulation of inducible nitric oxide synthase (iNOS) expression. We further demonstrate that this effect is mediated through reduction of Toll-like receptor 4 (TLR4) signaling. Thus we find that the polysaccharide components in pu-erh tea reduce NO levels in an animal model by inhibiting the iNOS expression via signaling through TLR4. PMID:22837686

  13. Artichoke, Cynarin and Cyanidin Downregulate the Expression of Inducible Nitric Oxide Synthase in Human Coronary Smooth Muscle Cells

    OpenAIRE

    Ning Xia; Andrea Pautz; Ursula Wollscheid; Gisela Reifenberg; Ulrich Förstermann; Huige Li

    2014-01-01

    Artichoke (Cynara scolymus L.) is one of the world’s oldest medicinal plants with multiple health benefits. We have previously shown that artichoke leaf extracts and artichoke flavonoids upregulate the gene expression of endothelial-type nitric oxide synthase (eNOS) in human endothelial cells. Whereas NO produced by the eNOS is a vasoprotective molecule, NO derived from the inducible iNOS plays a pro-inflammatory role in the vasculature. The present study was aimed to investigate the effects ...

  14. Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2

    Directory of Open Access Journals (Sweden)

    Bhubalan, K.

    2010-01-01

    Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.

  15. Vasodilatory effect of asafoetida essential oil on rat aorta rings: The role of nitric oxide, prostacyclin, and calcium channels.

    Science.gov (United States)

    Esmaeili, Hassan; Sharifi, Mozhdeh; Esmailidehaj, Mansour; Rezvani, Mohammad Ebrahim; Hafizibarjin, Zeynab

    2017-12-01

    Asafoetida is an oleo-gum resin mainly obtained from Ferula assa-foetida L. species in the apiaceae family. Previous studies have shown that it has antispasmodic effects on rat's and pig's ileums. The main goals of this study were to assess the vasodilatory effect of asafoetida essential oil (AEO) on the contractile response of rat's aorta rings and to find the role of nitric oxide, cyclooxygenase, and calcium channels. Thoracic aorta rings were stretched under a steady-state tension of 1 g in an organ bath apparatus for 1 h and then precontracted by KCl (80 mM) in the presence and absence of AEO. L-NAME (blocker of nitric oxide synthase) and indomethacin (blocker of cyclooxygenase) were used to assess the role of nitric oxide (NO) and prostacyclin in the vasodilatory effect of AEO. Also, the effect of AEO on the influx of calcium through the cell membrane calcium channels was determined. Data showed that AEO had vasodilatory effects on aorta rings with both intact (IC 50  = 1.6 µl/l) or denuded endothelium (IC 50  = 19.2 µl/l) with a significantly higher potency in intact endothelium rings. The vasodilatory effects of AEO were reduced, but not completely inhibited, in the presence of L-NAME or indomethacin. Adding AEO to the free-calcium medium also significantly reduced the CaCl 2 -induced contractions. The results indicated that AEO has a potent vasodilatory effect that is endothelium-dependent and endothelium-independent. Also, it reduced the influx of calcium into the cell through plasma membrane calcium channels. Copyright © 2017 Elsevier GmbH. All rights reserved.

  16. Valencene synthase from the heartwood of Nootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene.

    Science.gov (United States)

    Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk

    2014-02-01

    Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  17. Insight into Biochemical Characterization of Plant Sesquiterpene Synthases

    DEFF Research Database (Denmark)

    Manczak, Tom; Simonsen, Henrik Toft

    2016-01-01

    A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along...... with reduced reagent usage, it allows further reduction in the use of radioactive isotopes and flammable organic solvents. The sesquiterpene synthases previously characterized were expressed in yeast, and the plant-derived Thapsia garganica kunzeaol synthase TgTPS2 was tested in this method. KM for TgTPS2...... was found to be 0.55 μM; the turnover number, kcat, was found to be 0.29 s-1, kcat for TgTPS2 is in agreement with that of terpene synthases of other plants, and kcat/KM was found to be 0.53 s-1 μM-1 for TgTPS2. The kinetic parameters were in agreement with previously published data....

  18. Characterization of D-myo-inositol 3-phosphate synthase gene expression in two soybean low phytate mutants

    International Nuclear Information System (INIS)

    Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua

    2013-01-01

    1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)

  19. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

  20. [Effects of cytosolic bacteria on cyclic GMP-AMP synthase expression in human gingival tissues and periodontal ligament cells].

    Science.gov (United States)

    Xiaojun, Yang; Yongmei, Tan; Zhihui, Tian; Ting, Zhou; Wanghong, Zhao; Jin, Hou

    2017-04-01

    This work aims to determine the effect of cytosolic bacteria on the expression of cyclic GMP-AMP synthase (cGAS) in human periodontal ligament cells (hPDLCs) and gingival tissues. The ability of Porphyromonas gingivalis (P. gingivalis) to invade hPDLCs was detected using laser scanning confocal microscope assay at a multiplicity of infection of 10. P. gingivalis-infected cells were sorted by fluorescence-activated cell sorting (FACS). Then, quantitative real time reverse transcription polymerase chain reaction (qRT-PCR) and Western blot were used to detect cGAS expression in infected cells. Finally, the location and expression of cGAS in inflammatory and normal gingival tissues were investigated by immunohistochemistry. P. gingivalis actively invaded hPDLCs. Moreover, cGAS expression significantly increased in P. gingivalis-infected cells. Although cGAS was expressed in the epithelial and subepithelial cells of both inflamed and normal gingival tissues, cGAS expression significantly increased in inflamed gingival tissues. Cytosolic bacteria can upregulate cGAS expression in infected cells. These data suggest that cGAS may act as pattern-recognition receptors and participate in recognizing cytosolic nucleic acid pathogen-associated molecular patterns.
.

  1. Crystallization and preliminary crystallographic analysis of latent, active and recombinantly expressed aurone synthase, a polyphenol oxidase, from Coreopsis grandiflora

    Energy Technology Data Exchange (ETDEWEB)

    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette, E-mail: annette.rompel@univie.ac.at [Universität Wien, Althanstrasse 14, 1090 Wien (Austria)

    2015-05-22

    Latent and active aurone synthase purified from petals of C. grandiflora (cgAUS1) were crystallized. The crystal quality of recombinantly expressed latent cgAUS1 was significantly improved by co-crystallization with the polyoxotungstate Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase-separation zone. Aurone synthase (AUS), a member of a novel group of plant polyphenol oxidases (PPOs), catalyzes the oxidative conversion of chalcones to aurones. Two active cgAUS1 (41.6 kDa) forms that differed in the level of phosphorylation or sulfation as well as the latent precursor form (58.9 kDa) were purified from the petals of Coreopsis grandiflora. The differing active cgAUS1 forms and the latent cgAUS1 as well as recombinantly expressed latent cgAUS1 were crystallized, resulting in six different crystal forms. The active forms crystallized in space groups P2{sub 1}2{sub 1}2{sub 1} and P12{sub 1}1 and diffracted to ∼1.65 Å resolution. Co-crystallization of active cgAUS1 with 1,4-resorcinol led to crystals belonging to space group P3{sub 1}21. The crystals of latent cgAUS1 belonged to space group P12{sub 1}1 and diffracted to 2.50 Å resolution. Co-crystallization of recombinantly expressed pro-AUS with the hexatungstotellurate(VI) salt Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase separation zone significantly improved the quality of the crystals compared with crystals obtained without hexatungstotellurate(VI)

  2. Altering the expression of two chitin synthase genes differentially affects the growth and morphology of Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hjort, C.M.; Hansen, K.

    2002-01-01

    In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...

  3. A chemically stable analogue, 9 beta-methyl carbacyclin, with similar effects to epoprostenol (prostacyclin, PGI2) in man.

    OpenAIRE

    O'Grady, J; Hedges, A; Whittle, B J; Al-Sinawi, L A; Mekki, Q A; Burke, C; Moody, S G; Moti, M J; Hassan, S

    1984-01-01

    The effects of 9 beta-methyl carbacyclin, a chemically stable analogue of epoprostenol (prostacyclin, PGI2) were studied, in comparison with epoprostenol, both in vitro and in vivo in man. In vitro 9 beta-methyl carbacyclin and epoprostenol inhibited platelet aggregation induced by ADP, collagen, the endoperoxide analogue U46619 and arachidonic acid. The potency of 9 beta-methyl carbacyclin relative to epoprostenol was comparable in ADP and collagen-aggregated platelet rich plasma (PRP), 9 be...

  4. Riboflavin accumulation and characterization of cDNAs encoding lumazine synthase and riboflavin synthase in bitter melon (Momordica charantia).

    Science.gov (United States)

    Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un

    2012-12-05

    Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.

  5. Genome-wide analysis of the grapevine stilbene synthase multigenic family: genomic organization and expression profiles upon biotic and abiotic stresses

    Directory of Open Access Journals (Sweden)

    Vannozzi Alessandro

    2012-08-01

    Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be

  6. Differential accumulation of β-carotene and tissue specific expression of phytoene synthase (MaPsy) gene in banana (Musa sp) cultivars.

    Science.gov (United States)

    Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika

    2017-12-01

    An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.

  7. Expression, purification, crystallization and preliminary X-ray diffraction analysis of dihydrodipicolinate synthase from Bacillus anthracis in the presence of pyruvate

    International Nuclear Information System (INIS)

    Voss, Jarrod E.; Scally, Stephen W.; Taylor, Nicole L.; Dogovski, Con; Alderton, Malcolm R.; Hutton, Craig A.; Gerrard, Juliet A.; Parker, Michael W.; Dobson, Renwick C. J.; Perugini, Matthew A.

    2009-01-01

    Dihydrodipicolinate synthase (DHDPS) catalyses an important step in lysine biosynthesis. Here, the expression, purification, crystallization and preliminary diffraction analysis to 2.15 Å resolution of DHDPS from B. anthracis soaked with the substrate pyruvate are reported. Dihydrodipicolinate synthase (DHDPS) catalyses the first committed step in the lysine-biosynthesis pathway in bacteria, plants and some fungi. In this study, the expression of DHDPS from Bacillus anthracis (Ba-DHDPS) and the purification of the recombinant enzyme in the absence and presence of the substrate pyruvate are described. It is shown that DHDPS from B. anthracis purified in the presence of pyruvate yields greater amounts of recombinant enzyme with more than 20-fold greater specific activity compared with the enzyme purified in the absence of substrate. It was therefore sought to crystallize Ba-DHDPS in the presence of the substrate. Pyruvate was soaked into crystals of Ba-DHDPS prepared in 0.2 M sodium fluoride, 20%(w/v) PEG 3350 and 0.1 M bis-tris propane pH 8.0. Preliminary X-ray diffraction data of the recombinant enzyme soaked with pyruvate at a resolution of 2.15 Å are presented. The pending crystal structure of the pyruvate-bound form of Ba-DHDPS will provide insight into the function and stability of this essential bacterial enzyme

  8. Pathological Lesions and Inducible Nitric Oxide Synthase Expressions in the Liver of Mice Experimentally Infected with Clonorchis sinensis.

    Science.gov (United States)

    Yang, Qing-Li; Shen, Ji-Qing; Xue, Yan; Cheng, Xiao-Bing; Jiang, Zhi-Hua; Yang, Yi-Chao; Chen, Ying-Dan; Zhou, Xiao-Nong

    2015-12-01

    The nitric oxide (NO) formation and intrinsic nitrosation may be involved in the possible mechanisms of liver fluke-associated carcinogenesis. We still do not know much about the responses of inducible NO synthase (iNOS) induced by Clonorchis sinensis infection. This study was conducted to explore the pathological lesions and iNOS expressions in the liver of mice with different infection intensity levels of C. sinensis. Extensive periductal inflammatory cell infiltration, bile duct hyperplasia, and fibrosis were commonly observed during the infection. The different pathological responses in liver tissues strongly correlated with the infection intensity of C. sinensis. Massive acute spotty necrosis occurred in the liver parenchyma after a severe infection. The iNOS activity in liver tissues increased, and iNOS-expressing cells with morphological differences were observed after a moderate or severe infection. The iNOS-expressing cells in liver tissues had multiple origins.

  9. Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

    NARCIS (Netherlands)

    Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H

    2004-01-01

    The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

  10. Plasmodium falciparum avoids change in erythrocytic surface expression of phagocytosis markers during inhibition of nitric oxide synthase activity

    DEFF Research Database (Denmark)

    Hempel, Casper; Kohnke, Hannes; Maretty, Lasse

    2014-01-01

    Nitric oxide (NO) accumulates in Plasmodium falciparum-infected erythrocytes. It may be produced by a parasite NO synthase (NOS) or by nitrate reduction. The parasite's benefit of NO accumulation is not understood. We investigated if inhibiting the P. falciparum NOS with specific and unspecific NOS...... increased the fraction of phosphatidyl serine exposing cells significantly. The infection did not change the level of expression of neither total CD47 nor its oxidized form. Unrelated to NOS inhibition, incubation with caveolin-1 scaffolding domain peptide lead to a decrease in oxidized CD47. In conclusion...

  11. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  12. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    International Nuclear Information System (INIS)

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-01-01

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  13. Structural Basis of Catalysis in the Bacterial Monoterpene Synthases Linalool Synthase and 1,8-Cineole Synthase

    OpenAIRE

    Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.

    2017-01-01

    Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...

  14. Expression, purification and preliminary crystallographic analysis of sucrose phosphate synthase (SPS) from Halothermothrix orenii

    International Nuclear Information System (INIS)

    Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.

    2004-01-01

    The first crystallographic study of a sucrose phosphate synthase from H. orenii, an organism that is both thermophilic and halophilic, is reported. The protein crystal diffracts X-rays to 3.01 Å. This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure

  15. Effects of cavernous nerve reconstruction on expression of nitric oxide synthase isoforms in rats.

    Science.gov (United States)

    Schlenker, Boris; Matiasek, Kaspar; Saur, Dieter; Gratzke, Christian; Bauer, Ricarda M; Herouy, Yared; Arndt, Christian; Blesch, Armin; Hartung, Rudolf; Stief, Christian G; Weidner, Norbert; May, Florian

    2010-12-01

    To evaluate the expression of nitric oxide synthase (NOS) isoforms after various reconstruction techniques in rats, to improve the understanding of neuronal repair mechanisms after radical prostatectomy, as Schwann cell-seeded guidance tubes have been shown to promote cavernous nerve regeneration, and glial cell-line-derived neurotrophic factor (GDNF)-overexpressing Schwann cells enhance nerve regenerative capacity. Segments (5 mm) of the cavernous nerve were excised bilaterally, followed by immediate bilateral microsurgical reconstruction. In four rats per group, the eight nerves were reconstructed by autologous nerve grafting (A), interposition of Schwann cell-seeded silicon tubes (B), or silicon tubes seeded with GDNF-hypersecreting Schwann cells (C). Further rats were either sham-operated (D) or had nerve excision without repair (E). Erectile function was evaluated after 6 weeks by re-laparotomy, electrical nerve stimulation and morphological evaluation of reconstructed nerves. NOS isoform mRNA expression was analysed by reverse transcription-polymerase chain reaction in tissue specimens taken from the corpora cavernosa. GDNF-transduced Schwann cell grafts restored erectile function better than untransduced Schwann cell and autologous nerve grafts (88% vs 75% vs 38%; not significant). Tissue specimens in group C had the highest expression of neuronal NOS mRNA in relation to the neuronal marker PGP9.5 among all treatment groups (not significant). Compared to nerve grafts (A) and negative controls (E) nNOS/PGP9.5 expression was significantly higher (P Schwann cell grafts (P < 0.05). Restoration of erectile function is paralleled by an increase of neuronal NOS expression in rats. Further experiments will determine the physiological role of neuronal NOS in erectile nerve repair processes. © 2010 THE AUTHORS. JOURNAL COMPILATION © 2010 BJU INTERNATIONAL.

  16. Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum.

    Science.gov (United States)

    Flynn, Christopher M; Schmidt-Dannert, Claudia

    2018-06-01

    The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide

  17. Circulating prostacyclin metabolites in the dog

    International Nuclear Information System (INIS)

    Taylor, B.M.; Shebuski, R.J.; Sun, F.F.

    1983-01-01

    The present study was designed to determine the concentration of prostacyclin (PGI2) metabolites in the blood of the dog. After a bolus i.v. dose of [11 beta- 3 H]PGI2 (5 micrograms/kg) into each of five dogs, blood samples were withdrawn at 0.33, 0.67, 1, 3, 5, 20, 30, 60 and 120 min postdrug administration. Plasma samples were extracted and the radioactive components were analyzed by two-dimensional thin-layer chromatography with autoradiofluorography and radio-high-performance liquid chromatography. The compounds were identified by comparing their mobility with synthetic standards; only parallel responses observed in both tests constituted positive identification. Seven metabolites were identified by these two techniques: 6-keto-prostaglandin (PG)F1 alpha; 6-keto-PGE1; 2,3-dinor-6-keto-PGF 1 alpha; 2,3-dinor-13,14-dihydro-6,15-diketo-20-carboxyl PGF 1 alpha; and 2,3,18,19-tetranor-13,14-dihydro-6,15-diketo-20-carboxyl PGF 1 alpha. Several additional compounds, both polar and nonpolar in nature, which did not co-chromatograph with any of our standards were also detected. Early samples consisted predominantly of 6-keto-PGF 1 alpha and other 20-carbon metabolites. By 30 min, the predominant metabolites were the 16- and 18-carbon dicarboxylic acids. By 60 min, 85% of the radioactivity was associated with two unidentified polar compounds. The evidence suggests that 6-keto-PGF 1 alpha probably reflects only the transient levels of freshly entering PGI2 in the circulation, whereas levels of the most polar metabolites (e.g., dihydro-diketo-carboxyl tetranor-PGF 2 alpha) may be a better measure of the overall PGI2 presence due to its longer half-life in circulation

  18. Opposite effect of oxidative stress on inducible nitric oxide synthase and haem oxygenase-1 expression in intestinal inflammation: anti-inflammatory effect of carbon monoxide

    NARCIS (Netherlands)

    Dijkstra, Gerard; Blokzijl, Hans; Bok, Lisette; Homan, Manon; van Goor, Harry; Faber, Klaas Nico; Jansen, Peter L. M.; Moshage, Han

    2004-01-01

    Inducible nitric oxide synthase (iNOS) is expressed in intestinal epithelial cells (IEC) of patients with active inflammatory bowel disease (IBD) and in IEC of endotoxaemic rats. The induction of iNOS in IEC is an element of the NF-kappaB-mediated survival pathway. Haem oxygenase-1 (HO-1) is an

  19. Nitric oxide synthase 2 (NOS2) expression in histologically normal margins of oral squamous cell carcinoma.

    Science.gov (United States)

    Morelatto, Rosana; Itoiz, María-Elina; Guiñazú, Natalia; Piccini, Daniel; Gea, Susana; López-de Blanc, Silvia

    2014-05-01

    The activity of Nitric Oxide Synthase 2 (NOS2) was found in oral squamous cell carcinomas (OSCC) but not in normal mucosa. Molecular changes associated to early carcinogenesis have been found in mucosa near carcinomas, which is considered a model to study field cancerization. The aim of the present study is to analyze NOS2 expression at the histologically normal margins of OSCC. Eleven biopsy specimens of OSCC containing histologically normal margins (HNM) were analyzed. Ten biopsies of normal oral mucosa were used as controls. The activity of NOS2 was determined by immunohistochemistry. Salivary nitrate and nitrite as well as tobacco and alcohol consumption were also analyzed. The Chi-squared test was applied. Six out of the eleven HNM from carcinoma samples showed positive NOS2 activity whereas all the control group samples yielded negative (p=0.005). No statistically significant association between enzyme expression and tobacco and/or alcohol consumption and salivary nitrate and nitrite was found. NOS2 expression would be an additional evidence of alterations that may occur in a state of field cancerization before the appearance of potentially malignant morphological changes.

  20. HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.

    Science.gov (United States)

    PORRA, R J; ROSS, B D

    1965-03-01

    1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.

  1. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  2. Increased expressions of ADAMTS-13, neuronal nitric oxide synthase, and neurofilament correlate with severity of neuropathology in Border disease virus-infected small ruminants.

    Directory of Open Access Journals (Sweden)

    Gungor Cagdas Dincel

    Full Text Available Border Disease (BD, caused by Pestivirus from the family Flaviviridae, leads to serious reproductive losses and brain anomalies such as hydranencephaly and cerebellar hypoplasia in aborted fetuses and neonatal lambs. In this report it is aimed to investigate the expression of neuronal nitric oxide synthase (nNOS, A Disintegrin And Metalloprotease with Thrombospondin type I repeats-13 (ADAMTS-13, and neurofilament (NF in the brain tissue in small ruminants infected with Border Disease Virus (BDV and to identify any correlation between hypomyelinogenesis and BD neuropathology. Results of the study revealed that the levels of ADAMTS-13 (p<0.05, nNOS (p<0.05, and NF (p<0.05 were remarkably higher in BDV-infected brain tissue than in the uninfected control. It was suggested that L-arginine-NO synthase pathway is activated after infection by BDV and that the expression of NF and nNOS is associated with the severity of BD. A few studies have focused on ADAMTS-13 expression in the central nervous system, and its function continues to remain unclear. The most prominent finding from our study was that ADAMTS-13, which contain two CUB domains, has two CUB domains and its high expression levels are probably associated with the development of the central nervous system (CNS. The results also clearly indicate that the interaction of ADAMTS-13 and NO may play an important role in the regulation and protection of the CNS microenvironment in neurodegenerative diseases. In addition, NF expression might indicate the progress of the disease. To the best of the authors'knowledge, this is the first report on ADAMTS-13 expression in the CNS of BDV-infected small ruminants.

  3. Expression, Purification, and Characterisation of Dehydroquinate Synthase from Pyrococcus furiosus

    Directory of Open Access Journals (Sweden)

    Leonardo Negron

    2011-01-01

    Full Text Available Dehydroquinate synthase (DHQS catalyses the second step of the shikimate pathway to aromatic compounds. DHQS from the archaeal hyperthermophile Pyrococcus furiosus was insoluble when expressed in Escherichia coli but was partially solubilised when KCl was included in the cell lysis buffer. A purification procedure was developed, involving lysis by sonication at 30∘C followed by a heat treatment at 70∘C and anion exchange chromatography. Purified recombinant P. furiosus DHQS is a dimer with a subunit Mr of 37,397 (determined by electrospray ionisation mass spectrometry and is active over broad pH and temperature ranges. The kinetic parameters are KM (3-deoxy-D-arabino-heptulosonate 7-phosphate 3.7 μM and kcat 3.0 sec-1 at 60∘C and pH 6.8. EDTA inactivates the enzyme, and enzyme activity is restored by several divalent metal ions including (in order of decreasing effectiveness Cd2+, Co2+, Zn2+, and Mn2+. High activity of a DHQS in the presence of Cd2+ has not been reported for enzymes from other sources, and may be related to the bioavailability of Cd2+ for P. furiosus. This study is the first biochemical characterisation of a DHQS from a thermophilic source. Furthermore, the characterisation of this hyperthermophilic enzyme was carried out at elevated temperatures using an enzyme-coupled assay.

  4. Ceramide synthases expression and role of ceramide synthase-2 in the lung: insight from human lung cells and mouse models.

    Directory of Open Access Journals (Sweden)

    Irina Petrache

    Full Text Available Increases in ceramide levels have been implicated in the pathogenesis of both acute or chronic lung injury models. However, the role of individual ceramide species, or of the enzymes that are responsible for their synthesis, in lung health and disease has not been clarified. We now show that C24- and C16-ceramides are the most abundant lung ceramide species, paralleled by high expression of their synthetic enzymes, ceramide synthase 2 (CerS2 and CerS5, respectively. Furthermore, the ceramide species synthesis in the lung is homeostatically regulated, since mice lacking very long acyl chain C24-ceramides due to genetic deficiency of CerS2 displayed a ten-fold increase in C16-ceramides and C16-dihydroceramides along with elevation of acid sphingomyelinase and CerS5 activities. Despite relatively preserved total lung ceramide levels, inhibition of de novo sphingolipid synthesis at the level of CerS2 was associated with significant airflow obstruction, airway inflammation, and increased lung volumes. Our results suggest that ceramide species homeostasis is crucial for lung health and that CerS2 dysfunction may predispose to inflammatory airway and airspace diseases.

  5. Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

    Science.gov (United States)

    Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

    2013-12-01

    Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Testosterone improves erectile function through inhibition of reactive oxygen species generation in castrated rats

    Directory of Open Access Journals (Sweden)

    Rui Li

    2016-05-01

    Full Text Available Testosterone is overwhelmingly important in regulating erectile physiology. However, the associated molecular mechanisms are poorly understood. The purpose of this study was to explore the effects and mechanisms of testosterone in erectile dysfunction (ED in castrated rats. Forty male Sprague-Dawley rats were randomized to four groups (control, sham-operated, castration and castration-with-testosterone-replacement. Reactive oxygen species (ROS production was measured by dihydroethidium (DHE staining. Erectile function was assessed by the recording of intracavernous pressure (ICP and mean arterial blood pressure (MAP. Protein expression levels were examined by western blotting. We found that castration reduced erectile function and that testosterone restored it. Nitric oxide synthase (NOS activity was decrease in the castrated rats, and testosterone administration attenuated this decrease (each p < 0.05. The testosterone, dihydrotestosterone, cyclic guanosine monophosphate (cGMP and cyclic adenosine monophosphate (cAMP concentrations were lower in the castrated rats, and testosterone restored these levels (each p < 0.05. Furthermore, the cyclooxygenase-2 (COX-2 and prostacyclin synthase (PTGIS expression levels and phospho-endothelial nitric oxide synthase (p-eNOS, Ser1177/endothelial nitric oxide synthase (eNOS ratio were reduced in the castrated rats compared with the controls (each p < 0.05. In addition, the p40phox and p67phox expression levels were increased in the castrated rats, and testosterone reversed these changes (each p < 0.05. Overall, our results demonstrate that testosterone ameliorates ED after castration by reducing ROS production and increasing the activity of the eNOS/cGMP and COX-2/PTGIS/cAMP signaling pathways.

  7. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1) in Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.)

    OpenAIRE

    Bua-In Saowaluck; Paisooksantivatana Yingyong; Weimer Bart C.; Chowpongpang Srimek

    2014-01-01

    Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.) is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant an...

  8. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)

    2017-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  9. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  10. Distinct UV-B and UV-A/blue light signal transduction pathways induce chalcone synthase gene expression in Arabidopsis cells

    International Nuclear Information System (INIS)

    Christie, J.M.; Jenkins, G.I.

    1996-01-01

    UV and blue light control the expression of flavonoid biosynthesis genes in a range of higher plants. To investigate the signal transduction processes involved in the induction of chalcone synthase (CHS) gene expression by UV-B and UV-A/blue light, we examined the, effects of specific agonists and inhibitors of known signaling components in mammalian systems in a photomixotrophic Arabidopsis cell suspension culture. CHS expression is induced specifically by these wavelengths in the cell culture, in a manner similar to that in mature Arabidopsis leaf tissue. Both the UV-B and UV-A/blue phototransduction processes involve calcium, although the elevation of cytosolic calcium is insufficient on its own to stimulate CHS expression. The UV-A/blue light induction of CHS expression does not appear to involve calmodulin, whereas the UV-B response does; this difference indicates that the signal transduction pathways are, at least in part, distinct. We provide evidence that both pathways involve reversible protein phosphorylation and require protein synthesis. The UV-B and UV-A/blue light signaling pathways are therefore different from the phytochrome signal transduction pathway regulating CHS expression in other species

  11. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    OpenAIRE

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

  12. Effects of Chinese yellow wine on nitric oxide synthase and intercellular adhesion molecule-1 expressions in rat vascular endothelial cells.

    Science.gov (United States)

    Zhao, Fei; Ji, Zheng; Chi, Jufang; Tang, Weiliang; Zhai, Xiaoya; Meng, Liping; Guo, Hangyuan

    2016-02-01

    The objective of this study was to determine similarities in the effect of yellow wine as compared to statin and the possibility that yellow wine inhibits tumour necrosis factor-α (TNF-α)-induced nitric oxide (NO) synthesis, endothelial nitric oxide synthase (eNOS), inducible nitric oxide synthase (iNOS), and intercellular adhesion molecule-1 (ICAM-1) in cultured rat vascular endothelial cells (VECs). We isolated VECs, and cultivated and purified Sprague Dawley (SD) rat thoracic aortas in vitro. We selected the optimal wine concentration using clonogenic and MTT assays to measure cell survival. Next, we divided the cells into 9 groups: (1) control, (2) TNF-α, (3) TNF-α + rosuvastatin (10 μmol/L), (4) TNF-α + ethanol 0.5%, (5) TNF-α + yellow wine 0.5%, (6) TNF-α + ethanol 1.0%, (7) TNF-α + yellow wine 1.0%, (8) TNF-α + ethanol 1.5%, and (9) TNF-α + yellow wine 1.5% and they were given the corresponding treatment for 24 h. We determined NO production with nitrate reductase. We then measured eNOS activity, and detected eNOS, iNOS, and ICAM-1 protein levels by Western blotting. Compared with the TNF-α group, NO production, eNOS activity, and eNOS protein expression in the rosuvastatin, and yellow wine 1.0%, and 1.5% groups were significantly increased. Protein expression of iNOS and ICAM-1 in the rosuvastatin, yellow wine 1.0%, and 1.5% groups were significantly decreased. Compared with the rosuvastatin group, eNOS, iNOS, and ICAM-1 protein expression in the yellow wine (0.5% -1.5%) groups were significantly different. Treatment with yellow wine increased NO production, eNOS activity, and eNOS protein expression, which decreases iNOS and ICAM-1 protein expression. We conclude that yellow wine may have similar beneficial effects as rosuvastatin on the cardiovascular system. These effects may be attributed to their anti-atherosclerotic actions.

  13. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

    Science.gov (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

    2017-01-01

    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  14. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Directory of Open Access Journals (Sweden)

    Smrati Mishra

    Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  15. Identification of a Fungal 1,8-Cineole Synthase from Hypoxylon sp. with Specificity Determinants in Common with the Plant Synthases*

    Science.gov (United States)

    Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.

    2015-01-01

    Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891

  16. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  17. Genome-Wide Identification, Evolutionary and Expression Analyses of the GALACTINOL SYNTHASE Gene Family in Rapeseed and Tobacco

    Directory of Open Access Journals (Sweden)

    Yonghai Fan

    2017-12-01

    Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.

  18. Studies on the Active Site of Deacetoxycephalosporin C Synthase

    NARCIS (Netherlands)

    Lloyd, Matthew D.; Lee, Hwei-Jen; Harlos, Karl; Zhang, Zhi-Hong; Baldwin, Jack E.; Schofield, Christopher J.; Charnock, John M.; Garner, C. David; Hara, Takane; Terwisscha van Scheltinga, Anke C.; Valegård, Karin; Viklund, Jenny A.C.; Hajdu, Janos; Andersson, Inger; Danielsson, Åke; Bhikhabhai, Rama

    1999-01-01

    The Fe(II) and 2-oxoglutarate-dependent dioxygenase deacetoxycephalosporin C synthase (DAOCS) from Streptomyces clavuligerus was expressed at ca 25% of total soluble protein in Escherichia coli and purified by an efficient large-scale procedure. Purified protein catalysed the conversions of

  19. The expression, purification, crystallization and preliminary X-ray analysis of a subcomplex of the peripheral stalk of ATP synthase from bovine mitochondria

    International Nuclear Information System (INIS)

    Silvester, Jocelyn A.; Kane Dickson, Veronica; Runswick, Michael J.; Leslie, Andrew G. W.; Walker, John E.

    2006-01-01

    A recombinant subcomplex of the peripheral stalk or stator domain of the ATP synthase from bovine mitochondria has been crystallized and a native data set has been collected to 2.8 Å resolution. A subcomplex of the peripheral stalk or stator domain of the ATP synthase from bovine mitochondria has been expressed to high levels in a soluble form in Escherichia coli. The subcomplex consists of residues 79–184 of subunit b, residues 1–124 of subunit d and the entire F 6 subunit (76 residues). It has been purified and crystallized by vapour diffusion. The morphology and diffraction properties of the crystals of the subcomplex were improved by the presence of thioxane or 4-methylpyridine in the crystallization liquor. With a synchrotron-radiation source, these crystals diffracted to 2.8 Å resolution. They belong to the monoclinic space group P2 1

  20. Molecular cloning and functional characterization of three terpene synthases from unripe fruit of black pepper (Piper nigrum).

    Science.gov (United States)

    Jin, Zhehao; Kwon, Moonhyuk; Lee, Ah-Reum; Ro, Dae-Kyun; Wungsintaweekul, Juraithip; Kim, Soo-Un

    2018-01-15

    To identify terpene synthases (TPS) responsible for the biosynthesis of the sesquiterpenes that contribute to the characteristic flavors of black pepper (Piper nigrum), unripe peppercorn was subjected to the Illumina transcriptome sequencing. The BLAST analysis using amorpha-4,11-diene synthase as a query identified 19 sesquiterpene synthases (sesqui-TPSs), of which three full-length cDNAs (PnTPS1 through 3) were cloned. These sesqui-TPS cDNAs were expressed in E. coli to produce recombinant enzymes for in vitro assays, and also expressed in the engineered yeast strain to assess their catalytic activities in vivo. PnTPS1 produced β-caryophyllene as a main product and humulene as a minor compound, and thus was named caryophyllene synthase (PnCPS). Likewise, PnTPS2 and PnTPS3 were, respectively, named cadinol/cadinene synthase (PnCO/CDS) and germacrene D synthase (PnGDS). PnGDS expression in yeast yielded β-cadinene and α-copaene, the rearrangement products of germacrene D. Their k cat /K m values (20-37.7 s -1  mM -1 ) were comparable to those of other sesqui-TPSs. Among three PnTPSs, the transcript level of PnCPS was the highest, correlating with the predominant β-caryophyllene biosynthesis in the peppercorn. The products and rearranged products of three PnTPSs could account for about a half of the sesquiterpenes in number found in unripe peppercorn. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Minocycline attenuates experimental colitis in mice by blocking expression of inducible nitric oxide synthase and matrix metalloproteinases

    International Nuclear Information System (INIS)

    Huang, T.-Y.; Chu, H.-C.; Lin, Y.-L.; Lin, C.-K.; Hsieh, T.-Y.; Chang, W.-K.; Chao, Y.-C.; Liao, C.-L.

    2009-01-01

    In addition to its antimicrobial activity, minocycline exerts anti-inflammatory effects in several disease models. However, whether minocycline affects the pathogenesis of inflammatory bowel disease has not been determined. We investigated the effects of minocycline on experimental colitis and its underlying mechanisms. Acute and chronic colitis were induced in mice by treatment with dextran sulfate sodium (DSS) or trinitrobenzene sulfonic acid (TNBS), and the effect of minocycline on colonic injury was assessed clinically and histologically. Prophylactic and therapeutic treatment of mice with minocycline significantly diminished mortality rate and attenuated the severity of DSS-induced acute colitis. Mechanistically, minocycline administration suppressed inducible nitric oxide synthase (iNOS) expression and nitrotyrosine production, inhibited proinflammatory cytokine expression, repressed the elevated mRNA expression of matrix metalloproteinases (MMPs) 2, 3, 9, and 13, diminished the apoptotic index in colonic tissues, and inhibited nitric oxide production in the serum of mice with DSS-induced acute colitis. In DSS-induced chronic colitis, minocycline treatment also reduced body weight loss, improved colonic histology, and blocked expression of iNOS, proinflammatory cytokines, and MMPs from colonic tissues. Similarly, minocycline could ameliorate the severity of TNBS-induced acute colitis in mice by decreasing mortality rate and inhibiting proinflammatory cytokine expression in colonic tissues. These results demonstrate that minocycline protects mice against DSS- and TNBS-induced colitis, probably via inhibition of iNOS and MMP expression in intestinal tissues. Therefore, minocycline is a potential remedy for human inflammatory bowel diseases.

  2. An Arabidopsis callose synthase

    DEFF Research Database (Denmark)

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole

    2002-01-01

    in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....

  3. Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of SAICAR synthase from Streptococcus suis serotype 2

    International Nuclear Information System (INIS)

    Cheng, Xia; Lu, Guangwen; Qi, Jianxun; Cheng, Hao; Gao, Feng; Wang, Jundong; Yan, Jinghua

    2010-01-01

    Crystals of SAICAR synthase from S. suis serotype 2 were obtained in the presence of 40 mM aspartic acid substrate; they belonged to space group P2 and diffracted to 2.8 Å resolution. Phosphoribosylaminoimidazole-succinocarboxamide synthase (SAICAR synthase) plays an essential role in the de novo biosynthesis of purine nucleotides. In this study, the SAICAR synthase from Streptococcus suis was cloned and overexpressed in Escherichia coli. The subsequent product was purified and crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.8 Å resolution and belonged to space group P2, with unit-cell parameters a = 70.2, b = 52.2, c = 153.9 Å, β = 102.8°

  4. Geranylgeranyl diphosphate synthases from Scoparia dulcis and Croton sublyratus. cDNA cloning, functional expression, and conversion to a farnesyl diphosphate synthase.

    Science.gov (United States)

    Kojima, N; Sitthithaworn, W; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Sankaw, U

    2000-07-01

    cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene producing plants, Scoparia dulcis and Croton sublyratus, were isolated using the homology-based polymerase chain reaction method. Both cloned genes showed high amino acid sequence homology (60-70%) to other plant GGPPSs and contained highly conserved aspartate-rich motifs. The obtained clones were functionally expressed in Escherichia coli and showed sufficient GGPPS activity to catalyze the condensation of farnesyl diphosphate (FPP) and isopentenyl diphosphate to form geranylgeranyl diphosphate. To investigate the factor determining the product chain length of plant GGPPSs, S. dulcis GGPPS mutants in which either the small amino acids at the fourth and fifth positions before the first aspartate-rich motif (FARM) were replaced with aromatic amino acids or in which two additional amino acids in FARM were deleted were constructed. Both mutants behaved like FPPS-like enzymes and almost exclusively produced FPP when dimethylallyl diphosphate was used as a primer substrate, and failed to accept FPP as a primer substrate. These results indicate that both small amino acids at the fourth and fifth positions before FARM and the amino acid insertion in FARM play essential roles in product length determination in plant GGPPSs.

  5. Vasoconstrictor role of cyclooxygenase-1-mediated prostacyclin synthesis in non-insulin-dependent diabetic mice induced by high-fat diet and streptozotocin.

    Science.gov (United States)

    Zhu, Ningxia; Liu, Bin; Luo, Wenhong; Zhang, Yingzhan; Li, Hui; Li, Shasha; Zhou, Yingbi

    2014-08-01

    This study tested the hypothesis that in diabetic arteries, cyclooxygenase (COX)-1 mediates endothelial prostacyclin (PGI2) synthesis, which evokes vasoconstrictor activity under the pathological condition. Non-insulin-dependent diabetes was induced to C57BL/6 mice and those with COX-1 deficiency (COX-1(-/-) mice) using a high-fat diet in combination with streptozotocin injection. In vitro analyses were performed 3 mo after. Results showed that in diabetic aortas, the endothelial muscarinic receptor agonist ACh evoked an endothelium-dependent production of the PGI2 metabolite 6-keto-PGF1α, which was abolished in COX-1(-/-) mice. Meanwhile, COX-1 deficiency or COX-1 inhibition prevented vasoconstrictor activity in diabetic abdominal aortas, resulting in enhanced relaxation evoked by ACh. In a similar manner, COX-1 deficiency increased the relaxation evoked by ACh in nitric oxide synthase-inhibited diabetic renal arteries. Also, in diabetic abdominal aortas and/or renal arteries, both PGI2 and the COX substrate arachidonic acid evoked contractions similar to those of nondiabetic mice. However, the contraction to arachidonic acid, but not that to PGI2, was abolished in vessels from COX-1(-/-) mice. Moreover, we found that 3 mo after streptozotocin injection, systemic blood pressure increased in diabetic C57BL/6 mice but not in diabetic COX-1(-/-) mice. These results explicitly demonstrate that in the given arteries from non-insulin-dependent diabetic mice, COX-1 remains a major contributor to the endothelial PGI2 synthesis that evokes vasoconstrictor activity under the pathological condition. Also, our data suggest that COX-1 deficiency prevents or attenuates diabetic hypertension in mice, although this could be related to the loss of COX-1-mediated activities derived from both vascular and nonvascular tissues. Copyright © 2014 the American Physiological Society.

  6. The effect of inoculation with mycorrhizal arbuscular fungi on expression of limonene synthase in Mentha spicata L. genotypes

    Directory of Open Access Journals (Sweden)

    Leila Shabani

    2015-03-01

    Full Text Available Spearmint (Mentha spicata L. is an important economical and medicinal plant from Lamiaceae family, which has gained research attraction as a model for biosynthesis of essential oils due to its high capability for synthesis of monoterpenes. Limonene is a simple monoterpene and its biosynthesis is catalyzed by limonene synthase a key regulatory enzyme in the biosynthesis pathway of monoterpenes in spearmint plant. This study was concerned with the effect of colonization of roots with Funneliformis mosseae and F. etunicatum fungi on spearmint plant growth indices, leaf essential oils and changes in the expression of limonene synthase (LS gene. This study also explained the application of GADPH gene as the internal standard for real-time quantitative PCR (RTqPCR analysis of LS in spearmints. Our results showed that essential oil content of leaf in spearmint genotype Meybod inoculated with F. etunicatum was higher than that of genotypes from populations Kashan and Bojnourd and was 130% higher than the control. According to the results of this study, increase in transcript accumulation of the LS gene in leaves of spearmint plants inoculated with F. etunicatum was concordant with the increased essential oil contents and was dependent on the plant genotype.

  7. Impact of cardiac support device combined with slow-release prostacyclin agonist in a canine ischemic cardiomyopathy model.

    Science.gov (United States)

    Kubota, Yasuhiko; Miyagawa, Shigeru; Fukushima, Satsuki; Saito, Atsuhiro; Watabe, Hiroshi; Daimon, Takashi; Sakai, Yoshiki; Akita, Toshiaki; Sawa, Yoshiki

    2014-03-01

    The cardiac support device supports the heart and mechanically reduces left ventricular (LV) diastolic wall stress. Although it has been shown to halt LV remodeling in dilated cardiomyopathy, its therapeutic efficacy is limited by its lack of biological effects. In contrast, the slow-release synthetic prostacyclin agonist ONO-1301 enhances reversal of LV remodeling through biological mechanisms such as angiogenesis and attenuation of fibrosis. We therefore hypothesized that ONO-1301 plus a cardiac support device might be beneficial for the treatment of ischemic cardiomyopathy. Twenty-four dogs with induced anterior wall infarction were assigned randomly to 1 of 4 groups at 1 week postinfarction as follows: cardiac support device alone, cardiac support device plus ONO-1301 (hybrid therapy), ONO-1301 alone, or sham control. At 8 weeks post-infarction, LV wall stress was reduced significantly in the hybrid therapy group compared with the other groups. Myocardial blood flow, measured by positron emission tomography, and vascular density were significantly higher in the hybrid therapy group compared with the cardiac support device alone and sham groups. The hybrid therapy group also showed the least interstitial fibrosis, the greatest recovery of LV systolic and diastolic functions, assessed by multidetector computed tomography and cardiac catheterization, and the lowest plasma N-terminal pro-B-type natriuretic peptide levels (P < .05). The combination of a cardiac support device and the prostacyclin agonist ONO-1301 elicited a greater reversal of LV remodeling than either treatment alone, suggesting the potential of this hybrid therapy for the clinical treatment of ischemia-induced heart failure. Copyright © 2014 The American Association for Thoracic Surgery. Published by Mosby, Inc. All rights reserved.

  8. Cumulative inhibitory effect of low-dose aspirin on vascular prostacyclin and platelet thromboxane production in patients with atherosclerosis.

    Science.gov (United States)

    Weksler, B B; Tack-Goldman, K; Subramanian, V A; Gay, W A

    1985-02-01

    The relationship between the antithrombotic and antiplatelet effects of aspirin is complex, since aspirin influences other systems that protect against thrombosis as well as inhibiting platelet function. We investigated possible cumulative effects of low-dose aspirin on vascular production of prostacyclin in patients with documented atherosclerotic cardiovascular disease. Candidates for coronary artery vein graft bypass ingested 20 mg of aspirin daily during the week before surgery, and platelet aggregation, platelet formation of thromboxane A2 (TXA2), aortic and saphenous vein production of prostacyclin (PGI2), and hemostatic status were measured at the time of the bypass surgery. Low-dose aspirin markedly inhibited platelet aggregation responses and reduced TXA2 generation by greater than 90%, effects similar to those observed with much higher doses of aspirin. Both aortic and saphenous vein production of PGI2 were inhibited by 50% compared with PGI2 produced by vascular tissues of control subjects who received no aspirin preoperatively (51 +/- 10 pg 6-keto-PGF1 alpha/mg aortic wet weight [mean +/- SEM] in aspirin-treated subjects vs 130 +/- 16 pg/mg in control subjects, and 71 +/- 8 pg/mg saphenous vein wet weight vs 131 +/- 17 pg/mg). Blood loss at surgery was not significantly increased by preoperative low-dose aspirin as measured by chest tube drainage (754 +/- 229 ml in aspirin-treated subjects vs 645 +/- 271 ml in control subjects), hematocrit nadir (31.2 +/- 1.9% vs 31.8 +/- 1.7%), or transfusions (2.2 +/- 1.3 units of red blood cells vs 2.2 +/- 1.7 units).(ABSTRACT TRUNCATED AT 250 WORDS)

  9. Stimulation of prostacyclin synthesis in rats by phenobarbital treatment

    International Nuclear Information System (INIS)

    Pynadath, T.I.; Haghighi, A.Z.

    1986-01-01

    Prostacyclin (PGI 2 ), synthesized in the endothelial cells of arteries, is known to inhibit the aggregation of platelets and hence thrombosis in blood. Low levels of PGI 2 have been observed in coronary heart disease which is associated with low levels of HDL in blood. Recently, it has been shown that synthesis of PGI 2 in vitro, is stimulated by HDL. Hence it seems likely that higher level of HDL in blood would increase the level of PGI 2 in blood. Since phenobarbital treatment is known to increase blood HDL levels in humans and animals, this study was undertaken to determine the effect of phenobarbital treatment on the synthesis of PGI 2 . Coronary vascular microsomes were prepared from Sprague Dawley rats treated with phenobarbital for two days. The PGI 2 synthesizing activity was assayed by incubating these microsomes with 1- 14 C-arachidonic acid and by determining the 14 C-activity recovered in 6-ketoprostaglandin F/sub 1α/, the stable decomposition product of PGI 2 . Phenobarbital treatment increased the synthesis of PGI 2 nearly 2-fold. Addition of phenobarbital did not increase PGI 2 synthesis in control microsomes; however, the synthesis was increased by HDL. Thus, it appears that the observed increase in PGI 2 synthesis resulting from phenobarbital treatment was partly, if not totally, due to the increase in blood HDL level

  10. Immunohistochemical properties of the expression of endothelial nitric oxide synthase in placenta in its dysfunction in women with iron deficiency anemia

    Directory of Open Access Journals (Sweden)

    I. A. Ancheva

    2014-08-01

    Full Text Available Aim. The pertinence of the study is related to a large prevalence of dysfunction of the placenta in pregnant women suffering from anemia. To evaluate the immunohistochemical expression characteristics of endothelial NO-synthase (eNOS in the placenta during its dysfunction in women against the background of anemia 30 samples of placental tissue were studied with the use of immunohistochemical and micrometer methods. Materials and results. It was found that the expression of eNOS in patients with iron defi ciency anemia in the cytoplasm of syncytium of villi and fetal capillary endothelium as well as decidual vessels decreases, with the most pronounced changes in the expression of eNOS observed in the presence of the combination of placental dysfunction and iron defi ciency anemia in the form of paradoxical increase in expression. Conclusion. This indicates the necessity for correction of endothelial function in women with anemia during pregnancy.

  11. Distinct cell-specific expression of homospermidine synthase involved in pyrrolizidine alkaloid biosynthesis in three species of the boraginales.

    Science.gov (United States)

    Niemüller, Daniel; Reimann, Andreas; Ober, Dietrich

    2012-07-01

    Homospermidine synthase (HSS) is the first specific enzyme in pyrrolizidine alkaloid (PA) biosynthesis, a pathway involved in the plant's chemical defense. HSS has been shown to be recruited repeatedly by duplication of a gene involved in primary metabolism. Within the lineage of the Boraginales, only one gene duplication event gave rise to HSS. Here, we demonstrate that the tissue-specific expression of HSS in three boraginaceous species, Heliotropium indicum, Symphytum officinale, and Cynoglossum officinale, is unique with respect to plant organ, tissue, and cell type. Within H. indicum, HSS is expressed exclusively in nonspecialized cells of the lower epidermis of young leaves and shoots. In S. officinale, HSS expression has been detected in the cells of the root endodermis and in leaves directly underneath developing inflorescences. In young roots of C. officinale, HSS is detected only in cells of the endodermis, but in a later developmental stage, additionally in the pericycle. The individual expression patterns are compared with those within the Senecioneae lineage (Asteraceae), where HSS expression is reproducibly found in specific cells of the endodermis and the adjacent cortex parenchyma of the roots. The individual expression patterns within the Boraginales species are discussed as being a requirement for the successful recruitment of HSS after gene duplication. The diversity of HSS expression within this lineage adds a further facet to the already diverse patterns of expression that have been observed for HSS in other PA-producing plant lineages, making this PA-specific enzyme one of the most diverse expressed proteins described in the literature.

  12. The expression of inducible nitric oxide synthase (iNOS) in the testis and epididymis of rats with a dihydrotestosterone (DHT) deficiency.

    Science.gov (United States)

    Kolasa, Agnieszka; Marchlewicz, Mariola; Kurzawa, Rafał; Głabowski, Wojciech; Trybek, Grzegorz; Wenda-Rózewicka, Lidia; Wiszniewska, Barbara

    2009-01-01

    In our previous studies, we showed that a finasteride-induced DHT deficiency may cause changes in the morphology of the seminiferous epithelium without any morphological alteration of the epididymis. In this study, we demonstrated the constitutive immunoexpression of inducible nitric oxide synthase (iNOS) in the testis and epididymis of Wistar rats treated with finasteride for 28 days (the duration of two cycles of the seminiferous epithelium) and 56 days (the duration of one spermatogenesis). We noted that a 56-day finasteride treatment mainly caused a decrease in the level of circulating DHT, as well as a statistically insignificant decrease in the level of T. The hormone deficiency also led to a change in the iNOS immnoexpression in the testis and epididymis of the finasteride-treated rats. In vitro, DHT did not modify NO production by the epithelial cells of the caput epididymis even when stimulated with LPS and IFNgamma, but it did give rise to an increase in NO production by the epithelial cells of the cauda epididymis without the stimulation. DHT did not have a statistically significant influence on estradiol production by cultured, LPS- and IFNgamma-stimulated epithelial cells from the caput and cauda epididymis. In conclusion, our data clearly indicates that a finasterideinduced DHT deficiency intensifies the constitutive expression of iNOS in most rat testicular and epididymal cells, so it can be expected that the expression of inducible nitric oxide synthase (iNOS) could be regulated by DHT. On the other hand, the profile of the circulating DHT and T levels strongly suggests that the regulation of constitutive iNOS expression is complex and needs more detailed study.

  13. Glucose-Modulated Mitochondria Adaptation in Tumor Cells: A Focus on ATP Synthase and Inhibitor Factor 1

    Directory of Open Access Journals (Sweden)

    Irene Mavelli

    2012-02-01

    Full Text Available Warburg’s hypothesis has been challenged by a number of studies showing that oxidative phosphorylation is repressed in some tumors, rather than being inactive per se. Thus, treatments able to shift energy metabolism by activating mitochondrial pathways have been suggested as an intriguing basis for the optimization of antitumor strategies. In this study, HepG2 hepatocarcinoma cells were cultivated with different metabolic substrates under conditions mimicking “positive” (activation/biogenesis or “negative” (silencing mitochondrial adaptation. In addition to the expected up-regulation of mitochondrial biogenesis, glucose deprivation caused an increase in phosphorylating respiration and a rise in the expression levels of the ATP synthase β subunit and Inhibitor Factor 1 (IF1. Hyperglycemia, on the other hand, led to a markedly decreased level of the transcriptional coactivator PGC-α suggesting down-regulation of mitochondrial biogenesis, although no change in mitochondrial mass and no impairment of phosphorylating respiration were observed. Moreover, a reduction in mitochondrial networking and in ATP synthase dimer stability was produced. No effect on β-ATP synthase expression was elicited. Notably, hyperglycemia caused an increase in IF1 expression levels, but it did not alter the amount of IF1 associated with ATP synthase. These results point to a new role of IF1 in relation to high glucose utilization by tumor cells, in addition to its well known effect upon mitochondrial ATP synthase regulation.

  14. Expression of inducible nitric oxide synthase, caspase-3 and production of reactive oxygen intermediate on endothelial cells culture (HUVECs treated with P. falciparum infected erythrocytes and tumour necrosis factor-α

    Directory of Open Access Journals (Sweden)

    Loeki E. Fitri

    2006-09-01

    Full Text Available Cytoadherence of P. falciparum infected erythrocytes on endothelial cells is a key factor in development of severe malaria. This process may associated with the activation of local immune that was enhanced by tumour necrosis factor-α (TNF-α. This study was conducted to see the influence of P.falciparum infected erythrocytes cytoadherence and TNF-α treatment in inducing endothelial cells activation in vitro. inducible nitric oxide synthase (iNOS and caspase-3 expression, also reactive oxygen intermediate (ROI production were used as parameters. An Experimental laboratory study had been done to observe endothelial cells activation (HUVECs after treatment with TNF-α for 20 hours or P. falciparum infected erythrocytes for 1 hour or both of them. Normal endothelial cells culture had been used as a control. Using immunocytochemistry local immune activation of endothelial cells was determined by iNOS and caspase-3 expression. Nitro Blue Tetrazolium reduction-assay was conducted to see the ROI production semi quantitatively. inducible nitric oxide synthase expression only found on endothelial cells culture treated with P. falciparum infected erythrocytes or both P. falciparum infected erythrocytes and TNF-α. Caspase-3 expression found slightly on normal endothelial cells culture. This expression increased significantly on endothelial cells culture treated with both P.falciparum infected erythrocytes and TNF-α (p=0.000. The normal endothelial cells release low level of ROI in the presence of non-specific trigger, PMA. In the presence of P. falciparum infected erythrocytes or TNF-α or both of them, some cells showed medium to high levels of ROI. Cytoadherence of P. falciparum infected erythrocytes and TNF α treatment on endothelial cells can induce activation of local immune marked by increase inducible nitric oxide synthase and release of free radicals that cause cell damage. (Med J Indones 2006; 15:151-6 Keywords: P.falciparum ,HUVECs, TNF-α, i

  15. Neuronal expression of glucosylceramide synthase in central nervous system regulates body weight and energy homeostasis.

    Science.gov (United States)

    Nordström, Viola; Willershäuser, Monja; Herzer, Silke; Rozman, Jan; von Bohlen Und Halbach, Oliver; Meldner, Sascha; Rothermel, Ulrike; Kaden, Sylvia; Roth, Fabian C; Waldeck, Clemens; Gretz, Norbert; de Angelis, Martin Hrabě; Draguhn, Andreas; Klingenspor, Martin; Gröne, Hermann-Josef; Jennemann, Richard

    2013-01-01

    Hypothalamic neurons are main regulators of energy homeostasis. Neuronal function essentially depends on plasma membrane-located gangliosides. The present work demonstrates that hypothalamic integration of metabolic signals requires neuronal expression of glucosylceramide synthase (GCS; UDP-glucose:ceramide glucosyltransferase). As a major mechanism of central nervous system (CNS) metabolic control, we demonstrate that GCS-derived gangliosides interacting with leptin receptors (ObR) in the neuronal membrane modulate leptin-stimulated formation of signaling metabolites in hypothalamic neurons. Furthermore, ganglioside-depleted hypothalamic neurons fail to adapt their activity (c-Fos) in response to alterations in peripheral energy signals. Consequently, mice with inducible forebrain neuron-specific deletion of the UDP-glucose:ceramide glucosyltransferase gene (Ugcg) display obesity, hypothermia, and lower sympathetic activity. Recombinant adeno-associated virus (rAAV)-mediated Ugcg delivery to the arcuate nucleus (Arc) significantly ameliorated obesity, specifying gangliosides as seminal components for hypothalamic regulation of body energy homeostasis.

  16. Glycogen synthase from the parabasalian parasite Trichomonas vaginalis: An unusual member of the starch/glycogen synthase family.

    Science.gov (United States)

    Wilson, Wayne A; Pradhan, Prajakta; Madhan, Nayasha; Gist, Galen C; Brittingham, Andrew

    2017-07-01

    Trichomonas vaginalis, a parasitic protist, is the causative agent of the common sexually-transmitted infection trichomoniasis. The organism has long been known to synthesize substantial glycogen as a storage polysaccharide, presumably mobilizing this compound during periods of carbohydrate limitation, such as might be encountered during transmission between hosts. However, little is known regarding the enzymes of glycogen metabolism in T. vaginalis. We had previously described the identification and characterization of two forms of glycogen phosphorylase in the organism. Here, we measure UDP-glucose-dependent glycogen synthase activity in cell-free extracts of T. vaginalis. We then demonstrate that the TVAG_258220 open reading frame encodes a glycosyltransferase that is presumably responsible for this synthetic activity. We show that expression of TVAG_258220 in a yeast strain lacking endogenous glycogen synthase activity is sufficient to restore glycogen accumulation. Furthermore, when TVAG_258220 is expressed in bacteria, the resulting recombinant protein has glycogen synthase activity in vitro, transferring glucose from either UDP-glucose or ADP-glucose to glycogen and using both substrates with similar affinity. This protein is also able to transfer glucose from UDP-glucose or ADP-glucose to maltose and longer oligomers of glucose but not to glucose itself. However, with these substrates, there is no evidence of processivity and sugar transfer is limited to between one and three glucose residues. Taken together with our earlier work on glycogen phosphorylase, we are now well positioned to define both how T. vaginalis synthesizes and utilizes glycogen, and how these processes are regulated. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  17. Artichoke, Cynarin and Cyanidin Downregulate the Expression of Inducible Nitric Oxide Synthase in Human Coronary Smooth Muscle Cells

    Directory of Open Access Journals (Sweden)

    Ning Xia

    2014-03-01

    Full Text Available Artichoke (Cynara scolymus L. is one of the world’s oldest medicinal plants with multiple health benefits. We have previously shown that artichoke leaf extracts and artichoke flavonoids upregulate the gene expression of endothelial-type nitric oxide synthase (eNOS in human endothelial cells. Whereas NO produced by the eNOS is a vasoprotective molecule, NO derived from the inducible iNOS plays a pro-inflammatory role in the vasculature. The present study was aimed to investigate the effects of artichoke on iNOS expression in human coronary artery smooth muscle cells (HCASMC. Incubation of HCASMC with a cytokine mixture led to an induction of iNOS mRNA expression. This iNOS induction was concentration- and time-dependently inhibited by an artichoke leaf extract (1–100 µg/mL, 6 h or 24 h. Consistently, the artichoke leaf extract also reduced cytokine-induced iNOS promoter activation and iNOS protein expression. In addition, treatment of HCASMC with four well-known artichoke compounds (cynarin > cyanidin > luteolin ≈ cynaroside led to a downregulation iNOS mRNA and protein expression, with cynarin being the most potent one. In conclusion, artichoke contains both eNOS-upregulating and iNOS-downregulating compounds. Such compounds may contribute to the beneficial effects of artichoke and may per se have therapeutic potentials.

  18. Artichoke, cynarin and cyanidin downregulate the expression of inducible nitric oxide synthase in human coronary smooth muscle cells.

    Science.gov (United States)

    Xia, Ning; Pautz, Andrea; Wollscheid, Ursula; Reifenberg, Gisela; Förstermann, Ulrich; Li, Huige

    2014-03-24

    Artichoke (Cynara scolymus L.) is one of the world's oldest medicinal plants with multiple health benefits. We have previously shown that artichoke leaf extracts and artichoke flavonoids upregulate the gene expression of endothelial-type nitric oxide synthase (eNOS) in human endothelial cells. Whereas NO produced by the eNOS is a vasoprotective molecule, NO derived from the inducible iNOS plays a pro-inflammatory role in the vasculature. The present study was aimed to investigate the effects of artichoke on iNOS expression in human coronary artery smooth muscle cells (HCASMC). Incubation of HCASMC with a cytokine mixture led to an induction of iNOS mRNA expression. This iNOS induction was concentration- and time-dependently inhibited by an artichoke leaf extract (1-100 µg/mL, 6 h or 24 h). Consistently, the artichoke leaf extract also reduced cytokine-induced iNOS promoter activation and iNOS protein expression. In addition, treatment of HCASMC with four well-known artichoke compounds (cynarin > cyanidin > luteolin ≈ cynaroside) led to a downregulation iNOS mRNA and protein expression, with cynarin being the most potent one. In conclusion, artichoke contains both eNOS-upregulating and iNOS-downregulating compounds. Such compounds may contribute to the beneficial effects of artichoke and may per se have therapeutic potentials.

  19. Functional Characterization of Sesquiterpene Synthase from Polygonum minus

    Directory of Open Access Journals (Sweden)

    Su-Fang Ee

    2014-01-01

    Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.

  20. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: nishizaw@sk.ritsumei.ac.jp [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  1. Dynamic 1-aminocyclopropane-1-carboxylate-synthase and -oxidase transcript accumulation patterns during pollen tube growth in tobacco styles.

    Science.gov (United States)

    Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina

    2002-11-01

    In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.

  2. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  3. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

    2017-08-01

    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Crystallization and preliminary X-ray analysis of the bacillaene synthase trans-acting acyltransferase PksC

    International Nuclear Information System (INIS)

    Cuskin, Fiona; Solovyova, Alexandra S.; Lewis, Richard J.; Race, Paul R.

    2011-01-01

    The expression, purification and crystallization of the trans-acting acyltransferase PksC from the bacillaene hybrid polyketide synthase/nonribosomal peptide synthetase is described. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and diffracted to 1.44 Å resolution. The antibiotic bacillaene is biosynthesized in Bacillus subtilis by a hybrid type 1 modular polyketide synthase/nonribosomal peptide synthetase of the trans-acyltransferase (trans-AT) class. Within this system, the essential acyl-group loading activity is provided by the action of three free-standing trans-acting acyltransferases. Here, the recombinant expression, purification and crystallization of the bacillaene synthase trans-acting acyltransferase PksC are reported. A diffraction data set has been collected from a single PksC crystal to 1.44 Å resolution and the crystal was found to belong to the orthorhombic space group P2 1 2 1 2 1

  5. [Expression of enterotoxigenic Bacteroides fragilis and polyketide synthase gene-expressing Escherichia coli in colorectal adenoma patients].

    Science.gov (United States)

    Xie, L L; Wu, N; Zhu, Y M; Qiu, X Y; Chen, G D; Zhang, L M; Liu, Y L

    2016-03-29

    To investigate the distribution of various bacteria in adenoma tissue of colorectal adenoma (T/CRA), normal colonic mucosa tissue adjacent to the adenoma (N/CRA), and healthy colonic mucosa tissue (N/H) by comparing the number of total bacteria, Bacteroides fragilis (BF), enterotoxigenic Bacteroides fragilis (ETBF), polyketide synthase (pks) gene-expressing Escherichia coli(E.coli)(pks(+) E. coli)among the above 3 types of tissues. A total of 36 patients diagnosed with colorectal adenoma by colonoscopy and pathology in Department of Gastroenterology, Peking University People's Hospital from September 2011 to September 2013 were selected into this study. T/CRA and N/CRA tissues from the 36 patients and N/H tissues from 18 healthy controls were collected for DNA extraction. The number of total bacteria, BF, ETBF, pks(+) E. coli was detected by quantitative real time PCR, and their correlation with colorectal adenoma was analyzed. (1) The number of total bacteria decreased gradually from N/H, N/CRA, to T/CRA, with the median values being 3.18×10(8,) 1.57×10(8,) and 7.91×10(7) copies/g, respectively, and with significant difference among the three groups and between each two groups (all PCRA, to T/CRA, the median values being 6.03×10(5,) 4.28×10(4,) and 5.48×10(3) copies/g, respectively, and with significant difference among the three groups and between each two groups (all PCRA, to T/CRA, the relative expression being 1.73±0.30, 6.15±1.52, and 8.54±1.80, respectively. Significant difference was found between the T/CRA and N/H tissue (P=0.003), but not between any other two groups. (4) The expression of clbB in pks(+) E.coli was highest in T/CRA colonic tissue (2.96±0.28), followed by the N/CRA (2.79±0.19) and N/H tissue (1.06±0.08). Significant difference was found between T/CRA and N/H tissues, as well as between N/CRA and N/H tissues (both PCRA and N/CRA tissues. The number of total bacteria is markedly reduced in the colonic mucosa of CRA patients

  6. Novel class III phosphoribosyl diphosphate synthase: structure and properties of the tetrameric, phosphate-activated, non-allosterically inhibited enzyme from Methanocaldococcus jannaschii

    DEFF Research Database (Denmark)

    Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva

    2005-01-01

    The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...

  7. Expression of phytoene synthase1 and carotene desaturase crtI genes result in an increase in the total carotenoids content in transgenic elite wheat (Triticum aestivum L.).

    Science.gov (United States)

    Cong, Ling; Wang, Cheng; Chen, Ling; Liu, Huijuan; Yang, Guangxiao; He, Guangyuan

    2009-09-23

    Dietary micronutrient deficiencies, such as the lack of vitamin A, are a major source of morbidity and mortality worldwide. Carotenoids in food can function as provitamin A in humans, while grains of Chinese elite wheat cultivars generally have low carotenoid contents. To increase the carotenoid contents in common wheat endosperm, transgenic wheat has been generated by expressing the maize y1 gene encoding phytoene synthase driven by a endosperm-specific 1Dx5 promoter in the elite wheat (Triticum aestivum L.) variety EM12, together with the bacterial phytoene desaturase crtI gene from Erwinia uredovora under the constitutive CaMV 35S promoter control. A clear increase of the carotenoid content was detected in the endosperms of transgenic wheat that visually showed a light yellow color. The total carotenoids content was increased up to 10.8-fold as compared with the nontransgenic EM12 cultivar. To test whether the variability of total carotenoid content in different transgenic lines was due to differences in the transgene copy number or expression pattern, Southern hybridization and semiquantitative reverse transcriptase polymerase chain reaction analyses were curried out. The results showed that transgene copy numbers and transcript levels did not associate well with carotenoid contents. The expression patterns of endogenous carotenoid genes, such as the phytoene synthases and carotene desaturases, were also investigated in wild-type and transgenic wheat lines. No significant changes in expression levels of these genes were detected in the transgenic endosperms, indicating that the increase in carotenoid transgenic wheat endosperms resulted from the expression of transgenes.

  8. Effect of alkylglycerone phosphate synthase on the expression profile of circRNAs in the human thyroid cancer cell line FRO.

    Science.gov (United States)

    Hou, Shasha; Tan, Jian; Yang, Bing; He, Lu; Zhu, Yu

    2018-05-01

    Thyroid cancer is a common primary tumor in China. Therefore, it is important to investigate the underlying molecular mechanism of thyroid cancer in order to achieve effective individualized treatments. In our previous study, a positive correlation between the expression of alkylglycerone phosphate synthase (AGPS) and the malignant phenotype of thyroid cancer cell lines was identified. The inactivation of AGPS was able to decrease the malignancy of cancer, and inhibit tumor growth and invasion. However, the function of AGPS on thyroid cancer was unclear. In the present study, it was revealed that AGPS was able to regulate the expression of circular RNAs (circRNAs), which may be the mechanism of its anticancer activity. Therefore, the effects of AGPS silencing and knockout on circRNA expression in the thyroid cancer cell line FRO were investigated using circRNAs microarray, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses were performed in order to investigate the underlying molecular mechanism of AGPS for the regulation of thyroid cancer through circRNAs.

  9. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  10. The clinical significance of thymidylate synthase expression in human papillomavirus-related oropharyngeal squamous carcinoma

    International Nuclear Information System (INIS)

    Kato, Hisayuki; Yui, Takehiro; Okada, Tatsuyoshi; Urano, Makoto; Sakurai, Kazuo; Naito, Kensei; Yamamoto, Naoki

    2012-01-01

    The focus of human papilloma virus (HPV), particulary HPV 16 is on the role of carcinogenic and prognostic factors on oropharyngeal squamous carcinoma (OSCC). However, it remains unclear why patients with HPV-positive tumors have better outcomes than those with HPV-negative tumors. Thymidylate synthase (TS) is one of the initial key enzymes in the 5-fluouracil (5-FU) metabolic pathway. Clinical studies showed that intratumoural TS level was related to the response to 5-FU-based chemotherapy in patients with several types of cancer such as gastroenterological and head and neck cancers. We investigated the prevalence of HPV infection and TS expression in the patients with OSCC and evaluated the prognostic implications according to the HPV status and TS expression. We evaluated for high-risk HPV types (HPV 16, 18, 31, 33, 51, 52, 58) using a real-time polymerase chain reaction (RT-PCR) assay on archival biopsies from 54 patients with OSCC. Immunohistochemical assessments for TS were also performed. HPV was positive in 22 (40.7%) of 54 samples. Of these positive cases, 21 (95%) carried HPV 16 and only 1 (5%) HPV58 sequences. TS was overexpressed in 25 (46.3%) of 54 samples. Of these, 19 (76.0%) had an HPV-negative status and 21 (84.0%) were heavy smokers. TS overexpression was associated with the patients with HPV-negative tumors (P=0.02) and heavy smokers (p=0.012). Univariate analysis revealed that HPV positive status (77.3% vs. 29.0%; p=0.006) significantly improved overall survival. Conversely, no remarkable prognostic difference was observed on immunohistochemical analysis of TS expression. A multivariate analysis using Cox's proportional hazard model showed that early T stage (T1-2), early N stage (N0-1), and positive HPV status were significantly independent predictors for superior overall survival. Our studies suggested that positive HPV status was most strongly associated with a favorable prognosis in the patients with OSCC. TS expression has an unusual aspect

  11. Transfusion requirements and clinical outcome in intensive care patients receiving continuous renal replacement therapy: comparison of prostacyclin vs. heparin prefilter administration

    DEFF Research Database (Denmark)

    Windeløv, Nis Agerlin; Ostrowski, Sisse R; Perner, Anders

    2010-01-01

    Prostacyclin (PGI(2)) analogous are potent antithrombotics recommended as prefilter infusion during renal replacement therapy (RRT) when heparin is contraindicated. It is debated whether PGI(2) administration during RRT affects transfusion requirements and outcome. Retrospective cohort study of all......: before, during and after CRRT. For each time period, laboratory values were analysed as changes/day and blood transfusion requirements as absolute values. Organ failures during the ICU stay and 1 year all-cause mortality were registered. During CRRT the PGI(2) group had a higher incidence of disseminated...

  12. Novel polyhydroxyalkanoate copolymers produced in Pseudomonas putida by metagenomic polyhydroxyalkanoate synthases.

    Science.gov (United States)

    Cheng, Jiujun; Charles, Trevor C

    2016-09-01

    Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.

  13. Pre- and posttranslational upregulation of muscle-specific glycogen synthase in athletes

    DEFF Research Database (Denmark)

    Vestergaard, H; Andersen, P H; Lund, S

    1994-01-01

    Expression of muscle-specific glycogen synthase (GS) and phosphofructokinase (PFK) was analyzed in seven athletes and eight control subjects who were characterized using the euglycemic, hyperinsulinemic (2 mU.kg-1.min-1) clamp technique in combination with indirect calorimetry and biopsy sampling...

  14. Crystallization and preliminary crystallographic analysis of an octaketide-producing plant type III polyketide synthase

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)

    2007-11-01

    Octaketide synthase from A. arborescens has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.6 Å. Octaketide synthase (OKS) from Aloe arborescens is a plant-specific type III polyketide synthase that produces SEK4 and SEK4b from eight molecules of malonyl-CoA. Recombinant OKS expressed in Escherichia coli was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to space group I422, with unit-cell parameters a = b = 110.2, c = 281.4 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.6 Å resolution using synchrotron radiation at BL24XU of SPring-8.

  15. Expression of the Inducible Nitric Oxide Synthase Isoform in Chorionic Villi in the Early Spontaneous Abortion

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    To investigate the relationship between inducible nitric oxide synthase (iNOS) and the early spontaneous abortion. , in situ hybridization and immunohistochemistry were used to detect the expression of iNOS in trophoblasts in the early pregnancy with and without spontaneous abortion (group Ⅰ and group Ⅱ ). By light microscopy and computer color magic image analysis system (CMIAS), light density (D) and the positive cell number per statistic square (N/S) in situ hybridization were used to analyze the positive cell index, while total positive cells (N) and the positive unit (Pu) were used in immunohistochemistry. By in situ hybridization, D and N/S in trophoblasts were 0. 35±0. 028, 0. 07±0. 011 respectively in group Ⅰ and 0. 18±0. 016,0. 015±0. 003 in group Ⅱ . In terms of immunohistochemical staining, N and Pu were 0. 058±±0. 007, 11. 94±2. 01 in group Ⅰ and 0. 013±0. 009, 1. 08±0. 35 in group Ⅱ in trophoblasts. Significant differences existed between two groups. It is concluded that the higher nitric oxide produced by the higher expression of iNOS in trophoblasts might play an important role in the early spontaneous abortion.

  16. Nitric oxide synthase during early embryonic development in silkworm Bombyx mori: Gene expression, enzyme activity, and tissue distribution.

    Science.gov (United States)

    Kitta, Ryo; Kuwamoto, Marina; Yamahama, Yumi; Mase, Keisuke; Sawada, Hiroshi

    2016-12-01

    To elucidate the mechanism for embryonic diapause or the breakdown of diapause in Bombyx mori, we biochemically analyzed nitric oxide synthase (NOS) during the embryogenesis of B. mori. The gene expression and enzyme activity of B. mori NOS (BmNOS) were examined in diapause, non-diapause, and HCl-treated diapause eggs. In the case of HCl-treated diapause eggs, the gene expression and enzyme activity of BmNOS were induced by HCl treatment. However, in the case of diapause and non-diapause eggs during embryogenesis, changes in the BmNOS activity and gene expressions did not coincide except 48-60 h after oviposition in diapause eggs. The results imply that changes in BmNOS activity during the embryogenesis of diapause and non-diapause eggs are regulated not only at the level of transcription but also post-transcription. The distribution and localization of BmNOS were also investigated with an immunohistochemical technique using antibodies against the universal NOS; the localization of BmNOS was observed mainly in the cytoplasm of yolk cells in diapause eggs and HCl-treated diapause eggs. These data suggest that BmNOS has an important role in the early embryonic development of the B. mori. © 2016 Japanese Society of Developmental Biologists.

  17. Effects of Intracerebroventricularly (ICV) Injected Ghrelin on Cardiac Inducible Nitric Oxide Synthase Activity/Expression in Obese Rats.

    Science.gov (United States)

    Sudar Milovanovic, E; Jovanovic, A; Misirkic-Marjanovic, M; Vucicevic, Lj; Janjetovic, K; Isenovic, E R

    2015-11-01

    The aim of this study was to examine the effects of ghrelin on regulation of cardiac inducible nitric oxide synthase (iNOS) activity/expression in high fat (HF), obese rats.For this study, male Wistar rats fed with HF diet (30% fat) for 4 weeks were injected every 24 h for 5 days intracerebroventricularly (ICV) with ghrelin (0.3 nmol/5 µl) or with an equal volume of phosphate buffered saline (PBS). Control rats were ICV injected with an equal volume of PBS. Glucose, insulin and nitric oxide (NO) concentrations were measured in serum, while arginase activity and citrulline concentrations were measured in heart lysate. Protein iNOS and regulatory subunit of nuclear factor-κB (NFκB-p65), phosphorylation of enzymes protein kinase B (Akt) at Ser(473), and extracellular signal-regulated kinases 1/2 (ERK1/2) at Tyr(202)/Tyr(204) were determined in heart lysate by Western blot. For gene expression of iNOS qRT-PCR was used.Results show significantly (parginase activity (pactivity of cardiac iNOS via Akt phosphorylation followed by NFκB activation in HF rats. © Georg Thieme Verlag KG Stuttgart · New York.

  18. The Influence of Hyperoxia On Heat Shock Proteins Expression and Nitric Oxide Synthase Activity – the Review

    Directory of Open Access Journals (Sweden)

    Szyller Jakub

    2017-03-01

    Full Text Available Any stay in an environment with an increased oxygen content (a higher oxygen partial pressure, pO2 and an increased pressure (hyperbaric conditions leads to an intensification of oxidative stress. Reactive oxygen species (ROS damage the molecules of proteins, nucleic acids, cause lipid oxidation and are engaged in the development of numerous diseases, including diseases of the circulatory system, neurodegenerative diseases, etc. There are certain mechanisms of protection against unfavourable effects of oxidative stress. Enzymatic and non-enzymatic systems belong to them. The latter include, among others, heat shock proteins (HSP. Their precise role and mechanism of action have been a subject of intensive research conducted in recent years. Hyperoxia and hyperbaria also have an effect on the expression and activity of nitrogen oxide synthase (NOS. Its product - nitrogen oxide (NO can react with reactive oxygen species and contribute to the development of nitrosative stress. NOS occurs as isoforms in various tissues and exhibit different reactions to the discussed factors. The authors have prepared a brief review of research determining the effect of hyperoxia and hyperbaria on HSP expression and NOS activity.

  19. Oral benfotiamine plus alpha-lipoic acid normalises complication-causing pathways in type 1 diabetes.

    Science.gov (United States)

    Du, X; Edelstein, D; Brownlee, M

    2008-10-01

    We determined whether fixed doses of benfotiamine in combination with slow-release alpha-lipoic acid normalise markers of reactive oxygen species-induced pathways of complications in humans. Male participants with and without type 1 diabetes were studied in the General Clinical Research Centre of the Albert Einstein College of Medicine. Glycaemic status was assessed by measuring baseline values of three different indicators of hyperglycaemia. Intracellular AGE formation, hexosamine pathway activity and prostacyclin synthase activity were measured initially, and after 2 and 4 weeks of treatment. In the nine participants with type 1 diabetes, treatment had no effect on any of the three indicators used to assess hyperglycaemia. However, treatment with benfotiamine plus alpha-lipoic acid completely normalised increased AGE formation, reduced increased monocyte hexosamine-modified proteins by 40% and normalised the 70% decrease in prostacyclin synthase activity from 1,709 +/- 586 pg/ml 6-keto-prostaglandin F(1alpha) to 4,696 +/- 533 pg/ml. These results show that the previously demonstrated beneficial effects of these agents on complication-causing pathways in rodent models of diabetic complications also occur in humans with type 1 diabetes.

  20. Benzalacetone Synthase

    Directory of Open Access Journals (Sweden)

    Ikuro eAbe

    2012-03-01

    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  1. Eukaryotic beta-alanine synthases are functionally related but have a high degree of structural diversity

    DEFF Research Database (Denmark)

    Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure

    2001-01-01

    no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial......beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...

  2. The chalcone synthase multigene family of Petunia hybrida (V30): differential, light-regulated expression during flower development and UV light induction

    International Nuclear Information System (INIS)

    Koes, R.E.; Spelt, C.E.; Mol, J.N.M.

    1989-01-01

    We have analysed the expression of the 8-10 members of the gene family encoding the flavonoid biosynthetic enzyme chalcone synthase (CHS) from Petunia hybrida. During normal plant development only two members of the gene family (CHS-A and CHS-J) are expressed. Their expression is restricted to floral tissues mainly. About 90% of the total CHS mRNA pool is transcribed from CHS-A, wheares CHS-J delivers about 10% in flower corolla, tube and anthers. Expression of CHS-A and CHS-J during flower development is coordinated and (red) light-dependent. In young seedlings and cell suspension cultures expression of CHS-A and CHS-J can be induced with UV light. In addition to CHS-A and CHS-J, expression of another two CHS genes (CHS-B and CHS-G) is induced in young seedlings by UV light, albeit at a low level. In contrast to CHS genes from Leguminoseae, Petunia CHS genes are not inducible by phytopathogen-derived elicitors. Expression of CHS-A and CHS-J is reduced to a similar extent in a regulatory CHS mutant, Petunia hybrida Red Star, suggesting that both genes are regulated by the same trans-acting factors. Comparison of the promoter sequences of CHS-A and CHS-J reveals some striking homologies, which might represent cis-acting regulatory sequences. (author)

  3. A Dual Repeat Cis-Element Determines Expression of GERANYL DIPHOSPHATE SYNTHASE for Monoterpene Production in Phalaenopsis Orchids

    Directory of Open Access Journals (Sweden)

    Yu-Chen Chuang

    2018-06-01

    Full Text Available Phalaenopsis bellina is a scented orchid emitting large amount of monoterpenes. GERANYL DIPHOSPHATE SYNTHASE (PbGDPS is the key enzyme for monoterpene biosynthesis, and shows concomitant expression with the emission of monoterpenes during flower development in P. bellina. Here, we identified a dual repeat cis-element in the GDPS promoter that is critical for monoterpene biosynthesis in Phalaenopsis orchids. A strong correlation between the dual repeat and the monoterpene production was revealed by examination of the GDPS promoter fragments over 12 Phalaenopsis species. Serial-deletion of the 2-kb GDPS promoter fragments demonstrated that the integrity of the dual repeat was crucial for its promoter activities. By screening the Arabidopsis transcription factors (TFs cDNA library using yeast one-hybrid assay, AtbZIP18, a member of group I of bZIP TFs, was identified to be able to bind the dual repeat. We then identified PbbZIP4 in the transcriptome of P. bellina, showing 83% identity in the DNA binding region with that of AtbZIP18, and the expression level of PbbZIP4 was higher in the scented orchids. In addition, PbbZIP4 transactivated the GDPS promoter fragment containing the dual repeat in dual luciferase assay. Furthermore, transient ectopic expression of PbbZIP4 induced a 10-fold production of monoterpenoids in the scentless orchid. In conclusion, these results indicate that the dual repeat is a real TF-bound cis-element significant for GDPS gene expression, and thus subsequent monoterpene biosynthesis in the scented Phalaenopsis orchids.

  4. Angiotensin II-induced hypertension blunts thick ascending limb NO production by reducing NO synthase 3 expression and enhancing threonine 495 phosphorylation.

    Science.gov (United States)

    Ramseyer, Vanesa D; Gonzalez-Vicente, Agustin; Carretero, Oscar A; Garvin, Jeffrey L

    2015-01-15

    Thick ascending limbs reabsorb 30% of the filtered NaCl load. Nitric oxide (NO) produced by NO synthase 3 (NOS3) inhibits NaCl transport by this segment. In contrast, chronic angiotensin II (ANG II) infusion increases net thick ascending limb transport. NOS3 activity is regulated by changes in expression and phosphorylation at threonine 495 (T495) and serine 1177 (S1177), inhibitory and stimulatory sites, respectively. We hypothesized that NO production by thick ascending limbs is impaired by chronic ANG II infusion, due to reduced NOS3 expression, increased phosphorylation of T495, and decreased phosphorylation of S1177. Rats were infused with 200 ng·kg(-1)·min(-1) ANG II or vehicle for 1 and 5 days. ANG II infusion for 5 days decreased NOS3 expression by 40 ± 12% (P thick ascending limbs from ANG II-infused animals [ANG II -0.01 ± 0.06 arbitrary fluorescence units (AFU)/min vs. 0.17 ± 0.02 AFU/min in controls; P thick ascending limbs is impaired due to decreased NOS3 expression and altered phosphorylation. Copyright © 2015 the American Physiological Society.

  5. Sterol regulatory element-binding protein-1 participates in the regulation of fatty acid synthase expression in colorectal neoplasia.

    Science.gov (United States)

    Li, J N; Mahmoud, M A; Han, W F; Ripple, M; Pizer, E S

    2000-11-25

    Endogenous fatty acid synthesis has been observed in certain rapidly proliferating normal and neoplastic tissues. Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate the expression of lipogenic genes including fatty acid synthase (FAS), the major biosynthetic enzyme for fatty acid synthesis. We have previously shown that SREBP-1, FAS, and Ki-67, a proliferation marker, colocalized in the crypts of the fetal gastrointestinal tract epithelium. This study sought to determine whether SREBP-1 participates in the regulation of proliferation-associated fatty acid synthesis in colorectal neoplasia. An immunohistochemical analysis of SREBP-1, FAS, and Ki-67 expression in 25 primary human colorectal carcinoma specimens showed colocalization in 22 of these. To elucidate a functional linkage between SREBP-1 activation and proliferation-associated FA synthesis, SREBP-1 and FAS content were assayed during the adaptive response of cultured HCT116 colon carcinoma cells to pharmacological inhibition of FA synthesis. Cerulenin and TOFA each inhibited the endogenous synthesis of fatty acids in a dose-dependent manner and each induced increases in both precursor and mature forms of SREBP-1. Subsequently, both the transcriptional activity of the FAS promoter in a luciferase reporter gene construct and the FAS expression increased. These results demonstrate that tumor cells recognize and respond to a deficiency in endogenous fatty acid synthesis by upregulating both SREBP-1 and FAS expression and support the model that SREBP-1 participates in the transcriptional regulation of lipogenic genes in colorectal neoplasia. Copyright 2000 Academic Press.

  6. Glycogen Phosphorylase and Glycogen Synthase: Gene Cloning and Expression Analysis Reveal Their Role in Trehalose Metabolism in the Brown Planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae).

    Science.gov (United States)

    Zhang, Lu; Wang, Huijuan; Chen, Jianyi; Shen, Qida; Wang, Shigui; Xu, Hongxing; Tang, Bin

    2017-01-01

    RNA interference has been used to study insects' gene function and regulation. Glycogen synthase (GS) and glycogen phosphorylase (GP) are two key enzymes in carbohydrates' conversion in insects. Glycogen content and GP and GS gene expression in several tissues and developmental stages of the Brown planthopper Nilaparvata lugens Stål (Hemiptera: Delphacidae) were analyzed in the present study, using quantitative reverse-transcription polymerase chain reaction to determine their response to double-stranded trehalases (dsTREs), trehalose-6-phosphate synthases (dsTPSs), and validamycin injection. The highest expression of both genes was detected in the wing bud, followed by leg and head tissues, and different expression patterns were shown across the developmental stages analyzed. Glycogen content significantly decreased 48 and 72 h after dsTPSs injection and 48 h after dsTREs injection. GP expression increased 48 h after dsTREs and dsTPSs injection and significantly decreased 72 h after dsTPSs, dsTRE1-1, and dsTRE1-2 injection. GS expression significantly decreased 48 h after dsTPS2 and dsTRE2 injection and 72 h after dsTRE1-1 and dsTRE1-2 injection. GP and GS expression and glycogen content significantly decreased 48 h after validamycin injection. The GP activity significantly decreased 48 h after validamycin injection, while GS activities of dsTPS1 and dsTRE2 injection groups were significantly higher than that of double-stranded GFP (dsGFP) 48 h after injection, respectively. Thus, glycogen is synthesized, released, and degraded across several insect tissues according to the need to maintain stable trehalose levels. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

  7. Salinomycin enhances cisplatin-induced cytotoxicity in human lung cancer cells via down-regulation of AKT-dependent thymidylate synthase expression.

    Science.gov (United States)

    Ko, Jen-Chung; Zheng, Hao-Yu; Chen, Wen-Ching; Peng, Yi-Shuan; Wu, Chia-Hung; Wei, Chia-Li; Chen, Jyh-Cheng; Lin, Yun-Wei

    2016-12-15

    Salinomycin, a polyether antibiotic, acts as a highly selective potassium ionophore and has anticancer activity on various cancer cell lines. Cisplatin has been proved as chemotherapy drug for advanced human non-small cell lung cancer (NSCLC). Thymidylate synthase (TS) is a key enzyme in the pyrimidine salvage pathway, and increased expression of TS is thought to be associated with resistance to cisplatin. In this study, we showed that salinomycin (0.5-2μg/mL) treatment down-regulating of TS expression in an AKT inactivation manner in two NSCLC cell lines, human lung adenocarcinoma A549 and squamous cell carcinoma H1703 cells. Knockdown of TS using small interfering RNA (siRNA) or inhibiting AKT activity with PI3K inhibitor LY294002 enhanced the cytotoxicity and cell growth inhibition of salinomycin. A combination of cisplatin and salinomycin resulted in synergistic enhancement of cytotoxicity and cell growth inhibition in NSCLC cells, accompanied with reduced activation of phospho-AKT, and TS expression. Overexpression of a constitutive active AKT (AKT-CA) expression vector reversed the salinomycin and cisplatin-induced synergistic cytotoxicity. In contrast, pretreatment with LY294002 further decreased the cell viability in salinomycin and cisplatin cotreated cells. Our findings suggested that the down-regulation of AKT-mediated TS expression by salinomycin enhanced the cisplatin-induced cytotoxicity in NSCLC cells. These results may provide a rationale to combine salinomycin with cisplatin for lung cancer treatment. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Identification and characterization of two bisabolene synthases from linear glandular trichomes of sunflower (Helianthus annuus L., Asteraceae).

    Science.gov (United States)

    Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar

    2016-04-01

    Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Cloning expression and analysis of phytochelatin synthase (pcs) gene from Anabaena sp. PCC 7120 offering multiple stress tolerance in Escherichia coli

    International Nuclear Information System (INIS)

    Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand

    2008-01-01

    Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses

  10. Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua

    Science.gov (United States)

    Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing

    2016-01-01

    Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840

  11. Isolation and characterization of three new monoterpene synthases from Artemisia annua

    Directory of Open Access Journals (Sweden)

    Ju-Xin eRuan

    2016-05-01

    Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.

  12. Thymidilate synthase and p53 primary tumour expression as predictive factors for advanced colorectal cancer patients.

    Science.gov (United States)

    Paradiso, A; Simone, G; Petroni, S; Leone, B; Vallejo, C; Lacava, J; Romero, A; Machiavelli, M; De Lena, M; Allegra, C J; Johnston, P G

    2000-02-01

    The purpose of this work was to analyse the ability of p53 and thymidilate synthase (TS) primary tumour expression to retrospectively predict clinical response to chemotherapy and long-term prognosis in patients with advanced colorectal cancers homogeneously treated by methotrexate (MTX)-modulated-5-fluorouracil (5-FU-FA). A total of 108 advanced colorectal cancer patients entered the present retrospective study. Immunohistochemical p53 (pAb 1801 mAb) and TS (TS106 mAb) expression on formalin-fixed paraffin-embedded primary tumour specimens was related to probability of clinical response to chemotherapy, time to progression and overall survival. p53 was expressed in 53/108 (49%) tumours, while 54/108 (50%) showed TS immunostaining. No relationship was demonstrated between p53 positivity and clinical response to chemotherapy (objective response (OR): 20% vs 23%, in p53+ and p53- cases respectively) or overall survival. Percent of OR was significantly higher in TS-negative with respect to TS-positive tumours (30% vs 15% respectively; P < 0.04); simultaneous analysis of TS and p53 indicated 7% OR for p53-positive/TS-positive tumours vs 46% for p53-positive/TS-negative tumours (P < 0.03). Logistic regression analysis confirmed a significant association between TS tumour status and clinical response to chemotherapy (hazard ratio (HR): 2.91; 95% confidence interval (CI) 8.34-1.01; two-sided P < 0.05). A multivariate analysis of overall survival showed that only a small number of metastatic sites was statistically relevant (HR 1.89; 95% CI 2.85-1.26; two-sided P < 0.03). Our study suggests that immunohistochemical expression of p53 and TS could assist the clinician in predicting response of colorectal cancer patients to modulated MTX-5-FU therapy.

  13. Alterations in prostacyclin and thromboxane formation by chronic cigarette smoke exposure: temporal relationships and whole smoke vs. gas phase

    Energy Technology Data Exchange (ETDEWEB)

    Lubawy, W.C.; Culpepper, B.T.; Valentovic, M.A.

    1986-04-01

    Chronic cigarette smoke exposure in vivo causes decreased conversion of (/sup 14/C)arachidonic acid (AA) to prostacyclin (PGI2) by isolated aortic tissue and increased conversion to thromboxane (TXA2) by isolated platelets from rats. Alterations in the PGI2/TXA2 balance may be part of the mechanism through which smoking increases the risk of cardiovascular disease. To study the influence of smoke exposure duration on this response, male rats were exposed daily to 10 puffs of freshly generated cigarette smoke. Animals were killed after 1, 4, 14, 28 and 57 days of smoke exposure and 3, 7, 14 and 28 days after cessation of the 57-day of smoke-exposure regimen. Elevated carboxyhemoglobin levels during the smoke-exposure sessions verified smoke (gas phase) inhalation. Statistically significant alterations in prostacyclin synthesis preceded those of thromboxane. A decrease of 20-25% (P less than 0.05) in PGI2 production from (/sup 14/C)AA in isolated aortic tissue was found beginning 28 days after smoke was initiated and quickly rebounded when smoke exposure was terminated. Increased production of TXA2 from (/sup 14/C)AA by isolated platelets became statistically significant (P less than 0.05) on the 57th day and returned to normal 7-14 days after cessation of smoke exposure. To determine the effect of gas phase constituents on the PGI2/TXA2 balance a second series of experiments divided male and female Sprague-Dawley rats into sham, whole smoke and gas phase groups. Gas phase was produced by passing whole smoke through a Cambridge filter to remove particulate matter. Per cent COHb averaged 1.4 for sham, 7.8 for whole smoke and 9.4 for gas phase groups.

  14. Single prostacyclin receptor of gel-filtered platelets provides a correlation with antiaggregatory potency of PGI2 mimics

    International Nuclear Information System (INIS)

    Eggerman, T.L.; Hartzell, C.J.; Selfe, S.; Andersen, N.H.

    1987-01-01

    Gel-filtered human platelets (GFP) display only a single binding site for [ 3 H]-PGI2: KD = 61nM, 234 fmol/10(8) platelets (1410 sites/platelet). Platelet-rich plasma (PRP) displays the same receptor density but the KD value increases to 123 nM due to protein binding of PGI2 which lowers its effective concentration. The [ 3 H]-PGI2/GFP binding assay has been used to evaluate the molecular basis of aggregation inhibition for prostacyclin analogs and mimics, three PGE type structures, and PGD2. Antiaggregatory IC50s and radioligand binding IC50s correlate for PGE2, E1, and six PGI2 analogs. PGD2, and to a lesser extent 6-oxo-PGE1, display greater antiaggregatory potency than expected based on PGI2-binding site affinity data

  15. Glycogen synthase kinase 3: more than a namesake.

    Science.gov (United States)

    Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit

    2009-03-01

    Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, tau protein and beta catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as diabetes, inflammation, cancer, Alzheimer's and bipolar disorder. GSK3 negatively regulates insulin-mediated glycogen synthesis and glucose homeostasis, and increased expression and activity of GSK3 has been reported in type II diabetics and obese animal models. Consequently, inhibitors of GSK3 have been demonstrated to have anti-diabetic effects in vitro and in animal models. However, inhibition of GSK3 poses a challenge as achieving selectivity of an over achieving kinase involved in various pathways with multiple substrates may lead to side effects and toxicity. The primary concern is developing inhibitors of GSK3 that are anti-diabetic but do not lead to up-regulation of oncogenes. The focus of this review is the recent advances and the challenges surrounding GSK3 as an anti-diabetic therapeutic target.

  16. Differential regulation of glomerular and interstitial endothelial nitric oxide synthase expression in the kidney of hibernating ground squirrel.

    Science.gov (United States)

    Sandovici, Maria; Henning, Robert H; Hut, Roelof A; Strijkstra, Arjen M; Epema, Anne H; van Goor, Harry; Deelman, Leo E

    2004-09-01

    Hibernating animals transiently reduce renal function during their hypothermic periods (torpor), while completely restoring it during their periodical rewarming to euthermia (arousal). Moreover, structural integrity of the kidney is preserved throughout the hibernation. Nitric oxide (NO) generated by endothelial nitric oxide synthase (eNOS) is a crucial vasodilatory mediator and a protective factor in the kidney. We investigated renal NOS expression in hibernating European ground squirrels after 1 day and 7 days of torpor (torpor short, TS, and torpor long, TL, respectively), at 1.5 and at 10 h of rewarming (arousal short, AS, and arousal long, AL, respectively), and in continuously euthermic animals after hibernation (EU). For that purpose, we performed NOS activity assay, immunohistochemistry and real-time PCR analysis. Immunohistochemistry revealed a decreased glomerular eNOS expression in hibernating animals (TS, TL, AS, and AL) compared to non-hibernating animals (EU, p EU. In all methods used, torpid and aroused squirrels did not differ. These results demonstrate differential regulation of eNOS in glomeruli and interstitium of hibernating animals, which is unaffected during arousal. The differential regulation of eNOS may serve to reduce ultrafiltration without jeopardizing tubular structures during hibernation.

  17. cDNA cloning and expression analyses of phytoene synthase 1, phytoene desaturase and ζ-carotene desaturase genes from Solanum lycopersicum KKU-T34003

    Directory of Open Access Journals (Sweden)

    Krittaya Supathaweewat

    2013-10-01

    Full Text Available We report on the cloning of Psy1, Pds and Zds cDNAs encoding the enzymes responsible for lycopene biosynthesis,namely phytoene synthase 1 (PSY1, phytoene desaturase (PDS and -carotene desaturase (ZDS, respectively, from high-lycopene tomato cultivar, Solanum lycopersicum KKU-T34003. DNA sequence analyses showed that the complete openreading frames of Psy1, Pds and Zds cDNAs were 1,239, 1,752 and 1,767 base pairs in length and encoded proteins of 412,583 and 588 amino acids, respectively. Phylogenetic and the conserved domain analyses suggest that PSY1, PDS and ZDSfrom S. lycopersicum KKU-T34003 potentially have similar structures and biological functions to the corresponding proteinsfrom other plants. Gene expression studies showed that Psy1 was expressed only in the petal and the breaker fruit, whereasthe expressions of Pds and Zds were observed in the petal, the breaker fruit and the leaf. The highest expression level for allgenes was detected in the breaker-stage fruit, suggesting that carotenoid accumulation was developmentally regulated inthe chromoplast-containing tissues.

  18. GNC and CGA1 Modulate Chlorophyll Biosynthesis and Glutamate Synthase (GLU1/Fd-GOGAT) Expression in Arabidopsis

    Science.gov (United States)

    Hudson, Darryl; Guevara, David; Yaish, Mahmoud W.; Hannam, Carol; Long, Nykoll; Clarke, Joseph D.; Bi, Yong-Mei; Rothstein, Steven J.

    2011-01-01

    Chloroplast development is an important determinant of plant productivity and is controlled by environmental factors including amounts of light and nitrogen as well as internal phytohormones including cytokinins and gibberellins (GA). The paralog GATA transcription factors GNC and CGA1/GNL up-regulated by light, nitrogen and cytokinin while also being repressed by GA signaling. Modifying the expression of these genes has previously been shown to influence chlorophyll content in Arabidopsis while also altering aspects of germination, elongation growth and flowering time. In this work, we also use transgenic lines to demonstrate that GNC and CGA1 exhibit a partially redundant control over chlorophyll biosynthesis. We provide novel evidence that GNC and CGA1 influence both chloroplast number and leaf starch in proportion to their transcript level. GNC and CGA1 were found to modify the expression of chloroplast localized GLUTAMATE SYNTHASE (GLU1/Fd-GOGAT), which is the primary factor controlling nitrogen assimilation in green tissue. Altering GNC and CGA1 expression was also found to modulate the expression of important chlorophyll biosynthesis genes (GUN4, HEMA1, PORB, and PORC). As previously demonstrated, the CGA1 transgenic plants demonstrated significantly altered timing to a number of developmental events including germination, leaf production, flowering time and senescence. In contrast, the GNC transgenic lines we analyzed maintain relatively normal growth phenotypes outside of differences in chloroplast development. Despite some evidence for partial divergence, results indicate that regulation of both GNC and CGA1 by light, nitrogen, cytokinin, and GA acts to modulate nitrogen assimilation, chloroplast development and starch production. Understanding the mechanisms controlling these processes is important for agricultural biotechnology. PMID:22102866

  19. Mechanisms of suppression of inducible nitric oxide synthase (iNOS) expression in RAW 264.7 cells by andrographolide

    Science.gov (United States)

    Chiou, Wen-Fei; Chen, Chieh-Fu; Lin, Jin-Jung

    2000-01-01

    Andrographolide, an active component found in leaves of Andrographis paniculata, has been reported to exhibit nitric oxide (NO) inhibitory property in endotoxin-stimulated macrophages, however, the detailed mechanisms remain unclear. In the present study we investigated the effect of andrographolide on the expression of inducible NO synthase (iNOS) mRNA, protein, and enzyme activity in RAW 264.7 macrophages stimulated with lipopolysaccharide (LPS) plus interferon-γ (IFN-γ).RAW 264.7 cells stimulated with LPS/IFN-γ activated NO production; in this condition andrographolide (1–100 μM) inhibited NO production in a dose-dependent manner with an IC50 value of 17.4±1.1 μM. Andrographolide also reduces the expression of iNOS protein level but without a significant effect on iNOS mRNA. The reduction of iNOS activity is thought to be caused by decreased expression of iNOS protein.In a protein stability assay, andrographolide moderately but significantly reduced the amount of iNOS protein as suggested by accelerating degradation. Furthermore, andrographolide also inhibited total protein de novo synthesis as demonstrated by [35S]-methionine incorporation.As a whole, these data suggest that andrographolide inhibits NO synthesis in RAW 264.7 cells by reducing the expression of iNOS protein and the reduction could occur through two additional mechanisms: prevention of the de novo protein synthesis and decreasing the protein stability via a post-transcriptional mechanism. It is also possible that inhibition of iNOS protein expression and NO production under immune stimulation and/or bacteria infection may explain, in part, the beneficial effects of andrographolide as an anti-inflammatory agent. PMID:10780958

  20. Soybean seeds expressing feedback-insensitive cystathionine γ-synthase exhibit a higher content of methionine.

    Science.gov (United States)

    Song, Shikui; Hou, Wensheng; Godo, Itamar; Wu, Cunxiang; Yu, Yang; Matityahu, Ifat; Hacham, Yael; Sun, Shi; Han, Tianfu; Amir, Rachel

    2013-04-01

    Soybean seeds provide an excellent source of protein for human and livestock nutrition. However, their nutritional quality is hampered by a low concentration of the essential sulfur amino acid, methionine (Met). In order to study factors that regulate Met synthesis in soybean seeds, this study used the Met-insensitive form of Arabidopsis cystathionine γ-synthase (AtD-CGS), which is the first committed enzyme of Met biosynthesis. This gene was expressed under the control of a seed-specific promoter, legumin B4, and used to transform the soybean cultivar Zigongdongdou (ZD). In three transgenic lines that exhibited the highest expression level of AtD-CGS, the level of soluble Met increased significantly in developing green seeds (3.8-7-fold). These seeds also showed high levels of other amino acids. This phenomenon was more prominent in two transgenic lines, ZD24 and ZD91. The total Met content, which including Met incorporated into proteins, significantly increased in the mature dry seeds of these two transgenic lines by 1.8- and 2.3-fold, respectively. This elevation was accompanied by a higher content of other protein-incorporated amino acids, which led to significantly higher total protein content in the seeds of these two lines. However, in a third transgenic line, ZD01, the level of total Met and the level of other amino acids did not increase significantly in the mature dry seeds. This line also showed no significant change in protein levels. This suggests a positive connection between high Met content and the synthesis of other amino acids that enable the synthesis of more seed proteins.

  1. Selective Inducible Nitric Oxide Synthase Inhibitor Reversed Zinc Chloride-Induced Spatial Memory Impairment via Increasing Cholinergic Marker Expression.

    Science.gov (United States)

    Tabrizian, Kaveh; Azami, Kian; Belaran, Maryam; Soodi, Maliheh; Abdi, Khosrou; Fanoudi, Sahar; Sanati, Mehdi; Mottaghi Dastjerdi, Negar; Soltany Rezaee-Rad, Mohammad; Sharifzadeh, Mohammad

    2016-10-01

    Zinc, an essential micronutrient and biochemical element of the human body, plays structural, catalytic, and regulatory roles in numerous physiological functions. In the current study, the effects of a pretraining oral administration of zinc chloride (10, 25, and 50 mg/kg) for 14 consecutive days and post-training bilateral intra-hippocampal infusion of 1400W as a selective inducible nitric oxide synthase (iNOS) inhibitor (10, 50, and 100 μM/side), alone and in combination, on the spatial memory retention in Morris water maze (MWM) were investigated. Animals were trained for 4 days and tested 48 h after completion of training. Also, the molecular effects of these compounds on the expression of choline acetyltransferase (ChAT), as a cholinergic marker in the CA1 region of the hippocampus and medial septal area (MSA), were evaluated. Behavioral and molecular findings of this study showed that a 2-week oral administration of zinc chloride (50 mg/kg) impaired spatial memory retention in MWM and decreased ChAT expression. Immunohistochemical analysis of post-training bilateral intra-hippocampal infusion of 1400W revealed a significant increase in ChAT immunoreactivity. Furthermore, post-training bilateral intra-hippocampal infusion of 1400W into the CA1 region of the hippocampus reversed zinc chloride-induced spatial memory impairment in MWM and significantly increased ChAT expression in comparison with zinc chloride-treated animals. Taken together, these results emphasize the role of selective iNOS inhibitors in reversing zinc chloride-induced spatial memory deficits via modulation of cholinergic marker expression.

  2. Crystallization and preliminary crystallographic analysis of mannosyl-3-phosphoglycerate synthase from Rubrobacter xylanophilus

    International Nuclear Information System (INIS)

    Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno; Costa, Milton S. da; Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra

    2008-01-01

    The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6 5 22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6 5 22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative

  3. Chitinase-like (CTL) and cellulose synthase (CESA) gene expression in gelatinous-type cellulosic walls of flax (Linum usitatissimum L.) bast fibers.

    Science.gov (United States)

    Mokshina, Natalia; Gorshkova, Tatyana; Deyholos, Michael K

    2014-01-01

    Plant chitinases (EC 3.2.1.14) and chitinase-like (CTL) proteins have diverse functions including cell wall biosynthesis and disease resistance. We analyzed the expression of 34 chitinase and chitinase-like genes of flax (collectively referred to as LusCTLs), belonging to glycoside hydrolase family 19 (GH19). Analysis of the transcript expression patterns of LusCTLs in the stem and other tissues identified three transcripts (LusCTL19, LusCTL20, LusCTL21) that were highly enriched in developing bast fibers, which form cellulose-rich gelatinous-type cell walls. The same three genes had low relative expression in tissues with primary cell walls and in xylem, which forms a xylan type of secondary cell wall. Phylogenetic analysis of the LusCTLs identified a flax-specific sub-group that was not represented in any of other genomes queried. To provide further context for the gene expression analysis, we also conducted phylogenetic and expression analysis of the cellulose synthase (CESA) family genes of flax, and found that expression of secondary wall-type LusCESAs (LusCESA4, LusCESA7 and LusCESA8) was correlated with the expression of two LusCTLs (LusCTL1, LusCTL2) that were the most highly enriched in xylem. The expression of LusCTL19, LusCTL20, and LusCTL21 was not correlated with that of any CESA subgroup. These results defined a distinct type of CTLs that may have novel functions specific to the development of the gelatinous (G-type) cellulosic walls.

  4. Crocin Suppresses LPS-Stimulated Expression of Inducible Nitric Oxide Synthase by Upregulation of Heme Oxygenase-1 via Calcium/Calmodulin-Dependent Protein Kinase 4

    Directory of Open Access Journals (Sweden)

    Ji-Hee Kim

    2014-01-01

    Full Text Available Crocin is a water-soluble carotenoid pigment that is primarily used in various cuisines as a seasoning and coloring agent, as well as in traditional medicines for the treatment of edema, fever, and hepatic disorder. In this study, we demonstrated that crocin markedly induces the expression of heme oxygenase-1 (HO-1 which leads to an anti-inflammatory response. Crocin inhibited inducible nitric oxide synthase (iNOS expression and nitric oxide production via downregulation of nuclear factor kappa B activity in lipopolysaccharide- (LPS- stimulated RAW 264.7 macrophages. These effects were abrogated by blocking of HO-1 expression or activity. Crocin also induced Ca2+ mobilization from intracellular pools and phosphorylation of Ca2+/calmodulin-dependent protein kinase 4 (CAMK4. CAMK4 knockdown and kinase-dead mutant inhibited crocin-mediated HO-1 expression, Nrf2 activation, and phosphorylation of Akt, indicating that HO-1 expression is mediated by CAMK4 and that Akt is a downstream mediator of CAMK4 in crocin signaling. Moreover, crocin-mediated suppression of iNOS expression was blocked by CAMK4 inhibition. Overall, these results suggest that crocin suppresses LPS-stimulated expression of iNOS by inducing HO-1 expression via Ca2+/calmodulin-CAMK4-PI3K/Akt-Nrf2 signaling cascades. Our findings provide a novel molecular mechanism for the inhibitory effects of crocin against endotoxin-mediated inflammation.

  5. Beraprost sodium, a prostacyclin analogue, reduces fructose-induced hepatocellular steatosis in mice and in vitro via the microRNA-200a and SIRT1 signaling pathway.

    Science.gov (United States)

    Zhang, Pengyuan; Xu, Lijuan; Guan, Hongyu; Liu, Liehua; Liu, Juan; Huang, Zhimin; Cao, Xiaopei; Liao, Zhihong; Xiao, Haipeng; Li, Yanbing

    2017-08-01

    To determine whether beraprost sodium, a prostacyclin analogue, could reduce hepatic lipid accumulation induced by fructose in mice and cultured human hepatocytes, and to investigate the expression of microRNAs and the sirtuin 1 (SIRT1) pathway. Male C57BL/6JNju mice were divided into three groups and fed one of the following diets: a normal diet, a high fructose diet, or a high fructose diet with beraprost sodium treatment. In addition, human-derived HepG2 cells were cultured and treated with fructose (25mmol/L) with or without beraprost sodium (10μmol/L) for 24h, and transfected with small interfering RNA (siRNA) against SIRT1, miR-200a mimic, or miR-200a inhibitor for 48h. The miRNA microarray analysis was performed on the HepG2 cells, and the expression profiles of miRNAs were analyzed using Gene Cluster 3.0 and verified using qPCR. Beraprost sodium treatment attenuated hepatic steatosis, induced the transcription of genes involved in lipid metabolism in C57BL/6 mice (Pfructose. These effects were blocked in HepG2 cells after transfection with siRNA against SIRT1. MiR-200a was highly expressed during fructose treatment and was down regulated by beraprost sodium (Pfructose and revealed the primary role of miR-200a in the regulation of hepatic SIRT1 by beraprost sodium. Our findings suggested that SIRT1 might be a therapeutic target of fructose-related metabolism disorders. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. The cellulose synthase companion proteins act non-redundantly with CELLULOSE SYNTHASE INTERACTING1/POM2 and CELLULOSE SYNTHASE 6

    OpenAIRE

    Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan

    2016-01-01

    Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...

  7. 1-11C-acetate as a PET radiopharmaceutical for imaging fatty acid synthase expression in prostate cancer.

    Science.gov (United States)

    Vāvere, Amy L; Kridel, Steven J; Wheeler, Frances B; Lewis, Jason S

    2008-02-01

    Although it is accepted that the metabolic fate of 1-(11)C-acetate is different in tumors than in myocardial tissue because of different clearance patterns, the exact pathway has not been fully elucidated. For decades, fatty acid synthesis has been quantified in vitro by the incubation of cells with (14)C-acetate. Fatty acid synthase (FAS) has been found to be overexpressed in prostate carcinomas, as well as other cancers, and it is possible that imaging with 1-(11)C-acetate could be a marker for its expression. In vitro and in vivo uptake experiments in prostate tumor models with 1-(11)C-acetate were performed both with and without blocking of fatty acid synthesis with either C75, an inhibitor of FAS, or 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase (ACC). FAS levels were measured by Western blot and immunohistochemical techniques for comparison. In vitro studies in 3 different prostate tumor models (PC-3, LNCaP, and 22Rv1) demonstrated blocking of 1-(11)C-acetate accumulation after treatment with both C75 and TOFA. This was further shown in vivo in PC-3 and LNCaP tumor-bearing mice after a single treatment with C75. A positive correlation between 1-(11)C-acetate uptake into the solid tumors and FAS expression levels was found. Extensive involvement of the fatty acid synthesis pathway in 1-(11)C-acetate uptake in prostate tumors was confirmed, leading to a possible marker for FAS expression in vivo by noninvasive PET.

  8. The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase.

    Science.gov (United States)

    Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S

    2013-03-01

    Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

  9. Regulation of Banana Phytoene Synthase (MaPSY) Expression, Characterization and Their Modulation under Various Abiotic Stress Conditions

    Science.gov (United States)

    Kaur, Navneet; Pandey, Ashutosh; Shivani; Kumar, Prateek; Pandey, Pankaj; Kesarwani, Atul K.; Mantri, Shrikant S.; Awasthi, Praveen; Tiwari, Siddharth

    2017-01-01

    Phytoene synthase (PSY) is a key regulatory enzyme of carotenoid biosynthesis pathway in plants. The present study examines the role of PSY in carotenogenesis and stress management in banana. Germplasm screening of 10 Indian cultivars showed that Nendran (3011.94 μg/100 g dry weight) and Rasthali (105.35 μg/100 g dry weight) contained the highest and lowest amounts of β-carotene, respectively in ripe fruit-pulp. Nendran ripe pulp also showed significantly higher antioxidant activity as compared to Rasthali. Meta-analysis of three banana PSY genes (MaPSY1, MaPSY2, and MaPSY3) was performed to identify their structural features, subcellular, and chromosomal localization in banana genome. The distinct expression patterns of MaPSY1, MaPSY2, and MaPSY3 genes were observed in various tissues, and fruit developmental stages of these two contrasting cultivars, suggesting differential regulation of the banana PSY genes. A positive correlation was observed between the expression of MaPSY1 and β-carotene accumulation in the ripe fruit-peel and pulp of Nendran. The presence of stress responsive cis-regulatory motifs in promoter region of MaPSY genes were correlated with the expression pattern during various stress (abscisic acid, methyl jasmonate, salicylic acid and dark) treatments. The positive modulation of MaPSY1 noticed under abiotic stresses suggested its role in plant physiological functions and defense response. The amino acid sequence analysis of the PSY proteins in contrasting cultivars revealed that all PSY comprises conserved domains related to enzyme activity. Bacterial complementation assay has validated the functional activity of six PSY proteins and among them PSY1 of Nendran (Nen-PSY1) gave the highest activity. These data provide new insights into the regulation of PSY expression in banana by developmental and stress related signals that can be explored in the banana improvement programs. PMID:28421096

  10. Distinct Cell-Specific Expression of Homospermidine Synthase Involved in Pyrrolizidine Alkaloid Biosynthesis in Three Species of the Boraginales1[C][W][OA

    Science.gov (United States)

    Niemüller, Daniel; Reimann, Andreas; Ober, Dietrich

    2012-01-01

    Homospermidine synthase (HSS) is the first specific enzyme in pyrrolizidine alkaloid (PA) biosynthesis, a pathway involved in the plant’s chemical defense. HSS has been shown to be recruited repeatedly by duplication of a gene involved in primary metabolism. Within the lineage of the Boraginales, only one gene duplication event gave rise to HSS. Here, we demonstrate that the tissue-specific expression of HSS in three boraginaceous species, Heliotropium indicum, Symphytum officinale, and Cynoglossum officinale, is unique with respect to plant organ, tissue, and cell type. Within H. indicum, HSS is expressed exclusively in nonspecialized cells of the lower epidermis of young leaves and shoots. In S. officinale, HSS expression has been detected in the cells of the root endodermis and in leaves directly underneath developing inflorescences. In young roots of C. officinale, HSS is detected only in cells of the endodermis, but in a later developmental stage, additionally in the pericycle. The individual expression patterns are compared with those within the Senecioneae lineage (Asteraceae), where HSS expression is reproducibly found in specific cells of the endodermis and the adjacent cortex parenchyma of the roots. The individual expression patterns within the Boraginales species are discussed as being a requirement for the successful recruitment of HSS after gene duplication. The diversity of HSS expression within this lineage adds a further facet to the already diverse patterns of expression that have been observed for HSS in other PA-producing plant lineages, making this PA-specific enzyme one of the most diverse expressed proteins described in the literature. PMID:22566491

  11. Cyclophilin D Promotes Brain Mitochondrial F1FO ATP Synthase Dysfunction in Aging Mice.

    Science.gov (United States)

    Gauba, Esha; Guo, Lan; Du, Heng

    2017-01-01

    Brain aging is the known strongest risk factor for Alzheimer's disease (AD). In recent years, mitochondrial deficits have been proposed to be a common mechanism linking brain aging to AD. Therefore, to elucidate the causative mechanisms of mitochondrial dysfunction in aging brains is of paramount importance for our understanding of the pathogenesis of AD, in particular its sporadic form. Cyclophilin D (CypD) is a specific mitochondrial protein. Recent studies have shown that F1FO ATP synthase oligomycin sensitivity conferring protein (OSCP) is a binding partner of CypD. The interaction of CypD with OSCP modulates F1FO ATP synthase function and mediates mitochondrial permeability transition pore (mPTP) opening. Here, we have found that increased CypD expression, enhanced CypD/OSCP interaction, and selective loss of OSCP are prominent brain mitochondrial changes in aging mice. Along with these changes, brain mitochondria from the aging mice demonstrated decreased F1FO ATP synthase activity and defective F1FO complex coupling. In contrast, CypD deficient mice exhibited substantially mitigated brain mitochondrial F1FO ATP synthase dysfunction with relatively preserved mitochondrial function during aging. Interestingly, the aging-related OSCP loss was also dramatically attenuated by CypD depletion. Therefore, the simplest interpretation of this study is that CypD promotes F1FO ATP synthase dysfunction and the resultant mitochondrial deficits in aging brains. In addition, in view of CypD and F1FO ATP synthase alterations seen in AD brains, the results further suggest that CypD-mediated F1FO ATP synthase deregulation is a shared mechanism linking mitochondrial deficits in brain aging and AD.

  12. Exercise-induced prostacyclin release positively correlates with VO(2max) in young healthy men.

    Science.gov (United States)

    Zoladz, J A; Majerczak, J; Duda, K; Chłopicki, S

    2009-01-01

    In this study we have evaluated the effect of maximal incremental cycling exercise (IE) on the systemic release of prostacyclin (PGI(2)), assessed as plasma 6-keto-PGF(1alpha) concentration in young healthy men. Eleven physically active - untrained men (mean +/- S.D.) aged 22.7 +/- 2.1 years; body mass 76.3 +/- 9.1 kg; BMI 23.30 +/- 2.18 kg . m(-2); maximal oxygen uptake (VO(2max)) 46.5 +/- 3.9 ml . kg(-1) . min(-1), performed an IE test until exhaustion. Plasma concentrations of 6-keto-PGF(1alpha), lactate, and cytokines were measured in venous blood samples taken prior to the exercise and at the exhaustion. The net exercise-induced increase in 6-keto-PGF(1alpha) concentration, expressed as the difference between the end-exercise minus pre-exercise concentration positively correlated with VO(2max) (r=0.78, p=0.004) as well as with the net VO(2) increase at exhaustion (r=0.81, p=0.003), but not with other respiratory, cardiac, metabolic or inflammatory parameters of the exercise (minute ventilation, heart rate, plasma lactate, IL-6 or TNF-alpha concentrations). The exercise-induced increase in 6-keto-PGF(1alpha) concentration?? was significantly higher (p=0.008) in a group of subjects (n=5) with the highest VO(2max) when compared to the group of subjects with the lowest VO(2max), in which no increase in 6-keto-PGF(1alpha) concentration was found. In conclusion, we demonstrated, to our knowledge for the first time, that exercise-induced release of PGI(2) in young healthy men correlates with VO(2max), suggesting that vascular capacity to release PGI(2) in response to physical exercise represents an important factor characterizing exercise tolerance. Moreover, we postulate that the impairment of exercise-induced release of PGI(2) leads to the increased cardiovascular hazard of vigorous exercise.

  13. Nitric Oxide Synthase Enzymes in the Airways of Mice Exposed to Ovalbumin: NOS2 Expression Is NOS3 Dependent

    Directory of Open Access Journals (Sweden)

    Jennifer M. Bratt

    2010-01-01

    Full Text Available Objectives and Design. The function of the airway nitric oxide synthase (NOS isoforms and the lung cell types responsible for its production are not fully understood. We hypothesized that NO homeostasis in the airway is important to control inflammation, which requires upregulation, of NOS2 protein expression by an NOS3-dependent mechanism. Materials or Subjects. Mice from a C57BL/6 wild-type, NOS1−/−, NOS2−/−, and NOS3−/− genotypes were used. All mice strains were systemically sensitized and exposed to filtered air or ovalbumin (OVA aerosol for two weeks to create a subchronic model of allergen-induced airway inflammation. Methods. We measured lung function, lung lavage inflammatory and airway epithelial goblet cell count, exhaled NO, nitrate and nitrite concentration, and airway NOS1, NOS2, and NOS3 protein content. Results. Deletion of NOS1 or NOS3 increases NOS2 protein present in the airway epithelium and smooth muscle of air-exposed animals. Exposure to allergen significantly reduced the expression of NOS2 protein in the airway epithelium and smooth muscle of the NOS3−/− strain only. This reduction in NOS2 expression was not due to the replacement of epithelial cells with goblet cells as remaining epithelial cells did not express NOS2. NOS1−/− animals had significantly reduced goblet cell metaplasia compared to C57Bl/6 wt, NOS2−/−, and NOS3−/− allergen-exposed mice. Conclusion. The airway epithelial and smooth muscle cells maintain a stable airway NO concentration under noninflammatory conditions. This “homeostatic” mechanism is unable to distinguish between NOS derived from the different constitutive NOS isoforms. NOS3 is essential for the expression of NOS2 under inflammatory conditions, while NOS1 expression contributes to allergen-induced goblet cell metaplasia.

  14. Nitric Oxide Synthase Enzymes in the Airways of Mice Exposed to Ovalbumin: NOS2 Expression Is NOS3 Dependent

    Science.gov (United States)

    Bratt, Jennifer M.; Williams, Keisha; Rabowsky, Michelle F.; Last, Michael S.; Franzi, Lisa M.; Last, Jerold A.; Kenyon, Nicholas J.

    2010-01-01

    Objectives and Design. The function of the airway nitric oxide synthase (NOS) isoforms and the lung cell types responsible for its production are not fully understood. We hypothesized that NO homeostasis in the airway is important to control inflammation, which requires upregulation, of NOS2 protein expression by an NOS3-dependent mechanism. Materials or Subjects. Mice from a C57BL/6 wild-type, NOS1−/−, NOS2−/−, and NOS3−/− genotypes were used. All mice strains were systemically sensitized and exposed to filtered air or ovalbumin (OVA) aerosol for two weeks to create a subchronic model of allergen-induced airway inflammation. Methods. We measured lung function, lung lavage inflammatory and airway epithelial goblet cell count, exhaled NO, nitrate and nitrite concentration, and airway NOS1, NOS2, and NOS3 protein content. Results. Deletion of NOS1 or NOS3 increases NOS2 protein present in the airway epithelium and smooth muscle of air-exposed animals. Exposure to allergen significantly reduced the expression of NOS2 protein in the airway epithelium and smooth muscle of the NOS3−/− strain only. This reduction in NOS2 expression was not due to the replacement of epithelial cells with goblet cells as remaining epithelial cells did not express NOS2. NOS1−/− animals had significantly reduced goblet cell metaplasia compared to C57Bl/6 wt, NOS2−/−, and NOS3−/− allergen-exposed mice. Conclusion. The airway epithelial and smooth muscle cells maintain a stable airway NO concentration under noninflammatory conditions. This “homeostatic” mechanism is unable to distinguish between NOS derived from the different constitutive NOS isoforms. NOS3 is essential for the expression of NOS2 under inflammatory conditions, while NOS1 expression contributes to allergen-induced goblet cell metaplasia. PMID:20953358

  15. Use of linalool synthase in genetic engineering of scent production

    Science.gov (United States)

    Pichersky, Eran

    1998-01-01

    A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed.

  16. Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

    International Nuclear Information System (INIS)

    Dotson, G.D.; Woodard, R.W.

    1994-01-01

    The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O

  17. Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

    Energy Technology Data Exchange (ETDEWEB)

    Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)

    1994-12-01

    The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.

  18. Converting S-limonene synthase to pinene or phellandrene synthases reveals the plasticity of the active site.

    Science.gov (United States)

    Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong

    2017-05-01

    S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Directory of Open Access Journals (Sweden)

    Yue Ming

    2009-06-01

    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

  20. Ectopic Terpene Synthase Expression Enhances Sesquiterpene Emission in Nicotiana attenuata without Altering Defense or Development of Transgenic Plants or Neighbors1[W

    Science.gov (United States)

    Schuman, Meredith C.; Palmer-Young, Evan C.; Schmidt, Axel; Gershenzon, Jonathan; Baldwin, Ian T.

    2014-01-01

    Sesquiterpenoids, with approximately 5,000 structures, are the most diverse class of plant volatiles with manifold hypothesized functions in defense, stress tolerance, and signaling between and within plants. These hypotheses have often been tested by transforming plants with sesquiterpene synthases expressed behind the constitutively active 35S promoter, which may have physiological costs measured as inhibited growth and reduced reproduction or may require augmentation of substrate pools to achieve enhanced emission, complicating the interpretation of data from affected transgenic lines. Here, we expressed maize (Zea mays) terpene synthase10 (ZmTPS10), which produces (E)-α-bergamotene and (E)-β-farnesene, or a point mutant ZmTPS10M, which produces primarily (E)-β-farnesene, under control of the 35S promoter in the ecological model plant Nicotiana attenuata. Transgenic N. attenuata plants had specifically enhanced emission of target sesquiterpene(s) with no changes detected in their emission of any other volatiles. Treatment with herbivore or jasmonate elicitors induces emission of (E)-α-bergamotene in wild-type plants and also tended to increase emission of (E)-α-bergamotene and (E)-β-farnesene in transgenics. However, transgenics did not differ from the wild type in defense signaling or chemistry and did not alter defense chemistry in neighboring wild-type plants. These data are inconsistent with within-plant and between-plant signaling functions of (E)-β-farnesene and (E)-α-bergamotene in N. attenuata. Ectopic sesquiterpene emission was apparently not costly for transgenics, which were similar to wild-type plants in their growth and reproduction, even when forced to compete for common resources. These transgenics would be well suited for field experiments to investigate indirect ecological effects of sesquiterpenes for a wild plant in its native habitat. PMID:25187528

  1. Friedelin Synthase from Maytenus ilicifolia: Leucine 482 Plays an Essential Role in the Production of the Most Rearranged Pentacyclic Triterpene

    Science.gov (United States)

    Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.

    2016-11-01

    Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.

  2. Quantification of extracorporal platelet deposition in cardiopulmonary bypass: Effects of ZK 36374, a prostacyclin analogue

    Energy Technology Data Exchange (ETDEWEB)

    Martin, W.; Spyt, T.; Wheatley, D.J.; Thomas, I.; Davidson, J.F.

    1989-03-01

    The degree of extracorporal platelet sequestration in 32 patients undergoing cardiopulmonary bypass has been assessed using /sup 111/In labelled platelets and both a shadow shield whole body monitor and a standard gamma camera. The effects of ZK 36374, a prostacyclin analogue, on deposition of platelets in the oxygenator and atrial line filter were also investigated. Total platelet deposition in the placebo group ranged from 2.2% to 31.7%, mean 13.9+-7.8%; n=15, and was significantly higher than the deposition in the treatment group, range 0.7% to 9.4%, mean 3.9+-2.6%; n=16, P < 0.001. There was also a highly significant correlation between the gamma camera and whole body monitor measurements, r=0.99, P < 0.001, with no systematic difference between the techniques. This study demonstrates that accurate quantitative assessment of platelet deposition can be achieved with either the gamma camera or whole body monitor. In addition, significant reduction in platelet sequestration in the extracorporal circuit can be achieved by using ZK 36374 during the bypass operation.

  3. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  4. From bacterial to human dihydrouridine synthase: automated structure determination

    Energy Technology Data Exchange (ETDEWEB)

    Whelan, Fiona, E-mail: fiona.whelan@york.ac.uk; Jenkins, Huw T., E-mail: fiona.whelan@york.ac.uk [The University of York, Heslington, York YO10 5DD (United Kingdom); Griffiths, Samuel C. [University of Oxford, Headington, Oxford OX3 7BN (United Kingdom); Byrne, Robert T. [Ludwig-Maximilians-University Munich, Feodor-Lynen-Strasse 25, 81377 Munich (Germany); Dodson, Eleanor J.; Antson, Alfred A., E-mail: fiona.whelan@york.ac.uk [The University of York, Heslington, York YO10 5DD (United Kingdom)

    2015-06-30

    The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr-rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer.

  5. From bacterial to human dihydrouridine synthase: automated structure determination

    International Nuclear Information System (INIS)

    Whelan, Fiona; Jenkins, Huw T.; Griffiths, Samuel C.; Byrne, Robert T.; Dodson, Eleanor J.; Antson, Alfred A.

    2015-01-01

    The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr-rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer

  6. Chitin synthases from Saprolegnia are involved in tip growth and represent a potential target for anti-oomycete drugs.

    Directory of Open Access Journals (Sweden)

    Gea Guerriero

    Full Text Available Oomycetes represent some of the most devastating plant and animal pathogens. Typical examples are Phytophthora infestans, which causes potato and tomato late blight, and Saprolegnia parasitica, responsible for fish diseases. Despite the economical and environmental importance of oomycete diseases, their control is difficult, particularly in the aquaculture industry. Carbohydrate synthases are vital for hyphal growth and represent interesting targets for tackling the pathogens. The existence of 2 different chitin synthase genes (SmChs1 and SmChs2 in Saprolegnia monoica was demonstrated using bioinformatics and molecular biology approaches. The function of SmCHS2 was unequivocally demonstrated by showing its catalytic activity in vitro after expression in Pichia pastoris. The recombinant SmCHS1 protein did not exhibit any activity in vitro, suggesting that it requires other partners or effectors to be active, or that it is involved in a different process than chitin biosynthesis. Both proteins contained N-terminal Microtubule Interacting and Trafficking domains, which have never been reported in any other known carbohydrate synthases. These domains are involved in protein recycling by endocytosis. Enzyme kinetics revealed that Saprolegnia chitin synthases are competitively inhibited by nikkomycin Z and quantitative PCR showed that their expression is higher in presence of the inhibitor. The use of nikkomycin Z combined with microscopy showed that chitin synthases are active essentially at the hyphal tips, which burst in the presence of the inhibitor, leading to cell death. S. parasitica was more sensitive to nikkomycin Z than S. monoica. In conclusion, chitin synthases with species-specific characteristics are involved in tip growth in Saprolegnia species and chitin is vital for the micro-organisms despite its very low abundance in the cell walls. Chitin is most likely synthesized transiently at the apex of the cells before cellulose, the major

  7. Quantitative proteomic analysis of human lung tumor xenografts treated with the ectopic ATP synthase inhibitor citreoviridin.

    Directory of Open Access Journals (Sweden)

    Yi-Hsuan Wu

    Full Text Available ATP synthase is present on the plasma membrane of several types of cancer cells. Citreoviridin, an ATP synthase inhibitor, selectively suppresses the proliferation and growth of lung cancer without affecting normal cells. However, the global effects of targeting ectopic ATP synthase in vivo have not been well defined. In this study, we performed quantitative proteomic analysis using isobaric tags for relative and absolute quantitation (iTRAQ and provided a comprehensive insight into the complicated regulation by citreoviridin in a lung cancer xenograft model. With high reproducibility of the quantitation, we obtained quantitative proteomic profiling with 2,659 proteins identified. Bioinformatics analysis of the 141 differentially expressed proteins selected by their relative abundance revealed that citreoviridin induces alterations in the expression of glucose metabolism-related enzymes in lung cancer. The up-regulation of enzymes involved in gluconeogenesis and storage of glucose indicated that citreoviridin may reduce the glycolytic intermediates for macromolecule synthesis and inhibit cell proliferation. Using comprehensive proteomics, the results identify metabolic aspects that help explain the antitumorigenic effect of citreoviridin in lung cancer, which may lead to a better understanding of the links between metabolism and tumorigenesis in cancer therapy.

  8. TNF-Mediated Restriction of Arginase 1 Expression in Myeloid Cells Triggers Type 2 NO Synthase Activity at the Site of Infection

    Directory of Open Access Journals (Sweden)

    Ulrike Schleicher

    2016-05-01

    Full Text Available Neutralization or deletion of tumor necrosis factor (TNF causes loss of control of intracellular pathogens in mice and humans, but the underlying mechanisms are incompletely understood. Here, we found that TNF antagonized alternative activation of macrophages and dendritic cells by IL-4. TNF inhibited IL-4-induced arginase 1 (Arg1 expression by decreasing histone acetylation, without affecting STAT6 phosphorylation and nuclear translocation. In Leishmania major-infected C57BL/6 wild-type mice, type 2 nitric oxide (NO synthase (NOS2 was detected in inflammatory dendritic cells or macrophages, some of which co-expressed Arg1. In TNF-deficient mice, Arg1 was hyperexpressed, causing an impaired production of NO in situ. A similar phenotype was seen in L. major-infected BALB/c mice. Arg1 deletion in hematopoietic cells protected these mice from an otherwise lethal disease, although their disease-mediating T cell response (Th2, Treg was maintained. Thus, deletion or TNF-mediated restriction of Arg1 unleashes the production of NO by NOS2, which is critical for pathogen control.

  9. Crystallization and preliminary crystallographic analysis of a novel plant type III polyketide synthase that produces pentaketide chromone

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin [ZOEGENE Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Tsuyoshi; Noguchi, Hiroshi [School of Pharmaceutical Sciences and the COE21 Program, University of Shizuoka, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: ssugio@rc.m-kagaku.co.jp [ZOEGENE Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: ssugio@rc.m-kagaku.co.jp [School of Pharmaceutical Sciences and the COE21 Program, University of Shizuoka, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: ssugio@rc.m-kagaku.co.jp [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)

    2006-09-01

    Pentaketide chromone synthase from A. arborescens has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 1.6 Å. Pentaketide chromone synthase (PCS) from Aloe arborescens is a novel plant-specific type III polyketide synthase that catalyzes the formation of 5,7-dihydroxy-2-methylchromone from five molecules of malonyl-CoA. Recombinant PCS expressed in Escherichia coli was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 73.2, b = 88.4, c = 70.0 Å, α = γ = 90.0, β = 95.6°. Diffraction data were collected to 1.6 Å resolution using synchrotron radiation at BL24XU of SPring-8.

  10. Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd.

    Science.gov (United States)

    Jin, Mei Lan; Lee, Woo Moon; Kim, Ok Tae

    2017-11-15

    Oxidosqualene cyclases (OSCs) are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA), RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated) were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG) values calculated by fragments per kilobase million (FPKM). In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1 , and PtCAS2 , were found, in addition to the PtBS (β-amyrin synthase) gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia . All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.

  11. Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd

    Directory of Open Access Journals (Sweden)

    Mei Lan Jin

    2017-11-01

    Full Text Available Oxidosqualene cyclases (OSCs are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA, RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG values calculated by fragments per kilobase million (FPKM. In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1, and PtCAS2, were found, in addition to the PtBS (β-amyrin synthase gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia. All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.

  12. Functional expression and characterization of five wax ester synthases in Saccharomyces cerevisiae and their utility for biodiesel production

    Directory of Open Access Journals (Sweden)

    Shi Shuobo

    2012-02-01

    Full Text Available Abstract Background Wax ester synthases (WSs can synthesize wax esters from alcohols and fatty acyl coenzyme A thioesters. The knowledge of the preferred substrates for each WS allows the use of yeast cells for the production of wax esters that are high-value materials and can be used in a variety of industrial applications. The products of WSs include fatty acid ethyl esters, which can be directly used as biodiesel. Results Here, heterologous WSs derived from five different organisms were successfully expressed and evaluated for their substrate preference in Saccharomyces cerevisiae. We investigated the potential of the different WSs for biodiesel (that is, fatty acid ethyl esters production in S. cerevisiae. All investigated WSs, from Acinetobacter baylyi ADP1, Marinobacter hydrocarbonoclasticus DSM 8798, Rhodococcus opacus PD630, Mus musculus C57BL/6 and Psychrobacter arcticus 273-4, have different substrate specificities, but they can all lead to the formation of biodiesel. The best biodiesel producing strain was found to be the one expressing WS from M. hydrocarbonoclasticus DSM 8798 that resulted in a biodiesel titer of 6.3 mg/L. To further enhance biodiesel production, acetyl coenzyme A carboxylase was up-regulated, which resulted in a 30% increase in biodiesel production. Conclusions Five WSs from different species were functionally expressed and their substrate preference characterized in S. cerevisiae, thus constructing cell factories for the production of specific kinds of wax ester. WS from M. hydrocarbonoclasticus showed the highest preference for ethanol compared to the other WSs, and could permit the engineered S. cerevisiae to produce biodiesel.

  13. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    International Nuclear Information System (INIS)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A.; Nusrat, Asma

    2010-01-01

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  14. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    Energy Technology Data Exchange (ETDEWEB)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)

    2010-07-02

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  15. Cloning of a sesquiterpene synthase from Lavandula x intermedia glandular trichomes.

    Science.gov (United States)

    Sarker, Lukman S; Demissie, Zerihun A; Mahmoud, Soheil S

    2013-11-01

    The essential oil (EO) of Lavandula is dominated by monoterpenes, but can also contain small amounts of sesquiterpenes, depending on species and environmental conditions. For example, the sesquiterpene 9-epi-caryophyllene can make up to 8 % of the EO in a few species, including those commercially propagated for EO production. Here, we report the cloning and functional characterization of 9-epi-caryophyllene synthase (LiCPS) from the glandular trichomes of Lavandula x intermedia, cv. Grosso. The 1,617 bp open reading frame of LiCPS, which did not encode a transit peptide, was expressed in Escherichia coli and the recombinant protein purified by Ni-NTA agarose affinity chromatography. The ca. 60 kDa recombinant protein specifically converted farnesyl diphosphate to 9-epi-caryophyllene. LiCPS also produced a few monoterpenes when assayed with the monoterpene precursor geranyl diphosphate (GPP), but--unlike most monoterpene synthases--was not able to derive detectable amounts of any products from the cis isomer of GPP, neryl diphosphate. The LiCPS transcripts accumulated in developing L. x intermedia flowers and were highly enriched in glandular trichomes, but were not detected in leaves suggesting that the transcriptional expression of this gene is spatially and developmentally regulated.

  16. Phenotype commitment in vascular smooth muscle cells derived from coronary atherosclerotic plaques: differential gene expression of endothelial Nitric Oxide Synthase

    Directory of Open Access Journals (Sweden)

    ML Rossi

    2009-06-01

    Full Text Available Unstable angina and myocardial infarction are the clinical manifestations of the abrupt thrombotic occlusion of an epicardial coronary artery as a result of spontaneous atherosclerotic plaque rupture or fissuring, and the exposure of highly thrombogenic material to blood. It has been demonstrated that the proliferation of vascular smooth muscle cells (VSMCs and impaired bioavailabilty of nitric oxide (NO are among the most important mechanisms involved in the progression of atherosclerosis. It has also been suggested that a NO imbalance in coronary arteries may be involved in myocardial ischemia as a result of vasomotor dysfunction triggering plaque rupture and the thrombotic response. We used 5’ nuclease assays (TaqMan™ PCRs to study gene expression in coronary plaques collected by means of therapeutic directional coronary atherectomy from 15 patients with stable angina (SA and 15 with acute coronary syndromes (ACS without ST elevation. Total RNA was extracted from the 30 plaques and the cDNA was amplified in order to determine endothelial nitric oxide synthase (eNOS gene expression. Analysis of the results showed that the expression of eNOS was significantly higher (p<0.001 in the plaques from the ACS patients. Furthermore, isolated VSMCs from ACS and SA plaques confirmed the above pattern even after 25 plating passages. In situ RT-PCR was also carried out to co-localize the eNOS messengers and the VSMC phenotype.

  17. A Comparison of the Effects of Neuronal Nitric Oxide Synthase and Inducible Nitric Oxide Synthase Inhibition on Cartilage Damage

    Directory of Open Access Journals (Sweden)

    Nevzat Selim Gokay

    2016-01-01

    Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.

  18. Expression of Nitric Oxide Synthase Isoenzyme in Lung Tissue of Smokers with and without Chronic Obstructive Pulmonary Disease

    Directory of Open Access Journals (Sweden)

    Wen-Ting Jiang

    2015-01-01

    Full Text Available Background: It has been demonstrated that only 10%-20% cigarette smokers finally suffer chronic obstructive pulmonary disease (COPD. The underlying mechanism of development remains uncertain so far. Nitric oxide (NO has been found to be closely associated with the pathogenesis of COPD, the alteration of NO synthase (NOS expression need to be revealed. The study aimed to investigate the alterations of NOS isoforms expressions between smokers with and without COPD, which might be helpful for identifying the susceptibility of smokers developing into COPD. Methods: Peripheral lung tissues were obtained from 10 nonsmoker control subjects, 15 non-COPD smokers, and 15 smokers with COPD. Neuronal NOS (nNOS, inducible NOS (iNOS, and endothelial NOS (eNOS mRNA and protein levels were measured in each sample by using real-time polymerase chain reaction and Western blotting. Results: INOS mRNA was significantly increased in patients with COPD compared with nonsmokers and smokers with normal lung function (P < 0.001, P = 0.001, respectively. iNOS protein was also higher in COPD patients than nonsmokers and smokers with normal lung function (P < 0.01 and P = 0.01, respectively. However, expressions of nNOS and eNOS did not differ among nonsmokers, smokers with and without COPD. Furthermore, there was a negative correlation between iNOS protein level and lung function parameters forced expiratory volume in 1 s (FEV 1 (% predicted (r = −0.549, P = 0.001 and FEV 1 /forced vital capacity (%, r = −0.535, P = 0.001. Conclusions: The expression of iNOS significantly increased in smokers with COPD compared with that in nonsmokers or smokers without COPD. The results suggest that iNOS might be involved in the pathogenesis of COPD, and may be a potential marker to identify the smokers who have more liability to suffer COPD.

  19. Disruption of ATCSLD5 results in reduced growth, reduced xylan and homogalacturonan synthase activity and altered xylan occurrence in Arabidopsis

    DEFF Research Database (Denmark)

    Bernal Giraldo, Adriana Jimena; Jensen, Jacob Krüger; Harholt, Jesper

    2007-01-01

    Members of a large family of cellulose synthase-like genes (CSLs) are predicted to encode glycosyl transferases (GTs) involved in the biosynthesis of plant cell walls. The CSLA and CSLF families are known to contain mannan and glucan synthases, respectively, but the products of other CSLs...... are unknown. Here we report the effects of disrupting ATCSLD5 expression in Arabidopsis. Both stem and root growth were significantly reduced in ATCSLD5 knock-out plants, and these plants also had increased susceptibility to the cellulose synthase inhibitor isoxaben. Antibody and carbohydrate-binding module...

  20. Molecular cloning of a seed specific multifunctional RFO synthase/ galactosylhydrolase in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Roman eGangl

    2015-09-01

    Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.

  1. A highly prevalent equine glycogen storage disease is explained by constitutive activation of a mutant glycogen synthase

    DEFF Research Database (Denmark)

    Maile, C A; Hingst, Janne Rasmuss; Mahalingan, K K

    2017-01-01

    BACKGROUND: Equine type 1 polysaccharide storage myopathy (PSSM1) is associated with a missense mutation (R309H) in the glycogen synthase (GYS1) gene, enhanced glycogen synthase (GS) activity and excessive glycogen and amylopectate inclusions in muscle. METHODS: Equine muscle biochemical...... had significantly higher glycogen content than control horse muscle despite no difference in GS expression. GS activity was significantly higher in muscle from homozygous mutants than from heterozygote and control horses, in the absence and presence of the allosteric regulator, glucose 6 phosphate (G6...

  2. Microsomal prostaglandin E synthase-1 in rheumatic diseases

    Directory of Open Access Journals (Sweden)

    Marina eKorotkova

    2011-01-01

    Full Text Available Microsomal prostaglandin E synthase-1 (mPGES-1 is a well recognized target for the development of novel anti-inflammatory drugs that can reduce symptoms of inflammation in rheumatic diseases and other inflammatory conditions. In this review, we focus on mPGES-1 in rheumatic diseases with the aim to cover the most recent advances in the understanding of mPGES-1 in rheumatoid arthritis, osteoarthritis and inflammatory myopathies. Novel findings regarding regulation of mPGES1 cell expression as well as enzyme inhibitors are also summarized.

  3. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    International Nuclear Information System (INIS)

    Gou, Ke-Mian; Chang, Chia-Chun; Shen, Qing-Ji; Sung, Li-Ying; Liu, Ji-Long

    2014-01-01

    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus

  4. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    Energy Technology Data Exchange (ETDEWEB)

    Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: liyingsung@ntu.edu.tw [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)

    2014-04-15

    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.

  5. Flavonoids from artichoke (Cynara scolymus L.) up-regulate endothelial-type nitric-oxide synthase gene expression in human endothelial cells.

    Science.gov (United States)

    Li, Huige; Xia, Ning; Brausch, Isolde; Yao, Ying; Förstermann, Ulrich

    2004-09-01

    Nitric oxide (NO) produced by endothelial nitric-oxide synthase (eNOS) represents an antithrombotic and anti-atherosclerotic principle in the vasculature. Hence, an enhanced expression of eNOS in response to pharmacological interventions could provide protection against cardiovascular diseases. In EA.hy 926 cells, a cell line derived from human umbilical vein endothelial cells (HUVECs), an artichoke leaf extract (ALE) increased the activity of the human eNOS promoter (determined by luciferase reporter gene assay). An organic subfraction from ALE was more potent in this respect than the crude extract, whereas an aqueous subfraction of ALE was without effect. ALE and the organic subfraction thereof also increased eNOS mRNA expression (measured by an RNase protection assay) and eNOS protein expression (determined by Western blot) both in EA.hy 926 cells and in native HUVECs. NO production (measured by NO-ozone chemiluminescence) was increased by both extracts. In organ chamber experiments, ex vivo incubation (18 h) of rat aortic rings with the organic subfraction of ALE enhanced the NO-mediated vasodilator response to acetylcholine, indicating that the up-regulated eNOS remained functional. Caffeoylquinic acids and flavonoids are two major groups of constituents of ALE. Interestingly, the flavonoids luteolin and cynaroside increased eNOS promoter activity and eNOS mRNA expression, whereas the caffeoylquinic acids cynarin and chlorogenic acid were without effect. Thus, in addition to the lipid-lowering and antioxidant properties of artichoke, an increase in eNOS gene transcription may also contribute to its beneficial cardiovascular profile. Artichoke flavonoids are likely to represent the active ingredients mediating eNOS up-regulation.

  6. Glycogen synthase activation by sugars in isolated hepatocytes.

    Science.gov (United States)

    Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J

    1988-07-01

    We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.

  7. ACC synthase genes are polymorphic in watermelon (Citrullus spp.) and differentially expressed in flowers and in response to auxin and gibberellin.

    Science.gov (United States)

    Salman-Minkov, Ayelet; Levi, Amnon; Wolf, Shmuel; Trebitsh, Tova

    2008-05-01

    The flowering pattern of watermelon species (Citrullus spp.) is either monoecious or andromonoecious. Ethylene is known to play a critical role in floral sex determination of cucurbit species. In contrast to its feminizing effect in cucumber and melon, in watermelon ethylene promotes male flower development. In cucumber, the rate-limiting enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), regulates unisexual flower development. To investigate the role of ethylene in flower development, we isolated four genomic sequences of ACS from watermelon (CitACS1-4). Both CitACS1 and CitACS3 are expressed in floral tissue. CitACS1 is also expressed in vegetative tissue and it may be involved in cell growth processes. Expression of CitACS1 is up-regulated by exogenous treatment with auxin, gibberellin or ACC, the immediate precursor of ethylene. No discernible differential floral sex-dependent expression pattern was observed for this gene. The CitACS3 gene is expressed in open flowers and in young staminate floral buds (male or hermaphrodite), but not in female flowers. CitACS3 is also up-regulated by ACC, and is likely to be involved in ethylene-regulated anther development. The expression of CitACS2 was not detected in vegetative or reproductive organs but was up-regulated by auxin. CitACS4 transcript was not detected under our experimental conditions. Restriction fragment length polymorphism (RFLP) and sequence tagged site (STS) marker analyses of the CitACS genes showed polymorphism among and within the different Citrullus groups, including watermelon cultivars, Citrullus lanatus var. lanatus, the central subspecies Citrullus lanatus var. citroides, and the desert species Citrullus colocynthis (L).

  8. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Directory of Open Access Journals (Sweden)

    Meng eWang

    2013-05-01

    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  9. Antisense repression of sucrose phosphate synthase in transgenic muskmelon alters plant growth and fruit development

    International Nuclear Information System (INIS)

    Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao; Yu, Xiyan; Wang, Xiufeng

    2010-01-01

    To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.

  10. Antisense repression of sucrose phosphate synthase in transgenic muskmelon alters plant growth and fruit development

    Energy Technology Data Exchange (ETDEWEB)

    Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China); Yu, Xiyan, E-mail: yuxiyan@sdau.edu.cn [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China); Wang, Xiufeng, E-mail: xfwang@sdau.edu.cn [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China)

    2010-03-12

    To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.

  11. The role of hexokinases from grape berries (Vitis vinifera L.) in regulating the expression of cell wall invertase and sucrose synthase genes.

    Science.gov (United States)

    Wang, X Q; Li, L M; Yang, P P; Gong, C L

    2014-02-01

    In plants, hexokinase (HXK, EC 2.7.1.1) involved in hexose phosphorylation, plays an important role in sugar sensing and signaling. In this study, we found that at Phase I of grape berry development, lower hexose (glucose or fructose) levels were concomitant with higher HXK activities and protein levels. After the onset of ripening, we demonstrated a drastic reduction in HXK activity and protein levels accompanied by a rising hexose level. Therefore, our results revealed that HXK activity and protein levels had an inverse relationship with the endogenous glucose or fructose levels during grape berry development. A 51 kDa HXK protein band was detected throughout grape berry development. In addition, HXK located in the vacuoles, cytoplasm, nucleus, proplastid, chloroplast, and mitochondrion of the berry flesh cells. During grape berry development, HXK transcriptional level changed slightly, while cell wall invertase (CWINV) and sucrose synthase (SuSy) expression was enhanced after véraison stage. Intriguingly, when sliced grape berries were incubated in different glucose solutions, CWINV and SuSy expression was repressed by glucose, and the intensity of repression depended on glucose concentration and incubation time. After sliced, grape berries were treated with different glucose analogs, CWINV and SuSy expression analyses revealed that phosphorylation of hexoses by hexokinase was an essential component in the glucose-dependent CWINV and SuSy expression. In the meantime, mannoheptulose, a specific inhibitor of hexokinase, blocked the repression induced by glucose on CWINV and SuSy expression. It suggested that HXK played a major role in regulating CWINV and SuSy expression during grape berry development.

  12. Sequence heterogeneity of cannabidiolic- and tetrahydrocannabinolic acid-synthase in Cannabis sativa L. and its relationship with chemical phenotype.

    Science.gov (United States)

    Onofri, Chiara; de Meijer, Etienne P M; Mandolino, Giuseppe

    2015-08-01

    Sequence variants of THCA- and CBDA-synthases were isolated from different Cannabis sativa L. strains expressing various wild-type and mutant chemical phenotypes (chemotypes). Expressed and complete sequences were obtained from mature inflorescences. Each strain was shown to have a different specificity and/or ability to convert the precursor CBGA into CBDA and/or THCA type products. The comparison of the expressed sequences led to the identification of different mutations, all of them due to SNPs. These SNPs were found to relate to the cannabinoid composition of the inflorescence at maturity and are therefore proposed to have a functional significance. The amount of variation was found to be higher within the CBDAS sequence family than in the THCAS family, suggesting a more recent evolution of THCA-forming enzymes from the CBDAS group. We therefore consider CBDAS as the ancestral type of these synthases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Preparation, crystallization and preliminary X-ray analysis of the methionine synthase (MetE) from Streptococcus mutans

    International Nuclear Information System (INIS)

    Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen; Liang, Yu-He; Su, Xiao-Dong

    2006-01-01

    Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni 2+ -chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution. The crystal belongs to space group P2 1 , with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°

  14. Threonine phosphorylation of rat liver glycogen synthase

    International Nuclear Information System (INIS)

    Arino, J.; Arro, M.; Guinovart, J.J.

    1985-01-01

    32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase

  15. Plant oxidosqualene metabolism: cycloartenol synthase-dependent sterol biosynthesis in Nicotiana benthamiana.

    Science.gov (United States)

    Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert

    2014-01-01

    The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative (http://solgenomics.net/) to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.

  16. Cloning and functional expression of the small subunit of acetolactate synthase from Nicotiana plumbaginifolia.

    Science.gov (United States)

    Hershey, H P; Schwartz, L J; Gale, J P; Abell, L M

    1999-07-01

    Acetolactate synthase (ALS) is the first committed step of branched-chain amino acid biosynthesis in plants and bacteria. The bacterial holoenzyme has been well characterized and is a tetramer of two identical large subunits (LSUs) of 60 kDa and two identical small subunits (SSUs) ranging in molecular mass from 9 to 17 kDa depending on the isozyme. The enzyme from plants is much less well characterized. Attempts to purify the protein have yielded an enzyme which appears to be an oligomer of LSUs, with the potential existence of a SSU for the plant enzyme remaining a matter of considerable speculation. We report here the discovery of a cDNA clone that encodes a SSU of plant ALS based upon the homology of the encoded peptide with various bacterial ALS SSUs. The plant ALS SSU is more than twice as large as any of its prokaryotic homologues and contains two domains that each encode a full-length copy of the prokaryotic SSU polypeptide. The cDNA clone was used to express Nicotiana plumbaginifolia SSU in Escherichia coli. Mixing a partially purified preparation of this SSU with the LSU of ALS from either N. plumbaginifolia or Arabidopsis thaliana results in both increased specific activity and increased stability of the enzymic activity. These results are consistent with those observed for the bacterial enzyme in similar experiments and represent the first functional demonstration of the existence of a SSU for plant ALS.

  17. Nitric oxide synthase expression and apoptotic cell death in brains of AIDS and AIDS dementia patients

    NARCIS (Netherlands)

    Vincent, V. A.; de Groot, C. J.; Lucassen, P. J.; Portegies, P.; Troost, D.; Tilders, F. J.; van Dam, A. M.

    1999-01-01

    To determine the occurrence and cellular localization of inducible nitric oxide synthase (iNOS), NOS activity and its association with cell death in brains of AIDS and AIDS dementia complex (ADC) patients. Post-mortem cerebral cortex tissue of eight AIDS patients, eight ADC patients and eight

  18. Cloning, expression, and characterization of recombinant nitric oxide synthase-like protein from Bacillus anthracis

    International Nuclear Information System (INIS)

    Midha, Shuchi; Mishra, Rajeev; Aziz, M.A.; Sharma, Meenakshi; Mishra, Ashish; Khandelwal, Puneet; Bhatnagar, Rakesh

    2005-01-01

    Nitric oxide synthase (NOS) is amongst a family of evolutionarily conserved enzymes, involved in a multi-turnover process that results in NO as a product. The significant role of NO in various pathological and physiological processes has created an interest in this enzyme from several perspectives. This study describes for the first time, cloning and expression of a NOS-like protein, baNOS, from Bacillus anthracis, a pathogenic bacterium responsible for causing anthrax. baNOS was expressed in Escherichia coli as a soluble and catalytically active enzyme. Homology models generated for baNOS indicated that the key structural features that are involved in the substrate and active site interaction have been highly conserved. Further, the behavior of baNOS in terms of heme-substrate interactions and heme-transitions was studied in detail. The optical perturbation spectra of the heme domain demonstrated that the ligands perturb the heme site in a ligand specific manner. baNOS forms a five-coordinate, high-spin complex with L-arginine analogs and a six-coordinate low-spin complex with inhibitor imidazole. Studies indicated that the binding of L-arginine, N ω -hydroxy-L-arginine, and imidazole produces various spectroscopic species that closely correspond to the equivalent complexes of mammalian NOS. The values of spectral binding constants further corroborated these results. The overall conservation of the key structural features and the correlation of heme-substrate interactions in baNOS and mammalian NOS, thus, point towards an interesting phenomenon of convergent evolution. Importantly, the NO generated by NOS of mammalian macrophages plays a potent role in antimicrobicidal activity. Because of the existence of high structural and behavioral similarity between mammalian NOS and baNOS, we propose that NO produced by B. anthracis may also have a pivotal pathophysiological role in anthrax infection. Therefore, this first report of characterization of a NOS-like protein

  19. Cross-species complementation of bacterial- and eukaryotic-type cardiolipin synthases

    Directory of Open Access Journals (Sweden)

    Petra Gottier

    2017-11-01

    Full Text Available The glycerophospholipid cardiolipin is a unique constituent of bacterial and mitochondrial membranes. It is involved in forming and stabilizing high molecular mass membrane protein complexes and in maintaining membrane architecture. Absence of cardiolipin leads to reduced efficiency of the electron transport chain, decreased membrane potential, and, ultimately, impaired respiratory metabolism. For the protozoan parasite Trypanosoma brucei cardiolipin synthesis is essential for survival, indicating that the enzymes involved in cardiolipin production represent potential drug targets. T. brucei cardiolipin synthase (TbCLS is unique as it belongs to the family of phospholipases D (PLD, harboring a prokaryotic-type cardiolipin synthase (CLS active site domain. In contrast, most other eukaryotic CLS, including the yeast ortholog ScCrd1, are members of the CDP-alcohol phosphatidyl­ transferase family. To study if these mechanistically distinct CLS enzymes are able to catalyze cardiolipin production in a cell that normally expresses a different type of CLS, we expressed TbCLS and ScCrd1 in CLS-deficient yeast and trypanosome strains, respectively. Our results show that TbCLS complemented cardiolipin production in CRD1 knockout yeast and partly restored wild-type colony forming capability under stress conditions. Remarkably, CL remodeling appeared to be impaired in the transgenic construct, suggesting that CL production and remodeling are tightly coupled processes that may require a clustering of the involved proteins into specific CL-synthesizing domains. In contrast, no complementation was observed by heterologous expression of ScCrd1 in conditional TbCLS knockout trypanosomes, despite proper mitochondrial targeting of the protein.

  20. Functional characterization of ent-copalyl diphosphate synthase from Andrographis paniculata with putative involvement in andrographolides biosynthesis.

    Science.gov (United States)

    Shen, Qinqin; Li, Lixia; Jiang, Yu; Wang, Qiang

    2016-01-01

    To characterize the ent-copalyl diphosphate (ent-CPP) synthase involved in the biosynthetic pathway of andrographolides in a medicinal plant, Andrographis paniculata. The ent-CPP synthase (ent-CPS) gene was cloned from A. paniculata and its encoded ApCPS was demonstrated to react with (E,E,E)-geranylgeranyl diphosphate to form ent-CPP through recombinant expression in Escherichia coli. Site-directed mutagenesis of the Asp to Ala in the conserved DXDD motif of ApCPS resulted in loss of function. One Arg is located in the conserved position close to DXDD motif indicating the involvement of ApCPS in specialized metabolism. In addition, RT-PCR analysis revealed that ApCPS was expressed in all tissues of A. paniculata at all growth stages, which is consistent with andrographolides accumulating in these organs. Methyl jasmonate induced ApCPS gene expression, matching inducible accumulation of andrographolides in vivo. ApCPS is the first ent-CPS characterized in A. paniculata and is suggested to be involved in biosynthesis of andrographolides that have high pharmaceutical values.

  1. Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

    Energy Technology Data Exchange (ETDEWEB)

    Nicholas C Carpita

    2009-04-20

    Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

  2. MicroRNA-433 negatively regulates the expression of thymidylate synthase (TYMS) responsible for 5-fluorouracil sensitivity in HeLa cells

    International Nuclear Information System (INIS)

    Gotanda, Keisuke; Hirota, Takeshi; Matsumoto, Nozomi; Ieiri, Ichiro

    2013-01-01

    Thymidylate synthase (TYMS) is an important folate-dependent enzyme in DNA synthesis and an important target for cancer chemotherapy. High TYMS expression levels in tumors are generally associated with resistance to 5-fluorouracil (5-FU). The cause of the variability in TYMS expression is still not fully understood, however, only a small proportion of the TYMS expression can be explained by TYMS genetic polymorphisms. The purpose of this study is to identify novel microRNAs (miRNAs) which regulate the expression of TYMS and to determine whether miRNAs binding to the 3′-untranslated region (UTR) of TYMS mRNA affect the proliferation of HeLa cells treated with 5-FU. An in silico search was performed to find potential binding sites of miRNAs in TYMS mRNA. The efficacy of predicted miRNAs at the 3′-UTR of TYMS mRNA was evaluated using a dual-luciferase reporter assay. TYMS mRNA and protein expression in HeLa cells was quantified with real-time RT-PCR and Western blotting, respectively. The effects of miR-433 on cell proliferative activity were determined by WST-8 assay. The overexpression of miR-433 was associated with significantly decreased reporter activity in the plasmid containing the 3′-UTR of TYMS mRNA (P < 0.01). The levels of TYMS mRNA and protein in HeLa cells were significantly decreased by the overexpression of miR-433 (P < 0.05). Furthermore, miR-433 increased inhibition of cell proliferation in HeLa cells treated with 5-FU at over 2.0 μM. The results indicate that miR-433 post-transcriptionally regulates the expression of TYMS mRNA and protein, and increases sensitivity to 5-FU in HeLa cells. This is the first report showing that a miRNA regulating TYMS expression has a significant impact on sensitivity to 5-FU treatment

  3. Starch granules size distribution in superior and inferior grains of wheat is related to enzyme activities and their gene expressions during grain filling

    DEFF Research Database (Denmark)

    Zhang, Chuanhui; Jiang, Dong; Liu, Fulai

    2010-01-01

    with the temporally change patterns of starch synthase activities and relative gene expression levels. For instance, activities of soluble and granule-bound starch synthases (designated SSS and GBSS) peaked at 20 and 24 DAF. Genes encoding isoforms of starch synthases expressed at different grain filling periods...

  4. Glycogen Synthase in Sertoli Cells: More Than Glycogenesis?

    Science.gov (United States)

    Maldonado, Rodrigo; Mancilla, Héctor; Villarroel-Espíndola, Franz; Slebe, Felipe; Slebe, Juan Carlos; Méndez, Raúl; Guinovart, Joan J; Concha, Ilona I

    2016-11-01

    Sertoli cell metabolism actively maintains the nutritional needs of germ cells. It has been described that after glucose incorporation in Sertoli cells, less than 1% is converted to glycogen suggesting low levels of glycogen synthase activity. Phosphorylation of muscle glycogen synthase (MGS) at serine 640 (pS640MGS) decreases its activity, and this form of the enzyme was discovered as a non-ribosomal protein that modulates the translation of a subset of transcripts in HeLa cells. The aim of our study was to functionally characterize MGS in cultured Sertoli cells, as well as to explore this new feature related to RNA molecules. We detected MGS in the cytoplasm of Sertoli cells as well as in the nuclei. The activity rates of the enzyme were extremely low indicating that MGS is expressed but almost inactive. Protein targeting to glycogen (PTG) overexpression was performed to activate MGS by dephosphorylation. PTG induced glycogen synthesis massively, confirming that this enzyme is present but inactive. This finding correlates with high levels of pS640MGS, which were assayed by phosphatase treatment. To explore a putative new function for MGS in Sertoli cells, we performed RNA immunoprecipitation coupled to microarray studies. The results revealed that MGS co-immunoprecipitated with the several mRNAs and also rRNAs. These findings indicate that MGS is expressed Sertoli cells but in an inactive form, and also support a possibly novel feature of this metabolic enzyme associated with RNA-related molecules. J. Cell. Biochem. 117: 2597-2607, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  5. Influence of age-related changes in nitric oxide synthase-expressing neurons in the rat supraoptic nucleus on inhibition of salivary secretion.

    Science.gov (United States)

    Tanaka, Takehiko; Tamada, Yoshitaka; Suwa, Fumihiko

    2008-02-01

    Age-related inhibition of salivary secretion has been demonstrated in rats, and the nitric oxide (NO) present in the supraoptic nucleus (SON) and the medial septal area has been reported to play an inhibitory role in the regulation of salivary secretion. In the present study, we investigated the age-related changes occurring in the NO synthase (NOS)-expressing neurons in the SON, which is related to the production of NO, and discussed the interrelation between the age-related changes in the NOS-expressing neurons and the age-related inhibition of salivary secretion. Nissl staining and reduced nicotinamide adenine dinucleotide phosphate diaphorase (NADPH-d) histochemistry were performed for young adult and aged rats. Quantitative analysis was also performed using the Nissl-stained and NADPH-d-positive neurons. Although the numbers of the Nissl-stained neurons did not change, significant age-related increases were detected in cell number, cell size and reactive density of the NADPH-d-positive neurons. Therefore, the production of NO in the SON neurons increased with age. We concluded that the age-related increase in the NO in the SON might be a factor that contributes to the age-related inhibition of salivary secretion.

  6. Isolation and characterization of an oxidosqualene cyclase gene encoding a β-amyrin synthase involved in Polygala tenuifolia Willd. saponin biosynthesis.

    Science.gov (United States)

    Jin, Mei Lan; Lee, Dae Young; Um, Yurry; Lee, Jeong Hoon; Park, Chun Geun; Jetter, Reinhard; Kim, Ok Tae

    2014-03-01

    Expression of PtBS (Polygala tenuifolia β-amyrin synthase) led to the production of β-amyrin as sole product. Polygala tenuifolia Willdenow is a rich source of triterpene saponins, onjisaponins and polygalasaponins, used as herbal medicine to treat phlegms and for detumescence in traditional Asian healing. The Polygala saponins share the oleanane backbone structure and are, therefore, likely synthesized via β-amyrin as a common precursor. We hypothesized that, in analogy to diverse other plant species, this central intermediate should be formed by a β-amyrin synthase catalyzing the complex cyclization of oxidosqualene. This member of the oxidosqualene cyclase (OSC) family of enzymes is thus defining an important branch point between primary and secondary metabolisms, and playing a crucial role in the control of oleanane-type triterpene saponin biosynthesis. From P. tenuifolia roots, we isolated an OSC cDNA containing a reading frame of 2,289 bp nucleotides. The predicted protein of 763 amino acids (molecular weight 87.353 kDa) showed particularly high amino acid sequence identities to known β-amyrin synthases (85-87 %) and was, therefore, named PtBS. Expression of PtBS in the triterpenoid synthase-deficient yeast mutant GIL77 led to the production of β-amyrin as sole product. qRT-PCR analysis of various P. tenuifolia organs showed that PtBS transcript levels were highest in the roots, consistent with onjisaponin accumulation patterns. Therefore, we conclude that PtBS is the β-amyrin synthase enzyme catalyzing the first committed step in the biosynthesis of onjisaponins and polygalasaponins in P. tenuifolia.

  7. Expression of glycogen synthase and phosphofructokinase in muscle from type 1 (insulin-dependent) diabetic patients before and after intensive insulin treatment

    DEFF Research Database (Denmark)

    Vestergaard, H; Andersen, P H; Lund, S

    1994-01-01

    The aim of the present study was to determine whether short-term appropriate insulinization of Type 1 (insulin-dependent) diabetic patients in long-term poor glycaemic control (HbA1C > 9.5%) was associated with an adaptive regulation of the activity and gene expression of key proteins in muscle...... glycogen storage and glycolysis: glycogen synthase and phosphofructokinase, respectively. In nine diabetic patients biopsies of quadriceps muscle were taken before and 24-h after intensified insulin therapy and compared to findings in eight control subjects. Subcutaneous injections of rapid acting insulin...... were given at 3-h intervals to improve glycaemic control in diabetic patients (fasting plasma glucose decreased from 20.8 +/- 0.8 to 8.7 +/- 0.8 mmol/l whereas fasting serum insulin increased from 59 +/- 8 to 173 +/- 3 pmol/l). Before intensified insulin therapy, analysis of muscle biopsies from...

  8. Preparation, crystallization and preliminary X-ray analysis of the methionine synthase (MetE) from Streptococcus mutans

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen; Liang, Yu-He, E-mail: liangyh@pku.edu.cn; Su, Xiao-Dong [National Laboratory of Protein Engineering and Plant Genetic Engineering, Peking University, Beijing 100871 (China); Department of Biochemistry and Molecular Biology, College of Life Sciences, Peking University, Beijing 100871 (China)

    2006-10-01

    Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution. The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.

  9. The Balance of Expression of Dihydroflavonol 4-reductase and Flavonol Synthase Regulates Flavonoid Biosynthesis and Red Foliage Coloration in Crabapples.

    Science.gov (United States)

    Tian, Ji; Han, Zhen-yun; Zhang, Jie; Hu, YuJing; Song, Tingting; Yao, Yuncong

    2015-07-20

    Red leaf color is an attractive trait of Malus families, including crabapple (Malus spp.); however, little is known about the molecular mechanisms that regulate the coloration. Dihydroflavonols are intermediates in the production of both colored anthocyanins and colorless flavonols, and this current study focused on the gene expression balance involved in the relative accumulation of these compounds in crabapple leaves. Levels of anthocyanins and the transcript abundances of the anthocyanin biosynthetic gene, dihydroflavonol 4-reductase (McDFR) and the flavonol biosynthetic gene, flavonol synthase (McFLS), were assessed during the leaf development in two crabapple cultivars, 'Royalty' and 'Flame'. The concentrations of anthocyanins and flavonols correlated with leaf color and we propose that the expression of McDFR and McFLS influences their accumulation. Further studies showed that overexpression of McDFR, or silencing of McFLS, increased anthocyanin production, resulting in red-leaf and red fruit peel phenotypes. Conversely, elevated flavonol production and green phenotypes in crabapple leaves and apple peel were observed when McFLS was overexpressed or McDFR was silenced. These results suggest that the relative activities of McDFR and McFLS are important determinants of the red color of crabapple leaves, via the regulation of the metabolic fate of substrates that these enzymes have in common.

  10. The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

    Science.gov (United States)

    Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

    2015-01-01

    The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

  11. Lithium ameliorates open-field and elevated plus maze behaviors, and brain phospho-glycogen synthase kinase 3-beta expression in fragile X syndrome model mice.

    Science.gov (United States)

    Chen, Xi; Sun, Weiwen; Pan, Ying; Yang, Quan; Cao, Kaiyi; Zhang, Jin; Zhang, Yizhi; Chen, Mincong; Chen, Feidi; Huang, Yueling; Dai, Lijun; Chen, Shengqiang

    2013-10-01

    To investigate whether lithium modifies open-field and elevated plus maze behavior, and brain phospho-glycogen synthase kinase 3 (P-GSK3beta) expression in Fmr1 knockout mice. One hundred and eighty FVB mice, including knockout and wild type, with an age of 30 days were used. An open-field and elevated plus maze was utilized to test behavior, while western blot was used to measure the P-GSK3beta expression. Six groups were formed: control (saline), lithium chloride 30, 60, 90, 120, and 200 mg/kg. The experiments were carried out in the Institute of Neuroscience, Second Affiliated Hospital of Guangzhou Medical University, Guangzhou, China between January and June 2012. Lithium significantly decreased total distance, crossing, central area time, and center entry in the open-field test (popen-arm tracking, open-arm entry, and open-arm time in the elevated plus maze (popen-field and elevated plus maze behaviors of Fmr1 knockout mice. This effect may be related to its enhancement of P-GSK3beta expression. Our findings suggest that lithium might have a therapeutic effect in fragile X syndrome.

  12. Inhibition by sodium nitroprusside of the expression of inducible nitric oxide synthase in rat neutrophils.

    OpenAIRE

    Mariotto, S; Cuzzolin, L; Adami, A; Del Soldato, P; Suzuki, H; Benoni, G

    1995-01-01

    A well-known nitric oxide (NO)-releasing compound, sodium nitroprusside (SNP), decreases in a dose-dependent manner NO synthase (NOS) activity induced in rat neutrophils by treatment with lipopolysaccharide (LPS). This inhibitory action of SNP seems not to be due to its direct effect on the enzyme activity. The strong nitrosonium ion (NO+) character of SNP could be responsible for its inhibition of NOS induction in neutrophils.

  13. Macrophages in lung tissue from patients with pulmonary emphysema express both inducible and endothelial nitric oxide synthase

    NARCIS (Netherlands)

    van Straaten, JFM; Postma, DS; Coers, W; Noordhoek, JA; Kauffman, HF; Timens, W

    To provide information concerning a possible biologic role of nitric oxide (NO) in smoking-related emphysema, we performed immunohistochemical studies in lung tissue from control subjects and patients with mild and severe emphysema We studied the presence of inducible and endothelial NO synthases

  14. Geranylgeranyl diphosphate synthase from Scoparia dulcis and Croton sublyratus. Plastid localization and conversion to a farnesyl diphosphate synthase by mutagenesis.

    Science.gov (United States)

    Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U

    2001-02-01

    cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.

  15. Expression of mismatch repair gene PMS2 in nasopharyngeal carcinoma and regulation by glycogen synthase kinase-3β in vivo and in vitro.

    Science.gov (United States)

    Fang, Jugao; Lei, Wenbin; Huang, Xiaoming; Li, Pingdong; Chen, Xiaohong; Zhu, Xiaolin; Wen, Weiping; Li, Huabin

    2012-02-01

    To evaluate the expression of mismatch repair gene PMS2 in human nasopharyngeal carcinoma (NPC) tissues and evaluate the effect of glycogen synthase kinase (GSK)-3β on PMS2 production in vivo and in vitro. The expression of PMS2 and inactivated phosphorylated GSK-3β(s9) was examined by immunohistochemical staining in 25 NPC tissues and the relation was determined by correlation analysis. The effect of GSK-3β transfection in CNE-2 cells on PMS2 production as well as cell apoptosis and chemosensitization were evaluated using small interference RNA (siRNA), immunoblotting and flow cytometric analysis in vitro. The expression of inactivated phosphorylated GSK-3β(s9) was found to negative correlated with PMS2 in vivo. And transfected GSK-3β was found to be able to enhance PMS2 production, and increase cell apoptosis in CNE-2 cells in combination with cisplatin administration in vitro. Inactivation of GSK-3β might be important for NPC tumorgenesis through negatively regulating PMS2 production, and enhanced PMS2 production by GSK-3β is beneficial for understanding the NPC tumorgenesis and developing potential strategy for future therapy. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  16. Examination of thromboxane synthase as a prognostic factor and therapeutic target in non-small cell lung cancer

    LENUS (Irish Health Repository)

    Cathcart, Mary-Clare

    2011-03-09

    Abstract Background Thromboxane synthase (TXS) metabolises prostaglandin H2 into thromboxanes, which are biologically active on cancer cells. TXS over-expression has been reported in a range of cancers, and associated with a poor prognosis. TXS inhibition induces cell death in-vitro, providing a rationale for therapeutic intervention. We aimed to determine the expression profile of TXS in NSCLC and if it is prognostic and\\/or a survival factor in the disease. Methods TXS expression was examined in human NSCLC and matched controls by western analysis and IHC. TXS metabolite (TXB2) levels were measured by EIA. A 204-patient NSCLC TMA was stained for COX-2 and downstream TXS expression. TXS tissue expression was correlated with clinical parameters, including overall survival. Cell proliferation\\/survival and invasion was examined in NSCLC cells following both selective TXS inhibition and stable TXS over-expression. Results TXS was over-expressed in human NSCLC samples, relative to matched normal controls. TXS and TXB2 levels were increased in protein (p < 0.05) and plasma (p < 0.01) NSCLC samples respectively. TXS tissue expression was higher in adenocarcinoma (p < 0.001) and female patients (p < 0.05). No significant correlation with patient survival was observed. Selective TXS inhibition significantly reduced tumour cell growth and increased apoptosis, while TXS over-expression stimulated cell proliferation and invasiveness, and was protective against apoptosis. Conclusion TXS is over-expressed in NSCLC, particularly in the adenocarcinoma subtype. Inhibition of this enzyme inhibits proliferation and induces apoptosis. Targeting thromboxane synthase alone, or in combination with conventional chemotherapy is a potential therapeutic strategy for NSCLC.

  17. Heterologous Expression of the Clostridium carboxidivorans CO Dehydrogenase Alone or Together with the Acetyl Coenzyme A Synthase Enables both Reduction of CO2 and Oxidation of CO by Clostridium acetobutylicum.

    Science.gov (United States)

    Carlson, Ellinor D; Papoutsakis, Eleftherios T

    2017-08-15

    With recent advances in synthetic biology, CO 2 could be utilized as a carbon feedstock by native or engineered organisms, assuming the availability of electrons. Two key enzymes used in autotrophic CO 2 fixation are the CO dehydrogenase (CODH) and acetyl coenzyme A (acetyl-CoA) synthase (ACS), which form a bifunctional heterotetrameric complex. The CODH/ACS complex can reversibly catalyze CO 2 to CO, effectively enabling a biological water-gas shift reaction at ambient temperatures and pressures. The CODH/ACS complex is part of the Wood-Ljungdahl pathway (WLP) used by acetogens to fix CO 2 , and it has been well characterized in native hosts. So far, only a few recombinant CODH/ACS complexes have been expressed in heterologous hosts, none of which demonstrated in vivo CO 2 reduction. Here, functional expression of the Clostridium carboxidivorans CODH/ACS complex is demonstrated in the solventogen Clostridium acetobutylicum , which was engineered to express CODH alone or together with the ACS. Both strains exhibited CO 2 reduction and CO oxidation activities. The CODH reactions were interrogated using isotopic labeling, thus verifying that CO was a direct product of CO 2 reduction, and vice versa. CODH apparently uses a native C. acetobutylicum ferredoxin as an electron carrier for CO 2 reduction. Heterologous CODH activity depended on actively growing cells and required the addition of nickel, which is inserted into CODH without the need to express the native Ni insertase protein. Increasing CO concentrations in the gas phase inhibited CODH activity and altered the metabolite profile of the CODH-expressing cells. This work provides the foundation for engineering a complete and functional WLP in nonnative host organisms. IMPORTANCE Functional expression of CO dehydrogenase (CODH) from Clostridium carboxidivorans was demonstrated in C. acetobutylicum , which is natively incapable of CO 2 fixation. The expression of CODH, alone or together with the C. carboxidivorans

  18. Production of Δ9-tetrahydrocannabinolic acid from cannabigerolic acid by whole cells of Pichia (Komagataella) pastoris expressing Δ9-tetrahydrocannabinolic acid synthase from Cannabis sativa L.

    Science.gov (United States)

    Zirpel, Bastian; Stehle, Felix; Kayser, Oliver

    2015-09-01

    The Δ9-tetrahydrocannabinolic acid synthase (THCAS) from Cannabis sativa was expressed intracellularly in different organisms to investigate the potential of a biotechnological production of Δ9-tetrahydrocannabinolic acid (THCA) using whole cells. Functional expression of THCAS was obtained in Saccharomyces cerevisiae and Pichia (Komagataella) pastoris using a signal peptide from the vacuolar protease, proteinase A. No functional expression was achieved in Escherichia coli. The highest volumetric activities obtained were 98 pkat ml(-1) (intracellular) and 44 pkat ml(-1) (extracellular) after 192 h of cultivation at 15 °C using P. pastoris cells. Low solubility of CBGA prevents the THCAS application in aqueous cell-free systems, thus whole cells were used for a bioconversion of cannabigerolic acid (CBGA) to THCA. Finally, 1 mM (0.36 g THCA l(-1)) THCA could be produced by 10.5 gCDW l(-1) before enzyme activity was lost. Whole cells of P. pastoris offer the capability of synthesizing pharmaceutical THCA production.

  19. Microsatellite instability and the association with plasma homocysteine and thymidylate synthase in colorectal cancer

    DEFF Research Database (Denmark)

    Jensen, Lars Henrik; Lindebjerg, Jan; Crüger, Dorthe G.

    2008-01-01

    , carcinoembryonic antigen, vitamin B12, and folate. Microsatellite instability of tumors was associated with higher levels of plasma homocysteine (p = 0.008) and higher protein expression of thymidylate synthase (p ... factors. CEA was not associated with neither homocysteine nor microsatellite instability. The data suggests that there is a more pronounced methyl unit deficiency in microsatellite instable tumors....

  20. Caveolin versus calmodulin. Counterbalancing allosteric modulators of endothelial nitric oxide synthase.

    Science.gov (United States)

    Michel, J B; Feron, O; Sase, K; Prabhakar, P; Michel, T

    1997-10-10

    Nitric oxide is synthesized in diverse mammalian tissues by a family of calmodulin-dependent nitric oxide synthases. The endothelial isoform of nitric oxide synthase (eNOS) is targeted to the specialized signal-transducing membrane domains termed plasmalemmal caveolae. Caveolin, the principal structural protein in caveolae, interacts with eNOS and leads to enzyme inhibition in a reversible process modulated by Ca2+-calmodulin (Michel, J. B., Feron, O., Sacks, D., and Michel, T. (1997) J. Biol. Chem. 272, 15583-15586). Caveolin also interacts with other structurally distinct signaling proteins via a specific region identified within the caveolin sequence (amino acids 82-101) that appears to subserve the role of a "scaffolding domain." We now report that the co-immunoprecipitation of eNOS with caveolin is completely and specifically blocked by an oligopeptide corresponding to the caveolin scaffolding domain. Peptides corresponding to this domain markedly inhibit nitric oxide synthase activity in endothelial membranes and interact directly with the enzyme to inhibit activity of purified recombinant eNOS expressed in Escherichia coli. The inhibition of purified eNOS by the caveolin scaffolding domain peptide is competitive and completely reversed by Ca2+-calmodulin. These studies establish that caveolin, via its scaffolding domain, directly forms an inhibitory complex with eNOS and suggest that caveolin inhibits eNOS by abrogating the enzyme's activation by calmodulin.

  1. Inhibition by sodium nitroprusside of the expression of inducible nitric oxide synthase in rat neutrophils.

    Science.gov (United States)

    Mariotto, S; Cuzzolin, L; Adami, A; Del Soldato, P; Suzuki, H; Benoni, G

    1995-01-01

    A well-known nitric oxide (NO)-releasing compound, sodium nitroprusside (SNP), decreases in a dose-dependent manner NO synthase (NOS) activity induced in rat neutrophils by treatment with lipopolysaccharide (LPS). This inhibitory action of SNP seems not to be due to its direct effect on the enzyme activity. The strong nitrosonium ion (NO+) character of SNP could be responsible for its inhibition of NOS induction in neutrophils. PMID:7542530

  2. Crystallization and preliminary crystallographic analysis of an acridone-producing novel multifunctional type III polyketide synthase from Huperzia serrata

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)

    2007-07-01

    An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.

  3. The expression of endothelial and inducible nitric oxide synthase and apoptosis in intestinal ischemia and reperfusion injury under the action of ischemic preconditioning and pentoxifylline.

    Science.gov (United States)

    Oliveira, Teresinha Regina Ribeiro de; Oliveira, Geraldo Ferreira de; Simões, Ricardo Santos; Feitosa, Suellen Maurim; Tikazawa, Eduardo Hiroshi; Monteiro, Hugo Pequeno; Fagundes, Djalma José; Taha, Murched Omar

    2017-11-01

    To investigate the expression of nitric oxide synthase (NOS) and apoptosis associated with ischemic preconditioning (IPC) and pentoxifylline (PTX) in intestinal ischemia (I) and reperfusion (R) injury. Thirty male rats were assigned to 5 groups: (CG), no clamping of the superior mesenteric artery (90 minutes); (IR-SS) saline + ischemia (30 minutes) + reperfusion (60 minutes); (IR-PTX) PTX + ischemia (30 minutes) + reperfusion (60 minutes); (IPC-IR-SS) 5 minutes of ischemia + 5 minutes of reperfusion (IPC) + saline + I(30 minutes)+R(60 minutes); and (IPC-IR-PTX) IPC + PTX + I(30 minutes)+ R(60 minutes). The application of IPC and PTX showed a significantly lower immunohistochemistry reaction for active caspase-3 (P0.05). The NOS-2 expression (qRTPCR) in the IR-PTX group (P<0.05) was higher than the values for the IPC+IR-SS and IPC-IR-PTX groups. The NOS-3 expression was significantly upper in the IPC-IR-PTX group than in the CG (P<0.05), the IR-SS (P<0.05) and the IR-PTX (P<0.05) groups. The BCL-2 and active caspase-3 showed beneficial effects on PTX and IPC. The expression of NOS-2 and NOS-3 in the IPC and IPC-PTX groups showed no synergistic effect.

  4. Molecular and biochemical characterization of caffeine synthase and purine alkaloid concentration in guarana fruit.

    Science.gov (United States)

    Schimpl, Flávia Camila; Kiyota, Eduardo; Mayer, Juliana Lischka Sampaio; Gonçalves, José Francisco de Carvalho; da Silva, José Ferreira; Mazzafera, Paulo

    2014-09-01

    Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Effects of Paracetamol on NOS, COX, and CYP Activity and on Oxidative Stress in Healthy Male Subjects, Rat Hepatocytes, and Recombinant NOS

    Science.gov (United States)

    Trettin, Arne; Böhmer, Anke; Suchy, Maria-Theresia; Probst, Irmelin; Staerk, Ulrich; Stichtenoth, Dirk O.; Frölich, Jürgen C.

    2014-01-01

    Paracetamol (acetaminophen) is a widely used analgesic drug. It interacts with various enzyme families including cytochrome P450 (CYP), cyclooxygenase (COX), and nitric oxide synthase (NOS), and this interplay may produce reactive oxygen species (ROS). We investigated the effects of paracetamol on prostacyclin, thromboxane, nitric oxide (NO), and oxidative stress in four male subjects who received a single 3 g oral dose of paracetamol. Thromboxane and prostacyclin synthesis was assessed by measuring their major urinary metabolites 2,3-dinor-thromboxane B2 and 2,3-dinor-6-ketoprostaglandin F1α, respectively. Endothelial NO synthesis was assessed by measuring nitrite in plasma. Urinary 15(S)-8-iso-prostaglanding F2α was measured to assess oxidative stress. Plasma oleic acid oxide (cis-EpOA) was measured as a marker of cytochrome P450 activity. Upon paracetamol administration, prostacyclin synthesis was strongly inhibited, while NO synthesis increased and thromboxane synthesis remained almost unchanged. Paracetamol may shift the COX-dependent vasodilatation/vasoconstriction balance at the cost of vasodilatation. This effect may be antagonized by increasing endothelial NO synthesis. High-dosed paracetamol did not increase oxidative stress. At pharmacologically relevant concentrations, paracetamol did not affect NO synthesis/bioavailability by recombinant human endothelial NOS or inducible NOS in rat hepatocytes. We conclude that paracetamol does not increase oxidative stress in humans. PMID:24799980

  6. Anti-Inflammatory Effects of Benfotiamine are Mediated Through the Regulation of Arachidonic Acid Pathway in Macrophages

    Science.gov (United States)

    Shoeb, Mohammad; Ramana, Kota V

    2011-01-01

    Benfotiamine, a lipid-soluble analogue of vitamin B1, is a potent anti-oxidant that is used as a food supplement for the treatment of diabetic complications. Our recent study indicates a novel role of benfotiamine in the prevention of bacterial endotoxin, lipopolysaccharide (LPS)-induced cytotoxicity and inflammatory response in murine macrophages. Nevertheless, it remains unclear how benfotiamine mediates anti-inflammatory effects. In this study, we investigated the anti-inflammatory role of benfotiamine in regulating the arachidonic acid (AA) pathway generated inflammatory lipid mediators in RAW 264.7 macrophages. Benfotiamine prevented the LPS-induced activation of cPLA2 and release of AA metabolites such as leukotrienes (LTB4), prostaglandin E2 (PGE2), thromboxanes 2 (TXB2) and prostacyclin (PGI2) in macrophages. Further, LPS-induced expressions of AA metabolizing enzymes such as COX-2, LOX-5, TXB synthase and PGI2 synthase were significantly blocked by benfotiamine. Furthermore, benfotiamine prevented the LPS-induced phosphorylation of ERK1/2 and expression of transcription factors NF-kB, and Egr-1. Benfotiamine also prevented the LPS-induced oxidative stress and protein-HNE adducts formation. Most importantly, as compared to specific COX-2 and LOX-5 inhibitors, benfotiamine significantly prevented the LPS-induced macrophage death and monocytes adhesion to endothelial cells. Thus, our studies indicate that the dual regulation of COX and LOX pathways in AA metabolism could be a novel mechanism by which benfotiamine exhibits its potential anti-inflammatory response. PMID:22067901

  7. Glycogen synthase kinase 3 regulates expression of nuclear factor-erythroid-2 related transcription factor-1 (Nrf1) and inhibits pro-survival function of Nrf1

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y., E-mail: jchan@uci.edu

    2013-08-01

    Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.

  8. Myo-inositol phosphate synthase expression in the European eel (Anguilla anguilla) and Nile tilapia (Oreochromis niloticus): effect of seawater acclimation.

    Science.gov (United States)

    Kalujnaia, Svetlana; Hazon, Neil; Cramb, Gordon

    2016-08-01

    A single MIPS gene (Isyna1/Ino1) exists in eel and tilapia genomes with a single myo-d-inositol 3-phosphate synthase (MIPS) transcript identified in all eel tissues, although two MIPS spliced variants [termed MIPS(s) and MIPS(l)] are found in all tilapia tissues. The larger tilapia transcript [MIPS(l)] results from the inclusion of the 87-nucleotide intron between exons 5 and 6 in the genomic sequence. In most tilapia tissues, the MIPS(s) transcript exhibits much higher abundance (generally >10-fold) with the exception of white skeletal muscle and oocytes, in which the MIPS(l) transcript predominates. SW acclimation resulted in large (6- to 32-fold) increases in mRNA expression for both MIPS(s) and MIPS(l) in all tilapia tissues tested, whereas in the eel, changes in expression were limited to a more modest 2.5-fold increase and only in the kidney. Western blots identified a number of species- and tissue-specific immunoreactive MIPS proteins ranging from 40 to 67 kDa molecular weight. SW acclimation failed to affect the abundance of any immunoreactive protein in any tissue tested from the eel. However, a major 67-kDa immunoreactive protein (presumed to be MIPS) found in tilapia tissues exhibited 11- and 54-fold increases in expression in gill and fin samples from SW-acclimated fish. Immunohistochemical investigations revealed specific immunoreactivity in the gill, fin, skin, and intestine taken from only SW-acclimated tilapia. Immunofluorescence indicated that MIPS was expressed within gill chondrocytes and epithelial cells of the primary filaments, basal epithelial cell layers of the skin and fin, the cytosol of columnar intestinal epithelial and mucous cells, as well as unknown entero-endocrine-like cells. Copyright © 2016 the American Physiological Society.

  9. Examination of thromboxane synthase as a prognostic factor and therapeutic target in non-small cell lung cancer.

    LENUS (Irish Health Repository)

    Cathcart, Mary-Clare

    2011-03-01

    Thromboxane synthase (TXS) metabolises prostaglandin H2 into thromboxanes, which are biologically active on cancer cells. TXS over-expression has been reported in a range of cancers, and associated with a poor prognosis. TXS inhibition induces cell death in-vitro, providing a rationale for therapeutic intervention. We aimed to determine the expression profile of TXS in NSCLC and if it is prognostic and\\/or a survival factor in the disease.

  10. Crystallization and preliminary X-ray crystallographic analysis of strictosidine synthase from Rauvolfia: the first member of a novel enzyme family.

    Science.gov (United States)

    Ma, Xueyan; Koepke, Juergen; Fritzsch, Günter; Diem, Ralf; Kutchan, Toni M; Michel, Hartmut; Stöckigt, Joachim

    2004-10-01

    Strictosidine synthase is a central enzyme involved in the biosynthesis of almost all plant monoterpenoid indole alkaloids. Strictosidine synthase from Rauvolfia serpentina was heterologously expressed in Escherichia coli. Crystals of the purified recombinant enzyme have been obtained by the hanging-drop technique at 303 K with potassium sodium tartrate tetrahydrate as precipitant. The crystals belong to the space group R3 with cell dimensions of a=b=150.3 A and c=122.4 A. Under cryoconditions (120 K), the crystals diffract to about 2.95 A.

  11. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  12. Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize

    OpenAIRE

    Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei

    2013-01-01

    Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...

  13. Expression of inducible nitric oxide synthase in endotoxemic rat hepatocytes is dependent on the cellular glutathione status

    NARCIS (Netherlands)

    Vos, TA; van Goor, H; Tuyt, L; de Jager-Krikken, A; Leuvenink, R; Kuipers, F; Jansen, PLM; Moshage, H

    The inducible nitric oxide synthase (iNOS) promoter contains nuclear factor kappa B (NF-kappa B) binding sites. NF-kappa B activation is determined, in part, by the intracellular redox status, The aim of this study was to determine the importance of the cellular glutathione status in relation to

  14. The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression

    Directory of Open Access Journals (Sweden)

    Fei eZhou

    2015-04-01

    Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

  15. Formation of wood secondary cell wall may involve two type cellulose synthase complexes in Populus.

    Science.gov (United States)

    Xi, Wang; Song, Dongliang; Sun, Jiayan; Shen, Junhui; Li, Laigeng

    2017-03-01

    Cellulose biosynthesis is mediated by cellulose synthases (CesAs), which constitute into rosette-like cellulose synthase complexe (CSC) on the plasma membrane. Two types of CSCs in Arabidopsis are believed to be involved in cellulose synthesis in the primary cell wall and secondary cell walls, respectively. In this work, we found that the two type CSCs participated cellulose biosynthesis in differentiating xylem cells undergoing secondary cell wall thickening in Populus. During the cell wall thickening process, expression of one type CSC genes increased while expression of the other type CSC genes decreased. Suppression of different type CSC genes both affected the wall-thickening and disrupted the multilaminar structure of the secondary cell walls. When CesA7A was suppressed, crystalline cellulose content was reduced, which, however, showed an increase when CesA3D was suppressed. The CesA suppression also affected cellulose digestibility of the wood cell walls. The results suggest that two type CSCs are involved in coordinating the cellulose biosynthesis in formation of the multilaminar structure in Populus wood secondary cell walls.

  16. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.)

    Science.gov (United States)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  17. Eckmaxol, a Phlorotannin Extracted from Ecklonia maxima, Produces Anti-β-amyloid Oligomer Neuroprotective Effects Possibly via Directly Acting on Glycogen Synthase Kinase 3β.

    Science.gov (United States)

    Wang, Jialing; Zheng, Jiachen; Huang, Chunhui; Zhao, Jiaying; Lin, Jiajia; Zhou, Xuezhen; Naman, C Benjamin; Wang, Ning; Gerwick, William H; Wang, Qinwen; Yan, Xiaojun; Cui, Wei; He, Shan

    2018-04-10

    Alzheimer's disease is a progressive neurodegenerative disorder that mainly affects the elderly. Soluble β-amyloid oligomer, which can induce neurotoxicity, is generally regarded as the main neurotoxin in Alzheimer's disease. Here we report that eckmaxol, a phlorotannin extracted from the brown alga Ecklonia maxima, could produce neuroprotective effects in SH-SY5Y cells. Eckmaxol effectively prevented but did not rescue β-amyloid oligomer-induced neuronal apoptosis and increase of intracellular reactive oxygen species. Eckmaxol also significantly reversed the decreased expression of phospho-Ser9-glycogen synthase kinase 3β and increased expression of phospho-extracellular signal-regulated kinase, which was induced by Aβ oligomer. Moreover, both glycogen synthase kinase 3β and mitogen activated protein kinase inhibitors produced neuroprotective effects in SH-SY5Y cells. Furthermore, eckmaxol showed favorable interaction in the ATP binding site of glycogen synthase kinase 3β and mitogen activated protein kinase. These results suggested that eckmaxol might produce neuroprotective effects via concurrent inhibition of glycogen synthase kinase 3β and extracellular signal-regulated kinase pathways, possibly via directly acting on glycogen synthase kinase 3β and mitogen activated protein kinase. Based on the central role that β-amyloid oligomers play in the pathogenesis of Alzheimer's disease and the high annual production of Ecklonia maxima for alginate and other nutritional ingredients, this report represents a new candidate for the treatment of Alzheimer's disease, and also expands the potential application of Ecklonia maxima and its constituents in the field of pharmacology.

  18. [Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

    Science.gov (United States)

    Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

    2014-01-01

    Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

  19. Morphological alterations and NO-synthase expression in the heart after continuous light exposure of rats

    Czech Academy of Sciences Publication Activity Database

    Paulis, L.; Važan, R.; Šimko, F.; Pecháňová, Olga; Styk, J.; Babál, P.; Janega, P.

    2007-01-01

    Roč. 56, Suppl.2 (2007), S71-S76 ISSN 0862-8408 Grant - others:VEGA(SK) 1/3429/06; VEGA(SK) 2/6148/26; VEGA(SK) 2/5110/25; -(SK) 29/2007; -(SK) 30/2007; -(SK) SP51/0280900/0280901; -(SK) APVT-51-027404; -(SK) APVT51-018004 Institutional research plan: CEZ:AV0Z50110509 Keywords : myocardium * collagen I/III * nitric oxide synthase Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery Impact factor: 1.505, year: 2007

  20. Chrysanthemum expressing a linalool synthase gene 'smells good', but 'tastes bad' to western flower thrips

    DEFF Research Database (Denmark)

    Yang, Ting; Stoopen, Geert; Thoen, Manus

    2013-01-01

    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed...... less preferred by WFT. Considering the common occurrence of linalool and its glycosides in plant tissues, it suggests that plants may balance attractive fragrance with 'poor taste' using the same precursor compound....

  1. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

    Directory of Open Access Journals (Sweden)

    Dullat Harpreet K

    2011-03-01

    Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

  2. Yeast PAH1-encoded phosphatidate phosphatase controls the expression of CHO1-encoded phosphatidylserine synthase for membrane phospholipid synthesis.

    Science.gov (United States)

    Han, Gil-Soo; Carman, George M

    2017-08-11

    The PAH1 -encoded phosphatidate phosphatase (PAP), which catalyzes the committed step for the synthesis of triacylglycerol in Saccharomyces cerevisiae , exerts a negative regulatory effect on the level of phosphatidate used for the de novo synthesis of membrane phospholipids. This raises the question whether PAP thereby affects the expression and activity of enzymes involved in phospholipid synthesis. Here, we examined the PAP-mediated regulation of CHO1 -encoded phosphatidylserine synthase (PSS), which catalyzes the committed step for the synthesis of major phospholipids via the CDP-diacylglycerol pathway. The lack of PAP in the pah1 Δ mutant highly elevated PSS activity, exhibiting a growth-dependent up-regulation from the exponential to the stationary phase of growth. Immunoblot analysis showed that the elevation of PSS activity results from an increase in the level of the enzyme encoded by CHO1 Truncation analysis and site-directed mutagenesis of the CHO1 promoter indicated that Cho1 expression in the pah1 Δ mutant is induced through the inositol-sensitive upstream activation sequence (UAS INO ), a cis -acting element for the phosphatidate-controlled Henry (Ino2-Ino4/Opi1) regulatory circuit. The abrogation of Cho1 induction and PSS activity by a CHO1 UAS INO mutation suppressed pah1 Δ effects on lipid synthesis, nuclear/endoplasmic reticulum membrane morphology, and lipid droplet formation, but not on growth at elevated temperature. Loss of the DGK1 -encoded diacylglycerol kinase, which converts diacylglycerol to phosphatidate, partially suppressed the pah1 Δ-mediated induction of Cho1 and PSS activity. Collectively, these data showed that PAP activity controls the expression of PSS for membrane phospholipid synthesis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

    Directory of Open Access Journals (Sweden)

    Resnanti Utami Handayani

    2014-07-01

    Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

  4. Cloning and functional characterization of β-phellandrene synthase from Lavandula angustifolia.

    Science.gov (United States)

    Demissie, Zerihun A; Sarker, Lukman S; Mahmoud, Soheil S

    2011-04-01

    En route to building genomics resources for Lavandula, we have obtained over 14,000 ESTs for leaves and flowers of L. angustifolia, a major essential oil crop, and identified a number of previously uncharacterized terpene synthase (TPS) genes. Here we report the cloning, expression in E. coli, and functional characterization of β-phellandrene synthase, LaβPHLS. The ORF--excluding the transit peptide--for this gene encoded a 62.3 kDa protein that contained all conserved motifs present in plant TPSs. Expression in bacteria resulted in the production of a soluble protein that was purified by Ni-NTA agarose affinity chromatography. While the recombinant LaβPHLS did not utilize FPP as a substrate, it converted GPP (the preferred substrate) and NPP into β-phellandrene as the major product, with K (m) and k (cat) of 6.55 μM and 1.75 × 10(-2) s(-1), respectively, for GPP. The LaβPHLS transcripts were highly abundant in young leaves where β-phellandrene is produced, but were barely detectable in flowers and older leaves, where β-phellandrene is not synthesized in significant quantities. This data indicate that β-phellandrene biosynthesis is transcriptionally and developmentally regulated. We also cloned and expressed in E. coli a second TPS-like protein, LaTPS-I, that lacks an internal stretch of 73 amino acids, including the signature DDxxD divalent metal binding motif, compared to other plant TPSs. The recombinant LaTPS-I did not produce detectable products in vitro when assayed with GPP, NPP or FPP as substrates. The lack of activity is most likely due to the absence of catalytically important amino acid residues within the missing region.

  5. Genomic Analysis of Terpene Synthase Family and Functional Characterization of Seven Sesquiterpene Synthases from Citrus sinensis

    Directory of Open Access Journals (Sweden)

    Berta Alquézar

    2017-08-01

    Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.

  6. Gene structure, phylogeny and expression profile of the sucrose ...

    Indian Academy of Sciences (India)

    Gene structure, phylogeny and expression profile of the sucrose synthase gene family in .... 24, 701–713. Bate N. and Twell D. 1998 Functional architecture of a late pollen .... Manzara T. and Gruissem W. 1988 Organization and expression.

  7. Disequilibrium of flavonol synthase and dihydroflavonol-4-reductase expression associated tightly to white versus red color flower formation in plants

    Directory of Open Access Journals (Sweden)

    Ping eLuo

    2016-01-01

    Full Text Available Flower colour is the main character throughout the plant kingdom. Though substantial information exists regarding the structural and regulatory genes involved in anthocyanin and flavonol biosynthesis, little is known that what make a diverse white versus red color flower in natural species. Here, the contents of pigments in seven species from varied phylogenetic location in plants with red and white flowers.were determined. Flavonols could be detected in red and white flowers, but anthocyanins were almost undetectable in the white cultivar. Comparisons of expression patterns of gene related to the flavonoid biosynthesis indicated that disequilibrium expression of flavonol synthase (FLS and dihydroflavonol-4-reductase (DFR genes determined the accumulation of flavonols and anothcyanins in both red and white flowers of seven species. To further investigate the role of such common regulatory patterns in determining flower color, FLS genes were isolated from Rosa rugosa (RrFLS1, Prunus persica (PpFLS and Petunia hybrida (PhFLS, and DFR genes were isolated from Rosa rugosa (RrDFR1 and Petunia hybrida (PhDFR. Heterologous expression of the FLS genes within tobacco host plants demonstrated conservation of function, with the transgenes promoting flavonol biosynthesis and inhibiting anthocyanin accumulation, so resulting in white flowers. Conversely, overexpression of DFR genes in tobacco displayed down-regulation of the endogenous NtFLS gene, and the promotion of anthocyanin synthesis. On this basis, we propose a model in which FLS and DFR gene-products compete for common substrates in order to direct the biosynthesis of flavonols and anthocyanins, respectively, thereby determining white versus red coloration of flowers.

  8. Arabidopsis thaliana sucrose phosphate synthase (sps) genes are expressed differentially in organs and tissues, and their transcription is regulated by osmotic stress.

    Science.gov (United States)

    Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel Edmundo; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

    2017-11-01

    Sucrose is synthesized from UDP-Glc and Fru-6-phosphate via the activity of sucrose-phosphate synthase (SPS) enzymes, which produce Suc-6-phosphate. Suc-6-phosphate is rapidly dephosphorylated by phosphatases to produce Suc and inorganic phosphate. Arabidopsis has four sps genes encoding SPS enzymes. Of these enzymes, AtSPS1F and AtSPS2F have been grouped with other dicotyledonous SPS enzymes, while AtSPS3F and AtSPS4F are included in groups with both dicotyledonous and monocotyledonous SPS enzymes. In this work, we generated Arabidopsis thaliana transformants containing the promoter region of each sps gene fused to gfp::uidA reporter genes. A detailed characterization of expression conferred by the sps promoters in organs and tissues was performed. We observed expression of AtSPS1F, AtSPS2F and AtSPS3F in the columella roots of the plants that support sucrose synthesis. Hence, these findings support the idea that sucrose synthesis occurs in the columella cells, and suggests that sucrose has a role in this tissue. In addition, the expression of AtSPS4F was identified in embryos and suggests its participation in this developmental stage. Quantitative transcriptional analysis of A. thaliana plants grown in media with different osmotic potential showed that AtSPS2F and AtSPS4F respond to osmotic stress. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile

    Directory of Open Access Journals (Sweden)

    Shuiyuan Cheng

    2016-03-01

    Full Text Available Roman chamomile (Chamaemelum nobile L. is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969 was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  10. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile.

    Science.gov (United States)

    Cheng, Shuiyuan; Wang, Xiaohui; Xu, Feng; Chen, Qiangwen; Tao, Tingting; Lei, Jing; Zhang, Weiwei; Liao, Yongling; Chang, Jie; Li, Xingxiang

    2016-03-08

    Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  11. Terpene synthases from Cannabis sativa.

    Science.gov (United States)

    Booth, Judith K; Page, Jonathan E; Bohlmann, Jörg

    2017-01-01

    Cannabis (Cannabis sativa) plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS) were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E)-β-ocimene, (-)-limonene, (+)-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.

  12. Expression of microsomal prostaglandin E synthase-1 in intestinal type gastric adenocarcinoma and in gastric cancer cell lines

    NARCIS (Netherlands)

    van Rees, Bastiaan P.; Sivula, Anna; Thorén, Staffan; Yokozaki, Hiroshi; Jakobsson, Per-Johan; Offerhaus, G. Johan A.; Ristimäki, Ari

    2003-01-01

    Gastrointestinal carcinomas synthesize elevated levels of prostaglandin E(2) (PGE(2)), which has been mechanistically linked to carcinogenesis. Recently, microsomal prostaglandin E synthase-1 (mPGES-1) was cloned, which seems to be inducible and linked to cyclooxygenase-2 (Cox-2) in the biosynthesis

  13. The Dictyostelium discoideum cellulose synthase: Structure/function analysis and identification of interacting proteins

    Energy Technology Data Exchange (ETDEWEB)

    Richard L. Blanton

    2004-02-19

    OAK-B135 The major accomplishments of this project were: (1) the initial characterization of dcsA, the gene for the putative catalytic subunit of cellulose synthase in the cellular slime mold Dictyostelium discoideum; (2) the detection of a developmentally regulated event (unidentified, but perhaps a protein modification or association with a protein partner) that is required for cellulose synthase activity (i.e., the dcsA product is necessary, but not sufficient for cellulose synthesis); (3) the continued exploration of the developmental context of cellulose synthesis and DcsA; (4) the isolation of a GFP-DcsA-expressing strain (work in progress); and (5) the identification of Dictyostelium homologues for plant genes whose products play roles in cellulose biosynthesis. Although our progress was slow and many of our results negative, we did develop a number of promising avenues of investigation that can serve as the foundation for future projects.

  14. Enhancement of fracture healing in the rat, modulated by compounds that stimulate inducible nitric oxide synthase

    Science.gov (United States)

    Rajfer, R. A.; Kilic, A.; Neviaser, A. S.; Schulte, L. M.; Hlaing, S. M.; Landeros, J.; Ferrini, M. G.; Ebramzadeh, E.

    2017-01-01

    Objectives We investigated the effects on fracture healing of two up-regulators of inducible nitric oxide synthase (iNOS) in a rat model of an open femoral osteotomy: tadalafil, a phosphodiesterase inhibitor, and the recently reported nutraceutical, COMB-4 (consisting of L-citrulline, Paullinia cupana, ginger and muira puama), given orally for either 14 or 42 days. Materials and Methods Unilateral femoral osteotomies were created in 58 male rats and fixed with an intramedullary compression nail. Rats were treated daily either with vehicle, tadalafil or COMB-4. Biomechanical testing of the healed fracture was performed on day 42. The volume, mineral content and bone density of the callus were measured by quantitative CT on days 14 and 42. Expression of iNOS was measured by immunohistochemistry. Results When compared with the control group, the COMB-4 group exhibited 46% higher maximum strength (t-test, p = 0.029) and 92% higher stiffness (t-test, p = 0.023), but no significant changes were observed in the tadalafil group. At days 14 and 42, there was no significant difference between the three groups with respect to callus volume, mineral content and bone density. Expression of iNOS at day 14 was significantly higher in the COMB-4 group which, as expected, had returned to baseline levels at day 42. Conclusion This study demonstrates an enhancement in fracture healing by an oral natural product known to augment iNOS expression. Cite this article: R. A. Rajfer, A. Kilic, A. S. Neviaser, L. M. Schulte, S. M. Hlaing, J. Landeros, M. G. Ferrini, E. Ebramzadeh, S-H. Park. Enhancement of fracture healing in the rat, modulated by compounds that stimulate inducible nitric oxide synthase: Acceleration of fracture healing via inducible nitric oxide synthase. Bone Joint Res 2017:6:–97. DOI: 10.1302/2046-3758.62.BJR-2016-0164.R2. PMID:28188129

  15. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  16. Expression analysis of a heat-inducible, Myo-inositol-1-phosphate synthase (MIPS) gene from wheat and the alternatively spliced variants of rice and Arabidopsis.

    Science.gov (United States)

    Khurana, Neetika; Chauhan, Harsh; Khurana, Paramjit

    2012-01-01

    Molecular dissection and a deeper analysis of the heat stress response mechanism in wheat have been poorly understood so far. This study delves into the molecular basis of action of TaMIPS, a heat stress-inducible enzyme that was identified through PCR-select subtraction technology, which is named here as TaMIPS2. MIPS (L-Myo-inositol-phosphate synthase) is important for the normal growth and development in plants. Expression profiling showed that TaMIPS2 is expressed during different developing seed stages upon heat stress. Also, the transcript levels increase in unfertilized ovaries and significant amounts are present during the recovery period providing evidence that MIPS is crucial for its role in heat stress recovery and flower development. Alternatively spliced forms from rice and Arabidopsis were also identified and their expression analysis revealed that apart from heat stress, some of the spliced variants were also inducible by drought, NaCl, Cold, ABA, BR, SA and mannitol. In silico promoter analysis revealed various cis-elements that could contribute for the differential regulation of MIPS in different plant systems. Phylogenetic analysis indicated that MIPS are highly conserved among monocots and dicots and TaMIPS2 grouped specifically with monocots. Comparative analyses was undertaken by different experimental approaches, i.e., semi-quantitative RT-PCR, quantitative RT-PCR, Genevestigator as a reference expression tool and motif analysis to predict the possible function of TaMIPS2 in regulating the different aspects of plant development under abiotic stress in wheat.

  17. N-acetylglutamate synthase deficiency: an insight into the genetics, epidemiology, pathophysiology, and treatment

    Directory of Open Access Journals (Sweden)

    Caldovic L

    2011-08-01

    Full Text Available Nicholas Ah Mew, Ljubica CaldovicCenter for Genetic Medicine Research, Children’s Research Institute, Children’s National Medical Center, Washington DC, USAAbstract: The conversion of ammonia into urea by the human liver requires the coordinated function of the 6 enzymes and 2 transporters of the urea cycle. The initial and rate-limiting enzyme of the urea cycle, carbamylphosphate synthetase 1 (CPS1, requires an allosteric activator, N-acetylglutamate (NAG. The formation of this unique cofactor from glutamate and acetyl Coenzyme-A is catalyzed by N-acetylglutamate synthase (NAGS. An absence of NAG as a consequence of NAGS deficiency may compromise flux through CPS1 and result in hyperammonemia. The NAGS gene encodes a 528-amino acid protein, consisting of a C-terminal catalytic domain, a variable segment, and an N-terminal mitochondrial targeting signal. Only 22 mutations in the NAGS gene have been reported to date, mostly in the catalytic domain. NAGS is primarily expressed in the liver and intestine. However, it is also surprisingly expressed in testis, stomach and spleen, and during early embryonic development at levels not concordant with the expression of other urea cycle enzymes, CPS1, or ornithine transcarbamylase. The purpose of NAGS expression in these tissues, and its significance to NAGS deficiency is as yet unknown. Inherited NAGS deficiency is the rarest of the urea cycle disorders, and we review the currently reported 34 cases. Treatment of NAGS deficiency with N-carbamyglutamate, a stable analog of NAG, can restore deficient urea cycle function and normalize blood ammonia in affected patients.Keywords: urea cycle, urea cycle disorder, N-acetyl-L-glutamate, N-acetylglutamate synthase, hyperammonemia, N-carbamyl-L-glutamate

  18. Human endogenous retrovirus W env increases nitric oxide production and enhances the migration ability of microglia by regulating the expression of inducible nitric oxide synthase.

    Science.gov (United States)

    Xiao, Ran; Li, Shan; Cao, Qian; Wang, Xiuling; Yan, Qiujin; Tu, Xiaoning; Zhu, Ying; Zhu, Fan

    2017-06-01

    Human endogenous retrovirus W env (HERV-W env) plays a critical role in many neuropsychological diseases such as schizophrenia and multiple sclerosis (MS). These diseases are accompanied by immunological reactions in the central nervous system (CNS). Microglia are important immunocytes in brain inflammation that can produce a gasotransmitter-nitric oxide (NO). NO not only plays a role in the function of neuronal cells but also participates in the pathogenesis of various neuropsychological diseases. In this study, we reported increased NO production in CHME-5 microglia cells after they were transfected with HERV-W env. Moreover, HERV-W env increased the expression and function of human inducible nitric oxide synthase (hiNOS) and enhanced the promoter activity of hiNOS. Microglial migration was also enhanced. These data revealed that HERV-W env might contribute to increase NO production and microglial migration ability in neuropsychological disorders by regulating the expression of inducible NOS. Results from this study might lead to the identification of novel targets for the treatment of neuropsychological diseases, including neuroinflammatory diseases, stroke, and neurodegenerative diseases.

  19. Amaryllidaceae Alkaloids as Potential Glycogen Synthase Kinase-3β Inhibitors

    Directory of Open Access Journals (Sweden)

    Daniela Hulcová

    2018-03-01

    Full Text Available Glycogen synthase kinase-3β (GSK-3β is a multifunctional serine/threonine protein kinase that was originally identified as an enzyme involved in the control of glycogen metabolism. It plays a key role in diverse physiological processes including metabolism, the cell cycle, and gene expression by regulating a wide variety of well-known substances like glycogen synthase, tau-protein, and β-catenin. Recent studies have identified GSK-3β as a potential therapeutic target in Alzheimer´s disease, bipolar disorder, stroke, more than 15 types of cancer, and diabetes. GSK-3β is one of the most attractive targets for medicinal chemists in the discovery, design, and synthesis of new selective potent inhibitors. In the current study, twenty-eight Amaryllidaceae alkaloids of various structural types were studied for their potency to inhibit GSK-3β. Promising results have been demonstrated by alkaloids of the homolycorine-{9-O-demethylhomolycorine (IC50 = 30.00 ± 0.71 µM, masonine (IC50 = 27.81 ± 0.01 μM}, and lycorine-types {caranine (IC50 = 30.75 ± 0.04 μM}.

  20. Affinin (Spilanthol, Isolated from Heliopsis longipes, Induces Vasodilation via Activation of Gasotransmitters and Prostacyclin Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Jesús Eduardo Castro-Ruiz

    2017-01-01

    Full Text Available Heliopsis longipes roots have been widely used in Mexican traditional medicine to relieve pain, mainly, toothaches. Previous studies have shown that affinin, the major alkamide of these roots, induces potent antinociceptive and anti-inflammatory activities. However, the effect of H. longipes root extracts and affinin on the cardiovascular system have not been investigated so far. In the present study, we demonstrated that the dichloromethane and ethanolic extracts of H. longipes roots, and affinin, isolated from these roots, produce a concentration-dependent vasodilation of rat aorta. Affinin-induced vasorelaxation was partly dependent on the presence of endothelium and was significantly blocked in the presence of inhibitors of NO, H2S, and CO synthesis (NG-nitro-l-arginine methyl ester (l-NAME, dl-propargylglycine (PAG, and chromium mesoporphyrin (CrMP, respectively; K+ channel blockers (glibenclamide (Gli and tetraethyl ammonium (TEA, and guanylate cyclase and cyclooxygenase inhibitors (1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ and indomethacin (INDO, respectively. Our results demonstrate, for the first time, that affinin induces vasodilation by mechanisms that involve gasotransmitters, and prostacyclin signaling pathways. These findings indicate that this natural alkamide has therapeutic potential in the treatment of cardiovascular diseases.

  1. Isolation and functional effects of monoclonal antibodies binding to thymidylate synthase.

    Science.gov (United States)

    Jastreboff, M M; Todd, M B; Malech, H L; Bertino, J R

    1985-01-29

    Monoclonal antibodies against electrophoretically pure thymidylate synthase from HeLa cells have been produced. Antibodies (M-TS-4 and M-TS-9) from hybridoma clones were shown by enzyme-linked immunoassay to recognize thymidylate synthase from a variety of human cell lines, but they did not bind to thymidylate synthase from mouse cell lines. The strongest binding of antibodies was observed to enzyme from HeLa cells. These two monoclonal antibodies bind simultaneously to different antigenic sites on thymidylate synthase purified from HeLa cells, as reflected by a high additivity index and results of cross-linked radioimmunoassay. Both monoclonal antibodies inhibit the activity of thymidylate synthase from human cell lines. The strongest inhibition was observed with thymidylate synthase from HeLa cells. Monoclonal antibody M-TS-9 (IgM subclass) decreased the rate of binding of [3H]FdUMP to thymidylate synthase in the presence of 5,10-methylenetetrahydrofolate while M-TS-4 (IgG1) did not change the rate of ternary complex formation. These data indicate that the antibodies recognize different epitopes on the enzyme molecule.

  2. Inhibition of nitric oxide synthase expression in activated microglia and peroxynitrite scavenging activity by Opuntia ficus indica var. saboten.

    Science.gov (United States)

    Lee, Ming Hong; Kim, Jae Yeon; Yoon, Jeong Hoon; Lim, Hyo Jin; Kim, Tae Hee; Jin, Changbae; Kwak, Wie-Jong; Han, Chang-Kyun; Ryu, Jae-Ha

    2006-09-01

    Activated microglia by neuronal injury or inflammatory stimulation overproduce nitric oxide (NO) by inducible nitric oxide synthase (iNOS) and reactive oxygen species (ROS) such as superoxide anion, resulting in neurodegenerative diseases. The toxic peroxynitrite (ONOO-), the reaction product of NO and superoxide anion further contributes to oxidative neurotoxicity. A butanol fraction obtained from 50% ethanol extracts of Opuntia ficus indica var. saboten (Cactaceae) stem (SK OFB901) and its hydrolysis product (SK OFB901H) inhibited the production of NO in LPS-activated microglia in a dose dependent manner (IC50 15.9, 4.2 microg/mL, respectively). They also suppressed the expression of protein and mRNA of iNOS in LPS-activated microglial cells at higher than 30 microg/mL as observed by western blot analysis and RT-PCR experiment. They also inhibited the degradation of I-kappaB-alpha in activated microglia. Moreover, they showed strong activity of peroxynitrite scavenging in a cell free bioassay system. These results imply that Opuntia ficus indica may have neuroprotective activity through the inhibition of NO production by activated microglial cells and peroxynitrite scavenging activity. Copyright (c) 2006 John Wiley & Sons, Ltd.

  3. Estrous cycle influences the expression of neuronal nitric oxide synthase in the hypothalamus and limbic system of female mice

    Directory of Open Access Journals (Sweden)

    Viglietti-Panzica Carla

    2009-07-01

    Full Text Available Abstract Background Nitric oxide plays an important role in the regulation of male and female sexual behavior in rodents, and the expression of the nitric oxide synthase (NOS is influenced by testosterone in the male rat, and by estrogens in the female. We have here quantitatively investigated the distribution of nNOS immunoreactive (ir neurons in the limbic hypothalamic region of intact female mice sacrificed during different phases of estrous cycle. Results Changes were observed in the medial preoptic area (MPA (significantly higher number in estrus and in the arcuate nucleus (Arc (significantly higher number in proestrus. In the ventrolateral part of the ventromedial nucleus (VMHvl and in the bed nucleus of the stria terminalis (BST no significant changes have been observed. In addition, by comparing males and females, we observed a stable sex dimorphism (males have a higher number of nNOS-ir cells in comparison to almost all the different phases of the estrous cycle in the VMHvl and in the BST (when considering only the less intensely stained elements. In the MPA and in the Arc sex differences were detected only comparing some phases of the cycle. Conclusion These data demonstrate that, in mice, the expression of nNOS in some hypothalamic regions involved in the control of reproduction and characterized by a large number of estrogen receptors is under the control of gonadal hormones and may vary according to the rapid variations of hormonal levels that take place during the estrous cycle.

  4. Structure and mechanism of the diterpene cyclase ent-copalyl diphosphate synthase

    Energy Technology Data Exchange (ETDEWEB)

    Köksal, Mustafa; Hu, Huayou; Coates, Robert M.; Peters, Reuben J.; Christianson, David W. (UIUC); (Iowa State); (Penn)

    2011-09-20

    The structure of ent-copalyl diphosphate synthase reveals three {alpha}-helical domains ({alpha}, {beta} and {gamma}), as also observed in the related diterpene cyclase taxadiene synthase. However, active sites are located at the interface of the {beta}{gamma} domains in ent-copalyl diphosphate synthase but exclusively in the {alpha} domain of taxadiene synthase. Modular domain architecture in plant diterpene cyclases enables the evolution of alternative active sites and chemical strategies for catalyzing isoprenoid cyclization reactions.

  5. Evolutionary and mechanistic insights from the reconstruction of α-humulene synthases from a modern (+)-germacrene A synthase.

    Science.gov (United States)

    Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J; Faraldos, Juan A; Allemann, Rudolf K

    2014-10-15

    Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and <2% α-humulene, which arises from 1,11-cyclization of FDP. The origin of the 1,11-activity of GAS was investigated by amino acid sequence alignments of 1,10- and 1,11-synthases and comparisons of X-ray crystal structures with the homology model of GAS; a triad [Thr 401-Gly 402-Gly 403] that might be responsible for the predominant 1,10-cyclization activity of GAS was identified. Replacement of Gly 402 with residues of increasing size led to a progressive increase of 1,11-cyclization. The catalytic robustness of these 1,10- /1,11-GAS variants point to Gly 402 as a functional switch of evolutionary significance and suggests that enzymes with strict functionalities have evolved from less specific ancestors through a small number of substitutions. Similar results were obtained with germacrene D synthase (GDS) upon replacement of the homologous active-site residue Gly 404: GDS-G404V generated approximately 20% bicyclogermacrene, a hydrocarbon with a cyclopropane ring that underlines the dual 1,10-/1,11-cyclization activity of this mutant. This suggests that the reaction pathways to germacrenes and humulenes might be connected through a bridged 1,10,11-carbocation intermediate or transition state that resembles bicyclogermacrene. Mechanistic studies using [1-(3)H1]-10-fluorofarnesyl diphosphate and deuterium-labeling experiments with [12,13-(2)H6]-FDP support a germacrene-humulene rearrangement linking 1,10- and 1,11-pathways. These results support the bioinformatics proposal that modern 1,10-synthases could have evolved from promiscuous 1,11-sesquiterpene synthases.

  6. Increased cyclooxygenase-2 and thromboxane synthase expression is implicated in diosgenin-induced megakaryocytic differentiation in human erythroleukemia cells.

    Science.gov (United States)

    Cailleteau, C; Liagre, B; Battu, S; Jayat-Vignoles, C; Beneytout, J L

    2008-09-01

    Differentiation induction as a therapeutic strategy has, so far, the greatest impact in hematopoietic malignancies, most notably leukemia. Diosgenin is a very interesting natural product because, depending on the specific dose used, its biological effect is very different in HEL (human erythroleukemia) cells. For example, at 10 microM, diosgenin induced megakaryocytic differentiation, in contrast to 40 microM diosgenin, which induced apoptosis in HEL cells previously demonstrated using sedimentation field-flow fractionation (SdFFF). The goal of this work focused on the correlation between cyclooxygenase-2 (COX-2) and thromboxane synthase (TxS) and megakaryocytic differentiation induced by diosgenin in HEL cells. Furthermore, the technique of SdFFF, having been validated in our models, was used in this new study as an analytical tool that provided us with more or less enriched differentiated cell fractions that could then be used for further analyses of enzyme protein expression and activity for the first time. In our study, we showed the implication of COX-2 and TxS in diosgenin-induced megakaryocytic differentiation in HEL cells. Furthermore, we showed that the analytical technique of SdFFF may be used as a tool to confirm our results as a function of the degree of cell differentiation.

  7. Characterization of two geraniol synthases from Valeriana officinalis and Lippia dulcis: similar activity but difference in subcellular localization

    NARCIS (Netherlands)

    Dong, L.; Miettinen, K.; Verstappen, F.W.A.; Voster, A.; Jongsma, M.A.; Memelink, J.; Krol, van der S.; Bouwmeester, H.J.

    2013-01-01

    Two geraniol synthases (GES), from Valeriana officinalis (VoGES) and Lippia dulcis (LdGES), were isolated and were shown to have geraniol biosynthetic activity with Km values of 32 µM and 51 µM for GPP, respectively, upon expression in Escherichia coli. The in planta enzymatic activity and

  8. Leishmania donovani argininosuccinate synthase is an active enzyme associated with parasite pathogenesis.

    Directory of Open Access Journals (Sweden)

    Ines Lakhal-Naouar

    Full Text Available BACKGROUND: Gene expression analysis in Leishmania donovani (Ld identified an orthologue of the urea cycle enzyme, argininosuccinate synthase (LdASS, that was more abundantly expressed in amastigotes than in promastigotes. In order to characterize in detail this newly identified protein in Leishmania, we determined its enzymatic activity, subcellular localization in the parasite and affect on virulence in vivo. METHODOLOGY/PRINCIPAL FINDINGS: Two parasite cell lines either over expressing wild type LdASS or a mutant form (G128S associated with severe cases of citrullinemia in humans were developed. In addition we also produced bacterially expressed recombinant forms of the same proteins. Our results demonstrated that LdASS has argininosuccinate synthase enzymatic activity that is abolished using an ASS specific inhibitor (MDLA: methyl-D-L-Aspartic acid. However, the mutant form of the protein is inactive. We demonstrate that though LdASS has a glycosomal targeting signal that binds the targeting apparatus in vitro, only a small proportion of the total cellular ASS is localized in a vesicle, as indicated by protection from protease digestion of the crude organelle fraction. The majority of LdASS was found to be in the cytosolic fraction that may include large cytosolic complexes as indicated by the punctate distribution in IFA. Surprisingly, comparison to known glycosomal proteins by IFA revealed that LdASS was located in a structure different from the known glycosomal vesicles. Significantly, parasites expressing a mutant form of LdASS associated with a loss of in vitro activity had reduced virulence in vivo in BALB/c mice as demonstrated by a significant reduction in the parasite load in spleen and liver. CONCLUSION/SIGNIFICANCE: Our study suggests that LdASS is an active enzyme, with unique localization and essential for parasite survival and growth in the mammalian host. Based on these observations LdASS could be further explored as a

  9. The purification, crystallization and preliminary X-ray diffraction analysis of dihydrodipicolinate synthase from Clostridium botulinum

    International Nuclear Information System (INIS)

    Dobson, Renwick C. J.; Atkinson, Sarah C.; Gorman, Michael A.; Newman, Janet M.; Parker, Michael W.; Perugini, Matthew A.

    2008-01-01

    Dihydrodipicolinate synthase (DHDPS), an enzyme in the lysine-biosynthetic pathway, is a promising target for antibiotic development against pathogenic bacteria. Here, the expression, purification, crystallization and preliminary diffraction analysis of DHDPS from C. botulinum are reported. In recent years, dihydrodipicolinate synthase (DHDPS; EC 4.2.1.52) has received considerable attention from both mechanistic and structural viewpoints. This enzyme, which is part of the diaminopimelate pathway leading to lysine, couples (S)-aspartate-β-semialdehyde with pyruvate via a Schiff base to a conserved active-site lysine. In this paper, the expression, purification, crystallization and preliminary X-ray diffraction analysis of DHDPS from Clostridium botulinum, an important bacterial pathogen, are presented. The enzyme was crystallized in a number of forms, predominantly using PEG precipitants, with the best crystal diffracting to beyond 1.9 Å resolution and displaying P4 2 2 1 2 symmetry. The unit-cell parameters were a = b = 92.9, c = 60.4 Å. The crystal volume per protein weight (V M ) was 2.07 Å 3 Da −1 , with an estimated solvent content of 41%. The structure of the enzyme will help guide the design of novel therapeutics against the C. botulinum pathogen

  10. Suites of terpene synthases explain differential terpenoid production in ginger and turmeric tissues.

    Directory of Open Access Journals (Sweden)

    Hyun Jo Koo

    Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.

  11. Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues

    Science.gov (United States)

    Koo, Hyun Jo; Gang, David R.

    2012-01-01

    The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109

  12. Evolutionary history of callose synthases in terrestrial plants with emphasis on proteins involved in male gametophyte development.

    Directory of Open Access Journals (Sweden)

    Lenka Záveská Drábková

    Full Text Available Callose is a plant-specific polysaccharide (β-1,3-glucan playing an important role in angiosperms in many developmental processes and responses to biotic and abiotic stresses. Callose is synthesised at the plasma membrane of plant cells by callose synthase (CalS and, among others, represents the main polysaccharide in the callose wall surrounding the tetrads of developing microspores and in the growing pollen tube wall. CalS proteins involvement in spore development is a plesiomorphic feature of terrestrial plants, but very little is known about their evolutionary origin and relationships amongst the members of this protein family. We performed thorough comparative analyses of callose synthase family proteins from major plant lineages to determine their evolutionary history across the plant kingdom. A total of 1211 candidate CalS sequences were identified and compared amongst diverse taxonomic groups of plants, from bryophytes to angiosperms. Phylogenetic analyses identified six main clades of CalS proteins and suggested duplications during the evolution of specialised functions. Twelve family members had previously been identified in Arabidopsis thaliana. We focused on five CalS subfamilies directly linked to pollen function and found that proteins expressed in pollen evolved twice. CalS9/10 and CalS11/12 formed well-defined clades, whereas pollen-specific CalS5 was found within subfamilies that mostly did not express in mature pollen vegetative cell, although were found in sperm cells. Expression of five out of seven mature pollen-expressed CalS genes was affected by mutations in bzip transcription factors. Only three subfamilies, CalS5, CalS10, and CalS11, however, formed monophyletic, mostly conserved clades. The pairs CalS9/CalS10, CalS11/CalS12 and CalS3 may have diverged after angiosperms diversified from lycophytes and bryophytes. Our analysis of fully sequenced plant proteins identified new evolutionary lineages of callose synthase

  13. Estrogen Replacement Therapy in Ovariectomized Nonpregnant Ewes Stimulates Uterine Artery Hydrogen Sulfide Biosynthesis by Selectively Up-Regulating Cystathionine β-Synthase Expression.

    Science.gov (United States)

    Lechuga, Thomas J; Zhang, Hong-hai; Sheibani, Lili; Karim, Muntarin; Jia, Jason; Magness, Ronald R; Rosenfeld, Charles R; Chen, Dong-bao

    2015-06-01

    Estrogens dramatically dilate numerous vascular beds with the greatest response in the uterus. Endogenous hydrogen sulfide (H2S) is a potent vasodilator and proangiogenic second messenger, which is synthesized from L-cysteine by cystathionine β-synthase (CBS) and cystathionine γ-lyase (CSE). We hypothesized that estrogen replacement therapy (ERT) selectively stimulates H2S biosynthesis in uterine artery (UA) and other systemic arteries. Intact and endothelium-denuded UA, mesenteric artery (MA), and carotid artery (CA) were obtained from ovariectomized nonpregnant ewes (n = 5/group) receiving vehicle or estradiol-17β replacement therapy (ERT). Total RNA and protein were extracted for measuring CBS and CSE, and H2S production was determined by the methylene blue assay. Paraffin-embedded UA rings were used to localize CBS and CSE proteins by immunofluorescence microscopy. ERT significantly stimulated CBS mRNA and protein without altering CSE mRNA or protein in intact and denuded UA. Quantitative immunofluorescence microscopic analyses showed CBS and CSE protein localization in endothelium and smooth muscle and confirmed that ERT stimulated CBS but not CSE protein expression in UA endothelium and smooth muscle. ERT also stimulated CBS, but not CSE, mRNA and protein expression in intact and denuded MA but not CA in ovariectomized ewes. Concomitantly, ERT stimulated UA and MA but not CA H2S production. ERT-stimulated UA H2S production was completely blocked by a specific CBS but not CSE inhibitor. Thus, ERT selectively stimulates UA and MA but not CA H2S biosynthesis by specifically up-regulating CBS expression, implicating a role of H2S in estrogen-induced vasodilation and postmenopausal women's health.

  14. Identification of a polyketide synthase required for alternariol (AOH and alternariol-9-methyl ether (AME formation in Alternaria alternata.

    Directory of Open Access Journals (Sweden)

    Debjani Saha

    Full Text Available Alternaria alternata produces more than 60 secondary metabolites, among which alternariol (AOH and alternariol-9-methyl ether (AME are important mycotoxins. Whereas the toxicology of these two polyketide-based compounds has been studied, nothing is known about the genetics of their biosynthesis. One of the postulated core enzymes in the biosynthesis of AOH and AME is polyketide synthase (PKS. In a draft genome sequence of A. alternata we identified 10 putative PKS-encoding genes. The timing of the expression of two PKS genes, pksJ and pksH, correlated with the production of AOH and AME. The PksJ and PksH proteins are predicted to be 2222 and 2821 amino acids in length, respectively. They are both iterative type I reducing polyketide synthases. PksJ harbors a peroxisomal targeting sequence at the C-terminus, suggesting that the biosynthesis occurs at least partly in these organelles. In the vicinity of pksJ we found a transcriptional regulator, altR, involved in pksJ induction and a putative methyl transferase, possibly responsible for AME formation. Downregulation of pksJ and altR caused a large decrease of alternariol formation, suggesting that PksJ is the polyketide synthase required for the postulated Claisen condensations during the biosynthesis. No other enzymes appeared to be required. PksH downregulation affected pksJ expression and thus caused an indirect effect on AOH production.

  15. Rapid Discovery and Functional Characterization of Terpene Synthases from Four Endophytic Xylariaceae.

    Directory of Open Access Journals (Sweden)

    Weihua Wu

    Full Text Available Endophytic fungi are ubiquitous plant endosymbionts that establish complex and poorly understood relationships with their host organisms. Many endophytic fungi are known to produce a wide spectrum of volatile organic compounds (VOCs with potential energy applications, which have been described as "mycodiesel". Many of these mycodiesel hydrocarbons are terpenes, a chemically diverse class of compounds produced by many plants, fungi, and bacteria. Due to their high energy densities, terpenes, such as pinene and bisabolene, are actively being investigated as potential "drop-in" biofuels for replacing diesel and aviation fuel. In this study, we rapidly discovered and characterized 26 terpene synthases (TPSs derived from four endophytic fungi known to produce mycodiesel hydrocarbons. The TPS genes were expressed in an E. coli strain harboring a heterologous mevalonate pathway designed to enhance terpene production, and their product profiles were determined using Solid Phase Micro-Extraction (SPME and GC-MS. Out of the 26 TPS's profiled, 12 TPS's were functional, with the majority of them exhibiting both monoterpene and sesquiterpene synthase activity.

  16. Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.

    Directory of Open Access Journals (Sweden)

    Praveen Balabaskaran Nina

    2010-07-01

    Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a

  17. Increased expression and local accumulation of the Prion Protein, Alzheimer Aβ peptides, superoxide dismutase 1, and Nitric oxide synthases 1 & 2 in muscle in a rabbit model of diabetes

    Directory of Open Access Journals (Sweden)

    Bitel Claudine L

    2010-09-01

    Full Text Available Abstract Background Muscle disease associated with different etiologies has been shown to produce localized accumulations of amyloid and oxidative stress-related proteins that are more commonly associated with neurodegeneration in the brain. In this study we examined changes in muscle tissue in a classic model of diabetes and hyperglycemia in rabbits to determine if similar dysregulation of Alzheimer Aβ peptides, the prion protein (PrP, and superoxide dismutase 1 (SOD1, as well as nitric oxide synthases is produced in muscle in diabetic animals. This wild-type rabbit model includes systemic physiological expression of human-like Alzheimer precursor proteins and Aβ peptides that are considered key in Alzheimer protein studies. Results Diabetes was produced in rabbits by injection of the toxic glucose analogue alloxan, which selectively enters pancreatic beta cells and irreversibly decreases insulin production, similar to streptozotocin. Quadriceps muscle from rabbits 16 wks after onset of diabetes and hyperglycemia were analyzed with biochemical and in situ methods. Immunoblots of whole muscle protein samples demonstrated increased PrP, SOD1, as well as neuronal and inducible Nitric oxide synthases (NOS1 and NOS2 in diabetic muscle. In contrast, we detected little change in Alzheimer Aβ precursor protein expression, or BACE1 and Presenilin 1 levels. However, Aβ peptides measured by ELISA increased several fold in diabetic muscle, suggesting a key role for Aβ cleavage in muscle similar to Alzheimer neurodegeneration in this diabetes model. Histological changes in diabetic muscle included localized accumulations of PrP, Aβ, NOS1 and 2, and SOD1, and evidence of increased central nuclei and cell infiltration. Conclusions The present study provides evidence that several classic amyloid and oxidative stress-related disease proteins coordinately increase in overall expression and form localized accumulations in diabetic muscle. The present study

  18. Pycnogenol® effects on skin elasticity and hydration coincide with increased gene expressions of collagen type I and hyaluronic acid synthase in women.

    Science.gov (United States)

    Marini, A; Grether-Beck, S; Jaenicke, T; Weber, M; Burki, C; Formann, P; Brenden, H; Schönlau, F; Krutmann, J

    2012-01-01

    In recent years there has been an increasing interest in the use of nutritional supplements to benefit human skin. Molecular evidence substantiating such effects, however, is scarce. In the present study we investigated whether nutritional supplementation of women with the standardized pine bark extract Pycnogenol® will improve their cosmetic appearance and relate these effects to expression of corresponding molecular markers of their skin. For this purpose 20 healthy postmenopausal women were supplemented with Pycnogenol for 12 weeks. Before, during and after supplementation, their skin condition was assessed (i) by employing non-invasive, biophysical methods including corneometry, cutometry, visioscan and ultrasound analyses and (ii) by taking biopsies and subsequent PCR for gene expression analyses related to extracellular matrix homeostasis. Pycnogenol supplementation was well tolerated in all volunteers. Pycnogenol significantly improved hydration and elasticity of skin. These effects were most pronounced in women presenting with dry skin conditions prior to the start of supplementation. The skin-physiological improvement was accompanied by a significant increase in the mRNA expression of hyaluronic acid synthase-1 (HAS-1), an enzyme critically involved in the synthesis of hyaluronic acid, and a noticeable increase in gene expression involved in collagen de novo synthesis. This study provides skin-physiological and for the first time molecular evidence that Pycnogenol supplementation benefits human skin by increasing skin hydration and skin elasticity. These effects are most likely due to an increased synthesis of extracellular matrix molecules such as hyaluronic acid and possibly collagen. Pycnogenol supplementation may thus be useful to counteract the clinical signs of skin aging. Copyright © 2012 S. Karger AG, Basel.

  19. Arabidopsis ETO1 specifically interacts with and negatively regulates type 2 1-aminocyclopropane-1-carboxylate synthases

    Directory of Open Access Journals (Sweden)

    Saito Koji

    2005-08-01

    Full Text Available Abstract Background In Arabidopsis, ETO1 (ETHYLENE-OVERPRODUCER1 is a negative regulator of ethylene evolution by interacting with AtACS5, an isoform of the rate-limiting enzyme, 1-aminocyclopropane-1-carboxylate synthases (ACC synthase or ACS, in ethylene biosynthetic pathway. ETO1 directly inhibits the enzymatic activity of AtACS5. In addition, a specific interaction between ETO1 and AtCUL3, a constituent of a new type of E3 ubiquitin ligase complex, suggests the molecular mechanism in promoting AtACS5 degradation by the proteasome-dependent pathway. Because orthologous sequences to ETO1 are found in many plant species including tomato, we transformed tomato with Arabidopsis ETO1 to evaluate its ability to suppress ethylene production in tomato fruits. Results Transgenic tomato lines that overexpress Arabidopsis ETO1 (ETO1-OE did not show a significant delay of fruit ripening. So, we performed yeast two-hybrid assays to investigate potential heterologous interaction between ETO1 and three isozymes of ACC synthases from tomato. In the yeast two-hybrid system, ETO1 interacts with LE-ACS3 as well as AtACS5 but not with LE-ACS2 or LE-ACS4, two major isozymes whose gene expression is induced markedly in ripening fruits. According to the classification of ACC synthases, which is based on the C-terminal amino acid sequences, both LE-ACS3 and AtACS5 are categorized as type 2 isozymes and possess a consensus C-terminal sequence. In contrast, LE-ACS2 and LE-ACS4 are type 1 and type 3 isozymes, respectively, both of which do not possess this specific C-terminal sequence. Yeast two-hybrid analysis using chimeric constructs between LE-ACS2 and LE-ACS3 revealed that the type-2-ACS-specific C-terminal tail is required for interaction with ETO1. When treated with auxin to induce LE-ACS3, seedlings of ETO1-OE produced less ethylene than the wild type, despite comparable expression of the LE-ACS3 gene in the wild type. Conclusion These results suggest that ETO1

  20. Participation of hippocampal nitric oxide synthase and soluble guanylate cyclase in the modulation of behavioral responses elicited by the rat forced swimming test.

    Science.gov (United States)

    Sales, Amanda J; Hiroaki-Sato, Vinícius A; Joca, Sâmia R L

    2017-02-01

    Systemic or hippocampal administration of nitric oxide (NO) synthase inhibitors induces antidepressant-like effects in animals, implicating increased hippocampal levels of NO in the neurobiology of depression. However, the role played by different NO synthase in this process has not been clearly defined. As stress is able to induce neuroinflammatory mechanisms and trigger the expression of inducible nitric oxide synthase (iNOS) in the brain, as well as upregulate neuronal nitric oxide synthase (nNOS) activity, the aim of the present study was to investigate the possible differential contribution of hippocampal iNOS and nNOS in the modulation of the consequences of stress elicited by the forced swimming test. Male Wistar rats received intrahippocampal injections, immediately after the pretest or 1 h before the forced swimming test, of selective inhibitors of nNOS (N-propyl-L-arginine), iNOS (1400W), or sGC (ODQ), the main pharmacological target for NO. Stress exposure increased nNOS and phospho-nNOS levels at all time points, whereas iNOS expression was increased only 24 h after the pretest. All drugs induced an antidepressant-like effect. However, whereas the nNOS inhibitor was equally effective when injected at different times, the iNOS inhibitor was more effective 24 h after the pretest. These results suggest that hippocampal nNOS and iNOS contribute to increase in NO levels in response to stress, although with a differential time course after stress exposure.

  1. Anti-inflammatory effects of benfotiamine are mediated through the regulation of the arachidonic acid pathway in macrophages.

    Science.gov (United States)

    Shoeb, Mohammad; Ramana, Kota V

    2012-01-01

    Benfotiamine, a lipid-soluble analogue of vitamin B1, is a potent antioxidant that is used as a food supplement for the treatment of diabetic complications. Our recent study (U.C. Yadav et al., Free Radic. Biol. Med. 48:1423-1434, 2010) indicates a novel role for benfotiamine in the prevention of bacterial endotoxin, lipopolysaccharide (LPS)-induced cytotoxicity and inflammatory response in murine macrophages. Nevertheless, it remains unclear how benfotiamine mediates anti-inflammatory effects. In this study, we investigated the anti-inflammatory role of benfotiamine in regulating arachidonic acid (AA) pathway-generated inflammatory lipid mediators in RAW264.7 macrophages. Benfotiamine prevented the LPS-induced activation of cPLA2 and release of AA metabolites such as leukotrienes, prostaglandin E2, thromboxane 2 (TXB2), and prostacyclin (PGI2) in macrophages. Further, LPS-induced expression of AA-metabolizing enzymes such as COX-2, LOX-5, TXB synthase, and PGI2 synthase was significantly blocked by benfotiamine. Furthermore, benfotiamine prevented the LPS-induced phosphorylation of ERK1/2 and expression of transcription factors NF-κB and Egr-1. Benfotiamine also prevented the LPS-induced oxidative stress and protein-HNE adduct formation. Most importantly, compared to specific COX-2 and LOX-5 inhibitors, benfotiamine significantly prevented LPS-induced macrophage death and monocyte adhesion to endothelial cells. Thus, our studies indicate that the dual regulation of the COX and LOX pathways in AA metabolism could be a novel mechanism by which benfotiamine exhibits its potential anti-inflammatory response. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  3. Osteopontin protects against hyperoxia-induced lung injury by inhibiting nitric oxide synthases.

    Science.gov (United States)

    Zhang, Xiang-Feng; Liu, Shuang; Zhou, Yu-Jie; Zhu, Guang-Fa; Foda, Hussein D

    2010-04-05

    Exposure of adult mice to more than 95% O(2) produces a lethal injury by 72 hours. Nitric oxide synthase (NOS) is thought to contribute to the pathophysiology of murine hyperoxia-induced acute lung injury (ALI). Osteopontin (OPN) is a phosphorylated glycoprotein produced principally by macrophages. OPN inhibits inducible nitric oxide synthase (iNOS), which generates large amounts of nitric oxide production. However, the relationship between nitric oxide and endogenous OPN in lung tissue during hyperoxia-induced ALI has not yet been elucidated, thus we examined the role that OPN plays in the hyperoxia-induced lung injury and its relationships with NOS. One hundred and forty-four osteopontin knock-out (KO) mice and their matched wild type background control (WT) were exposed in sealed cages > 95% oxygen or room air for 24- 72 hours, and the severity of lung injury was assessed; expression of OPN, endothelial nitric oxide synthase (eNOS) and iNOS mRNA in lung tissues at 24, 48 and 72 hours of hyperoxia were studied by reverse transcription-polymerase chain reaction (RT-PCR); immunohistochemistry (IHC) was performed for the detection of iNOS, eNOS, and OPN protein in lung tissues. OPN KO mice developed more severe acute lung injury at 72 hours of hyperoxia. The wet/dry weight ratio increased to 6.85 +/- 0.66 in the KO mice at 72 hours of hyperoxia as compared to 5.31 +/- 0.92 in the WT group (P < 0.05). iNOS mRNA (48 hours: 1.04 +/- 0.08 vs. 0.63 +/- 0.09, P < 0.01; 72 hours: 0.89 +/- 0.08 vs. 0.72 +/- 0.09, P < 0.05) and eNOS mRNA (48 hours: 0.62 +/- 0.08 vs. 0.43 +/- 0.09, P < 0.05; 72 hours: 0.67 +/- 0.08 vs. 0.45 +/- 0.09, P < 0.05) expression was more significantly increased in OPN KO mice than their matched WT mice when exposed to hyperoxia. IHC study showed higher expression of iNOS (20.54 +/- 3.18 vs. 12.52 +/- 2.46, P < 0.05) and eNOS (19.83 +/- 5.64 vs. 9.45 +/- 3.82, P < 0.05) in lung tissues of OPN KO mice at 72 hours of hyperoxia. OPN can protect against

  4. Constitutive expression of feedback-insensitive cystathionine γ-synthase increases methionine levels in soybean leaves and seeds

    Institute of Scientific and Technical Information of China (English)

    YU Yang; HOU Wen-sheng; YaeI Hacham; SUN Shi; WU Cun-xiang; Ifat Matityahu; SONG Shikui; RacheI Amir; HAN Tian-fu

    2018-01-01

    Soybean (Glycine max (L.) Merr.) is a major crop that provides plant-origin protein and oil for humans and livestock. Although the soybean vegetative tissues and seeds provide a major source of high-quality protein, they suffer from low concentration of an essential sulfur-containing amino acid, methionine, which significantly limits their nutritional quality. The level of methionine is mainly controlled by the first unique enzyme of methionine synthesis, cystathione γ-synthase (CGS). Aiming to elevate methionine level in vegetative tissues and seeds, we constitutively over-expressed a feedback-insensitive Arabidopsis CGS (AtD-CGS) in soybean cultivars, Zigongdongdou (ZD) and Jilinxiaoli 1 (JX). The levels of soluble methionine increased remarkably in leaves of transgenic soybeans compared to wild-type plants (6.6- and 7.3-fold in two transgenic ZD lines, and 3.7-fold in one transgenic JX line). Furthermore, the total methionine contents were significantly increased in seeds of the transgenic ZD lines (1.5- to 4.8-fold increase) and the transgenic JX lines (1.3- to 2.3-fold increase) than in the wild type. The protein contents of the transgenic soybean seeds were significantly elevated compared to the wild type, suggesting that the scarcity of methionine in soybeans may limit protein accumulation in soybean seeds. The increased protein content did not alter the profile of major storage proteins in the seeds. Generally, this study provides a promising strategy to increase the levels of methionine and protein in soybean through the breeding programs.

  5. Terpene synthases from Cannabis sativa.

    Directory of Open Access Journals (Sweden)

    Judith K Booth

    Full Text Available Cannabis (Cannabis sativa plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E-β-ocimene, (--limonene, (+-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.

  6. Expression of inducible nitric oxide synthase in macrophages inversely correlates with parasitism of lymphoid tissues in dogs with visceral leishmaniasis.

    Science.gov (United States)

    Sanches, Françoise P; Tomokane, Thaise Y; Da Matta, Vânia L R; Marcondes, Mary; Corbett, Carlos E P; Laurenti, Márcia D

    2014-09-07

    There are only a few studies reporting the role of nitric oxide metabolites for controlling macrophage intracellular parasitism, and these are controversial. Therefore, the present study aimed to evaluate the expression of inducible nitric oxide synthase (iNOS) in the lymph nodes and spleen of dogs affected by visceral leishmaniasis through immunohistochemistry and to determine its correlation with tissue parasite burden and serum interferon (IFN)-γ levels. Twenty-eight dogs were selected and assigned to one of two groups, symptomatic (n = 18) and asymptomatic (n = 10), according to clinical status and laboratory evaluation. A negative control group (n = 6) from a non-endemic region for visceral leishmaniasis was included as well. Parasite density (amastigotes/mm2) was similar between clinical groups in the lymph nodes (P = 0.2401) and spleen (P = 0.8869). The density of iNOS⁺ cells was higher in infected dogs compared to controls (P spleen (P = 0.5940) densities between symptomatic and asymptomatic dogs. A positive correlation was found between the number of iNOS⁺ cells in lymph nodes and interferon-γ levels (r = 0.3776; P = 0.0303), and there was a negative correlation between parasites and iNOS⁺ cell densities both in lymph nodes (r = -0.5341; P = 0.0034) and spleen (r = -0.4669; P = 0.0329). The negative correlation observed between tissue parasitism and the expression of iNOS may be a reflection of NO acting on the control of parasites.

  7. Ocean acidification modulates expression of genes and physiological performance of a marine diatom

    Science.gov (United States)

    Li, Y.; Zhuang, S.; Wu, Y.; Ren, H.; Cheng, F.; Lin, X.; Wang, K.; Beardall, J.; Gao, K.

    2015-09-01

    Ocean Acidification (OA) is known to affect various aspects of the physiological performance of diatoms, but there is little information on the underlining molecular mechanisms involved. Here, we show that in the model diatom Phaeodactylum tricornutum expression of the genes related to light harvesting, carbon acquisition and carboxylation, nitrite assimilation and ATP synthesis are modulated by OA. Growth and photosynthetic carbon fixation were enhanced by elevated CO2 (1000 μatm) under both constant indoor and fluctuating outdoor light regimes. The genetic expression of nitrite reductase (NiR) was up-regulated by OA regardless of light levels and/or regimes. The transcriptional expression of fucoxanthin chlorophyll a/c protein (lhcf type (FCP)) and mitochondrial ATP synthase (mtATP synthase) genes were also enhanced by OA, but only under high light intensity. OA treatment decreased the expression of β-carbonic anhydrase (β-CA) along with down-regulation of CO2 concentrating mechanisms (CCMs). Additionally, the genes for these proteins (NiR, FCP, mtATP synthase, β-CA) showed diel expressions either under constant indoor light or fluctuating sunlight. Thus, OA enhanced photosynthetic and growth rates by stimulating nitrogen assimilation and indirectly by down-regulating the energy-costly inorganic carbon acquisition process.

  8. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  9. Selective knockdown of ceramide synthases reveals complex interregulation of sphingolipid metabolism[S

    OpenAIRE

    Mullen, Thomas D.; Spassieva, Stefka; Jenkins, Russell W.; Kitatani, Kazuyuki; Bielawski, Jacek; Hannun, Yusuf A.; Obeid, Lina M.

    2011-01-01

    Mammalian ceramide synthases 1 to 6 (CerS1–6) generate Cer in an acyl-CoA-dependent manner, and expression of individual CerS has been shown to enhance the synthesis of ceramides with particular acyl chain lengths. However, the contribution of each CerS to steady-state levels of specific Cer species has not been evaluated. We investigated the knockdown of individual CerS in the MCF-7 human breast adenocarcinoma cell line by using small-interfering RNA (siRNA). We found that siRNA-induced down...

  10. Modulation of inducible nitric oxide synthase gene expression in RAW 264.7 murine macrophages by Pacific ciguatoxin.

    Science.gov (United States)

    Kumar-Roiné, Shilpa; Matsui, Mariko; Chinain, Mireille; Laurent, Dominique; Pauillac, Serge

    2008-08-01

    To investigate the possible involvement of the nitric oxide radical (NO) in ciguatera fish poisoning (CFP), the in vitro effects of the main Pacific ciguatoxin (P-CTX-1B) and bacterial lipopolysaccharide (LPS) were comparatively studied on neuroblastoma Neuro-2a and on macrophage RAW 264.7 cell lines. NO accumulation was quantified by measuring nitrite levels in cellular supernatant using Griess reagent while the up-regulation of inducible nitric oxide synthase (iNOS) at the mRNA level was quantified via Real-Time Reverse-Transcription Polymerase Chain Reaction (RT-PCR). P-CTX-1B caused a concentration- and time-dependent induction of iNOS in RAW 264.7 cells but not in Neuro-2a cells. NO production was evidenced by increased nitrite levels in the 10 microM range after 48 h of RAW 264.7 cells exposure to LPS and P-CTX-1B (0.05 microg/ml and 6 nM, respectively). The expression of iNOS mRNA peaked at 8h for LPS then gradually decreased to low level at 48 h. In contrast, a sustained level was recorded with P-CTX-1B in the 8-48 h time interval. The addition of N(omega)-nitro-L-arginine methyl ester (L-NAME), a stereoselective NOS inhibitor, strongly diminished NO formation but had no effect on iNOS mRNA synthesis. The implication of NO in CFP paves the way for new therapies for both western and traditional medicines.

  11. Heterologous gene expression and functional analysis of a type III polyketide synthase from Aspergillus niger NRRL 328

    Energy Technology Data Exchange (ETDEWEB)

    Kirimura, Kohtaro, E-mail: kkohtaro@waseda.jp; Watanabe, Shotaro; Kobayashi, Keiichi

    2016-05-13

    Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr-8-2: 2978617–2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni{sup 2+}-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity of the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. -- Highlights: •Type III PKS from Aspergillus niger NRRL 328, An-CsyA, was cloned and characterized. •An-CsyA produced triketide pyrones, tetraketide pyrones and pentaketide resorcinols. •Functional properties of An-CsyA differs from those of other fungal type III PKSs.

  12. Heterologous gene expression and functional analysis of a type III polyketide synthase from Aspergillus niger NRRL 328

    International Nuclear Information System (INIS)

    Kirimura, Kohtaro; Watanabe, Shotaro; Kobayashi, Keiichi

    2016-01-01

    Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr-8-2: 2978617–2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni"2"+-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity of the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. -- Highlights: •Type III PKS from Aspergillus niger NRRL 328, An-CsyA, was cloned and characterized. •An-CsyA produced triketide pyrones, tetraketide pyrones and pentaketide resorcinols. •Functional properties of An-CsyA differs from those of other fungal type III PKSs.

  13. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  14. Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1

    Science.gov (United States)

    Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.

    1992-01-01

    The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990

  15. The effect of a selective neuronal nitric oxide synthase inhibitor 3-bromo 7-nitroindazole on spatial learning and memory in rats.

    Science.gov (United States)

    Gocmez, Semil Selcen; Yazir, Yusufhan; Sahin, Deniz; Karadenizli, Sabriye; Utkan, Tijen

    2015-04-01

    Since the discovery of nitric oxide (NO) as a neuronal messenger, its way to modulate learning and memory functions is subject of intense research. NO is an intercellular messenger in the central nervous system and is formed on demand through the conversion of L-arginine to L-citrulline via the enzyme nitric oxide synthase (NOS). Neuronal form of nitric oxide synthase may play an important role in a wide range of physiological and pathological conditions. Therefore the aim of this study was to investigate the effects of chronic 3-bromo 7-nitroindazole (3-Br 7-NI), specific neuronal nitric oxide synthase (nNOS) inhibitor, administration on spatial learning and memory performance in rats using the Morris water maze (MWM) paradigm. Male rats received either 3-Br 7-NI (20mg/kg/day) or saline via intraperitoneal injection for 5days. Daily administration of the specific neuronal nitric oxide synthase (nNOS) inhibitor, 3-Br 7-NI impaired the acquisition of the MWM task. 3-Br 7-NI also impaired the probe trial. The MWM training was associated with a significant increase in the brain-derived neurotrophic factor (BDNF) mRNA expression in the hippocampus. BDNF mRNA expression in the hippocampus did not change after 3-Br 7-NI treatment. L-arginine significantly reversed behavioural parameters, and the effect of 3-Br 7-NI was found to be NO-dependent. There were no differences in locomotor activity and blood pressure in 3-Br 7-NI treated rats. Our results may suggest that nNOS plays a key role in spatial memory formation in rats. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Cortisol regulates nitric oxide synthase in freshwater and seawater acclimated rainbow trout, Oncorhynchus mykiss

    DEFF Research Database (Denmark)

    Gerber, Lucie; Madsen, Steffen S; Jensen, Frank B

    2017-01-01

    Cortisol and nitric oxide (NO) are regulators of ion transport and metabolic functions in fish. In the gill, they show opposite effects on Na(+)/K(+)-ATPase (NKA) activity: cortisol stimulates NKA activity while NO inhibits NKA activity. We hypothesized that cortisol may impact NO production...... in osmoregulatory tissues by regulating NO synthase (NOS) expression. We evaluated the influence of cortisol treatment on mRNA expression of Nos1 and Nos2 in gill, kidney and middle intestine of both freshwater (FW) and seawater (SW) acclimated rainbow trout and found both tissue- and salinity-dependent effects....... Nos2 expression was down-regulated in the gill by cortisol injection in both FW and SW trout. This was substantiated by incubating gill tissue with cortisol ex vivo. Similarly, cortisol injection significantly down-regulated Nos2 expression in kidney of SW fish but not in FW fish. In the middle...

  17. The rice terpene synthase gene OsTPS19 functions as an (S)-limonene synthase in planta, and its overexpression leads to enhanced resistance to the blast fungus Magnaporthe oryzae.

    Science.gov (United States)

    Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng

    2018-03-06

    Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    Science.gov (United States)

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

  19. Transcriptome profiling of the Australian arid-land plant Eremophila serrulata (A.DC.) Druce (Scrophulariaceae) for the identification of monoterpene synthases.

    Science.gov (United States)

    Kracht, Octavia Natascha; Ammann, Ann-Christin; Stockmann, Julia; Wibberg, Daniel; Kalinowski, Jörn; Piotrowski, Markus; Kerr, Russell; Brück, Thomas; Kourist, Robert

    2017-04-01

    Plant terpenoids are a large and highly diverse class of metabolites with an important role in the immune defense. They find wide industrial application as active pharmaceutical ingredients, aroma and fragrance compounds. Several Eremophila sp. derived terpenoids have been documented. To elucidate the terpenoid metabolism, the transcriptome of juvenile and mature Eremophila serrulata (A.DC.) Druce (Scrophulariaceae) leaves was sequenced and a transcript library was generated. We report on the first transcriptomic dataset of an Eremophila plant. IlluminaMiSeq sequencing (2 × 300 bp) revealed 7,093,266 paired reads, which could be assembled to 34,505 isogroups. To enable detection of terpene biosynthetic genes, leaves were separately treated with methyl jasmonate, a well-documented inducer of plant secondary metabolites. In total, 21 putative terpene synthase genes were detected in the transcriptome data. Two terpene synthase isoenzymatic genes, termed ES01 and ES02, were successfully expressed in E. coli. The resulting proteins catalyzed the conversion of geranyl pyrophosphate, the universal substrate of monoterpene synthases to myrcene and Z-(b)-ocimene, respectively. The transcriptomic data and the discovery of the first terpene synthases from Eremophila serrulata are the initial step for the understanding of the terpene metabolism in this medicinally important plant genus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. SNP in Chalcone Synthase gene is associated with variation of 6-gingerol content in contrasting landraces of Zingiber officinale.Roscoe.

    Science.gov (United States)

    Ghosh, Subhabrata; Mandi, Swati Sen

    2015-07-25

    Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Effects of Tributyltin Chloride on Cybrids with or without an ATP Synthase Pathologic Mutation.

    Science.gov (United States)

    López-Gallardo, Ester; Llobet, Laura; Emperador, Sonia; Montoya, Julio; Ruiz-Pesini, Eduardo

    2016-09-01

    The oxidative phosphorylation system (OXPHOS) includes nuclear chromosome (nDNA)- and mitochondrial DNA (mtDNA)-encoded polypeptides. Many rare OXPHOS disorders, such as striatal necrosis syndromes, are caused by genetic mutations. Despite important advances in sequencing procedures, causative mutations remain undetected in some patients. It is possible that etiologic factors, such as environmental toxins, are the cause of these cases. Indeed, the inhibition of a particular enzyme by a poison could imitate the biochemical effects of pathological mutations in that enzyme. Moreover, environmental factors can modify the penetrance or expressivity of pathological mutations. We studied the interaction between mitochondrially encoded ATP synthase 6 (p.MT-ATP6) subunit and an environmental exposure that may contribute phenotypic differences between healthy individuals and patients suffering from striatal necrosis syndromes or other mitochondriopathies. We analyzed the effects of the ATP synthase inhibitor tributyltin chloride (TBTC), a widely distributed environmental factor that contaminates human food and water, on transmitochondrial cell lines with or without an ATP synthase mutation that causes striatal necrosis syndrome. Doses were selected based on TBTC concentrations previously reported in human whole blood samples. TBTC modified the phenotypic effects caused by a pathological mtDNA mutation. Interestingly, wild-type cells treated with this xenobiotic showed similar bioenergetics when compared with the untreated mutated cells. In addition to the known genetic causes, our findings suggest that environmental exposure to TBTC might contribute to the etiology of striatal necrosis syndromes. López-Gallardo E, Llobet L, Emperador S, Montoya J, Ruiz-Pesini E. 2016. Effects of tributyltin chloride on cybrids with or without an ATP synthase pathologic mutation. Environ Health Perspect 124:1399-1405; http://dx.doi.org/10.1289/EHP182.

  2. Inhibitors of Fatty Acid Synthase for Prostate Cancer

    Science.gov (United States)

    2012-05-01

    compounds. For example, numerous classes of acetyl- cholinesterase inhibitors have been developed, m any with fe mtomolar binding affinities (7). This...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...CONTRACT NUMBER Inhibitors of Fatty Acid Synthase for Prostate Cancer 5b. GRANT NUMBER W81XWH-09-1-0204 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR

  3. Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.

    Science.gov (United States)

    Lather, Amit; Sharma, Sunil; Khatkar, Anurag

    2018-01-01

    Infections caused by microorganisms are the major cause of death today. The tremendous and improper use of antimicrobial agents leads to antimicrobial resistance. Various currently available antimicrobial drugs are inadequate to control the infections and lead to various adverse drug reactions. Efforts based on computer-aided drug design (CADD) can excavate a large number of databases to generate new, potent hits and minimize the requirement of time as well as money for the discovery of newer antimicrobials. Pharmaceutical sciences also have made development with advances in drug designing concepts. The current research article focuses on the study of various G-6-P synthase inhibitors from literature cited molecular database. Docking analysis was conducted and ADMET data of various molecules was evaluated by Schrodinger Glide and PreADMET software, respectively. Here, the results presented efficacy of various inhibitors towards enzyme G-6-P synthase. Docking scores, binding energy and ADMET data of various molecules showed good inhibitory potential toward G-6-P synthase as compared to standard antibiotics. This novel antimicrobial drug target G-6-P synthase has not so extensively been explored for its application in antimicrobial therapy, so the work done so far proved highly essential. This article has helped the drug researchers and scientists to intensively explore about this wonderful antimicrobial drug target. The Schrodinger, Inc. (New York, USA) software was utilized to carry out the computational calculations and docking studies. The hardware configuration was Intel® core (TM) i5-4210U CPU @ 2.40GHz, RAM memory 4.0 GB under 64-bit window operating system. The ADMET data was calculated by using the PreADMET tool (PreADMET ver. 2.0). All the computational work was completed in the Laboratory for Enzyme Inhibition Studies, Department of Pharmaceutical Sciences, M.D. University, Rohtak, INDIA. Molecular docking studies were carried out to identify the binding

  4. Class II recombinant phosphoribosyl diphosphate synthase from spinach

    DEFF Research Database (Denmark)

    Krath, B N; Hove-Jensen, B

    2001-01-01

    to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...... an unusual low specificity toward diphosphoryl donors by accepting dATP, GTP, CTP, and UTP in addition to ATP. The kinetic mechanism of the enzyme is an ordered steady state Bi Bi mechanism with K(ATP) and K(Rib-5-P) values of 170 and 110 micrometer, respectively, and a V(max) value of 13.1 micromol (min x...... mg of protein)(-1). The enzyme has an absolute requirement for magnesium ions, and maximal activity is obtained at 40 degrees C at pH 7.6....

  5. X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients

    International Nuclear Information System (INIS)

    Lamas, Maria J.; Duran, Goretti; Gomez, Antonio; Balboa, Emilia; Anido, Urbano; Bernardez, Beatriz; Rana-Diez, Pablo; Lopez, Rafael; Carracedo, Angel; Barros, Francisco

    2012-01-01

    Purpose: 5-Fluorouracil–based chemoradiotherapy before total mesorectal excision is currently the standard treatment of Stage II and III rectal cancer patients. We used known predictive pharmacogenetic biomarkers to identify the responders to preoperative chemoradiotherapy in our series. Methods and Materials: A total of 93 Stage II-III rectal cancer patients were genotyped using peripheral blood samples. The genes analyzed were X-ray cross-complementing group 1 (XRCC1), ERCC1, MTHFR, EGFR, DPYD, and TYMS. The patients were treated with 225 mg/m 2 /d continuous infusion of 5-fluorouracil concomitantly with radiotherapy (50.4 Gy) followed by total mesorectal excision. The outcomes were measured by tumor regression grade (TRG) as a major response (TRG 1 and TRG 2) or as a poor response (TRG3, TRG4, and TRG5). Results: The major histopathologic response rate was 47.3%. XRCC1 G/G carriers had a greater probability of response than G/A carriers (odds ratio, 4.18; 95% confidence interval, 1.62–10.74, p = .003) Patients with polymorphisms associated with high expression of thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) showed a greater pathologic response rate compared with carriers of low expression (odds ratio, 2.65; 95% confidence interval, 1.10–6.39, p = .02) No significant differences were seen in the response according to EGFR, ERCC1, MTHFR C 677 and MTHFR A 1298 expression. Conclusions: XRCC1 G/G and thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) are independent factors of a major response. Germline thymidylate synthase and XRCC1 polymorphisms might be useful as predictive markers of rectal tumor response to neoadjuvant chemoradiotherapy with 5-fluorouracil.

  6. X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients

    Energy Technology Data Exchange (ETDEWEB)

    Lamas, Maria J., E-mail: mlamasd@yahoo.es [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Duran, Goretti [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Gomez, Antonio [Department of Oncology Radiotherapy, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Balboa, Emilia [Molecular Medicine Unit, Fundacion Publica Galega de Medicina Xenomica, Choupana S/N, Santiago de Compostela (Spain); Anido, Urbano [Department of Medical Oncology, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Bernardez, Beatriz [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Rana-Diez, Pablo [Molecular Medicine Unit, Fundacion Publica Galega de Medicina Xenomica, Choupana S/N, Santiago de Compostela (Spain); Lopez, Rafael [Department of Medical Oncology, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Carracedo, Angel; Barros, Francisco [Fundacion Publica Galega de Medicina Xenomica and Genomic Medicine Group-CIBERER, University of Santiago de Compostela, Calle San Fransisco S/N, Santiago de Compostela (Spain)

    2012-01-01

    Purpose: 5-Fluorouracil-based chemoradiotherapy before total mesorectal excision is currently the standard treatment of Stage II and III rectal cancer patients. We used known predictive pharmacogenetic biomarkers to identify the responders to preoperative chemoradiotherapy in our series. Methods and Materials: A total of 93 Stage II-III rectal cancer patients were genotyped using peripheral blood samples. The genes analyzed were X-ray cross-complementing group 1 (XRCC1), ERCC1, MTHFR, EGFR, DPYD, and TYMS. The patients were treated with 225 mg/m{sup 2}/d continuous infusion of 5-fluorouracil concomitantly with radiotherapy (50.4 Gy) followed by total mesorectal excision. The outcomes were measured by tumor regression grade (TRG) as a major response (TRG 1 and TRG 2) or as a poor response (TRG3, TRG4, and TRG5). Results: The major histopathologic response rate was 47.3%. XRCC1 G/G carriers had a greater probability of response than G/A carriers (odds ratio, 4.18; 95% confidence interval, 1.62-10.74, p = .003) Patients with polymorphisms associated with high expression of thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) showed a greater pathologic response rate compared with carriers of low expression (odds ratio, 2.65; 95% confidence interval, 1.10-6.39, p = .02) No significant differences were seen in the response according to EGFR, ERCC1, MTHFR{sub C}677 and MTHFR{sub A}1298 expression. Conclusions: XRCC1 G/G and thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) are independent factors of a major response. Germline thymidylate synthase and XRCC1 polymorphisms might be useful as predictive markers of rectal tumor response to neoadjuvant chemoradiotherapy with 5-fluorouracil.

  7. Enantiospecific (+)- and (-)-germacrene D synthases, cloned from goldenrod, reveal a functionally active variant of the universal isoprenoid-biosynthesis aspartate-rich motif.

    Science.gov (United States)

    Prosser, Ian; Altug, Iris G; Phillips, Andy L; König, Wilfried A; Bouwmeester, Harro J; Beale, Michael H

    2004-12-15

    The naturally occurring, volatile sesquiterpene hydrocarbon germacrene D has strong effects on insect behaviour and genes encoding enzymes that produce this compound are of interest in the study of plant-insect interactions and in a number of biotechnological approaches to pest control. Goldenrod, Solidago canadensis, is unusual in that it produces both enantiomers of germacrene D. Two new sesquiterpene synthase cDNAs, designated Sc11 and Sc19, have been isolated from goldenrod and functional expression in Escherichia coli identified Sc11 as (+)-germacrene D synthase and Sc19 as (-)-germacrene D synthase. Thus, the enantiomers of germacrene D are the products of separate, but closely related (85% amino-acid identity), enzymes. Unlike other sesquiterpene synthases and the related monoterpene synthases and prenyl transferases, which contain the characteristic amino-acid motif DDXX(D,E), Sc11 is unusual in that this motif occurs as (303)NDTYD. Mutagenesis of this motif to (303)DDTYD gave rise to an enzyme that fully retained (+)-germacrene D synthase activity. The converse mutation in Sc19 (D303N) resulted in a less efficient but functional enzyme. Mutagenesis of position 303 to glutamate in both enzymes resulted in loss of activity. These results indicate that the magnesium ion-binding role of the first aspartate in the DDXXD motif may not be as critical as previously thought. Further amino-acid sequence comparisons and molecular modelling of the enzyme structures revealed that very subtle changes to the active site of this family of enzymes are required to alter the reaction pathway to form, in this case, different enantiomers from the same enzyme-bound carbocationic intermediate.

  8. The consequences of long-term glycogen synthase kinase-3 inhibition on normal and insulin resistant rat hearts.

    Science.gov (United States)

    Flepisi, T B; Lochner, Amanda; Huisamen, Barbara

    2013-10-01

    Glycogen synthase kinase-3 (GSK-3) is a serine-threonine protein kinase, discovered as a regulator of glycogen synthase. GSK-3 may regulate the expression of SERCA-2a potentially affecting myocardial contractility. It is known to phosphorylate and inhibit IRS-1, thus disrupting insulin signalling. This study aimed to determine whether myocardial GSK-3 protein and its substrate proteins are dysregulated in obesity and insulin resistance, and whether chronic GSK-3 inhibition can prevent or reverse this. Weight matched male Wistar rats were rendered obese by hyperphagia using a special diet (DIO) for 16 weeks and compared to chow fed controls. Half of each group was treated with the GSK-3 inhibitor CHIR118637 (30 mg/kg/day) from week 12 to16 of the diet period. Biometric and biochemical parameters were measured and protein expression determined by Western blotting and specific antibodies. Ca(2+)ATPase activity was determined spectrophotometrically. Cardiomyocytes were prepared by collagenase perfusion and insulin stimulated 2-deoxy-glucose uptake determined. DIO rats were significantly heavier than controls, associated with increased intra-peritoneal fat and insulin resistance. GSK-3 inhibition did not affect weight but improved insulin resistance, also on cellular level. It had no effect on GSK-3 expression but elevated its phospho/total ratio and elevated IRS-2 expression. Obesity lowered SERCA-2a expression and activity while GSK-3 inhibition alleviated this. The phospho/total ratio of phospholamban underscored inhibition of SERCA-2a in obesity. In addition, signs of myocardial hypertrophy were observed in treated control rats. GSK-3 inhibition could not reverse all the detrimental effects of obesity but may be harmful in normal rat hearts. It regulates IRS-2, SERCA-2a and phospholamban expression but not IRS-1.

  9. Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution

    International Nuclear Information System (INIS)

    Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi

    2010-01-01

    The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.

  10. Production of 7,8-Dihydroxy Unsaturated Fatty Acids from Plant Oils by Whole Recombinant Cells Expressing 7,8-Linoleate Diol Synthase from Glomerella cingulata.

    Science.gov (United States)

    Seo, Min-Ju; Kang, Woo-Ri; Shin, Kyung-Chul; Oh, Deok-Kun

    2016-11-16

    The reaction conditions for the production of 7S,8S-dihydroxy-9,12(Z,Z)-octadecadienoic acid from linoleic acid by recombinant Escherichia coli expressing 7,8-linoleate diol synthase from Glomerella cingulata were optimized using response surface methodology. The optimal reaction conditions were pH 7.0, 18.6 °C, 10.8% (v/v) dimethyl sulfoxide, 44.9 g/L cells, and 14.3 g/L linoleic acid, with agitation at 256 rpm. Under these conditions, recombinant cells produced 7,8-dihydroxy unsaturated fatty acids in the range of 7.0-9.8 g/L from 14.3 g/L linoleic acid, 14.3 g/L oleic acid, and plant oil hydrolysates such as waste oil and olive oil containing 14.3 g/L linoleic acid or oleic acid. To the best of the authors' knowledge, this is the first report on the biotechnological production of 7,8-dihydroxy unsaturated fatty acids.

  11. Hyperbaric oxygen upregulates cochlear constitutive nitric oxide synthase

    Directory of Open Access Journals (Sweden)

    Kao Ming-Ching

    2011-02-01

    Full Text Available Abstract Background Hyperbaric oxygen therapy (HBOT is a known adjuvant for treating ischemia-related inner ear diseases. Controversies still exist in the role of HBOT in cochlear diseases. Few studies to date have investigated the cellular changes that occur in inner ears after HBOT. Nitric oxide, which is synthesized by nitric oxide synthase (NOS, is an important signaling molecule in cochlear physiology and pathology. Here we investigated the effects of hyperbaric oxygen on eardrum morphology, cochlear function and expression of NOS isoforms in cochlear substructures after repetitive HBOT in guinea pigs. Results Minor changes in the eardrum were observed after repetitive HBOT, which did not result in a significant hearing threshold shift by tone burst auditory brainstem responses. A differential effect of HBOT on the expression of NOS isoforms was identified. Upregulation of constitutive NOS (nNOS and eNOS was found in the substructures of the cochlea after HBOT, but inducible NOS was not found in normal or HBOT animals, as shown by immunohistochemistry. There was no obvious DNA fragmentation present in this HBOT animal model. Conclusions The present evidence indicates that the customary HBOT protocol may increase constitutive NOS expression but such upregulation did not cause cell death in the treated cochlea. The cochlear morphology and auditory function are consequently not changed through the protocol.

  12. Nuclear receptor 5A (NR5A) family regulates 5-aminolevulinic acid synthase 1 (ALAS1) gene expression in steroidogenic cells.

    Science.gov (United States)

    Ju, Yunfeng; Mizutani, Tetsuya; Imamichi, Yoshitaka; Yazawa, Takashi; Matsumura, Takehiro; Kawabe, Shinya; Kanno, Masafumi; Umezawa, Akihiro; Kangawa, Kenji; Miyamoto, Kaoru

    2012-11-01

    5-Aminolevulinic acid synthase 1 (ALAS1) is a rate-limiting enzyme for heme biosynthesis in mammals. Heme is essential for the catalytic activities of P450 enzymes including steroid metabolic enzymes. Nuclear receptor 5A (NR5A) family proteins, steroidogenic factor-1 (SF-1), and liver receptor homolog-1 (LRH-1) play pivotal roles in regulation of steroidogenic enzymes. Recently, we showed that expression of SF-1/LRH-1 induces differentiation of mesenchymal stem cells into steroidogenic cells. In this study, genome-wide analysis revealed that ALAS1 was a novel SF-1-target gene in differentiated mesenchymal stem cells. Chromatin immunoprecipitation and reporter assays revealed that SF-1/LRH-1 up-regulated ALAS1 gene transcription in steroidogenic cells via binding to a 3.5-kb upstream region of ALAS1. The ALAS1 gene was up-regulated by overexpression of SF-1/LRH-1 in steroidogenic cells and down-regulated by knockdown of SF-1 in these cells. Peroxisome proliferator-activated receptor-γ coactivator-1α, a coactivator of nuclear receptors, also strongly coactivated expression of NR5A-target genes. Reporter analysis revealed that peroxisome proliferator-activated receptor-γ coactivator-1α strongly augmented ALAS1 gene transcription caused by SF-1 binding to the 3.5-kb upstream region. Finally knockdown of ALAS1 resulted in reduced progesterone production by steroidogenic cells. These results indicate that ALAS1 is a novel NR5A-target gene and participates in steroid hormone production.

  13. Glycogen Synthase Kinase 3 Inactivation Induces Cell Senescence through Sterol Regulatory Element Binding Protein 1-Mediated Lipogenesis in Chang Cells.

    Science.gov (United States)

    Kim, You-Mie; Song, Insun; Seo, Yong-Hak; Yoon, Gyesoon

    2013-12-01

    Enhanced lipogenesis plays a critical role in cell senescence via induction of expression of the mature form of sterol regulatory element binding protein 1 (SREBP1), which contributes to an increase in organellar mass, one of the indicators of senescence. We investigated the molecular mechanisms by which signaling molecules control SREBP1-mediated lipogenesis and senescence. We developed cellular models for stress-induced senescence, by exposing Chang cells, which are immortalized human liver cells, to subcytotoxic concentrations (200 µM) of deferoxamine (DFO) and H2O2. In this model of stress-induced cell senescence using DFO and H2O2, the phosphorylation profile of glycogen synthase kinase 3α (GSK3α) and β corresponded closely to the expression profile of the mature form of SREBP-1 protein. Inhibition of GSK3 with a subcytotoxic concentration of the selective GSK3 inhibitor SB415286 significantly increased mature SREBP1 expression, as well as lipogenesis and organellar mass. In addition, GSK3 inhibition was sufficient to induce senescence in Chang cells. Suppression of GSK3 expression with siRNAs specific to GSK3α and β also increased mature SREBP1 expression and induced senescence. Finally, blocking lipogenesis with fatty acid synthase inhibitors (cerulenin and C75) and siRNA-mediated silencing of SREBP1 and ATP citrate lyase (ACL) significantly attenuated GSK3 inhibition-induced senescence. GSK3 inactivation is an important upstream event that induces SREBP1-mediated lipogenesis and consequent cell senescence.

  14. Quick and sensitive determination of gene expression of fatty acid ...

    African Journals Online (AJOL)

    User

    2011-05-16

    May 16, 2011 ... from fatty acid synthase (FAS) with a different glucose level in ... By using the following formula, this study was able to quantify the mRNA expression of ... hypertension, heart disease and diabetes. ... regulation of gene expression has emerged in recent ... stages of adipocyte meta-bolism are relatively well.

  15. Chrysanthemyl diphosphate synthase operates in planta as a bifunctional enzyme with chrysanthemol synthase activity

    DEFF Research Database (Denmark)

    Yang, Ting; Gao, Liping; Hu, Hao

    2014-01-01

    Chrysanthemyl diphosphate synthase (CDS) is the first path-way-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate...

  16. Identification and phylogenetic analysis of a novel starch synthase in maize

    Directory of Open Access Journals (Sweden)

    Hanmei eLiu

    2015-11-01

    Full Text Available Starch is an important reserve of carbon and energy in plants, providing the majority of calories in the human diet and animal feed. Its synthesis is orchestrated by several key enzymes, and the amount and structure of starch, affecting crop yield and quality, are determined mainly by starch synthase (SS activity. To date, five SS isoforms, including SSI-IV and Granule Bound Starch Synthase (GBSS have been identified and their physiological functions have been well characterized. Here, we report the identification of a new SS isoform in maize, designated SSV. By searching sequenced genomes, SSV has been found in all green plants with conserved sequences and gene structures. Our phylogenetic analysis based on 780 base pairs has suggested that SSIV and SSV resulted from a gene duplication event, which may have occurred before the algae formation. An expression profile analysis of SSV in maize has indicated that ZmSSV is mainly transcribed in the kernel and ear leaf during the grain filling stage, which is partly similar to other SS isoforms. Therefore, it is likely that SSV may play an important role in starch biosynthesis. Subsequent analysis of SSV function may facilitate understanding the mechanism of starch granules formation, number and structure.

  17. 1-Aminocyclopropane-1-carboxylic acid (ACC) concentration and ACC synthase expression in soybean roots, root tips, and soybean cyst nematode (Heterodera glycines)-infected roots.

    Science.gov (United States)

    Tucker, Mark L; Xue, Ping; Yang, Ronghui

    2010-01-01

    Colonization of plant roots by root knot and cyst nematodes requires a functional ethylene response pathway. However, ethylene plays many roles in root development and whether its role in nematode colonization is direct or indirect, for example lateral root initiation or root hair growth, is not known. The temporal requirement for ethylene and localized synthesis of ethylene during the life span of soybean cyst nematode (SCN) on soybean roots was further investigated. Although a significant increase in ethylene evolution was not detected from SCN-colonized roots, the concentration of the immediate precursor to ethylene, 1-aminocyclopropane-1-carboxylic acid (ACC), was higher in SCN-colonized root pieces and root tips than in other parts of the root. Moreover, expression analysis of 17 ACC synthase (ACS) genes indicated that a select set of ACS genes is expressed in SCN-colonized root pieces that is clearly different from the set of genes expressed in non-colonized roots or root tips. Semi-quantitative real-time PCR indicated that ACS transcript accumulation correlates with the high concentration of ACC in root tips. In addition, an ACS-like sequence was found in the public SCN nucleotide database. Acquisition of a full-length sequence for this mRNA (accession GQ389647) and alignment with transcripts for other well-characterized ACS proteins indicated that the nematode sequence is missing a key element required for ACS activity and therefore probably is not a functional ACS. Moreover, no significant amount of ACC was found in any growth stage of SCN that was tested.

  18. Bioenergetic Consequences of FLAG Tag Addition to the C-Terminus of Subunit 8 of Yeast Saccharomyces cerevisiae Mitochondrial ATP Synthase

    Directory of Open Access Journals (Sweden)

    I MADE ARTIKA

    2010-09-01

    Full Text Available The yeast mitochondrial F1F0-ATP synthase is a multisubunit complex that contains at least 17 different subunits. Subunit 8 of yeast mitochondrial ATP synthase is a hydrophobic protein of 48 amino acids encoded by the mitochondrial ATP8 gene. Subunit 8 has three distinct domains; an N-terminal domain, a central hydrophobic domain and a C-terminal domain. FLAG tag addition to subunit 8 protein potentially facilitate elucidation of its topology, structure, and function. It has been shown that following incorporation of FLAG tag to its C-terminus, subunit 8 still assemble into functional ATP synthase complex. In order to analyze bioenergetic consequences of the FLAG tag addition, a yeast strain expressing FLAG tagged-subunit 8 was subjected to cellular respiration assays. Results obtained showed that addition of FLAG tag to the C-terminus of subunit 8 does not impair its proper functioning. The FLAG tag system, therefore, can be employed to study subunit 8′s detailed structure, topology, and function.

  19. Prognostic role of syncytin expression in breast cancer

    DEFF Research Database (Denmark)

    Larsson, Lars-Inge; Holck, Susanne; Christensen, Ib Jarle

    2007-01-01

    Breast cancer cells were recently found to produce syncytin, an endogenous retroviral protein implicated in cell fusion, immune regulation, and nitric oxide synthase expression. To determine whether syncytin has a prognostic role in breast cancer, we investigated a series of 165 premenopausal lymph...... node-negative women for syncytin expression using an immunocytochemical scoring system. Results were analyzed with the Kaplan-Meier method and with the Cox proportional hazard model. Syncytin expression was observed in 38% of the patients, and the degree of syncytin expression constituted a positive...

  20. Identification and reconstitution of the polyketide synthases responsible for biosynthesis of the anti-malarial agent, cladosporin

    OpenAIRE

    Cochrane, Rachel V. K.; Sanichar, Randy; Lambkin, Gareth R.; Reiz, Béla; Xu, Wei; Tang, Yi; Vederas, John C.

    2015-01-01

    The anti-malarial agent cladosporin is a nanomolar inhibitor of Plasmodium falciparum lysyl-tRNA synthetase, and exhibits activity against both blood and liver stage infection. Cladosporin can be isolated from the fungus Cladosporium cladosporioides, where it was believed to be biosynthesized by a highly reducing (HR) and non-reducing (NR) iterative type I polyketide synthase (PKS) pair. Genome sequencing of the host organism, and subsequent heterologous expression of these enzymes in Sacchar...

  1. Hybrid polyketide synthases

    Energy Technology Data Exchange (ETDEWEB)

    Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey

    2016-05-10

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.

  2. Geranylgeranyl diphosphate synthase in fission yeast is a heteromer of farnesyl diphosphate synthase (FPS), Fps1, and an FPS-like protein, Spo9, essential for sporulation.

    Science.gov (United States)

    Ye, Yanfang; Fujii, Makoto; Hirata, Aiko; Kawamukai, Makoto; Shimoda, Chikashi; Nakamura, Taro

    2007-09-01

    Both farnesyl diphosphate synthase (FPS) and geranylgeranyl diphosphate synthase (GGPS) are key enzymes in the synthesis of various isoprenoid-containing compounds and proteins. Here, we describe two novel Schizosaccharomyces pombe genes, fps1(+) and spo9(+), whose products are similar to FPS in primary structure, but whose functions differ from one another. Fps1 is essential for vegetative growth, whereas, a spo9 null mutant exhibits temperature-sensitive growth. Expression of fps1(+), but not spo9(+), suppresses the lethality of a Saccharomyces cerevisiae FPS-deficient mutant and also restores ubiquinone synthesis in an Escherichia coli ispA mutant, which lacks FPS activity, indicating that S. pombe Fps1 in fact functions as an FPS. In contrast to a typical FPS gene, no apparent GGPS homologues have been found in the S. pombe genome. Interestingly, although neither fps1(+) nor spo9(+) expression alone in E. coli confers clear GGPS activity, coexpression of both genes induces such activity. Moreover, the GGPS activity is significantly reduced in the spo9 mutant. In addition, the spo9 mutation perturbs the membrane association of a geranylgeranylated protein, but not that of a farnesylated protein. Yeast two-hybrid and coimmunoprecipitation analyses indicate that Fps1 and Spo9 physically interact. Thus, neither Fps1 nor Spo9 alone functions as a GGPS, but the two proteins together form a complex with GGPS activity. Because spo9 was originally identified as a sporulation-deficient mutant, we show here that expansion of the forespore membrane is severely inhibited in spo9Delta cells. Electron microscopy revealed significant accumulation membrane vesicles in spo9Delta cells. We suggest that lack of GGPS activity in a spo9 mutant results in impaired protein prenylation in certain proteins responsible for secretory function, thereby inhibiting forespore membrane formation.

  3. Placental Vesicles Carry Active Endothelial Nitric Oxide Synthase and Their Activity is Reduced in Preeclampsia.

    Science.gov (United States)

    Motta-Mejia, Carolina; Kandzija, Neva; Zhang, Wei; Mhlomi, Vuyane; Cerdeira, Ana Sofia; Burdujan, Alexandra; Tannetta, Dionne; Dragovic, Rebecca; Sargent, Ian L; Redman, Christopher W; Kishore, Uday; Vatish, Manu

    2017-08-01

    Preeclampsia, a multisystem hypertensive disorder of pregnancy, is associated with increased systemic vascular resistance. Placentae from patients with preeclampsia have reduced levels of endothelial nitric oxide synthase (eNOS) and, thus, less nitric oxide (NO). Syncytiotrophoblast extracellular vesicles (STBEV), comprising microvesicles (STBMV) and exosomes, carry signals from the syncytiotrophoblast to the mother. We hypothesized that STBEV-bound eNOS (STBEV-eNOS), capable of producing NO, are released into the maternal circulation. Dual-lobe ex vivo placental perfusion and differential centrifugation was used to isolate STBEV from preeclampsia (n=8) and normal pregnancies (NP; n=11). Plasma samples of gestational age-matched preeclampsia and NP (n=6) were used to isolate circulating STBMV. STBEV expressed placental alkaline phosphatase, confirming placental origin. STBEV coexpressed eNOS, but not inducible nitric oxide synthase, confirmed using Western blot, flow cytometry, and immunodepletion. STBEV-eNOS produced NO, which was significantly inhibited by N   G -nitro-l-arginine methyl ester (eNOS inhibitor; P preeclampsia-perfused placentae had lower levels of STBEV-eNOS (STBMV; P preeclampsia women had lower STBEV-eNOS expression compared with that from NP women ( P preeclampsia placentae, as well as in plasma. The lower STBEV-eNOS NO production seen in preeclampsia may contribute to the decreased NO bioavailability in this disease. © 2017 The Authors.

  4. Inhibitors of Fatty Acid Synthase for Prostate Cancer. Revision

    Science.gov (United States)

    2013-05-01

    acetyl- cholinesterase inhibitors have been developed, many with femtomolar binding affinities (7). This body of literature also confirms that the...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...May 2013 2. REPORT TYPE Revised Final 3. DATES COVERED 01 May 2009-30 Apr 2013 4. TITLE AND SUBTITLE Inhibitors of Fatty Acid Synthase for

  5. Prostaglandin H synthase immunoreactivity in human gut. An immunohistochemical study

    DEFF Research Database (Denmark)

    Mikkelsen, H B; Rumessen, J J; Qvortrup, Klaus

    1991-01-01

    Prostaglandins exhibit a variety of actions on intestinal smooth muscle depending upon the type, dose and muscle layer studied. As the cellular origin of prostaglandin H (PGH) synthase has not been established with certainty in the human gut wall, we studied the localization of PGH synthase...

  6. Expression of the multimeric and highly immunogenic Brucella spp. lumazine synthase fused to bovine rotavirus VP8d as a scaffold for antigen production in tobacco chloroplasts

    Directory of Open Access Journals (Sweden)

    Edgardo Federico Alfano

    2015-12-01

    Full Text Available Lumazine synthase from Brucella spp. (BLS is a highly immunogenic decameric protein which can accommodate foreign polypeptides or protein domains fused to its N-termini, markedly increasing their immunogenicity.The inner core domain (VP8d of VP8 spike protein from bovine rotavirus (BRV is responsible for viral adhesion to sialic acid residues and infection. It also displays neutralizing epitopes, making it a good candidate for vaccination.In this work, the BLS scaffold was assessed for the first time in plants for recombinant vaccine development by N-terminally fusing BLS to VP8d and expressing the resulting fusion (BLSVP8d in tobacco chloroplasts. Transplastomic plants were obtained and characterized by Southern, northern and western blot. BLSVP8d was highly expressed, representing 40% of total soluble protein (TSP (4.85 mg/g fresh tissue. BLSVP8d remained soluble and stable during all stages of plant development and even in lyophilized leaves stored at room temperature. Soluble protein extracts from fresh and lyophilized leaves were able to induce specific neutralizing IgY antibodies in a laying hen model. This work presents BLS as an interesting platform for highly immunogenic injectable, or even oral, subunit vaccines. Lyophilization of transplastomic leaves expressing stable antigenic fusions to BLS would further reduce costs and simplify downstream processing, purification and storage, allowing for more practical vaccines.

  7. Prostacyclin production in rabbit arteries in situ: inhibition by arachidonic acid-induced endothelial cell damage or by low-dose aspirin.

    Science.gov (United States)

    Ingerman-Wojenski, C; Silver, M J; Smith, J B; Nissenbaum, M; Sedar, A W

    1981-04-01

    The central artery of the rabbit ear was perfused in situ and effluent fractions from the artery were assayed for 6-keto-prostaglandin F1 alpha (6-K-PGF1 alpha) and thromboxane B2 (TxB2), the stable metabolites of prostacyclin (PGI2) and TxA2, using specific radioimmunoassays. These metabolites of arachidonic acid (AA) were not detected in the effluent during infusion of Tyrode's solution but both metabolites were detected when small amounts of AA were infused into the artery. Examination of the arteries by scanning electron microscopy revealed that high concentrations of AA which caused a short burst of 6-K-PGF1 alpha and TxB2 production damaged the endothelial cells while lower concentrations which stimulated continuous production did not cause damage. When a non-damaging concentration of AA was infused into an artery that had previously received a damaging concentration, PG production was greatly reduced. Pretreatment of the rabbits with 4 mg/kg acetyl-salicylic acid (ASA) inhibited 6-K-PGF1 alpha production by the rabbit ear artery in response to AA and 70% inhibition was still evident 18 hours after ASA.

  8. L-Myo-inositol 1-phosphate synthase in the aquatic fern Azolla filiculoides.

    Science.gov (United States)

    Benaroya, Rony Oren; Zamski, Eli; Tel-Or, Elisha

    2004-02-01

    L-Myo-inositol 1-phosphate synthase (INPS EC 5.5.1.4) catalyzes the conversion of D-glucose 6-phosphate to L-myo-inositol 1-phosphate. INPS is a key enzyme involved in the biosynthesis of phytate which is a common form of stored phosphates in higher plants. The present study monitored the increase of INPS expression in Azolla filiculoides resulting from exposure to inorganic phosphates, metals and salt stress. The expression of INPS was significantly higher in Azolla plants that were grown in rich mineral growth medium than those maintained on nutritional growth medium. The expression of INPS protein and corresponding mRNA increased in plants cultured in minimal nutritional growth medium when phosphate or Zn2+, Cd2+ and NaCl were added to the growth medium. When employing rich mineral growth medium, INPS protein content increased with the addition of Zn2+, but decreased in the presence of Cd2+ and NaCl. These results indicated that accumulation of phytate in Azolla is a result of the intensified expression of INPS protein and mRNA, and its regulation may be primarily derived by the uptake of inorganic phosphate, and Zn2+, Cd2+ or NaCl.

  9. Requirement of the inducible nitric oxide synthase pathway for IL-1-induced osteoclastic bone resorption

    OpenAIRE

    van't Hof, R. J.; Armour, K. J.; Smith, L. M.; Armour, K. E.; Wei, X. Q.; Liew, F. Y.; Ralston, S. H.

    2000-01-01

    Nitric oxide has been suggested to be involved in the regulation of bone turnover, especially in pathological conditions characterized by release of bone-resorbing cytokines. The cytokine IL-1 is thought to act as a mediator of periarticular bone loss and tissue damage in inflammatory diseases such as rheumatoid arthritis. IL-1 is a potent stimulator of both osteoclastic bone resorption and expression of inducible nitric oxide synthase (iNOS) in bone cells and other cell types. In this study,...

  10. Selective decrease of components of the creatine kinase system and ATP synthase complex in chronic Chagas disease cardiomyopathy.

    Directory of Open Access Journals (Sweden)

    Priscila Camillo Teixeira

    2011-06-01

    Full Text Available BACKGROUND: Chronic Chagas disease cardiomyopathy (CCC is an inflammatory dilated cardiomyopathy with a worse prognosis than other cardiomyopathies. CCC occurs in 30 % of individuals infected with Trypanosoma cruzi, endemic in Latin America. Heart failure is associated with impaired energy metabolism, which may be correlated to contractile dysfunction. We thus analyzed the myocardial gene and protein expression, as well as activity, of key mitochondrial enzymes related to ATP production, in myocardial samples of end-stage CCC, idiopathic dilated (IDC and ischemic (IC cardiomyopathies. METHODOLOGY/PRINCIPAL FINDINGS: Myocardium homogenates from CCC (N=5, IC (N=5 and IDC (N=5 patients, as well as from heart donors (N=5 were analyzed for protein and mRNA expression of mitochondrial creatine kinase (CKMit and muscular creatine kinase (CKM and ATP synthase subunits aplha and beta by immunoblotting and by real-time RT-PCR. Total myocardial CK activity was also assessed. Protein levels of CKM and CK activity were reduced in all three cardiomyopathy groups. However, total CK activity, as well as ATP synthase alpha chain protein levels, were significantly lower in CCC samples than IC and IDC samples. CCC myocardium displayed selective reduction of protein levels and activity of enzymes crucial for maintaining cytoplasmic ATP levels. CONCLUSIONS/SIGNIFICANCE: The selective impairment of the CK system may be associated to the loss of inotropic reserve observed in CCC. Reduction of ATP synthase alpha levels is consistent with a decrease in myocardial ATP generation through oxidative phosphorylation. Together, these results suggest that the energetic deficit is more intense in the myocardium of CCC patients than in the other tested dilated cardiomyopathies.

  11. Structure of the human beta-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase

    DEFF Research Database (Denmark)

    Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny

    2007-01-01

    Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...

  12. Lithium chloride ameliorates learning and memory ability and inhibits glycogen synthase kinase-3 beta activity in a mouse model of fragile X syndrome

    Institute of Scientific and Technical Information of China (English)

    Shengqiang Chen; Xuegang Luo; Quan Yang; Weiwen Sun; Kaiyi Cao; Xi Chen; Yueling Huang; Lijun Dai; Yonghong Yi

    2011-01-01

    In the present study, Fmr1 knockout mice (KO mice) were used as the model for fragile X syndrome. The results of step-through and step-down tests demonstrated that Fmr1 KO mice had shorter latencies and more error counts, indicating a learning and memory disorder. After treatment with 30, 60, 90, 120, or 200 mg/kg lithium chloride, the learning and memory abilities of the Fmr1 KO mice were significantly ameliorated, in particular, the 200 mg/kg lithium chloride treatment had the most significant effect. Western blot analysis showed that lithium chloride significantly enhanced the expression of phosphorylated glycogen synthase kinase 3 beta, an inactive form of glycogen synthase kinase 3 beta, in the cerebral cortex and hippocampus of the Fmr1 KO mice. These results indicated that lithium chloride improved learning and memory in the Fmr1 KO mice, possibly by inhibiting glycogen synthase kinase 3 beta activity.

  13. Induction of a leaf specific geranylgeranyl pyrophosphate synthase and emission of (E,E)-4,8,12-trimethyltrideca-1,3,7,11-tetraene in tomato are dependent on both jasmonic acid and salicylic acid signaling pathways

    NARCIS (Netherlands)

    Ament, K.; Schie, C.C.; Bouwmeester, H.J.; Haring, M.A.; Schuurink, R.C.

    2006-01-01

    Two cDNAs encoding geranylgeranyl pyrophosphate (GGPP) synthases from tomato (Lycopersicon esculentum) have been cloned and functionally expressed in Escherichia coli. LeGGPS1 was predominantly expressed in leaf tissue and LeGGPS2 in ripening fruit and flower tissue. LeGGPS1 expression was induced

  14. Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

    International Nuclear Information System (INIS)

    Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

    2017-01-01

    Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

  15. Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

    Science.gov (United States)

    Ober, Dietrich; Hartmann, Thomas

    1999-01-01

    Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

  16. Cyclic GMP-AMP Synthase Is Required for Cell Proliferation and Inflammatory Responses in Rheumatoid Arthritis Synoviocytes

    OpenAIRE

    Wang, Yan; Su, Guo-Hua; Zhang, Fang; Chu, Jing-Xue; Wang, Yun-Shan

    2015-01-01

    Rheumatoid arthritis (RA) is characterized by inflammatory cell infiltration, fibroblast-like synoviocytes (FLS) invasive proliferation, and joint destruction. Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor that induces immune activation. In this study, we examined whether cGAS plays a role in RA FLS. In this study, cGAS was overexpressed in RA-FLS compared with OA FLS. TNFα stimulation induced cGAS expression in RA FLS. Overexpression of cGAS promoted the proliferation and knockdow...

  17. Structure of the dimeric form of CTP synthase from Sulfolobus solfataricus

    DEFF Research Database (Denmark)

    Lauritsen, Iben; Willemoës, Martin; Jensen, Kaj Frank

    2011-01-01

    CTP synthase catalyzes the last committed step in de novo pyrimidine-nucleotide biosynthesis. Active CTP synthase is a tetrameric enzyme composed of a dimer of dimers. The tetramer is favoured in the presence of the substrate nucleotides ATP and UTP; when saturated with nucleotide, the tetramer...... completely dominates the oligomeric state of the enzyme. Furthermore, phosphorylation has been shown to regulate the oligomeric states of the enzymes from yeast and human. The crystal structure of a dimeric form of CTP synthase from Sulfolobus solfataricus has been determined at 2.5 Å resolution...

  18. Role of thyroid hormones in the normal and glucocorticosteroid hormone-induced evolution of carbamoyl-phosphate synthase (ammonia) activity in axolotl liver

    NARCIS (Netherlands)

    Lamers, W. H.; Vink, C.; Charles, R.

    1978-01-01

    1. In axolotl liver, the activity of carbamoyl-phosphate synthase (ammonia), expressed per mg liver protein, decreases to a minimum at 5 months of age, then increases to a maximum at 8 months of age which is followed by a decrease again. The initial decrease between 3 and 5 months of age appears to

  19. Influence of environmental ammonia on the production of nitric oxide and expression of inducible nitric oxide synthase in the freshwater air-breathing catfish (Heteropneustes fossilis)

    Energy Technology Data Exchange (ETDEWEB)

    Choudhury, Mahua G. [Biochemical Adaptation Laboratory, Department of Zoology, North-Eastern Hill University, Shillong 793022 (India); Saha, Nirmalendu, E-mail: nsaha@nehu.ac.in [Biochemical Adaptation Laboratory, Department of Zoology, North-Eastern Hill University, Shillong 793022 (India)

    2012-07-15

    Highlights: Black-Right-Pointing-Pointer High environmental ammonia caused more production and accumulation of NO in air-breathing catfish (Heteropneustes fossilis). Black-Right-Pointing-Pointer Hyper-ammonia stress caused induction and zonal specific expression of iNOS enzyme protein, mRNA expression in different tissues. Black-Right-Pointing-Pointer Activation of NF{kappa}B that resulted under hyper-ammonia stress was believed to be the cause of induction of iNOS gene. - Abstract: Nitric oxide (NO) is a highly versatile and unique ubiquitous signaling molecule, and is known to play diverse physiological functions in mammals including those of adaptation to various stresses. The present study reports on the influence of exposure to high external ammonia (HEA) on the production of nitric oxide (NO) and the expression of inducible nitric oxide synthase (iNOS), that produces NO from L-arginine in the freshwater air-breathing catfish (Heteropneustes fossilis), which is reported to tolerate a very HEA. Some levels of NO were found to be present in all the tissues and also in plasma of control fish, which further enhanced significantly in fishes treated with high concentrations of environmental ammonia (25 and 50 mM ammonium chloride) for 7 days, accompanied by more efflux of NO from the perfused liver. This was accomplished by the induction of iNOS activity in different tissues of fish exposed to HEA, which otherwise was not detectable in control fish. Exposure to 25 mM ammonium chloride also led to a significant expression of iNOS protein in different tissues, followed by further increase at 50 mM ammonium chloride. Further, there was an increase in the expression of iNOS mRNA in ammonia-treated fish, thus suggesting that the expression of iNOS gene under hyper-ammonia stress was probably regulated at the transcriptional level. Immunocytochemical analysis indicated that the expression of iNOS in different tissues was zonal specific and not expressed uniformly

  20. Influence of environmental ammonia on the production of nitric oxide and expression of inducible nitric oxide synthase in the freshwater air-breathing catfish (Heteropneustes fossilis)

    International Nuclear Information System (INIS)

    Choudhury, Mahua G.; Saha, Nirmalendu

    2012-01-01

    Highlights: ► High environmental ammonia caused more production and accumulation of NO in air-breathing catfish (Heteropneustes fossilis). ► Hyper-ammonia stress caused induction and zonal specific expression of iNOS enzyme protein, mRNA expression in different tissues. ► Activation of NFκB that resulted under hyper-ammonia stress was believed to be the cause of induction of iNOS gene. - Abstract: Nitric oxide (NO) is a highly versatile and unique ubiquitous signaling molecule, and is known to play diverse physiological functions in mammals including those of adaptation to various stresses. The present study reports on the influence of exposure to high external ammonia (HEA) on the production of nitric oxide (NO) and the expression of inducible nitric oxide synthase (iNOS), that produces NO from L-arginine in the freshwater air-breathing catfish (Heteropneustes fossilis), which is reported to tolerate a very HEA. Some levels of NO were found to be present in all the tissues and also in plasma of control fish, which further enhanced significantly in fishes treated with high concentrations of environmental ammonia (25 and 50 mM ammonium chloride) for 7 days, accompanied by more efflux of NO from the perfused liver. This was accomplished by the induction of iNOS activity in different tissues of fish exposed to HEA, which otherwise was not detectable in control fish. Exposure to 25 mM ammonium chloride also led to a significant expression of iNOS protein in different tissues, followed by further increase at 50 mM ammonium chloride. Further, there was an increase in the expression of iNOS mRNA in ammonia-treated fish, thus suggesting that the expression of iNOS gene under hyper-ammonia stress was probably regulated at the transcriptional level. Immunocytochemical analysis indicated that the expression of iNOS in different tissues was zonal specific and not expressed uniformly throughout the organ. Hyper-ammonia stress also led to activation and nuclear

  1. Impairments in cognition and neural precursor cell proliferation in mice expressing constitutively active glycogen synthase kinase-3

    Directory of Open Access Journals (Sweden)

    Marta ePardo

    2015-03-01

    Full Text Available ABSTRACTBrain glycogen synthase kinase-3 (GSK3 is hyperactive in several neurological conditions that involve impairments in both cognition and neurogenesis. This raises the hypotheses that hyperactive GSK3 may directly contribute to impaired cognition, and that this may be related to deficiencies in neural precursor cells (NPC. To study the effects of hyperactive GSK3 in the absence of disease influences, we compared adult hippocampal NPC proliferation and performance in three cognitive tasks in male and female wild-type mice and GSK3 knockin mice, which express constitutively active GSK3. NPC proliferation was ~40% deficient in both male and female GSK3 knockin mice compared with wild-type mice. Environmental enrichment (EE increased NPC proliferation in male, but not female, GSK3 knockin mice and wild-type mice. Male and female GSK3 knockin mice exhibited impairments in novel object recognition, temporal order memory, and coordinate spatial processing compared with gender-matched wild-type mice. EE restored impaired novel object recognition and temporal ordering in both sexes of GSK3 knockin mice, indicating that this repair was not dependent on NPC proliferation, which was not increased by EE in female GSK3 knockin mice. Acute 1 hr pretreatment with the GSK3 inhibitor TDZD-8 also improved novel object recognition and temporal ordering in male and female GSK3 knockin mice. These findings demonstrate that hyperactive GSK3 is sufficient to impair adult hippocampal NPC proliferation and to impair performance in three cognitive tasks in both male and female mice, but these changes in NPC proliferation do not directly regulate novel object recognition and temporal ordering tasks.

  2. Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants.

    Science.gov (United States)

    Degenhardt, Jörg; Köllner, Tobias G; Gershenzon, Jonathan

    2009-01-01

    The multitude of terpene carbon skeletons in plants is formed by enzymes known as terpene synthases. This review covers the monoterpene and sesquiterpene synthases presenting an up-to-date list of enzymes reported and evidence for their ability to form multiple products. The reaction mechanisms of these enzyme classes are described, and information on how terpene synthase proteins mediate catalysis is summarized. Correlations between specific amino acid motifs and terpene synthase function are described, including an analysis of the relationships between active site sequence and cyclization type and a discussion of whether specific protein features might facilitate multiple product formation.

  3. Nitric Oxide Synthase and Cyclooxygenase Pathways: A Complex Interplay in Cellular Signaling.

    Science.gov (United States)

    Sorokin, Andrey

    2016-01-01

    The cellular reaction to external challenges is a tightly regulated process consisting of integrated processes mediated by a variety of signaling molecules, generated as a result of modulation of corresponding biosynthetic systems. Both, nitric oxide synthase (NOS) and cyclooxygenase (COX) systems, consist of constitutive forms (NOS1, NOS3 and COX-1), which are mostly involved in housekeeping tasks, and inducible forms (NOS2 and COX-2), which shape the cellular response to stress and variety of bioactive agents. The complex interplay between NOS and COX pathways can be observed at least at three levels. Firstly, products of NOS and Cox systems can mediate the regulation and the expression of inducible forms (NOS2 and COX-2) in response of similar and dissimilar stimulus. Secondly, the reciprocal modulation of cyclooxygenase activity by nitric oxide and NOS activity by prostaglandins at the posttranslational level has been shown to occur. Mechanisms by which nitric oxide can modulate prostaglandin synthesis include direct S-nitrosylation of COX and inactivation of prostaglandin I synthase by peroxynitrite, product of superoxide reaction with nitric oxide. Prostaglandins, conversely, can promote an increased association of dynein light chain (DLC) (also known as protein inhibitor of neuronal nitric oxide synthase) with NOS1, thereby reducing its activity. The third level of interplay is provided by intracellular crosstalk of signaling pathways stimulated by products of NOS and COX which contributes significantly to the complexity of cellular signaling. Since modulation of COX and NOS pathways was shown to be principally involved in a variety of pathological conditions, the dissection of their complex relationship is needed for better understanding of possible therapeutic strategies. This review focuses on implications of interplay between NOS and COX for cellular function and signal integration.

  4. Expression of Hyaluronan Synthases (HAS1–3) and Hyaluronidases (HYAL1–2) in Serous Ovarian Carcinomas: Inverse Correlation between HYAL1 and Hyaluronan Content

    International Nuclear Information System (INIS)

    Nykopp, Timo K; Anttila, Maarit; Rilla, Kirsi; Sironen, Reijo; Tammi, Markku I; Tammi, Raija H; Hämäläinen, Kirsi; Heikkinen, Anna-Mari; Komulainen, Marja; Kosma, Veli-Matti

    2009-01-01

    Hyaluronan, a tumor promoting extracellular matrix polysaccharide, is elevated in malignant epithelial ovarian tumors, and associates with an unfavorable prognosis. To explore possible contributors to the accumulation of hyaluronan, we examined the expression of hyaluronan synthases (HAS1, HAS2 and HAS3) and hyaluronidases (HYAL1 and HYAL2), correlated with hyaluronidase enzyme activity hyaluronan content and HAS1–3 immunoreactivity. Normal ovaries (n = 5) and 34 serous epithelial ovarian tumors, divided into 4 groups: malignant grades 1+2 (n = 10); malignant grade 3 (n = 10); borderline (n = 4) and benign epithelial tumors (n = 10), were analyzed for mRNA by real-time RT-PCR and compared to hyaluronidase activity, hyaluronan staining, and HAS1–3 immunoreactivity in tissue sections of the same specimens. The levels of HAS2 and HAS3 mRNA (HAS1 was low or absent), were not consistently increased in the carcinomas, and were not significantly correlated with HAS protein or hyaluronan accumulation in individual samples. Instead, the median of HYAL1 mRNA level was 69% lower in grade 3 serous ovarian cancers compared to normal ovaries (P = 0.01). The expression of HYAL1, but not HYAL2, significantly correlated with the enzymatic activity of tissue hyaluronidases (r = 0.5; P = 0.006). An inverse correlation was noted between HYAL1 mRNA and the intensity of hyaluronan staining of the corresponding tissue sections (r = -0.4; P = 0.025). The results indicate that in serous epithelial ovarian malignancies HAS expression is not consistently elevated but HYAL1 expression is significantly reduced and correlates with the accumulation of hyaluronan. (233 words)

  5. Differential appearance of placentomes and expression of prostaglandin H synthase type 2 in placentome subtypes after betamethasone treatment of sheep late in gestation.

    Science.gov (United States)

    Braun, T; Li, S; Moss, T J M; Connor, K L; Doherty, D A; Nitsos, I; Newnham, J P; Challis, J R G; Sloboda, D M

    2011-04-01

    Inappropriate fetal exposure to maternal glucocorticoid (GC) has been proposed as a mechanism for fetal programming where the effects of GC may be mediated by the placenta. However, the consequences of maternal GC on placental morphology and enzyme expression are unclear. We used betamethasone (BET) to determine effects on placentome subtype distribution and expression of prostaglandin H synthase type 2 (PGHS-2) enzyme. Pregnant sheep carrying male fetuses were randomized to receive injections of saline (n = 30) or one (104 days of gestation, (dG); n = 6), two (104, 111 dG; n = 6) or three (104, 111, 118 dG; n = 11) doses of BET (0.5 mg/kg). Placental tissue was collected prior to (75, 84, 101 dG), during (109, 116 dG) and after BET (122, 132, 146 dG). Total number of placentomes was not different between gestational ages. A- and B-subtypes were most affected by prenatal BET exposure; numbers of A-subtypes were increased and numbers of B-subtypes were decreased compared to controls at 116 dG. At term numbers of A-subtypes were lower after BET, but the weight range distribution was similar to controls. In controls, placental PGHS-2 protein levels increased with gestational age and PGHS-2 localized primarily to uninuclear trophoblast cells. After BET, PGHS-2 protein in C-subtypes at term was significantly increased compared to A-subtypes. Maternal BET treatment in late gestation affects the proportions of placentome subtypes and their differential expression of PGHS-2. Our data do not support previous hypotheses that A-subtypes develop into B-, C- and D-subtypes over the course of gestation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

    Science.gov (United States)

    Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

    2016-12-01

    Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

  7. Differential modulation of nitric oxide synthases in aging: therapeutic opportunities

    Directory of Open Access Journals (Sweden)

    Stêfany Bruno De Assis Cau

    2012-06-01

    Full Text Available Vascular aging is the term that describes the structural and functional disturbances of the vasculature with advancing aging. The molecular mechanisms of aging-associated endothelial dysfunction are complex, but reduced nitric oxide (NO bioavailability and altered vascular expression and activity of NO synthase (NOS enzymes have been implicated as major players. Impaired vascular relaxation in aging has been attributed to reduced endothelial NOS (eNOS-derived NO, while increased inducible NOS (iNOS expression seems to account for nitrosative stress and disrupted vascular homeostasis. Although eNOS is considered the main source of NO in the vascular endothelium, neuronal NOS (nNOS also contributes to endothelial cells-derived NO, a mechanism that is reduced in aging. Pharmacological modulation of NO generation and expression/activity of NOS isoforms may represent a therapeutic alternative to prevent the progression of cardiovascular diseases. Accordingly, this review will focus on drugs that modulate NO bioavailability, such as nitrite anions and NO-releasing non-steroidal anti-inflammatory drugs, hormones (dehydroepiandrosterone and estrogen, statins, resveratrol and folic acid, since they may be useful to treat/to prevent aging-associated vascular dysfunction. The impact of these therapies on life quality in elderly and longevity will be discussed.

  8. Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

    OpenAIRE

    Good, Laura Lee

    2001-01-01

    The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

  9. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  10. Diffusible Signal Factor (DSF) Synthase RpfF of Xylella fastidiosa Is a Multifunction Protein Also Required for Response to DSF

    OpenAIRE

    Ionescu, Michael; Baccari, Clelia; Da Silva, Aline Maria; Garcia, Angelica; Yokota, Kenji; Lindow, Steven E.

    2013-01-01

    Xylella fastidiosa, like related Xanthomonas species, employs an Rpf cell-cell communication system consisting of a diffusible signal factor (DSF) synthase, RpfF, and a DSF sensor, RpfC, to coordinate expression of virulence genes. While phenotypes of a ΔrpfF strain in Xanthomonas campestris could be complemented by its own DSF, the DSF produced by X. fastidiosa (XfDSF) did not restore expression of the XfDSF-dependent genes hxfA and hxfB to a ΔrpfF strain of X. fastidiosa, suggesting that Rp...

  11. A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

    Science.gov (United States)

    Cascini, Fidelia; Passerotti, Stella; Martello, Simona

    2012-04-10

    In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  12. The Involvement of Arginase and Nitric Oxide Synthase in Breast Cancer Development: Arginase and NO Synthase as Therapeutic Targets in Cancer

    Directory of Open Access Journals (Sweden)

    Nikolay Avtandilyan

    2018-01-01

    Full Text Available It is well established that, during development of malignancies, metabolic changes occur, including alterations of enzyme activities and isoenzyme expression. Arginase and nitric oxide (NO synthase (NOS are two of those enzymes considered to be involved in tumorigenesis. The goal of this article was to study the involvement of arginase and NOS in the development of different stages of breast cancer. Our results have shown that human serum arginase activity and NO (resp., and NOS activity and polyamines quantities increased in parallel with cancer stage progression and decreased after neoadjuvant chemotherapy. For breast cancer, the only isoenzyme of arginase expressed in serum before and after chemotherapy was in a cationic form. The data of Lineweaver-Burk plot with a Km value of 2 mM was calculated, which is characteristic for human liver type isoform of arginase. During electrophoresis at pH 8.9, the enzyme exhibited high electrophoretic mobility and was detected near the anode. The presented results demonstrated that arginase in human serum with breast cancer and after chemotherapy is not polymorphic. We suggest that arginase and NOS inhibition has antitumor effects on cancer development, as it can inhibit polyamines and NO levels, a precursor of cancer cell proliferation, metastasis, and tumor angiogenesis.

  13. Molecular size estimation of plasma membrane β-glucan synthase from red beet root

    International Nuclear Information System (INIS)

    Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.

    1986-01-01

    Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane

  14. Drosophila UNC-45 prevents heat-induced aggregation of skeletal muscle myosin and facilitates refolding of citrate synthase

    Energy Technology Data Exchange (ETDEWEB)

    Melkani, Girish C.; Lee, Chi F.; Cammarato, Anthony [Department of Biology and the Molecular Biology Institute, San Diego State University, San Diego, CA 92182-4614 (United States); Bernstein, Sanford I., E-mail: sbernst@sciences.sdsu.edu [Department of Biology and the Molecular Biology Institute, San Diego State University, San Diego, CA 92182-4614 (United States)

    2010-05-28

    UNC-45 belongs to the UCS (UNC-45, CRO1, She4p) domain protein family, whose members interact with various classes of myosin. Here we provide structural and biochemical evidence that Escherichia coli-expressed Drosophila UNC-45 (DUNC-45) maintains the integrity of several substrates during heat-induced stress in vitro. DUNC-45 displays chaperone function in suppressing aggregation of the muscle myosin heavy meromyosin fragment, the myosin S-1 motor domain, {alpha}-lactalbumin and citrate synthase. Biochemical evidence is supported by electron microscopy, which reveals the first structural evidence that DUNC-45 prevents inter- or intra-molecular aggregates of skeletal muscle heavy meromyosin caused by elevated temperatures. We also demonstrate for the first time that UNC-45 is able to refold a denatured substrate, urea-unfolded citrate synthase. Overall, this in vitro study provides insight into the fate of muscle myosin under stress conditions and suggests that UNC-45 protects and maintains the contractile machinery during in vivo stress.

  15. Stimulation of Inducible Nitric Oxide Synthase Expression by Beta Interferon Increases Necrotic Death of Macrophages upon Listeria monocytogenes Infection▿

    OpenAIRE

    Zwaferink, Heather; Stockinger, Silvia; Reipert, Siegfried; Decker, Thomas

    2008-01-01

    Murine macrophage death upon infection with Listeria monocytogenes was previously shown to be increased by beta interferon, produced by the infected cells. We saw that interferon-upregulated caspase activation or other interferon-inducible, death-associated proteins, including TRAIL, protein kinase R, and p53, were not necessary for cell death. Macrophage death was reduced when inducible nitric oxide synthase (iNOS) was inhibited during infection, and iNOS-deficient macrophages were less susc...

  16. Analysis of tandem repeat units of the promoter of capsanthin/capsorubin synthase (Ccs) gene in pepper fruit.

    Science.gov (United States)

    Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui

    2017-07-01

    Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.

  17. SCREENING OF 6-PYRUVOYL-TETRAHYDROPTERIN SYNTHASE ACTIVITY DEFICIENCY AMONG HYPERP HENYLALANINEMIC PATIENTS

    Directory of Open Access Journals (Sweden)

    DURDI QUJEQ

    1999-10-01

    Full Text Available A deficiency of the phenylalanine hydroxylase activity or its cofactor tetrahydrobiopterin may"nlead to hyperphenylalamnemia and as a result, loss of IQ, poor school performance, and"nbehavior problems occurs. Deficiency in 6-pyruvoyl-tetrahydropterin synthase activity is the"nmajor cause of tetrahydrobiopterin deficient phenylketonuria. In this study, blood specimens"nfrom 165 healthy volunteers and 127 children with phenylketonuria were used to determine"nthe 6-pyruvoyl-tetrahydropterin synthase activity. It was found that the activity of 6-"npyruvoyl- tetrahydropterin synthase was decreased in comparison with control [23.46 +/-"n2.94, (mean +/- SD, mmol/ ml/h, n=I27 vs. 127.63 +/- 4.52, n=165, p<0.05]. Results of"nthis study indicate that examination of 6-pyruvoyl-tetrahydropterin synthase activity is helpful"nand may lead to the diagnosis cause of hyperphenylalaninemia.

  18. The Glycogen Synthase Kinase 3α and β Isoforms Differentially Regulates Interleukin-12p40 Expression in Endothelial Cells Stimulated with Peptidoglycan from Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Ricarda Cortés-Vieyra

    Full Text Available Glycogen synthase kinase 3 (GSK3 is a constitutively active regulatory enzyme that is important in cancer, diabetes, and cardiovascular, neurodegenerative, and psychiatric diseases. While GSK3α is usually important in neurodegenerative and psychiatric diseases GSK3β is fundamental in the inflammatory response caused by bacterial components. Peptidoglycan (PGN, one of the most abundant cell-wall structures of Gram-positive bacteria, is an important inducer of inflammation. To evaluate whether inhibition of GSK3α and GSK3β activity in bovine endothelial cells (BEC regulates the expression of the pro-inflammatory cytokine IL-12p40, we treated BEC with SDS-purified PGN from Staphylococcus aureus. We found that PGN triggered a TLR2/PI3K/Akt-dependent phosphorylation of GSK3α at Ser21, GSK3β at Ser9, and NF-κB p65 subunit (p65 at Ser536, and the phosphorylation of GSK3α was consistently higher than that of GSK3β. The expression of IL-12p40 was inhibited in BEC stimulated with PGN and pre-treated with a specific neutralizing anti-TLR2 antibody that targets the extracellular domain of TLR2 or by the addition of Akt-i IV (an Akt inhibitor. Inhibition of GSK3α and GSK3β with LiCl or SB216763 induced an increase in IL-12p40 mRNA and protein. The effect of each isoform on IL-12p40 expression was evaluated by siRNA-gene expression silencing of GSK3α and GSK3β. GSK3α gene silencing resulted in a marked increase in IL-12p40 mRNA and protein while GSK3β gene silencing had the opposite effect on IL-12p40 expression. These results indicate that the TLR2/PI3K/Akt-dependent inhibition of GSK3α activity also plays an important role in the inflammatory response caused by stimulation of BEC with PGN from S. aureus.

  19. Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle

    DEFF Research Database (Denmark)

    Højlund, Kurt; Beck-Nielsen, Henning

    2006-01-01

    Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...

  20. Modulation of hyaluronan synthase activity in cellular membrane fractions

    OpenAIRE

    Vigetti, Davide; Genasetti, A; Karousou, Evgenia; Viola, Manuela; Clerici, M; Bartolini, B; Moretto, Paola; DE LUCA, Giancarlo; Hascall, Vc; Passi, Alberto

    2009-01-01

    Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in euk...

  1. Inhibition of fatty acid synthase prevents preadipocyte differentiation

    International Nuclear Information System (INIS)

    Schmid, Bernhard; Rippmann, Joerg F.; Tadayyon, Moh; Hamilton, Bradford S.

    2005-01-01

    Inhibition of fatty acid synthase (FAS) reduces food intake in rodents. As adipose tissue expresses FAS, we sought to investigate the effect of reduced FAS activity on adipocyte differentiation. FAS activity was suppressed either pharmacologically or by siRNA during differentiation of 3T3-L1 cells. Cerulenin (10 μM), triclosan (50 μM), and C75 (50 μM) reduced dramatically visible lipid droplet accumulation, while incorporation of [1- 14 C]acetate into lipids was reduced by 75%, 70%, and 90%, respectively. Additionally, the substances reduced FAS, CEBPα, and PPARγ mRNA by up to 85% compared to that of control differentiated cells. Transient transfection with FAS siRNA suppressed FAS mRNA and FAS activity, and this was accompanied by reduction of CEBPα and PPARγ mRNA levels, and complete prevention of lipid accumulation. CD36, a late marker of differentiation, was also reduced. Together, these results suggest that FAS generated signals may be essential to support preadipocyte differentiation

  2. [PREPARATION OF HUMAN TISSUE PROTEIN EXTRACTS ENRICHED WITH THE SPHINGOMYELIN SYNTHASE 1].

    Science.gov (United States)

    Sudarkina, O Yu; Dergunova, L V

    2015-01-01

    Sphingomyelin synthase 1 (SMS 1) catalyzes sphingomyelin biosynthesis in eukaryotic cells. We previously studied the structure of the human SGMS1 gene, which encodes the enzyme and its numerous transcripts. The tissue-specific expression of the transcripts was also described. Analysis of the SMS1 protein expression in human tissues using immunoblotting of tissue extracts prepared in the RIPA (Radio Immuno-Precipitation Assay) buffer revealed a weak signal in renal cortex, testis, lung, and no signal in placenta and lymphatic node. In this work, a new method of preparation of the tissue protein extracts enriched with SMS1 was suggested. The method based on the consecutive extraction with a buffer containing 0.05 and 1 mg/ml of the Quillaja saponaria saponin allowed SMS1 to be detected in all tissues tested. The SMS1 content in the saponin extract of kidney cortex is about 12-fold higher compared to the RIPA extraction procedure.

  3. A high-throughput colorimetric screening assay for terpene synthase activity based on substrate consumption.

    Directory of Open Access Journals (Sweden)

    Maiko Furubayashi

    Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.

  4. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  5. Uridine 5'-Monophosphate Synthase Is Transcriptionally Regulated by Pyrimidine Levels in Nicotiana plumbaginifolia

    Science.gov (United States)

    Santoso; Thornburg

    1998-02-01

    To understand the regulation and expression of pyrimidine biosynthesis in plants, we have examined the effect of the metabolic inhibitor 5-fluoroorotic acid (FOA) on uridine-5'-monophosphate synthase (UMPSase) expression in cell cultures of Nicotiana plumbaginifolia. UMPSase is the rate-limiting step of pyrimidine biosynthesis in plants. Addition of FOA causes an up-regulation of UMPSase enzyme activity in cell cultures after a lag phase of several days. Western-blot analysis demonstrated that the up-regulation in enzyme activity was caused by increased expression of the UMPSase protein. Northern-blot analysis demonstrated a higher level of UMPSase mRNA in the FOA-induced tissues than in control tissues. Run-on transcriptional assays showed that the UMPSase gene was transcriptionally activated after FOA treatment. The mechanism of toxicity of FOA is through thymine starvation. We found that addition of thymine abrogated the FOA-mediated up-regulation of UMPSase. In addition, methotrexate and aminopterin, which affect thymine levels by inhibiting dihydrofolate reductase, also up-regulate UMPSase in N. plumbaginifolia cells.

  6. Involvement of an ent-copalyl diphosphate synthase in tissue-specific accumulation of specialized diterpenes in Andrographis paniculata.

    Science.gov (United States)

    Misra, Rajesh Chandra; Garg, Anchal; Roy, Sudeep; Chanotiya, Chandan Singh; Vasudev, Prema G; Ghosh, Sumit

    2015-11-01

    Ent-labdane-related diterpene (ent-LRD) specialized (i.e. secondary) metabolites of the medicinal plant kalmegh (Andrographis paniculata) have long been known for several pharmacological activities. However, our understanding of the ent-LRD biosynthetic pathway has remained largely incomplete. Since ent-LRDs accumulate in leaves, we carried out a comparative transcriptional analysis using leaf and root tissues, and identified 389 differentially expressed transcripts, including 223 transcripts that were preferentially expressed in leaf tissue. Analysis of the transcripts revealed various specialized metabolic pathways, including transcripts of the ent-LRD biosynthetic pathway. Two class II diterpene synthases (ApCPS1 and ApCPS2) along with one (ApCPS1') and two (ApCPS2' and ApCPS2″) transcriptional variants that were the outcomes of alternative splicing of the precursor mRNA and alternative transcriptional termination, respectively, were identified. ApCPS1 and ApCPS2 encode for 832- and 817-amino acids proteins, respectively, and are phylogenetically related to the dicotyledons ent-copalyl diphosphate synthases (ent-CPSs). The spatio-temporal patterns of ent-LRD metabolites accumulation and gene expression suggested a likely role for ApCPS1 in general (i.e. primary) metabolism, perhaps by providing precursor for the biosynthesis of phytohormone gibberellin (GA). However, ApCPS2 is potentially involved in tissue-specific accumulation of ent-LRD specialized metabolites. Bacterially expressed recombinant ApCPS2 catalyzed the conversion of (E,E,E)-geranylgeranyl diphosphate (GGPP), the general precursor of diterpenes to ent-copalyl diphosphate (ent-CPP), the precursor of ent-LRDs. Taken together, these results advance our understanding of the tissue-specific accumulation of specialized ent-LRDs of medicinal importance. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. Identification of an algal xylan synthase indicates that there is functional orthology between algal and plant cell wall biosynthesis

    Energy Technology Data Exchange (ETDEWEB)

    Jensen, Jacob Kruger [Michigan State Univ., East Lansing, MI (United States). Dept. of Plant Biology; Michigan State Univ., East Lansing, MI (United States). DOE Great Lakes Bioenergy Research Center; Busse-Wicher, Marta [Univ. of Cambridge (United Kingdom). Dept. of Biochemistry; Poulsen, Christian Peter [Carlsberg Research Lab., Copenhagen (Denmark); Fangel, Jonatan Ulrik [Carlsberg Research Lab., Copenhagen (Denmark); Smith, Peter James [Univ. of Georgia, Athens, GA (United States). Complex Carbohydrate Research Center; Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). BioEnergy Science Center (BESC); Yang, Jeong-Yeh [Univ. of Georgia, Athens, GA (United States). Complex Carbohydrate Research Center; Peña, Maria-Jesus [Univ. of Georgia, Athens, GA (United States). Complex Carbohydrate Research Center; Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). BioEnergy Science Center (BESC); Dinesen, Malene Hessellund [Carlsberg Research Lab., Copenhagen (Denmark); Martens, Helle Juel [Univ. of Copenhagen (Denmark). Dept. of Plant and Environmental Sciences; Melkonian, Michael [Univ. zu Koln (Germany). Botanical Inst., Dept. of Biological Sciences; Wong, Gane Ka-Shu [BGI-Shenzhen, Shenzhen, Guangdong (China); Moremen, Kelley W. [Univ. of Georgia, Athens, GA (United States). Complex Carbohydrate Research Center; Wilkerson, Curtis Gene [Michigan State Univ., East Lansing, MI (United States). Dept. of Plant Biology; Michigan State Univ., East Lansing, MI (United States). DOE Great Lakes Bioenergy Research Center; Michigan State Univ., East Lansing, MI (United States). Dept. of Biochemistry and Molecular Biology; Scheller, Henrik Vibe [Joint BioEnergy Inst. (JBEI), Emeryville, CA (United States); Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Environmental Genomics and Systems Biology Division; Dupree, Paul [Univ. of Cambridge (United Kingdom). Dept. of Biochemistry; Ulvskov, Peter [Univ. of Georgia, Athens, GA (United States). Complex Carbohydrate Research Center; Urbanowicz, Breeanna Rae [Univ. of Georgia, Athens, GA (United States). Complex Carbohydrate Research Center; Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). BioEnergy Science Center (BESC); Harholt, Jesper [Carlsberg Research Lab., Copenhagen (Denmark)

    2018-02-20

    Insights into the evolution of plant cell walls have important implications for comprehending these diverse and abundant biological structures. In order to understand the evolving structure-function relationships of the plant cell wall, it is imperative to trace the origin of its different components. The present study is focused on plant 1,4-β-xylan, tracing its evolutionary origin by genome and transcriptome mining followed by phylogenetic analysis, utilizing a large selection of plants and algae. It substantiates the findings by heterologous expression and biochemical characterization of a charophyte alga xylan synthase. Of the 12 known gene classes involved in 1,4-β-xylan formation, XYS1/IRX10 in plants, IRX7, IRX8, IRX9, IRX14 and GUX occurred for the first time in charophyte algae. An XYS1/IRX10 ortholog from Klebsormidium flaccidum, designated K. flaccidumXYLAN SYNTHASE-1 (KfXYS1), possesses 1,4-β-xylan synthase activity, and 1,4-β-xylan occurs in the K. flaccidum cell wall. Finally, these data suggest that plant 1,4-β-xylan originated in charophytes and shed light on the origin of one of the key cell wall innovations to occur in charophyte algae, facilitating terrestrialization and emergence of polysaccharide-based plant cell walls.

  8. Plant polyketide synthases: a chalcone synthase-type enzyme which performs a condensation reaction with methylmalonyl-CoA in the biosynthesis of C-methylated chalcones.

    Science.gov (United States)

    Schröder, J; Raiber, S; Berger, T; Schmidt, A; Schmidt, J; Soares-Sello, A M; Bardshiri, E; Strack, D; Simpson, T J; Veit, M; Schröder, G

    1998-06-09

    Heterologous screening of a cDNA library from Pinusstrobus seedlings identified clones for two chalcone synthase (CHS) related proteins (PStrCHS1 and PStrCHS2, 87.6% identity). Heterologous expression in Escherichia coli showed that PStrCHS1 performed the typical CHS reaction, that it used starter CoA-esters from the phenylpropanoid pathway, and that it performed three condensation reactions with malonyl-CoA, followed by the ring closure to the chalcone. PstrCHS2 was completely inactive with these starters and also with linear CoA-esters. Activity was detected only with a diketide derivative (N-acetylcysteamine thioester of 3-oxo-5-phenylpent-4-enoic acid) that corresponded to the CHS reaction intermediate postulated after the first condensation reaction. PstrCHS2 performed only one condensation, with 6-styryl-4-hydroxy-2-pyrone derivatives as release products. The enzyme preferred methylmalonyl-CoA against malonyl-CoA, if only methylmalonyl-CoA was available. These properties and a comparison with the CHS from Pinus sylvestris suggested for PstrCHS2 a special function in the biosynthesis of secondary products. In contrast to P. sylvestris, P. strobus contains C-methylated chalcone derivatives, and the methyl group is at the position predicted from a chain extension with methylmalonyl-CoA in the second condensation of the biosynthetic reaction sequence. We propose that PstrCHS2 specifically contributes the condensing reaction with methylmalonyl-CoA to yield a methylated triketide intermediate. We discuss a model that the biosynthesis of C-methylated chalcones represents the simplest example of a modular polyketide synthase.

  9. Cloning and sequence analysis of putative type II fatty acid synthase ...

    Indian Academy of Sciences (India)

    Prakash

    Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

  10. Cloning and functional characterization of three terpene synthases from lavender (Lavandula angustifolia).

    Science.gov (United States)

    Landmann, Christian; Fink, Barbara; Festner, Maria; Dregus, Márta; Engel, Karl-Heinz; Schwab, Wilfried

    2007-09-15

    The essential oil of lavender (Lavandula angustifolia) is mainly composed of mono- and sesquiterpenes. Using a homology-based PCR strategy, two monoterpene synthases (LaLIMS and LaLINS) and one sesquiterpene synthase (LaBERS) were cloned from lavender leaves and flowers. LaLIMS catalyzed the formation of (R)-(+)-limonene, terpinolene, (1R,5S)-(+)-camphene, (1R,5R)-(+)-alpha-pinene, beta-myrcene and traces of alpha-phellandrene. The proportions of these products changed significantly when Mn(2+) was supplied as the cofactor instead of Mg(2+). The second enzyme LaLINS produced exclusively (R)-(-)-linalool, the main component of lavender essential oil. LaBERS transformed farnesyl diphosphate and represents the first reported trans-alpha-bergamotene synthase. It accepted geranyl diphosphate with higher affinity than farnesyl diphosphate and also produced monoterpenes, albeit at low rates. LaBERS is probably derived from a parental monoterpene synthase by the loss of the plastidial signal peptide and by broadening its substrate acceptance spectrum. The identification and description of the first terpene synthases from L. angustifolia forms the basis for the biotechnological modification of essential oil composition in lavender.

  11. The molecular motor F-ATP synthase is targeted by the tumoricidal protein HAMLET.

    Science.gov (United States)

    Ho, James; Sielaff, Hendrik; Nadeem, Aftab; Svanborg, Catharina; Grüber, Gerhard

    2015-05-22

    HAMLET (human alpha-lactalbumin made lethal to tumor cells) interacts with multiple tumor cell compartments, affecting cell morphology, metabolism, proteasome function, chromatin structure and viability. This study investigated if these diverse effects of HAMLET might be caused, in part, by a direct effect on the ATP synthase and a resulting reduction in cellular ATP levels. A dose-dependent reduction in cellular ATP levels was detected in A549 lung carcinoma cells, and by confocal microscopy, co-localization of HAMLET with the nucleotide-binding subunits α (non-catalytic) and β (catalytic) of the energy converting F1F0 ATP synthase was detected. As shown by fluorescence correlation spectroscopy, HAMLET binds to the F1 domain of the F1F0 ATP synthase with a dissociation constant (KD) of 20.5μM. Increasing concentrations of the tumoricidal protein HAMLET added to the enzymatically active α3β3γ complex of the F-ATP synthase lowered its ATPase activity, demonstrating that HAMLET binding to the F-ATP synthase effects the catalysis of this molecular motor. Single-molecule analysis was applied to study HAMLET-α3β3γ complex interaction. Whereas the α3β3γ complex of the F-ATP synthase rotated in a counterclockwise direction with a mean rotational rate of 3.8±0.7s(-1), no rotation could be observed in the presence of bound HAMLET. Our findings suggest that direct effects of HAMLET on the F-ATP synthase may inhibit ATP-dependent cellular processes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora.

    Science.gov (United States)

    Schindler, Daniel; Nowrousian, Minou

    2014-07-01

    Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Identification and characterization of multiple curcumin synthases from the herb Curcuma longa.

    Science.gov (United States)

    Katsuyama, Yohei; Kita, Tomoko; Horinouchi, Sueharu

    2009-09-03

    Curcuminoids are pharmaceutically important compounds isolated from the herb Curcuma longa. Two additional type III polyketide synthases, named CURS2 and CURS3, that are capable of curcuminoid synthesis were identified and characterized. In vitro analysis revealed that CURS2 preferred feruloyl-CoA as a starter substrate and CURS3 preferred both feruloyl-CoA and p-coumaroyl-CoA. These results suggested that CURS2 synthesizes curcumin or demethoxycurcumin and CURS3 synthesizes curcumin, bisdemethoxycurcumin and demethoxycurcumin. The availability of the substrates and the expression levels of the three different enzymes capable of curcuminoid synthesis with different substrate specificities might influence the composition of curcuminoids in the turmeric and in different cultivars.

  14. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    DEFF Research Database (Denmark)

    von Wettstein, Penny

    2017-01-01

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

  15. Prostacyclin and milrinone by aerosolization improve pulmonary hemodynamics in newborn lambs with experimental pulmonary hypertension.

    Science.gov (United States)

    Kumar, Vasanth H; Swartz, Daniel D; Rashid, Nasir; Lakshminrusimha, Satyan; Ma, Changxing; Ryan, Rita M; Morin, Frederick C

    2010-09-01

    Aerosolized prostacyclin (PGI2) produces selective pulmonary vasodilation in patients with pulmonary hypertension (PH). The response to PGI2 may be increased by phosphodiesterase type 3 inhibitors such as milrinone. We studied the dose response effects of aerosolized PGI2 and aerosolized milrinone both alone and in combination on pulmonary and systemic hemodynamics in newborn lambs with Nomega-nitro-L-arginine methyl ester (L-NAME)-induced PH. We hypothesized that coaerosolization of PGI2 with milrinone would additively decrease pulmonary vascular resistance (PVR), prolong the duration of action of PGI2, and selectively dilate the pulmonary vasculature. Near-term lambs were delivered by C-section and instrumented and PH was induced by L-NAME (bolus 25 mg/kg; infusion 10 mg.kg(-1).h(-1)) and indomethacin. In the first set of experiments, PGI2 was aerosolized at random doses of 2, 20, 100, 200, 500, and 1,000 ng.kg(-1).min(-1) followed by milrinone at doses of 0.1, 1, and 10 microg.kg(-1).min(-1) over 10 min. In the second set of experiments, milrinone at 1 microg.kg(-1).min(-1) was aerosolized in combination with PGI2 at doses of 20, 100, and 200 ng.kg(-1).min(-1) over 10 min. Pulmonary arterial pressures (PAP) and PVR decreased significantly with increasing doses of aerosolized PGI2 and milrinone. The combination of PGI2 and milrinone significantly reduced PAP and PVR more than either of the drugs aerosolized alone. Addition of milrinone significantly increased the duration of action of PGI2. When aerosolized independently, PGI2 and milrinone selectively dilated the pulmonary vasculature but the combination did not. Milrinone enhances the vasodilatory effects of PGI2 on the pulmonary vasculature but caution must be exercised regarding systemic hypotension.

  16. A maize spermine synthase 1 PEST sequence fused to the GUS reporter protein facilitates proteolytic degradation.

    Science.gov (United States)

    Maruri-López, Israel; Rodríguez-Kessler, Margarita; Rodríguez-Hernández, Aída Araceli; Becerra-Flora, Alicia; Olivares-Grajales, Juan Elías; Jiménez-Bremont, Juan Francisco

    2014-05-01

    Polyamines are low molecular weight aliphatic compounds involved in various biochemical, cellular and physiological processes in all organisms. In plants, genes involved in polyamine biosynthesis and catabolism are regulated at transcriptional, translational, and posttranslational level. In this research, we focused on the characterization of a PEST sequence (rich in proline, glutamic acid, serine, and threonine) of the maize spermine synthase 1 (ZmSPMS1). To this aim, 123 bp encoding 40 amino acids of the C-terminal region of the ZmSPMS1 enzyme containing the PEST sequence were fused to the GUS reporter gene. This fusion was evaluated in Arabidopsis thaliana transgenic lines and onion monolayers transient expression system. The ZmSPMS1 PEST sequence leads to specific degradation of the GUS reporter protein. It is suggested that the 26S proteasome may be involved in GUS::PEST fusion degradation in both onion and Arabidopsis. The PEST sequences appear to be present in plant spermine synthases, mainly in monocots. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  17. Trypanosoma cruzi: Serum levels of nitric oxide and expression of inducible nitric oxide synthase in myocardium and spleen of dogs in the acute stage of infection with metacyclic or blood trypomastigotes.

    Science.gov (United States)

    Vieira, Paula Melo de Abreu; Francisco, Amanda Fortes; de Souza, Sheler Martins; Malaquias, Luiz Cosme Cotta; Reis, Alexandre Barbosa; Giunchetti, Rodolfo Cordeiro; Veloso, Vanja Maria; de Lana, Marta; Tafuri, Washington Luiz; Carneiro, Cláudia Martins

    2009-01-01

    The participation of nitric oxide (NO) in the control of blood parasitemia and parasitism during the acute phase of infection in dogs inoculated with blood trypomastigotes (BT) or metacyclic trypomastigotes (MT group) of Berenice-78 Trypanosoma cruzi strain has been evaluated. Animals of the MT group (n=4) presented increased levels of serum NO throughout the infection when compared with the BT (n=4) or control (n=4) groups, and a delay in parasitemia peak compared with the BT group. In spleen fragments, tissue parasitism was not observed but the MT group presented larger areas associated with inducible NO synthase (iNOS) in relation to BT and control groups. Heart fragments of MT-infected animals exhibited comparatively low tissue parasitism and high iNOS expression, while animals of the BT group presented high inflammatory infiltrate, high tissue parasitism and low iNOS expression. These results indicate that the source of inoculum can interfere with the development of the acute phase of Chagas disease, and may also trigger a distinct parasite-host interaction during this phase.

  18. Mice lacking cystathionine beta synthase have lung fibrosis and air space enlargement.

    Science.gov (United States)

    Hamelet, Julien; Maurin, Nicole; Fulchiron, Romain; Delabar, Jean-Maurice; Janel, Nathalie

    2007-10-01

    Cystathionine beta synthase (CBS) is a crucial regulator of plasma concentrations of homocysteine. Severe hyperhomocysteinemia due to CBS deficiency confers diverse clinical manifestations, notably pulmonary thrombotic disease. However, the association between hyperhomocysteinemia and chronic obstructive pulmonary disease is not well understood. To investigate the role of hyperhomocysteinemia in lung injury and pulmonary fibrosis, we analyzed the lung of CBS-deficient mice, a murine model of severe hyperhomocysteinemia. The degree of lung injury was assessed by histologic examination. Analysis of profibrogenic factors was performed by real-time quantitative reverse transcription-polymerase chain reaction. CBS-deficient mice develop fibrosis and air space enlargement in the lung, concomitant with an enhanced expression of heme oxygenase-1, pro(alpha)1 collagen type I, transforming growth factor-beta1 and alpha-smooth muscle actin. However, lung fibrosis was found in the absence of increased inflammatory cell infiltrates as determined by histology, without changes in gene expression of proinflammatory cytokines TNFalpha and interleukin 6. The increased expression of alpha-smooth muscle actin and transforming growth factor-beta1 emphasizes the role of myofibroblasts differentiation in case of lung fibrosis due to CBS deficiency in mice.

  19. Comparative Analysis of Two Flavonol Synthases from Different-Colored Onions Provides Insight into Flavonoid Biosynthesis.

    Science.gov (United States)

    Park, Sangkyu; Kim, Da-Hye; Lee, Jong-Yeol; Ha, Sun-Hwa; Lim, Sun-Hyung

    2017-07-05

    We isolated cDNAs encoding flavonol synthase (FLS) from the red onion "H6" (AcFLS-H6) and the yellow onion "Hwangryongball" (AcFLS-HRB). We found three amino acid variations between the two sequences. Kinetic analysis with recombinant proteins revealed that AcFLS-HRB exhibited approximately 2-fold higher catalytic efficiencies than AcFLS-H6 for dihydroflavonol substrates and that both proteins preferred dihydroquercetin to dihydrokaempferol. The expression patterns of flavonoid biosynthesis genes corresponded to the accumulation patterns of flavonoid aglycones in both onions. Whereas the other flavonoid biosynthesis genes were weakly expressed in the HRB sheath compared to that of H6, the expression of FLS was similar in both onions. This relatively enhanced FLS expression, along with the higher activity of AcFLS-HRB, could increase the quercetin production in the HRB sheath. The quercetin content was approximately 12-fold higher than the cyanidin content in the H6 sheath, suggesting that FLS has priority in the competition between FLS and dihydroflavonol 4-reductase (DFR) for their substrate dihydroquercetin.

  20. Identification and Functional Characterization of Monofunctional ent-Copalyl Diphosphate and ent-Kaurene Synthases in White Spruce Reveal Different Patterns for Diterpene Synthase Evolution for Primary and Secondary Metabolism in Gymnosperms1[W][OA

    Science.gov (United States)

    Keeling, Christopher I.; Dullat, Harpreet K.; Yuen, Mack; Ralph, Steven G.; Jancsik, Sharon; Bohlmann, Jörg

    2010-01-01

    The biosynthesis of the tetracyclic diterpene ent-kaurene is a critical step in the general (primary) metabolism of gibberellin hormones. ent-Kaurene is formed by a two-step cyclization of geranylgeranyl diphosphate via the intermediate ent-copalyl diphosphate. In a lower land plant, the moss Physcomitrella patens, a single bifunctional diterpene synthase (diTPS) catalyzes both steps. In contrast, in angiosperms, the two consecutive cyclizations are catalyzed by two distinct monofunctional enzymes, ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS). The enzyme, or enzymes, responsible for ent-kaurene biosynthesis in gymnosperms has been elusive. However, several bifunctional diTPS of specialized (secondary) metabolism have previously been characterized in gymnosperms, and all known diTPSs for resin acid biosynthesis in conifers are bifunctional. To further understand the evolution of ent-kaurene biosynthesis as well as the evolution of general and specialized diterpenoid metabolisms in gymnosperms, we set out to determine whether conifers use a single bifunctional diTPS or two monofunctional diTPSs in the ent-kaurene pathway. Using a combination of expressed sequence tag, full-length cDNA, genomic DNA, and targeted bacterial artificial chromosome sequencing, we identified two candidate CPS and KS genes from white spruce (Picea glauca) and their orthologs in Sitka spruce (Picea sitchensis). Functional characterization of the recombinant enzymes established that ent-kaurene biosynthesis in white spruce is catalyzed by two monofunctional diTPSs, PgCPS and PgKS. Comparative analysis of gene structures and enzyme functions highlights the molecular evolution of these diTPSs as conserved between gymnosperms and angiosperms. In contrast, diTPSs for specialized metabolism have evolved differently in angiosperms and gymnosperms. PMID:20044448

  1. A CACGTG motif of the Antirrhinum majus chalcone synthase promoter is recognized by an evolutionarily conserved nuclear protein

    International Nuclear Information System (INIS)

    Staiger, D.; Kaulen, H.; Schell, J.

    1989-01-01

    In the chalcone synthase gene of Antirrhinum majus (snapdragon), 150 base pairs of the 5' flanking region contain cis-acting signals for UV light-induced expression. A nuclear factor, designated CG-1, specifically recognizes a hexameric motif with internal dyad symmetry, CACGTG, located within this light-responsive sequence. Binding of CG-1 is influenced by C-methylation of the CpG dinucleotide in the recognition sequence. CG-1 is a factor found in a variety of dicotyledonous plant species including Nicotiana tabacum, A. majus, Petunia hybrida, Arabidopsis thaliana, and Glycine max. CACGTG motifs contained within trans-acting factor recognition sites in various other plant promoters can interact with CG-1. In addition, the binding site of the human adenovirus major late transcription factor USF can compete for CG-1 binding to the chalcone synthase promoter. This suggests an evolutionary conservation of trans-acting factor recognition sites involved in divergent mechanisms of gene control. (author)

  2. Cloning and expression analysis of chalcone synthase gene from ...

    Indian Academy of Sciences (India)

    Expression analysis of CfCHS in different tissues and elicitor treatments showed that methyl jasmonate ... Journal of Genetics, DOI 10.1007/s12041-016-0680-8, Vol. 95, No. ... leaf of C. forskohlii. Quantitative real time RT-PCR was used ..... SGG acknowledges the financial support for this work from CSIR. 12th FYP project ...

  3. Expression of Angiotensin II Types 1 and 2 Receptors in Endometriotic Lesions.

    Science.gov (United States)

    Nakao, Takehiro; Chishima, Fumihisa; Sugitani, Masahiko; Tsujimura, Ryusuke; Hayashi, Chuyu; Yamamoto, Tatsuo

    2017-01-01

    The aim of this study was to evaluate the gene and protein expression of angiotensin type (AT) 1, AT2 receptors in endometriotic lesions and its relation to prostaglandin (PG) synthases. Endometriosis samples were obtained from 32 patients with endometriotic cysts. Endometrial tissues were obtained during operations for benign gynecological conditions. The expression of the AT1 and AT2 receptor mRNA and that of PG-endoperoxide synthase 2 and microsomal PGE2 synthase-1 (mPGES-1) was examined by quantitative RT-PCR. Immunohistochemical staining was performed for these receptors. AT1 and AT2 receptor proteins were mostly located in endometrial glandular epithelium and some stromal cells. Immunoreactivity of the receptor proteins was observed in both the eutopic endometrium and endometriotic lesions. The AT1/AT2 ratio in endometriotic cysts (median 7.29, range 1.88-187.60) was significantly increased compared with that in the eutopic endometrium in the proliferative-phase in controls (median 1.01, range 0.37-2.09, p < 0.001). There was a relationship between the AT1 mRNA expression and that of mPGES-1 mRNA in the endometriotic cysts (r = 0.394089, p < 0.05). There was a significant relationship between the mRNA expression of the AT2 receptor and that of mPGES-1 in eutopic endometrium of non-endometriotic control (r = 0.610714, p < 0.05). Renin-angiotensin system may play an important role in the pathophysiology of endometriosis. © 2016 S. Karger AG, Basel.

  4. Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    International Nuclear Information System (INIS)

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi

    2005-01-01

    Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å 3 Da −1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively

  5. Optimization of ATP synthase function in mitochondria and chloroplasts via the adenylate kinase equilibrium

    Directory of Open Access Journals (Sweden)

    Abir U Igamberdiev

    2015-01-01

    Full Text Available The bulk of ATP synthesis in plants is performed by ATP synthase, the main bioenergetics engine of cells, operating both in mitochondria and in chloroplasts. The reaction mechanism of ATP synthase has been studied in detail for over half a century; however, its optimal performance depends also on the steady delivery of ATP synthase substrates and the removal of its products. For mitochondrial ATP synthase, we analyze here the provision of stable conditions for (i the supply of ADP and Mg2+, supported by adenylate kinase (AK equilibrium in the intermembrane space, (ii the supply of phosphate via membrane transporter in symport with H+, and (iii the conditions of outflow of ATP by adenylate transporter carrying out the exchange of free adenylates. We also show that, in chloroplasts, AK equilibrates adenylates and governs Mg2+ contents in the stroma, optimizing ATP synthase and Calvin cycle operation, and affecting the import of inorganic phosphate in exchange with triose phosphates. It is argued that chemiosmosis is not the sole component of ATP synthase performance, which also depends on AK-mediated equilibrium of adenylates and Mg2+, adenylate transport and phosphate release and supply.

  6. Small molecule inhibition of cGAS reduces interferon expression in primary macrophages from autoimmune mice.

    Science.gov (United States)

    Vincent, Jessica; Adura, Carolina; Gao, Pu; Luz, Antonio; Lama, Lodoe; Asano, Yasutomi; Okamoto, Rei; Imaeda, Toshihiro; Aida, Jumpei; Rothamel, Katherine; Gogakos, Tasos; Steinberg, Joshua; Reasoner, Seth; Aso, Kazuyoshi; Tuschl, Thomas; Patel, Dinshaw J; Glickman, J Fraser; Ascano, Manuel

    2017-09-29

    Cyclic GMP-AMP synthase is essential for innate immunity against infection and cellular damage, serving as a sensor of DNA from pathogens or mislocalized self-DNA. Upon binding double-stranded DNA, cyclic GMP-AMP synthase synthesizes a cyclic dinucleotide that initiates an inflammatory cellular response. Mouse studies that recapitulate causative mutations in the autoimmune disease Aicardi-Goutières syndrome demonstrate that ablating the cyclic GMP-AMP synthase gene abolishes the deleterious phenotype. Here, we report the discovery of a class of cyclic GMP-AMP synthase inhibitors identified by a high-throughput screen. These compounds possess defined structure-activity relationships and we present crystal structures of cyclic GMP-AMP synthase, double-stranded DNA, and inhibitors within the enzymatic active site. We find that a chemically improved member, RU.521, is active and selective in cellular assays of cyclic GMP-AMP synthase-mediated signaling and reduces constitutive expression of interferon in macrophages from a mouse model of Aicardi-Goutières syndrome. RU.521 will be useful toward understanding the biological roles of cyclic GMP-AMP synthase and can serve as a molecular scaffold for development of future autoimmune therapies.Upon DNA binding cyclic GMP-AMP synthase (cGAS) produces a cyclic dinucleotide, which leads to the upregulation of inflammatory genes. Here the authors develop small molecule cGAS inhibitors, functionally characterize them and present the inhibitor and DNA bound cGAS crystal structures, which will facilitate drug development.

  7. Transcriptome resources and functional characterization of monoterpene synthases for two host species of the mountain pine beetle, lodgepole pine (Pinus contorta) and jack pine (Pinus banksiana)

    Science.gov (United States)

    2013-01-01

    Background The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. Results We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. Conclusion In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine. PMID:23679205

  8. Transcriptome resources and functional characterization of monoterpene synthases for two host species of the mountain pine beetle, lodgepole pine (Pinus contorta) and jack pine (Pinus banksiana).

    Science.gov (United States)

    Hall, Dawn E; Yuen, Macaire M S; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet K; Li, Maria; Henderson, Hannah; Arango-Velez, Adriana; Liao, Nancy Y; Docking, Roderick T; Chan, Simon K; Cooke, Janice Ek; Breuil, Colette; Jones, Steven Jm; Keeling, Christopher I; Bohlmann, Jörg

    2013-05-16

    The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine.

  9. Purification and characterization of CDP-diacylglycerol synthase from Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Kelley, M.J.; Carman, G.M.

    1987-01-01

    The membrane-associated phospholipid biosynthetic enzyme CDP-diacylglycerol synthase (CTP:phosphatidate cytidylyltransferase was purified 2300-fold from Saccharomyces cerevisiae. The purification procedure included Triton X-100 solubilization of mitochondrial membranes, CDP-diacylglycerol-Sepharose affinity chromatography, and hydroxylapatite chromatography. The procedure resulted in a nearly homogeneous enzyme preparation as determined by native and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Radiation inactivation of mitochondrial associated and purified CDP-diacylglycerol synthase suggested that the molecular weight of the native enzyme was 114,000. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the purified enzyme preparation yielded two subunits with molecular weights of 56,000 and 54,000. Antibodies prepared against the purified enzyme immunoprecipitated CDP-diacylglycerol synthase activity and subunits. CDP-diacylglycerol synthase activity was dependent on magnesium ions and Triton X-100 at pH 6.5. Thio-reactive agents inhibited activity. The activation energy for the reaction was 9 kcal/mol, and the enzyme was thermally labile above 30 degrees C. The Km values for CTP and phosphatidate were 1 and 0.5 mM, respectively, and the Vmax was 4700 nmol/min/mg. Results of kinetic and isotopic exchange reactions suggested that the enzyme catalyzes a sequential Bi Bi reaction mechanism

  10. Evaluation of synthase and hemisynthase activities of glucosamine-6-phosphate synthase by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    Science.gov (United States)

    Gaucher-Wieczorek, Florence; Guérineau, Vincent; Touboul, David; Thétiot-Laurent, Sophie; Pelissier, Franck; Badet-Denisot, Marie-Ange; Badet, Bernard; Durand, Philippe

    2014-08-01

    Glucosamine-6-phosphate synthase (GlmS, EC 2.6.1.16) catalyzes the first and rate-limiting step in the hexosamine biosynthetic pathway, leading to the synthesis of uridine-5'-diphospho-N-acetyl-D-glucosamine, the major building block for the edification of peptidoglycan in bacteria, chitin in fungi, and glycoproteins in mammals. This bisubstrate enzyme converts D-fructose-6-phosphate (Fru-6P) and L-glutamine (Gln) into D-glucosamine-6-phosphate (GlcN-6P) and L-glutamate (Glu), respectively. We previously demonstrated that matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) allows determination of the kinetic parameters of the synthase activity. We propose here to refine the experimental protocol to quantify Glu and GlcN-6P, allowing determination of both hemisynthase and synthase parameters from a single assay kinetic experiment, while avoiding interferences encountered in other assays. It is the first time that MALDI-MS is used to survey the activity of a bisubstrate enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. cDNA cloning and expression of carotenogenic genes during flower development in Gentiana lutea.

    Science.gov (United States)

    Zhu, Changfu; Yamamura, Saburo; Koiwa, Hiroyuki; Nishihara, Masashiro; Sandmann, Gerhard

    2002-02-01

    All cDNAs involved in carotenoid biosynthesis leading to lycopene in yellow petals of Gentiana lutea have been cloned from a cDNA library. They encode a geranylgeranyl pyrophosphate synthase, a phytoene synthase, a phytoene desaturase and a zeta-carotene desaturase. The indicated function of all cDNAs was established by heterologous complementation in Escherichia coli. The amino acid sequences deduced from the cDNAs were between 47.5% and 78.9% identical to those reported for the corresponding enzymes from other higher plants. Southern analysis suggested that the genes for each enzyme probably represent a small multi-gene family. Tissue-specific expression of the genes and expression during flower development was investigated. The expression of the phytoene synthase gene, psy, was enhanced in flowers but transcripts were not detected in stems and leaves by northern blotting. Transcripts of the genes for geranylgeranyl pyrophosphate (ggpps), phytoene desaturase (pds) and zeta-carotene desaturase (zds) were detected in flowers and leaves but not in stems. Analysis of the expression of psy and zds in petals revealed that levels of the transcripts were lowest in young buds and highest in fully open flowers, in parallel with the formation of carotenoids. Obviously, the transcription of these genes control the accumulation of carotenoids during flower development in G. lutea. For pds only a very slight increase of mRNA was found whereas the transcripts of ggpps decreased during flower development.

  12. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-24

    May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

  13. Cyanide detoxification in an insect herbivore: Molecular identification of β-cyanoalanine synthases from Pieris rapae.

    Science.gov (United States)

    van Ohlen, Maike; Herfurth, Anna-Maria; Kerbstadt, Henrike; Wittstock, Ute

    2016-03-01

    Cyanogenic compounds occur widely in the plant kingdom. Therefore, many herbivores are adapted to the presence of these compounds in their diet by either avoiding cyanide release or by efficient cyanide detoxification mechanisms. The mechanisms of adaptation are not fully understood. Larvae of Pieris rapae (Lepidoptera: Pieridae) are specialist herbivores on glucosinolate-containing plants. They are exposed to cyanide during metabolism of phenylacetonitrile, a product of benzylglucosinolate breakdown catalyzed by plant myrosinases and larval nitrile-specifier protein (NSP) in the gut. Cyanide is metabolized to β-cyanoalanine and thiocyanate in the larvae. Here, we demonstrate that larvae of P. rapae possess β-cyanoalanine activity in their gut. We have identified three gut-expressed cDNAs designated PrBSAS1-PrBSAS3 which encode proteins with similarity to β-substituted alanine synthases (BSAS). Characterization of recombinant PrBSAS1-PrBSAS3 shows that they possess β-cyanoalanine activity. In phylogenetic trees, PrBSAS1-PrBSAS3, the first characterized insect BSAS, group together with a characterized mite β-cyanoalanine synthase and bacterial enzymes indicating a similar evolutionary history. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  14. Overexpression of Rat Neurons Nitric Oxide Synthase in Rice Enhances Drought and Salt Tolerance.

    Directory of Open Access Journals (Sweden)

    Wei Cai

    Full Text Available Nitric oxide (NO has been shown to play an important role in the plant response to biotic and abiotic stresses in Arabidopsis mutants with lower or higher levels of endogenous NO. The exogenous application of NO donors or scavengers has also suggested an important role for NO in plant defense against environmental stress. In this study, rice plants under drought and high salinity conditions showed increased nitric oxide synthase (NOS activity and NO levels. Overexpression of rat neuronal NO synthase (nNOS in rice increased both NOS activity and NO accumulation, resulting in improved tolerance of the transgenic plants to both drought and salt stresses. nNOS-overexpressing plants exhibited stronger water-holding capability, higher proline accumulation, less lipid peroxidation and reduced electrolyte leakage under drought and salt conditions than wild rice. Moreover, nNOS-overexpressing plants accumulated less H2O2, due to the observed up-regulation of OsCATA, OsCATB and OsPOX1. In agreement, the activities of CAT and POX were higher in transgenic rice than wild type. Additionally, the expression of six tested stress-responsive genes including OsDREB2A, OsDREB2B, OsSNAC1, OsSNAC2, OsLEA3 and OsRD29A, in nNOS-overexpressing plants was higher than that in the wild type under drought and high salinity conditions. Taken together, our results suggest that nNOS overexpression suppresses the stress-enhanced electrolyte leakage, lipid peroxidation and H2O2 accumulation, and promotes proline accumulation and the expression of stress-responsive genes under stress conditions, thereby promoting increased tolerance to drought and salt stresses.

  15. Hypoxia-inducible factor-1α, vascular endothelial growth factor, inducible nitric oxide synthase, and endothelin-1 expression correlates with angiogenesis in congenital heart disease

    Directory of Open Access Journals (Sweden)

    Hsin-Ling Yin

    2016-07-01

    Full Text Available In Taiwan, the average prevalence of congenital heart disease (CHD is 13.08/1000 live births. Most children with CHD die before the age of 5 years; therefore, identifying treatment methods to extend the life of CHD patients is an important issue in clinical practice. The objective of this study is to evaluate the roles of hypoxia-inducible factor-1α (HIF-1α, vascular endothelial growth factor (VEGF, inducible nitric oxide synthase (iNOS, endothelin-1 (ET-1, and CD34 in CHD autopsy cases in comparison with autopsy cases without CHD. The study included 19 autopsy cases, which were divided into the following four groups: acyanotic CHD (n = 11, cyanotic CHD (n = 3, CHD associated with chromosomal abnormalities (n = 3, and complex CHD (n = 2. Heart specimens obtained from 10 autopsy cases without CHD were included as controls. Our results indicated that high percentages of HIF-1α (100%, VEGF (89.5%, iNOS (78.9%, and ET-1 (84.2% expressions were observed in CHD autopsy cases and this was found to be significant. HIF-1α induced by hypoxia could play a potential role in relating downstream gene expressions in CHD patients. Upregulation of VEGF by HIF-1α could play an important role in triggering angiogenesis to protect myocardial cell survival in a hypoxic microenvironment. Therefore, HIF-1α could be a significant prognosis marker in CHD and be a prospective candidate in the development of target therapy in cardiovascular diseases.

  16. Molecular cloning and characterization of glycogen synthase in Eriocheir sinensis.

    Science.gov (United States)

    Li, Ran; Zhu, Li-Na; Ren, Li-Qi; Weng, Jie-Yang; Sun, Jin-Sheng

    2017-12-01

    Glycogen plays an important role in glucose and energy homeostasis at cellular and organismal levels. In glycogen synthesis, glycogen synthase (GS) is a rate-limiting enzyme catalysing the addition of α-1,4-linked glucose units from (UDP) 3 -glucose to a nascent glycogen chain using glycogenin (GN) as a primer. While studies on mammalian liver GS (GYS2) are numerous, enzymes from crustaceans, which also use glycogen and glucose as their main energy source, have received less attention. In the present study, we amplified full-length GS cDNA from Eriocheir sinensis. Tissue expression profiling revealed the highest expression of GS in the hepatopancreas. During moulting, GS expression and activity declined, and glycogen levels in the hepatopancreas were reduced. Recombinant GS was expressed in Escherichia coli Rosetta (DE3), and induction at 37°C or 16°C yielded EsGS in insoluble inclusion bodies (EsGS-I) or in soluble form (EsGS-S), respectively. Enzyme activity was measured in a cell-free system containing glucose-6-phosphate (G6P), and both forms possessed glycosyltransferase activity, but refolded EsGS-I was more active. Enzyme activity of both GS and EsGS-I in the hepatopancreas was optimum at 25°C, which is coincident with the optimum growth temperature of Chinese mitten crab, and higher (37°C) or lower (16°C) temperatures resulted in lower enzyme activity. Taken together, the results suggest that GS may be important for maintaining normal physiological functions such as growth and reproduction. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells

    International Nuclear Information System (INIS)

    Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.

    1986-01-01

    Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio [(activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)]. Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of 125 I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms

  18. Synergistic Effect of Vaginal Trauma and Ovariectomy in a Murine Model of Stress Urinary Incontinence: Upregulation of Urethral Nitric Oxide Synthases and Estrogen Receptors

    Directory of Open Access Journals (Sweden)

    Huey-Yi Chen

    2014-01-01

    Full Text Available The molecular mechanisms underlying stress urinary incontinence (SUI are unclear. We aimed to evaluate the molecular alterations in mice urethras following vaginal trauma and ovariectomy (OVX. Twenty-four virgin female mice were equally distributed into four groups: noninstrumented control; vaginal distension (VD group; OVX group; and VD + OVX group. Changes in leak point pressures (LPPs, genital tract morphology, body weight gain, plasma 17β-estradiol level and expressions of neuronal nitric oxide synthase (nNOS, induced nitric oxide synthase (iNOS, and estrogen receptors (ERs—ERα and ERβ were analyzed. Three weeks after VD, the four groups differed significantly in genital size and body weight gain. Compared with the control group, the plasma estradiol levels were significantly decreased in the OVX and VD + OVX groups, and LPPs were significantly decreased in all three groups. nNOS, iNOS, and ERα expressions in the urethra were significantly increased in the VD and VD + OVX groups, whereas ERβ expression was significantly increased only in the VD + OVX group. These results show that SUI following vaginal trauma and OVX involves urethral upregulations of nNOS, iNOS, and ERs, suggesting that NO- and ER-mediated signaling might play a role in the synergistic effect of birth trauma and OVX-related SUI pathogenesis.

  19. Fetal and neonatal exposure to nicotine leads to augmented hepatic and circulating triglycerides in adult male offspring due to increased expression of fatty acid synthase

    International Nuclear Information System (INIS)

    Ma, Noelle; Nicholson, Catherine J.; Wong, Michael; Holloway, Alison C.; Hardy, Daniel B.

    2014-01-01

    While nicotine replacement therapy is assumed to be a safer alternative to smoking during pregnancy, the long-term consequences for the offspring remain elusive. Animal studies now suggest that maternal nicotine exposure during perinatal life leads to a wide range of adverse outcomes for the offspring including increased adiposity. The focus of this study was to investigate if nicotine exposure during pregnancy and lactation leads to alterations in hepatic triglyceride synthesis. Female Wistar rats were randomly assigned to receive daily subcutaneous injections of saline (vehicle) or nicotine bitartrate (1 mg/kg/day) for two weeks prior to mating until weaning. At postnatal day 180 (PND 180), nicotine exposed offspring exhibited significantly elevated levels of circulating and hepatic triglycerides in the male offspring. This was concomitant with increased expression of fatty acid synthase (FAS), the critical hepatic enzyme in de novo triglyceride synthesis. Given that FAS is regulated by the nuclear receptor Liver X receptor (LXRα), we measured LXRα expression in both control and nicotine-exposed offspring. Nicotine exposure during pregnancy and lactation led to an increase in hepatic LXRα protein expression and enriched binding to the putative LXRE element on the FAS promoter in PND 180 male offspring. This was also associated with significantly enhanced acetylation of histone H3 [K9,14] surrounding the FAS promoter, a hallmark of chromatin activation. Collectively, these findings suggest that nicotine exposure during pregnancy and lactation leads to an increase in circulating and hepatic triglycerides long-term via changes in the transcriptional and epigenetic regulation of the hepatic lipogenic pathway. - Highlights: • Our data reveals the links nicotine exposure in utero and long-term hypertriglyceridemia. • It is due to nicotine-induced augmented expression of hepatic FAS and LXRα activity. • Moreover, this involves nicotine-induced enhanced

  20. Fetal and neonatal exposure to nicotine leads to augmented hepatic and circulating triglycerides in adult male offspring due to increased expression of fatty acid synthase

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Noelle [Department of Physiology and Pharmacology, The University of Western Ontario (Canada); Department of Obstetrics and Gynecology, The University of Western Ontario (Canada); The Lawson Health Research Institute, The University of Western Ontario (Canada); Nicholson, Catherine J. [Department of Obstetrics and Gynecology, McMaster University (Canada); Wong, Michael [Department of Physiology and Pharmacology, The University of Western Ontario (Canada); Department of Obstetrics and Gynecology, The University of Western Ontario (Canada); The Lawson Health Research Institute, The University of Western Ontario (Canada); Holloway, Alison C. [Department of Obstetrics and Gynecology, McMaster University (Canada); Hardy, Daniel B., E-mail: Daniel.Hardy@schulich.uwo.ca [Department of Physiology and Pharmacology, The University of Western Ontario (Canada); Department of Obstetrics and Gynecology, The University of Western Ontario (Canada); The Children' s Health Research Institute, The University of Western Ontario (Canada); The Lawson Health Research Institute, The University of Western Ontario (Canada)

    2014-02-15

    While nicotine replacement therapy is assumed to be a safer alternative to smoking during pregnancy, the long-term consequences for the offspring remain elusive. Animal studies now suggest that maternal nicotine exposure during perinatal life leads to a wide range of adverse outcomes for the offspring including increased adiposity. The focus of this study was to investigate if nicotine exposure during pregnancy and lactation leads to alterations in hepatic triglyceride synthesis. Female Wistar rats were randomly assigned to receive daily subcutaneous injections of saline (vehicle) or nicotine bitartrate (1 mg/kg/day) for two weeks prior to mating until weaning. At postnatal day 180 (PND 180), nicotine exposed offspring exhibited significantly elevated levels of circulating and hepatic triglycerides in the male offspring. This was concomitant with increased expression of fatty acid synthase (FAS), the critical hepatic enzyme in de novo triglyceride synthesis. Given that FAS is regulated by the nuclear receptor Liver X receptor (LXRα), we measured LXRα expression in both control and nicotine-exposed offspring. Nicotine exposure during pregnancy and lactation led to an increase in hepatic LXRα protein expression and enriched binding to the putative LXRE element on the FAS promoter in PND 180 male offspring. This was also associated with significantly enhanced acetylation of histone H3 [K9,14] surrounding the FAS promoter, a hallmark of chromatin activation. Collectively, these findings suggest that nicotine exposure during pregnancy and lactation leads to an increase in circulating and hepatic triglycerides long-term via changes in the transcriptional and epigenetic regulation of the hepatic lipogenic pathway. - Highlights: • Our data reveals the links nicotine exposure in utero and long-term hypertriglyceridemia. • It is due to nicotine-induced augmented expression of hepatic FAS and LXRα activity. • Moreover, this involves nicotine-induced enhanced