Directory of Open Access Journals (Sweden)
Heidi G. Rodriguez-Ramirez
2014-01-01
Full Text Available In 2009, a new influenza A (H1N1 virus affected many persons around the world. There is an urgent need for finding biomarkers to distinguish between influenza A (H1N1pdm09 and seasonal influenza virus. We investigated these possible biomarkers in the lung of fatal cases of confirmed influenza A (H1N1pdm09. Cytokines (inflammatory and anti-inflammatory and cellular markers (macrophages and lymphocytes subpopulation markers were analyzed in lung tissue from both influenza A (H1N1pdm09 and seasonal influenza virus. High levels of IL-17, IFN-γ, and TNF-α positive cells were identical in lung tissue from the influenza A (H1N1pdm09 and seasonal cases when compared with healthy lung tissue (P<0.05. Increased IL-4+ cells, and CD4+ and CD14+ cells were also found in high levels in both influenza A (H1N1pdm09 and seasonal influenza virus (P<0.05. Low levels of CD206+ cells (marker of alternatively activated macrophages marker in lung were found in influenza A (H1N1pdm09 when compared with seasonal influenza virus (P<0.05, and the ratio of CD206/CD14+ cells was 2.5-fold higher in seasonal and noninfluenza group compared with influenza A (H1N1pdm09 (P<0.05. In conclusion, CD206+ cells differentiate between influenza A (H1N1pdm09 and seasonal influenza virus in lung tissue of fatal cases.
Structural, magnetic and transport properties of Mn3.1Sn0.9 and Mn3.1Sn0.9N compounds
International Nuclear Information System (INIS)
Feng, W.J.; Li, D.; Ren, W.J.; Li, Y.B.; Li, W.F.; Li, J.; Zhang, Y.Q.; Zhang, Z.D.
2007-01-01
The cubic anti-perovskite Mn 3.1 Sn 0.9 N compound is prepared via nitrogenation of the hexagonal Mn 3.1 Sn 0.9 compound. A magnetic phase diagram of Mn 3.1 Sn 0.9 compound is constructed by analysis of data of its magnetic properties. For Mn 3.1 Sn 0.9 N compound, parasitic ferromagnetism exists in the temperature range of 5-370 K, besides a spin-reorientation at about 280 K. Mn 3.1 Sn 0.9 compound exhibits a metallic conducting behavior, while Mn 3.1 Sn 0.9 N displays a metal-nonmetal transition due to the electron localization caused by the static disorder. The differences of the physical properties between the both compounds, are discussed, in terms of the correlation of the hexagonal DO 19 and the cubic anti-perovskite structures, the reduction of the distances between Mn atoms, and the spin-pairing or charge transfer effect due to the electron donation by N 2p to Mn 3d states after introduction of N atoms into the interstitial sites of Mn 3.1 Sn 0.9 compound
Directory of Open Access Journals (Sweden)
Eduardo Azziz-Baumgartner
Full Text Available INTRODUCTION: While there is much information about the burden of influenza A(H1N1pdm09 in North America, little data exist on its burden in South America. METHODS: During April to December 2009, we actively searched for persons with severe acute respiratory infection and influenza-like illness (ILI in three sentinel cities. A proportion of case-patients provided swabs for influenza testing. We estimated the number of case-patients that would have tested positive for influenza by multiplying the number of untested case-patients by the proportion who tested positive. We estimated rates by dividing the estimated number of case-patients by the census population after adjusting for the proportion of case-patients with missing illness onset information and ILI case-patients who visited physicians multiple times for one illness event. RESULTS: We estimated that the influenza A(H1N1pdm09 mortality rate per 100,000 person-years (py ranged from 1.5 among persons aged 5-44 years to 5.6 among persons aged ≥ 65 years. A(H1N1pdm09 hospitalization rates per 100,000 py ranged between 26.9 among children aged <5 years to 41.8 among persons aged ≥ 65 years. Influenza A(H1N1pdm09 ILI rates per 100 py ranged between 1.6 among children aged <5 to 17.1 among persons aged 45-64 years. While 9 (53% of 17 influenza A(H1N1pdm09 decedents with available data had obesity and 7 (17% of 40 had diabetes, less than 4% of surviving influenza A(H1N1pdm09 case-patients had these pre-existing conditions (p ≤ 0.001. CONCLUSION: Influenza A(H1N1pdm09 caused a similar burden of disease in Argentina as in other countries. Such disease burden suggests the potential value of timely influenza vaccinations.
DEFF Research Database (Denmark)
Basith, M. A.; Khan, F. A.; Ahmmad, Bashir
2015-01-01
that the strength of the exchange bias effect is tunable by the field cooling. The HEB values are also found to be dependent on the temperature. This magnetically tunable exchange bias obtained at temperatures up to 250K in Bi0.9Gd0.1Fe0.9Ti0.1O3 nanoparticles may be worthwhile for potential applications.......The exchange bias (EB) effect has been observed in magnetic Bi0.9Gd0.1Fe0.9Ti0.1O3 nanoparticles.The influence of magnetic field cooling on the exchange bias effect has also been investigated. The magnitude of the exchange bias field (HEB) increases with the cooling magnetic field, showing...
Nason, Martin L.; Brown, Clarence A., Jr.; Rock, Rupert S.
1955-01-01
A linear stability analysis and flight-test investigation has been performed on a rolleron-type roll-rate stabilization system for a canard-type missile configuration through a Mach number range from 0.9 to 2.3. This type damper provides roll damping by the action of gyro-actuated uncoupled wing-tip ailerons. A dynamic roll instability predicted by the analysis was confirmed by flight testing and was subsequently eliminated by the introduction of control-surface damping about the rolleron hinge line. The control-surface damping was provided by an orifice-type damper contained within the control surface. Steady-state rolling velocities were at all times less than 1 radian per second between the Mach numbers of 0.9 to 2.3 on the configurations tested. No adverse longitudinal effects were experienced in flight because of the tendency of the free-floating rollerons to couple into the pitching motion at the low angles of attack and disturbance levels investigated herein after the introduction of control-surface damping.
Directory of Open Access Journals (Sweden)
Brett N Archer
Full Text Available Describing transmissibility parameters of past pandemics from diverse geographic sites remains critical to planning responses to future outbreaks. We characterize the transmissibility of influenza A(H1N1pdm09 (hereafter pH1N1 in South Africa during 2009 by estimating the serial interval (SI, the initial effective reproductive number (initial R(t and the temporal variation of R(t.We make use of data from a central registry of all pH1N1 laboratory-confirmed cases detected throughout South Africa. Whenever date of symptom onset is missing, we estimate it from the date of specimen collection using a multiple imputation approach repeated 100 times for each missing value. We apply a likelihood-based method (method 1 for simultaneous estimation of initial R(t and the SI; estimate initial R(t from SI distributions established from prior field studies (method 2; and the Wallinga and Teunis method (method 3 to model the temporal variation of R(t.12,360 confirmed pH1N1 cases were reported in the central registry. During the period of exponential growth of the epidemic (June 21 to August 3, 2009, we simultaneously estimate a mean R(t of 1.47 (95% CI: 1.30-1.72 and mean SI of 2.78 days (95% CI: 1.80-3.75 (method 1. Field studies found a mean SI of 2.3 days between primary cases and laboratory-confirmed secondary cases, and 2.7 days when considering both suspected and confirmed secondary cases. Incorporating the SI estimate from field studies using laboratory-confirmed cases, we found an initial R(t of 1.43 (95% CI: 1.38-1.49 (method 2. The mean R(t peaked at 2.91 (95% CI: 0.85-2.91 on June 21, as the epidemic commenced, and R(t>1 was sustained until August 22 (method 3.Transmissibility characteristics of pH1N1 in South Africa are similar to estimates reported by countries outside of Africa. Estimations using the likelihood-based method are in agreement with field findings.
Manabe, Toshie; Higuera Iglesias, Anjarath Lorena; Vazquez Manriquez, Maria Eugenia; Martinez Valadez, Eduarda Leticia; Ramos, Leticia Alfaro; Izumi, Shinyu; Takasaki, Jin; Kudo, Koichiro
2012-01-01
Background In addition to clinical aspects and pathogen characteristics, people's health-related behavior and socioeconomic conditions can affect the occurrence and severity of diseases including influenza A(H1N1)pdm09. Methodology and Principal Findings A face-to-face interview survey was conducted in a hospital in Mexico City at the time of follow-up consultation for hospitalized patients with pneumonia due to influenza virus infection. In all, 302 subjects were enrolled and divided into two groups based on the period of hospitalization. Among them, 211 tested positive for influenza A(H1N1)pdm09 virus by real-time reverse-transcriptase-polymerase-chain-reaction during the pandemic period (Group-pdm) and 91 tested positive for influenza A virus in the post-pandemic period (Group-post). All subjects were treated with oseltamivir. Data on the demographic characteristics, socioeconomic status, living environment, and information relating to A(H1N1)pdm09, and related clinical data were compared between subjects in Group-pdm and those in Group-post. The ability of household income to pay for utilities, food, and health care services as well as housing quality in terms of construction materials and number of rooms revealed a significant difference: Group-post had lower socioeconomic status than Group-pdm. Group-post had lower availability of information regarding H1N1 influenza than Group-pdm. These results indicate that subjects in Group-post had difficulty receiving necessary information relating to influenza and were more likely to be impoverished than those in Group-pdm. Possible factors influencing time to seeking health care were number of household rooms, having received information on the necessity of quick access to health care, and house construction materials. Conclusions Health-care-seeking behavior, poverty level, and the distribution of information affect the occurrence and severity of pneumonia due to H1N1 virus from a socioeconomic point of view. These
Proposed Columbia Wind Farm number-sign 1. Joint NEPA/SEPA draft environmental impact statement
International Nuclear Information System (INIS)
1995-03-01
This Draft Environmental Impact Statement (DEIS) addresses the Columbia Wind Farm number-sign 1 (Project) proposal for construction and operation of a 25 megawatt (MW) wind power project in the Columbia Hills area southeast of Goldendale in Klickitat County, Washington. The Project would be constructed on private land by Conservation and Renewable Energy System (CARES) (the Applicant). An Environmental Impact Statement is required under both NEPA and SEPA guidelines and is issued under Section 102 (2) (C) of the National Environmental Policy Act (NEPA) at 42 U.S.C. 4321 et seq and under the Washington State Environmental Policy Act (SEPA) as provided by RCW 43.21C.030 (2) (c). Bonneville Power Administration is the NEPA lead agency; Klickitat County is the nominal SEPA lead agency and CARES is the SEPA co-lead agency for this DEIS. The Project site is approximately 395 hectares (975 acres) in size. The Proposed Action would include approximately 91 model AWT-26 wind turbines. Under the No Action Alternative, the Project would not be constructed and existing grazing and agricultural activities on the site would continue
Altered response to A(H1N1)pnd09 vaccination in pregnant women
DEFF Research Database (Denmark)
Bischoff, Anne Louise; Følsgaard, Nilofar Vahman; Carson, Charlotte Giwercman
2013-01-01
BACKGROUND: Pregnant women were suspected to be at particular risk when H1N1pnd09 influenza became pandemic in 2009. Our primary objective was to compare the immune responses conferred by MF59®-adjuvanted vaccine (Focetria®) in H1N1pnd09-naïve pregnant and non-pregnant women. The secondary aims...... were to compare influences of dose and adjuvant on the immune response. METHODS: The study was nested in the Copenhagen Prospective Studies on Asthma in Childhood (COPSAC2010) pregnancy cohort in 2009-2010 and conducted as a single-blinded block-randomised [1∶1∶1] controlled clinical trial in pregnant...... women after gestational week 20: (1) 7.5 µg H1N1pnd09 antigen with MF59-adjuvant (Pa7.5 µg); (2) 3.75 µg antigen half MF59-adjuvanted (Pa3.75 µg); (3) 15 µg antigen unadjuvanted (P15 µg); and in non-pregnant women receiving (4) 7.5 µg antigen full adjuvanted (NPa7.5 µg). Blood samples were collected...
Directory of Open Access Journals (Sweden)
Toshie Manabe
Full Text Available BACKGROUND: In addition to clinical aspects and pathogen characteristics, people's health-related behavior and socioeconomic conditions can affect the occurrence and severity of diseases including influenza A(H1N1pdm09. METHODOLOGY AND PRINCIPAL FINDINGS: A face-to-face interview survey was conducted in a hospital in Mexico City at the time of follow-up consultation for hospitalized patients with pneumonia due to influenza virus infection. In all, 302 subjects were enrolled and divided into two groups based on the period of hospitalization. Among them, 211 tested positive for influenza A(H1N1pdm09 virus by real-time reverse-transcriptase-polymerase-chain-reaction during the pandemic period (Group-pdm and 91 tested positive for influenza A virus in the post-pandemic period (Group-post. All subjects were treated with oseltamivir. Data on the demographic characteristics, socioeconomic status, living environment, and information relating to A(H1N1pdm09, and related clinical data were compared between subjects in Group-pdm and those in Group-post. The ability of household income to pay for utilities, food, and health care services as well as housing quality in terms of construction materials and number of rooms revealed a significant difference: Group-post had lower socioeconomic status than Group-pdm. Group-post had lower availability of information regarding H1N1 influenza than Group-pdm. These results indicate that subjects in Group-post had difficulty receiving necessary information relating to influenza and were more likely to be impoverished than those in Group-pdm. Possible factors influencing time to seeking health care were number of household rooms, having received information on the necessity of quick access to health care, and house construction materials. CONCLUSIONS: Health-care-seeking behavior, poverty level, and the distribution of information affect the occurrence and severity of pneumonia due to H1N1 virus from a socioeconomic
A study of analysis PB1-F2 protein of Influenza Viruses A/H1N1pdm09, A/ H3N2, and A/H5N1
Directory of Open Access Journals (Sweden)
Hana Apsari Pawestri
2016-07-01
/H5N1 and A/H1N1pdm09 Methods. We conducted Gen Bank National Center for Biotechnology Information (NCBI for A/H5N1 and A/H1N1pdm09 Influenza virus sequences database search started from 1997 until 2015. Data pertinent to this study is PB1 gene of A/H5N1 and A/H1N1pdm09 Influenza viruses. We conducted the multiple alignments to determine the various length and important mutation. Results. The PB1-F2 sequences from the 3262 Influenza A/H5N1 and 2472 Influenza A/H1N1pdm09 were studied. The analysis showed that all Influenza A/H5N1 carrying the full length 90 amino acids of PB2-F1 sequences, except the Influenza pandemic A/H1N1 2009, only 87 amino acids. In addition, the mutation indicates the presence of a significant correlation with the virulence shown by Serine at nucleotide number 66 which replaces Asparagines (N66S. The mutation occurs in 8.5% of Influenza A/H5N1 and 0.5% of Influenza A/H1N1pdm09. Conclusion. Several varying length and important mutation of PB2-F1 sequences from different subtype of A/H5N1 and A/H1N1pdm09 were obtained which are indicating the positively selected in specific subtype due to introduction and adaptation into different host. The further studies are required to understanding this variability and contribution of PB1-F2 proteins in virulence and pathogenesis of influenza viruses. Key Words : Pathogenesis, Influenza virus, PB-F2 Protein
A study of analysis PB1-F2 protein of Influenza Viruses A/H1N1pdm09, A/ H3N2, and A/H5N1
Directory of Open Access Journals (Sweden)
Hana Apsari Pawestri
2016-07-01
/H5N1 and A/H1N1pdm09 Methods. We conducted Gen Bank National Center for Biotechnology Information (NCBI for A/H5N1 and A/H1N1pdm09 Influenza virus sequences database search started from 1997 until 2015. Data pertinent to this study is PB1 gene of A/H5N1 and A/H1N1pdm09 Influenza viruses. We conducted the multiple alignments to determine the various length and important mutation. Results. The PB1-F2 sequences from the 3262 Influenza A/H5N1 and 2472 Influenza A/H1N1pdm09 were studied. The analysis showed that all Influenza A/H5N1 carrying the full length 90 amino acids of PB2-F1 sequences, except the Influenza pandemic A/H1N1 2009, only 87 amino acids. In addition, the mutation indicates the presence of a significant correlation with the virulence shown by Serine at nucleotide number 66 which replaces Asparagines (N66S. The mutation occurs in 8.5% of Influenza A/H5N1 and 0.5% of Influenza A/H1N1pdm09. Conclusion. Several varying length and important mutation of PB2-F1 sequences from different subtype of A/H5N1 and A/H1N1pdm09 were obtained which are indicating the positively selected in specific subtype due to introduction and adaptation into different host. The further studies are required to understanding this variability and contribution of PB1-F2 proteins in virulence and pathogenesis of influenza viruses. Key Words : Pathogenesis, Influenza virus, PB-F2 Protein
Outcomes of influenza A(H1N1)pdm09 virus infection
DEFF Research Database (Denmark)
Lynfield, Ruth; Davey, Richard; Dwyer, Dominic E
2014-01-01
BACKGROUND: Data from prospectively planned cohort studies on risk of major clinical outcomes and prognostic factors for patients with influenza A(H1N1)pdm09 virus are limited. In 2009, in order to assess outcomes and evaluate risk factors for progression of illness, two cohort studies were...
Coinfection with influenza A(H1N1)pdm09 and dengue virus in fatal cases.
Perdigão, Anne Carolinne Bezerra; Ramalho, Izabel Letícia Cavalcante; Guedes, Maria Izabel Florindo; Braga, Deborah Nunes Melo; Cavalcanti, Luciano Pamplona Góes; Melo, Maria Elisabeth Lisboa de; Araújo, Rafael Montenegro de Carvalho; Lima, Elza Gadelha; Silva, Luciene Alexandre Bié da; Araújo, Lia de Carvalho; Araújo, Fernanda Montenegro de Carvalho
2016-09-01
We report on four patients with fatal influenza A(H1N1)pdm09 and dengue virus coinfections. Clinical, necropsy and histopathologic findings presented in all cases were characteristic of influenza-dengue coinfections, and all were laboratory-confirmed for both infections. The possibility of influenza and dengue coinfection should be considered in locations where these two viruses' epidemic periods coincide to avoid fatal outcomes. Dengue is a mosquito-borne viral infection caused by one of the four dengue viruses (DENV-1 to 4). Each of these viruses is capable of causing nonspecific febrile illnesses, classic dengue fever and dengue haemorrhagic fever (Gubler 1998). As a result, dengue is often difficult to diagnose clinically, especially because peak dengue season often coincides with that of other common febrile illnesses in tropical regions (Chacon et al. 2015). In April 2009, a new virus, influenza A/H1N1/pandemic (FluA/H1N1/09pdm), caused a severe outbreak in Mexico. The virus quickly spread throughout the world, and in June 2009, the World Health Organization declared a pandemic (WHO 2010). In Brazil, the first laboratory confirmed case of FluA/H1N1/09pdm was in July 2009 (Pires Neto et al. 2013). The state of Ceará, in Northeast Brazil, is a dengue endemic area. In this state, the virus influenza A(H1N1)pdm09 has circulated since 2009, and through the first half of 2012, 11 deaths caused by the virus were confirmed (Pires Neto et al. 2013). The influenza and dengue seasons in Ceará overlap, which led to diagnostic difficulties. We report four cases of laboratory-confirmed coinfection of deadly influenza A(H1N1)pdm09 with DENV, which occurred during the dengue and influenza season in 2012 and 2013 in Ceará.
Coinfection with influenza A(H1N1pdm09 and dengue virus in fatal cases
Directory of Open Access Journals (Sweden)
Anne Carolinne Bezerra Perdigão
2016-01-01
Full Text Available Abstract We report on four patients with fatal influenza A(H1N1pdm09 and dengue virus coinfections. Clinical, necropsy and histopathologic findings presented in all cases were characteristic of influenza-dengue coinfections, and all were laboratory-confirmed for both infections. The possibility of influenza and dengue coinfection should be considered in locations where these two viruses’ epidemic periods coincide to avoid fatal outcomes. Dengue is a mosquito-borne viral infection caused by one of the four dengue viruses (DENV-1 to 4. Each of these viruses is capable of causing nonspecific febrile illnesses, classic dengue fever and dengue haemorrhagic fever (Gubler 1998. As a result, dengue is often difficult to diagnose clinically, especially because peak dengue season often coincides with that of other common febrile illnesses in tropical regions (Chacon et al. 2015. In April 2009, a new virus, influenza A/H1N1/pandemic (FluA/H1N1/09pdm, caused a severe outbreak in Mexico. The virus quickly spread throughout the world, and in June 2009, the World Health Organization declared a pandemic (WHO 2010. In Brazil, the first laboratory confirmed case of FluA/H1N1/09pdm was in July 2009 (Pires Neto et al. 2013. The state of Ceará, in Northeast Brazil, is a dengue endemic area. In this state, the virus influenza A(H1N1pdm09 has circulated since 2009, and through the first half of 2012, 11 deaths caused by the virus were confirmed (Pires Neto et al. 2013. The influenza and dengue seasons in Ceará overlap, which led to diagnostic difficulties. We report four cases of laboratory-confirmed coinfection of deadly influenza A(H1N1pdm09 with DENV, which occurred during the dengue and influenza season in 2012 and 2013 in Ceará.
Impedance spectroscopy studies on lead free Ba1-xMgx(Ti0.9Zr0.1)O3 ceramics
Ben Moumen, S.; Neqali, A.; Asbani, B.; Mezzane, D.; Amjoud, M.; Choukri, E.; Gagou, Y.; El Marssi, M.; Luk'yanchuk, Igor A.
2018-06-01
Ba1-xMgx(Ti0.9Zr0.1)O3 (x = 0.01 and 0.02) ceramics were prepared using the conventional solid state reaction. Rietveld refinement performed on X-ray diffraction patterns indicates that the samples are tetragonal crystal structure with P4mm space group. By increasing Mg content from 1 to 2% the unit cell volume decreased. Likewise, the grains size is greatly reduced from 10 μm to 4 μm. The temperature dependence of dielectric constants at different frequencies exhibited typical relaxor ferroelectric characteristic, with sensitive dependence in frequency and temperature for ac conductivity. The obtained activation energy values were correlated to the proposed conduction mechanisms.
Kaasaaitamine. Riigikohtu kriminaalkolleegiumi otsus asjas 3-1-1-97-09 / Jaan Sootak
Sootak, Jaan, 1948-
2009-01-01
Riigikohtu lahendist 3-1-1-97-09: I. V. kaitsja vandeadvokaat Aivar Ennoki kassatsioon Tallinna Ringkonnakohtu 15. juuni 2009. a kohtuotsuse peale kriminaalasjas I. V. süüdistuses KarS § 200 lg 2 p 7 - § 22 lg 3; § 215 lg 2 p 3 - § 22 lg 3 järgi
Emergence of influenza A (H1N1) PDM09 in the remote Islands of India--a molecular approach.
Muruganandam, N; Bhattacharya, D; Chaaithanya, I K; Bhattacharya, H; Reesu, R; Maile, A; Bharathi, G S J; Sugunan, A P; Vijayachari, P
2015-01-01
A disease outbreak of A (H1N1) PDM09 was reported in Andaman and Nicobar islands in 2009 with an attack rate of 33.5% among settler population and 26.3% among the aboriginal Nicobarese tribe. During the ongoing outbreak of A (H1N1) PDM09 disease in different parts of the world, a subject working in Dubai city of Saudi Arabia, came to Port Blair, following which the pandemic triggered for the first time in these Islands. During the period August 2009 to January 2011, 30 confirmed cases of Influenza A (H1N1) PDM09 virus infection was detected. To understand the genetic relationship, the NA gene sequences of the viruses were phylogenetically analysed together along with the virus sequence isolated from other parts of the world. Formation of multiple clusters were observed, with the sequences of Andaman Islands, mainland India, Mexico, Saudi Arabia and few other counties clustering together. The sequence analysis data revealed that there was no specific mutation conferring resistance to oseltamivir among the Andaman A (H1N1) PDM09 virus isolates. The result of phylogenetic analysis have also revealed that the A (H1N1) PDM09 virus might have spread in these remote Islands of India via the subject from Saudi Arabia/Dubai. A (H1N1) PDM09 Influenza outbreak have highlighted the need to strengthen the region-specific pandemic preparedness plans and surveillance strategies.
Gefenaite, G.; Tacken, M.; Bos, J.; Stirbu-Wagner, I.; Korevaar, J.C.; Stolk, R.P.; Wolters, B.; Bijl, M.; Postma, M.J.; Wilschut, J.; Nichol, K.L.; Hak, E.
2013-01-01
Introduction: Because of variability in published A(H1N1)pdm09 influenza vaccine effectiveness estimates, we conducted a study in the adults belonging to the risk groups to assess the A(H1N1)pdm09 MF59-adjuvanted influenza vaccine effectiveness. Methods: VE against influenza and/or pneumonia was
Microstructural evolution of nanostructured Ti0.9Al0.1N prepared by reactive ball-milling
International Nuclear Information System (INIS)
Bhaskar, U.K.; Bid, S.; Pradhan, S.K.
2011-01-01
Research highlights: → Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N powder has been prepared by ball-milling the 0.9 mol fraction of α-Ti (hcp) and 0.1 mol fraction of aluminum (fcc) powders under N 2 at room temperature. Initially, α-Ti phase partially transformed to the transient β-Ti phase and Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N phase is formed after 7 h of milling. The main features which are observed in the present study are stated below: 1.During ball-milling of α-Ti, the α-Ti phase partially converted to transient cubic β-Ti phase within 1 h of milling. 2.Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Complete formation of Ti 0.9 Al 0.1 N (fcc) is obtained at 7 h of milling which is lesser than complete formation time (9 h) of TiN. Doping Al atoms accelerates the formation of (TiAl)N phase. 3.The particle size of Ti 0.9 Al 0.1 N decrease rapidly up to 3 h and then increase slightly due to agglomeration effect. 4.The particle size of Ti 0.9 Al 0.1 N estimated from X-ray is in good agreement with that measured from HRTEM. - Abstract: Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N powder has been prepared by ball-milling the α-Ti (hcp) and aluminum (fcc) powders under N 2 at room temperature. Initially, α-Ti phase partially transformed to the transient cubic β-Ti phase and Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N phase is formed after 7 h of milling. After 1 h of milling, all Al atoms are diffused into the α-Ti matrix. The transient β-Ti phase is noticed to form after 1 h of milling and disappears completely after 7 h of milling. Microstructure characterization of unmilled and ball-milled powders by analyzing XRD patterns employing the Rietveld structure refinement reveals the inclusion of Al and nitrogen atoms into the Ti lattice on the way to formation of Ti 0.9 Al 0.1 N
Emergence of influenza A (H1N1 PDM09 in the remote Islands of India - A molecular approach
Directory of Open Access Journals (Sweden)
N Muruganandam
2015-01-01
Full Text Available Background: A disease outbreak of A (H1N1 PDM09 was reported in Andaman and Nicobar islands in 2009 with an attack rate of 33.5% among settler population and 26.3% among the aboriginal Nicobarese tribe. During the ongoing outbreak of A (H1N1 PDM09 disease in different parts of the world, a subject working in Dubai city of Saudi Arabia, came to Port Blair, following which the pandemic triggered for the first time in these Islands. Materials and Methods: During the period August 2009 to January 2011, 30 confirmed cases of Influenza A (H1N1 PDM09 virus infection was detected. To understand the genetic relationship, the NA gene sequences of the viruses were phylogenetically analysed together along with the virus sequence isolated from other parts of the world. Result: Formation of multiple clusters were observed, with the sequences of Andaman Islands, mainland India, Mexico, Saudi Arabia and few other counties clustering together. The sequence analysis data revealed that there was no specific mutation conferring resistance to oseltamivir among the Andaman A (H1N1 PDM09 virus isolates. The result of phylogenetic analysis have also revealed that the A (H1N1 PDM09 virus might have spread in these remote Islands of India via the subject from Saudi Arabia/Dubai. Conclusion: A (H1N1 PDM09 Influenza outbreak have highlighted the need to strengthen the region-specific pandemic preparedness plans and surveillance strategies.
HIV-1 and its gp120 inhibits the influenza A(H1N1)pdm09 life cycle in an IFITM3-dependent fashion.
Mesquita, Milene; Fintelman-Rodrigues, Natalia; Sacramento, Carolina Q; Abrantes, Juliana L; Costa, Eduardo; Temerozo, Jairo R; Siqueira, Marilda M; Bou-Habib, Dumith Chequer; Souza, Thiago Moreno L
2014-01-01
HIV-1-infected patients co-infected with A(H1N1)pdm09 surprisingly presented benign clinical outcome. The knowledge that HIV-1 changes the host homeostatic equilibrium, which may favor the patient resistance to some co-pathogens, prompted us to investigate whether HIV-1 infection could influence A(H1N1)pdm09 life cycle in vitro. We show here that exposure of A(H1N1)pdm09-infected epithelial cells to HIV-1 viral particles or its gp120 enhanced by 25% the IFITM3 content, resulting in a decrease in influenza replication. This event was dependent on toll-like receptor 2 and 4. Moreover, knockdown of IFITM3 prevented HIV-1 ability to inhibit A(H1N1)pdm09 replication. HIV-1 infection also increased IFITM3 levels in human primary macrophages by almost 100%. Consequently, the arrival of influenza ribonucleoproteins (RNPs) to nucleus of macrophages was inhibited, as evaluated by different approaches. Reduction of influenza RNPs entry into the nucleus tolled A(H1N1)pdm09 life cycle in macrophages earlier than usual, limiting influenza's ability to induce TNF-α. As judged by analysis of the influenza hemagglutin (HA) gene from in vitro experiments and from samples of HIV-1/A(H1N1)pdm09 co-infected individuals, the HIV-1-induced reduction of influenza replication resulted in delayed viral evolution. Our results may provide insights on the mechanisms that may have attenuated the clinical course of Influenza in HIV-1/A(H1N1)pdm09 co-infected patients during the recent influenza form 2009/2010.
HIV-1 and its gp120 inhibits the influenza A(H1N1pdm09 life cycle in an IFITM3-dependent fashion.
Directory of Open Access Journals (Sweden)
Milene Mesquita
Full Text Available HIV-1-infected patients co-infected with A(H1N1pdm09 surprisingly presented benign clinical outcome. The knowledge that HIV-1 changes the host homeostatic equilibrium, which may favor the patient resistance to some co-pathogens, prompted us to investigate whether HIV-1 infection could influence A(H1N1pdm09 life cycle in vitro. We show here that exposure of A(H1N1pdm09-infected epithelial cells to HIV-1 viral particles or its gp120 enhanced by 25% the IFITM3 content, resulting in a decrease in influenza replication. This event was dependent on toll-like receptor 2 and 4. Moreover, knockdown of IFITM3 prevented HIV-1 ability to inhibit A(H1N1pdm09 replication. HIV-1 infection also increased IFITM3 levels in human primary macrophages by almost 100%. Consequently, the arrival of influenza ribonucleoproteins (RNPs to nucleus of macrophages was inhibited, as evaluated by different approaches. Reduction of influenza RNPs entry into the nucleus tolled A(H1N1pdm09 life cycle in macrophages earlier than usual, limiting influenza's ability to induce TNF-α. As judged by analysis of the influenza hemagglutin (HA gene from in vitro experiments and from samples of HIV-1/A(H1N1pdm09 co-infected individuals, the HIV-1-induced reduction of influenza replication resulted in delayed viral evolution. Our results may provide insights on the mechanisms that may have attenuated the clinical course of Influenza in HIV-1/A(H1N1pdm09 co-infected patients during the recent influenza form 2009/2010.
Influenza A (H1N1pdm09)-Related Critical Illness and Mortality in Mexico and Canada, 2014.
Dominguez-Cherit, Guillermo; De la Torre, Alethse; Rishu, Asgar; Pinto, Ruxandra; Ñamendys-Silva, Silvio A; Camacho-Ortiz, Adrián; Silva-Medina, Marco Antonio; Hernández-Cárdenas, Carmen; Martínez-Franco, Michel; Quesada-Sánchez, Alejandro; López-Gallegos, Guadalupe Celia; Mosqueda-Gómez, Juan L; Rivera-Martinez, Norma E; Campos-Calderón, Fernando; Rivero-Sigarroa, Eduardo; Hernández-Gilsoul, Thierry; Espinosa-Pérez, Lourdes; Macías, Alejandro E; Lue-Martínez, Dolores M; Buelna-Cano, Christian; Ramírez-García Luna, Ana-Sofía; Cruz-Ruiz, Nestor G; Poblano-Morales, Manuel; Molinar-Ramos, Fernando; Hernandez-Torre, Martin; León-Gutiérrez, Marco Antonio; Rosaldo-Abundis, Oscar; Baltazar-Torres, José Ángel; Stelfox, Henry T; Light, Bruce; Jouvet, Philippe; Reynolds, Steve; Hall, Richard; Shindo, Nikki; Daneman, Nick; Fowler, Robert A
2016-10-01
The 2009-2010 influenza A (H1N1pdm09) pandemic caused substantial morbidity and mortality among young patients; however, mortality estimates have been confounded by regional differences in eligibility criteria and inclusion of selected populations. In 2013-2014, H1N1pdm09 became North America's dominant seasonal influenza strain. Our objective was to compare the baseline characteristics, resources, and treatments with outcomes among critically ill patients with influenza A (H1N1pdm09) in Mexican and Canadian hospitals in 2014 using consistent eligibility criteria. Observational study and a survey of available healthcare setting resources. Twenty-one hospitals, 13 in Mexico and eight in Canada. Critically ill patients with confirmed H1N1pdm09 during 2013-2014 influenza season. None. The main outcome measures were 90-day mortality and independent predictors of mortality. Among 165 adult patients with H1N1pdm09-related critical illness between September 2013 and March 2014, mean age was 48.3 years, 64% were males, and nearly all influenza was community acquired. Patients were severely hypoxic (median PaO2-to-FIO2 ratio, 83 mm Hg), 97% received mechanical ventilation, with mean positive end-expiratory pressure of 14 cm H2O at the onset of critical illness and 26.7% received rescue oxygenation therapy with prone ventilation, extracorporeal life support, high-frequency oscillatory ventilation, or inhaled nitric oxide. At 90 days, mortality was 34.6% (13.9% in Canada vs 50.5% in Mexico, p Mexico (odds ratio, 7.76 [95% CI, 2.02-27.35]). ICUs in Canada generally had more beds, ventilators, healthcare personnel, and rescue oxygenation therapies. Influenza A (H1N1pdm09)-related critical illness still predominantly affects relatively young to middle-aged patients and is associated with severe hypoxemic respiratory failure. The local critical care system and available resources may be influential determinants of patient outcome.
2012-03-28
... DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT [Docket No. FR-5607-N-09] Notice of Proposed... Housing and Urban Development, 451 7th Street SW., Washington, DC 20410, Room 9120, or the number for the Federal Information Relay Service (1-800-877-8339). FOR FURTHER INFORMATION CONTACT: Marilyn M. Edge...
Piezoresistance of Silicon and Strained Si0.9Ge0.1
DEFF Research Database (Denmark)
Richter, Jacob; Hansen, Ole; Larsen, A. Nylandsted
2005-01-01
We present experimentally obtained results of the piezoresistive effect in p-type silicon and strained Si0.9Ge0.1. Today, strained Si1-xGex is used for high speed electronic devices. This paper investigates if this area of use can be expanded to also cover piezoresistive micro electro mechanical...... systems (MEMS) devices. The measurements are performed on microfabricated test chips where resistors are defined in layers grown by molecular beam epitaxy on (0 0 1) silicon substrates. A uniaxial stress along the [1 1 0] direction is applied to the chip, with the use of a four point bending fixture....... The investigation covers materials with doping levels of N-A = 10(18) cm(-3) and NA = 1019 cm(-3), respectively. The results show that the pi(66) piezoresistive coefficient in strained Si0.9Ge0.1 is approximately 30% larger than the comparable pi(44) piezoresistive coefficient in silicon at a doping level of N...
Gefenaite, Giedre; Tacken, Margot; Bos, Jens; Stirbu-Wagner, Irina; Korevaar, Joke C.; Stolk, Ronald P.; Wolters, Bert; Bijl, Marc; Postma, Maarten J.; Wilschut, Jan; Nichol, Kristin L.; Hak, Eelko
Background: Because of variability in published A(H1N1)pdm09 influenza vaccine effectiveness estimates, we aimed to assess the effectiveness of MF59-adjuvanted A(H1N1)pdm09 vaccine in a matched case-control study. Objectives: We aimed to assess the effectiveness of MF59- adjuvanted A(H1N1)pdm09
Directory of Open Access Journals (Sweden)
Hsin-Ying Lee
2014-01-01
Full Text Available The Mg0.1Zn0.9O films were grown using atomic layer deposition (ALD system and applied to metal-semiconductor-metal ultraviolet photodetectors (MSM-UPDs as an active layer. To suppress the dangling bonds on the Mg0.1Zn0.9O surface, the photoelectrochemical (PEC treatment was used to passivate the Mg0.1Zn0.9O surface, which could reduce the dark current of the MSM-UPDs about one order. Beside, to increase more incident light into the Mg0.1Zn0.9O active layer of the MSM-UPDs, the 500-nm-diameter silica nanospheres were spin-coated on the Mg0.1Zn0.9O active layer to improve the antireflection capability at the wavelength of 340 nm. The reflectivity of the Mg0.1Zn0.9O films with silica nanospheres antireflection layer decreased about 7.0% in comparison with the Mg0.1Zn0.9O films without silica nanospheres. The photocurrent and UV-visible ratio of the passivated Mg0.1Zn0.9O MSM-UPDs with antireflection layer were enhanced to 5.85 μA and 1.44×104, respectively, at the bias voltage of 5 V. Moreover, the noise equivalent power and the specific detectivity of the passivated Mg0.1Zn0.9O MSM-UPDs with antireflection layer were decreased to 2.60×10-13 W and increased to 1.21×1012 cmHz1/2W−1, respectively, at the bias voltage of 5 V. According to the above mentions, the PEC treatment and silica nanospheres antireflection layer could effectively enhance the performance of Mg0.1Zn0.9O MSM-UPDs.
XRD and HRTEM characterization of mechanosynthesized Ti{sub 0.9}W{sub 0.1}C cermet
Energy Technology Data Exchange (ETDEWEB)
Bandyopadhyay, S. [Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India); Dutta, H. [Department of Physics, Vivekananda College, Burdwan 713103, West Bengal (India); Pradhan, S.K., E-mail: skp_bu@yahoo.com [Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India)
2013-12-25
Highlights: •Cubic Ti{sub 0.9}W{sub 0.1}C is formed after 50 min of milling of α-Ti, W and graphite powders. •Nanocrystalline Ti{sub 0.9}W{sub 0.1}C with particle size ∼11 nm is obtained after 8 h milling. •Average particle size of Ti{sub 0.9}W{sub 0.1}C from XRD analysis and HRTEM is very close. •Formation of Ti{sub 0.9}W{sub 0.1}C is hindered as compared with TiC. -- Abstract: Elemental powder mixture of titanium, tungsten and graphite is milled by high energy planetary ball mill at a fixed ball to powder mass ratio (BPMR) for different duration to produce nanosized particles of Ti{sub 0.9}W{sub 0.1}C hard metal. Microstructure characterization in terms of lattice imperfections and phase quantification of ball-milled samples has been done primarily by analyzing the XRD pattern and employing Rietveld method of structure and microstructure refinement. After 8 h of ball-milling full formation of Ti{sub 0.9}W{sub 0.1}C is noticed without any contamination of other phase or milling media. TEM study of 8 h ball-milled sample gives direct supportive evidence of structural and microstructural evaluation by XRD pattern analysis. A comparative study of microstructural changes between TiC and Ti{sub 0.9}W{sub 0.1}C helps to understand the effect of addition of W as solute in Ti–C metal matrix.
Perovskite-based heterostructures integrating ferromagnetic-insulating La0.1Bi0.9MnO3
Gajek, M.; Bibes, M.; Barthélémy, A.; Varela, M.; Fontcuberta, J.
2005-05-01
We report on the growth of thin films and heterostructures of the ferromagnetic-insulating perovskite La0.1Bi0.9MnO3. We show that the La0.1Bi0.9MnO3 perovskite grows single phased, epitaxially, and with a single out-of-plane orientation either on SrTiO3 substrates or onto strained La2/3Sr1/3MnO3 and SrRuO3 ferromagnetic-metallic buffer layers. We discuss the magnetic properties of the La0.1Bi0.9MnO3 films and heterostructures in view of their possible potential as magnetoelectric or spin-dependent tunneling devices.
Directory of Open Access Journals (Sweden)
Pekka Ylipalosaari
2017-11-01
Full Text Available Abstract Background We compared in a single mixed intensive care unit (ICU patients with influenza A(H1N1 pdm09 between pandemic and postpandemic periods. Methods Retrospective analysis of prospectively collected data in 2009–2016. Data are expressed as median (25th–75th percentile or number (percentile. Results Seventy-six influenza A(H1N1 pdm09 patients were admitted to the ICU: 16 during the pandemic period and 60 during the postpandemic period. Postpandemic patients were significantly older (60 years vs. 43 years, p < 0.001 and less likely to have epilepsy or other neurological diseases compared with pandemic patients (5 [8.3%] vs. 6 [38%], respectively; p = 0.009. Postpandemic patients were more likely than pandemic patients to have cardiovascular disease (24 [40%] vs. 1 [6%], respectively; p = 0.015, and they had higher scores on APACHE II (17 [13–22] vs. 14 [10–17], p = 0.002 and SAPS II (40 [31–51] vs. 31 [25–35], p = 0.002 upon admission to the ICU. Postpandemic patients had higher maximal SOFA score (9 [5–12] vs. 5 [4–9], respectively; p = 0.03 during their ICU stay. Postpandemic patients had more often septic shock (40 [66.7%] vs. 8 [50.0%], p = 0.042, and longer median hospital stays (15.0 vs. 8.0 days, respectively; p = 0.006. During 2015–2016, only 18% of the ICU- treated patients had received seasonal influenza vaccination. Conclusions Postpandemic ICU-treated A(H1N1 pdm09 influenza patients were older and developed more often septic shock and had longer hospital stays than influenza patients during the 2009 pandemic.
McCluskey, Susan V; Sztajnkrycer, Matthew D; Jenkins, Donald A; Zietlow, Scott P; Berns, Kathleen S; Park, Myung S
2014-01-01
Tranexamic acid has recently been demonstrated to decrease all-cause mortality and deaths due to hemorrhage in trauma patients. The optimal administration of tranexamic acid is within one hour of injury, but not more than three hours from the time of injury. To aid with timely administration, a premixed solution of 1 gram tranexamic acid and 0.9% sodium chloride was proposed to be stocked as a medication in both the aeromedical transport helicopters and Emergency Department at Mayo Clinic Hospital--Rochester Saint Marys Campus. Since no published stability data exists for tranexamic acid diluted with 0.9% sodium chloride, this study was undertaken to determine the stability of tranexamic acid diluted with 0.9% sodium chloride while being stored in two types of containers. Stability was determined through the use of a stability-indicating high-performance liquid reverse phase chromatography assay, pH, and visual tests. Tranexamic acid solutions of 1 gram in 0.9% sodium chloride 65 mL were studied at predetermined intervals for 90 days in ethylene/propylene copolymer plastic containers, protected from light, and at both controlled room and refrigerated temperatures. Tranexamic acid solutions of 1 gram in 0.9% sodium chloride 50 mL were studied at predetermined intervals for 180 days in clear Type 1 borosilicate glass vials sealed with intact elastomeric, Flourotec-coated stoppers, stored protected from light at controlled room temperature. Solutions stored in the ethylene/propylene copolymer plastic containers at both storage temperatures maintained at least 98% of initial potency throughout the 90-day study period. Solutions stored in glass vials at controlled room temperature maintained at least 92% of initial potency throughout the 180-day study period. Visual and pH tests revealed stable, clear, colorless, and particulate-free solutions throughout the respective study periods.
Shape-Control of a 0D/1D NaFe0.9Mn0.1PO4 Nano-Complex by Electrospinning
Shin, Mi-Ra; Son, Jong-Tae
2018-03-01
NaFePO4 with a maricite structure was one of the most promising candidates for sodium ion batteries (SIBs) due to its advantages of environmental friendly and having low cost. However, it has low electrochemical conductivity and energy density, which impose limitations on its application as commercial cathode materials. In this study, other transition-metal ions such as Mn2+ were substituted into the iron (Fe2+) site in NaFePO4 to increase the surface area and the number of nanofibers in the prepared one-dimensional (1D) nano-sized material with 0D/1D dimensions to enhance the energy density. Also, the 0D/1D NaFe0.9Mn0.1PO4 cathode material has increased electrochemical conductivity because the fiber size was reduced to the nano-scale level by using the electrospinning method in order to decrease the diffusion path of Na-ions. The morphology of the 0D/1D nanofiber was evaluated by Field-emission scanning electron microscope and atomic force microscope analyses. The NaFe0.9Mn0.1PO4 nanofibers had a diameter of approximately 180 nm, while the spherical particle had a diameter 1 μm. The 0D/1D nano-sized cathode material show a discharge capacity of 27 mAhg -1 at a 0.05 C rate within the 2.0 4.5 V voltage range and a low R ct of 110 Ω.
Gilev, A. R.; Kiselev, E. A.; Zakharov, D. M.; Cherepanov, V. A.
2017-10-01
The total conductivity, Seebeck coefficient and oxygen non-stoichiometry for La1.2Sr0.8Ni0.9Fe0.1O4+δ have been measured vs temperature and oxygen partial pressure P(O2). The measurements were carried out at 800, 850, 900 and 950 °C within the P(O2) range of 10-5-0.21 atm. La1.2Sr0.8Ni0.9Fe0.1O4+δ was shown to be oxygen deficient in all temperature and P(O2) ranges studied. The calculated values of the partial molar enthalpy of oxygen depend very slightly on oxygen content (δ), indicating that La1.2Sr0.8Ni0.9Fe0.1O4+δ with the oxygen deficiency can be considered an ideal solution. The model of point defect equilibria in La1.2Sr0.8Ni0.9Fe0.1O4+δ has been proposed and fitted to experimental dependencies. Subsequent joint analysis of the defect structure and transport properties revealed that electron holes can coexist in both localized and quasi-delocalized states in the oxide: the former corresponded to high-spin state Ni3+ and the latter - to low-spin state Ni3+. The mobilities of localized electron holes were shown to be significantly lower in comparison to quasi-delocalized ones. The behavior of localized electron holes was explained in terms of a small polaron conduction mechanism; in contrast, quasi-delocalized electron holes were described in terms of a band conduction approach. The small polaron conduction mechanism was shown to be predominant in the Sr- and Fe-co-doped lanthanum nickelate.
Rith, Sareth; Chin, Savuth; Sar, Borann; Y, Phalla; Horm, Srey Viseth; Ly, Sovann; Buchy, Philippe; Dussart, Philippe; Horwood, Paul F
2015-12-01
Despite annual co-circulation of different subtypes of seasonal influenza, co-infections between different viruses are rarely detected. These co-infections can result in the emergence of reassortant progeny. We document the detection of an influenza co-infection, between influenza A/H3N2 with A/H1N1pdm09 viruses, which occurred in a 3 year old male in Cambodia during April 2014. Both viruses were detected in the patient at relatively high viral loads (as determined by real-time RT-PCR CT values), which is unusual for influenza co-infections. As reassortment can occur between co-infected influenza A strains we isolated plaque purified clonal viral populations from the clinical material of the patient infected with A/H3N2 and A/H1N1pdm09. Complete genome sequences were completed for 7 clonal viruses to determine if any reassorted viruses were generated during the influenza virus co-infection. Although most of the viral sequences were consistent with wild-type A/H3N2 or A/H1N1pdm09, one reassortant A/H3N2 virus was isolated which contained an A/H1N1pdm09 NS1 gene fragment. The reassortant virus was viable and able to infect cells, as judged by successful passage in MDCK cells, achieving a TCID50 of 10(4)/ml at passage number two. There is no evidence that the reassortant virus was transmitted further. The co-infection occurred during a period when co-circulation of A/H3N2 and A/H1N1pdm09 was detected in Cambodia. It is unclear how often influenza co-infections occur, but laboratories should consider influenza co-infections during routine surveillance activities. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Bandyopadhyay, S. [Department of Physics, The University of Burdwan, Golapbag, Burdwan, 713104, West Bengal (India); Dutta, H. [Department of Physics, Vivekananda College, Burdwan, 713103, West Bengal (India); Kar, T. [Department of Materials Science, Indian Association for the Cultivation of Science, Jadavpur, Kolkata, 700032, West Bengal (India); Pradhan, S.K., E-mail: skp_bu@yahoo.com [Department of Physics, The University of Burdwan, Golapbag, Burdwan, 713104, West Bengal (India)
2016-02-01
This article reports the synthesis and microstructure characterization of nanocrystalline Si{sub 0.9}Al{sub 0.1}C powder obtained by mechanical milling the mixture of Si, Al and graphite powders at room temperature under inert atmosphere. XRD patterns of ball-milled powders clearly reveal the nucleation of Si{sub 0.9}Al{sub 0.1}C phase after 5 h of milling and the stoichiometric cubic Si{sub 0.9}Al{sub 0.1}C is formed after 10 h of milling with crystallite size of ∼3 nm. Microstructure of ball-milled powders in terms of different lattice imperfections is characterized by employing both Rietveld's method of structure refinement using XRD data and high resolution transmission electron microscope (HRTEM). HRTEM micrographs of 10 h milled powder substantiate the formation of nanocrystalline Si{sub 0.9}Al{sub 0.1}C compound without any contamination and confirm the findings of Rietveld analysis using XRD data. - Highlights: • Cubic Si{sub 0.9}Al{sub 0.1}C is formed after 5 h of milling of Si, Al and graphite powders. • Nanocrystalline Si{sub 0.9}Al{sub 0.1}C with particle size ∼3 nm is obtained after 10 h milling. • Average particle size of Si{sub 0.9}Al{sub 0.1}C from XRD analysis and HRTEM is very close.
Magnetic-entropy change in Mn1.1Fe0.9P0.7As0.3-xGe x
International Nuclear Information System (INIS)
Tegus, O.; Fuquan, B.; Dagula, W.; Zhang, L.; Brueck, E.; Si, P.Z.; Boer, F.R. de; Buschow, K.H.J.
2005-01-01
We have studied the magnetic properties and magnetic-entropy changes of Mn 1.1 Fe 0.9 P 0.7 As 0.3-x Ge x compounds with x = 0, 0.05, 0.1, 0.15 and 0.3. X-ray diffraction (XRD) study shows all the compounds crystallize in the Fe 2 P-type structure. Magnetic measurements show that the Curie temperature increases from 150 K for Mn 1.1 Fe 0.9 P 0.7 As 0.3 to 380 K for Mn 1.1 Fe 0.9 P 0.7 Ge 0.3 . A field-induced first-order magnetic phase transition is observed above the Curie temperature for the compounds with x up to 0.15. There exists an optimal composition in which the first-order phase transition is the sharpest. The optimal composition for this system is x = 0.1. The maximal magnetic-entropy change derived from the magnetization data is about 40 J/(kg K) for a field change from 0 to 3 T
2011-04-13
... Activities; Proposed Collection; Comment Request; Contractor Conflicts of Interest AGENCY: Environmental....regulations.gov . Title: Contractor Conflicts of Interest. ICR numbers: EPA ICR No. 1550.09, OMB Control No... control numbers in certain EPA regulations is consolidated in 40 CFR part 9. Abstract: EPA contractors...
Weak antilocalization effect due to topological surface states in Bi2Se2.1Te0.9
Shrestha, K.; Graf, D.; Marinova, V.; Lorenz, B.; Chu, C. W.
2017-10-01
We have investigated the weak antilocalization (WAL) effect in the p-type Bi2Se2.1Te0.9 topological system. The magnetoconductance shows a cusp-like feature at low magnetic fields, indicating the presence of the WAL effect. The WAL curves measured at different tilt angles merge together when they are plotted as a function of the normal field components, showing that surface states dominate the magnetoconductance in the Bi2Se2.1Te0.9 crystal. We have calculated magnetoconductance per conduction channel and applied the Hikami-Larkin-Nagaoka formula to determine the physical parameters that characterize the WAL effect. The number of conduction channels and the phase coherence length do not change with temperature up to T = 5 K. In addition, the sample shows a large positive magnetoresistance that reaches 1900% under a magnetic field of 35 T at T = 0.33 K with no sign of saturation. The magnetoresistance value decreases with both increasing temperature and tilt angle of the sample surface with respect to the magnetic field. The large magnetoresistance of topological insulators can be utilized in future technology such as sensors and memory devices.
Screening for Influenza A(H1N1)pdm09, Auckland International Airport, New Zealand
Hale, Michael J.; Baker, Michael G.
2012-01-01
Entry screening for influenza A(H1N1)pdm09 at Auckland International Airport, New Zealand, detected 4 cases, which were later confirmed, among 456,518 passengers arriving April 27–June 22, 2009. On the basis of national influenza surveillance data, which suggest that ≈69 infected travelers passed through the airport, sensitivity for screening was only 5.8%. PMID:22516105
Energy Technology Data Exchange (ETDEWEB)
Herrera-Pérez, G., E-mail: guillermo.herrera@cimav.edu.mx, E-mail: damasio.morales@cimav.edu.mx [Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Physics of Materials Department, Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Morales, D., E-mail: guillermo.herrera@cimav.edu.mx, E-mail: damasio.morales@cimav.edu.mx; Paraguay-Delgado, F.; Reyes-Rojas, A.; Fuentes-Cobas, L. E. [Physics of Materials Department, Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Borja-Urby, R. [Centro de Nanociencias Micro y Nanotecnologías, Instituto Politécnico Nacional, 07300 México City (Mexico)
2016-09-07
This work presents the identification of inter-band transitions in the imaginary part of the dielectric function (ε{sub 2}) derived from the Kramers–Kronig analysis for [Ba{sub 0.9}Ca{sub 0.1}](Ti{sub 0.9}Zr{sub 0.1})O{sub 3} (BCZT) nanocrystals synthesized by the modified Pechini method. The analysis started with the chemical identification of the atoms that conform BCZT in the valence loss energy region of a high energy-resolution of electron energy loss spectroscopy. The indirect band energy (E{sub g}) was determined in the dielectric response function. This result is in agreement with the UV-Vis technique, and it obtained an optical band gap of 3.16 eV. The surface and volume plasmon peaks were observed at 13.1 eV and 26.2 eV, respectively. The X-ray diffraction pattern and the Rietveld refinement data of powders heat treated at 700 °C for 1 h suggest a tetragonal structure with a space group (P4 mm) with the average crystal size of 35 nm. The average particle size was determined by transmission electron microscopy.
A 0.9-V 12-bit 40-MSPS Pipeline ADC for Wireless Receivers
Ito, Tomohiko; Itakura, Tetsuro
A 0.9-V 12-bit 40-MSPS pipeline ADC with I/Q amplifier sharing technique is presented for wireless receivers. To achieve high linearity even at 0.9-V supply, the clock signals to sampling switches are boosted over 0.9V in conversion stages. The clock-boosting circuit for lifting these clocks is shared between I-ch ADC and Q-ch ADC, reducing the area penalty. Low supply voltage narrows the available output range of the operational amplifier. A pseudo-differential (PD) amplifier with two-gain-stage common-mode feedback (CMFB) is proposed in views of its wide output range and power efficiency. This ADC is fabricated in 90-nm CMOS technology. At 40MS/s, the measured SNDR is 59.3dB and the corresponding effective number of bits (ENOB) is 9.6. Until Nyquist frequency, the ENOB is kept over 9.3. The ADC dissipates 17.3mW/ch, whose performances are suitable for ADCs for mobile wireless systems such as WLAN/WiMAX.
16 CFR 0.9 - Organization structure.
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Organization structure. 0.9 Section 0.9 Commercial Practices FEDERAL TRADE COMMISSION ORGANIZATION, PROCEDURES AND RULES OF PRACTICE ORGANIZATION § 0.9 Organization structure. The Federal Trade Commission comprises the following principal units...
Characterization of Ce0.9Gd0.1O1.95 powders synthesized by spray drying
DEFF Research Database (Denmark)
Blennow Tullmar, Peter; Chen, Weiwu; Lundberg, Mats
2009-01-01
Ce0.9Gd0.1O1.95 powders were synthesized by spray drying and successive calcinations. The phase purity, BET surface area, and particle morphology of as-sprayed and calcined powders were characterized. After calcination above 300 °C, the powders were single phase and showed a BET surface area of 68...
First reported detection of influenza A (H1N1)pdm09 in turkeys in the United Kingdom.
Reid, Scott M; Cox, William J; Ceeraz, Vanessa; Sutton, David; Essen, Steve C; Howard, Wendy A; Slomka, Marek J; Irvine, Richard M; Brown, Ian H
2012-12-01
We report the first occurrence of pandemic (H1N1) 2009 virus [A(H1N1)pdm09] infection on two epidemiologically linked turkey breeder premises in the United Kingdom during December 2010 and January 2011. Clinically, the birds showed only mild signs of disease, with the major presenting sign being an acute and marked reduction in egg production, leading to the prompt reporting of suspected avian notifiable disease for official investigation. Presence of A(H1N1)pdm09 infection in the United Kingdom turkey breeder flocks was confirmed by detailed laboratory investigations including virus isolation in embryonated specific pathogen-free fowls' eggs, two validated real-time reverse transcription-PCR tests, and nucleotide sequencing of the hemagglutinin and neuraminidase genes. These investigations revealed high nucleotide identity with currently circulating human A(H1N1)pdm09 strains, suggesting that human-to-poultry transmission (reverse zoonosis) was the most likely route of infection. Peak levels of human influenza-like illness community transmission also coincided with the onset of clinical signs in both affected turkey breeder flocks. This case demonstrated the value of the existing passive surveillance framework and associated veterinary and laboratory infrastructure that enables the detection and management of both exotic and new and emerging disease hazards and risks. The case also presents further evidence of the susceptibility of turkeys to infection with influenza A viruses of nonavian origin.
Oxygen permeation in thin, dense Ce0.9Gd0.1O 1.95- membranes II. experimental determination
DEFF Research Database (Denmark)
Chatzichristodoulou, Christodoulos; Søgaard, Martin; Glasscock, Julie
2011-01-01
Thin (∼30 m), dense Ce0.9Gd0.1O1.95- (CGO10) membranes (5 5 cm2+) supported on a porous NiO/YSZ substrate were fabricated by tape casting, wet powder spraying and lamination. A La 0.58Sr0.4Co0.2Fe0.8O 3-δ/Ce0.9Gd0.1O1.95- (LSCF/CGO10) composite cathode was applied by screen printing. Oxygen...... compartment. The performance of the membrane was also investigated under varying CH 4 and H2O gas mixtures at 1106 K. The oxygen flux increased with decreasing steam to carbon ratio and was found to exceed 10 N mL min-1 cm-2 of O2 for steam to carbon ratios below 4:3. Post-test analysis of the tested membrane...
International Nuclear Information System (INIS)
Sougrati, Moulay T; Hermann, Raphael P; Grandjean, Fernande; Long, Gary J; Brueck, E; Tegus, O; Trung, N T; Buschow, K H J
2008-01-01
The structural, magnetic and Moessbauer spectral properties of the magnetocaloric Mn 1.1 Fe 0.9 P 1-x Ge x compounds, with 0.19 1.1 Fe 0.9 P 0.74 Ge 0.26 . The temperature dependence of the magnetization reveals a ferromagnetic to paramagnetic transition with a Curie temperature between approximately 250 and 330 K and hysteresis width of 10 to 4 K, for 0.19 1.1 Fe 0.9 P 0.78 Ge 0.22 shows the largest isothermal entropy change of approximately 10 J/(kgKT) at 290 K. The Moessbauer spectra have been analysed with a binomial distribution of hyperfine fields correlated with a change in isomer shift and quadrupole shift, a distribution that results from the distribution of phosphorus and germanium among the near neighbours of the iron. The coexistence of paramagnetic and magnetically ordered phases in ranges of temperature of up to 50 K around the Curie temperature is observed in the Moessbauer spectra and is associated with the first-order character of the ferromagnetic to paramagnetic transition. The temperature dependence of the weighted average hyperfine field is well fitted within the magnetostrictive model of Bean and Rodbell. Good fits of the Moessbauer spectra could only be achieved by introducing a difference between the isomer shifts in the paramagnetic and ferromagnetic phases, a difference that is related to the magnetostriction and electronic structure change.
DEFF Research Database (Denmark)
Bischoff, Anne Louise
2013-01-01
against H1N1pnd09 according to the EMEA criteria with a HI titre of 40 or greater. Women receiving the non-adjuvanted vaccine had significantly fewer local reactions but similar rates of systemic reactions as women receiving the adjuvanted vaccine. There were no reports of serious adverse events in any......Pregnant women experience increased influenza related morbidity and mortality during seasonal influenza epidemics, and even graver outcomes during influenza pandemics. Thus, even though the huge amount of data on clinical efficacy and effectiveness of influenza vaccine in pregnant women......, there is limited information on the details of the immunological responses to influenza immunization in pregnant versus non-pregnant. We had the unique opportunity to study the H1N1pnd09 vaccination of pregnant and non-pregnant women in our unselected, prospective, clinical pregnancy-cohort: the Copenhagen...
Synthesis, Magnetization, and Electrical Transport Properties of Mn3Zn0.9Cu0.1N
Directory of Open Access Journals (Sweden)
Y. Yin
2013-01-01
Full Text Available We synthesized Mn3Zn0.9Cu0.1N by solid state reaction, and magnetic as well as electrical transport properties were investigated. It is found that Mn3Zn0.9Cu0.1N exhibits a first-order antiferromagnetism (AFM to paramagnetic (PM transition with the Néel temperature TN ~163 K, and substitution of Cu for Zn would favor ferromagnetism (FM state and weaken AFM ground state, leading to a convex curvature character of M(T curve. With high external fields 10 kOe–50 kOe, magnetic transition remains a robust AFM-PM feature while FM phase is completely suppressed. Thermal hysteresis of M(T under 500 Oe is also suppressed when the magnetic field exceeds 10 kOe. Mn3Zn0.9Cu0.1N exhibits a good metallic behavior except for a slope change around TN, which is closely related to AFM-PM magnetic transition. Compared with the first differential of resistivity with respect to temperature for (dρ/dTMn3ZnN in transition temperature range, the absolute value of (dρ/dTMn3Zn0.9Cu0.1N is much lower which is close to zero.
Diversity of the murine antibody response targeting influenza A(H1N1pdm09) hemagglutinin.
Wilson, Jason R; Tzeng, Wen-Pin; Spesock, April; Music, Nedzad; Guo, Zhu; Barrington, Robert; Stevens, James; Donis, Ruben O; Katz, Jacqueline M; York, Ian A
2014-06-01
We infected mice with the 2009 influenza A pandemic virus (H1N1pdm09), boosted with an inactivated vaccine, and cloned immunoglobulins (Igs) from HA-specific B cells. Based on the redundancy in germline gene utilization, we inferred that between 72-130 unique IgH VDJ and 35 different IgL VJ combinations comprised the anti-HA recall response. The IgH VH1 and IgL VK14 variable gene families were employed most frequently. A representative panel of antibodies were cloned and expressed to confirm reactivity with H1N1pdm09 HA. The majority of the recombinant antibodies were of high avidity and capable of inhibiting H1N1pdm09 hemagglutination. Three of these antibodies were subtype-specific cross-reactive, binding to the HA of A/South Carolina/1/1918(H1N1), and one further reacted with A/swine/Iowa/15/1930(H1N1). These results help to define the genetic diversity of the influenza anti-HA antibody repertoire profile induced following infection and vaccination, which may facilitate the development of influenza vaccines that are more protective and broadly neutralizing. Protection against influenza viruses is mediated mainly by antibodies, and in most cases this antibody response is narrow, only providing protection against closely related viruses. In spite of this limited range of protection, recent findings indicate that individuals immune to one influenza virus may contain antibodies (generally a minority of the overall response) that are more broadly reactive. These findings have raised the possibility that influenza vaccines could induce a more broadly protective response, reducing the need for frequent vaccine strain changes. However, interpretation of these observations is hampered by the lack of quantitative characterization of the antibody repertoire. In this study, we used single-cell cloning of influenza HA-specific B cells to assess the diversity and nature of the antibody response to influenza hemagglutinin in mice. Our findings help to put bounds on the
Directory of Open Access Journals (Sweden)
Antonio Piralla
Full Text Available Recent molecular diagnostic methods have significantly improved the diagnosis of viral pneumonia in intensive care units (ICUs. It has been observed that 222G/N changes in the HA gene of H1N1pdm09 are associated with increased lower respiratory tract (LRT replication and worse clinical outcome. In the present study, the frequency of respiratory viruses was assessed in respiratory samples from 88 patients admitted to 16 ICUs during the 2014-2015 winter-spring season in Lombardy. Sixty-nine out of 88 (78.4% patients were positive for a respiratory viral infection at admission. Of these, 57/69 (82.6% were positive for influenza A (41 A/H1N1pdm09 and 15 A/H3N2, 8/69 (11.6% for HRV, 2/69 (2.9% for RSV and 2/69 (2.9% for influenza B. Phylogenetic analysis of influenza A/H1N1pdm09 strains from 28/41 ICU-patients and 21 patients with mild respiratory syndrome not requiring hospitalization, showed the clear predominance of subgroup 6B strains. The median influenza A load in LRT samples of ICU patients was higher than that observed in the upper respiratory tract (URT (p<0.05. Overall, a greater number of H1N1pdm09 virus variants were observed using next generation sequencing on partial HA sequences (codons 180-286 in clinical samples from the LRT as compared to URT. In addition, 222G/N/A mutations were observed in 30% of LRT samples from ICU patients. Finally, intra-host evolution analysis showed the presence of different dynamics of viral population in LRT of patients hospitalized in ICU with a severe influenza infection.
Oxygen permeation in thin, dense Ce0.9Gd0.1O 1.95- membranes I. Model study
DEFF Research Database (Denmark)
Chatzichristodoulou, Christodoulos; Søgaard, Martin; Hendriksen, Peter Vang
2011-01-01
at the feed and permeate side of the membrane, related to the gaseous oxygen reduction and fuel oxidation, respectively, as well as the gas conversion and gas diffusion resistances in the porous support structure at the permeate side. The temperature and oxygen activity dependence of the oxide ionic...... was analyzed by a separation of the various losses. The chemical expansion of Ce 0.9Gd0.1O1.95-δ under operation was estimated from the calculated oxygen activity and nonstoichiometry profiles inside the membrane. © 2011 The Electrochemical Society.......A model of a supported planar Ce0.9Gd0.1O 1.95-δ oxygen membrane in a plug-flow setup was constructed and a sensitivity analysis of its performance under varying operating conditions and membrane parameters was performed. The model takes into account the driving force losses at the catalysts...
META-ANALYSIS OF THE RESEARCH OF IL-6 IN PERIPHERAL BLOOD OF PATIENTS WITH INFLUENZA A(H1N1pdm09
Directory of Open Access Journals (Sweden)
M. V. Shipilov
2017-01-01
Full Text Available Interleukin-6 (IL-6 is a potent proinflammatory cytokine, which level is increased in the peripheral blood in many infectious diseases, including the flu A(H1N1pdm09, in some cases (when the excess of his development of immune cells, resulting not only to strengthen the immune system, but also to the development of a “cytokine storm” is characterized by multi-organ failure and often followed by death. To reduce errors, increase the statistical power and increase the reliability of the results according to different researchers, as well as on the results of their own research was conducted a meta-analysis (a quantitative systematic review of IL-6 studies in peripheral blood of patients with influenza A(H1N1 pdm09. Question: to determine with a high level of confidence, whether IL-6, a marker of the severity and prognosis of the disease. Searches were carried out research work on this subject in a variety of electronic databases (Medline, EMBASE, the Cochrane Controlled Trials Register, and others, reviews, theses, magazines, conference proceedings, and others. In the process of carrying out a meta-analysis of 5 scientific papers were selected that meet the criteria for inclusion/noninclusion in the study (characteristic of scientific papers, diagnostic criteria, age of patients, comparable groups of patients, the presence of self-control, research methodology, statistical criterion and the total number of independent stu dies. Selected studies have shown sufficient uniformity (homogeneity comparison groups. The results of the meta-analysis are presented in tables, charts and blobogramme, meta-analysis of 5 scientific papers showed that in moderate and severe influenza A(H1N1pdm09 noted a significant increase in the concentration of IL-6 in peripheral blood of patients compared with the control a group of individuals (healthy. Severe influenza A(H1N1pdm09 with a high probability of death is characterized by an even greater
New genetic variants of influenza A(H1N1)pdm09 detected in Cuba during 2011-2013.
Arencibia, Amely; Acosta, Belsy; Muné, Mayra; Valdés, Odalys; Fernandez, Leandro; Medina, Isel; Savón, Clara; Oropesa, Suset; Gonzalez, Grehete; Roque, Rosmery; Gonzalez, Guelsys; Hernández, Bárbara; Goyenechea, Angel; Piñón, Alexander
2015-06-01
Influenza A(H1N1)pdm09 virus has evolved continually since its emergence in 2009. For influenza virus strains, genetic changes occurring in HA1 domain of the hemagglutinin cause the emergence of new variants. The aim of our study is to establish genetic associations between 35 A(H1N1)pdm09 viruses circulating in Cuba in 2011-2012 and 2012-2013 seasons, and A/California/07/2009 strain recommended by WHO as the H1N1 component of the influenza vaccine. The phylogenetic analysis revealed the circulation of clades 3, 6A, 6B, 6C and 7. Mutations were detected in the antigenic site or in the receptor-binding domains of HA1 segment, including S174P, S179N, K180Q, S202T, S220T and R222K. Substitutions S174P, S179N, K180Q and R222K were detected in Cuban strains for the first time. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Katia Corrêa de Oliveira Santos
Full Text Available ABSTRACT Compared to previous years, seasonal influenza activity commenced early in São Paulo State, Brazil, Southern hemisphere during the 2016 year. In order to investigate the genetic pattern of influenza A(H1N1pdm09 in the State of Sao Paulo a total of 479 respiratory samples, collected in January by Sentinel Surveillance Units, were screened by real-time RT-PCR. A total of 6 Influenza viruses A(H1N1pdm09 presenting ct values ≤ 30 were sequenced following phylogenetic analysis. The present study identified the circulation of the new 6B.1 subgroup (A/Sao Paulo/10-118/2016 and A/Sao Paulo/3032/2016. In addition, influenza A(H1N1pdm09 group 6B has also been identified during January in the State of Sao Paulo. Despite amino acid changes and changes in potential glycosylation motifs, 6B.1 viruses were well inhibited by the reference ferret antiserum against A/California/07/2009 virus, the A(H1N1pdm09 component of the vaccine for the 2016 influenza season.
Baumüller, E; Schaller, S J; Chiquito Lama, Y; Frick, C G; Bauhofer, T; Eikermann, M; Fink, H; Blobner, M
2015-05-01
A train-of-four ratio (TOFR) ≥0.9 measured by quantitative neuromuscular monitoring is accepted as an indication of sufficient neuromuscular recovery for extubation, even though many postsynaptic acetylcholine receptors may still be inhibited. We investigated whether antagonism with sugammadex after spontaneous recovery to TOFR≥0.9 further improves muscle function or subjective well-being. Following recovery to TOFR≥0.9 and emergence from anaesthesia, 300 patients randomly received either sugammadex 1.0 mg kg(-1) or placebo. Fine motor function (Purdue Pegboard Test) and maximal voluntary grip strength were measured before and after surgery (before and after test drug administration). At discharge from the postanaesthesia care unit, well-being was assessed with numerical analogue scales and the Quality-of-Recovery Score 40 (QoR-40). Patients' fine motor function [6 (sd 4) vs 15 (3) pegs (30 s)(-1), Psugammadex or placebo, motor function was significantly improved in both groups but did not reach the preoperative level. There was no difference between groups at any time. Global well-being was unaffected (QoR-40: placebo, 174 vs 185; sugammadex, 175 vs 186, P>0.05). Antagonizing rocuronium at TOF≥0.9 with sugammadex 1.0 mg kg(-) (1) did not improve patients' motor function or well-being when compared with placebo. Our data support the view that TOFR≥0.9 measured by electromyography signifies sufficient recovery of neuromuscular function. The trial is registered at ClinicalTrials.gov (NCT01101139). © The Author 2014. Published by Oxford University Press on behalf of the British Journal of Anaesthesia. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Household transmission of influenza A(H1N1pdm09 in the pandemic and post-pandemic seasons.
Directory of Open Access Journals (Sweden)
Itziar Casado
Full Text Available The transmission of influenza viruses occurs person to person and is facilitated by contacts within enclosed environments such as households. The aim of this study was to evaluate secondary attack rates and factors associated with household transmission of laboratory-confirmed influenza A(H1N1pdm09 in the pandemic and post-pandemic seasons.During the 2009-2010 and 2010-2011 influenza seasons, 76 sentinel physicians in Navarra, Spain, took nasopharyngeal and pharyngeal swabs from patients diagnosed with influenza-like illness. A trained nurse telephoned households of those patients who were laboratory-confirmed for influenza A(H1N1pdm09 to ask about the symptoms, risk factors and vaccination status of each household member.In the 405 households with a patient laboratory-confirmed for influenza A(H1N1pdm09, 977 susceptible contacts were identified; 16% of them (95% CI 14-19% presented influenza-like illness and were considered as secondary cases. The secondary attack rate was 14% in 2009-2010 and 19% in the 2010-2011 season (p=0.049, an increase that mainly affected persons with major chronic conditions. In the multivariate logistic regression analysis, the risk of being a secondary case was higher in the 2010-2011 season than in the 2009-2010 season (adjusted odds ratio: 1.72; 95% CI 1.17-2.54, and in children under 5 years, with a decreasing risk in older contacts. Influenza vaccination was associated with lesser incidence of influenza-like illness near to statistical significance (adjusted odds ratio: 0.29; 95% CI 0.08-1.03.The secondary attack rate in households was higher in the second season than in the first pandemic season. Children had a greater risk of infection. Preventive measures should be maintained in the second pandemic season, especially in high-risk persons.
Synthesis and electrical characterization of BaZr0.9Ho0.1O3-δ electrolyte ceramic for IT - SOFCs
Saini, Deepash S.; Singh, Lalit K.; Bhattacharya, D.
2018-04-01
A cost-effective modified combustion method using citric acid and glycine has recently been developed to synthesize high quality, and nanosized BaZr0.9Ho0.1O3 ceramic powder. BaZr0.9Ho0.1O3-δ ceramic powder was characterized by X-ray diffraction (XRD), high-resolution transmission electron microscopy (HRTEM) and field emission scanning electron microscopy (FESEM). XRD pattern of BaZr0.9Ho0.1O3-δ ceramic sintered at 1600 °C has shown that pure phase of BaZr0.9Ho0.1O3-δ with cubic Pm3¯m space group symmetry. The transmission electron microscopic investigation has shown that the particle size of the powder calcined at 1100 °C was in the range 30-80 nm. The FESEM image of sintered pellet at 1600 °C for 4 h reveals porous nature of BaZr0.9Ho0.1O3-δ with 83.7 relative density. Impedance analysis reveal three type relaxations in the temperature range 250 °C to 500 °C as studied at different frequencies over 100 Hz to 1 MHz in air. The grain boundary conductivity of BaZr0.9Ho0.1O3-δ ceramic is found lower then grain (bulk) conductivity due to core-space charge layer behavior in grain boundary.
Hirsnik, Erkki, 1982-
2010-01-01
Riigikohtu lahendist 3-1-1-104-09: Edelaraudtee Infrastruktuuri AS kaitsja vandeadvokaat Leonid Tolstovi kassatsioon Pärnu Maakohtu 4. juuni 2009. a kohtuotsuse peale Edelaraudtee Infrastruktuuri AS väärteoasjas looduskaitseseaduse § 71 lg 2 järgi
Lifescience Database Archive (English)
Full Text Available FC (Link to library) FC-AI09 (Link to dictyBase) - - - Contig-U16149-1 FC-AI09Z (Li...nk to Original site) - - FC-AI09Z 591 - - - - Show FC-AI09 Library FC (Link to library) Clone ID FC-AI09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AI/FC-AI09Q.Seq.d/ Representative seq. ID FC-AI...09Z (Link to Original site) Representative DNA sequence >FC-AI09 (FC-AI09Q) /CSM/FC/FC-AI/FC-AI09Q.Seq....*tkl ik*ilifykiknnkkkkkk Frame B: ---gt*kvpeflailfkrmasrsvlwy*rcltkakkglkapqtltik
Electronic structure of Rh-based CuRh0.9Mg0.1O2 oxide thermoelectrics
Vilmercati, P.; Martin, E.; Cheney, C. Parks; Bondino, F.; Magnano, E.; Parmigiani, F.; Sasagawa, T.; Mannella, N.
2013-03-01
The electronic structure of the Rh-based CuRh0.9Mg0.1O2 oxide thermoelectric compound has been studied with a multitechnique approach consisting of photoemission, x-ray absorption, and x-ray emission spectroscopies. The data indicate that the region of the valence band in the proximity of the Fermi level is dominated by Rh-derived states. These findings outline the importance of the electronic structure of the Rh ions for the large thermoelectric power in CuRh0.9Mg0.1O2 at high temperature.
DEFF Research Database (Denmark)
Davey, Richard T; Lynfield, Ruth; Dwyer, Dominic E
2013-01-01
Prospective studies establishing the temporal relationship between the degree of inflammation and human influenza disease progression are scarce. To assess predictors of disease progression among patients with influenza A(H1N1)pdm09 infection, 25 inflammatory biomarkers measured at enrollment wer...
Directory of Open Access Journals (Sweden)
Dudek Magdalena
2016-03-01
Full Text Available In this paper, the impact of partial substitution of calcium for barium in (Ba1-xCax (M0.9Y0.1 O3, M = Ce, Zr on physicochemical properties of the powders and sintered samples was investigated. The powders, with various contents of calcium (x = 0, 0.02, 0.05, 0.1, were prepared by means of thermal decomposition of organometallic precursors containing EDTA. All of the BaCeO3-based powders synthesised at 1100 °C were monophasic with a rhombohedral structure, however, completely cubic BaZrO3-based solid solutions were obtained at 1200 °C. A study of the sinterability of BaZr0.9Y0.1O3 and BaCe0.9Y0.1O3-based pellets was performed under non-isothermal conditions within a temperature range of 25 to 1200 °C. The partial substitution of barium for calcium in the (Ba1-xCax (M0.9Y0.1 O3, M = Ce, Zr solid solution improved the sinterability of the samples in comparison to the initial BaCe0.9Y0.1O3 or BaZr0.9Y0.1O3. The relative density of calcium-modified BaCe0.9Y0.1O3-based samples reached approximately 95 to 97 % after sintering at 1500 °C for 2 h in air. The same level of relative density was achieved after sintering calcium-modified BaZr0.9Y0.1O3 at 1600 °C for 2 h. Analysis of the electrical conductivity from both series of investigated materials showed that the highest ionic conductivity, in air and wet 5 % H2 in Ar, was attained for the compositions of x = 0.02 to 0.05 (Ba1-xCax(M0.9Y0.1O3, M = Zr, Ce. The oxygen reduction reaction on the interface Pt│BaM0.9Y0.1O3, M = Ce, Zr was investigated using Pt microelectrodes. Selected samples of (Ba1-xCax (M0.9Y0.1O3, M = Zr, Ce were tested as ceramic electrolytes in hydrogen-oxygen solid oxide fuel cells operating at temperatures of 700 to 850 °C.
Lifescience Database Archive (English)
Full Text Available FC (Link to library) FC-BS09 (Link to dictyBase) - - - Contig-U16215-1 FC-BS09Z (Li...nk to Original site) - - FC-BS09Z 626 - - - - Show FC-BS09 Library FC (Link to library) Clone ID FC-BS09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS09Q.Seq.d/ Representative seq. ID FC-BS...09Z (Link to Original site) Representative DNA sequence >FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS09Q.Seq....ignments: (bits) Value SSF360 (SSF360Q) /CSM/SS/SSF3-C/SSF360Q.Seq.d/ 854 0.0 FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS
DEFF Research Database (Denmark)
Gil Cuesta, Julita; Aavitsland, Preben; Englund, Hélène
2016-01-01
During the 2009/10 influenza A(H1N1)pdm09 pandemic, the five Nordic countries adopted different approaches to pandemic vaccination. We compared pandemic vaccination strategies and severe influenza outcomes, in seasons 2009/10 and 2010/11 in these countries with similar influenza surveillance...... systems. We calculated the cumulative pandemic vaccination coverage in 2009/10 and cumulative incidence rates of laboratory confirmed A(H1N1)pdm09 infections, intensive care unit (ICU) admissions and deaths in 2009/10 and 2010/11. We estimated incidence risk ratios (IRR) in a Poisson regression model...... with the other countries. In 2010/11 Denmark had a significantly higher cumulative incidence of A(H1N1)pdm09 ICU admissions (IRR: 2.4; 95% confidence interval (CI): 1.9-3.0) and deaths (IRR: 8.3; 95% CI: 5.1-13.5). Compared with Denmark, the other countries had higher pandemic vaccination coverage...
International Nuclear Information System (INIS)
Ross, S.B.; Oegren, S.-O.; Renyi, A.L.
1976-01-01
The inhibition of the uptake of 3 H-(-)-noradrenaline (NA), 3 H-dopamine and 14 C-5-hydroxytryptamine (5-HT) in mouse brain slices by (Z)-3-dimethylamino-1-(4-bromophenyl)-1-(3-pyridyl)propene(H 102/09), desipramine and chlorimipramine and their releasing effect on the 3 H-amines previously accumulated in the slices were examined. The interactions with reserpine produced hypothermia and sedation and the 5-hydroxytryptophan (5-HTP) syndrome in mice were also studied. Due to the poor inhibitory activity on the NA uptake H 102/09 was a more selective inhii.or of the 5-HT uptake than was chlorimipramine, particularly after administration in vivo, where it was as potent as chlorimipramine (ED50=19μmol/kg intraperitoneally). In vitro chlorimipramine was 6 to 12 times more active than H 102/09. Desipramine was a very selective inhibitor of the NA uptake in vitro and in vivo. The compounds were generally more potent in inhibiting the uptake than in releasing the amines. However, in striatal slices the inhibition of DA uptake could be due to the releasing effect since the difference in potencies were small. The effect of desipramine on 5-HT uptake and that of H102/09 on NA uptake could also involve a release component. The 5-HTP syndrome was potentiated by H 102/09 and chlorimipramine but not by desipramine. The reserpine hypothermia but not the sedation was potently antagonized and reversed by desipramine and by chlorimipramine at high doses but not by H 102/09, suggested that NA but not 5-HT is involved in the hypothermic action of reserpine. (author)
Molecular diagnosis of microbial copathogens with influenza A(H1N1pdm09 in Oaxaca, Mexico
Directory of Open Access Journals (Sweden)
Ramírez-Palacios LR
2018-04-01
Full Text Available Luis Román Ramírez-Palacios,1 Diana Reséndez-Pérez,2 Maria Cristina Rodríguez-Padilla,2 Santiago Saavedra-Alonso,2 Olga Real-Najarro,3 Nadia A Fernández-Santos,4 Mario A Rodriguez Perez4 1Laboratorio Estatal de Salud Pública de Oaxaca, Oaxaca, 2Departamento de Inmunología y Virología, Facultad de Ciencias Biológicas, Universidad Autónoma de Nuevo León, San Nicolás de los Garza, Mexico; 3Consejería de Educación, Madrid, Spain; 4Instituto Politécnico Nacional (IPN, Centro de Biotecnología Genómica, Reynosa, Mexico Background: Multiple factors have been associated with the severity of infection by influenza A(H1N1pdm09. These include H1N1 cases with proven coinfections showing clinical association with bacterial contagions. Purpose: The objective was to identify H1N1 and copathogens in the Oaxaca (Mexico population. A cross-sectional survey was conducted from 2009 to 2012. A total of 88 study patients with confirmed H1N1 by quantitative RT-PCR were recruited. Methods: Total nucleic acid from clinical samples of study patients was analyzed using a TessArray RPM-Flu microarray assay to identify other respiratory pathogens. Results: High prevalence of copathogens (77.3%; 68 patients harbored one to three pathogens, predominantly from Streptococcus, Haemophilus, Neisseria, and Pseudomonas, were detected. Three patients (3.4% had four or five respiratory copathogens, whereas others (19.3% had no copathogens. Copathogenic occurrence with Staphylococcus aureus was 5.7%, Coxsackie virus 2.3%, Moraxella catarrhalis 1.1%, Klebsiella pneumoniae 1.1%, and parainfluenza virus 3 1.1%. The number of patients with copathogens was four times higher to those with H1N1 alone (80.68% and 19.32%, respectively. Four individuals (4.5%; two males, one female, and one infant who died due to H1N1 were observed to have harbored such copathogens as Streptococcus, Staphylococcus, Haemophilus, and Neisseria. Conclusion: In summary, copathogens were found in a
DEFF Research Database (Denmark)
Yue, Zhao; Grivel, Jean-Claude; Abrahamsen, Asger Bech
2011-01-01
An optimized buffer layer architecture prepared by a metal organic deposition method on biaxially textured metallic substrate is proposed and developed successfully. The major achievement of this work is to choose a ${\\rm Ce}_{0.9}{\\rm La}_{0.1}{\\rm O}_{2}$ layer as cap layer that possesses an ex...
Baggett, Henry C.; Chittaganpitch, Malinee; Thamthitiwat, Somsak; Prapasiri, Prabda; Naorat, Sathapana; Sawatwong, Pongpun; Ditsungnoen, Darunee; Olsen, Sonja J.; Simmerman, James M.; Srisaengchai, Prasong; Chantra, Somrak; Peruski, Leonard F.; Sawanpanyalert, Pathom; Maloney, Susan A.; Akarasewi, Pasakorn
2012-01-01
Background Data on the burden of the 2009 influenza pandemic in Asia are limited. Influenza A(H1N1)pdm09 was first reported in Thailand in May 2009. We assessed incidence and epidemiology of influenza-associated hospitalizations during 2009–2010. Methods We conducted active, population-based surveillance for hospitalized cases of acute lower respiratory infection (ALRI) in all 20 hospitals in two rural provinces. ALRI patients were sampled 1∶2 for participation in an etiology study in which nasopharyngeal swabs were collected for influenza virus testing by PCR. Results Of 7,207 patients tested, 902 (12.5%) were influenza-positive, including 190 (7.8%) of 2,436 children aged incidence of hospitalized influenza cases was 136 per 100,000, highest in ages 75 years (407 per 100,000). The incidence of influenza A(H1N1)pdm09 was 62 per 100,000 (214 per 100,000 in children <5 years). Eleven influenza-infected patients required mechanical ventilation, and four patients died, all adults with influenza A(H1N1)pdm09 (1) or H3N2 (3). Conclusions Influenza-associated hospitalization rates in Thailand during 2009–10 were substantial and exceeded rates described in western countries. Influenza A(H1N1)pdm09 predominated, but H3N2 also caused notable morbidity. Expanded influenza vaccination coverage could have considerable public health impact, especially in young children. PMID:23139802
Spatio-temporal Change Patterns of Tropical Forests from 2000 to 2014 Using MOD09A1 Dataset
Qin, Y.; Xiao, X.; Dong, J.
2016-12-01
Large-scale deforestation and forest degradation in the tropical region have resulted in extensive carbon emissions and biodiversity loss. However, restricted by the availability of good-quality observations, large uncertainty exists in mapping the spatial distribution of forests and their spatio-temporal changes. In this study, we proposed a pixel- and phenology-based algorithm to identify and map annual tropical forests from 2000 to 2014, using the 8-day, 500-m MOD09A1 (v005) product, under the support of Google cloud computing (Google Earth Engine). A temporal filter was applied to reduce the random noises and to identify the spatio-temporal changes of forests. We then built up a confusion matrix and assessed the accuracy of the annual forest maps based on the ground reference interpreted from high spatial resolution images in Google Earth. The resultant forest maps showed the consistent forest/non-forest, forest loss, and forest gain in the pan-tropical zone during 2000 - 2014. The proposed algorithm showed the potential for tropical forest mapping and the resultant forest maps are important for the estimation of carbon emission and biodiversity loss.
Directory of Open Access Journals (Sweden)
Radheshyam Rai
2014-04-01
Full Text Available The multiferroic Bi0.8Gd0.1M0.1Fe0.9Ti0.1O3, (where M = Ba (DB, La (DL and Pb (DP has been synthesized by using solid-state reaction technique. Effects of Ba, La and Pb substitution on the structure, electrical and ferroelectric properties of Bi0.8Gd0.1M0.1Fe0.9Ti0.1O3 samples have been studied by performing X-ray diffraction, dielectric and magnetic measurements. The crystal structures of the ceramic samples have a tetragonal phase. The vibrating sample magnetometer (VSM measurement shows a significant change in the magnetic properties of Ba-doped Bi0.8Gd0.1M0.1Fe0.9Ti0.1O3 as compared to La- and Pb-doped ceramics. It is seen that coercive field (HC and remanent magnetization (MR increases with Ba-doped ceramics but decreases for La- and Pb-doped ceramics.
78 FR 28619 - Proposed Information Collection; Fish and Wildlife Service Conservation Banking Survey
2013-05-15
...-FF09E31000] Proposed Information Collection; Fish and Wildlife Service Conservation Banking Survey AGENCY... banking credits. The surveys will benefit the Service by helping to identify constraints in the current... Number: 1018-XXXX. This is a new collection. Title: Fish and Wildlife Service Conservation Banking Survey...
Magnetocaloric response of La 0.70 Ca 0.1 Sr 0.2 Fe 0.1 Mn 0.9 O 3 ...
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science; Volume 38; Issue 1. Magnetocaloric response of La0.70Ca0.1Sr0.2Fe0.1Mn0.9O3 pervoskite for magnetic refrigeration. M S Anwar Faheem Ahmed Bon Heun Koo. Volume 38 Issue 1 February 2015 pp 101-104 ...
Gachara, George; Symekher, Samuel; Otieno, Michael; Magana, Japheth; Opot, Benjamin; Bulimo, Wallace
2016-06-01
An influenza pandemic caused by a novel influenza virus A(H1N1)pdm09 spread worldwide in 2009 and is estimated to have caused between 151,700 and 575,400 deaths globally. While whole genome data on new virus enables a deeper insight in the pathogenesis, epidemiology, and drug sensitivities of the circulating viruses, there are relatively limited complete genetic sequences available for this virus from African countries. We describe herein the full genome analysis of influenza A(H1N1)pdm09 viruses isolated in Kenya between June 2009 and August 2010. A total of 40 influenza A(H1N1)pdm09 viruses isolated during the pandemic were selected. The segments from each isolate were amplified and directly sequenced. The resulting sequences of individual gene segments were concatenated and used for subsequent analysis. These were used to infer phylogenetic relationships and also to reconstruct the time of most recent ancestor, time of introduction into the country, rates of substitution and to estimate a time-resolved phylogeny. The Kenyan complete genome sequences clustered with globally distributed clade 2 and clade 7 sequences but local clade 2 viruses did not circulate beyond the introductory foci while clade 7 viruses disseminated country wide. The time of the most recent common ancestor was estimated between April and June 2009, and distinct clusters circulated during the pandemic. The complete genome had an estimated rate of nucleotide substitution of 4.9×10(-3) substitutions/site/year and greater diversity in surface expressed proteins was observed. We show that two clades of influenza A(H1N1)pdm09 virus were introduced into Kenya from the UK and the pandemic was sustained as a result of importations. Several closely related but distinct clusters co-circulated locally during the peak pandemic phase but only one cluster dominated in the late phase of the pandemic suggesting that it possessed greater adaptability. Copyright © 2016 Elsevier B.V. All rights reserved.
Doping effects on the relaxation of frustration and magnetic properties of YMn0.9Cu0.1O3
Xiao, L. X.; Xia, Z. C.; Wang, X.; Ni, Y.; Yu, W.; Shi, L. R.; Jin, Z.; Xiao, G. L.
2017-12-01
The crystal structure and magnetic properties of hexagonal YMn0.9Cu0.1O3 single crystal are systematically investigated. The refinement results of XRD show the lattice constant decreases, which is unusually due to the doped Cu2+ ion has a larger ionic radius than the Mn3+ ions. The XPS results show that the coexistence of Mn2+, Mn3+ and Mn4+ ions in YMn0.9Cu0.1O3 single crystal. Magnetization measurements show that Cu doped YMn0.9Cu0.1O3 and parent YMnO3 have almost the same antiferromagnetic transition temperature TN, which indicates the AFM interaction is robust in the geometry frustrated system. Because doping directly destroy some of the Mn3+ ions nets, the relaxation of frustration of Mn in-plane 2D triangular geometry network leads to the significantly decrease of Mn3+ ions AFM interaction. In addition, the coexistence and competition between the ferromagnetic and antiferromagnetic interactions among the Mn2+, Mn3+ and Mn4+ ions lead to a complicated and irreversible magnetization behavior in YMn0.9Cu0.1O3 single crystal.
Molecular epidemiology of influenza A(H1N1pdm09 viruses from Pakistan in 2009-2010.
Directory of Open Access Journals (Sweden)
Uzma Bashir Aamir
Full Text Available In early 2009, a novel influenza A(H1N1 virus that emerged in Mexico and United States rapidly disseminated worldwide. The spread of this virus caused considerable morbidity with over 18000 recorded deaths. The new virus was found to be a reassortant containing gene segments from human, avian and swine influenza viruses.The first case of human infection with A(H1N1pdm09 in Pakistan was detected on 18(th June 2009. Since then, 262 laboratory-confirmed cases have been detected during various outbreaks with 29 deaths (as of 31(st August 2010. The peak of the epidemic was observed in December with over 51% of total respiratory cases positive for influenza. Representative isolates from Pakistan viruses were sequenced and analyzed antigenically. Sequence analysis of genes coding for surface glycoproteins HA and NA showed high degree of high levels of sequence identity with corresponding genes of regional viruses circulating South East Asia. All tested viruses were sensitive to Oseltamivir in the Neuraminidase Inhibition assays.Influenza A(H1N1pdm09 viruses from Pakistan form a homogenous group of viruses. Their HA genes belong to clade 7 and show antigenic profile similar to the vaccine strain A/California/07/2009. These isolates do not show any amino acid changes indicative of high pathogenicity and virulence. It is imperative to continue monitoring of these viruses for identification of potential variants of high virulence or drug resistance.
Ling, Yihan; Xie, Huixin; Liu, Zijing; Du, Xiaoni; Chen, Hui; Ou, Xuemei; Zhao, Ling; Budiman, Riyan Achmad
2018-03-01
For the sake of improving the electrochemical activity and chromium tolerance of the K2NiF4-type oxide, La2NiO4+δ (LNO), with nonnucleation agents like Mn and Sr elements, the electrochemical performance and degradation were comparatively studied at two cathodes La2Ni0.9Fe0.1O4+δ (LNF) and LNF-40wt%Gd0.1Ce0.9O1.95 (LNF-GDC) on the GDC electrolyte, where 5wt%Cr2O3 incorporation provides Cr-containing atmosphere. Compared with non-doped LNO, LNF shows a higher interstitial oxygen concentration (δ = 0.298) and a lower electrical conductivity, where bivalent Ni ion, {Ni}_{Ni}^{ × } , and trivalent Ni ion, {Ni}_{Ni}^{ \\cdot } , and trivalent Fe ion on Ni-site, {Fe}_{Ni}^{ \\cdot } , were observed from the XPS measurements. LNF-GDC shows greatly reduced interfacial polarization resistances (Rp), which are only half of those of LNF, indicating a better electrochemical performance. More importantly, no significant degradation of LNF-GDC in performance has been observed under exposure of Cr-containing atmosphere at 700 °C for 350 h, while Rp of LNF increased by nearly 20%, suggesting LNF by GDC incorporation can enhance the electrochemical performance as well as chromium tolerance for intermediate temperature solid oxide fuel cells (IT-SOFCs).
Riigikohtu kriminaalkolleegiumi 24. aprilli 2009. a otsus kriminaalasjas 3-1-1-10-09 / Margus Mõttus
Mõttus, Margus
2009-01-01
Riigikohtu otsusest 3-1-1-10-09: Livio Karro kaitsjate A. Pilve ja R. Otsa, Margus Nei kaitsja T. Pilve, Vladimir Kudrjavtsevi kaitsja A. Lubergi, M. Loorpuu kaitsja T. Ploomipuu, R. Väinoja kaitsja H. Tombergi ja K. Kaunispaiga kaitsja A. Gorkini kassatsioonid kriminaalasjas L. Karro süüdistuses KarS § 294 lg 2 p-de 1 ja 3; § 294 lg 2 p-de 1 ja 3 ja § 22 lg 2 ning § 296 lg 2 p-de 1 ja 2 järgi, M. Nei ja V. Kudrjavtsevi süüdistuses KarS § 294 lg 2 p 3 järgi, R. Väinoja süüdistuses KarS § 298 lg 1 järgi ja K. Kaunispaiga süüdistuses KarS § 298 lg 1 ja § 22 lg 2 järgi
Kobayashi, Miho; Takayama, Ikuyo; Kageyama, Tsutomu; Tsukagoshi, Hiroyuki; Saitoh, Mika; Ishioka, Taisei; Yokota, Yoko; Kimura, Hirokazu; Tashiro, Masato; Kozawa, Kunihisa
2013-12-01
We isolated a novel influenza virus A(H1N2) strain from a pig on January 13, 2012, in Gunma Prefecture, Japan. Phylogenetic analysis showed that the strain was a novel type of double-reassortant virus derived from the swine influenza virus strains H1N1pdm09 and H1N2, which were prevalent in Gunma at that time.
Clark, Josh
2009-01-01
With iWork '09: The Missing Manual, you'll quickly learn everything you need to know about Apple's incredible productivity programs, including the Pages word-processor, the Numbers spreadsheet, and the Keynote presentation program that Al Gore and Steve Jobs made famous. This book gives you crystal-clear and jargon-free explanations of iWork's capabilities, advantages, and limitations to help you produce stunning documents and cinema-quality digital presentations in no time.
Farrell, Margaret; Sebeny, Peter; Klena, John D; Demattos, Cecilia; Pimentel, Guillermo; Turner, Mark; Joseph, Antony; Espiritu, Jennifer; Zumwalt, John; Dueger, Erica
2013-01-01
At the onset of an influenza pandemic, when the severity of a novel strain is still undetermined and there is a threat of introduction into a new environment, e.g., via the deployment of military troops, sensitive screening criteria and conservative isolation practices are generally recommended. In response to elevated rates of influenza-like illness among U.S. military base camps in Kuwait, U.S. Naval Medical Research Unit No. 3 partnered with local U.S. Army medical units to conduct an A(H1N1) pdm09 outbreak investigation. Initial clinical data and nasal specimens were collected via the existent passive surveillance system and active surveillance was conducted using a modified version of the World Health Organization/U.S. Centers for Disease Control and Prevention influenza-like illness case definition [fever (T > 100.5˚F/38˚C) in addition to cough and/or sore throat in the previous 72 hours] as the screening criteria. Samples were tested via real-time reverse-transcription PCR and sequenced for comparison to global A(H1N1) pdm09 viruses from the same time period. The screening criteria used in Kuwait proved insensitive, capturing only 16% of A(H1N1) pdm09-positive individuals. While still not ideal, using cough as the sole screening criteria would have increased sensitivity to 73%. The results of and lessons learned from this outbreak investigation suggest that pandemic influenza risk management should be a dynamic process (as information becomes available regarding true attack rates and associated mortality, screening and isolation criteria should be re-evaluated and revised as appropriate), and that military operational environments present unique challenges to influenza surveillance.
Clinical and Immune Responses to Inactivated Influenza A(H1N1)pdm09 Vaccine in Children
Kotloff, Karen L.; Halasa, Natasha B.; Harrison, Christopher J.; Englund, Janet A.; Walter, Emmanuel B.; King, James C.; Creech, C. Buddy; Healy, Sara A.; Dolor, Rowena J.; Stephens, Ina; Edwards, Kathryn M.; Noah, Diana L.; Hill, Heather; Wolff, Mark
2014-01-01
Background As the influenza AH1N1 pandemic emerged in 2009, children were found to experience high morbidity and mortality and were prioritized for vaccination. This multicenter, randomized, double-blind, age-stratified trial assessed the safety and immunogenicity of inactivated influenza A(H1N1)pdm09 vaccine in healthy children aged 6 months to 17 years. Methods Children received two doses of approximately 15 μg or 30 μg hemagglutin antigen 21 days apart. Reactogenicity was assessed for 8 days after each dose, adverse events through day 42, and serious adverse events or new-onset chronic illnesses through day 201. Serum hemagglutination inhibition (HAI) titers were measured on days 0 (pre-vaccination), 8, 21, 29, and 42. Results A total of 583 children received the first dose and 571 received the second dose of vaccine. Vaccinations were generally well-tolerated and no related serious adverse events were observed. The 15 μg dosage elicited a seroprotective HAI (≥1:40) in 20%, 47%, and 93% of children in the 6-35 month, 3-9 year, and 10-17 year age strata 21 days after dose 1 and in 78%, 82%, and 98% of children 21 days after dose 2, respectively. The 30 μg vaccine dosage induced similar responses. Conclusions The inactivated influenza A(H1N1)pdm09 vaccine exhibited a favorable safety profile at both dosage levels. While a single 15 or 30 μg dose induced seroprotective antibody responses in most 10-17 year olds, younger children required 2 doses, even when receiving dosages 4-6 fold higher than recommended. Well-tolerated vaccines are needed that induce immunity after a single dose for use in young children during influenza pandemics. PMID:25222307
Directory of Open Access Journals (Sweden)
David La
Full Text Available BACKGROUND: Infection by the pandemic influenza A (H1N1/09 virus resulted in significant pathology among specific ethnic groups worldwide. Natural Killer (NK cells are important in early innate immune responses to viral infections. Activation of NK cells, in part, depend on killer-cell immunoglobulin-like receptors (KIR and HLA class I ligand interactions. To study factors involved in NK cell dysfunction in overactive immune responses to H1N1 infection, KIR3DL1/S1 and KIR2DL2/L3 allotypes and cognate HLA ligands of H1N1/09 intensive-care unit (ICU patients were determined. METHODOLOGY AND FINDINGS: KIR3DL1/S1, KIR2DL2/L3, and HLA -B and -C of 51 H1N1/09 ICU patients and 105 H1N1-negative subjects (St. Theresa Point, Manitoba were characterized. We detected an increase of 3DL1 ligand-negative pairs (3DL1/S1(+ Bw6(+ Bw4(-, and a lack of 2DL1 HLA-C2 ligands, among ICU patients. They were also significantly enriched for 2DL2/L3 ligand-positive pairs (PVA, P=0.024, Pc=0.047; Odds Ratio:2.563, CI95%:1.109-5.923, 3DL1*00101 (Ab>VA, PSTh, P=0.034, Pc=0.268, and 3DL1*029 (Ab>STh, P=0.039, Pc=0.301. Aboriginal patients ligand-positive for 3DL1/S1 and 2DL1 had the lowest probabilities of death (R(d (R(d=28%, compared to patients that were 3DL1/S1 ligand-negative (R(d=52% or carried 3DL1*029 (R(d=52%. Relative to Caucasoids (CA, two allotypes were enriched among non-aboriginal ICU patients (NAb: 3DL1*00401 (NAb>CA, P<0.001, Pc<0.001 and 3DL1*01502 (CA
Petersen, Henning; Mostafa, Ahmed; Tantawy, Mohamed A.; Iqbal, Azeem A.; Hoffmann, Donata; Tallam, Aravind; Selvakumar, Balachandar; Pessler, Frank; Beer, Martin; Rautenschlein, Silke; Pleschka, Stephan
2018-01-01
The 2009 pandemic influenza A virus (IAV) H1N1 strain (H1N1pdm09) has widely spread and is circulating in humans and swine together with other human and avian IAVs. This fact raises the concern that reassortment between H1N1pdm09 and co-circulating viruses might lead to an increase of H1N1pdm09 pathogenicity in different susceptible host species. Herein, we explored the potential of different NS segments to enhance the replication dynamics, pathogenicity and host range of H1N1pdm09 strain A/Giessen/06/09 (Gi-wt). The NS segments were derived from (i) human H1N1- and H3N2 IAVs, (ii) highly pathogenic- (H5- or H7-subtypes) or (iii) low pathogenic avian influenza viruses (H7- or H9-subtypes). A significant increase of growth kinetics in A549 (human lung epithelia) and NPTr (porcine tracheal epithelia) cells was only noticed in vitro for the reassortant Gi-NS-PR8 carrying the NS segment of the 1918-descendent A/Puerto Rico/8/34 (PR8-wt, H1N1), whereas all other reassortants showed either reduced or comparable replication efficiencies. Analysis using ex vivo tracheal organ cultures of turkeys (TOC-Tu), a species susceptible to IAV H1N1 infection, demonstrated increased replication of Gi-NS-PR8 compared to Gi-wt. Also, Gi-NS-PR8 induced a markedly higher expression of immunoregulatory and pro-inflammatory cytokines, chemokines and interferon-stimulated genes in A549 cells, THP-1-derived macrophages (dHTP) and TOC-Tu. In vivo, Gi-NS-PR8 induced an earlier onset of mortality than Gi-wt in mice, whereas, 6-week-old chickens were found to be resistant to both viruses. These data suggest that the specific characteristics of the PR8 NS segments can impact on replication, virus induced cellular immune responses and pathogenicity of the H1N1pdm09 in different avian and mammalian host species. PMID:29623073
Scherließ, Regina; Ajmera, Ankur; Dennis, Mike; Carroll, Miles W; Altrichter, Jens; Silman, Nigel J; Scholz, Martin; Kemter, Kristina; Marriott, Anthony C
2014-04-17
Currently, the need for cooled storage and the impossibility of terminal sterilisation are major drawbacks in vaccine manufacturing and distribution. To overcome current restrictions a preclinical safety and efficacy study was conducted to evaluate new influenza A vaccine formulations regarding thermal resistance, resistance against irradiation-mediated damage and storage stability. We evaluated the efficacy of novel antigen stabilizing and protecting solutions (SPS) to protect influenza A(H1N1)pdm09 split virus antigen under experimental conditions in vitro and in vivo. Original or SPS re-buffered vaccine (Pandemrix) was spray-dried and terminally sterilised by irradiation with 25 kGy (e-beam). Antigen integrity was monitored by SDS-PAGE, dynamic light scattering, size exclusion chromatography and functional haemagglutination assays. In vitro screening experiments revealed a number of highly stable compositions containing glycyrrhizinic acid (GA) and/or chitosan. The most stable composition was selected for storage tests and in vivo assessment of seroconversion in non-human primates (Macaca fascicularis) using a prime-boost strategy. Redispersed formulations with original adjuvant were administered intramuscularly. Storage data revealed high stability of protected vaccines at 4°C and 25°C, 60% relative humidity, for at least three months. Animals receiving original Pandemrix exhibited expected levels of seroconversion after 21 days (prime) and 48 days (boost) as assessed by haemagglutination inhibition and microneutralisation assays. Animals vaccinated with spray-dried and irradiated Pandemrix failed to exhibit seroconversion after 21 days whereas spray-dried and irradiated, SPS-protected vaccines elicited similar seroconversion levels to those vaccinated with original Pandemrix. Boost immunisation with SPS-protected vaccine resulted in a strong increase in seroconversion but had only minor effects in animals treated with non SPS-protected vaccine. In conclusion
Directory of Open Access Journals (Sweden)
Gayle P Dolan
Full Text Available The Influenza Clinical Information Network (FLU-CIN was established to gather detailed clinical and epidemiological information about patients with laboratory confirmed A(H1N1pdm09 infection in UK hospitals. This report focuses on the clinical course and outcomes of infection in pregnancy.A standardised data extraction form was used to obtain detailed clinical information from hospital case notes and electronic records, for patients with PCR-confirmed A(H1N1pdm09 infection admitted to 13 sentinel hospitals in five clinical 'hubs' and a further 62 non-sentinel hospitals, between 11th May 2009 and 31st January 2010.Outcomes were compared for pregnant and non-pregnant women aged 15-44 years, using univariate and multivariable techniques.Of the 395 women aged 15-44 years, 82 (21% were pregnant; 73 (89% in the second or third trimester. Pregnant women were significantly less likely to exhibit severe respiratory distress at initial assessment (OR = 0.49 (95% CI: 0.30-0.82, require supplemental oxygen on admission (OR = 0.40 (95% CI: 0.20-0.80, or have underlying co-morbidities (p-trend <0.001. However, they were equally likely to be admitted to high dependency (Level 2 or intensive care (Level 3 and/or to die, after adjustment for potential confounders (adj. OR = 0.93 (95% CI: 0.46-1.92. Of 11 pregnant women needing Level 2/3 care, 10 required mechanical ventilation and three died.Since the expected prevalence of pregnancy in the source population was 6%, our data suggest that pregnancy greatly increased the likelihood of hospital admission with A(H1N1pdm09. Pregnant women were less likely than non-pregnant women to have respiratory distress on admission, but severe outcomes were equally likely in both groups.
Soo, Anneli, 1984-
2010-01-01
Riigikohtu otsusest asjas 3-1-1-57-09: N. Kohtovi kaitsja vandeadvokaat Tarmo Pilve kassatsioon Tartu Ringkonnakohtu 18. veebruari 2009. a kohtuotsuse peale kriminaalasi N. Kohtovi süüdistuses KarS § 256 lg 1, § 120 ja § 121 järgi
DEFF Research Database (Denmark)
He, Zeming; Yuan, Hao; Glasscock, Julie
2010-01-01
The present work investigates the processes of densification and grain growth of Ce0.9Gd0.1O1.95-δ (CGO10) during sintering in reducing atmosphere. Sintering variables were experimentally characterized and analyzed using defect chemistry and sintering constitutive laws. Based on the achieved...
Directory of Open Access Journals (Sweden)
Danuta M Skowronski
2010-04-01
Full Text Available In late spring 2009, concern was raised in Canada that prior vaccination with the 2008-09 trivalent inactivated influenza vaccine (TIV was associated with increased risk of pandemic influenza A (H1N1 (pH1N1 illness. Several epidemiologic investigations were conducted through the summer to assess this putative association.(1 test-negative case-control design based on Canada's sentinel vaccine effectiveness monitoring system in British Columbia, Alberta, Ontario, and Quebec; (2 conventional case-control design using population controls in Quebec; (3 test-negative case-control design in Ontario; and (4 prospective household transmission (cohort study in Quebec. Logistic regression was used to estimate odds ratios for TIV effect on community- or hospital-based laboratory-confirmed seasonal or pH1N1 influenza cases compared to controls with restriction, stratification, and adjustment for covariates including combinations of age, sex, comorbidity, timeliness of medical visit, prior physician visits, and/or health care worker (HCW status. For the prospective study risk ratios were computed. Based on the sentinel study of 672 cases and 857 controls, 2008-09 TIV was associated with statistically significant protection against seasonal influenza (odds ratio 0.44, 95% CI 0.33-0.59. In contrast, estimates from the sentinel and three other observational studies, involving a total of 1,226 laboratory-confirmed pH1N1 cases and 1,505 controls, indicated that prior receipt of 2008-09 TIV was associated with increased risk of medically attended pH1N1 illness during the spring-summer 2009, with estimated risk or odds ratios ranging from 1.4 to 2.5. Risk of pH1N1 hospitalization was not further increased among vaccinated people when comparing hospitalized to community cases.Prior receipt of 2008-09 TIV was associated with increased risk of medically attended pH1N1 illness during the spring-summer 2009 in Canada. The occurrence of bias (selection, information or
Areva: 1. quarter 2015 revenue down, at euros 1.762 bn: -1.1% vs. March 2014 (-0.9% like for like)
International Nuclear Information System (INIS)
Repaire, Philippine du
2015-01-01
In the 1. quarter of 2015, AREVA generated consolidated revenue of 1.762 billion euros, representing a decrease of 1.1% (-0.9% like for like) compared with the same period in 2014. Foreign exchange had a positive impact of 36 million euros over the period, while consolidation scope had a negative impact of 39 million euros. At March 31, 2015, the group had 47.520 billion euros in backlog, a 1.4% increase in relation to December 31, 2014 (46.866 billion euros) reflecting a favorable foreign exchange impact. It should be noted that the backlog does not include the amount from agreements signed with EDF in October 2013 for the EPR reactors project at Hinkley Point in the United Kingdom or for the related fuel. The order intake totaled 881 million euros in the 1. quarter of 2015, an increase compared with the 1. quarter of 2014 (668 million euros)
Dia, Ndongo; Ndiaye, Mbayame Niang; Monteiro, Maria de Lourdes; Koivogui, Lamine; Bara, Mohamed Ould; Diop, Ousmane M
2013-05-01
During the pandemic 2009 episode, we conducted laboratory-based surveillance in four countries from West Africa: Senegal, Mauritania, Cape Verde, and Guinea. Specimens were obtained from 3,155 patients: 2,264 patients from Senegal, 498 patients from Cape Verde, 227 patients from Mauritania, and 166 patients from Guinea; 911 (28.9%) patients were positive for influenza, 826 (90.7%) patients were positive for influenza A, and 85 (9.3%) patients were positive for influenza B. Among the influenza A positives, 503 (60.9%) positives were H1N1pdm09, 314 (38.0%) positives were H3N2, and 9 (1.1%) positives were seasonal H1N1. The highest detection rate for seasonal influenza viruses (17.1%) occurred in the 5-14 years age group. However, for A(H1N1)pdm09, the detection rate was highest in the 15-24 years age group (35.8%). Based on the present study data, the timeline of detection of A(H1N1)pdm09 viruses in these four countries should be Cape Verde, Guinea, Mauritania, and finally, Senegal. Genetic and antigenic analyses were performed in some isolates.
Zhao, Xiaomeng; Zhang, Yang; Guan, Min; Cui, Lijie; Wang, Baoqiang; Zhu, Zhanping; Zeng, Yiping
2017-07-01
The effect of InSb/In0.9Al0.1Sb buffer layers on InSb thin films grown on GaAs (0 0 1) substrate by molecular beam epitaxy (MBE) is investigated. The crystal quality and the surface morphology of InSb are characterized by XRD and AFM. The carrier transport property is researched through variable temperature hall test. The sharp interface between InSb/In0.9Al0.1Sb is demonstrated important for the high quality InSb thin film. We try different superlattice buffer layers by changing ratios, 2-0.5, thickness, 300-450 nm, and periods, 20-50. According to the function of the dislocation density to the absolute temperature below 150 K with different periods of SL buffers, we can find that the number of periods of superlattice is a major factor to decrease the density of threading dislocations. With the 50 periods SL buffer layer, the electron mobility of InSb at the room temperature and liquid nitrogen cooling temperature is ∼63,000 and ∼4600 cm2/V s, respectively. We deduce that the interface in the SL structure works as a filter layer to prevent the dislocation propagating to the upper InSb thin films.
Electrochemical Activity of a La0.9Ca0.1Co1−xFexO3 Catalyst for a Zinc Air Battery Electrode
Directory of Open Access Journals (Sweden)
Seungwook Eom
2015-01-01
Full Text Available The optimum composition of cathode catalyst has been studied for rechargeable zinc air battery application. La0.9Ca0.1Co1−xFexO3 (x=0–0.4 perovskite powders were prepared using the citrate method. The substitution ratio of Co2+ with Fe3+ cations was controlled in the range of 0–0.4. The optimum substitution ratio of Fe3+ cations was determined by electrochemical measurement of the air cathode composed of the catalyst, polytetrafluoroethylene (PTFE binder, and Vulcan XC-72 carbon. The substitution by Fe enhanced the electrochemical performances of the catalysts. Considering oxygen reduction/evolution reactions and cyclability, we achieved optimum substitution level of x=0.1 in La0.9Ca0.1Co1−xFexO3.
Rossi, C; Hess, S; Eckl, R W; di Lena, A; Bruno, A; Thomas, O; Poggi, A
2006-03-01
Treatment with anticoagulant drugs has shown potential inhibitory effect on tumor invasion, although the relationship with clotting inhibition was not clear. The aim of our study was to evaluate the potential antitumor activity of MCM09, a newly developed, active site-directed, small molecule inhibitor of factor Xa (FXa) [WO0216312], and to relate the findings to anticlotting potency. MCM09 (0.1-10 mg kg(-1)) or heparin (H; 10 mg kg(-1)) was injected intravenously (i.v.), with 5 x 10(4) B16-BL6 melanoma cells, in C57BL/6 mice. Mice were killed after 18 days, to count lung colonies. Ex vivo anticoagulant activity was measured by activated partial thromboplastin time (APTT) on mouse plasma. MCM09, a selective inhibitor of FXa (IC-50 = 2.4 nm against human FXa), inhibited in a dose-dependent manner B16-BL6 melanoma lung colonies in mice. Mean lung metastasis number was 20.9 +/- 4.8 in controls (n = 10), 1.2 +/- 0.4 in mice treated with H, 10 mg kg(-1) i.v. (P < 0.01), 0.9 +/- 0.3, 9.2 +/- 2.2 and 15.5 +/- 2.6 in mice treated with MCM09, at 10 (P < 0.01), 1 (P < 0.05) and 0.1 mg kg(-1) i.v. (ns), respectively. MCM09 (10 mg kg(-1) i.v.) significantly prolonged APTT (57.1 +/- 10.2 s) 30 min after i.v. injection when compared with controls (25.3 +/- 1.6 s; P < 0.05). Lung colonies were 74.2-72.6% reduced by MCM09 (10 mg kg(-1)) given 60 or 120 min before cells, but not by MCM09 given 60 min thereafter, suggesting a direct cell interaction as a mechanism underlying antitumor activity.
Correlation between thermal vibration and conductivity in La0.9Sr0.1B0.9Mg0.1O3-δ, B=Al, Ga and Sc
DEFF Research Database (Denmark)
Lybye, Dorthe; Nielsen, K.
2004-01-01
In order to obtain abetter understanding of the oxide ion conductivity in perovskites, the structure of La(0.9)Sr(0.1)Bo(9)Mg(0.1)O(3 - delta), B=Al, Ga and Sc, have been investigated by time-of-flight powder neutron diffraction at room temperature, 270, 470, 750, 850 and 950 degreesC. For all...... compounds, at all temperatures, structural and anisotropic thermal parameters were refined by full profile Rietveld methods to weighted profile R values less than 0.063. The changes in difference nuclear densities, Deltarho, due to changes in temperature are illustrated by difference density maps around...... the atoms. The observed difference densities are described mainly by zeroth- and second-order spherical harmonics (quadrupolar functions), the nature of which vary with atomic site. The difference density maps provide a direct picture of the average in space and time of changes in atomic thermal vibrations...
Path covering number and L(2,1)-labeling number of graphs
Lu, Changhong; Zhou, Qing
2012-01-01
A {\\it path covering} of a graph $G$ is a set of vertex disjoint paths of $G$ containing all the vertices of $G$. The {\\it path covering number} of $G$, denoted by $P(G)$, is the minimum number of paths in a path covering of $G$. An {\\sl $k$-L(2,1)-labeling} of a graph $G$ is a mapping $f$ from $V(G)$ to the set ${0,1,...,k}$ such that $|f(u)-f(v)|\\ge 2$ if $d_G(u,v)=1$ and $|f(u)-f(v)|\\ge 1$ if $d_G(u,v)=2$. The {\\sl L(2,1)-labeling number $\\lambda (G)$} of $G$ is the smallest number $k$ suc...
Dutta, Mousumi; Dutta, Prafulla; Medhi, Subhash; Borkakoty, Biswajyoti; Biswas, Dipankar
2018-05-01
Human leucocyte antigen (HLA) represents one of the most highly polymorphic systems which plays a central role in the immune response. Genetic polymorphism of HLA in influenza A(H1N1)pdm09 infected population may be an important factor in disease progression and severity that needs further probing. In this study, a total of 110 Influenza like illness patients were recruited from the population of Assam, Northeast India, from which 35 cases infected by A(H1N1)pdm09 viruses and 35 controls were typed for HLA-A, B and DRB1 locus by PCR-SSP method. A total of seven alleles of HLA-A, 16 alleles of HLA-B, and 11 alleles of HLA-DRB1 locus were identified. The most common alleles within each locus in cases were HLA-A*11 (85.71%, P = 0.046), HLA-B*35 (25%, P = 0.0001), and HLA-DRB1*15 (49.35%, P = 0.133) as compared to the controls, HLA-A*11 (40.82%), HLA-B*35 (0.00%), and HLA-DRB1*15 (67.53%). The frequency of HLA-A*11 and HLA-B*35 were significantly higher in cases as compared to the controls. In DRB1 locus, HLA-DRB1*10 was significantly higher in cases (20.78%, P = 0.005) than that of controls (0.00%). Whereas, HLA-DRB1*15 showed a higher frequency in controls than in cases. In addition, HLA-DRB3*01 (P = 0.053), DRB4*01 (P = 1.000), and DRB5*01(P = 0.591) were also identified along with HLA-DRB1 haplotype. From this preliminary study, it is suspected that there may be a role of HLA-A*11, HLA-B*35 and HLA-DRB1*10 in conferring susceptibility to influenza A(H1N1)pdm09 infection in the study population. A larger extended study on HLA polymorphism may explain the association between HLA and influenza A(H1N1)pdm09 infection and provide insights for HLA restricted peptide based vaccines. © 2018 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Marianne Wedde
Full Text Available Influenza A(H1N1pdm09 viruses cause sporadically very severe disease including fatal clinical outcomes associated with pneumonia, viremia and myocarditis. A mutation characterized by the substitution of aspartic acid (wild-type to glycine at position 222 within the haemagglutinin gene (HA-D222G was recorded during the 2009 H1N1 pandemic in Germany and other countries with significant frequency in fatal and severe cases. Additionally, A(H1N1pdm09 viruses exhibiting the polymorphism HA-222D/G/N were detected both in the respiratory tract and in blood. Specimens from mild, fatal and severe cases were collected to study the heterogeneity of HA-222 in A(H1N1pdm09 viruses circulating in Germany between 2009 and 2011. In order to enable rapid and large scale analysis we designed a pyrosequencing (PSQ assay. In 2009/2010, the 222D wild-type of A(H1N1pdm09 viruses predominated in fatal and severe outcomes. Moreover, co-circulating virus mutants exhibiting a D222G or D222E substitution (8/6% as well as HA-222 quasispecies were identified (10%. Both the 222D/G and the 222D/G/N/V/Y polymorphisms were confirmed by TA cloning. PSQ analyses of viruses associated with mild outcomes revealed mainly the wild-type 222D and no D222G change in both seasons. However, an increase of variants with 222D/G polymorphism (60% was characteristic for A(H1N1pdm09 viruses causing fatal and severe cases in the season 2010/2011. Pure 222G viruses were not observed. Our results support the hypothesis that the D222G change may result from adaptation of viral receptor specificity to the lower respiratory tract. This could explain why transmission of the 222G variant is less frequent among humans. Thus, amino acid changes at HA position 222 may be the result of viral intra-host evolution leading to the generation of variants with an altered viral tropism.
Erratum!- in paper volume 19, Supplement 1, Year 2015, pp. S109-S115, DOI:10.2298/TSCI15S1S09C
Directory of Open Access Journals (Sweden)
Editorial
2015-01-01
Full Text Available In the paper published in THERMAL SCIENCE Volume 19, Supplement 1, YEAR 2015, pp. S109-S115, DOI REFERENCE: 10.2298/TSCI15S1S09C Names and affiliations of the authors has been incorrectly written Istead of: THE DIFFUSION MODEL OF FRACTAL HEAT AND MASS TRANSFER IN FLUIDIZED BED A Local Fractional Arbitrary Euler-Lagrange Formula by Xu CHENG∗ and Xiao-Xun MA School of Chemical Engineering, Northwest University, Xi'an, Shaanxi, China Correctly has to be written: THE DIFFUSION MODEL OF FRACTAL HEAT AND MASS TRANSFER IN FLUIDIZED BED A Local Fractional Arbitrary Euler-Lagrange Formula by Xu CHENG1∗ and Lin Wang2 - 1School of Chemical Engineering, Northwest University, Xi'an, Shaanxi, China - 2Xi'an Modern Chemistry Research Institute, Xi'an, Shaanxi, China Link to the corrected article 10.2298/TSCI15S1S09C
Directory of Open Access Journals (Sweden)
Peña-Martínez, J.
2008-06-01
Full Text Available A combination of impedance spectroscopy and a modified electromotive force method (emf were used to evaluate the ionic transport numbers and the overall conductivity of several doped lanthanum gallate materials, i.e. La0.9Sr0.1Ga1-xMgxO3-δ (x=0.05-0.30, La0.9A0.1Ga0.8Mg0.2O3-δ (A=Sr, Ba and Ca and La0.9Sr0.1Ga0.8Mg0.2-yCoyO3-δ (y=0.015 and 0.045. La0.9Sr0.1Ga0.8Mg0.2O2.85 (LSGM sample showed the maximum ionic transport number in the temperature range 900-1173 K, around 0.99 in both O2/air and H2/air gradients.
La conductividad total y los números de transporte iónico de las composiciones, basadas en el galato de lantano, La0,9Sr0,1Ga1-xMgxO3-δ (x=0,05-0,30, La0,9A0,1Ga0,8Mg0,2O3-δ (A=Sr, Ba, Ca y La0,9Sr0,1Ga0,8Mg0,2-yCoyO3-δ (y=0.015; 0,045 fueron estudiadas mediante una combinación de técnicas de espectroscopia de impedancia compleja y fuerza electromotriz (fem. La composición La0,9Sr0,1Ga0,8Mg0,2O2,85 (LSGM presenta el mayor número de transporte iónico, concretamente 0,99 en el rango de temperaturas 900-1173 K, tanto en gradiente de O2/aire como de H2/aire.
Dia, Ndongo; Ndiaye, Mbayame Niang; Monteiro, Maria de Lourdes; Koivogui, Lamine; Bara, Mohamed Ould; Diop, Ousmane M.
2013-01-01
During the pandemic 2009 episode, we conducted laboratory-based surveillance in four countries from West Africa: Senegal, Mauritania, Cape Verde, and Guinea. Specimens were obtained from 3,155 patients: 2,264 patients from Senegal, 498 patients from Cape Verde, 227 patients from Mauritania, and 166 patients from Guinea; 911 (28.9%) patients were positive for influenza, 826 (90.7%) patients were positive for influenza A, and 85 (9.3%) patients were positive for influenza B. Among the influenza A positives, 503 (60.9%) positives were H1N1pdm09, 314 (38.0%) positives were H3N2, and 9 (1.1%) positives were seasonal H1N1. The highest detection rate for seasonal influenza viruses (17.1%) occurred in the 5–14 years age group. However, for A(H1N1)pdm09, the detection rate was highest in the 15–24 years age group (35.8%). Based on the present study data, the timeline of detection of A(H1N1)pdm09 viruses in these four countries should be Cape Verde, Guinea, Mauritania, and finally, Senegal. Genetic and antigenic analyses were performed in some isolates. PMID:23509122
Vesikari, Timo; Richardus, Jan Hendrik; Berglund, Johan; Korhonen, Tiina; Flodmark, Carl-Erik; Lindstrand, Ann; Silfverdal, Sven Arne; Bambure, Vinod; Caplanusi, Adrian; Dieussaert, Ilse; Roy-Ghanta, Sumita; Vaughn, David W
2015-07-01
During the influenza pandemic 2009-2010, an AS03-adjuvanted A(H1N1)pdm09 vaccine was used extensively in children 6 months of age and older, and during the 2010-2011 influenza season, the A(H1N1)pdm09 strain was included in the seasonal trivalent inactivated influenza vaccine (TIV) without adjuvant. We evaluated the immunogenicity and safety of TIV in children previously vaccinated with the AS03-adjuvanted A(H1N1)pdm09 vaccine. Healthy children were randomized (1:1) to receive TIV or a control vaccine. Children were aged 6 months to 9 years (n = 154) and adolescents 10-17 years (n = 77) when they received AS03-adjuvanted A(H1N1)pdm09 vaccine at least 6 months before study enrolment. Hemagglutination inhibition (HI) and neutralizing antibody responses against the A(H1N1)pdm09 strain were evaluated before (day 0) and at day 28 and month 6 after study vaccination. Reactogenicity was assessed during the 7 day postvaccination period, and safety was assessed for 6 months. At day 0, >93.9% of all children had HI titers ≥1:40 for the A(H1N1)pdm09 strain, which increased to 100% at both day 28 and month 6 in the TIV group. Between days 0 and 28, HI antibody geometric mean titers against A(H1N1)pdm09 increased by 9-fold and 4-fold in children 6 months to 9 years of age and 10-17 years of age, respectively. AS03-adjuvanted A(H1N1)pdm09 vaccine-induced robust immune responses in children that persisted into the next season, yet were still boosted by TIV containing A(H1N1)pdm09. The reactogenicity and safety profile of TIV did not appear compromised by prior receipt of AS03-adjuvanted A(H1N1)pdm09 vaccine.
DEFF Research Database (Denmark)
Pedersen, Susanne Brix; Bischoff, Anne L.; Folsgaard, Nilofar V.
2015-01-01
, IL-5, IL-13, eotaxin-1, eotaxin-3, TARC, MDC, IL-17, IL-1 beta, IL-8, transforming growth factor beta (TGF)-beta 1, IL-10 and IL-2. Infections were monitored the first year of life by daily diary cards and clinical controls. Results: Neonates of mothers vaccinated during pregnancy had significant up...... significant and positive association to up-regulation of TGF-beta 1 levels (P = 0.0003) and significant negative association to other mediators. The study was not powered to study differences in the incidence of infections in early infancy which did not differ between the study groups. Conclusion: Influenza A......(H1N1) pnd09 vaccination during pregnancy up-regulates TGF-beta 1 and down-regulates key mediators of the protective immunity....
17 CFR 210.12-09 - Valuation and qualifying accounts.
2010-04-01
... period Column C—Additions (1)—Charged to costs and expenses (2)—Charged to other accounts—describe Column... qualifying accounts and reserves by descriptive title. Group (a) those valuation and qualifying accounts... accounts. 210.12-09 Section 210.12-09 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION...
Directory of Open Access Journals (Sweden)
Wongsrichanalai Chansuda
2009-01-01
Full Text Available Abstract Background The combination of artesunate and mefloquine was introduced as the national first-line treatment for Plasmodium falciparum malaria in Cambodia in 2000. However, recent clinical trials performed at the Thai-Cambodian border have pointed to the declining efficacy of both artesunate-mefloquine and artemether-lumefantrine. Since pfmdr1 modulates susceptibility to mefloquine and artemisinin derivatives, the aim of this study was to assess the link between pfmdr1 copy number, in vitro susceptibility to individual drugs and treatment failure to combination therapy. Methods Blood samples were collected from P. falciparum-infected patients enrolled in two in vivo efficacy studies in north-western Cambodia: 135 patients were treated with artemether-lumefantrine (AL group in Sampovloun in 2002 and 2003, and 140 patients with artesunate-mefloquine (AM group in Sampovloun and Veal Veng in 2003 and 2004. At enrollment, the in vitro IC50 was tested and the strains were genotyped for pfmdr1 copy number by real-time PCR. Results The pfmdr1 copy number was analysed for 115 isolates in the AM group, and for 109 isolates in the AL group. Parasites with increased pfmdr1 copy number had significantly reduced in vitro susceptibility to mefloquine, lumefantrine and artesunate. There was no association between pfmdr1 polymorphisms and in vitro susceptibilities. In the patients treated with AM, the mean pfmdr1copy number was lower in subjects with adequate clinical and parasitological response compared to those who experienced late treatment failure (n = 112, p p = 0.364. The presence of three or more copies of pfmdr1 were associated with recrudescence in artesunate-mefloquine treated patients (hazard ratio (HR = 7.80 [95%CI: 2.09–29.10], N = 115, p = 0.002 but not with recrudescence in artemether-lumefantrine treated patients (HR = 1.03 [95%CI: 0.24–4.44], N = 109, p = 0.969. Conclusion This study shows that pfmdr1 copy number is a molecular
2010-07-01
... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Numbering. 105-1.109 Section 105-1.109 Public Contracts and Property Management Federal Property Management Regulations System (Continued) GENERAL SERVICES ADMINISTRATION 1-INTRODUCTION 1.1-Regulations System § 105-1.109 Numbering. ...
TOP1 gene copy numbers are increased in cancers of the bile duct and pancreas
DEFF Research Database (Denmark)
Grunnet, Mie; Calatayud, Dan; Schultz, Nicolai Aa.
2015-01-01
) poison. Top1 protein, TOP1 gene copy number and mRNA expression, respectively, have been proposed as predictive biomarkers of response to irinotecan in other cancers. Here we investigate the occurrence of TOP1 gene aberrations in cancers of the bile ducts and pancreas. Material and methods. TOP1...
Catastrophic dechanneling resonance study of In0.1Ga0.9As/GaAs multilayers
International Nuclear Information System (INIS)
Siddiqui, A.M.; Pathak, A.P.
1998-10-01
Catastrophic Dechanneling Resonance (CDR) has bee used for probing important properties of Strained Layer Superlattices (SLS). We have undertaken a systematic study on strain and strain revealing mechanisms in technologically important SLS using ion channeling methods. Here we present the theoretical calculations on CDR for a 4 He ion beam along the (110) plane in In 0.1 Ga 0.9 As/GaAs superlattice using Moliere potential. CDR is found to have occurred at 1.2 MeV. Also the most regular feature of CDR, the Incident Angle Asymmetry has been observed. (author)
4U 1907+09: an HMXB running away from the Galactic plane
Gvaramadze, V. V.; Röser, S.; Scholz, R.-D.; Schilbach, E.
2011-05-01
We report the discovery of a bow shock around the high-mass X-ray binary (HMXB) 4U 1907+09 using the Spitzer Space Telescope 24 μm data (after Vela X-1 the second example of bow shocks associated with HMXBs). The detection of the bow shock implies that 4U 1907+09 is moving through space with a high (supersonic) peculiar velocity. To confirm the runaway nature of 4U 1907+09, we measured its proper motion, which for an adopted distance to the system of 4 kpc corresponds to a peculiar transverse velocity of ≃ 160 ± 115 km s-1, meaning that 4U 1907+09 is indeed a runaway system. This also supports the general belief that most HMXBs possess high space velocities. The direction of motion of 4U 1907+09 inferred from the proper motion measurement is consistent with the orientation of the symmetry axis of the bow shock, and shows that the HMXB is running away from the Galactic plane. We also present the Spitzer images of the bow shock around Vela X-1 (a system similar to 4U 1907+09) and compare it with the bow shock generated by 4U 1907+09.
Energy Technology Data Exchange (ETDEWEB)
Liu, Jun; Chen, Zonghai; Busking, Sara; Belharouak, Ilias; Amine, Khalil [Chemical Engineering Division, Argonne National Laboratory, 9700 S. Cass Avenue, IL 60439 (United States)
2007-12-06
Lithium-rich layered metal oxide Li{sub 1.1}[Ni{sub 1/3}Co{sub 1/3}Mn{sub 1/3}]{sub 0.9}O{sub 2} was investigated as a potential positive electrode material for high-power batteries for hybrid electric vehicle (HEV) applications. In order to evaluate the power and life characteristics of the graphite/Li{sub 1.1}[Ni{sub 1/3}Co{sub 1/3}Mn{sub 1/3}]{sub 0.9}O{sub 2} cell chemistry, hybrid pulse power characterization (HPPC) and accelerated calendar life tests were conducted on several pouch cells containing electrolytes with and without additives. The data show that the cells containing 0.5 wt% lithium bis(oxalate)borate (LiBOB) or vinyl ethyl carbonate (VEC) additives, or the novel lithium difluoro(oxalato)borate (LiDFOB) additive, have much improved cycle and calendar life performance. (author)
Directory of Open Access Journals (Sweden)
Ling Qin
2018-05-01
Full Text Available Background: The C allele of the interferon-induced transmembrane protein-3 (IFITM3 SNP rs12252, a common allele in South East Asia and China, is strongly associated with severe influenza infection. However, despite the high occurrence of rs12252-CC genotype in Chinese population (~25%, severe influenza infection is rare. The aim of study is to determine whether rs12252-CC individuals have pre-existing antibody responses to previous seasonal influenza infections.Cohort and Method: A total 99 young healthy volunteers (18–20 years were recruited and received an influenza seasonal Vaccination [A/Switzerland/9715293/2013(H3N2, A/California/7/2009 (pdm09H1N1 and B/Jeep/3073/2013-like virus (Flu-B]. Plasma and gDNA was isolated from each volunteer before, and 14, 28, 180, 360, and 540 days after vaccination. Additionally, 68 elderlies (>65 years were also recruited as a control group to compare the levels of antibodies at baseline between the young adults and the elderly. For each sample IFITM3 rs12252 genotype was determined and antibody levels in response to pdmH1N1, H3N2 and Influenza B infection were measured for each time point.Results: We found a significantly higher level of pre-existing antibodies to pandemic influenza H1N1/09 virus (pdm09H1N1 but not to H3N2 or FluB in CC donors in comparison with CT/TT donors prior to vaccination. No impact of IFITM3 genotype in boosting influenza specific antibodies in young adults within 1 year after receiving seasonal influenza vaccination was observed. In addition, there was no difference in pdm09H1N1 specific antibody levels observed in the elderly cohort between volunteers carrying different IFITM3 genotypes. Higher levels of antibodies to pdmH1N1 were observed in elderly CC carriers when compared to the young CC carriers, but this trend was not replicated in TT carriers.Conclusion:IFITM3-rs12252 CC carriers exhibit a high level of pre-existing immunity to pdm09H1N1 compared to TT carriers in the
Advanced Power Batteries for Renewable Energy Applications 3.09
Energy Technology Data Exchange (ETDEWEB)
Shane, Rodney [East Penn Manufacturing Company, Inc., Lyon Station, PA (United States)
2011-12-01
This report describes the research that was completed under project title Advanced Power Batteries for Renewable Energy Applications 3.09, Award Number DE-EE0001112. The report details all tasks described in the Statement of Project Objectives (SOPO). The SOPO includes purchasing of test equipment, designing tooling, building cells and batteries, testing all variables and final evaluation of results. The SOPO is included. There were various types of tests performed during the project, such as; gas collection, float current monitoring, initial capacity, high rate partial state of charge (HRPSoC), hybrid pulse power characterization (HPPC), high rate capacity, corrosion, software modeling and solar life cycle tests. The grant covered a period of two years starting October 1, 2009 and ending September 30, 2011.
International Nuclear Information System (INIS)
Pan Fusheng; Yang Mingbo; Shen Jia; Wu Lu
2011-01-01
Research highlights: → Minor Zr and/or Sr additions can effectively refine the grains of the Mg-3Ce-1.2Mn-0.9Sc alloy. → Minor Zr and/or Sr additions can improve the tensile properties of the Mg-3Ce-1.2Mn-0.9Sc alloy. → Minor Zr and/or Sr additions can improve the creep properties of the Mg-3Ce-1.2Mn-0.9Sc alloy. - Abstract: The effects of minor Zr and Sr on the as-cast microstructure and mechanical properties of the Mg-3Ce-1.2Mn-0.9Sc (wt.%) alloy were investigated by using optical and electron microscopies, differential scanning calorimetry (DSC) analysis, and tensile and creep tests. The results indicate that adding minor Zr and/or Sr to the Mg-3Ce-1.2Mn-0.9Sc alloy does not cause an obvious change in the morphology and distribution of the Mg 12 Ce phase. However, the grains of the Zr and/or Sr-containing alloys are effectively refined. Among the Zr and/or Sr-containing alloys, the grains of the alloy with the addition of 0.5 wt.%Zr + 0.1 wt.%Sr are the finest, followed by the alloys with the additions of 0.5 wt.%Zr and 0.1 wt.%Sr, respectively. In addition, small additions of Zr and/or Sr can improve the tensile and creep properties of the Mg-3Ce-1.2Mn-0.9Sc alloy. Among the Zr and/or Sr-containing alloys, the alloy with the addition of 0.5 wt.%Zr + 0.1 wt.%Sr obtains the optimum tensile and creep properties.
Yen, Chia-Sheng; Choy, Cheuk-Sing; Huang, Wei-Jan; Huang, Shiu-Wen; Lai, Pin-Ye; Yu, Meng-Chieh; Shiue, Ching; Hsu, Ya-Fen; Hsu, Ming-Jen
2018-01-01
Growing evidence shows that hydroxamate-based compounds exhibit broad-spectrum pharmacological properties including anti-tumor activity. However, the precise mechanisms underlying hydroxamate derivative-induced cancer cell death remain incomplete understood. In this study, we explored the anti-tumor mechanisms of a novel aliphatic hydroxamate-based compound, WMJ-J-09, in FaDu head and neck squamous cell carcinoma (HNSCC) cells. WMJ-J-09 induced G2/M cell cycle arrest and apoptosis in FaDu cells. These actions were associated with liver kinase B1 (LKB1), AMP-activated protein kinase (AMPK) and p38 mitogen-activated protein kinase (p38MAPK) activation, transcription factor p63 phosphorylation, as well as modulation of p21 and survivin. LKB1-AMPK-p38MAPK signaling blockade reduced WMJ-J-09's enhancing effects in p63 phosphorylation, p21 elevation and survivin reduction. Moreover, WMJ-J-09 caused an increase in α-tubulin acetylation and interfered with microtubule assembly. Furthermore, WMJ-J-09 suppressed the growth of subcutaneous FaDu xenografts in vivo . Taken together, WMJ-J-09-induced FaDu cell death may involve LKB1-AMPK-p38MAPK-p63-survivin signaling cascade. HDACs inhibition and disruption of microtubule assembly may also contribute to WMJ-J-09's actions in FaDu cells. This study suggests that WMJ-J-09 may be a potential lead compound and warrant the clinical development in the treatment of HNSCC.
Nandenha, J.; Isidoro, R.A.; Dresch, M.A.; Fernandes, V.C.; Aricó, B.; Santiago, E.I.; Rothenberg, G.; Oliveira, W.S.; Linardi, M.
2012-01-01
The nanophase material (powder) of Ce0.9W0.1O2 was synthesized via coprecipitation of oxalates of cerium (IV) and tungsten cations. Pt-Ce0.9W0.1O2 (2 wt% Pt) was prepared by an alcohol-reduction process using H2PtCl6.6H2O as source of Pt, Ce0.9W0.1O2 as support and ethylene glycol as solvent and
Final Technical Report 09 LW 112
Energy Technology Data Exchange (ETDEWEB)
Lenhoff, R J
2010-11-28
Since the development of new antibiotics is out-paced by the emergence of bacterial resistance to existing antibiotics, it is crucial to understand the genetic mechanisms underlying resistance existing antibiotics. At the center of this mystery is a poorly understood phenomenon, heteroresistance: the coexistence of multiple subpopulations with varying degrees of antibiotic resistance. A better understanding of the fundamental basis of heteroresistance could result in sorely needed breakthroughs in treatment options. This project proposed to leverage a novel microfluidic (microchemostat) technology to probe the heteroresistance phenomenon in bacteria, with the aim of restoring the efficacy of existing {beta}-lactam antibiotics. The clinically important bacteria Methicillin Resistant S. aureus (MRSA) was used as the test case of bacteria that exhibits antibiotic heteroresistance. MRSA is difficult to treat because it is resistant to all {beta}-lactam antibiotics, as well as other classes of antimicrobials. Whereas {beta}-lactams such as methicillin and oxacillin are the preferred antibiotics to treat S. aureus infections due to their efficacy and low side effects, accurate determination and use of oxacillin/methicillin dosage is hampered by heteroresistance. In fact, invasive MRSA infections now account for about 95,000 deaths per year, a number that exceeds the deaths due to either influenza or HIV (12). In some MRSA strains, two subpopulations of cells may coexist: both populations carry the mecA gene that confers resistance, but mecA is differentially expressed so that only a small number of cells are observed during in vitro testing. Why this occurs is not understood. Prior experiments have sought to explain this phenomenon with conflicting results, with technology being the primary barrier to test the system sufficiently. This is the final report on work accomplished under the Lab-wide LDRD project 09-LW-112. This project was awarded to Frederick Balagadde who
The magnetic transition temperature tuned by strain in YMn0.9Ru0.1O3 thin films
Directory of Open Access Journals (Sweden)
L. P. Yang
2018-05-01
Full Text Available Epitaxial orthorhombic YMn0.9Ru0.1O3 films with different thickness have been grown on (001-SrTiO3 substrates by pulsed laser deposition (PLD. The crystal structure is well investigated by X-ray Diffraction. It is found that the out-of-plane parameter c slowly increases with decreasing thickness of samples because of the tensile strain between the films and substrates along c axis. The lengths of in-plane Mn-O bonds expand with the enhancement of strains, which is proved by Raman scatting. The magnetic measurements reveal that there exist two magnetic transition temperatures TN1 and TN2. The TN1 is close to that of orthorhombic YMnO3 bulk. With decreasing thickness of the films, TN1 keeps almost constant because of the small stain along c-axis. TN2, however, obviously increases from 117 K to 134 K, which could be related to the expansion of in-plane Mn-O bonds. Results show that the magnetic transition temperature of YMn0.9Ru0.1O3 films can be sensitively manipulated by the strain of the films.
African Journals Online (AJOL)
OLUWOLE
Agro-Science Journal of Tropical Agriculture, Food, Environment and Extension. Volume 9 Number 1 ... of persistent dumping of cheap subsidized food imports from developed ... independence of the inefficiency effects in the two estimation ...
NCBI nr-aa BLAST: CBRC-HSAP-09-0006 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-HSAP-09-0006 ref|ZP_00960995.1| pyruvate carboxylase [Roseovarius nubinhibens ...ISM] gb|EAP76566.1| pyruvate carboxylase [Roseovarius nubinhibens ISM] ZP_00960995.1 1.2 28% ...
Unigene BLAST: CBRC-GGAL-09-0012 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GGAL-09-0012 gnl|UG|Gga#S6698203 pnl1s.pk003.f8 chicken liver cDNA library Gallus gallus cDNA clone pnl...1s.pk003.f8 5' similar to histidine-rich glycoprotein - bovine (fragments), mRNA sequence /clone=pnl
33 CFR 151.09 - Applicability.
2010-07-01
....09 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) POLLUTION... Pertains to Pollution from Ships Oil Pollution § 151.09 Applicability. (a) Except as provided in paragraph... the United States and is certificated for ocean service; (3) Is operated under the authority of the...
Low toxicity binder systems for tape cast Ce0.9Gd0.1O1.95 laminates
DEFF Research Database (Denmark)
Klemensø, Trine; Menon, Mohan; Ramousse, Severine
2010-01-01
Conventional binder systems for tape casting contain toxic phthalate plasticizers and butanone (MEK) as part of the solvent. The effects of exchanging the phthalate with a non-toxic alternative, and butanone with ethanol, were studied on laminates of high-green density CGO (Ce0.9Gd0.1O1.95) tapes....... Samples were prepared with a binder system containing DBP (dibutyl phthalate) plasticizer and MEK solvent, and with a binder system based on a non-toxic non-phthalate plasticizer and ethanol. In both systems, the weight ratio of plasticizer to the PVB (polyvinyl butyral) binder was varied between 0.......4 and 0.7. Substitution to the less toxic binder system had no adverse impacts on the microstructure. In fact, denser packing and improved homogeneity were observed with the non-phthalate-based system at ratio 0.5 indicating improved dispersion in this system. The denser packing also coincided...
Thermoelectric properties of Ca1-xYxMnO3 and Ca0.9Y0.1-yFeyMnO3 perovskite compounds
DEFF Research Database (Denmark)
Thuy, Nguyen Thi; Minh, Dang Le; Van Nong, Ngo
2012-01-01
Polycrystalline Ca1-xYxMnO3 (x = 0.0; 0.1; 0.3; 0.5; 0.7) and Ca0.9Y0.1-yFeyMnO3 (y = 0.00; 0.01; 0.03; 0.05) compounds were prepared by solid-state reaction. X-ray diffraction (XRD) analysis revealed all XRD peaks of all the samples as identical to the orthorhombic structure. The thermoelectric ...
NCBI nr-aa BLAST: CBRC-RMAC-09-0022 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-RMAC-09-0022 ref|YP_026083.1| NADH dehydrogenase subunit 2 [Steinernema carpoc...apsae] gb|AAT00526.1| NADH dehydrogenase subunit 2 [Steinernema carpocapsae] YP_026083.1 1e-05 30% ...
NCBI nr-aa BLAST: CBRC-GACU-09-0002 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GACU-09-0002 ref|YP_594114.1| amidohydrolase [Deinococcus geothermalis DSM 113...00] gb|ABF44040.1| amidohydrolase [Deinococcus geothermalis DSM 11300] YP_594114.1 5.5 28% ...
DEFF Research Database (Denmark)
Ni, De Wei; Schmidt, Cristine Grings; Teocoli, Francesca
2013-01-01
The sintering behavior of porous Ce0.9Gd0.1O1.95(CGO10) tape cast layers was systematically investigated to establish fundamental kinetic parameters associated to densification and grain growth. Densification and grain growth were characterized by a set of different methods to determine the domin...... and grain boundary mobility in the porous body was estimated around 10−18–10−16m3N−1s−1 at the investigated temperature range.© 2013 Elsevier Ltd. All rights reserved.......The sintering behavior of porous Ce0.9Gd0.1O1.95(CGO10) tape cast layers was systematically investigated to establish fundamental kinetic parameters associated to densification and grain growth. Densification and grain growth were characterized by a set of different methods to determine...... the dominant sintering mechanisms and kinetics, both in isothermal and at constant heating rate (iso-rate) conditions. Densification of porous CGO10 tape is thermally activated with typical activation energy which was estimated around 440–470 kJ mol−1. Grain growth showed similar thermal activation energy...
Magnetic properties of Nd-deficient manganites Nd0.9-xCaxMnOy
International Nuclear Information System (INIS)
Troyanchuk, I.O.; Khomchenko, V.A.; Pastushonok, S.N.; Novitsky, O.A.; Pavlov, V.I.; Szymczak, H.
2006-01-01
X-ray diffraction and magnetic studies of neodymium deficient Nd 0.9-x Ca x MnO y (0= 0.9 MnO y samples have been prepared in the 2.85= g -orbitals of manganese ions. Composition with y=2.85 is antiferromagnet with T N =85K, whereas for more oxidized Nd 0.9 MnO y samples a coexistence of antiferromagnetic and ferromagnetic phases is suggested. Low-temperature magnetic phase transition which is accompanied by a negative magnetization appearance has been found in the Nd 0.9 MnO 2.90 compound. Magnetic behavior of Nd 0.9-x Ca x MnO y (0.1= 1-x Ca x MnO 3 series. Properties of the Nd 0.9-x Ca x MnO y (0=< x=<0.4) solid solutions are in agreement with a hypothesis according to which a part of Nd ions can be substituted by Mn ions
NCBI nr-aa BLAST: CBRC-TGUT-09-0014 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TGUT-09-0014 ref|NP_000675.1| beta-1-adrenergic receptor [Homo sapiens] gb|AAA51667.1| beta-1-adrenergi...c receptor emb|CAI16920.1| adrenergic, beta-1-, receptor [Homo sapiens] NP_000675.1 1e-144 67% ...
NCBI nr-aa BLAST: CBRC-GGAL-09-0008 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GGAL-09-0008 ref|XP_001568166.1| proteophosphoglycan ppg4 [Leishmania brazilie...nsis] emb|CAM43270.1| proteophosphoglycan ppg4 [Leishmania braziliensis] XP_001568166.1 5e-61 23% ...
Power Systems Development Facility Gasification Test Run TC09
Energy Technology Data Exchange (ETDEWEB)
Southern Company Services
2002-09-30
This report discusses Test Campaign TC09 of the Kellogg Brown & Root, Inc. (KBR) Transport Gasifier train with a Siemens Westinghouse Power Corporation (Siemens Westinghouse) particle filter system at the Power Systems Development Facility (PSDF) located in Wilsonville, Alabama. The Transport Gasifier is an advanced circulating fluidized-bed gasifier designed to operate as either a combustor or a gasifier in air- or oxygen-blown mode of operation using a particulate control device (PCD). The Transport Gasifier was operated as a pressurized gasifier during TC09 in air- and oxygen-blown modes. Test Run TC09 was started on September 3, 2002, and completed on September 26, 2002. Both gasifier and PCD operations were stable during the test run, with a stable baseline pressure drop. The oxygen feed supply system worked well and the transition from air to oxygen was smooth. The gasifier temperature varied between 1,725 and 1,825 F at pressures from 125 to 270 psig. The gasifier operates at lower pressure during oxygen-blown mode due to the supply pressure of the oxygen system. In TC09, 414 hours of solid circulation and over 300 hours of coal feed were attained with almost 80 hours of pure oxygen feed.
International Nuclear Information System (INIS)
Wu, Ling; Lu, JiaJia; Wei, Gui; Wang, Pengfei; Ding, Hao; Zheng, Junwei; Li, Xiaowei; Zhong, Shengkui
2014-01-01
Highlights: • xLiMn 0.9 Fe 0.1 PO4·yLi 3 V 2 (PO 4 ) 3 /C composites are prepared by a solid-state method. • The addition of Li 3 V 2 (PO 4 ) 3 can improve the properties of LiMn 0.9 Fe 0.1 PO 4 . • Mutual doping occurrs between the LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 phases. • 5LiMn 0.9 Fe 0.1 PO 4 ·Li 3 V 2 (PO 4 ) 3 /C shows the best electrochemical properties. - Abstract: The xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x:y=1:0, 9:1 5:1, 3:1, 1:1 and 0:1) cathode materials are synthesized by a ball–milling and post–calcination method. XRD results reveal that the xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x,y≠0) composites are composed of LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 phases, and no impurities are detected. In LiMn 0.9 Fe 0.1 PO 4 –Li 3 V 2 (PO 4 ) 3 system, most of the manganese, iron and vanadium elements in the raw materials tend to form the two major phases, and only small amounts of V, Mn and Fe as dopants enter into the lattice of LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 . Electrochemical tests show that the xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x,y≠0) composites exhibit much better performance than the single LiMn 0.9 Fe 0.1 PO 4 /C. Among the samples, 5LiMn 0.9 Fe 0.1 PO 4 ·Li 3 V 2 (PO 4 ) 3 /C shows the best electrochemical performance. The sample delivers the specific capacities of 158.1, 140.7 and 100.2 mAh g −1 at 0.05, 1 and 4 C rates in the potential range of 2.5–4.5 V, and exhibits very long and flat discharge plateau around 4.0 V up to 1 C rate. The sample also shows good cycling performance at various C–rates
Magnetic Properties of La0.9Ag0.1(Mn1-xCoxO3 under Pressure
Directory of Open Access Journals (Sweden)
Mihalik M.
2013-01-01
Full Text Available In our paper we report on magnetic properties of La0.90Ag0.10(CoxMn1-xO3 ferromagnetic ceramics (x = 0.00 and0.03 which were studied in pressures up to 0.9 GPa. Magnetic transition at the Curie temperature TC is accompanied with metal insulator transition with a maximum at T* which is shifted to lower temperature with applied magnetic field. The Curie temperature is decreasing with substitution of Co for Mn and is ranging from 178 K to 126.5 K. Hydrostatic pressure increases TC for sample with x = 0.03 nearly linearly with the pressure coefficient dTc/dp = 5.7 K/GPa. Hysteresis loop is affected marginally; µs increases and Hc decreases with pressure.
NCBI nr-aa BLAST: CBRC-TNIG-09-0033 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-09-0033 ref|YP_001510423.1| hypothetical protein Franean1_6173 [Frankia s...p. EAN1pec] gb|ABW15517.1| hypothetical protein Franean1_6173 [Frankia sp. EAN1pec] YP_001510423.1 0.097 29% ...
NCBI nr-aa BLAST: CBRC-RMAC-09-0031 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-RMAC-09-0031 ref|NP_000675.1| beta-1-adrenergic receptor [Homo sapiens] gb|AAA51667.1| beta-1-adrenergi...c receptor emb|CAI16920.1| adrenergic, beta-1-, receptor [Homo sapiens] NP_000675.1 0.0 97% ...
NCBI nr-aa BLAST: CBRC-MMUS-09-0186 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0186 ref|XP_001213909.1| predicted protein [Aspergillus terreus NIH262...4] gb|EAU35178.1| predicted protein [Aspergillus terreus NIH2624] XP_001213909.1 0.076 27% ...
NCBI nr-aa BLAST: CBRC-HSAP-09-0074 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-HSAP-09-0074 ref|XP_001564659.1| dynein heavy chain, putative [Leishmania brazil...iensis] emb|CAM38725.1| dynein heavy chain, putative [Leishmania braziliensis] XP_001564659.1 7.8 31% ...
Influenza A(H1N1)pdm09 vaccination policies and coverage in Europe.
Mereckiene, J; Cotter, S; Weber, J T; Nicoll, A; D'Ancona, F; Lopalco, P L; Johansen, K; Wasley, A M; Jorgensen, P; Lévy-Bruhl, D; Giambi, C; Stefanoff, P; Dematte, L; O'Flanagan, D
2012-01-26
In August 2010 the Vaccine European New Integrated Collaboration Effort (VENICE) project conducted a survey to collect information on influenza A(H1N1)pdm09 vaccination policies and vaccination coverage in the European Union (EU), Norway and Iceland. Of 29 responding countries, 26 organised national pandemic influenza vaccination and one country had recommendations for vaccination but did not have a specific programme. Of the 27 countries with vaccine recommendations, all recommended it for healthcare workers and pregnant women. Twelve countries recommended vaccine for all ages. Six and three countries had recommendations for specific age groups in children and in adults, countries for specific adult age groups. Most countries recommended vaccine for those in new risk groups identified early in the pandemic such as morbid obese and people with neurologic diseases. Two thirds of countries started their vaccination campaigns within a four week period after week 40/2009. The reported vaccination coverage varied between countries from 0.4% to 59% for the entire population (22 countries); 3% to 68% for healthcare workers (13 countries); 0% to 58% for pregnant women (12 countries); 0.2% to 74% for children (12 countries). Most countries identified similar target groups for pandemic vaccine, but substantial variability in vaccination coverage was seen. The recommendations were in accordance with policy advice from the EU Health Security Committee and the World Health Organization.
Influenza A(H1N1)pdm09 vaccination policies and coverage in Europe.
LENUS (Irish Health Repository)
Mereckiene, J
2012-06-01
In August 2010 the Vaccine European New Integrated Collaboration Effort (VENICE) project conducted a survey to collect information on influenza A(H1N1)pdm09 vaccination policies and vaccination coverage in the European Union (EU), Norway and Iceland. Of 29 responding countries, 26 organised national pandemic influenza vaccination and one country had recommendations for vaccination but did not have a specific programme. Of the 27 countries with vaccine recommendations, all recommended it for healthcare workers and pregnant women. Twelve countries recommended vaccine for all ages. Six and three countries had recommendations for specific age groups in children and in adults, countries for specific adult age groups. Most countries recommended vaccine for those in new risk groups identified early in the pandemic such as morbid obese and people with neurologic diseases. Two thirds of countries started their vaccination campaigns within a four week period after week 40\\/2009. The reported vaccination coverage varied between countries from 0.4% to 59% for the entire population (22 countries); 3% to 68% for healthcare workers (13 countries); 0% to 58% for pregnant women (12 countries); 0.2% to 74% for children (12 countries). Most countries identified similar target groups for pandemic vaccine, but substantial variability in vaccination coverage was seen. The recommendations were in accordance with policy advice from the EU Health Security Committee and the World Health Organization.
Deformed lattice states in a Zn{sub 0.9}V{sub 0.1}Se cubic crystal
Energy Technology Data Exchange (ETDEWEB)
Maksimov, V. I., E-mail: kokailo@rambler.ru; Dubinin, S. F.; Surkova, T. P.; Parkhomenko, V. D. [Russian Academy of Sciences, Institute of Metal Physics, Ural Branch (Russian Federation)
2016-01-15
Neutron scattering patterns have been recorded for a bulk Zn{sub 0.9}V{sub 0.1}Se cubic crystal at room temperature; they are indicative of macroscopic deformation in the material and its significant inhomogeneity. Specific features of the previously found state, preceding the fcc ↔ hcp structural transformation of the sphalerite lattice upon strong destabilization induced by vanadium ions in the doped ZnSe matrix, are discussed taking into account the data obtained.
Directory of Open Access Journals (Sweden)
Leny Yuliati
2014-05-01
Full Text Available Background: The hydrothermal method was used as a new approach to prepare a series of Ag-doped Cd0.1Zn0.9S photocatalysts. The effect of Ag doping on the properties and photocatalytic activity of Cd0.1Zn0.9S was studied for the hydrogen production from water reduction under visible light irradiation.Results: Compared to the series prepared by the co-precipitation method, samples prepared by the hydrothermal method performed with a better photocatalytic activity. The sample with the optimum amount of Ag doping showed the highest hydrogen production rate of 3.91 mmol/h, which was 1.7 times higher than that of undoped Cd0.1Zn0.9S. With the Ag doping, a red shift in the optical response was observed, leading to a larger portion of the visible light absorption than that of without doping. In addition to the larger absorption in the visible-light region, the increase in photocatalytic activity of samples with Ag doping may also come from the Ag species facilitating electron–hole separation.Conclusion: This study demonstrated that Ag doping is a promising way to enhance the activity of Cd0.1Zn0.9S photocatalyst.
Ac conductivity and relaxation mechanism in Ba0.9Sr0.1TiO3
International Nuclear Information System (INIS)
Singh, A.K.; Barik, Subrat K.; Choudhary, R.N.P.; Mahapatra, P.K.
2009-01-01
The ac conductivity and relaxation mechanism in Ba 0.9 Sr 0.1 TiO 3 ceramics have been investigated systematically. A high-temperature solid-state reaction technique was used to synthesize the compound. The formation of the compound was checked by an X-ray diffraction (XRD) technique. The dielectric permittivity and the loss tangent of the sample were measured in a frequency range from 1 kHz to 1 MHz at different temperatures (30-500 deg. C). A study on dielectric properties reveals the electrical relaxation phenomenon occurs in the material. The activation energy was calculated from the temperature variation of dc conductivity. Studies of frequency and temperature dependence of ac conductivity of the compound suggest that conduction process in the material is thermally activated.
Microsoft Support Phone Number +1-877-353-1149(toll-free) Microsoft Helpline Phone Number
Allina willson
2018-01-01
Microsoft Helpline Phone Number Call Now: +1-877-353-1149 for Microsoft support and services. This is Trusted Microsoft Support number provide instant support.if you get any problem while using Microsoft office just relaxed because Microsoft support phone number +1-877-353-1149 is here to provide instant help of microsoft issues. Just dial our Microsoft support phone number +1-877-353-1149 and get instant online support.
Number of radiological examinations in Finland in 2000
Hakanen, A
2002-01-01
STUK (Radiation and Nuclear Safety Authority) collected the number of radiological examinations in Finland in 2000. The work was based on a decree of the ministry of social affairs and health on the medical use of radiation. The work was done in cooperation with the Finnish work group of nomenclature of radiological examinations and procedures and professor Seppo Soimakallio. In 2000, ca. 4.1 million x-ray examinations were made in Finland. In 1984 and in 1995, the numbers were ca. 4.6 million and 4.2 million, respectively, indicating that the total number of x-ray examinations has remained nearly unaltered. The proportions of conventional x-ray examinations, computed tomography examinations, angiographic and interventional procedures were ca. 93.5 %, 5.0 %, 0.9 % and 0.6 %, respectively. The reported number of ultrasound examinations was ca. 0.5 million. The reported number of MRI examinations was ca. 0.1 million.
Influence of Cobalt Doping on the Physical Properties of Zn0.9Cd0.1S Nanoparticles
Directory of Open Access Journals (Sweden)
Gupta Hari Om
2009-01-01
Full Text Available Abstract Zn0.9Cd0.1S nanoparticles doped with 0.005–0.24 M cobalt have been prepared by co-precipitation technique in ice bath at 280 K. For the cobalt concentration >0.18 M, XRD pattern shows unidentified phases along with Zn0.9Cd0.1S sphalerite phase. For low cobalt concentration (≤0.05 M particle size, d XRDis ~3.5 nm, while for high cobalt concentration (>0.05 M particle size decreases abruptly (~2 nm as detected by XRD. However, TEM analysis shows the similar particle size (~3.5 nm irrespective of the cobalt concentration. Local strain in the alloyed nanoparticles with cobalt concentration of 0.18 M increases ~46% in comparison to that of 0.05 M. Direct to indirect energy band-gap transition is obtained when cobalt concentration goes beyond 0.05 M. A red shift in energy band gap is also observed for both the cases. Nanoparticles with low cobalt concentrations were found to have paramagnetic nature with no antiferromagnetic coupling. A negative Curie–Weiss temperature of −75 K with antiferromagnetic coupling was obtained for the high cobalt concentration.
International Nuclear Information System (INIS)
Xu, Yang; Yu, Jingang; Peng, Sui; Liu, Suqin; Wei, Zhongqiang; Li, Xianhong; Li, Yajuan
2012-01-01
Homogeneous carbon-coated LiFe 0.9 Mn 0.1 PO 4 cathode material was synthesized by one-step solid-state reaction using glucose as carbon source. Powder X-ray diffractometry (XRD), transmission electron microscopy (TEM), cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS) and galvanostatic measurements were employed to characterize the samples. Mn-doping and carbon co-modification did not affect the olivine structure of LiFePO 4 , but improved its kinetics in terms of capacity delivery, polarization and rate capability. When compared with the undoped LiFePO 4 /C, the LiFe 0.9 Mn 0.1 PO 4 /C sample presented good size distribution - around 100-200 nm - and better electrochemical performance. At current rates of 0.1, 1.0, 3.0 and 10.0 C (C = 170 mA g -1 ), the LiFe 0.9 Mn 0.1 PO 4 /C electrode delivered discharge capacities of 154.1, 138.8, 120.0 and 94.0 mA h g -1 , respectively. Results obtained by cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) indicated that the polarization and charge transfer resistance of the sample were greatly decreased by Mn-doping. (author)
NCBI nr-aa BLAST: CBRC-GACU-09-0004 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GACU-09-0004 ref|XP_747491.1| K+ homeostasis protein Kha1, putative [Aspergill...us fumigatus Af293] gb|EAL85453.1| K+ homeostasis protein Kha1, putative [Aspergillus fumigatus Af293] XP_747491.1 0.53 28% ...
Takemae, Nobuhiro; Harada, Michiyo; Nguyen, Phuong Thanh; Nguyen, Tung; Nguyen, Tien Ngoc; To, Thanh Long; Nguyen, Tho Dang; Pham, Vu Phong; Le, Vu Tri; Do, Hoa Thi; Vo, Hung Van; Le, Quang Vinh Tin; Tran, Tan Minh; Nguyen, Thanh Duy; Thai, Phuong Duy; Nguyen, Dang Hoang; Le, Anh Quynh Thi; Nguyen, Diep Thi; Uchida, Yuko; Saito, Takehiko
2017-01-01
Active surveillance of influenza A viruses of swine (IAV-S) involving 262 farms and 10 slaughterhouses in seven provinces in northern and southern Vietnam from 2010 to 2015 yielded 388 isolates from 32 farms; these viruses were classified into H1N1, H1N2, and H3N2 subtypes. Whole-genome sequencing followed by phylogenetic analysis revealed that the isolates represented 15 genotypes, according to the genetic constellation of the eight segments. All of the H1N1 viruses were entirely A(H1N1)pdm09 viruses, whereas all of the H1N2 and H3N2 viruses were reassortants among 5 distinct ancestral viruses: H1 and H3 triple-reassortant (TR) IAV-S that originated from North American pre-2009 human seasonal H1, human seasonal H3N2, and A(H1N1)pdm09 viruses. Notably, 93% of the reassortant IAV-S retained M genes that were derived from A(H1N1)pdm09, suggesting some advantage in terms of their host adaptation. Bayesian Markov chain Monte Carlo analysis revealed that multiple introductions of A(H1N1)pdm09 and TR IAV-S into the Vietnamese pig population have driven the genetic diversity of currently circulating Vietnamese IAV-S. In addition, our results indicate that a reassortant IAV-S with human-like H3 and N2 genes and an A(H1N1)pdm09 origin M gene likely caused a human case in Ho Chi Minh City in 2010. Our current findings indicate that human-to-pig transmission as well as cocirculation of different IAV-S have contributed to diversifying the gene constellations of IAV-S in Vietnam. This comprehensive genetic characterization of 388 influenza A viruses of swine (IAV-S) isolated through active surveillance of Vietnamese pig farms from 2010 through 2015 provides molecular epidemiological insight into the genetic diversification of IAV-S in Vietnam after the emergence of A(H1N1)pdm09 viruses. Multiple reassortments among A(H1N1)pdm09 viruses and enzootic IAV-S yielded 14 genotypes, 9 of which carried novel gene combinations. The reassortants that carried M genes derived from A(H1N1
Energy Technology Data Exchange (ETDEWEB)
Parjansri, P. [Rajamangala University of Technology Krungthep, Physics Division, Faculty of Science and Technology, Bangkok (Thailand); Intatha, U. [Mae Fah Luang University, School of Science, Chiang Rai (Thailand); Guo, R.; Bhalla, A.S. [University of Texas at San Antonio, Department of Electrical and Computer Engineering, Faculty of Engineering, San Antonio, TX (United States); Eitssayeam, S. [Chiang Mai University, Department of Physics and Materials Science, Faculty of Science, Chiang Mai (Thailand); Chiang Mai University, Materials Science Research Center, Faculty of Science, Chiang Mai (Thailand)
2016-09-15
This work was to investigate the effects of antimony oxide (Sb{sub 2}O{sub 3}) on the electrical properties of Ba{sub 0.9}Ca{sub 0.1}Zr{sub 0.1}Ti{sub 0.9}O{sub 3} (BCZT) ceramics and was prepared by adding 1 mol% of BCZT nanocrystals. The seed is nanocrystals of BCZT which was synthesized by the molten salt method. The ceramics powders were prepared by the mixed oxide method using BaCO{sub 3}, CaCO{sub 3}, ZrO{sub 2}, TiO{sub 2} as starting materials, and the BCZT seed was added as nanocrystal for induce phase transition. They were doped with x mol% Sb{sub 2}O{sub 3} (x = 0.0-0.5). Results indicated that all samples show pure perovskite phase. The Sb{sub 2}O{sub 3} enhanced the electrical properties of the ceramic systems. Excellent values of a dielectric constant (ε {sub r}) at room temperature (T{sub r}) were 4086 with sample of x = 0.5, and at Curie temperature (T{sub c}) was 15,485 for samples with x = 0.1. The highest remnant polarization (P{sub r}), piezoelectric charge coefficient (d{sub 33}), piezoelectric voltage coefficient (g{sub 33}), electromechanical coefficient for planar mode (k{sub p}) and thickness mode (k{sub t}) values were 6.3 μC/cm{sup 2}, 346 pC/N, 15.6 x 10{sup -3} Vm/N, 42 and 41 %, respectively, which were obtained for the sample of x = 0.2 mol% Sb. (orig.)
76 FR 59676 - Combined Notice of Filings #1
2011-09-27
... MBR Tariff to be effective 10/1/2011. Filed Date: 09/16/2011. Accession Number: 20110916-5146. Comment... 35.1: ONEOK Energy Services Company Baseline MBR Filing to be effective 9/16/2011. Filed Date: 09/16... Services Order No. 697 Compliance Filing of MBR Tariff to be effective 9/16/2011. Filed Date: 09/16/2011...
NCBI nr-aa BLAST: CBRC-HSAP-09-0074 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-HSAP-09-0074 ref|XP_001558290.1| hypothetical protein BC1G_02954 [Botryotinia fuck...eliana B05.10] gb|EDN18805.1| hypothetical protein BC1G_02954 [Botryotinia fuckeliana B05.10] XP_001558290.1 2.7 34% ...
NCBI nr-aa BLAST: CBRC-TNIG-09-0017 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-09-0017 ref|NP_001079227.1| shaker-like potassium channel subunit Kv1.3B ...[Xenopus laevis] gb|AAK83378.1|AF395810_1 shaker-like potassium channel subunit Kv1.3B [Xenopus laevis] NP_001079227.1 0.0 86% ...
NCBI nr-aa BLAST: CBRC-TNIG-09-0017 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-09-0017 ref|NP_001025549.1| potassium voltage-gated channel, shaker-relat...ed subfamily, member 3 [Gallus gallus] gb|AAP94028.1| shaker subfamily potassium channel Kv1.3 [Gallus gallus] NP_001025549.1 0.0 83% ...
NCBI nr-aa BLAST: CBRC-GACU-09-0056 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GACU-09-0056 sp|P48766|NAC1_CAVPO Sodium/calcium exchanger 1 precursor (Na(+)/Ca(2+)-exchange... protein 1) gb|AAA73904.1| sodium-calcium exchanger prf||2108269A Na/Ca exchanger P48766 0.0 68% ...
CAT-ASVAB Technical Bulletin Number 1
2006-03-01
CAT -ASVAB Technical Bulletin #1 Personnel Testing Division Defense Manpower Data Center March 2006 Report...2. REPORT TYPE N/A 3. DATES COVERED - 4. TITLE AND SUBTITLE CAT -ASVAB Technical Bulletin #1 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c...Hetter, R. D. "Psychometric Procedures for Administering CAT -ASVAB" (pp. 131-140) Chapter 4 Hetter, R. D., & Sympson J. B. "Item Exposure
NCBI nr-aa BLAST: CBRC-PTRO-09-0001 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-PTRO-09-0001 ref|ZP_01444684.1| hypothetical protein R2601_22801 [Roseovarius ...sp. HTCC2601] gb|EAU45065.1| hypothetical protein R2601_22801 [Roseovarius sp. HTCC2601] ZP_01444684.1 0.32 34% ...
NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MDOM-09-0050 ref|NP_001017377.1| progestin and adipoQ receptor family member I...V [Rattus norvegicus] gb|AAH92635.1| Progestin and adipoQ receptor family member IV [Rattus norvegicus] gb|EDM03772.1| progesti
Directory of Open Access Journals (Sweden)
Žarkov Marija
2015-01-01
Full Text Available Background/Aim. Spinal muscular atrophy (SMA is an autosomal recessive disease characterized by degeneration of alpha motor neurons in the spinal cord and the medulla oblongata, causing progressive muscle weakness and atrophy. The aim of this study was to determine association between the SMN2 gene copy number and disease phenotype in Serbian patients with SMA with homozygous deletion of exon 7 of the SMN1 gene. Methods. The patients were identified using regional Serbian hospital databases. Investigated clinical characteristics of the disease were: patients’ gender, age at disease onset, achieved and current developmental milestones, disease duration, current age, and the presence of the spinal deformities and joint contractures. The number of SMN1 and SMN2 gene copies was determined using real-time polymerase chain reaction (PCR. Results. Among 43 identified patients, 37 (86.0% showed homozygous deletion of SMN1 exon 7. One (2.7% of 37 patients had SMA type I with 3 SMN2 copies, 11 (29.7% patients had SMA type II with 3.1 ± 0.7 copies, 17 (45.9% patients had SMA type III with 3.7 ± 0.9 copies, while 8 (21.6% patients had SMA type IV with 4.2 ± 0.9 copies. There was a progressive increase in the SMN2 gene copy number from type II towards type IV (p < 0.05. A higher SMN2 gene copy number was associated with better current motor performance (p < 0.05. Conclusion. In the Serbian patients with SMA, a higher SMN2 gene copy number correlated with less severe disease phenotype. A possible effect of other phenotype modifiers should not be neglected.
NCBI nr-aa BLAST: CBRC-MMUS-09-0186 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0186 ref|ZP_01510169.1| ABC-2 type transporter, NodJ family [Burkholderia phytofirm...ans PsJN] gb|EAV05032.1| ABC-2 type transporter, NodJ family [Burkholderia phytofirmans PsJN] ZP_01510169.1 1.4 31% ...
Magnetic transitions in double perovskite Sr2FeRe1-xSbxO6 (0≤x≤0.9)
International Nuclear Information System (INIS)
Jung, Alexandra; Ksenofontov, Vadim; Reiman, Sergey; Therese, Helen Annal; Felser, Claudia; Tremel, Wolfgang; Kolb, Ute
2006-01-01
The double perovskites Sr 2 FeMO 6 (M=Re,Mo) belong to the important class of half-metallic magnetic materials. In this study we explore the effect of replacing the electronic 5d buffer element Re with variable valency by the main group element Sb with fixed valency. X-ray diffraction reveals Sr 2 FeRe 1-x Sb x O 6 (0 2 FeReO 6 changes to antiferromagnetic upon Sb substitution as was determined by magnetic susceptibility measurements. Samples up to a doping level of 0.3 are ferrimagnetic, while Sb contents higher than 0.6 result in an overall antiferromagnetic behavior. 57 Fe and 121 Sb Moessbauer spectroscopy specifies the valence state of Sb to be +5 within the whole range of substitution whereas the Fe valence state changes from +2.7 for the parent compound to +2.9 for Sr 2 FeRe 0.1 Sb 0.9 O 6 . Accordingly, Fe adopts the role of an electronic buffer element from Re upon heavy Sb doping. Additionally, 57 Fe Moessbauer results show a coexistence of ferri- and antiferromagnetic clusters within the same perovskite-type crystal structure in the Sb substitution range 0.3 2 FeReO 6 and Sr 2 FeRe 0.9 Sb 0.1 O 6 are ''purely'' ferrimagnetic and Sr 2 FeRe 0.1 Sb 0.9 O 6 contains antiferromagnetically ordered Fe sites only. Consequently, a replacement of the Re atoms by a nonmagnetic main group element such as Sb blocks the superexchange pathways -Fe-O-Re(Sb)-O-Fe- along the crystallographic axis of the perovskite unit cell and destroys the itinerant magnetism of the parent compound
Wolf, Heinz; Stauffer, Tony; Chen, Shu-Chen Y; Lee, Yoojin; Forster, Ronald; Ludzinski, Miron; Kamat, Madhav; Godorov, Phillip; Guazzo, Dana Morton
2009-01-01
ASTM F2338-09 Standard Test Method for Nondestructive Detection of Leaks in Packages by Vacuum Decay Method is applicable for leak-testing rigid and semi-rigid non-lidded trays; trays or cups sealed with porous barrier lidding materials; rigid, nonporous packages; and flexible, nonporous packages. Part 1 of this series describes the precision and bias studies performed in 2008 to expand this method's scope to include rigid, nonporous packages completely or partially filled with liquid. Round robin tests using three VeriPac 325/LV vacuum decay leak testers (Packaging Technologies & Inspection, LLC, Tuckahoe, NY) were performed at three test sites. Test packages were 1-mL glass syringes. Positive controls had laser-drilled holes in the barrel ranging from about 5 to 15 microm in nominal diameter. Two different leak tests methods were performed at each site: a "gas leak test" performed at 250 mbar (absolute) and a "liquid leak test" performed at about 1 mbar (absolute). The gas leak test was used to test empty, air-filled syringes. All defects with holes > or = 5.0 microm and all no-defect controls were correctly identified. The only false negative result was attributed to a single syringe with a ASTM F2338-09 test method and the precision and bias study report are available by contacting ASTM International in West Conshohocken, PA, USA (www.astm.org).
2011-02-22
... DEPARTMENT OF STATE [Public Notice 7339] 30-Day Notice of Proposed Information Collection: Refugee... accordance with the Paperwork Reduction Act of 1995. Title of Information Collection: Refugee Biographic Data... Originating Office: Bureau of Population, Refugees, and Migration, PRM/A Form Number: N/A Respondents: Refugee...
Hong Kong domestic health spending: financial years 1989/90 to 2008/09.
Tin, K Y K; Tsoi, P K O; Lee, Y H; Tsui, E L H; Lam, D W S; Chui, A W M; Lo, S V
2012-08-01
This report presents the latest estimates of Hong Kong domestic health spending for financial years 1989/90 to 2008/09, cross-stratified and categorised by financing source, provider and function. Total expenditure on health (TEH) was HK$84,391 million in financial year 2008/09, which represents an increase of HK$5030 million or 6.3% over the preceding year. Amid the financial tsunami in late 2008, TEH grew faster relative to gross domestic product (GDP) leading to a marked increase as a percentage of GDP from 4.8% in 2007/08 to 5.1% in 2008/09. During the period 1989/90 to 2008/09, TEH per capita (at constant 2009 prices) grew at an average annual rate of 4.9%, which was faster than that of per capita GDP by 2.0 percentage points. 6.4% when compared with 2007/08, reaching HK$41 257 million and HK$43 134 million, respectively. Consequently, public and private shares of total health expenditure remained the same in the 2 years at 48.9% and 51.1%, respectively. Regarding private spending, the most important source of health financing was out-of-pocket payments by households (35.4% of TEH), followed by employer-provided group medical benefits (7.5%) and private insurance (6.4%). During the period, a growing number of households (mostly in middle to high-income groups) subscribed to pre-payment plans for financing health care. As such, private insurance has taken on an increasingly important role for financing private spending. Of the HK$84 391 million total health expenditure in 2008/09, current expenditure comprised HK$81 186 million (96.2%), whereas HK$3206 million (3.8%) was for capital expenses (ie investment in medical facilities). Analysed by health care function, services for curative care accounted for the largest share of total health spending (66.1%), which was made up of ambulatory services (32.8%), in-patient curative care (28.8%), day patient hospital services (3.9%) and home care (0.5%). Notwithstanding the small share of total spending for day patient
NCBI nr-aa BLAST: CBRC-PABE-09-0037 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-PABE-09-0037 ref|YP_890142.1| hypothetical protein MSMEG_5916 [Mycobacterium sme...gmatis str. MC2 155] gb|ABK71889.1| hypothetical protein MSMEG_5916 [Mycobacterium smegmatis str. MC2 155] YP_890142.1 0.033 36% ...
A 60 GOPS/W, -1.8 V to 0.9 V body bias ULP cluster in 28 nm UTBB FD-SOI technology
Rossi, Davide; Pullini, Antonio; Loi, Igor; Gautschi, Michael; Gürkaynak, Frank K.; Bartolini, Andrea; Flatresse, Philippe; Benini, Luca
2016-03-01
Ultra-low power operation and extreme energy efficiency are strong requirements for a number of high-growth application areas, such as E-health, Internet of Things, and wearable Human-Computer Interfaces. A promising approach to achieve up to one order of magnitude of improvement in energy efficiency over current generation of integrated circuits is near-threshold computing. However, frequency degradation due to aggressive voltage scaling may not be acceptable across all performance-constrained applications. Thread-level parallelism over multiple cores can be used to overcome the performance degradation at low voltage. Moreover, enabling the processors to operate on-demand and over a wide supply voltage and body bias ranges allows to achieve the best possible energy efficiency while satisfying a large spectrum of computational demands. In this work we present the first ever implementation of a 4-core cluster fabricated using conventional-well 28 nm UTBB FD-SOI technology. The multi-core architecture we present in this work is able to operate on a wide range of supply voltages starting from 0.44 V to 1.2 V. In addition, the architecture allows a wide range of body bias to be applied from -1.8 V to 0.9 V. The peak energy efficiency 60 GOPS/W is achieved at 0.5 V supply voltage and 0.5 V forward body bias. Thanks to the extended body bias range of conventional-well FD-SOI technology, high energy efficiency can be guaranteed for a wide range of process and environmental conditions. We demonstrate the ability to compensate for up to 99.7% of chips for process variation with only ±0.2 V of body biasing, and compensate temperature variation in the range -40 °C to 120 °C exploiting -1.1 V to 0.8 V body biasing. When compared to leading-edge near-threshold RISC processors optimized for extremely low power applications, the multi-core architecture we propose has 144× more performance at comparable energy efficiency levels. Even when compared to other low-power processors
DEFF Research Database (Denmark)
Broberg, Eeva; Melidou, Angeliki; Prosenc, Katarina
2016-01-01
Influenza A(H1N1)pdm09 viruses predominated in the European influenza 2015/16 season. Most analysed viruses clustered in a new genetic subclade 6B.1, antigenically similar to the northern hemisphere vaccine component A/California/7/2009. The predominant influenza B lineage was Victoria compared...
Directory of Open Access Journals (Sweden)
Koichiro Kudo
Full Text Available BACKGROUND: Pneumonia patients with wheezing due to influenza A(H1N1pdm09 were frequently treated with systemic corticosteroids in Japan although systemic corticosteroid for critically ill patients with pneumonia caused by influenza A(H1N1pdm09 has been controversial. Applicability of systemic corticosteroid treatment needs to be evaluated. METHODS/PRINCIPAL FINDINGS: We retrospectively reviewed 89 subjects who were diagnosed with influenza A(H1N1pdm09 and admitted to a national hospital, Tokyo during the pandemic period. The median age of subjects (45 males was 8 years (range, 0-71. All subjects were treated with antiviral agents and the median time from symptom onset to initiation of antiviral agents was 2 days (range, 0-7. Subjects were classified into four groups: upper respiratory tract infection, wheezing illness, pneumonia with wheezing, and pneumonia without wheezing. The characteristics of each group was evaluated. A history of asthma was found more frequently in the wheezing illness (55.6% and pneumonia with wheezing (43.3% groups than in the other two groups (p = 0.017. Corticosteroid treatment was assessed among subjects with pneumonia. Oxygen saturation was lower in subjects receiving corticosteroids (steroid group than in subjects not receiving corticosteroids (no-steroid group (p<0.001. The steroid group required greater oxygen supply than the no-steroid group (p<0.001. No significant difference was found by the Kaplan-Meier method between the steroid and the no-steroid groups in hours to fever alleviation from the initiation of antiviral agents and hospitalization days. In logistic regression analysis, wheezing, pneumonia and oxygen saturation were independent factors associated with using systemic corticosteroids. CONCLUSION: Patients with wheezing and a history of asthma were frequently found in the study subjects. Systemic corticosteroids together with early administration of antiviral agents to pneumonia with wheezing and
General displaced SU(1, 1) number states: Revisited
Energy Technology Data Exchange (ETDEWEB)
Dehghani, A., E-mail: alireza.dehghani@gmail.com, E-mail: a-dehghani@tabrizu.ac.ir [Physics Department, Payame Noor University, P.O. Box 19395-3697 Tehran (Iran, Islamic Republic of)
2014-04-15
The most general displaced number states, based on the bosonic and an irreducible representation of the Lie algebra symmetry of su(1, 1) and associated with the Calogero-Sutherland model are introduced. Here, we utilize the Barut-Girardello displacement operator instead of the Klauder-Perelomov counterpart, to construct new kind of the displaced number states which can be classified in nonlinear coherent states regime, too, with special nonlinearity functions. They depend on two parameters, and can be converted into the well-known Barut-Girardello coherent and number states, respectively, depending on which of the parameters equal to zero. A discussion of the statistical properties of these states is included. Significant are their squeezing properties and anti-bunching effects which can be raised by increasing the energy quantum number. Depending on the particular choice of the parameters of the above scenario, we are able to determine the status of compliance with flexible statistics. Major parts of the issue is spent on something that these states, in fact, should be considered as new kind of photon-added coherent states, too. Which can be reproduced through an iterated action of a creation operator on new nonlinear Barut-Girardello coherent states. Where the latter carry, also, outstanding statistical features.
L'Huillier, Arnaud G; Abed, Yacine; Petty, Tom J; Cordey, Samuel; Thomas, Yves; Bouhy, Xavier; Schibler, Manuel; Simon, Audrey; Chalandon, Yves; van Delden, Christian; Zdobnov, Evgeny; Boquete-Suter, Patricia; Boivin, Guy; Kaiser, Laurent
2015-12-01
An influenza A(H1N1)pdm09 infection was diagnosed in a hematopoietic stem cell transplant recipient during conditioning regimen. He was treated with oral oseltamivir, later combined with intravenous zanamivir. The H275Y neuraminidase (NA) mutation was first detected, and an E119D NA mutation was identified during zanamivir therapy. Recombinant wild-type (WT) E119D and E119D/H275Y A(H1N1)pdm09 NA variants were generated by reverse genetics. Susceptibility to NA inhibitors (NAIs) was evaluated with a fluorometric assay using the 2'-(4-methylumbelliferyl)-α-D-N-acetylneuraminic acid (MUNANA) substrate. Susceptibility to favipiravir (T-705) was assessed using plaque reduction assays. The NA affinity and velocity values were determined with NA enzymatic studies. We identified an influenza A(H1N1)pdm09 E119D mutant that exhibited a marked increase in the 50% inhibitory concentrations against all tested NAIs (827-, 25-, 286-, and 702-fold for zanamivir, oseltamivir, peramivir, and laninamivir, respectively). The double E119D/H275Y mutation further increased oseltamivir and peramivir 50% inhibitory concentrations by 790- and >5000-fold, respectively, compared with the WT. The mutant viruses remained susceptible to favipiravir. The NA affinity and velocity values of the E119D variant decreased by 8.1-fold and 4.5-fold, respectively, compared with the WT. The actual emergence of a single NA mutation conferring pan-NAI resistance in the clinical setting reinforces the pressing need to develop new anti-influenza strategies. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
3D network single-phase Ni0.9Zn0.1O as anode materials for lithium-ion batteries
DEFF Research Database (Denmark)
Huang, Guoyong; Guo, Xueyi; Cao, Xiao
2016-01-01
A novel 3D network single-phase Ni0.9Zn0.1O has been designed and synthesized by calcining a special metal-organic precursor (MOP) (MeO2C3H6, Me=Ni and Zn, the molar ratio of Ni: Zn=9:1) as the self-sacrificing template for the first time. Comparing with NiO or the mixture of NiO and ZnO, the new...
Alteraciones morfológicas en pulmón por la influenza A H1N1/v09 en autopsias, Colombia, 2009
Jorge Rivera; Ladys Sarmiento; Edgar Parra; Gabriel Toro; Marcela Neira; Jairo Méndez; Juliana Barbosa; María Leonor Caldas
2011-01-01
Introducción. La influenza es una infección respiratoria aguda que se presenta de forma estacional y pandémica. En el 2009, la Organización Mundial de Salud (OMS) declaró una pandemia por influenza de tipo A en la que se reportaron en Colombia 3.876 casos de infección, de los cuales 239 fallecieron. Objetivo. Describir los cambios morfológicos asociados a la infección por el virus A H1N1/v09 en tejido pulmonar de autopsias de la pandemia de 2009 en Colombia. Materiales y métodos. Se est...
NCBI nr-aa BLAST: CBRC-TNIG-09-0033 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-09-0033 ref|ZP_01901905.1| hypothetical protein RAZWK3B_08726 [Roseobacte...r sp. AzwK-3b] gb|EDM72321.1| hypothetical protein RAZWK3B_08726 [Roseobacter sp. AzwK-3b] ZP_01901905.1 0.13 31% ...
Neutron Diffraction Study On Gamma To Alpha Phase Transition In Ce0.9th0.1 Alloy
Energy Technology Data Exchange (ETDEWEB)
Lashley, Jason C1 [Los Alamos National Laboratory; Heffner, Robert H [Los Alamos National Laboratory; Llobet, A [Los Alamos National Laboratory; Darling, T W [U OF NEVADA; Jeong, I K [PUSAN NATL UNIV
2008-01-01
Comprehensive neutron diffraction measurements were performed to study the isostructural {gamma} {leftrightarrow} {alpha} phase transition in Ce{sub 0.9}Th{sub 0.1} alloy. Using Rietveld refinements, we obtained lattice and thermal parameters as a function of temperature. From the temperature slope of the thermal parameters, we determined Debye temperatures {Theta}{sup {gamma}}{sub D} = 133(1) K and {Theta}{sup {alpha}}{sub D} = 140(1) K for the {gamma} phase and the {alpha} phase, respectively. This result implies that the vibrational entropy change is not significant at the {gamma} {leftrightarrow} {alpha} transition, contrary to that from elemental Cerium [Phys. Rev. Lett. 92, 105702, 2004].
Directory of Open Access Journals (Sweden)
Maria José Couto Oliveira
2014-11-01
Full Text Available After the World Health Organization officially declared the end of the first pandemic of the XXI century in August 2010, the influenza A(H1N1pdm09 virus has been disseminated in the human population. In spite of its sustained circulation, very little on phylogenetic data or oseltamivir (OST resistance is available for the virus in equatorial regions of South America. In order to shed more light on this topic, we analysed the haemagglutinin (HA and neuraminidase (NA genes of influenza A(H1N1pdm09 positive samples collected during the pandemic period in the Pernambuco (PE, a northeastern Brazilian state. Complete HA sequences were compared and amino acid changes were related to clinical outcome. In addition, the H275Y substitution in NA, associated with OST resistance, was investigated by pyrosequencing. Samples from PE were grouped in phylogenetic clades 6 and 7, being clustered together with sequences from South and Southeast Brazil. The D222N/G HA gene mutation, associated with severity, was found in one deceased patient that was pregnant. Additionally, the HA mutation K308E, which appeared in Brazil in 2010 and was only detected worldwide the following year, was identified in samples from hospitalised cases. The resistance marker H275Y was not identified in samples tested. However, broader studies are needed to establish the real frequency of resistance in this Brazilian region.
40 CFR 164.1 - Number of words.
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Number of words. 164.1 Section 164.1... OTHER HEARINGS CALLED PURSUANT TO SECTION 6 OF THE ACT General § 164.1 Number of words. As used in this part, a word in the singular form shall be deemed to import the plural, and vice versa, as the case may...
NCBI nr-aa BLAST: CBRC-PABE-09-0018 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-PABE-09-0018 ref|NP_005276.2| G protein-coupled receptor 7 [Homo sapiens] gb|AAH69117.1| Neuropeptides... B/W receptor 1 [Homo sapiens] gb|AAI07102.1| Neuropeptides B/W receptor 1 [Homo sap...iens] gb|EAW86722.1| neuropeptides B/W receptor 1 [Homo sapiens] NP_005276.2 0.0 100% ...
NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MDOM-09-0050 gb|EAW85442.1| progestin and adipoQ receptor family member IV, is...oform CRA_b [Homo sapiens] gb|EAW85444.1| progestin and adipoQ receptor family member IV, isoform CRA_b [Homo sapiens] EAW85442.1 3e-94 65% ...
2010-06-28
... SECURITIES AND EXCHANGE COMMISSION [Release No. 34-62329; File No. SR-OCC-2010-09] Self-Regulatory... on the proposed rule change from interested persons. \\1\\ 15 U.S.C. 78s(b)(1). I. Self-Regulatory... futures any futures contracts on Sprott Physical Gold Shares. II. Self-Regulatory Organization's Statement...
Registration of 'CP 09-2392' Sugarcane
CP 09-2392’ (Reg. No.____; PI _____) sugarcane, a complex hybrid of Saccharum spp, was developed through cooperative research conducted by the USDA-ARS, the University of Florida, and the Florida Sugar Cane League, Inc., and was released to growers in June 2016. ‘CP 09-2392’ was selected from a cro...
Influences of mach number and flow incidence on aerodynamic losses of steam turbine blade
International Nuclear Information System (INIS)
Yoo, Seok Jae; Ng, Wing Fai
2000-01-01
An experiment was conducted to investigate the aerodynamic losses of high pressure steam turbine nozzle (526A) subjected to a large range of incident angles (-34 .deg. to 26 .deg. ) and exit Mach numbers (0.6 and 1.15). Measurements included downstream pitot probe traverses, upstream total pressure, and endwall static pressures. Flow visualization techniques such as shadowgraph and color oil flow visualization were performed to complement the measured data. When the exit Mach number for nozzles increased from 0.9 to 1.1 the total pressure loss coefficient increased by a factor of 7 as compared to the total pressure losses measured at subsonic conditions (M 2 <0.9). For the range of incidence tested, the effect of flow incidence on the total pressure losses is less pronounced. Based on the shadowgraphs taken during the experiment, it's believed that the large increase in losses at transonic conditions is due to strong shock/ boundary layer interaction that may lead to flow separation on the blade suction surface
Directory of Open Access Journals (Sweden)
Elisa Minchole
Full Text Available Recent pandemics of influenza A H1N1pdm09 virus have caused severe illness, especially in young people. Very few studies on influenza A H1N1pdm09 in post-pandemic periods exist, and there is no information on the severity of both seasonal influenza A(H1N1 and A(H3N2 from the same season, adjusting for potential confounders, including vaccine.We performed a retrospective observational study of adults hospitalized during the 2014 season with influenza A(H1N1 or A(H3N2. All patients underwent the same diagnostic and therapeutic protocol in a single hospital, including early Oseltamivir therapy. We included 234 patients: 146 (62.4% influenza A(H1N1 and 88 (37.6% A(H3N2. A(H1N1 patients were younger (p<0.01, developed more pneumonia (p<0.01, respiratory complications (p = 0.015, ARDS (p = 0.047, and septic shock (p = 0.049, were more frequently admitted to the ICU (p = 0.022, required IMV (p = 0.049, and were less frequently vaccinated (p = 0.008. After adjusting for age, comorbidities, time from onset of illness, and vaccine status, influenza A(H1N1 (OR, 2.525, coinfection (OR, 2.821, and no vaccination (OR, 3.086 were independent risk factors for severe disease.Hospitalized patients with influenza A(H1N1 were more than twice as likely to have severe influenza. They were younger and most had not received the vaccine. Our findings suggest that seasonal influenza A(H1N1 maintains some features of pandemic viruses, and recommend wider use of vaccination in younger adult high-risk patients.
Corrosion of Dental Au-Ag-Cu-Pd Alloys in 0.9 % Sodium Chloride Solution
International Nuclear Information System (INIS)
Chiba, Atsushi; Kusayanagi, Yukiharu
2005-01-01
Two Au-Ag-Cu-Pd dental casting alloys (Au:12% and 20%) used. The test solutions used 0.9 % NaCl solution (isotonic sodium chloride solution), 0.9 % NaCl solution containing 1 % lactic acid, and 0.9 % NaCl solution containing 1 % lactic acid and 0.1 mol dm -3 Na 2 S. The surface of two samples in three sample solutions was not natural discoloration during one year. The alloy containing 12 % gold was easily alloyed and the composition was uniform comparing with the alloy containing 20 % gold. The rest potentials have not a little effect after three months. The kinds of metals could not definitely from the oxidation and reduction waves of metal on the cyclic voltammograms. The dissolutions of gold and palladium were 12 % Au sample in the 0.9 % NaCl solution containing 1 % lactic acid and 0.1 mol dm -3 Na 2 S. The pH of solution had an affect on dissolution of copper, and sulfur ion had an affect on dissolution of silver. The copper dissolved amount from 20 % gold sample was about 26 times comparing with that of 12 % gold sample in the 0.9 % solution containing 1 % lactic acid. Corrosion products were silver chloride and copper chloride in NaCl solution, and silver sulfide and copper sulfide in NaCl solution containing Na 2 S
THE STELLAR INITIAL MASS FUNCTION AT 0.9 < z < 1.5
Energy Technology Data Exchange (ETDEWEB)
Martín-Navarro, Ignacio; Trujillo, Ignacio; Vazdekis, Alexandre [Instituto de Astrofísica de Canarias, c/Vía Láctea s/n, E38205 - La Laguna, Tenerife (Spain); Pérez-González, Pablo G.; Esquej, Pilar; Sánchez, Helena Domínguez; Espino, Néstor [Departamento de Astrofísica, Facultad de CC. Físicas, Universidad Complutense de Madrid, E-28040 Madrid (Spain); Barro, Guillermo [UCO/Lick Observatory, Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Bruzual, Gustavo [Centro de Radioastronomía y Astrofísica, UNAM, Campus Morelia, México (Mexico); Charlot, Stéphane [UPMC-CNRS, UMR7095, Institut d' Astrophysique de Paris, F-75014 Paris (France); Cava, Antonio [Observatoire de Genève, Université de Genève, 51 Ch. des Maillettes, 1290 Versoix (Switzerland); Ferreras, Ignacio [Mullard Space Science Laboratory, University College London, Holmbury St. Mary, Dorking, Surrey RH5 6NT (United Kingdom); Barbera, Francesco La [INAF-Osservatorio Astronomico di Capodimonte, Napoli (Italy); Koekemoer, Anton M. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Cenarro, A. Javier, E-mail: imartin@iac [Centro de Estudios de Física del Cosmos de Aragǿn, Plaza San Juan 1, E-44001 Teruel (Spain)
2015-01-01
We explore the stellar initial mass function (IMF) of a sample of 49 massive quiescent galaxies (MQGs) at 0.9 < z < 1.5. We base our analysis on intermediate resolution spectro-photometric data in the GOODS-N field taken in the near-infrared and optical with the Hubble Space Telescope Wide Field Camera 3 G141 grism and the Survey for High-z Absorption Red and Dead Sources. To constrain the slope of the IMF, we have measured the TiO{sub 2} spectral feature, whose strength depends strongly on the content of low-mass stars, as well as on stellar age. Using ultraviolet to near-infrared individual and stacked spectral energy distributions, we have independently estimated the stellar ages of our galaxies. Knowing the age of the stellar population, we interpret the strong differences in the TiO{sub 2} feature as an IMF variation. In particular, for the heaviest z ∼ 1 MQGs (M > 10{sup 11} M {sub ☉}), we find an average age of 1.7 ± 0.3 Gyr and a bottom-heavy IMF (Γ {sub b} = 3.2 ± 0.2). Lighter MQGs (2 × 10{sup 10} < M < 10{sup 11} M {sub ☉}) at the same redshift are younger on average (1.0 ± 0.2 Gyr) and present a shallower IMF slope (Γ{sub b}=2.7{sub −0.4}{sup +0.3}). Our results are in good agreement with the findings about the IMF slope in early-type galaxies of similar mass in the present-day universe. This suggests that the IMF, a key characteristic of the stellar populations in galaxies, is bottom-heavier for more massive galaxies and has remained unchanged in the last ∼8 Gyr.
THE SUBLUMINOUS AND PECULIAR TYPE Ia SUPERNOVA PTF 09dav
International Nuclear Information System (INIS)
Sullivan, M.; Ofek, E. O.; Blake, S.; Podsiadlowski, P.; Kasliwal, M. M.; Cooke, J.; Quimby, R.; Kulkarni, S. R.; Nugent, P. E.; Thomas, R. C.; Poznanski, D.; Howell, D. A.; Arcavi, I.; Gal-Yam, A.; Hook, I. M.; Mazzali, P.; Bildsten, L.; Bloom, J. S.; Cenko, S. B.; Law, N.
2011-01-01
PTF 09dav is a peculiar subluminous Type Ia supernova (SN) discovered by the Palomar Transient Factory (PTF). Spectroscopically, it appears superficially similar to the class of subluminous SN1991bg-like SNe, but it has several unusual features which make it stand out from this population. Its peak luminosity is fainter than any previously discovered SN1991bg-like SN Ia (M B ∼ -15.5), but without the unusually red optical colors expected if the faint luminosity were due to extinction. The photospheric optical spectra have very unusual strong lines of Sc II and Mg I, with possible Sr II, together with stronger than average Ti II and low velocities of ∼6000 km s -1 . The host galaxy of PTF09dav is ambiguous. The SN lies either on the extreme outskirts (∼41 kpc) of a spiral galaxy or in an very faint (M R ≥ -12.8) dwarf galaxy, unlike other 1991bg-like SNe which are invariably associated with massive, old stellar populations. PTF 09dav is also an outlier on the light-curve-width-luminosity and color-luminosity relations derived for other subluminous SNe Ia. The inferred 56 Ni mass is small (0.019 ± 0.003 M sun ), as is the estimated ejecta mass of 0.36 M sun . Taken together, these properties make PTF 09dav a remarkable event. We discuss various physical models that could explain PTF 09dav. Helium shell detonation or deflagration on the surface of a CO white dwarf can explain some of the features of PTF 09dav, including the presence of Sc and the low photospheric velocities, but the observed Si and Mg are not predicted to be very abundant in these models. We conclude that no single model is currently capable of explaining all of the observed signatures of PTF 09dav.
Aamodt, K.; Abeysekara, U.; Abrahantes Quintana, A.; Abramyan, A.; Adamova, D.; Aggarwal, M.M.; Aglieri Rinella, G.; Agocs, A.G.; Aguilar Salazar, S.; Ahammed, Z.; Ahmad, A.; Ahmad, N.; Ahn, S.U.; Akimoto, R.; Akindinov, A.; Aleksandrov, D.; Alessandro, B.; Alfaro Molina, R.; Alici, A.; Almaraz Avina, E.; Alme, J.; Alt, T.; Altini, V.; Altinpinar, S.; Andrei, C.; Andronic, A.; Anelli, G.; Angelov, V.; Anson, C.; Anticic, T.; Antinori, F.; Antinori, S.; Antipin, K.; Antonczyk, D.; Antonioli, P.; Anzo, A.; Aphecetche, L.; Appelshauser, H.; Arcelli, S.; Arceo, R.; Arend, A.; Armesto, N.; Arnaldi, R.; Aronsson, T.; Arsene, I.C.; Asryan, A.; Augustinus, A.; Averbeck, R.; Awes, T.C.; Aysto, J.; Azmi, M.D.; Bablok, S.; Bach, M.; Badala, A.; Baek, Y.W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Baldisseri, A.; Baldit, A.; Ban, J.; Barbera, R.; Barnafoldi, G.G.; Barnby, L.; Barret, V.; Bartke, J.; Barile, F.; Basile, M.; Basmanov, V.; Bastid, N.; Bathen, B.; Batigne, G.; Batyunya, B.; Baumann, C.; Bearden, I.G.; Becker, B.; Belikov, I.; Bellwied, R.; Belmont-Moreno, E.; Belogianni, A.; Benhabib, L.; Beole, S.; Berceanu, I.; Bercuci, A.; Berdermann, E.; Berdnikov, Y.; Betev, L.; Bhasin, A.; Bhati, A.K.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielcik, J.; Bielcikova, J.; Bilandzic, A.; Bimbot, L.; Biolcati, E.; Blanc, A.; Blanco, F.; Blau, D.; Blume, C.; Boccioli, M.; Bock, N.; Bogdanov, A.; Boggild, H.; Bogolyubsky, M.; Bohm, J.; Boldizsar, L.; Bombara, M.; Bombonati, C.; Bondila, M.; Borel, H.; Borisov, A.; Bortolin, C.; Bose, S.; Bosisio, L.; Bossu, F.; Botje, M.; Bottger, S.; Bourdaud, G.; Boyer, B.; Braun, M.; Braun-Munzinger, P.; Bravina, L.; Bregant, M.; Breitner, T.; Bruckner, G.; Brun, R.; Bruna, E.; Bruno, G.E.; Budnikov, D.; Buesching, H.; Buncic, P.; Busch, O.; Buthelezi, Z.; Caffarri, D.; Cai, X.; Caines, H.; Camacho, E.; Camerini, P.; Campbell, M.; Canoa Roman, V.; Capitani, G.P.; Cara Romeo, G.; Carena, F.; Carena, W.; Carminati, F.; Casanova Diaz, A.; Caselle, M.; Castillo Castellanos, J.; Castillo Hernandez, J.F.; Catanescu, V.; Cattaruzza, E.; Cavicchioli, C.; Cerello, P.; Chambert, V.; Chang, B.; Chapeland, S.; Charpy, A.; Charvet, J.L.; Chattopadhyay, S.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Chiavassa, E.; Chibante Barroso, V.; Chinellato, D.D.; Chochula, P.; Choi, K.; Chojnacki, M.; Christakoglou, P.; Christensen, C.H.; Christiansen, P.; Chujo, T.; Chuman, F.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Cobanoglu, O.; Coffin, J.-P.; Coli, S.; Colla, A.; Conesa Balbastre, G.; Conesa del Valle, Z.; Conner, E.S.; Constantin, P.; Contin, G.; Contreras, J.G.; Corrales Morales, Y.; Cormier, T.M.; Cortese, P.; Cortes Maldonado, I.; Cosentino, M.R.; Costa, F.; Cotallo, M.E.; Crescio, E.; Crochet, P.; Cuautle, E.; Cunqueiro, L.; Cussonneau, J.; Dainese, A.; Dalsgaard, H.H.; Danu, A.; Das, I.; Dash, A.; Dash, S.; de Barros, G.O.V.; De Caro, A.; de Cataldo, G.; de Cuveland, J.; De Falco, A.; De Gaspari, M.; de Groot, J.; De Gruttola, D.; De Marco, N.; De Pasquale, S.; De Remigis, R.; de Rooij, R.; de Vaux, G.; Delagrange, H.; Dellacasa, G.; Deloff, A.; Demanov, V.; Denes, E.; Deppman, A.; D'Erasmo, G.; Derkach, D.; Devaux, A.; Di Bari, D.; Di Giglio, C.; Di Liberto, S.; Di Mauro, A.; Di Nezza, P.; Dialinas, M.; Diaz, L.; Diaz, R.; Dietel, T.; Divia, R.; Djuvsland, O.; Dobretsov, V.; Dobrin, A.; Dobrowolski, T.; Donigus, B.; Dominguez, I.; Dordic, O.; Dubey, A.K.; Dubuisson, J.; Ducroux, L.; Dupieux, P.; Dutta Majumdar, A.K.; Dutta Majumdar, M.R.; Elia, D.; Emschermann, D.; Enokizono, A.; Espagnon, B.; Estienne, M.; Esumi, S.; Evans, D.; Evrard, S.; Eyyubova, G.; Fabjan, C.W.; Fabris, D.; Faivre, J.; Falchieri, D.; Fantoni, A.; Fasel, M.; Fateev, O.; Fearick, R.; Fedunov, A.; Fehlker, D.; Fekete, V.; Felea, D.; Fenton-Olsen, B.; Feofilov, G.; Fernandez Tellez, A.; Ferreiro, E.G.; Ferretti, A.; Ferretti, R.; Figueredo, M.A.S.; Filchagin, S.; Fini, R.; Fionda, F.M.; Fiore, E.M.; Floris, M.; Fodor, Z.; Foertsch, S.; Foka, P.; Fokin, S.; Formenti, F.; Fragiacomo, E.; Fragkiadakis, M.; Frankenfeld, U.; Frolov, A.; Fuchs, U.; Furano, F.; Furget, C.; Fusco Girard, M.; Gaardhoje, J.J.; Gadrat, S.; Gagliardi, M.; Gago, A.; Gallio, M.; Ganoti, P.; Ganti, M.S.; Garabatos, C.; Garcia Trapaga, C.; Gebelein, J.; Gemme, R.; Germain, M.; Gheata, A.; Gheata, M.; Ghidini, B.; Ghosh, P.; Giraudo, G.; Giubellino, P.; Gladysz-Dziadus, E.; Glasow, R.; Glassel, P.; Glenn, A.; Gomez Jimenez, R.; Gonzalez Santos, H.; Gonzalez-Trueba, L.H.; Gonzalez-Zamora, P.; Gorbunov, S.; Gorbunov, Y.; Gotovac, S.; Gottschlag, H.; Grabski, V.; Grajcarek, R.; Grelli, A.; Grigoras, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grinyov, B.; Grion, N.; Gros, P.; Grosse-Oetringhaus, J.F.; Grossiord, J.-Y.; Grosso, R.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gulkanyan, H.; Gunji, T.; Gupta, A.; Gupta, R.; Gustafsson, H.-A.; Gutbrod, H.; Haaland, O.; Hadjidakis, C.; Haiduc, M.; Hamagaki, H.; Hamar, G.; Hamblen, J.; Han, B.H.; Harris, J.W.; Hartig, M.; Harutyunyan, A.; Hasch, D.; Hasegan, D.; Hatzifotiadou, D.; Hayrapetyan, A.; Heide, M.; Heinz, M.; Helstrup, H.; Herghelegiu, A.; Hernandez, C.; Herrera Corral, G.; Herrmann, N.; Hetland, K.F.; Hicks, B.; Hiei, A.; Hille, P.T.; Hippolyte, B.; Horaguchi, T.; Hori, Y.; Hristov, P.; Hrivnacova, I.; Hu, S.; Huang, M.; Huber, S.; Humanic, T.J.; Hutter, D.; Hwang, D.S.; Ichou, R.; Ilkaev, R.; Ilkiv, I.; Inaba, M.; Innocenti, P.G.; Ippolitov, M.; Irfan, M.; Ivan, C.; Ivanov, A.; Ivanov, M.; Ivanov, V.; Iwasaki, T.; Jacholkowski, A.; Jacobs, P.; Jancurova, L.; Jangal, S.; Janik, R.; Jena, C.; Jena, S.; Jirden, L.; Jones, G.T.; Jones, P.G.; Jovanovic, P.; Jung, H.; Jung, W.; Jusko, A.; Kaidalov, A.B.; Kalcher, S.; Kalinak, P.; Kalisky, M.; Kalliokoski, T.; Kalweit, A.; Kamal, A.; Kamermans, R.; Kanaki, K.; Kang, E.; Kang, J.H.; Kapitan, J.; Kaplin, V.; Kapusta, S.; Karavichev, O.; Karavicheva, T.; Karpechev, E.; Kazantsev, A.; Kebschull, U.; Keidel, R.; Khan, M.M.; Khan, S.A.; Khanzadeev, A.; Kharlov, Y.; Kikola, D.; Kileng, B.; Kim, D.J; Kim, D.S.; Kim, D.W.; Kim, H.N.; Kim, J.; Kim, J.H.; Kim, J.S.; Kim, M.; Kim, S.H.; Kim, S.; Kim, Y.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Klay, J.L.; Klein, J.; Klein-Bosing, C.; Kliemant, M.; Klovning, A.; Kluge, A.; Knichel, M.L.; Kniege, S.; Koch, K.; Kolevatov, R.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Konevskih, A.; Kornas, E.; Kour, R.; Kowalski, M.; Kox, S.; Kozlov, K.; Kral, J.; Kralik, I.; Kramer, F.; Kraus, I.; Kravcakova, A.; Krawutschke, T.; Krivda, M.; Krumbhorn, D.; Krus, M.; Kryshen, E.; Krzewicki, M.; Kucheriaev, Y.; Kuhn, C.; Kuijer, P.G.; Kumar, L.; Kumar, N.; Kupczak, R.; Kurashvili, P.; Kurepin, A.; Kurepin, A.N.; Kuryakin, A.; Kushpil, S.; Kushpil, V.; Kutouski, M.; Kvaerno, H.; Kweon, M.J.; Kwon, Y.; La Rocca, P.; Lackner, F.; Ladron de Guevara, P.; Lafage, V.; Lal, C.; Lara, Camilo; Larsen, D.T.; Laurenti, G.; Lazzeroni, C.; Le Bornec, Y.; Le Bris, N.; Lee, H.; Lee, K.S.; Lee, S.C.; Lefevre, F.; Lenhardt, M.; Leistam, L.; Lehnert, J.; Lenti, V.; Leon, H.; Leon Monzon, I.; Leon Vargas, H.; Levai, P.; Li, X.; Li, Y.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M.A.; Liu, L.; Loginov, V.; Lohn, S.; Lopez, X.; Lopez Noriega, M.; Lopez-Ramirez, R.; Lopez Torres, E.; Lovhoiden, G.; Lozea Feijo Soares, A.; Lu, S.; Lunardon, M.; Luparello, G.; Luquin, L.; Lutz, J.-R.; Ma, K.; Ma, R.; Madagodahettige-Don, D.M.; Maevskaya, A.; Mager, M.; Mahapatra, D.P.; Maire, A.; Makhlyueva, I.; Mal'Kevich, D.; Malaev, M.; Malagalage, K.J.; Maldonado Cervantes, I.; Malek, M.; Malkiewicz, T.; Malzacher, P.; Mamonov, A.; Manceau, L.; Mangotra, L.; Manko, V.; Manso, F.; Manzari, V.; Mao, Y.; Mares, J.; Margagliotti, G.V.; Margotti, A.; Marin, A.; Martashvili, I.; Martinengo, P.; Martinez Hernandez, M.I.; Martinez Davalos, A.; Martinez Garcia, G.; Maruyama, Y.; Marzari Chiesa, A.; Masciocchi, S.; Masera, M.; Masetti, M.; Masoni, A.; Massacrier, L.; Mastromarco, M.; Mastroserio, A.; Matthews, Z.L.; Matyja, A.; Mayani, D.; Mazza, G.; Mazzoni, M.A.; Meddi, F.; Menchaca-Rocha, A.; Mendez Lorenzo, P.; Meoni, M.; Mercado Perez, J.; Mereu, P.; Miake, Y.; Michalon, A.; Miftakhov, N.; Milano, L.; Milosevic, J.; Minafra, F.; Mischke, A.; Miskowiec, D.; Mitu, C.; Mizoguchi, K.; Mlynarz, J.; Mohanty, B.; Molnar, L.; Mondal, M.M.; Montano Zetina, L.; Monteno, M.; Montes, E.; Morando, M.; Moretto, S.; Morsch, A.; Moukhanova, T.; Muccifora, V.; Mudnic, E.; Muhuri, S.; Muller, H.; Munhoz, M.G.; Munoz, J.; Musa, L.; Musso, A.; Nandi, B.K.; Nania, R.; Nappi, E.; Navach, F.; Navin, S.; Nayak, T.K.; Nazarenko, S.; Nazarov, G.; Nedosekin, A.; Nendaz, F.; Newby, J.; Nianine, A.; Nicassio, M.; Nielsen, B.S.; Nikolaev, S.; Nikolic, V.; Nikulin, S.; Nikulin, V.; Nilsen, B.S.; Nilsson, M.S.; Noferini, F.; Nomokonov, P.; Nooren, G.; Novitzky, N.; Nyatha, A.; Nygaard, C.; Nyiri, A.; Nystrand, J.; Ochirov, A.; Odyniec, G.; Oeschler, H.; Oinonen, M.; Okada, K.; Okada, Y.; Oldenburg, M.; Oleniacz, J.; Oppedisano, C.; Orsini, F.; Ortiz Velasquez, A.; Ortona, G.; Oskarsson, A.; Osmic, F.; Osterman, L.; Ostrowski, P.; Otterlund, I.; Otwinowski, J.; Ovrebekk, G.; Oyama, K.; Ozawa, K.; Pachmayer, Y.; Pachr, M.; Padilla, F.; Pagano, P.; Paic, G.; Painke, F.; Pajares, C.; Pal, S.; Pal, S.K.; Palaha, A.; Palmeri, A.; Panse, R.; Papikyan, V.; Pappalardo, G.S.; Park, W.J.; Pastircak, B.; Pastore, C.; Paticchio, V.; Pavlinov, A.; Pawlak, T.; Peitzmann, T.; Pepato, A.; Pereira, H.; Peressounko, D.; Perez, C.; Perini, D.; Perrino, D.; Peryt, W.; Peschek, J.; Pesci, A.; Peskov, V.; Pestov, Y.; Peters, A.J.; Petracek, V.; Petridis, A.; Petris, M.; Petrov, P.; Petrovici, M.; Petta, C.; Peyre, J.; Piano, S.; Piccotti, A.; Pikna, M.; Pillot, P.; Pinazza, O.; Pinsky, L.; Pitz, N.; Piuz, F.; Platt, R.; Ploskon, M.; Pluta, J.; Pocheptsov, T.; Pochybova, S.; Podesta Lerma, P.L.M.; Poggio, F.; Poghosyan, M.G.; Polak, K.; Polichtchouk, B.; Polozov, P.; Polyakov, V.; Pommeresch, B.; Pop, A.; Posa, F.; Pospisil, V.; Potukuchi, B.; Pouthas, J.; Prasad, S.K.; Preghenella, R.; Prino, F.; Pruneau, C.A.; Pshenichnov, I.; Puddu, G.; Pujahari, P.; Pulvirenti, A.; Punin, A.; Punin, V.; Putis, M.; Putschke, J.; Quercigh, E.; Rachevski, A.; Rademakers, A.; Radomski, S.; Raiha, T.S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Rodriguez Cahuantzi, M.; Rammler, M.; Raniwala, R.; Raniwala, S.; Rasanen, S.S.; Rashevskaya, I.; Rath, S.; Read, K.F.; Real, J.S.; Redlich, K.; Renfordt, R.; Reolon, A.R.; Reshetin, A.; Rettig, F.; Revol, J.-P.; Reygers, K.; Ricaud, H.; Riccati, L.; Ricci, R.A.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Rivetti, A.; Roed, K.; Rohrich, D.; Roman Lopez, S.; Romita, R.; Ronchetti, F.; Rosinsky, P.; Rosnet, P.; Rossegger, S.; Rossi, A.; Roukoutakis, F.; Rousseau, S.; Roy, C.; Roy, P.; Rubio-Montero, A.J.; Rui, R.; Rusanov, I.; Russo, G.; Ryabinkin, E.; Rybicki, A.; Sadovsky, S.; Safarik, K.; Sahoo, R.; Saini, J.; Saiz, P.; Sakata, D.; Salgado, C.A.; Salgueiro Domingues da Silva, R.; Salur, S.; Samanta, T.; Sambyal, S.; Samsonov, V.; Sandor, L.; Sandoval, A.; Sano, M.; Sano, S.; Santo, R.; Santoro, R.; Sarkamo, J.; Saturnini, P.; Scapparone, E.; Scarlassara, F.; Scharenberg, R.P.; Schiaua, C.; Schicker, R.; Schindler, H.; Schmidt, C.; Schmidt, H.R.; Schossmaier, K.; Schreiner, S.; Schuchmann, S.; Schukraft, J.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Scott, P.A.; Segato, G.; Semenov, D.; Senyukov, S.; Seo, J.; Serci, S.; Serkin, L.; Serradilla, E.; Sevcenco, A.; Sgura, I.; Shabratova, G.; Shahoyan, R.; Sharkov, G.; Sharma, N.; Sharma, S.; Shigaki, K.; Shimomura, M.; Shtejer, K.; Sibiriak, Y.; Siciliano, M.; Sicking, E.; Siddi, E.; Siemiarczuk, T.; Silenzi, A.; Silvermyr, D.; Simili, E.; Simonetti, G.; Singaraju, R.; Singh, R.; Singhal, V.; Sinha, B.C.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T.B.; Skjerdal, K.; Smakal, R.; Smirnov, N.; Snellings, R.; Snow, H.; Sogaard, C.; Soloviev, A.; Soltveit, H.K.; Soltz, R.; Sommer, W.; Son, C.W.; Son, Hyungsuk; Song, M.; Soos, C.; Soramel, F.; Soyk, D.; Spyropoulou-Stassinaki, M.; Srivastava, B.K.; Stachel, J.; Staley, F.; Stan, E.; Stefanek, G.; Stefanini, G.; Steinbeck, T.; Stenlund, E.; Steyn, G.; Stocco, D.; Stock, R.; Stolpovsky, P.; Strmen, P.; Suaide, A.A.P.; Subieta Vasquez, M.A.; Sugitate, T.; Suire, C.; Sumbera, M.; Susa, T.; Swoboda, D.; Symons, J.; Szanto de Toledo, A.; Szarka, I.; Szostak, A.; Szuba, M.; Tadel, M.; Tagridis, C.; Takahara, A.; Takahashi, J.; Tanabe, R.; Tapia Takaki, J.D.; Taureg, H.; Tauro, A.; Tavlet, M.; Tejeda Munoz, G.; Telesca, A.; Terrevoli, C.; Thaeder, Jochen Mathias; Tieulent, R.; Tlusty, D.; Toia, A.; Tolyhy, T.; Torcato de Matos, C.; Torii, H.; Torralba, G.; Toscano, L.; Tosello, F.; Tournaire, A.; Traczyk, T.; Tribedy, P.; Troger, G.; Truesdale, D.; Trzaska, W.H.; Tsiledakis, G.; Tsilis, E.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Turvey, A.; Tveter, T.S.; Tydesjo, H.; Tywoniuk, K.; Ulery, J.; Ullaland, K.; Uras, A.; Urban, J.; Urciuoli, G.M.; Usai, G.L.; Vacchi, A.; Vala, M.; Valencia Palomo, L.; Vallero, S.; van der Kolk, N.; Vyvre, P.Vande; van Leeuwen, M.; Vannucci, L.; Vargas, A.; Varma, R.; Vasiliev, A.; Vassiliev, I.; Vasileiou, M.; Vechernin, V.; Venaruzzo, M.; Vercellin, E.; Vergara, S.; Vernet, R.; Verweij, M.; Vetlitskiy, I.; Vickovic, L.; Viesti, G.; Vikhlyantsev, O.; Vilakazi, Z.; Villalobos Baillie, O.; Vinogradov, A.; Vinogradov, L.; Vinogradov, Y.; Virgili, T.; Viyogi, Y.P.; Vodopianov, A.; Voloshin, K.; Voloshin, S.; Volpe, G.; von Haller, B.; Vranic, D.; Vrlakova, J.; Vulpescu, B.; Wagner, B.; Wagner, V.; Wallet, L.; Wan, R.; Wang, D.; Wang, Y.; Watanabe, K.; Wen, Q.; Wessels, J.; Westerhoff, U.; Wiechula, J.; Wikne, J.; Wilk, A.; Wilk, G.; Williams, M.C.S.; Willis, N.; Windelband, B.; Xu, C.; Yang, C.; Yang, H.; Yasnopolskiy, S.; Yermia, F.; Yi, J.; Yin, Z.; Yokoyama, H.; Yoo, I-K.; Yuan, X.; Yurevich, V.; Yushmanov, I.; Zabrodin, E.; Zagreev, B.; Zalite, A.; Zampolli, C.; Zanevsky, Yu.; Zaporozhets, S.; Zarochentsev, A.; Zavada, P.; Zbroszczyk, H.; Zelnicek, P.; Zenin, A.; Zepeda, A.; Zgura, I.; Zhalov, M.; Zhang, X.; Zhou, D.; Zhou, S.; Zhu, J.; Zichichi, A.; Zinchenko, A.; Zinovjev, G.; Zoccarato, Y.; Zychacek, V.; Zynovyev, M.
2010-01-01
The ratio of the yields of antiprotons to protons in pp collisions has been measured by the ALICE experiment at $\\sqrt{s} = 0.9$ and $7$~TeV during the initial running periods of the Large Hadron Collider(LHC). The measurement covers the transverse momentum interval $0.45 < p_{\\rm{t}} < 1.05$~GeV/$c$ and rapidity $|y| < 0.5$. The ratio is measured to be $R_{|y| < 0.5} = 0.957 \\pm 0.006 (stat.) \\pm 0.014 (syst.)$ at $0.9$~TeV and $R_{|y| < 0.5} = 0.991 \\pm 0.005 (stat.) \\pm 0.014 (syst.)$ at $7$~TeV and it is independent of both rapidity and transverse momentum. The results are consistent with the conventional model of baryon-number transport and set stringent limits on any additional contributions to baryon-number transfer over very large rapidity intervals in pp collisions.
Nakamura, Kazuya; Shirakura, Masayuki; Fujisaki, Seiichiro; Kishida, Noriko; Burke, David F; Smith, Derek J; Kuwahara, Tomoko; Takashita, Emi; Takayama, Ikuyo; Nakauchi, Mina; Chadha, Mandeep; Potdar, Varsha; Bhushan, Arvind; Upadhyay, Bishnu Prasad; Shakya, Geeta; Odagiri, Takato; Kageyama, Tsutomu; Watanabe, Shinji
2017-09-01
We characterized influenza A(H1N1)pdm09 isolates from large-scale outbreaks that occurred in Nepal and India in early 2015. Although no specific viral features, which may have caused the outbreaks, were identified, an S84N substitution in hemagglutinin was frequently observed. Chronological phylogenetic analysis revealed that these Nepalese and Indian viruses possessing the S84N substitution constitute potential ancestors of the novel genetic subclade 6B.1 virus that spread globally in the following (2015/16) influenza season. Thus, active surveillance of circulating influenza viruses in the Southern Asia region, including Nepal and India, would be beneficial for detecting novel variant viruses prior to their worldwide spread. © 2017 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.
NCBI nr-aa BLAST: CBRC-OLAT-09-0016 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-OLAT-09-0016 sp|P43141|ADB4C_MELGA Beta-4C adrenergic receptor (Beta-4C adreno...ceptor) (Beta-4C adrenoreceptor) gb|AAA62151.1| beta-4C-adrenergic receptor gb|AAA62150.1| adrenergic beta-4c receptor P43141 1e-107 51% ...
Hydrostatic pressure effect on Tsub(c) of Basub(0.9)Ksub(0.1)Pbsub(0.75)Bisub(0.25)O3
International Nuclear Information System (INIS)
Chu, C.W.; Huang, S.; Sleight, A.W.
1976-01-01
The superconducting transition temperature of Basub(0.9)Ksub(0.1)Pbsub(0.75)Bisub(0.25)O 3 has been found to be suppressed smoothly by the application of hydrostatic pressure at a rate of -(2.9 +- 0.2) x 10 -5 kbar -1 up to 15 kbar. The implications of these results are discussed. (author)
Carvalho, A. M. G.; Alves, C. S.; Trevizoli, P. V.; dos Santos, A. O.; Gama, S.; Coelho, A. A.
2018-03-01
The Gd5.09Ge2.03Si1.88 compound, as well as other magnetocaloric materials, certainly will not be used in their un-manufactured as-cast condition in future magnetic refrigeration applications or other devices. In this work, we have studied the Gd5.09Ge2.03Si1.88 compound processed in different ways, mainly, the as-cast powder, the annealed powder, and the pressed and sintered powder. The annealed powder (1370 K/20 h) does not present the monoclinic phase and the first-order magneto-structural transition observed in the as-cast powder. The pressed and sintered powder also do not present the first-order transition. Furthermore, the compacting pressure shifts the second-order magnetic transition to lower temperatures. The behavior of cell parameters as a function of the compacting pressure indicates that T C is directly affected by parameter c change.
Hart-Davis, Guy
2010-01-01
If you want to get the very most out of the suite of iWork '09 applications, put this savvy Portable Genius guide to work. Want to create professional-quality documents? Make your spreadsheets powerful and unique? Deliver a persuasive presentation in person, on paper, or via the Internet? You'll find cool and useful Genius tips, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy the iWork '09 applications to the max.
Number Question Answer 1 1. Who is the entity responsible for ...
International Development Research Centre (IDRC) Digital Library (Canada)
Carlos Guiza
of this information ahead of time? Obviously it would be very useful in making a proposal budget for the financial proposal detailed in. 5.6. The budget is divided in three main components: 1. Strategic alliances and governance structure. 2. SCALA-IDN Platform,. Knowledge products and. Events. 3. Sustainability plan and.
Parametric Blade Study Test Report Rotor Configuration. Number 4
1988-11-01
Figure 2. The rotor shaft is mounted on an oil-damped roller bearing at the forward location and a ball bearing at the aft location; radial runout does...thermodynamic properties. 22 d. Corrections were made to measured compressor temperatures and pressures, facility flowrate, and rotor wheel speed to...1152 .Z660 .1024 STRM- BLADE BLADE WHEEL LINE SECT. LEAN SPEED NUMBER ANGLE ANGLE 1 -55.15 7.32 1497.9 2 -53.85 8.09 1434.7 3 -52.96 7.11 1372.1 4
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the...
Ghaderi, Sara; Gunnes, Nina; Bakken, Inger Johanne; Magnus, Per; Trogstad, Lill; Håberg, Siri Eldevik
2016-01-01
Vaccinations and infections are possible triggers of Guillain-Barré syndrome (GBS). However, studies on GBS after vaccinations during the influenza A(H1N1)pmd09 pandemic in 2009, show inconsistent results. Only few studies have addressed the role of influenza infection. We used information from national health data-bases with information on the total Norwegian population (N = 4,832,211). Cox regression analyses with time-varying covariates and self-controlled case series was applied. The risk of being hospitalized with GBS during the pandemic period, within 42 days after an influenza diagnosis or pandemic vaccination was estimated. There were 490 GBS cases during 2009-2012 of which 410 cases occurred after October 1, 2009 of which 46 new cases occurred during the peak period of the influenza pandemic. An influenza diagnosis was registered for 2.47% of the population and the vaccination coverage was 39.25%. The incidence rate ratio of GBS during the pandemic peak relative to other periods was 1.46 [95% confidence interval (CI) 1.08-1.98]. The adjusted hazard ratio (HR) of GBS within 42 days after a diagnosis of pandemic influenza was 4.89 (95% CI 1.17-20.36). After pandemic vaccination the adjusted HR was 1.11 (95% CI 0.51-2.43). Our results indicated that there was a significantly increased risk of GBS during the pandemic season and after pandemic influenza infection. However, vaccination did not increase the risk of GBS. The small number of GBS cases in this study warrants caution in the interpretation of the findings.
DEFF Research Database (Denmark)
Jadhav, L. D.; Pawar, S. H.; Chourashiya, M. G.
2007-01-01
Gadolinium doped ceria oxide is one of the promising materials as an electrolyte for IT-SOFCs. Ce0.9Gd0.1O1.95 (GDC10) powder was prepared by solid state reaction and sintered at 1473 K, 1573 K, 1673 K and 1773 K All samples were studied using X-ray diffraction, scanning electron micrograph and d...
Electroresistance and magnetoresistance in La0.9Ba0.1MnO3 thin films
International Nuclear Information System (INIS)
Hu, F.X.; Gao, J.; Wang, Z.H.
2006-01-01
The electroresistance and magnetoresistance effects have been investigated in La 0.9 Ba 0.1 MnO 3 epitaxial thin films. Tensile strain caused by substrate mismatch makes the Curie temperature T C of the film at ∼300 K. The influence of an applied dc-current on the resistance in the absence of a magnetic field was studied. Significant change of the peak resistance at different currents was found. The reduction of the peak resistance reaches ∼27% with an electric current density up to 1.3 x 10 5 A cm -2 . We also studied colossal magnetoresistance (CMR) effect in the films. Applying a magnetic field of 2 T could lead to a magnetoresistance as large as 42%. The reduction of resistance caused by a current density ∼1.3 x 10 5 A cm -2 was found to be equivalent to the CMR effect caused by 1.5 T near T C . The phenomenon that the resistance in CMR manganites could be easily controlled by the electric current should be of high interest for both fundamental research and practical applications
Synthesis, Sintering, and Electrical Properties of BaCe0.9−xZrxY0.1O3−δ
DEFF Research Database (Denmark)
Ricote, S.; Caboche, G.; Estournes, C.
2008-01-01
BaCe0.9-xZrxY0.1O3-delta powders were synthesized by a solid-state reaction. Different contents of cerium and zirconium were studied. Pellets were sintered using either conventional sintering in air at 1700 degrees C or the Spark Plasma Sintering (SPS) technique. The density of the samples sintered...
Development of 650 MHz (β=0.9) single-cell SCRF cavity
International Nuclear Information System (INIS)
Bagre, M.; Jain, V.; Yedle, A.; Maurya, T.; Yadav, A.; Puntambekar, A.; Goswami, S.G.; Choudhary, R.S.; Sandha, S.; Dwivedi, J.; Kane, G.V.; Mahawar, A.; Mohania, P.; Shrivastava, P.; Sharma, S.; Gupta, R.; Sharma, S.D.; Joshi, S.C.; Mistri, K.K.; Prakash, P.N.
2013-01-01
Raja Ramanna Centre for Advanced Technology has initiated the work on development of Superconducting Radio Frequency (SCRF) cavities and associated technologies as part of R and D activities for upcoming Spallation Neutron Source (SNS) project involving superconducting Linear Accelerator (LINAC). It is planned to use 650 MHz SCRF cavities for the medium and high energy section of the proposed LINAC. Under Indian Institution Fermilab Collaboration (IIFC), Raja Ramanna Centre for Advanced Technology is also working on development of 650 MHz (β=0.9) SCRF cavities proposed to be used in the high energy section of Project-X at FNAL. The work has been initiated with design and development of 650 MHz single cell SCRF cavity. FE analysis was done to estimate change in frequency with temperature as well as to estimate the frequency of the cavity at different cavity manufacturing stages. The development cycle comprises of design and manufacturing of forming tooling, machining, welding and RF measurement fixtures as well as design for manufacturing. The half-cell and beam tubes forming and machining of all parts were done using in-house facilities. The Electron beam welding was carried out at Inter-University Accelerator Centre (IUAC), New Delhi under a MoU. One 650 MHz single cell SCRF cavity has been recently manufactured. In this paper we present the development efforts on manufacturing and pre-qualification of 650 MHz (β=0.9) single cell SCRF cavity. (author)
Alteraciones morfológicas en pulmón por la influenza A H1N1/v09 en autopsias, Colombia, 2009
Directory of Open Access Journals (Sweden)
Jorge Rivera
2011-03-01
Conclusión. El porcentaje bajo de infección bacteriana concomitante observado en los casos de influenza A H1N1/ v09 en este estudio, es una característica sobresaliente que sugiere que el resultado fatal de la infección, probablemente no esté asociado a una enfermedad bacteriana secundaria, como se ha sugerido en reportes previos. Es probable que las lesiones observadas se puedan atribuir al daño tisular en la respuesta inflamatoria celular y humoral asociada a la infiltración por células poliformonucleares y macrófagos en el intersticio y la luz alveolares, como también por la lesión viral.
International Nuclear Information System (INIS)
Jin, Changqing; Zhu, Kexin; Jian, Zengyun; Wei, Yongxing; Ge, Chenghai; Peterson, George
2017-01-01
1D Zn 0.9 Cd 0.1 S nanostructures were successfully synthesized via one-step physical vapor deposition. The separation of ultraviolet (UV) emission peaks in the cathodoluminescence (CL) curves, taken in combination with x-ray diffraction (XRD) patterns, proves the coexistence of wurtzite and zincblende phases. The diversity of morphology in nanostuctures originates from Au catalyst splitting during the growth process. The similar photoluminescence spectrums at different positions prove that the composition and defect types were homogeneous, and that defect distribution and density have very small fluctuation at the micron scale. In contrast, the CL curves taken from different locations showed that the defect types and distribution were not uniform on the nanoscale level. (paper)
NCBI nr-aa BLAST: CBRC-PTRO-09-0020 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-PTRO-09-0020 ref|NP_000671.2| alpha-1A-adrenergic receptor isoform 1 [Homo sap...iens] sp|P35348|ADA1A_HUMAN Alpha-1A adrenergic receptor (Alpha 1A-adrenoceptor) (Alpha 1A-adrenoreceptor) (Alpha-1C adrenergic... receptor) (Alpha adrenergic receptor 1c) gb|AAB60353.1| adrenergic alpha-1c receptor pro...tein dbj|BAC05926.1| seven transmembrane helix receptor [Homo sapiens] gb|AAQ91331.1| adrenergic
Factors controlling the microstructure of Ce0.9Gd0.1O2-δ films in pulsed laser deposition process
DEFF Research Database (Denmark)
Rodrigo, Katarzyna Agnieszka; Heiroth, S.; Döbeli, M.
2010-01-01
Films of Ce0.9Gd0.1O2-delta (CGO10) are prepared at a range of conditions by pulsed laser deposition (PLD) on a single crystal Si (100) and MgO (100), and on a polycrystalline Pt/MgO (100) substrate. The relationship between the film microstructure, crystallography, chemical composition and PLD p...
International Nuclear Information System (INIS)
Todorov, T.D.
1980-01-01
The set of asymptotic numbers A as a system of generalized numbers including the system of real numbers R, as well as infinitely small (infinitesimals) and infinitely large numbers, is introduced. The detailed algebraic properties of A, which are unusual as compared with the known algebraic structures, are studied. It is proved that the set of asymptotic numbers A cannot be isomorphically embedded as a subspace in any group, ring or field, but some particular subsets of asymptotic numbers are shown to be groups, rings, and fields. The algebraic operation, additive and multiplicative forms, and the algebraic properties are constructed in an appropriate way. It is shown that the asymptotic numbers give rise to a new type of generalized functions quite analogous to the distributions of Schwartz allowing, however, the operation multiplication. A possible application of these functions to quantum theory is discussed
Microhardness and fracture toughness of Ce0.9Gd0.1O1.95 for manufacturing solid oxide electrolytes
International Nuclear Information System (INIS)
Mangalaraja, R.V.; Ananthakumar, S.; Uma, Kasimayan; Jimenez, Romel M.; Lopez, Marta; Camurri, Carlos P.
2009-01-01
Synthesis of nanocrystalline gadolinium doped ceria (Ce 0.9 Gd 0.1 O 1.95 ) was attempted by nitrate-fuel combustion technique involving different organic fuels namely urea, citric acid, glycine and poly ethylene glycol. As-combusted ceria precursors were calcined at 700 deg. C for 2 h for obtaining fully dense, nanocrystalline ceria powders. Cylindrical ceria discs were fabricated by uni-axial pressing and sintered intentionally at low temperature of 1200 deg. C for 2 h for assessing the sintering characteristics of the nano powders as well as the mechanical performance of the sintered ceria body. The study confirms that the nano powders could be sintered to 98% theoretical sintered density at 1200 deg. C with a grain size of 400 nm to 1 μm. The sintered samples exhibited the Vickers microhardness of 8.82 ± 0.2 GPa and the fracture toughness of 1.75 ± 0.3 MPa m 1/2 at a load 20 N for glycine and citric acid fuels derived ceria, respectively. A comparison between the fuels was made with respect to the sintering and mechanical properties of doped ceria. Citric acid and glycine fuels resulted in sintered ceria with high hardness where as the urea and polyethylene fuels derived nano ceria resulted in high fracture toughness.
Komissarov, Andrey; Fadeev, Artem; Sergeeva, Maria; Petrov, Sergey; Sintsova, Kseniya; Egorova, Anna; Pisareva, Maria; Buzitskaya, Zhanna; Musaeva, Tamila; Danilenko, Daria; Konovalova, Nadezhda; Petrova, Polina; Stolyarov, Kirill; Smorodintseva, Elizaveta; Burtseva, Elena; Krasnoslobodtsev, Kirill; Kirillova, Elena; Karpova, Lyudmila; Eropkin, Mikhail; Sominina, Anna; Grudinin, Mikhail
2016-07-01
A dramatic increase of influenza activity in Russia since week 3 of 2016 significantly differs from previous seasons in terms of the incidence of influenza and acute respiratory infection (ARI) and in number of lethal cases. We performed antigenic analysis of 108 and whole-genome sequencing of 77 influenza A(H1N1)pdm09 viruses from Moscow and Saint Petersburg. Most of the viruses were antigenically related to the vaccine strain. Whole-genome analysis revealed a composition of specific mutations in the internal genes (D2E and M83I in NEP, E125D in NS1, M105T in NP, Q208K in M1, and N204S in PA-X) that probably emerged before the beginning of 2015/2016 epidemic season. © 2016 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.
40 CFR 61.09 - Notification of startup.
2010-07-01
... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Notification of startup. 61.09 Section...) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS General Provisions § 61.09 Notification of startup. (a) The owner or operator of each stationary source which has an initial startup after the effective...
DEFF Research Database (Denmark)
Ni, De Wei; Esposito, Vincenzo; Foghmoes, Søren Preben Vagn
2014-01-01
process at the initial sintering stage at T constitutive laws indicate......The sintering behavior of Ce0.9Gd0.1O1.95(CGO) tape cast layers with different porosity was investigated by an extensive characterization of densification, microstructural evolution, and applying the constitutive laws of sintering. The densification of CGO tapes associates with grain coarsening...
76 FR 61351 - Combined Notice of Filings #1
2011-10-04
... MBR Baseline Tariff Filing to be effective 9/22/2011. Filed Date: 09/22/2011. Accession Number... submits tariff filing per 35.1: ECNY MBR Re-File to be effective 9/22/2011. Filed Date: 09/22/2011... Industrial Energy Buyers, LLC submits tariff filing per 35.1: NYIEB MBR Re-File to be effective 9/22/2011...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater...
Exon: CBRC-MMUS-09-0206 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0206 gttcaataccaccaccaccaccaccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccactaccaccaccaccacca...ccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccatcaccactaccaccaccaccaccaccaccaccaccaccaccaccaccaccagggagaacaagcattcaa ...
75 FR 7985 - Blueberry Promotion, Research, and Information Order; Withdrawal of a Proposed Rule
2010-02-23
..., advertising, and promotion of highbush blueberries in the marketplace. The Council recommended increasing the...-09-0021; FV-09-704] Blueberry Promotion, Research, and Information Order; Withdrawal of a Proposed... amend the Blueberry Promotion, Research, and Information Order (Order) by increasing the assessment rate...
A new pseudorandom number generator based on a complex number chaotic equation
International Nuclear Information System (INIS)
Liu Yang; Tong Xiao-Jun
2012-01-01
In recent years, various chaotic equation based pseudorandom number generators have been proposed. However, the chaotic equations are all defined in the real number field. In this paper, an equation is proposed and proved to be chaotic in the imaginary axis. And a pseudorandom number generator is constructed based on the chaotic equation. The alteration of the definitional domain of the chaotic equation from the real number field to the complex one provides a new approach to the construction of chaotic equations, and a new method to generate pseudorandom number sequences accordingly. Both theoretical analysis and experimental results show that the sequences generated by the proposed pseudorandom number generator possess many good properties
New topological structures of Skyrme theory: baryon number and monopole number
Energy Technology Data Exchange (ETDEWEB)
Cho, Y.M. [Chinese Academy of Science, Institute of Modern Physics, Lanzhou (China); Konkuk University, Seoul (Korea, Republic of); Seoul National University, School of Physics and Astronomy, Seoul (Korea, Republic of); Kimm, Kyoungtae [Seoul National University, Faculty of Liberal Education, Seoul (Korea, Republic of); Yoon, J.H. [Konkuk University, Department of Physics, Seoul (Korea, Republic of); Zhang, Pengming [Chinese Academy of Science, Institute of Modern Physics, Lanzhou (China)
2017-02-15
Based on the observation that the skyrmion in Skyrme theory can be viewed as a dressed monopole, we show that the skyrmions have two independent topology, the baryon topology π{sub 3}(S{sup 3}) and the monopole topology π{sub 2}(S{sup 2}). With this we propose to classify the skyrmions by two topological numbers (m, n), the monopole number m and the shell (radial) number n. In this scheme the popular (non spherically symmetric) skyrmions are classified as the (m, 1) skyrmions but the spherically symmetric skyrmions are classified as the (1, n) skyrmions, and the baryon number B is given by B = mn. Moreover, we show that the vacuum of the Skyrme theory has the structure of the vacuum of the Sine-Gordon theory and QCD combined together, which can also be classified by two topological numbers (p, q). This puts the Skyrme theory in a totally new perspective. (orig.)
La2/3Sr1/3MnO3-La0.1Bi0.9MnO3 heterostructures for spin filtering
Gajek, M.; Bibes, M.; Varela, M.; Fontcuberta, J.; Herranz, G.; Fusil, S.; Bouzehouane, K.; Barthélémy, A.; Fert, A.
2006-04-01
We have grown heterostructures associating half-metallic La2/3Sr1/3MnO3 (LSMO) bottom electrodes and ferromagnetic La0.1Bi0.9MnO3 (LBMO) tunnel barriers. The layers in the heterostructures have good structural properties and top LBMO films (4 nm thick) have a very low roughness when deposited onto LSMO/SrTiO3(1.6 nm) templates. The LBMO films show an insulating behavior and a ferromagnetic character that are both preserved down to very low thicknesses. They are thus suitable for being used as tunnel barriers. Spin-dependent transport measurements performed on tunnel junctions defined from LSMO/SrTiO3/LBMO/Au samples show a magnetoresistance of up to ~90% at low temperature and bias. This evidences a spin-filtering effect by the LBMO layer, with a spin-filtering efficiency of ~35%.
Directory of Open Access Journals (Sweden)
H. H. Yu
2016-10-01
Full Text Available Hollow spheres structures of La0.7Sr0.2Ca0.1Co0.9Fe0.1O3–δ (LSCCT have been synthesized via hydrothermal method using carbon spheres as template. The structure and electrical conductivity of obtained samples are characterized by X-ray diffraction (XRD, scanning electron microscope (SEM, transmission electron microscope (TEM and direct current (DC four-probe method respectively. The results show that hollow spheres structures of LSCCT with the mean particle size of 0,9 - 1,2 μm is single perovskite. The electrical conductivity of the samples is higher than 100 S/cm from 600 to 800 ℃ and can meet the demand of the electrical properties for the cathode materials.
75 FR 30810 - Combined Notice of Filings #1
2010-06-02
...: ER09-934-004; ER09-936-001. Applicants: Bangor Hydro Electric Company. Description: Offer of Settlement of Bangor Hydro Electric Company. Filed Date: 05/24/2010. Accession Number: 20100524-5035. Comment...: CMS Energy Resource Management Company submits tariff filing under Schedule No. 1 Electric Tariff, to...
TU-F-18A-09: CT Number Stability Across Patient Sizes Using Virtual-Monoenergetic Dual-Energy CT
Energy Technology Data Exchange (ETDEWEB)
Michalak, G; Grimes, J; Fletcher, J; McCollough, C [Mayo Clinic, Rochester, MN (United States); Halaweish, A [Siemens Healthcare, Rochester, MN (United States)
2014-06-15
Purpose: Virtual-monoenergetic imaging uses dual-energy CT data to synthesize images corresponding to a single photon energy, thereby reducing beam-hardening artifacts. This work evaluated the ability of a commercial virtual-monoenergetic algorithm to achieve stable CT numbers across patient sizes. Methods: Test objects containing a range of iodine and calcium hydroxyapatite concentrations were placed inside 8 torso-shaped water phantoms, ranging in lateral width from 15 to 50 cm, and scanned on a dual-source CT system (Siemens Somatom Force). Single-energy scans were acquired from 70-150 kV in 10 kV increments; dual-energy scans were acquired using 4 energy pairs (low energy: 70, 80, 90, and 100 kV; high energy: 150 kV + 0.6 mm Sn). CTDIvol was matched for all single- and dual-energy scans for a given phantom size. All scans used 128×0.6 mm collimation and were reconstructed with 1-mm thickness at 0.8-mm increment and a medium smooth body kernel. Monoenergetic images were generated using commercial software (syngo Via Dual Energy, VA30). Iodine contrast was calculated as the difference in mean iodine and water CT numbers from respective regions-of-interest in 10 consecutive images. Results: CT numbers remained stable as phantom width varied from 15 to 50 cm for all dual-energy data sets (except for at 50 cm using 70/150Sn due to photon starvation effects). Relative to the 15 cm phantom, iodine contrast was within 5.2% of the 70 keV value for phantom sizes up to 45 cm. At 90/150Sn, photon starvation did not occur at 50 cm, and iodine contrast in the 50-cm phantom was within 1.4% of the 15-cm phantom. Conclusion: Monoenergetic imaging, as implemented in the evaluated commercial system, eliminated the variation in CT numbers due to patient size, and may provide more accurate data for quantitative tasks, including radiation therapy treatment planning. Siemens Healthcare.
BKP and projective Hurwitz numbers
Natanzon, Sergey M.; Orlov, Aleksandr Yu.
2017-06-01
We consider d-fold branched coverings of the projective plane RP^2 and show that the hypergeometric tau function of the BKP hierarchy of Kac and van de Leur is the generating function for weighted sums of the related Hurwitz numbers. In particular, we get the RP^2 analogues of the CP^1 generating functions proposed by Okounkov and by Goulden and Jackson. Other examples are Hurwitz numbers weighted by the Hall-Littlewood and by the Macdonald polynomials. We also consider integrals of tau functions which generate Hurwitz numbers related to base surfaces with arbitrary Euler characteristics sc {e}, in particular projective Hurwitz numbers sc {e}=1.
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the HOS Davis in the Gulf of Mexico from 2010-09-09 to 2010-09-27 in response to the Deepwater...
DEFF Research Database (Denmark)
Bragstad, Karoline; Vinner, Lasse; Hansen, Mette Sif
2013-01-01
seasonal and emerging influenza viruses. We have developed an alternative influenza vaccine based on DNA expressing selected influenza proteins of pandemic and seasonal origin. In the current study, we investigated the protection of a polyvalent influenza DNA vaccine approach in pigs. We immunised pigs...... intradermally with a combination of influenza DNA vaccine components based on the pandemic 1918 H1N1 (M and NP genes), pandemic 2009 H1N1pdm09 (HA and NA genes) and seasonal 2005 H3N2 genes (HA and NA genes) and investigated the protection against infection with virus both homologous and heterologous to the DNA...... of this DNA vaccine to limit virus shedding may have an impact on virus spread among pigs which could possibly extend to humans as well, thereby diminishing the risk for epidemics and pandemics to evolve....
Thermal equation of state of (Mg 0.9Fe 0.1) 2SiO 4 olivine
Liu, Wei; Li, Baosheng
2006-08-01
In situ synchrotron X-ray diffraction measurements have been carried out on San Carlos olivine (Mg 0.9Fe 0.1) 2SiO 4 up to 8 GPa and 1073 K. Data analysis using the high-temperature Birch-Murnaghan (HTBM) equation of state (EoS) yields the temperature derivative of the bulk modulus (∂ KT/∂ T) P = -0.019 ± 0.002 GPa K -1. The thermal pressure (TH) approach gives αKT = 4.08 ± 0.10 × 10 -3 GPa K -1, from which (∂ KT/∂ T) P = -0.019 ± 0.001 GPa K -1 is derived. Fitting the present data to the Mie-Grüneisen-Debye (MGD) formalism, the Grüneisen parameter at ambient conditions γ0 is constrained to be 1.14 ± 0.02 with fixed volume dependence q = 1. Combining the present data with previous results on iron-bearing olivine and fitting to MGD EoS, we obtain γ0 = 1.11 ± 0.01 and q = 0.54 ± 0.36. In this study the thermoelastic parameters obtained from various approaches are in good agreement with one another and previous results.
Synthesis dependent characteristics of Sr1−xMnxTiO3 (x=0.03, 0.05, 0.07 and 0.09)
International Nuclear Information System (INIS)
Preethi Meher, K.R.S.; Bogicevic, Christine; Janolin, Pierre-Eymeric; Varma, K.B.R.
2012-01-01
Sr 1−x Mn x TiO 3 (where x=0.03, 0.05, 0.07 and 0.09) was synthesized via different routes that include solid-state, oxalate precipitation and freeze drying. In oxalate precipitation technique, compositions corresponding to 3 and 5 mol% doping of Mn were monophasic whereas the higher compositions revealed the presence of the secondary phases such as MnO, Mn 3 O 4 etc., as confirmed by high resolution X-ray diffraction (XRD) studies. The decomposition behavior of the precursors prepared using oxalate precipitation method corresponding to the above mentioned compositions was studied. Nanopowders of compositions pertaining to 5 to 9 mol% of Mn doping were obtained using freeze–drying technique. The average crystallite size of these nanopowders was found to be in the 35 to 65 nm range. The microstructural studies carried out on the sintered ceramics, fabricated using powders synthesized by different routes established the fine grained nature ( 1−x Mn x TiO 3 (x=0.03 and 0.05) obtained by oxalate precipitation technique along with that of the nanopowders for x=0.05, 0.07 and 0.09 obtained by freeze drying method, microstructural characterization and synthesis dependent dielectric behavior. Highlights: ► Monophasic samples obtained for compositions Sr 1−x Mn x TiO 3 with x=0.03 and 0.05. ► Nanopowders of Sr 1−x Mn x TiO 3 with x=0.05, 0.07 and 0.09 were synthesized by freeze–drying method. ► Phase purity of samples synthesized using freeze drying method were studied at different sintering temperatures. ► Analysis of Raman spectra for samples prepared by both oxalate precipitation and freeze–drying. ► Microstructure dependent dielectric characteristics have been illustrated.
International Nuclear Information System (INIS)
Kolchina, L.M.; Lyskov, N.V.; Petukhov, D.I.; Mazo, G.N.
2014-01-01
Highlights: • PCO–GDC composites are studied as a cathode for SOFCs. • The rate-determined step of the overall electrode process vs. temperature was defined. • PCO–GDC33 composite gave the lowest area surface resistance of 0.41 Ω cm 2 at 700 °C. • PCO–GDC33 is preferred to use as a cathode material for IT-SOFCs. - Abstract: Pr 2 CuO 4 –Ce 0.9 Gd 0.1 O 1.95 (PCO–GDC) composites screen printed on Ce 0.9 Gd 0.1 O 1.95 (GDC) electrolyte were considered as a cathode material for intermediate temperature solid oxide fuel cells (IT-SOFCs). Phase composition, microstructure and electrochemical properties were investigated by X-ray powder diffraction (XRD), scanning electron microscopy and AC impedance spectroscopy, respectively. The oxygen reduction on porous PCO–GDC electrode applied on CGO electrolyte was studied in a symmetrical cell configuration by AC impedance spectroscopy at OCV conditions at 670–730 °C and p O 2 =10 -2 -0.21atm. The charge transfer process and the dissociation of adsorbed molecular oxygen were found to be rate-determining steps of the oxygen reduction reaction. Results reveal that both GDC addition and electrode morphology have strong influence on area specific resistance (ASR) of the electrode/electrolyte interface. The lowest ASR value of 0.41 Ω cm 2 was achieved for the composition containing 33 wt.% GDC at 700 °S in air. The data obtained allow to consider the PCO–GDC33 composite as a promising cathode material for IT-SOFCs
Russo, Mara L; Pontoriero, Andrea V; Benedetti, Estefania; Czech, Andrea; Avaro, Martin; Periolo, Natalia; Campos, Ana M; Savy, Vilma L; Baumeister, Elsa G
2014-12-01
This study was conducted as part of the Argentinean Influenza and other Respiratory Viruses Surveillance Network, in the context of the Global Influenza Surveillance carried out by the World Health Organization (WHO). The objective was to study the activity and the antigenic and genomic characteristics of circulating viruses for three consecutive seasons (2010, 2011 and 2012) in order to investigate the emergence of influenza viral variants. During the study period, influenza virus circulation was detected from January to December. Influenza A and B, and all current subtypes of human influenza viruses, were present each year. Throughout the 2010 post-pandemic season, influenza A(H1N1)pdm09, unexpectedly, almost disappeared. The haemagglutinin (HA) of the A(H1N1)pdm09 viruses studied were segregated in a different genetic group to those identified during the 2009 pandemic, although they were still antigenically closely related to the vaccine strain A/California/07/2009. Influenza A(H3N2) viruses were the predominant strains circulating during the 2011 season, accounting for nearly 76 % of influenza viruses identified. That year, all HA sequences of the A(H3N2) viruses tested fell into the A/Victoria/208/2009 genetic clade, but remained antigenically related to A/Perth/16/2009 (reference vaccine recommended for this three-year period). A(H3N2) viruses isolated in 2012 were antigenically closely related to A/Victoria/361/2011, recommended by the WHO as the H3 component for the 2013 Southern Hemisphere formulation. B viruses belonging to the B/Victoria lineage circulated in 2010. A mixed circulation of viral variants of both B/Victoria and B/Yamagata lineages was detected in 2012, with the former being predominant. A(H1N1)pdm09 viruses remained antigenically closely related to the vaccine virus A/California/7/2009; A(H3N2) viruses continually evolved into new antigenic clusters and both B lineages, B/Victoria/2/87-like and B/Yamagata/16/88-like viruses, were observed
Effects of the fabrication process on the grain-boundary resistance in BaZr0.9Y0.1O3-δ
DEFF Research Database (Denmark)
Ricote, Sandrine; Bonanos, Nikolaos; Manerbino, A.
2014-01-01
This paper reports on the effect of the fabrication process on the conductivity of BZY10 (BaZr0.9Y0.1O3-δ). The dense specimens were prepared by four methods: (1) solid-state reactive sintering (SSRS), (2) conventional sintering using powder prepared by solid-state reaction and NiO as sintering a...
Synthesis and characterization of Gd0.1Ce0.9O1.95 thin films by spray pyrolysis technique
DEFF Research Database (Denmark)
Chourashiya, M. G.; Pawar, S. H.; Jadhav, L. D.
2008-01-01
The Gd doped ceria (CGO) in thin layers is of great interest for low temperature operation. In the present investigation, we report on the use of spray pyrolysis technique for the synthesis of CGO thin films. The process parameters were optimized for synthesizing Gd0.1Ce0.9O1.95 films. Films were...... characterized by XRD, EDS, SEM, and AFM and are observed to be phase pure and dense with surface roughness of the order of ∼5 nm. The d.c. conductivity was also measured and is observed to be ∼0.5 S/cm at 623 K....
75 FR 5904 - Proposed Amendment of Class E Airspace; Magnolia, AR
2010-02-05
...-1179; Airspace Docket No. 09-ASW-35] Proposed Amendment of Class E Airspace; Magnolia, AR AGENCY... action proposes to amend Class E airspace at Magnolia, AR. Decommissioning of the Magnolia non-directional beacon (NDB) at Magnolia Municipal Airport, Magnolia, AR, has made this action necessary for the...
NCBI nr-aa BLAST: CBRC-MMUS-09-0191 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0191 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r
NCBI nr-aa BLAST: CBRC-MMUS-09-0013 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0013 ref|NP_005950.1| melatonin receptor 1B [Homo sapiens] sp|P49286|M...TR1B_HUMAN Melatonin receptor type 1B (Mel-1B-R) (Mel1b melatonin receptor) gb|AAC50612.1| Mel1b-melatonin r...eceptor dbj|BAA92315.1| melatonin 1b receptor [Homo sapiens] gb|AAS00461.1| melatonin receptor 1B [Homo sapi...ens] gb|AAH69163.1| Melatonin receptor 1B [Homo sapiens] gb|EAW66891.1| melatonin receptor 1B [Homo sapiens] NP_005950.1 1e-164 80% ...
Sokolova, T M; Poloskov, V V; Shuvalov, A N; Rudneva, I A; Timofeeva, T A
2018-03-01
In culture of THP-1 cells differentiated into macrophages with PMA (THP-PMA macrophages) infected with influenza viruses of subtypes H1, H5 and H9, we measured the expression of TLR7 and RIG1 receptor genes, sensors of viral RNA and ribonucleoprotein, and the levels of production of inflammatory cytokines IL-1β, TNFα, IL-10, and IFNα. The sensitivity and inflammatory response of THP-PMA macrophages to pandemic influenza A virus H1N1pdm09 and avian influenza H5N2 and H9N2 viruses correlate with the intracellular level of their viral RNA and activation of the RIG1 gene. Abortive infection is accompanied by intensive macrophage secretion of TNFα, IL-1β, and toxic factors inducing cell death. Activity of endosomal TLR7 receptor gene changed insignificantly in 24 h after infection and significantly decreased in 48 and 72 h under the action of H5N2 and H9N2, which correlated with manifestation of the cytopathogenic effect of these viruses. H5N2 and H9N2 avian viruses in THP-PMA macrophages are strong activators of the expression of the gene of the cytoplasmic RIG1 receptor 24 and 48 h after infection, and the pandemic virus H1N1pdm09 is a weak stimulator of RIG1 gene. Avian influenza H5N2 and H9N2 viruses are released by rapid induction of the inflammatory response in macrophages. At the late stages of infection, we observed a minor increase in IL-10 secretion in macrophages and, probably, the polarization of a part of the population in type M2. The studied influenza A viruses are weak inductors of IFN in THP-PMA macrophages. In the culture medium of THP-PMA macrophages infected with H9N2 and H5N2 viruses, MTT test revealed high levels of toxic factors causing the death of Caco-2 cells. In contrast to avian viruses, pandemic virus H1N1pdm09 did not induce production of toxic factors.
NCBI nr-aa BLAST: CBRC-GACU-09-0018 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GACU-09-0018 ref|NP_000669.1| alpha-1D-adrenergic receptor [Homo sapiens] sp|P...25100|ADA1D_HUMAN Alpha-1D adrenergic receptor (Alpha 1D-adrenoceptor) (Alpha 1D-adrenoreceptor) (Alpha-1A adrenergic... receptor) (Alpha adrenergic receptor 1a) gb|AAB60351.1| adrenergic alpha-1a receptor protein gb|AAB59487.1| alpha 1a/d adre...nergic receptor dbj|BAA06222.1| alpha1A/D adrenergic rec...eptor [Homo sapiens] emb|CAH70478.1| adrenergic, alpha-1D-, receptor [Homo sapiens] emb|CAC00601.2| adrenergic
Cephradine as corrosion inhibitor for copper in 0.9% NaCl solution
Tasić, Žaklina Z.; Petrović Mihajlović, Marija B.; Radovanović, Milan B.; Simonović, Ana T.; Antonijević, Milan M.
2018-05-01
The effect of (6R,7R)-7-[[(2R)-2-amino-2-cyclohexa-1,4-dien-1-ylacetyl]amino]-3-methyl-8-oxo-5-thia-1-azobicyclo[4.2.0]oct-2-ene-2-carboxylic acid (cephradine) on corrosion behavior of copper in 0.9% NaCl solution was investigated. The electrochemical methods including the open circuit potential measurements, potentiodynamic polarization and electrochemical impedance spectroscopy measurements, scanning electron microscopy with energy dispersive X-ray spectroscopy and quantum chemical calculations were used for this investigation. According to the results obtained by potentiodynamic polarization, cephradine acts as mixed type inhibitor. Also, the results obtained by electrochemical impedance spectroscopy indicate that cephradine provides good copper protection in 0.9% NaCl solution. The inhibition efficiency of cephradine increases with increasing its concentration. The scanning electron microscopy with energy dispersive X-ray spectroscopy confirms that a protective layer is formed on the copper surface due to the adsorption of cephradine on the active sites on the copper surface. Adsorption of cephradine in 0.9% NaCl solution follows the Langmuir adsorption isotherm. Quantum chemical calculations are in agreement with results obtained by electrochemical measurements.
75 FR 6592 - Proposed Amendment of Class E Airspace; Emmetsburg, IA
2010-02-10
...-1153; Airspace Docket No. 09-ACE-13] Proposed Amendment of Class E Airspace; Emmetsburg, IA AGENCY... action proposes to amend Class E airspace at Emmetsburg, IA. Additional controlled airspace is necessary..., Emmetsburg, IA. The FAA is taking this action to enhance the safety and management of Instrument Flight Rules...
75 FR 15360 - Proposed Amendment of Class E Airspace; Austin, TX
2010-03-29
...-1152; Airspace Docket No. 09-ASW-31] Proposed Amendment of Class E Airspace; Austin, TX AGENCY: Federal... proposes to amend Class E airspace in the Austin, TX area. Additional controlled airspace is necessary to accommodate new Standard Instrument Approach Procedures (SIAPs) at Austin Executive Airport, Austin, TX. The...
75 FR 6594 - Proposed Amendment of Class E Airspace; Osceola, AR
2010-02-10
...-1183; Airspace Docket No. 09-ASW-38] Proposed Amendment of Class E Airspace; Osceola, AR AGENCY... action proposes to amend Class E airspace at Osceola, AR. Decommissioning of the Osceola non-directional beacon (NDB) at Osceola Municipal Airport, Osceola, AR, has made this action necessary for the safety and...
International Nuclear Information System (INIS)
2009-01-01
This book contains the short papers from the International Symposium on Convective heat and Mass Transfer in sustainable Energy ( Conv-09), organized on behalf of the International Centre for Heat and Mass Transfer, it was held on April 26- 1st May, In Hammamet, Tunisia. The objective of this conference is to bring together researchers in a forum to exchange innovative ideas, methods and results, and visions of the future related to the general theme of convective heat and mass transfer
Ac conductivity and relaxation mechanism in Ba{sub 0.9}Sr{sub 0.1}TiO{sub 3}
Energy Technology Data Exchange (ETDEWEB)
Singh, A K; Barik, Subrat K [Department of Physics and Meteorology, Indian Institute of Technology, Kharagpur 721 302 (India); Choudhary, R N.P. , [Department of Physics and Meteorology, Indian Institute of Technology, Kharagpur 721 302 (India); Mahapatra, P K [Department of Physics, Vidyasagar University, Midnapore 721 102 (India)
2009-06-24
The ac conductivity and relaxation mechanism in Ba{sub 0.9}Sr{sub 0.1}TiO{sub 3} ceramics have been investigated systematically. A high-temperature solid-state reaction technique was used to synthesize the compound. The formation of the compound was checked by an X-ray diffraction (XRD) technique. The dielectric permittivity and the loss tangent of the sample were measured in a frequency range from 1 kHz to 1 MHz at different temperatures (30-500 deg. C). A study on dielectric properties reveals the electrical relaxation phenomenon occurs in the material. The activation energy was calculated from the temperature variation of dc conductivity. Studies of frequency and temperature dependence of ac conductivity of the compound suggest that conduction process in the material is thermally activated.
The n-Cu0.9Ag0.1In3Se5 chalcopyrite, electronic as well as ionic conductor
International Nuclear Information System (INIS)
Diaz, R
2008-01-01
A resistance increase with time of the n-Cu 0.9 Ag 0.1 In 3 Se 5 chalcopyrite has been observed. This new effect is analysed in terms of a hypothesis of ion migration and Schottky barrier formation. These results might explain why different solar cell efficiencies are obtained for the chalcopyrites, CuInSe 2 and CuIn x Ga 1-x Se 2 , when an In-rich film is deposited on top of the chalcopyrite. In these solar cells, ion migration can exist and a new effect appears similar to the one observed in our compound. The ions, probably the cations, are moved by the electrical field towards the cathode. A gradient of mobile ions appears across the sample and the positive charge is accumulated near this electrode such that it varies the metal-semiconductor interface. This interface is a Schottky barrier where the contact potential is a function of time due to the arrival of ions. The electrical measurements have been carried out on a solid state device, graphite/n-Cu 0.9 Ag 0.1 In 3 Se 5 /graphite. The current intensity and the potential drop across the sample have been measured with time when a constant electrical potential is applied for 600 s at dark or under ultraviolet illumination and at room temperature. A comparative study in similar electrical conditions is done; the current intensity difference and the potential drop across the difference (under ultraviolet illumination minus at dark) are not constant and both measurements increase with time
Discrete Fourier transformation processor based on complex radix (−1 + j number system
Directory of Open Access Journals (Sweden)
Anidaphi Shadap
2017-02-01
Full Text Available Complex radix (−1 + j allows the arithmetic operations of complex numbers to be done without treating the divide and conquer rules, which offers the significant speed improvement of complex numbers computation circuitry. Design and hardware implementation of complex radix (−1 + j converter has been introduced in this paper. Extensive simulation results have been incorporated and an application of this converter towards the implementation of discrete Fourier transformation (DFT processor has been presented. The functionality of the DFT processor have been verified in Xilinx ISE design suite version 14.7 and performance parameters like propagation delay and dynamic switching power consumption have been calculated by Virtuoso platform in Cadence. The proposed DFT processor has been implemented through conversion, multiplication and addition. The performance parameter matrix in terms of delay and power consumption offered a significant improvement over other traditional implementation of DFT processor.
75 FR 6595 - Proposed Amendment of Class E Airspace; Mapleton, IA
2010-02-10
...-1155; Airspace Docket No. 09-ACE-14] Proposed Amendment of Class E Airspace; Mapleton, IA AGENCY... action proposes to amend Class E airspace at Mapleton, IA. Additional controlled airspace is necessary to..., Mapleton, IA. The FAA is taking this action to enhance the safety and management of Instrument Flight Rules...
75 FR 43884 - Proposed Amendment of Class E Airspace; Searcy, AR
2010-07-27
...-1182; Airspace Docket No. 09-ASW-37] Proposed Amendment of Class E Airspace; Searcy, AR AGENCY: Federal... proposes to amend Class E airspace at Searcy, AR. Decommissioning of the Searcy non-directional beacon (NDB) at Searcy Municipal Airport, Searcy, AR, has made this action necessary for the safety and management...
2010-01-22
... System (NPDES) general permit to placer mining operations in Idaho for small suction dredges (intake... ENVIRONMENTAL PROTECTION AGENCY [FRL-9104-3] Proposed Issuance of a General NPDES Permit for Small... significant economic impact on a substantial number of small entities.'' EPA has concluded that NPDES general...
The SU(1, 1) Perelomov number coherent states and the non-degenerate parametric amplifier
Energy Technology Data Exchange (ETDEWEB)
Ojeda-Guillén, D., E-mail: dojedag@ipn.mx; Granados, V. D. [Escuela Superior de Física y Matemáticas, Instituto Politécnico Nacional, Ed. 9, Unidad Profesional Adolfo López Mateos, C.P. 07738 México D. F. (Mexico); Mota, R. D. [Escuela Superior de Ingeniería Mecánica y Eléctrica, Unidad Culhuacán, Instituto Politécnico Nacional, Av. Santa Ana No. 1000, Col. San Francisco Culhuacán, Delegación Coyoacán, C.P. 04430, México D. F. (Mexico)
2014-04-15
We construct the Perelomov number coherent states for an arbitrary su(1, 1) group operation and study some of their properties. We introduce three operators which act on Perelomov number coherent states and close the su(1, 1) Lie algebra. By using the tilting transformation we apply our results to obtain the energy spectrum and eigenfunctions of the non-degenerate parametric amplifier. We show that these eigenfunctions are the Perelomov number coherent states of the two-dimensional harmonic oscillator.
Directory of Open Access Journals (Sweden)
W. Lunz
2008-11-01
Full Text Available We determined the effect of long-term aerobic swimming training regimens of different intensities on colonic carcinogenesis in rats. Male Wistar rats (11 weeks old were given 4 subcutaneous injections (40 mg/kg body weight each of 1,2-dimethyl-hydrazine (DMH, dissolved in 0.9% NaCl containing 1.5% EDTA, pH 6.5, at 3-day intervals and divided into three exercise groups that swam with 0% body weight (EG1, N = 11, 2% body weight (EG2, N = 11, and 4% body weight of load (EG3, N = 10, 20 min/day, 5 days/week for 35 weeks, and one sedentary control group (CG, N = 10. At sacrifice, the colon was removed and counted for tumors and aberrant crypt foci. Tumor size was measured and intra-abdominal fat was weighed. The mean number of aberrant crypt foci was reduced only for EG2 compared to CG (26.21 ± 2.99 vs 36.40 ± 1.53 crypts; P < 0.05. Tumor incidence was not significantly different among groups (CG: 90%; EG1: 72.7%; EG2: 90%; EG3: 80%. Swimming training did not affect either tumor multiplicity (CG: 2.30 ± 0.58; EG1: 2.09 ± 0.44; EG2: 1.27 ± 0.19; EG3: 1.50 ± 0.48 tumors or size (CG: 1.78 ± 0.24; EG1: 1.81 ± 0.14; EG2: 1.55 ± 0.21; EG3: 2.17 ± 0.22 cm³. Intra-abdominal fat was not significantly different among groups (CG: 10.54 ± 2.73; EG1: 6.12 ± 1.15; EG2: 7.85 ± 1.24; EG3: 5.11 ± 0.74 g. Aerobic swimming training with 2% body weight of load protected against the DMH-induced preneoplastic colon lesions, but not against tumor development in the rat.
Directory of Open Access Journals (Sweden)
Marie Barrau
2012-08-01
Full Text Available OBJECTIVE: To describe the methodology used for implementing a surveillance system specifically for influenza A(H1N1pdm09 in the French West Indies and French Guiana during an outbreak of this new virus in 2009-2010, and to report its main results. METHODS: This was an observational descriptive study of confirmed and probable cases of influenza A(H1N1pdm09 hospitalized for at least 24 hours in 23 July 2009-3 March 2010. Reverse transcription polymerase chain reaction was performed on nasopharyngeal swab samples according to the Centers for Disease Control and Prevention protocol. A probable case was defined as fever > 38ºC or aches or asthenia with respiratory symptoms (cough or dyspnea. All confirmed and probable hospitalized cases were reported, along with patient's age, sex, clinical condition at admission, place and length of hospitalization, antiviral treatment, underlying conditions, complications, and clinical evolution. A case was classified as severe if respiratory assistance or intensive care was required or if death resulted. RESULTS: A total of 331 confirmed and 16 probable cases were hospitalized, with a hospitalization rate ranging from 4.3 per 1 000 clinical cases in Saint Martin to 10.3 in French Guiana. Of these, 36 were severe, and subsequently, 10 were fatal. The median length of stay was 4 days for non-severe cases and 9 days for severe (P OBJETIVO: Describir la metodología usada para implementar un sistema de vigilancia específico para la gripe A(H1N1pdm09 en las Indias Occidentales Francesas y la Guayana Francesa durante un brote ocasionado por este virus nuevo ocurrido en 20092010 y presentar sus principales resultados. MÉTODOS: Se llevó a cabo un estudio de observación descriptivo de los casos confirmados y probables de gripe por A(H1N1pdm09 hospitalizados durante al menos 24 horas entre el 23 de julio de 2009 y el 3 de marzo de 2010. De conformidad con el protocolo de los Centros para el Control y la Prevención de
Evidence for a vortex-glass transition in superconducting Ba(Fe0.9Co0.1)2As2.
Prando, G; Giraud, R; Aswartham, S; Vakaliuk, O; Abdel-Hafiez, M; Hess, C; Wurmehl, S; Wolter, A U B; Büchner, B
2013-12-18
Measurements of magneto-resistivity and magnetic susceptibility were performed on single crystals of superconducting Ba(Fe0.9Co0.1)2As2 close to the conditions of optimal doping. The high quality of the investigated samples allows us to reveal dynamic scaling behaviour associated with a vortex-glass phase transition in the limit of a weak degree of quenched disorder. Accordingly, the dissipative component of the ac susceptibility is reproduced well within the framework of Havriliak-Negami relaxation, assuming a critical power-law divergence for the characteristic correlation time τ of the vortex dynamics. Remarkably, the random disorder introduced by the Fe1-xCox chemical substitution is found to act on the vortices as a much weaker quenched disorder than previously reported for cuprate superconductors such as Y1-xPrxBa2Cu3O7-δ.
48 CFR 15.404-1 - Proposal analysis techniques.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Proposal analysis techniques. 15.404-1 Section 15.404-1 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... assistance of other experts to ensure that an appropriate analysis is performed. (6) Recommendations or...
Directory of Open Access Journals (Sweden)
Pool Marcos
Full Text Available Objetivos. Estandarizar la técnica de reacción en cadena de la polimerasa en tiempo real (RT-PCR múltiple para la detección de virus influenza A, B y tipificación de subtipos A (H1N1 pdm09, A (H3N2 en muestras clínicas. Materiales y métodos. Se analizaron 300 muestras de hisopado nasofaríngeo. Esta metodología fue estandarizada en dos pasos: la primera reacción detectó el gen de la matriz del virus de influenza A, gen de la nucleoproteína del virus influenza B y el gen GAPDH de las células huésped. La segunda reacción detectó el gen de la hemaglutinina de los subtipos A (H1N1 pandémico (pdm09 y A (H3N2. Resultados. Se identificaron 109 muestras positivas a influenza A y B, de las cuales 72 fueron positivas a influenza A (36 positivas a influenza A (H1N1 pdm09 y 36 positivos a influenza A (H3N2 y 37 muestras positivas a influenza B. 191 fueron negativas a ambos virus mediante RT-PCR en tiempo real multiplex. Se encontró una sensibilidad y especificidad del 100% al analizar los resultados de ambas reacciones. El límite de detección viral fue del rango de 7 a 9 copias/µL por virus. Los resultados no mostraron ninguna reacción cruzada con otros virus tales como adenovirus, virus sincitial respiratorio, parainfluenza (1,2 y 3, metapneumovirus, subtipos A (H1N1 estacional, A (H5N2 y VIH. Conclusiones. La RT-PCR múltiple demostró ser una prueba muy sensible y específica para la detección de virus influenza A, B y subtipos A (H1N1, H3N2 y su uso puede ser conveniente en brotes estacionales.
Directory of Open Access Journals (Sweden)
Alok K Chakrabarti
Full Text Available Widespread infection of highly pathogenic avian influenza A H5N1 was reported from backyard and commercial poultry in West Bengal (WB, an eastern state of India in early 2008. Infection gradually spread to Tripura, Assam and Sikkim, the northeastern states, with 70 outbreaks reported between January 2008 and May 2009. Whole genome sequence analysis of three isolates from WB, one isolate from Tripura along with the analysis of hemagglutinin (HA and neuraminidase (NA genes of 17 other isolates was performed during this study. In the HA gene phylogenetic tree, all the 2008-09 Indian isolates belonged to EMA3 sublineage of clade 2.2. The closest phylogenetic relationship was found to be with the 2007-09 isolates from Bangladesh and not with the earlier 2006 and 2007 Indian isolates implying a third introduction into the country. The receptor-binding pocket of HA1 of two isolates from WB showed S221P mutation, one of the markers predicted to be associated with human receptor specificity. Two substitutions E119A (2 isolates of WB and N294S (2 other isolates of WB known to confer resistance to NA inhibitors were observed in the active site of neuraminidase. Several additional mutations were observed within the 2008-09 Indian isolates indicating genetic diversification. Overall, the study is indicative of a possible endemicity in the eastern and northeastern parts of the country, demanding active surveillance specifically in view of the critical mutations that have been observed in the influenza A H5N1 viruses.
46 CFR 42.09-5 - All vessels-division into types.
2010-10-01
... 46 Shipping 2 2010-10-01 2010-10-01 false All vessels-division into types. 42.09-5 Section 42.09-5... BY SEA Load Line Assignments and Surveys-General Requirements § 42.09-5 All vessels—division into types. (a) For the purposes of this part, each vessel to which this part applies is either a Type “A” or...
International Nuclear Information System (INIS)
Dickens, P.G.; Flynn, G.J.; Patat, S.; Stuttart, G.P.
1997-01-01
Complete crystal structures of the related phases UTi x Nb 3-x O 10 (x=0,1/3,1) and of the intercalation compound Li 0.9 UTiNb 2 O 10 have been determined by Rietveld analysis of room-temperature powder neutron diffraction data. The new structural data combined with magnetic susceptibility measurements made in the range 5 y 1 U V 1+y-x U VI x-y Ti IV x Nb V 3-x O 10 (y≤ x ≤1) with U V (f 1 ) being the only paramagnetic species present. (Author)
48 CFR 53.301-1437 - Settlement Proposal for Cost-Reimbursement Type Contracts.
2010-10-01
... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Settlement Proposal for Cost-Reimbursement Type Contracts. 53.301-1437 Section 53.301-1437 Federal Acquisition Regulations...-1437 Settlement Proposal for Cost-Reimbursement Type Contracts. ER09DE97.012 [62 FR 64951, Dec. 9, 1997] ...
Integrity verification testing of the ADI International Inc. Pilot Test Unit No. 2002-09 with MEDIA G2® arsenic adsorption media filter system was conducted at the Hilltown Township Water and Sewer Authority (HTWSA) Well Station No. 1 in Sellersville, Pennsylvania from October 8...
26 CFR 301.6109-1 - Identifying numbers.
2010-04-01
... §§ 1.671-4(b)(4) of this chapter. (6) Effective date. Paragraphs (a)(3), (4), and (5) of this section...) of this chapter, any college or university that is an educational organization as defined in § 1.501... must have an employer identification number for use in any communication with the Internal Revenue...
Wu, Yuan; Wang, Yun; Mi, Xue-Fei; Shan, Jun-Xiang; Li, Xin-Min; Xu, Jian-Long; Lin, Hong-Xuan
2016-10-01
Cytokinins and gibberellins (GAs) play antagonistic roles in regulating reproductive meristem activity. Cytokinins have positive effects on meristem activity and maintenance. During inflorescence meristem development, cytokinin biosynthesis is activated via a KNOX-mediated pathway. Increased cytokinin activity leads to higher grain number, whereas GAs negatively affect meristem activity. The GA biosynthesis genes GA20oxs are negatively regulated by KNOX proteins. KNOX proteins function as modulators, balancing cytokinin and GA activity in the meristem. However, little is known about the crosstalk among cytokinin and GA regulators together with KNOX proteins and how KNOX-mediated dynamic balancing of hormonal activity functions. Through map-based cloning of QTLs, we cloned a GA biosynthesis gene, Grain Number per Panicle1 (GNP1), which encodes rice GA20ox1. The grain number and yield of NIL-GNP1TQ were significantly higher than those of isogenic control (Lemont). Sequence variations in its promoter region increased the levels of GNP1 transcripts, which were enriched in the apical regions of inflorescence meristems in NIL-GNP1TQ. We propose that cytokinin activity increased due to a KNOX-mediated transcriptional feedback loop resulting from the higher GNP1 transcript levels, in turn leading to increased expression of the GA catabolism genes GA2oxs and reduced GA1 and GA3 accumulation. This rebalancing process increased cytokinin activity, thereby increasing grain number and grain yield in rice. These findings uncover important, novel roles of GAs in rice florescence meristem development and provide new insights into the crosstalk between cytokinin and GA underlying development process.
47 CFR 1.787 - Reports of proposed changes in depreciation rates.
2010-10-01
... 47 Telecommunication 1 2010-10-01 2010-10-01 false Reports of proposed changes in depreciation... Reports and Requests § 1.787 Reports of proposed changes in depreciation rates. Carriers shall file reports regarding proposed changes in depreciation rates as required by part 43 of this chapter. ...
International Nuclear Information System (INIS)
2009-01-01
The Pakistan Atomic Energy Commission (PAEC) annual report for the year 2008-09 has been compiled. The salient features of the activities of various Centers, Power Plants and different project have been explained. The activities are described under the topics as: highlights of various projects, nuclear power, engineering, physical sciences, biological sciences, nuclear materials, safety, human resource development, PAEC health services projects and publications. (A.B).
75 FR 59673 - Public Hearing Locations for the Proposed Fuel Economy Labels
2010-09-28
...] RIN 2060-AQ09; RIN 2127-AK73 Public Hearing Locations for the Proposed Fuel Economy Labels AGENCY... Vehicle Fuel Economy Label,'' published in the Federal Register on September 23, 2010. The goal of a... testimony or comment on the Agency's proposed revisions and additions to the motor vehicle fuel economy...
Zamaere, Christine Berkesch; Griffeth, Stephen; Sam, Steven V.
2014-08-01
We show that for Jack parameter α = -( k + 1)/( r - 1), certain Jack polynomials studied by Feigin-Jimbo-Miwa-Mukhin vanish to order r when k + 1 of the coordinates coincide. This result was conjectured by Bernevig and Haldane, who proposed that these Jack polynomials are model wavefunctions for fractional quantum Hall states. Special cases of these Jack polynomials include the wavefunctions of Laughlin and Read-Rezayi. In fact, along these lines we prove several vanishing theorems known as clustering properties for Jack polynomials in the mathematical physics literature, special cases of which had previously been conjectured by Bernevig and Haldane. Motivated by the method of proof, which in the case r = 2 identifies the span of the relevant Jack polynomials with the S n -invariant part of a unitary representation of the rational Cherednik algebra, we conjecture that unitary representations of the type A Cherednik algebra have graded minimal free resolutions of Bernstein-Gelfand-Gelfand type; we prove this for the ideal of the ( k + 1)-equals arrangement in the case when the number of coordinates n is at most 2 k + 1. In general, our conjecture predicts the graded S n -equivariant Betti numbers of the ideal of the ( k + 1)-equals arrangement with no restriction on the number of ambient dimensions.
77 FR 35660 - Proposed Collection; Comment Request
2012-06-14
...; WHS Form 09; OMB Control Number 0704-TBD. Needs and Uses: The information collection requirement is...) and the outcome of such requests. Respondents are employees of WHS serviced components or applicants for employment of WHS serviced components. Dated: May 7, 2012. Patricia L. Toppings, OSD Federal...
International Nuclear Information System (INIS)
Dinamarca, Robinson; Garcia, Ximena; Jimenez, Romel; Fierro, J.L.G.; Pecchi, Gina
2016-01-01
Highlights: • A-site defective perovskites increases the oxidation state of the B-cation. • Not always non-stoichiometric perovskites exhibit higher catalytic activity in soot combustion. • The highly symmetric cubic crystalline structure diminishes the redox properties of perovskites. - Abstract: The influence of lanthanum stoichiometry in Ag-doped (La_1_-_xAg_xMn_0_._9Co_0_._1O_3) and A-site deficient (La_1_-_xMn_0_._9Co_0_._1O_3_-_δ) perovskites with x equal to 10, 20 and 30 at.% has been investigated in catalysts for soot combustion. The catalysts were prepared by the amorphous citrate method and characterized by XRD, nitrogen adsorption, XPS, O_2-TPD and TPR. The formation of a rhombohedral excess-oxygen perovskite for Ag-doped and a cubic perovskite structure for an A-site deficient series is confirmed. The efficient catalytic performance of the larger Ag-doped perovskite structure is attributed to the rhombohedral crystalline structure, Ag_2O segregated phases and the redox pair Mn"4"+/Mn"3"+. A poor catalytic activity for soot combustion was observed with A-site deficient perovskites, despite the increase in the redox pair Mn"4"+/Mn"3"+, which is attributed to the cubic crystalline structure.
Garcia-Sicilia, José; Arístegui, Javier; Omeñaca, Félix; Carmona, Alfonso; Tejedor, Juan C; Merino, José M; García-Corbeira, Pilar; Walravens, Karl; Bambure, Vinod; Moris, Philippe; Caplanusi, Adrian; Gillard, Paul; Dieussaert, Ilse
2015-01-01
In children, 2 AS03-adjuvanted A(H1N1)pdm09 vaccine doses given 21 days apart were previously shown to induce a high humoral immune response and to have an acceptable safety profile up to 42 days following the first vaccination. Here, we analyzed the persistence data from 2 open-label studies, which assessed the safety, and humoral and cell-mediated immune responses induced by 2 doses of this vaccine. The first study was a phase II, randomized trial conducted in 104 children aged 6-35 months vaccinated with the A(H1N1)pdm09 vaccine containing 1.9 µg haemagglutinin antigen (HA) and AS03B (5.93 mg tocopherol) and the second study, a phase III, non-randomized trial conducted in 210 children and adolescents aged 3-17 years vaccinated with the A(H1N1)pdm09 vaccine containing 3.75 µg HA and AS03A (11.86 mg tocopherol). Approximately one year after the first dose, all children with available data were seropositive for haemagglutinin inhibition and neutralising antibody titres, but a decline in geometric mean antibody titres was noted. The vaccine induced a cell-mediated immune response in terms of antigen-specific CD4(+) T-cells, which persisted up to one year post-vaccination. The vaccine did not raise any safety concern, though these trials were not designed to detect rare events. In conclusion, 2 doses of the AS03-adjuvanted A(H1N1)pdm09 vaccine at 2 different dosages had a clinically acceptable safety profile, and induced high and persistent humoral and cell-mediated immune responses in children aged 6-35 months and 3-17 years. These studies have been registered at www.clinicaltrials.gov NCT00971321 and NCT00964158.
Viswanath, Pamarti; Prashanth, Sadhu Sai Pavan; Molli, Muralikrishna; Wicram, Jaschin Prem; Sai Muthukumar, V.
2018-04-01
Glass ceramics are excellent replacement for single crystalline materials which are expensive and difficult to fabricate. In this context, we have attempted to fabricate glass nanocomposites comprising of Lithium Borate glass matrix embedded with lead free ferroelectric Ba0.85Ca0.15Zr0.1Ti0.9O3 (BCZT). Both of these functional materials are known to exhibit excellent ferroelectric behavior and are currently explored for various device applications. We have prepared these novel glass nanocomposite using melt-quenching techniquein various chemical composition involving different molar ratio. x(Ba0.85Ca0.15Zr0.1Ti0.9O3)-(1-x)(Li2O.2B2O3) where (x=0.1,0.2,0.3,0.4). The as-quenched samples exhibited amorphous nature as revealed by X-ray Diffraction studies. With the increase in BCZT content we have observed significant alteration in optical bandgap and Urbach energy. The tailoring of optical properties by tuning the structure was probed by Raman vibrational spectroscopy which confirmed the dominant role played by BCZT as a network modifier in these borate glasses. Concomitantly, these glass nanocomposites were found to be excellent UV absorbers.
iMovie '09 & iDVD pocket genius
Hart-Davis, Guy
2010-01-01
If you want to get the very most out of iMovie '09 or iDVD, put this savvy Portable Genius to work. Want to quickly turn raw footage into a polished movie? Crop, rotate, or delete clips? Add background music or sound effects? Customize your iDVD themes? You'll find cool and useful Genius tips, insider secrets, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy iMovie '09 and iDVD to the max.
Mechanical properties of the Mg-14Ti-1Al-0.9Mn (%Wt) synthesized by physical vapour
International Nuclear Information System (INIS)
Garces, G.; Cristina, M. C.; Torralba, M.; Adeva, P.
2001-01-01
The mechanical properties of the alloy Mg-14% Ti-1% Al-0.9 Mn obtained by PVD techniques have been evaluated up to 300 degree centigree. The alloy presents a columnar grain microstructure, typical of the zone 2 of the structure zone model of MD, where surface diffusion takes place. The alloy tested in compression at room temperature presented a high yield stress, 360 MPa. This resistance to the plastic deformation is principally due to a solid solution hardening and small grain size. The yield stress decrease with the compression temperature. However, the alloy showed low fracture resistance, especially at room temperature. The presence of pores at the grain boundaries, results in the crack formation, running fast along the grain boundary. (Author) 13 refs
Enhanced reducibility and electronic conductivity of Nb or W doped Ce0.9Gd0.1O1.95 - δ
DEFF Research Database (Denmark)
Chatzichristodoulou, Christodoulos; Ricote, Sandrine; Foghmoes, Søren Preben Vagn
2015-01-01
The transport and thermomechanical properties of acceptor (Gd) and donor (Nb or W) co-doped ceria were investigated. The solubility limit of Nb in Ce0.9Gd0.1O2 - δ (CGO10) exceeds 4 at.%, whereas that of W is approximately 2 at.%. Both the thermal and stoichiometric expansion coefficients...... are decreased relative to that of CGO10. Charge compensation of the donor dopants takes place primarily by annihilation of oxide ion vacancies, and a sharp decrease in ionic mobility is observed upon Nb or W doping of CGO10. On the other hand, the n-type electronic conductivity, associated with the reduction...... of Ce4+, increases upon doping with Nb or W, due to enhanced reducibility of cerium. This is beneficial for applications where electronic conductivity is also required, like oxygen permeation membranes. Modeling shows that 4 at.% Nb or W doped CGO10 will deliver higher oxygen fluxes than CGO10, due...
Performance of different metrics proposed to CIE TC 1-91
Bhusal, P.; Dangol, R.
2017-01-01
The main aim of the article is to find out the performance of different metrics proposed to CIE TC 1-91. Currently, six different indexes have been proposed to CIE TC 1-91: Colour Quality Scale (CQS), Feeling of Contrast Index (FCI), Memory colour rendering index (MCRI), Preference of skin (PS),
Pan-STARRS1 DISCOVERY OF TWO ULTRALUMINOUS SUPERNOVAE AT z Almost-Equal-To 0.9
Energy Technology Data Exchange (ETDEWEB)
Chomiuk, L. [National Radio Astronomy Observatory, P.O. Box O, Socorro, NM 87801 (United States); Chornock, R.; Soderberg, A. M.; Berger, E.; Foley, R. J.; Kirshner, R. P.; Czekala, I. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Chevalier, R. A. [Department of Astronomy, University of Virginia, P.O. Box 400325, Charlottesville, VA 22904-4325 (United States); Huber, M. E.; Gezari, S.; Riess, A.; Rodney, S. A. [Department of Physics and Astronomy, Johns Hopkins University, 3400 North Charles Street, Baltimore, MD 21218 (United States); Narayan, G.; Stubbs, C. W. [Department of Physics, Harvard University, Cambridge, MA 02138 (United States); Rest, A. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Smartt, S. J. [Astrophysics Research Centre, School of Mathematics and Physics, Queen' s University Belfast, Belfast BT7 1NN (United Kingdom); Tonry, J. L.; Burgett, W. S.; Chambers, K. C. [Institute for Astronomy, University of Hawaii at Manoa, Honolulu, HI 96822 (United States); Wood-Vasey, W. M., E-mail: lchomiuk@cfa.harvard.edu [Department of Physics and Astronomy, University of Pittsburgh, 3941 O' Hara Street, Pittsburgh, PA 15260 (United States); and others
2011-12-20
We present the discovery of two ultraluminous supernovae (SNe) at z Almost-Equal-To 0.9 with the Pan-STARRS1 Medium Deep Survey. These SNe, PS1-10ky and PS1-10awh, are among the most luminous SNe ever discovered, comparable to the unusual transients SN 2005ap and SCP 06F6. Like SN 2005ap and SCP 06F6, they show characteristic high luminosities (M{sub bol} Almost-Equal-To -22.5 mag), blue spectra with a few broad absorption lines, and no evidence for H or He. We have constructed a full multi-color light curve sensitive to the peak of the spectral energy distribution in the rest-frame ultraviolet, and we have obtained time series spectroscopy for these SNe. Given the similarities between the SNe, we combine their light curves to estimate a total radiated energy over the course of explosion of (0.9-1.4) Multiplication-Sign 10{sup 51} erg. We find photospheric velocities of 12,000-19,000 km s{sup -1} with no evidence for deceleration measured across {approx}3 rest-frame weeks around light curve peak, consistent with the expansion of an optically thick massive shell of material. We show that, consistent with findings for other ultraluminous SNe in this class, radioactive decay is not sufficient to power PS1-10ky, and we discuss two plausible origins for these events: the initial spin-down of a newborn magnetar in a core-collapse SN, or SN shock breakout from the dense circumstellar wind surrounding a Wolf-Rayet star.
DEFF Research Database (Denmark)
Kjellsson, Gøsta; Strandberg, Morten Tune
2012-01-01
"DMU har modtaget og vurderet de supplerende oplysninger (mail fra Skov- og Naturstyrelsen d. 07-09-2004) til ansøgningen om tilladelse til markedsføring af genetisk modificeret majs C/DE/02/09 (MON863 og MON863 x MON810). Vi har gennemgået oplysningerne i det tilsendte materiale for at se om de ...
Gubari, Ghamdan M. M.; Ibrahim Mohammed S., M.; Huse, Nanasaheb P.; Dive, Avinash S.; Sharma, Ramphal
2018-05-01
The Cu0.1Zn0.9S thin film was grown by facile chemical bath deposition (CBD) method on glass substrates at 60°C. The structural, morphological, photosensor properties of the as-grown thin film has been investigated. The structural and phase confirmation of the as-grown thin film was carried out by X-ray diffraction (XRD) technique and Raman spectroscopy. The FE-SEM images showed that the thin films are well covered with material on an entire glass substrate. From the optical absorption spectrum, the direct band gap energy for the Cu0.1Zn0.9S thin film was found to be ˜3.16 eV at room temperature. The electrical properties were measured at room temperature in the voltage range ±2.5 V, showed a drastic enhancement in current under light illumination with the highest photosensitivity of ˜72 % for 260 W.
76 FR 17403 - Proposed Priorities: Disability in the Family
2011-03-29
... Disabilities, 34, 76-80. Lightfoot, E., Hill, K., & LaLiberte, T. (2010). The inclusion of disability as a... DEPARTMENT OF EDUCATION [CFDA: 84.133A-09] Proposed Priorities: Disability in the Family AGENCY... Disability and Rehabilitation Research Projects and Centers Program administered by NIDRR. Specifically, this...
NJP Volume 38 Number 1 PDF.cdr
African Journals Online (AJOL)
Prof Ezechukwu
discrimination against HIV orphans. ... both of their parents to AIDS The estimated number of AIDS orphans in Nigeria at the end of 2007 was. 1,200,000. ..... American Academy of ... Malabika et al , in central Kampala, Uganda, it was reported ...
International Nuclear Information System (INIS)
Xu Lin; Luo Mingfang; Li Wangliang; Wei Xuetuan; Xie Keng; Liu Lijun; Jiang Chengying; Liu Huizhou
2011-01-01
Research highlights: → Growing cells have high Cr (VI) resistant and reducing ability aerobically. → Resting cells show strong anaerobic-reduction potential. → Acetate can highly stimulate both aerobic and anaerobic reduction process. - Abstract: A novel Cr (VI) resistant bacterial strain LSSE-09, identified as Pannonibacter phragmitetus, was isolated from industrial sludge. It has strong aerobic and anaerobic Cr (VI)-reduction potential under alkaline conditions. At 37 o C and pH 9.0, growing cells of strain LSSE-09 could completely reduce 100 and 1000 mg L -1 Cr (VI)-Cr (III) within 9 and 24 h, respectively under aerobic condition. Resting cells showed higher anaerobic reduction potential with the rate of 1.46 mg g -1 (dryweight) min -1 , comparing with their aerobic reduction rate, 0.21 mg g -1 min -1 . External electron donors, such as lactate, acetate, formate, pyruvate, citrate and glucose could highly increase the reduction rate, especially for aerobic reduction. The presence of 3000 mg L -1 acetate enhanced anaerobic and aerobic Cr (VI)-reduction rates up to 9.47 mg g -1 min -1 and 4.42 mg g -1 min -1 , respectively, which were 5 and 20 times faster than those without it. Strain LSSE-09 retained high activities over six batch cycles and NO 3 - and SO 4 2- had slightly negative effects on Cr (VI)-reduction rates. The results suggest that strain LSSE-09 has potential application for Cr (VI) detoxification in alkaline wastewater.
Khan, Kamran; Eckhardt, Rose; Brownstein, John S; Naqvi, Raza; Hu, Wei; Kossowsky, David; Scales, David; Arino, Julien; MacDonald, Michael; Wang, Jun; Sears, Jennifer; Cetron, Martin S
2013-05-01
To evaluate the screening measures that would have been required to assess all travellers at risk of transporting A(H1N1)pdm09 out of Mexico by air at the start of the 2009 pandemic. Data from flight itineraries for travellers who flew from Mexico were used to estimate the number of international airports where health screening measures would have been needed, and the number of travellers who would have had to be screened, to assess all air travellers who could have transported the H1N1 influenza virus out of Mexico during the initial stages of the 2009 A(H1N1) pandemic. Exit screening at 36 airports in Mexico, or entry screening of travellers arriving on direct flights from Mexico at 82 airports in 26 other countries, would have resulted in the assessment of all air travellers at risk of transporting A(H1N1)pdm09 out of Mexico at the start of the pandemic. Entry screening of 116 travellers arriving from Mexico by direct or connecting flights would have been necessary for every one traveller at risk of transporting A(H1N1)pdm09. Screening at just eight airports would have resulted in the assessment of 90% of all air travellers at risk of transporting A(H1N1)pdm09 out of Mexico in the early stages of the pandemic. During the earliest stages of the A(H1N1) pandemic, most public health benefits potentially attainable through the screening of air travellers could have been achieved by screening travellers at only eight airports.
Toyo-Oka, L; Mahasirimongkol, S; Yanai, H; Mushiroda, T; Wattanapokayakit, S; Wichukchinda, N; Yamada, N; Smittipat, N; Juthayothin, T; Palittapongarnpim, P; Nedsuwan, S; Kantipong, P; Takahashi, A; Kubo, M; Sawanpanyalert, P; Tokunaga, K
2017-09-01
Tuberculosis (TB) occurs as a result of complex interactions between the host immune system and pathogen virulence factors. Human leukocyte antigen (HLA) class II molecules play an important role in the host immune system. However, no study has assessed the association between HLA class II genes and susceptibility to TB caused by specific strains. This study investigated the possible association of HLA class II genes with TB caused by modern and ancient Mycobacterium tuberculosis (MTB). The study included 682 patients with TB and 836 control subjects who were typed for HLA-DRB1 and HLA-DQB1 alleles. MTB strains were classified using a large sequence polymorphism typing method. Association analysis was performed using common HLA alleles and haplotypes in different MTB strains. HLA association analysis of patients infected with modern MTB strains showed significant association for HLA-DRB1*09:01 (odds ratio [OR] = 1.82; P-value = 9.88 × 10 -4 ) and HLA-DQB1*03:03 alleles (OR = 1.76; P-value = 1.31 × 10 -3 ) with susceptibility to TB. Haplotype analysis confirmed that these alleles were in strong linkage disequilibrium and did not exert an interactive effect. Thus, the results of this study showed an association between HLA class II genes and susceptibility to TB caused by modern MTB strains, suggesting the importance of strain-specific analysis to determine susceptibility genes associated with TB. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Effect of synthesis conditions on the nanopowder properties of Ce{sub 0.9}Zr{sub 0.1}O{sub 2}
Energy Technology Data Exchange (ETDEWEB)
Zimicz, M.G.; Fabregas, I.O.; Lamas, D.G. [CINSO (Centro de Investigaciones en Solidos) CONICET-CITEFA J.B. de La Salle 4397, 1603 Villa Martelli, Pcia. de Buenos Aires (Argentina); Larrondo, S.A., E-mail: susana@di.fcen.uba.ar [Laboratorio de Procesos Cataliticos, Departamento de Ingenieria Quimica, Facultad de Ingenieria, Universidad de Buenos Aires, Pabellon de Industrias, Ciudad Universitaria, 1428 Buenos Aires (Argentina)
2011-06-15
Graphical abstract: . The synthesis of nanocrystalline Ce{sub 0.9}Zr{sub 0.1}O{sub 2} powders via the gel-combustion method, using different fuels, and following either stoichiometric or non-stoichiometric pH-controlled routes is investigated. Research highlights: {yields} All samples exhibited the fluorite-type crystal structure, nanometric average crystallite size and negligible carbon content. {yields} Synthesis conditions strongly affect the average crystallite size, the degree of agglomeration, the specific surface area and the pore volume. {yields} Our results indicate that, by controlling the synthesis conditions it is possible to obtain solids with custom-made morphological properties. -- Abstract: In this work, the synthesis of nanocrystalline Ce{sub 0.9}Zr{sub 0.1}O{sub 2} powders via the gel-combustion method, using different fuels, and following either stoichiometric or non-stoichiometric pH-controlled routes is investigated. The objective is to evaluate the effect of synthesis conditions on the textural and morphological properties, and the crystal structure of the synthesized materials. The solids were characterized by nitrogen physisorption, Scanning Electron Microscopy (SEM), X-ray powder diffraction (XPD), and Carbon-Hydrogen-Nitrogen Elemental Analysis (CHN). All the powders exhibited nanometric crystallite size, fluorite-type structure and negligible carbon content. Synthesis conditions strongly affect the average crystallite size, the degree of agglomeration, the specific surface area and the pore volume. Our results indicate that, by controlling the synthesis conditions it is possible to obtain solids with custom-made morphological properties.
International Nuclear Information System (INIS)
Nakayama, Kazunori; Takahashi, Fuminobu; Yanagida, Tsutomu T.
2011-01-01
We propose that the stability of dark matter is ensured by a discrete subgroup of the U(1) B-L gauge symmetry, Z 2 (B-L). We introduce a set of chiral fermions charged under the U(1) B-L in addition to the right-handed neutrinos, and require the anomaly-cancellation conditions associated with the U(1) B-L gauge symmetry. We find that the possible number of fermions and their charges are tightly constrained, and that non-trivial solutions appear when at least five additional chiral fermions are introduced. The Fermat theorem in the number theory plays an important role in this argument. Focusing on one of the solutions, we show that there is indeed a good candidate for dark matter, whose stability is guaranteed by Z 2 (B-L).
48 CFR 815.404-1 - Proposal analysis techniques.
2010-10-01
... CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Contract Pricing 815.404-1 Proposal analysis... necessary for initial and revised pricing of all negotiated prime contracts, including subcontract pricing...
Barakat, Amal; Ihazmad, Hassan; El Falaki, Fatima; Tempia, Stefano; Cherkaoui, Imad; El Aouad, Rajae
2012-01-01
Background. Following the emergence of 2009 pandemic influenza A virus subtype H1N1 (A[H1N1]pdm09) in the United States and Mexico in April 2009, A(H1N1)pdm09 spread rapidly all over the world. There is a dearth of information about the epidemiology of A(H1N1)pdm09 in Africa, including Morocco. We describe the epidemiologic characteristics of the A(H1N1)pdm09 epidemic in Morocco during 2009–2010, including transmissibility and risk factors associated with fatal disease. Methods. We implemented influenza surveillance for patients presenting with influenza-like illness (ILI) at 136 private and public clinics for patients with severe acute respiratory illness (SARI) at 16 regional public hospitals from June 2009 through February 2010. Respiratory samples and structured questionnaires were collected from all enrolled patients, and samples were tested by real-time reverse-transcription polymerase chain reaction for influenza viruses. We estimated the risk factors associated with fatal disease as well as the basic reproduction number (R0) and the serial interval of the pandemic virus. Results. From June 2009 through February 2010, we obtained 3937 specimens, of which 1452 tested positive for influenza virus. Of these, 1398 (96%) were A(H1N1)pdm09. Forty percent of specimens from ILI cases (1056 of 2646) and 27% from SARI cases (342 of 1291) were positive for A(H1N1)pdm09. Sixty-four deaths occurred among laboratory-confirmed A(H1N1)pdm09 SARI cases. Among these cases, those who had hypertension (age-adjusted odd ratio [aOR], 28.2; 95% confidence interval [CI], 2.0–398.7), had neurological disorders (aOR, 7.5; 95% CI, 1.5–36.4), or were obese (aOR, 7.1; 95% CI, 1.6–31.1), as well as women of gestational age who were pregnant (aOR, 2.5; 95% CI, 1.1–5.6), were at increased risk of death. Across the country, elevated numbers of locally acquired infections were detected 4 months after the detection of the first laboratory-confirmed case and coincided with the
Energy Technology Data Exchange (ETDEWEB)
Ghoudi, Hanen; Khirouni, Kamel [Universite de Gabes, Laboratoire de Physique des Materiaux et des Nanomateriaux Appliquee a l' Environnement (La Phy MNE), Faculte des Sciences de Gabes, Gabes (Tunisia); Chkoundali, Souad [Universite de Sfax, Laboratoire des Materiaux Multifonctionnels et Applications (LaMMA), Faculte des Sciences de Sfax (FSS), Sfax (Tunisia); Aydi, Abdelhedi [Universite de Gabes, Laboratoire de Physique des Materiaux et des Nanomateriaux Appliquee a l' Environnement (La Phy MNE), Faculte des Sciences de Gabes, Gabes (Tunisia); Universite de Sfax, Laboratoire des Materiaux Multifonctionnels et Applications (LaMMA), Faculte des Sciences de Sfax (FSS), Sfax (Tunisia)
2017-11-15
(Ba{sub 0.7}Sr{sub 0.3}){sub 1-x}Na{sub x}(Ti{sub 0.9}Sn{sub 0.1}){sub 1-x}Nb{sub x}O{sub 3} ceramics with compositions x = 0.6, 0.7, 0.8 and 0.9 were synthesized using the solid-state reaction method. These ceramics were examined by X-ray diffraction and dielectric measurements over a broad temperature and frequency ranges. X-ray diffraction patterns revealed a single-perovskite phase crystallized in a cubic structure, for x < 0.8, and in tetragonal, for x ≥ 0.8, with Pm3m and P4mm spaces groups, respectively. Two types of behaviors, classical ferroelectric or relaxor, were observed depending on the x composition. It is noted that temperatures T{sub C} (the Curie temperature) or T{sub m} (the temperature of maximum permittivity) rise when x increases and the relaxor character grows more significantly when x composition decreases. To analyze the dielectric relaxation degree of relaxor, various models were considered. It was proven that an exponential function could well describe the temperature dependence of the static dielectric constant and relaxation time. (orig.)
NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MDOM-09-0050 ref|NP_689554.2| progestin and adipoQ receptor family member IV [...Homo sapiens] sp|Q8N4S7|PAQR4_HUMAN RecName: Full=Progestin and adipoQ receptor family member 4; AltName: Full=Progesti...n and adipoQ receptor family member IV gb|AAH33703.1| Progestin and adipoQ receptor family member... IV [Homo sapiens] gb|AAR08370.1| progestin and adipoQ receptor family member IV ...[Homo sapiens] gb|EAW85441.1| progestin and adipoQ receptor family member IV, isoform CRA_a [Homo sapiens] gb|EAW85443.1| progesti
Lower and upper chromatic numbers for BSTSs(2h - 1
Directory of Open Access Journals (Sweden)
Marco Buratti
2001-08-01
Full Text Available In [Discrete Math. 174, (1997 247-259] an infinite class of STSs(2h - 1 was found with the upper chromatic number not(χ=h. We prove that in this class, for all STSs(2h - 1 with h<10, the lower chromatic number coincides with the upper chromatic number, i.e. χ=not(χ=h and moreover, there exists a infinite sub-class of STSs with χ=not(χ=h for any value of h.
Ali, Sheikh Taslim; Kadi, A S; Ferguson, Neil M
2013-12-01
The role of social-distancing measures, such as school closures, is a controversial aspect of pandemic mitigation planning. However, the timing of 2009 pandemic provides a natural experiment for evaluating the impact of school closure during holidays on influenza transmission. To quantify the transmission intensity of the influenza A (H1N1) pdm'09 in India, by estimating the time varying reproduction number (Rt) and correlating the temporal changes in the estimates of Rt for different regions of India with the timing of school holidays. We used daily lab-confirmed case reports of influenza A (H1N1) pdm'09 in India (during 17 May'09 to 17 May'10), stratified by regions. We estimated the transmissibility of the pandemic for different regions from these time-series, using Bayesian methods applied to a branching process model of disease spread and correlated the resulting estimates with the timing of school holidays in each region. The North-west region experienced two notable waves, with the peak of the first wave coinciding with the start of a 4 week school holiday (September-October'09). In the southern region the two waves were less clear cut, though again the first peak of the first wave coincided with the start of school holidays--albeit of less than 2 weeks duration (August'09). Our analysis suggests that the school holidays had a significant influence on the epidemiology of the 2009 pandemic in India. We estimate that school holidays reduced the reproduction number by 14-27% in different regions of India, relative to levels seen outside holiday periods. The estimates of the reproduction number obtained (with peak R values below 1.5) are compatible with those reported from other regions of the world. This work reinforces past studies showing the significant impact of school holidays on spread of 2009 pandemic virus, and by inference the role of contact patterns in children on transmission. Copyright © 2013 Sheikh Taslim Ali Elsevier B.V. Published by Elsevier B
78 FR 72141 - New Mexico Disaster Number NM-00037
2013-12-02
... SMALL BUSINESS ADMINISTRATION [Disaster Declaration 13787 and 13788] New Mexico Disaster Number NM... Mexico (FEMA-4148-DR), dated 09/30/2013. Incident: Severe Storms and Flooding Incident Period: 07/23/2013... INFORMATION: The notice of the President's major disaster declaration for Private Non-Profit organizations in...
Proposed Columbia Wind Farm No. 1 : Draft Environmental Impact Statement, Joint NEPA/SEPA.
Energy Technology Data Exchange (ETDEWEB)
United States. Bonneville Power Administration; Klickitat County (Wash.)
1995-03-01
This Draft Environmental Impact Statement (DEIS) addresses the Columbia Wind Farm {number_sign}1 (Project) proposal for construction and operation of a 25 megawatt (MW) wind power project in the Columbia Hills area southeast of Goldendale in Klickitat County, Washington. The Project would be constructed on private land by Conservation and Renewable Energy System (CARES) (the Applicant). An Environmental Impact Statement is required under both NEPA and SEPA guidelines and is issued under Section 102 (2) (C) of the National Environmental Policy Act (NEPA) at 42 U.S.C. 4321 et seq and under the Washington State Environmental Policy Act (SEPA) as provided by RCW 43.21C.030 (2) (c). Bonneville Power Administration is the NEPA lead agency; Klickitat County is the nominal SEPA lead agency and CARES is the SEPA co-lead agency for this DEIS. The Project site is approximately 395 hectares (975 acres) in size. The Proposed Action would include approximately 91 model AWT-26 wind turbines. Under the No Action Alternative, the Project would not be constructed and existing grazing and agricultural activities on the site would continue.
Understanding the impact of 1q21.1 copy number variant
Directory of Open Access Journals (Sweden)
Harvard Chansonette
2011-08-01
Full Text Available Abstract Background 1q21.1 Copy Number Variant (CNV is associated with a highly variable phenotype ranging from congenital anomalies, learning deficits/intellectual disability (ID, to a normal phenotype. Hence, the clinical significance of this CNV can be difficult to evaluate. Here we described the consequences of the 1q21.1 CNV on genome-wide gene expression and function of selected candidate genes within 1q21.1 using cell lines from clinically well described subjects. Methods and Results Eight subjects from 3 families were included in the study: six with a 1q21.1 deletion and two with a 1q21.1 duplication. High resolution Affymetrix 2.7M array was used to refine the 1q21.1 CNV breakpoints and exclude the presence of secondary CNVs of pathogenic relevance. Whole genome expression profiling, studied in lymphoblast cell lines (LBCs from 5 subjects, showed enrichment of genes from 1q21.1 in the top 100 genes ranked based on correlation of expression with 1q21.1 copy number. The function of two top genes from 1q21.1, CHD1L/ALC1 and PRKAB2, was studied in detail in LBCs from a deletion and a duplication carrier. CHD1L/ALC1 is an enzyme with a role in chromatin modification and DNA damage response while PRKAB2 is a member of the AMP kinase complex, which senses and maintains systemic and cellular energy balance. The protein levels for CHD1L/ALC1 and PRKAB2 were changed in concordance with their copy number in both LBCs. A defect in chromatin remodeling was documented based on impaired decatenation (chromatid untangling checkpoint (DCC in both LBCs. This defect, reproduced by CHD1L/ALC1 siRNA, identifies a new role of CHD1L/ALC1 in DCC. Both LBCs also showed elevated levels of micronuclei following treatment with a Topoisomerase II inhibitor suggesting increased DNA breaks. AMP kinase function, specifically in the deletion containing LBCs, was attenuated. Conclusion Our studies are unique as they show for the first time that the 1q21.1 CNV not only
Treatability study Number PDC-1-O-T. Final report
International Nuclear Information System (INIS)
1998-01-01
Los Alamos National Laboratory provided treatability study samples from four waste streams, designated Stream number-sign 1, Stream number-sign 3, Stream number-sign 6, and Stream number-sign 7. Stream number-sign 1 consisted of one 55-gallon drum of personal protective equipment (PPE), rags, and neutralizing agent (bicarbonate) generated during the cleanup of a sodium dichromate solution spill. Stream number-sign 3 was one 55-gallon drum of paper, rags, lab utensils, tools, and tape from the decontamination of a glovebox. The sample of Stream number-sign 6 was packaged in three 30-gallon drums and a 100 ft 3 wooden box. It consisted of plastic sheeting, PPE, and paper generated from the cleanup of mock explosive (barium nitrate) from depleted uranium parts. Stream number-sign 7 was scrap metal (copper, stainless and carbon steel joined with silver solder) from the disassembly of gas manifolds. The objective of the treatability study is to determine: (1) whether the Perma-Fix stabilization/solidification process can treat the waste sample to meet Land Disposal Restrictions and the Waste Acceptance Criteria for LANL Technical Area 54, Area G, and (2) optimum loading and resulting weight and volume of finished waste form. The stabilized waste was mixed into grout that had been poured into a lined drum. After each original container of waste was processed, the liner was closed and a new liner was placed in the same drum on top of the previous closed liner. This allowed an overall reduction in waste volume but kept waste segregated to minimize the amount of rework in case analytical results indicated any batch did not meet treatment standards. Samples of treated waste from each waste stream were analyzed by Perma-Fix Analytical Services to get a preliminary approximation of TCLP metals. Splits of these samples were sent to American Environmental Network's mixed waste analytical lab in Cary, NC for confirmation analysis. Results were all below applicable limits
Light U(1) gauge boson coupled to baryon number
International Nuclear Information System (INIS)
Carone, C.D.; Murayama, Hitoshi
1995-06-01
The authors discuss the phenomenology of a light U(1) gauge boson, γ B , that couples only to baryon number. Gauging baryon number at high energies can prevent dangerous baryon-number violating operators that may be generated by Planck scale physics. However, they assume at low energies that the new U(1) gauge symmetry is spontaneously broken and that the γ B mass m B is smaller than m z . They show for m Υ B z that the γB coupling α B can be as large as ∼ 0.1 without conflicting with the current experimental constraints. The authors argue that α B ∼ 0.1 is large enough to produce visible collider signatures and that evidence for the γ B could be hidden in existing LEP data. They show that there are realistic models in which mixing between the γ B and the electroweak gauge bosons occurs only as a radiative effect and does not lead to conflict with precision electroweak measurements. Such mixing may nevertheless provide a leptonic signal for models of this type at an upgraded Tevatron
Energy Technology Data Exchange (ETDEWEB)
Nakayama, Kazunori [Theory Center, KEK, 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan); Takahashi, Fuminobu, E-mail: fumi@tuhep.phys.tohoku.ac.jp [Department of Physics, Tohoku University, Sendai 980-8578 (Japan); Institute for the Physics and Mathematics of the Universe, University of Tokyo, Kashiwa 277-8568 (Japan); Yanagida, Tsutomu T. [Institute for the Physics and Mathematics of the Universe, University of Tokyo, Kashiwa 277-8568 (Japan); Department of Physics, University of Tokyo, Tokyo 113-0033 (Japan)
2011-05-23
We propose that the stability of dark matter is ensured by a discrete subgroup of the U(1){sub B-L} gauge symmetry, Z{sub 2}(B-L). We introduce a set of chiral fermions charged under the U(1){sub B-L} in addition to the right-handed neutrinos, and require the anomaly-cancellation conditions associated with the U(1){sub B-L} gauge symmetry. We find that the possible number of fermions and their charges are tightly constrained, and that non-trivial solutions appear when at least five additional chiral fermions are introduced. The Fermat theorem in the number theory plays an important role in this argument. Focusing on one of the solutions, we show that there is indeed a good candidate for dark matter, whose stability is guaranteed by Z{sub 2}(B-L).
38 CFR 1.575 - Social security numbers in veterans' benefits matters.
2010-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Social security numbers... Affairs Records § 1.575 Social security numbers in veterans' benefits matters. (a) Except as provided in... because of refusal to disclose to the Department of Veterans Affairs a social security number. (b) VA...
Photon number projection using non-number-resolving detectors
International Nuclear Information System (INIS)
Rohde, Peter P; Webb, James G; Huntington, Elanor H; Ralph, Timothy C
2007-01-01
Number-resolving photo-detection is necessary for many quantum optics experiments, especially in the application of entangled state preparation. Several schemes have been proposed for approximating number-resolving photo-detection using non-number-resolving detectors. Such techniques include multi-port detection and time-division multiplexing. We provide a detailed analysis and comparison of different number-resolving detection schemes, with a view to creating a useful reference for experimentalists. We show that the ideal architecture for projective measurements is a function of the detector's dark count and efficiency parameters. We also describe a process for selecting an appropriate topology given actual experimental component parameters
41 CFR 115-1.109 - Numbering in FPMR system.
2010-07-01
... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Numbering in FPMR system. 115-1.109 Section 115-1.109 Public Contracts and Property Management Federal Property Management Regulations System (Continued) ENVIRONMENTAL PROTECTION AGENCY 1-INTRODUCTION 1.1-Regulation System § 115-1...
International Nuclear Information System (INIS)
1997-10-01
The Proposed Action is the sale of all right, title and interest of the US in Naval Petroleum Reserve Number 1 (NPR-1) in accordance with the National Defense Authorization Act for Fiscal Year 1996 (Public Law 104-106). The Proposed Action is also DOE's Preferred Alternative. DOE has determined that the sale of NPR-1 as required by Public Law 104-106 constitutes a major Federal action which may have a significant impact upon the environment within the meaning of the National Environmental Policy Act of 1969 (NEPA) and Kern County has determined that the sale could have a significant effect on the environment under the California Environmental Quality Act of 1970 (CEQA). Significant impacts may occur because private-sector operation of the NPR-1 oil field could result in accelerated levels of development and different types of activities than under continued government ownership. This SEIS/PEIR assesses the potential environmental impacts from the Proposed Action, a No Action Alternative under which NPR-1 would continue to be operated by DOE, and an Alternative to the Proposed Action under which some form of government control would be maintained. This document assesses the environmental impacts on: geology and soils; hazardous materials and waste management; air; water; biology; cultural and historical resources; land use; noise socioeconomics; risk assessment; energy conservation; and environmental justice
75 FR 1761 - Combined Notice of Filings #1
2010-01-13
.... Applicants: Cloud County Wind Farm, LLC, Pioneer Prairie Wind Farm I, LLC, Arlington Wind Power Project LLC... of the Localized Costs Sharing Agreement. Filed Date: 12/22/2009. Accession Number: 20091224-0002... Rate Schedule 1 effective 11/25/09. Filed Date: 12/22/2009. Accession Number: 20091224-0077. Comment...
76 FR 62801 - Combined Notice of Filings #1
2011-10-11
... Pseudo PGA with Mesquite Solar 1 to be effective 11/1/2011. Filed Date: 09/30/2011. Accession Number... Electric Company submits tariff filing per 35.13(a)(2)(iii: Western USBR TFA for Red Bluff Pumping Plant to...
Zouari, I.; Sassi, Z.; Seveyrat, L.; Perrin, V.; Zghal, S.; Abdelmoula, N.; Lebrun, L.; Khemakhem, H.
2017-07-01
BaTi0.9Zr0.1O3 (BZT), Ba1- x Ln2 x/3□ x/3Ti0.9Zr0.1O3 (with x = 0.5% mol and Ln = Er3+) (BZT-Er) and Ba1- x Ln2 x/3□ x/3Ti0.9Zr0.1O3 (with x = 0.5% mol and Ln = Pr3+) (BZT-Pr) were prepared via the conventional solid-state reaction method. X-ray diffraction showed that all these ceramics were in the single perovskite phase at room temperature (RT). The temperature dependence of dielectric behavior was investigated in the temperature range 25-225°C and exhibited a classical ferroelectric behavior. A slight decrease of the Curie temperature ( T C) with Pr3+ and Er3+ substitution was observed in addition to an increase in the maximum dielectric permittivity ( \\varepsilon_{r {max} }^' }} ) of about 40% for the BZT-Er. At RT, the ferroelectric and piezoelectric coefficients were decreased for BZT-Pr, but were maintained for BZT-Er with a piezoelectric coefficient ( d 33) of 185 pC/N, a planar electromechanical coupling factor of 30%, and a remanent polarization of 11.6 μC/cm2. The Raman bands as a function of temperature confirmed the paraelectric-ferroelectric phase transition of all those ceramics. The photoluminescence spectra showed that strong red (615 nm and 645 nm) and bright green (523 nm and 545 nm) emission bands were obtained, under excitation by laser at 488 nm at RT, for BZT-Pr and BZT-Er, respectively. These multifunctional materials showed a significant technological promise in coupling device applications.
Energy Technology Data Exchange (ETDEWEB)
Kappenberger, Rhea; Hammerath, Franziska; Wurmehl, Sabine; Buechner, Bernd [Leibniz Institute for Solid State and Materials Research Dresden, IFW Dresden (Germany); Institut fuer Festkoerperphysik, TU Dresden, Dresden (Germany); Asfaw Afrassa, Mesfin [Leibniz Institute for Solid State and Materials Research Dresden, IFW Dresden (Germany); Addis Ababa University, College of Natural Science, Addis Ababa (Ethiopia); Rousse, Pierre; Hess, Christian; Prando, Giacomo; Moroni, Matteo; Wolter, Anja U.B. [Leibniz Institute for Solid State and Materials Research Dresden, IFW Dresden (Germany); Sanna, Samuele; Carretta, Pietro [Dipartimento di Fisica e Unita di CNISM, Pavia (Italy); Lamura, Gianrico [Universita di Genova (Italy); CNR-SPIN, Genova (Italy); Kamusella, Sirko; Klauss, Hans-Henning [Institut fuer Festkoerperphysik, TU Dresden, Dresden (Germany)
2016-07-01
The substitution of constituents is frequently used as a local probe to check the microscopic properties of an unconventional superconductor in response to such an ''impurity''. In this talk, we present several structural parameters and the superconducting critical temperatures in response to different substitution levels of Mn and Y in La{sub 1-z}Y{sub z}Fe{sub 1-y}Mn{sub y}AsO{sub 0.9}F{sub 0.1}. We will discuss our findings in the light of chemical pressure inflicted by Y, which has a significantly smaller ionic radius than La, and strong electron localization caused by small amounts of paramagnetic Mn impurities.
41 CFR 101-1.109 - Numbering in FPMR System.
2010-07-01
... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Numbering in FPMR System. 101-1.109 Section 101-1.109 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.1-Regulation System § 101...
DEFF Research Database (Denmark)
Ovtar, Simona; Gurauskis, Jonas; Bjørnetun Haugen, Astri
2017-01-01
The oxygen permeation through dense Ce0.9Gd0.1O1.95-La0.6Sr0.4FeO3−d dual-phase composite asymmetric membranes supported on a porous MgO tube was studied. The membranes were prepared by thermoplastic extrusion, dip coating, co-sintering and infiltration of a catalyst. Oxygen permeation measureme...
Where Are All the Typical Numbers - 1
Indian Academy of Sciences (India)
inequality, independence. B V Rao was a Professor at the Indian Statistical. Institute, Kolkata. He is currently with the. Chennai Mathematical. Institute. The entire discussion below, except the first few paragraphs, takes place on the interval (0;1], so you can relax. In this two-part article, we show that decimal digits of numbers ...
International Nuclear Information System (INIS)
Gao, Ning; Quan, Chuye; Ma, Yuhui; Han, Yumin; Wu, Zhenli; Mao, Weiwei
2016-01-01
We propose first-principles methods to study the structure, electronic, optical and magnetic properties of BiFeO 3 (BFO) and Bi 0.9 Ca 0.1 FeO 3 (BCFO). The morphology, optical band gap as well as magnetic hysteresis also have been investigated using experimental methods. X-ray diffraction data shows that Bi-site doping with Ca could result in a transition of crystal structure (from single phase rhombohedral (R3c) to two phase coexistence). Changing of Fermi level and decreasing of band gap indicating that the Ca-doped BFO exhibit a typical half-metallic nature. The optical absorption properties are related to the electronic structure and play the key role in determining their band gaps, also we have analyzed the inter-band contribution to the theory of optical properties such as absorption spectra, dielectric constant, energy-loss spectrum, absorption coefficient, optical reflectivity, and refractive index of BCFO. Enhancement of magnetic properties after doping is proved by both experimental and calculated result, which can be explained by size effect and structural distortion.
46 CFR 42.09-35 - Additional survey requirements for wood-hull vessels.
2010-10-01
... 46 Shipping 2 2010-10-01 2010-10-01 false Additional survey requirements for wood-hull vessels. 42.09-35 Section 42.09-35 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) LOAD LINES... Additional survey requirements for wood-hull vessels. (a) In addition to the requirements in § 42.09-25, the...
Kusznierz, Gabriela; Carolina, Cudós; Manuel, Rudi Juan; Sergio, Lejona; Lucila, Ortellao; Julio, Befani; Mirta, Villani; Pedro, Morana; Graciana, Morera; Andrea, Uboldi; Elsa, Zerbini
2017-07-01
It is important to characterize the clinical and epidemiological pattern of the influenza A (H1N1) pdm09 virus and compare it with influenza A (H3N2) virus, as surveyed in just a few studies, in order to contribute to the implementation and strengthening of influenza control and prevention strategies. The aims in this study were to describe influenza clinical and epidemiological characteristics in hospitalized patients, caused by influenza A (H1N1)pdm09 and influenza A (H3N2) viruses during 2013, in Santa Fe, Argentina. A retrospective study was conducted over 2013 among hospitalized patients with laboratory-confirmed influenza diagnosis. In contrast to patients with influenza A (H3N2) (20.5%), a higher proportion of hospitalizations associated with influenza H1N1pdm were reported among adults aged 35-65 years (42.8%). Of all patients, 73.6% had an underlying medical condition. Hospitalized patients with H1N1pdm were subject to 2.6 (95%CI, 1.0-6.8) times higher risk of severity, than those hospitalized with influenza A (H3N2). This results demonstrate the impact in the post-pandemic era of H1N1pdm virus, with increased risk of severe disease, in relation to H3N2 virus, both viruses co-circulating during 2013. © 2017 Wiley Periodicals, Inc.
Impedance spectroscopy studies on lead free (Ba0.85Ca0.15(Ti0.9Zr0.1O3 ceramics
Directory of Open Access Journals (Sweden)
Ahcène Chaouchi
2012-12-01
Full Text Available The AC complex impedance spectroscopy technique has been used to obtain the electrical parameters of polycrystalline sample of (Ba0.85Ca0.15(Ti0.9Zr0.1O3 in a wide frequency range at different temperatures. This sample was prepared by a high temperature solid-state reaction technique and single phase formation was confirmed by X-ray diffraction technique. This study was carried out by the means of simultaneous analysis of impedance, modulus, and electrical conductivity. The Cole-Cole (Nyquist plots suggest that the grains and grain boundaries are responsible in the conduction mechanism of the material at high temperature. The ColeCole (Nyquist plot studies revealed the presence of grain and grain boundary effect at 485 °C. On the other hand, it showed only the presence of grain boundary component of the resistivity at 535 °C. Complex impedance analysis indicated the presence of non-Debye type dielectric relaxation. The bulk resistance of the material decreases with rise in temperature similar to a semiconductor, and the Cole-Cole (Nyquist plot showed the negative temperature coefficient of resistance (NTCR character of (Ba0.85Ca0.15(Ti0.9Zr0.1O3. The value of activation energy is found to be 0.7433 eV, which suggests that the conduction may be the result of defect and charge carriers present in the materials.
International Nuclear Information System (INIS)
Rico, V. J.; Frutos, F.; Yubero, F.; Espinos, J. P.; Gonzales-Elipe, A. R.
2010-01-01
InTaO 4 and In 0.9 Ni 0.1 TaO 4 thin films have been prepared by electron evaporation of successive layers of the single oxide components and posterior annealing at T>800 deg. C. The annealed thin films presented the monoclinic crystallographic structure typical of these mixed oxides. The electrical and optical behaviors of the films, assessed by C-V measurements, surface conductivity as a function of temperature, and UV-vis absorption spectroscopy, indicate that these oxides are wide band gap semiconductors with a variable dielectric constant depending on the annealing conditions. By reflection electron energy loss spectroscopy some electronic states have been found in the gap at an energy that is compatible with the activation energy deduced from the conductivity versus 1/T plots for these oxides. The photoactivity of these materials has been assessed by looking to the evolution of the wetting contact angle as a function of the irradiation time. All the films became superhydrophilic when irradiated with UV light, while the In 0.9 Ni 0.1 TaO 4 thin films also presented a small partial decrease in wetting angle when irradiated with visible photons.
The Apollo Number: space suits, self-support, and the walk-run transition.
Directory of Open Access Journals (Sweden)
Christopher E Carr
Full Text Available BACKGROUND: How space suits affect the preferred walk-run transition is an open question with relevance to human biomechanics and planetary extravehicular activity. Walking and running energetics differ; in reduced gravity (<0.5 g, running, unlike on Earth, uses less energy per distance than walking. METHODOLOGY/PRINCIPAL FINDINGS: The walk-run transition (denoted * correlates with the Froude Number (Fr = v(2/gL, velocity v, gravitational acceleration g, leg length L. Human unsuited Fr* is relatively constant (approximately 0.5 with gravity but increases substantially with decreasing gravity below approximately 0.4 g, rising to 0.9 in 1/6 g; space suits appear to lower Fr*. Because of pressure forces, space suits partially (1 g or completely (lunar-g support their own weight. We define the Apollo Number (Ap = Fr/M as an expected invariant of locomotion under manipulations of M, the ratio of human-supported to total transported mass. We hypothesize that for lunar suited conditions Ap* but not Fr* will be near 0.9, because the Apollo Number captures the effect of space suit self-support. We used the Apollo Lunar Surface Journal and other sources to identify 38 gait events during lunar exploration for which we could determine gait type (walk/lope/run and calculate Ap. We estimated the binary transition between walk/lope (0 and run (1, yielding Fr* (0.36+/-0.11, mean+/-95% CI and Ap* (0.68+/-0.20. CONCLUSIONS/SIGNIFICANCE: The Apollo Number explains 60% of the difference between suited and unsuited Fr*, appears to capture in large part the effects of space suits on the walk-run transition, and provides several testable predictions for space suit locomotion and, of increasing relevance here on Earth, exoskeleton locomotion. The knowledge of how space suits affect gait transitions can be used to optimize space suits for use on the Moon and Mars.
2009-01-01
Kohtulahendi 3-4-1-2-09 (Tallinna Linnavolikogu taotlus tunnistada kehtetuks kohaliku omavalitsuse volikogu valimise seaduse § 7 lg 2 p 5 ja § 8 lg 4 ; või § 7 lg 2 p 5 ja § 9 lg 4 ; või § 7 lg 2 p 5, § 8 lg 4 ja § 9 lg 2.) tekst inglise keeles
Water vapour solubility and conductivity study of the proton conductor BaCe(0.9 − x)ZrxY0.1O(3 − δ)
DEFF Research Database (Denmark)
Ricote, Sandrine; Bonanos, Nikolaos; Caboche, G:
2009-01-01
The perovskite BaCe(0.9 − x)ZrxY0.1O(3 − δ) has been prepared by solid state reaction at 1400 °C and conventional sintering at 1700 °C. Water uptake experiments performed between 400 and 600 °C, at a water vapour pressure of 0.02 atm, provide data on the concentration of protons incorporated in t...
DEFF Research Database (Denmark)
Cheng, Shiyang; Chatzichristodoulou, Christodoulos; Søgaard, Martin
2017-01-01
Pr. A series of compositions of PrxGd0.1Ce0.9-xO1.95-δ (x = 0, 0.02, 0.05, 0.08, 0.15, 0.25, 0.3 and 0.4) was prepared by solid state reaction. X-ray powder diffraction (XPD) indicates that Pr is completely dissolved in the fluorite structure up to 40 at.%. Pronounced nonlinear thermal expansion...... behavior was observed as a function of temperature, due to the simultaneous contributions of both thermal and chemical expansion. The electronic and ionic conductivities were measured as a function of temperature and oxygen partial pressure. Within the range from 10 to 15 at.% Pr, a drastic drop...
Sein, Karin, 1974-
2010-01-01
Riigikohtu lahendist 3-2-1-98-09: A & M Invest OÜ kassatsioonkaebus Tallinna Ringkonnakohtu 30.03.2009. a otsusele A & M Invest OÜ hagis K. Radiku ja M. Radiku vastu hüvitise 1 950 946,70 krooni väljamõistmiseks
Isomers of (Ca0.1La0.9)(Ba1.65La0.35)Cu3Oy Superconductor Having Different Tc
International Nuclear Information System (INIS)
Knizhnik, A.; Reisner, G.M.; Men, A.; Eckstein, Y.
1998-01-01
(Ca 0.1 La 0.9 )(Ba 1.65 La 0.35 )Cu 3 O y is a YBCO like superconductor but tetragonal for any y, i.e. without ordered chains. Its T c vs y plot has no intermediate plateau and is a nearly straight line in the under doped region. Different oxygen contents were obtained by oxygenation at various temperatures under 1 atm O 2 followed by quench in liquid nitrogen. This type of oxygenation leads to samples where the oxygen content corresponds to the thermodynamic equilibrium with the gas phase because the form of attaining the oxygenation temperature (Tom higher or lower temperature) and time (over 10h) of oxygenation do not change y and Tc. Changing of the firing temperature (we used the usual carbonate-oxide preparation which included 3 firings in powder, pelletization, sintering and oxygenation) changes Tc at the same y. The increase of the firing temperature by 40 deg C increases T c by 7-10K while y remains unchanged. Increases of the temperature of sintering virtually do not change T c which shows that low and high Tc compounds are formed during the first stages of preparation and that there is no thermodynamic equilibrium between them. The low Tc compounds cannot be transformed into high Tc ones by raising the temperature
Facilities Performance Indicators Report, 2008-09
Hills, Christina, Ed.
2010-01-01
This paper features another expanded Web-based Facilities Performance Indicators Report (FPI). The purpose of APPA's Facilities Performance Indicators is to provide a representative set of statistics about facilities in educational institutions. The 2008-09 iteration of the Web-based Facilities Performance Indicators Survey was posted and…
76 FR 19007 - Proposed Flood Elevation Determinations
2011-04-06
... County. Approximately 0.9 mile None +33 upstream of Hemingway Highway. Boggy Swamp B Approximately 0.9... +74 upstream of Old Forreston Road. Muddy Creek At the Clarks Creek None +29 Town of Hemingway.... Approximately 1.3 miles None +35 upstream of Hemingway Highway. Spring Branch A At the Clapps Swamp None +65...
Savaaksrat Kisitchisit (Numbers 1-10).
Pulu, Tupou L.; And Others
This first grade workbook is designed for children in bilingual Inupiat-English programs in the Alaskan villages of Ambler, Kiana, Kobuk, Noorvik, Selawik, and Shungnak. Each page has a particular number, a corresponding picture with an appropriate caption, and lines for the child to use in writing the number. (CFM)
Chu, Julio; Luckring, James M.
1996-01-01
An experimental wind tunnel test of a 65 deg. delta wing model with interchangeable leading edges was conducted in the Langley National Transonic Facility (NTF). The objective was to investigate the effects of Reynolds and Mach numbers on slender-wing leading-edge vortex flows with four values of wing leading-edge bluntness. Experimentally obtained pressure data are presented without analysis in tabulated and graphical formats across a Reynolds number range of 6 x 10(exp 6) to 84 x 10(exp 6) at a Mach number of 0.85 and across a Mach number range of 0.4 to 0.9 at Reynolds numbers of 6 x 10(exp 6) and 60 x 10(exp 6). Normal-force and pitching-moment coefficient plots for these Reynolds number and Mach number ranges are also presented.
78 FR 10200 - Proposed Information Collection; Captive Wildlife Safety Act
2013-02-13
... DEPARTMENT OF THE INTERIOR Fish and Wildlife Service [FWS-HQ-LE-2013-N020; FF09L00200-FX-LE12200900000] Proposed Information Collection; Captive Wildlife Safety Act AGENCY: Fish and Wildlife Service, Interior. ACTION: Notice; request for comments. SUMMARY: We (U.S. Fish and Wildlife Service) will ask the...
DEFF Research Database (Denmark)
Ricote, Sandrine; Bonanos, Nikolaos; Marco de Lucas, M.C.
2009-01-01
The perovskite BaCe(0.9−x)ZrxY0.1O(3−δ) is prepared by solid-state reaction at 1400 °C and sintering at 1700 °C. It is characterised using X-ray diffraction, Raman spectroscopy and electrical measurements. A distortion from the cubic structure at room temperature is noticeable in the Raman spectr...
a Pseudo-Random Number Generator Employing Multiple RÉNYI Maps
Lui, Oi-Yan; Yuen, Ching-Hung; Wong, Kwok-Wo
2013-11-01
The increasing risk along with the drastic development of multimedia data transmission has raised a big concern on data security. A good pseudo-random number generator is an essential tool in cryptography. In this paper, we propose a novel pseudo-random number generator based on the controlled combination of the outputs of several digitized chaotic Rényi maps. The generated pseudo-random sequences have passed both the NIST 800-22 Revision 1a and the DIEHARD tests. Moreover, simulation results show that the proposed pseudo-random number generator requires less operation time than existing generators and is highly sensitive to the seed.
[Activation of nucleolar organizers during in vitro cultivation of mouse R1 embryonic stem cells].
Kunafina, E R; Chaplina, M V; Filiasova, E I; Gibanova, N V; Khodarovich, Iu M; Larionov, O A; Zatsepina, O V
2005-01-01
We studies the activities of ribosomal genes (nucleolus forming regions of chromosomes) at successive stages of cultivation of the mouse R1 embryonic stem cells. The total number and number of active nucleolar organizers were estimated by means of in situ hybridization with mouse rDNA probes and argentophilic staining of nucleolus forming chromosomes regions from the 16th until the 32nd passages. The data we obtained suggest that the total number of nucleolar organizers per metaphase plate was constant (as a rule, eight), while the mean number of active nucleolar organizers progressively increased from the early (16th) to the late (32nd) passages: 5.2 +/- 0.4 versus 7.4 +/- 0.9 argentophilic organizers per cell. Cell heterogeneity by the number of active nucleolar organizers also increased during the late passages. Taken together, these data suggest activation of DNA transcription and synthesis of ribosomes during cultivation of mouse R1 embryonic stem cells. Based on the experimental and published data, it has been proposed that activation of ribosomal genes correlates in time with a decreased capacity of embryonic stem cells for pluripotent differentiation.
Denson, D D; Crews, J C; Grummich, K W; Stirm, E J; Sue, C A
1991-03-01
The stability of methadone hydrochloride in 0.9% sodium chloride injection in flexible polyvinyl chloride containers was studied. Commercially available methadone hydrochloride 20 mg/mL and 25-mL single-dose bags of 0.9% sodium chloride injection were used. Six samples each were prepared at methadone hydrochloride concentrations of 1, 2, and 5 mg/mL. The solutions were stored at room temperature and were not protected from light. Immediately after preparation and after two, three, and four weeks of storage, each of the 18 samples was divided into three aliquots, each of which was analyzed in duplicate for methadone hydrochloride concentration by gas chromatography. There was less than 10% change in methadone hydrochloride concentration in any sample throughout the four-week study period. Methadone hydrochloride at concentrations of 1, 2, and 5 mg/mL prepared in commercially available flexible polyvinyl chloride containers of 0.9% sodium chloride injection and stored at room temperature without deliberate protection from light is stable for at least four weeks.
Dynamic mass exchange in doubly degenerate binaries. I - 0.9 and 1.2 solar mass stars
International Nuclear Information System (INIS)
Benz, W.; Cameron, A.G.W.; Press, W.H.; Bowers, R.L.
1990-01-01
The dynamic mass exchange process in doubly degenerate binaries was investigated using a three-dimensional numerical simulation of the evolution of a doubly degenerate binary system in which the primary is a 1.2-solar-mass white dwarf and the Roche lobe filling secondary is a 0.9-solar-mass dwarf. The results show that, in a little more than two orbital periods, the secondary is completely destroyed and transformed into a thick disk orbiting about the primary. Since only a very small fraction of the mass (0.0063 solar mass) escapes the system, the evolution of the binary results in the formation of a massive object. This object is composed of three parts, the initial white dwarf primary, a very hot pressure-supported spherical envelope, and a rotationally supported outer disk. The evolution of the system can be understood in terms of a simple analytical model where it is shown that the angular momentum carried by the mass during the transfer and stored in the disk determines the evolution of the system. 34 refs
DEFF Research Database (Denmark)
Basith, M. A.; Ngo, Duc-The; Quader, A.
2014-01-01
We present a simple technique to synthesize ultrafine nanoparticles directly from bulk multiferroic perovskitepowder. The starting materials, which were ceramic pellets of the nominal compositions Bi0.9Gd0.1-Fe1−xTixO3 (x = 0.00–0.20), were prepared initially by a solid state reaction technique, ...
Measurement of Bose–Einstein Correlations in pp Collisions at $\\sqrt{s}$ = 0.9 and 7 TeV
Khachatryan, Vardan; Tumasyan, Armen; Adam, Wolfgang; Bergauer, Thomas; Dragicevic, Marko; Erö, Janos; Fabjan, Christian; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hammer, Josef; Haensel, Stephan; Hartl, Christian; Hoch, Michael; Hörmann, Natascha; Hrubec, Josef; Jeitler, Manfred; Kasieczka, Gregor; Kiesenhofer, Wolfgang; Krammer, Manfred; Liko, Dietrich; Mikulec, Ivan; Pernicka, Manfred; Rohringer, Herbert; Schöfbeck, Robert; Strauss, Josef; Taurok, Anton; Teischinger, Florian; Wagner, Philipp; Waltenberger, Wolfgang; Walzel, Gerhard; Widl, Edmund; Wulz, Claudia-Elisabeth; Mossolov, Vladimir; Shumeiko, Nikolai; Suarez Gonzalez, Juan; Benucci, Leonardo; Cerny, Karel; De Wolf, Eddi A.; Janssen, Xavier; Maes, Thomas; Mucibello, Luca; Ochesanu, Silvia; Roland, Benoit; Rougny, Romain; Selvaggi, Michele; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Adler, Volker; Beauceron, Stephanie; Blekman, Freya; Blyweert, Stijn; D'Hondt, Jorgen; Devroede, Olivier; Gonzalez Suarez, Rebeca; Kalogeropoulos, Alexis; Maes, Joris; Maes, Michael; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Van Onsem, Gerrit Patrick; Villella, Ilaria; Charaf, Otman; Clerbaux, Barbara; De Lentdecker, Gilles; Dero, Vincent; Gay, Arnaud; Hammad, Gregory Habib; Hreus, Tomas; Marage, Pierre Edouard; Thomas, Laurent; Vander Velde, Catherine; Vanlaer, Pascal; Wickens, John; Costantini, Silvia; Grunewald, Martin; Klein, Benjamin; Marinov, Andrey; Mccartin, Joseph; Ryckbosch, Dirk; Thyssen, Filip; Tytgat, Michael; Vanelderen, Lukas; Verwilligen, Piet; Walsh, Sinead; Zaganidis, Nicolas; Basegmez, Suzan; Bruno, Giacomo; Caudron, Julien; Ceard, Ludivine; De Favereau De Jeneret, Jerome; Delaere, Christophe; Demin, Pavel; Favart, Denis; Giammanco, Andrea; Grégoire, Ghislain; Hollar, Jonathan; Lemaitre, Vincent; Liao, Junhui; Militaru, Otilia; Ovyn, Severine; Pagano, Davide; Pin, Arnaud; Piotrzkowski, Krzysztof; Schul, Nicolas; Beliy, Nikita; Caebergs, Thierry; Daubie, Evelyne; Alves, Gilvan; De Jesus Damiao, Dilson; Pol, Maria Elena; Henrique Gomes E Souza, Moacyr; Carvalho, Wagner; Melo Da Costa, Eliza; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Mundim, Luiz; Nogima, Helio; Oguri, Vitor; Prado Da Silva, Wanda Lucia; Santoro, Alberto; Silva Do Amaral, Sheila Mara; Sznajder, Andre; De Almeida Dias, Flavia; Ferreira Dias, Marco Andre; Tomei, Thiago; De Moraes Gregores, Eduardo; Da Cunha Marinho, Franciole; Novaes, Sergio F.; Padula, Sandra; Darmenov, Nikolay; Dimitrov, Lubomir; Genchev, Vladimir; Iaydjiev, Plamen; Piperov, Stefan; Rodozov, Mircho; Stoykova, Stefka; Sultanov, Georgi; Tcholakov, Vanio; Trayanov, Rumen; Vankov, Ivan; Dyulendarova, Milena; Hadjiiska, Roumyana; Kozhuharov, Venelin; Litov, Leander; Marinova, Evelina; Mateev, Matey; Pavlov, Borislav; Petkov, Peicho; Bian, Jian-Guo; Chen, Guo-Ming; Chen, He-Sheng; Jiang, Chun-Hua; Liang, Dong; Liang, Song; Wang, Jian; Wang, Jian; Wang, Xianyou; Wang, Zheng; Xu, Ming; Yang, Min; Zang, Jingjing; Zhang, Zhen; Ban, Yong; Guo, Shuang; Guo, Yifei; Li, Wenbo; Mao, Yajun; Qian, Si-Jin; Teng, Haiyun; Zhang, Linlin; Zhu, Bo; Zou, Wei; Cabrera, Andrés; Gomez Moreno, Bernardo; Ocampo Rios, Alberto Andres; Osorio Oliveros, Andres Felipe; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Damir; Lelas, Karlo; Plestina, Roko; Polic, Dunja; Puljak, Ivica; Antunovic, Zeljko; Dzelalija, Mile; Brigljevic, Vuko; Duric, Senka; Kadija, Kreso; Morovic, Srecko; Attikis, Alexandros; Galanti, Mario; Mousa, Jehad; Nicolaou, Charalambos; Ptochos, Fotios; Razis, Panos A.; Rykaczewski, Hans; Assran, Yasser; Mahmoud, Mohammed; Hektor, Andi; Kadastik, Mario; Kannike, Kristjan; Müntel, Mait; Raidal, Martti; Rebane, Liis; Azzolini, Virginia; Eerola, Paula; Czellar, Sandor; Härkönen, Jaakko; Heikkinen, Mika Aatos; Karimäki, Veikko; Kinnunen, Ritva; Klem, Jukka; Kortelainen, Matti J.; Lampén, Tapio; Lassila-Perini, Kati; Lehti, Sami; Lindén, Tomas; Luukka, Panja-Riina; Mäenpää, Teppo; Tuominen, Eija; Tuominiemi, Jorma; Tuovinen, Esa; Ungaro, Donatella; Wendland, Lauri; Banzuzi, Kukka; Korpela, Arja; Tuuva, Tuure; Sillou, Daniel; Besancon, Marc; Choudhury, Somnath; Dejardin, Marc; Denegri, Daniel; Fabbro, Bernard; Faure, Jean-Louis; Ferri, Federico; Ganjour, Serguei; Gentit, François-Xavier; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Locci, Elizabeth; Malcles, Julie; Marionneau, Matthieu; Millischer, Laurent; Rander, John; Rosowsky, André; Shreyber, Irina; Titov, Maksym; Verrecchia, Patrice; Baffioni, Stephanie; Beaudette, Florian; Bianchini, Lorenzo; Bluj, Michal; Broutin, Clementine; Busson, Philippe; Charlot, Claude; Dahms, Torsten; Dobrzynski, Ludwik; Granier de Cassagnac, Raphael; Haguenauer, Maurice; Miné, Philippe; Mironov, Camelia; Ochando, Christophe; Paganini, Pascal; Sabes, David; Salerno, Roberto; Sirois, Yves; Thiebaux, Christophe; Wyslouch, Bolek; Zabi, Alexandre; Agram, Jean-Laurent; Andrea, Jeremy; Besson, Auguste; Bloch, Daniel; Bodin, David; Brom, Jean-Marie; Cardaci, Marco; Chabert, Eric Christian; Collard, Caroline; Conte, Eric; Drouhin, Frédéric; Ferro, Cristina; Fontaine, Jean-Charles; Gelé, Denis; Goerlach, Ulrich; Greder, Sebastien; Juillot, Pierre; Karim, Mehdi; Le Bihan, Anne-Catherine; Mikami, Yoshinari; Van Hove, Pierre; Fassi, Farida; Mercier, Damien; Baty, Clement; Beaupere, Nicolas; Bedjidian, Marc; Bondu, Olivier; Boudoul, Gaelle; Boumediene, Djamel; Brun, Hugues; Chanon, Nicolas; Chierici, Roberto; Contardo, Didier; Depasse, Pierre; El Mamouni, Houmani; Falkiewicz, Anna; Fay, Jean; Gascon, Susan; Ille, Bernard; Kurca, Tibor; Le Grand, Thomas; Lethuillier, Morgan; Mirabito, Laurent; Perries, Stephane; Sordini, Viola; Tosi, Silvano; Tschudi, Yohann; Verdier, Patrice; Xiao, Hong; Rurua, Lali; Lomidze, David; Anagnostou, Georgios; Edelhoff, Matthias; Feld, Lutz; Heracleous, Natalie; Hindrichs, Otto; Jussen, Ruediger; Klein, Katja; Merz, Jennifer; Mohr, Niklas; Ostapchuk, Andrey; Perieanu, Adrian; Raupach, Frank; Sammet, Jan; Schael, Stefan; Sprenger, Daniel; Weber, Hendrik; Weber, Martin; Wittmer, Bruno; Ata, Metin; Bender, Walter; Erdmann, Martin; Frangenheim, Jens; Hebbeker, Thomas; Hinzmann, Andreas; Hoepfner, Kerstin; Hof, Carsten; Klimkovich, Tatsiana; Klingebiel, Dennis; Kreuzer, Peter; Lanske, Dankfried; Magass, Carsten; Masetti, Gianni; Merschmeyer, Markus; Meyer, Arnd; Papacz, Paul; Pieta, Holger; Reithler, Hans; Schmitz, Stefan Antonius; Sonnenschein, Lars; Steggemann, Jan; Teyssier, Daniel; Bontenackels, Michael; Davids, Martina; Duda, Markus; Flügge, Günter; Geenen, Heiko; Giffels, Manuel; Haj Ahmad, Wael; Heydhausen, Dirk; Kress, Thomas; Kuessel, Yvonne; Linn, Alexander; Nowack, Andreas; Perchalla, Lars; Pooth, Oliver; Rennefeld, Jörg; Sauerland, Philip; Stahl, Achim; Thomas, Maarten; Tornier, Daiske; Zoeller, Marc Henning; Aldaya Martin, Maria; Behrenhoff, Wolf; Behrens, Ulf; Bergholz, Matthias; Borras, Kerstin; Cakir, Altan; Campbell, Alan; Castro, Elena; Dammann, Dirk; Eckerlin, Guenter; Eckstein, Doris; Flossdorf, Alexander; Flucke, Gero; Geiser, Achim; Glushkov, Ivan; Hauk, Johannes; Jung, Hannes; Kasemann, Matthias; Katkov, Igor; Katsas, Panagiotis; Kleinwort, Claus; Kluge, Hannelies; Knutsson, Albert; Krücker, Dirk; Kuznetsova, Ekaterina; Lange, Wolfgang; Lohmann, Wolfgang; Mankel, Rainer; Marienfeld, Markus; Melzer-Pellmann, Isabell-Alissandra; Meyer, Andreas Bernhard; Mnich, Joachim; Mussgiller, Andreas; Olzem, Jan; Parenti, Andrea; Raspereza, Alexei; Raval, Amita; Schmidt, Ringo; Schoerner-Sadenius, Thomas; Sen, Niladri; Stein, Matthias; Tomaszewska, Justyna; Volyanskyy, Dmytro; Walsh, Roberval; Wissing, Christoph; Autermann, Christian; Bobrovskyi, Sergei; Draeger, Jula; Enderle, Holger; Gebbert, Ulla; Kaschube, Kolja; Kaussen, Gordon; Klanner, Robert; Lange, Jörn; Mura, Benedikt; Naumann-Emme, Sebastian; Nowak, Friederike; Pietsch, Niklas; Sander, Christian; Schettler, Hannes; Schleper, Peter; Schröder, Matthias; Schum, Torben; Schwandt, Joern; Srivastava, Ajay Kumar; Stadie, Hartmut; Steinbrück, Georg; Thomsen, Jan; Wolf, Roger; Barth, Christian; Bauer, Julia; Buege, Volker; Chwalek, Thorsten; De Boer, Wim; Dierlamm, Alexander; Dirkes, Guido; Feindt, Michael; Gruschke, Jasmin; Hackstein, Christoph; Hartmann, Frank; Heindl, Stefan Michael; Heinrich, Michael; Held, Hauke; Hoffmann, Karl-Heinz; Honc, Simon; Kuhr, Thomas; Martschei, Daniel; Mueller, Steffen; Müller, Thomas; Niegel, Martin; Oberst, Oliver; Oehler, Andreas; Ott, Jochen; Peiffer, Thomas; Piparo, Danilo; Quast, Gunter; Rabbertz, Klaus; Ratnikov, Fedor; Renz, Manuel; Saout, Christophe; Scheurer, Armin; Schieferdecker, Philipp; Schilling, Frank-Peter; Schott, Gregory; Simonis, Hans-Jürgen; Stober, Fred-Markus Helmut; Troendle, Daniel; Wagner-Kuhr, Jeannine; Zeise, Manuel; Zhukov, Valery; Ziebarth, Eva Barbara; Daskalakis, Georgios; Geralis, Theodoros; Kesisoglou, Stilianos; Kyriakis, Aristotelis; Loukas, Demetrios; Manolakos, Ioannis; Markou, Athanasios; Markou, Christos; Mavrommatis, Charalampos; Ntomari, Eleni; Petrakou, Eleni; Gouskos, Loukas; Mertzimekis, Theodoros; Panagiotou, Apostolos; Evangelou, Ioannis; Foudas, Costas; Kokkas, Panagiotis; Manthos, Nikolaos; Papadopoulos, Ioannis; Patras, Vaios; Triantis, Frixos A.; Aranyi, Attila; Bencze, Gyorgy; Boldizsar, Laszlo; Debreczeni, Gergely; Hajdu, Csaba; Horvath, Dezso; Kapusi, Anita; Krajczar, Krisztian; Laszlo, Andras; Sikler, Ferenc; Vesztergombi, Gyorgy; Beni, Noemi; Molnar, Jozsef; Palinkas, Jozsef; Szillasi, Zoltan; Veszpremi, Viktor; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Bansal, Sunil; Beri, Suman Bala; Bhatnagar, Vipin; Dhingra, Nitish; Gupta, Ruchi; Jindal, Monika; Kaur, Manjit; Kohli, Jatinder Mohan; Mehta, Manuk Zubin; Nishu, Nishu; Saini, Lovedeep Kaur; Sharma, Archana; Sharma, Richa; Singh, Anil; Singh, Jas Bir; Singh, Supreet Pal; Ahuja, Sudha; Bhattacharya, Satyaki; Choudhary, Brajesh C.; Gupta, Pooja; Jain, Sandhya; Jain, Shilpi; Kumar, Ashok; Shivpuri, Ram Krishen; Choudhury, Rajani Kant; Dutta, Dipanwita; Kailas, Swaminathan; Kataria, Sushil Kumar; Mohanty, Ajit Kumar; Pant, Lalit Mohan; Shukla, Prashant; Aziz, Tariq; Guchait, Monoranjan; Gurtu, Atul; Maity, Manas; Majumder, Devdatta; Majumder, Gobinda; Mazumdar, Kajari; Mohanty, Gagan Bihari; Saha, Anirban; Sudhakar, Katta; Wickramage, Nadeesha; Banerjee, Sudeshna; Dugad, Shashikant; Mondal, Naba Kumar; Arfaei, Hessamaddin; Bakhshiansohi, Hamed; Etesami, Seyed Mohsen; Fahim, Ali; Hashemi, Majid; Jafari, Abideh; Khakzad, Mohsen; Mohammadi, Abdollah; Mohammadi Najafabadi, Mojtaba; Paktinat Mehdiabadi, Saeid; Safarzadeh, Batool; Zeinali, Maryam; Abbrescia, Marcello; Barbone, Lucia; Calabria, Cesare; Colaleo, Anna; Creanza, Donato; De Filippis, Nicola; De Palma, Mauro; Dimitrov, Anton; Fiore, Luigi; Iaselli, Giuseppe; Lusito, Letizia; Maggi, Giorgio; Maggi, Marcello; Manna, Norman; Marangelli, Bartolomeo; My, Salvatore; Nuzzo, Salvatore; Pacifico, Nicola; Pierro, Giuseppe Antonio; Pompili, Alexis; Pugliese, Gabriella; Romano, Francesco; Roselli, Giuseppe; Selvaggi, Giovanna; Silvestris, Lucia; Trentadue, Raffaello; Tupputi, Salvatore; Zito, Giuseppe; Abbiendi, Giovanni; Benvenuti, Alberto; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Brigliadori, Luca; Capiluppi, Paolo; Castro, Andrea; Cavallo, Francesca Romana; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Giunta, Marina; Grandi, Claudio; Marcellini, Stefano; Meneghelli, Marco; Montanari, Alessandro; Navarria, Francesco; Odorici, Fabrizio; Perrotta, Andrea; Primavera, Federica; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gianni; Albergo, Sebastiano; Cappello, Gigi; Chiorboli, Massimiliano; Costa, Salvatore; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Frosali, Simone; Gallo, Elisabetta; Genta, Chiara; Gonzi, Sandro; Lenzi, Piergiulio; Meschini, Marco; Paoletti, Simone; Sguazzoni, Giacomo; Tropiano, Antonio; Benussi, Luigi; Bianco, Stefano; Colafranceschi, Stefano; Fabbri, Franco; Piccolo, Davide; Fabbricatore, Pasquale; Musenich, Riccardo; Benaglia, Andrea; De Guio, Federico; Di Matteo, Leonardo; Ghezzi, Alessio; Malberti, Martina; Malvezzi, Sandra; Martelli, Arabella; Massironi, Andrea; Menasce, Dario; Moroni, Luigi; Paganoni, Marco; Pedrini, Daniele; Ragazzi, Stefano; Redaelli, Nicola; Sala, Silvano; Tabarelli de Fatis, Tommaso; Tancini, Valentina; Buontempo, Salvatore; Carrillo Montoya, Camilo Andres; Cimmino, Anna; De Cosa, Annapaola; De Gruttola, Michele; Fabozzi, Francesco; Iorio, Alberto Orso Maria; Lista, Luca; Merola, Mario; Noli, Pasquale; Paolucci, Pierluigi; Azzi, Patrizia; Bacchetta, Nicola; Bellan, Paolo; Bisello, Dario; Branca, Antonio; Carlin, Roberto; Checchia, Paolo; Conti, Enrico; De Mattia, Marco; Dorigo, Tommaso; Dosselli, Umberto; Fanzago, Federica; Gasparini, Fabrizio; Gasparini, Ugo; Giubilato, Piero; Gresele, Ambra; Lacaprara, Stefano; Lazzizzera, Ignazio; Margoni, Martino; Mazzucato, Mirco; Meneguzzo, Anna Teresa; Perrozzi, Luca; Pozzobon, Nicola; Ronchese, Paolo; Simonetto, Franco; Torassa, Ezio; Tosi, Mia; Vanini, Sara; Zotto, Pierluigi; Zumerle, Gianni; Baesso, Paolo; Berzano, Umberto; Riccardi, Cristina; Torre, Paola; Vitulo, Paolo; Viviani, Claudio; Biasini, Maurizio; Bilei, Gian Mario; Caponeri, Benedetta; Fanò, Livio; Lariccia, Paolo; Lucaroni, Andrea; Mantovani, Giancarlo; Menichelli, Mauro; Nappi, Aniello; Santocchia, Attilio; Servoli, Leonello; Taroni, Silvia; Valdata, Marisa; Volpe, Roberta; Azzurri, Paolo; Bagliesi, Giuseppe; Bernardini, Jacopo; Boccali, Tommaso; Broccolo, Giuseppe; Castaldi, Rino; D'Agnolo, Raffaele Tito; Dell'Orso, Roberto; Fiori, Francesco; Foà, Lorenzo; Giassi, Alessandro; Kraan, Aafke; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Palla, Fabrizio; Palmonari, Francesco; Sarkar, Subir; Segneri, Gabriele; Serban, Alin Titus; Spagnolo, Paolo; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Barone, Luciano; Cavallari, Francesca; Del Re, Daniele; Di Marco, Emanuele; Diemoz, Marcella; Franci, Daniele; Grassi, Marco; Longo, Egidio; Organtini, Giovanni; Palma, Alessandro; Pandolfi, Francesco; Paramatti, Riccardo; Rahatlou, Shahram; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Biino, Cristina; Botta, Cristina; Cartiglia, Nicolo; Castello, Roberto; Costa, Marco; Demaria, Natale; Graziano, Alberto; Mariotti, Chiara; Marone, Matteo; Maselli, Silvia; Migliore, Ernesto; Mila, Giorgia; Monaco, Vincenzo; Musich, Marco; Obertino, Maria Margherita; Pastrone, Nadia; Pelliccioni, Mario; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Sola, Valentina; Solano, Ada; Staiano, Amedeo; Trocino, Daniele; Vilela Pereira, Antonio; Ambroglini, Filippo; Belforte, Stefano; Cossutti, Fabio; Della Ricca, Giuseppe; Gobbo, Benigno; Montanino, Damiana; Penzo, Aldo; Heo, Seong Gu; Chang, Sunghyun; Chung, Jin Hyuk; Kim, Dong Hee; Kim, Gui Nyun; Kim, Ji Eun; Kong, Dae Jung; Park, Hyangkyu; Son, Dohhee; Son, Dong-Chul; Kim, Jaeho; Kim, Jae Yool; Song, Sanghyeon; Choi, Suyong; Hong, Byung-Sik; Jo, Mihee; Kim, Hyunchul; Kim, Ji Hyun; Kim, Tae Jeong; Lee, Kyong Sei; Moon, Dong Ho; Park, Sung Keun; Rhee, Han-Bum; Seo, Eunsung; Shin, Seungsu; Sim, Kwang Souk; Choi, Minkyoo; Kang, Seokon; Kim, Hyunyong; Park, Chawon; Park, Inkyu; Park, Sangnam; Ryu, Geonmo; Choi, Young-Il; Choi, Young Kyu; Goh, Junghwan; Lee, Jongseok; Lee, Sungeun; Seo, Hyunkwan; Yu, Intae; Bilinskas, Mykolas Jurgis; Grigelionis, Ignas; Janulis, Mindaugas; Martisiute, Dalia; Petrov, Pavel; Sabonis, Tomas; Castilla-Valdez, Heriberto; De La Cruz-Burelo, Eduard; Lopez-Fernandez, Ricardo; Sanchez-Hernandez, Alberto; Villasenor-Cendejas, Luis Manuel; Carrillo Moreno, Salvador; Vazquez Valencia, Fabiola; Salazar Ibarguen, Humberto Antonio; Casimiro Linares, Edgar; Morelos Pineda, Antonio; Reyes-Santos, Marco A.; Allfrey, Philip; Krofcheck, David; Butler, Philip H.; Doesburg, Robert; Silverwood, Hamish; Ahmad, Muhammad; Ahmed, Ijaz; Asghar, Muhammad Irfan; Hoorani, Hafeez R.; Khan, Wajid Ali; Khurshid, Taimoor; Qazi, Shamona; Cwiok, Mikolaj; Dominik, Wojciech; Doroba, Krzysztof; Kalinowski, Artur; Konecki, Marcin; Krolikowski, Jan; Frueboes, Tomasz; Gokieli, Ryszard; Górski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Romanowska-Rybinska, Katarzyna; Szleper, Michal; Wrochna, Grzegorz; Zalewski, Piotr; Almeida, Nuno; David Tinoco Mendes, Andre; Faccioli, Pietro; Ferreira Parracho, Pedro Guilherme; Gallinaro, Michele; Sá Martins, Pedro; Musella, Pasquale; Nayak, Aruna; Ribeiro, Pedro Quinaz; Seixas, Joao; Silva, Pedro; Varela, Joao; Wöhri, Hermine Katharina; Belotelov, Ivan; Bunin, Pavel; Finger, Miroslav; Finger Jr., Michael; Golutvin, Igor; Kamenev, Alexey; Karjavin, Vladimir; Kozlov, Guennady; Lanev, Alexander; Moisenz, Petr; Palichik, Vladimir; Perelygin, Victor; Shmatov, Sergey; Smirnov, Vitaly; Volodko, Anton; Zarubin, Anatoli; Bondar, Nikolai; Golovtsov, Victor; Ivanov, Yury; Kim, Victor; Levchenko, Petr; Murzin, Victor; Oreshkin, Vadim; Smirnov, Igor; Sulimov, Valentin; Uvarov, Lev; Vavilov, Sergey; Vorobyev, Alexey; Andreev, Yuri; Gninenko, Sergei; Golubev, Nikolai; Kirsanov, Mikhail; Krasnikov, Nikolai; Matveev, Viktor; Pashenkov, Anatoli; Toropin, Alexander; Troitsky, Sergey; Epshteyn, Vladimir; Gavrilov, Vladimir; Kaftanov, Vitali; Kossov, Mikhail; Krokhotin, Andrey; Lychkovskaya, Natalia; Safronov, Grigory; Semenov, Sergey; Stolin, Viatcheslav; Vlasov, Evgueni; Zhokin, Alexander; Boos, Edouard; Dubinin, Mikhail; Dudko, Lev; Ershov, Alexander; Gribushin, Andrey; Kodolova, Olga; Lokhtin, Igor; Obraztsov, Stepan; Petrushanko, Sergey; Sarycheva, Ludmila; Savrin, Viktor; Snigirev, Alexander; Andreev, Vladimir; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Rusakov, Sergey V.; Vinogradov, Alexey; Azhgirey, Igor; Bitioukov, Sergei; Grishin, Viatcheslav; Kachanov, Vassili; Konstantinov, Dmitri; Korablev, Andrey; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Slabospitsky, Sergey; Sobol, Andrei; Tourtchanovitch, Leonid; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Djordjevic, Milos; Krpic, Dragomir; Milosevic, Jovan; Aguilar-Benitez, Manuel; Alcaraz Maestre, Juan; Arce, Pedro; Battilana, Carlo; Calvo, Enrique; Cepeda, Maria; Cerrada, Marcos; Colino, Nicanor; De La Cruz, Begona; Diez Pardos, Carmen; Domínguez Vázquez, Daniel; Fernandez Bedoya, Cristina; Fernández Ramos, Juan Pablo; Ferrando, Antonio; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M.; Josa, Maria Isabel; Merino, Gonzalo; Puerta Pelayo, Jesus; Redondo, Ignacio; Romero, Luciano; Santaolalla, Javier; Willmott, Carlos; Albajar, Carmen; Codispoti, Giuseppe; de Trocóniz, Jorge F; Cuevas, Javier; Fernandez Menendez, Javier; Folgueras, Santiago; Gonzalez Caballero, Isidro; Lloret Iglesias, Lara; Vizan Garcia, Jesus Manuel; Brochero Cifuentes, Javier Andres; Cabrillo, Iban Jose; Calderon, Alicia; Chamizo Llatas, Maria; Chuang, Shan-Huei; Duarte Campderros, Jordi; Felcini, Marta; Fernandez, Marcos; Gomez, Gervasio; Gonzalez Sanchez, Javier; Jorda, Clara; Lobelle Pardo, Patricia; Lopez Virto, Amparo; Marco, Jesus; Marco, Rafael; Martinez Rivero, Celso; Matorras, Francisco; Munoz Sanchez, Francisca Javiela; Piedra Gomez, Jonatan; Rodrigo, Teresa; Ruiz Jimeno, Alberto; Scodellaro, Luca; Sobron Sanudo, Mar; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Auzinger, Georg; Baillon, Paul; Ball, Austin; Barney, David; Bell, Alan James; Benedetti, Daniele; Bernet, Colin; Bialas, Wojciech; Bloch, Philippe; Bocci, Andrea; Bolognesi, Sara; Breuker, Horst; Brona, Grzegorz; Bunkowski, Karol; Camporesi, Tiziano; Cano, Eric; Cerminara, Gianluca; Christiansen, Tim; Coarasa Perez, Jose Antonio; Curé, Benoît; D'Enterria, David; De Roeck, Albert; Di Guida, Salvatore; Duarte Ramos, Fernando; Elliott-Peisert, Anna; Frisch, Benjamin; Funk, Wolfgang; Gaddi, Andrea; Gennai, Simone; Georgiou, Georgios; Gerwig, Hubert; Gigi, Dominique; Gill, Karl; Giordano, Domenico; Glege, Frank; Gomez-Reino Garrido, Robert; Gouzevitch, Maxime; Govoni, Pietro; Gowdy, Stephen; Guiducci, Luigi; Hansen, Magnus; Harvey, John; Hegeman, Jeroen; Hegner, Benedikt; Henderson, Conor; Hesketh, Gavin; Hoffmann, Hans Falk; Honma, Alan; Innocente, Vincenzo; Janot, Patrick; Kaadze, Ketino; Karavakis, Edward; Lecoq, Paul; Lourenco, Carlos; Macpherson, Alick; Maki, Tuula; Malgeri, Luca; Mannelli, Marcello; Masetti, Lorenzo; Meijers, Frans; Mersi, Stefano; Meschi, Emilio; Moser, Roland; Mozer, Matthias Ulrich; Mulders, Martijn; Nesvold, Erik; Nguyen, Matthew; Orimoto, Toyoko; Orsini, Luciano; Perez, Emmanuelle; Petrilli, Achille; Pfeiffer, Andreas; Pierini, Maurizio; Pimiä, Martti; Polese, Giovanni; Racz, Attila; Rodrigues Antunes, Joao; Rolandi, Gigi; Rommerskirchen, Tanja; Rovelli, Chiara; Rovere, Marco; Sakulin, Hannes; Schäfer, Christoph; Schwick, Christoph; Segoni, Ilaria; Sharma, Archana; Siegrist, Patrice; Simon, Michal; Sphicas, Paraskevas; Spiga, Daniele; Spiropulu, Maria; Stöckli, Fabian; Stoye, Markus; Tropea, Paola; Tsirou, Andromachi; Tsyganov, Andrey; Veres, Gabor Istvan; Vichoudis, Paschalis; Voutilainen, Mikko; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Gabathuler, Kurt; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; König, Stefan; Kotlinski, Danek; Langenegger, Urs; Meier, Frank; Renker, Dieter; Rohe, Tilman; Sibille, Jennifer; Starodumov, Andrei; Bortignon, Pierluigi; Caminada, Lea; Chen, Zhiling; Cittolin, Sergio; Dissertori, Günther; Dittmar, Michael; Eugster, Jürg; Freudenreich, Klaus; Grab, Christoph; Hervé, Alain; Hintz, Wieland; Lecomte, Pierre; Lustermann, Werner; Marchica, Carmelo; Martinez Ruiz del Arbol, Pablo; Meridiani, Paolo; Milenovic, Predrag; Moortgat, Filip; Nef, Pascal; Nessi-Tedaldi, Francesca; Pape, Luc; Pauss, Felicitas; Punz, Thomas; Rizzi, Andrea; Ronga, Frederic Jean; Rossini, Marco; Sala, Leonardo; Sanchez, Ann - Karin; Sawley, Marie-Christine; Stieger, Benjamin; Tauscher, Ludwig; Thea, Alessandro; Theofilatos, Konstantinos; Treille, Daniel; Urscheler, Christina; Wallny, Rainer; Weber, Matthias; Wehrli, Lukas; Weng, Joanna; Aguiló, Ernest; Amsler, Claude; Chiochia, Vincenzo; De Visscher, Simon; Favaro, Carlotta; Ivova Rikova, Mirena; Millan Mejias, Barbara; Regenfus, Christian; Robmann, Peter; Schmidt, Alexander; Snoek, Hella; Chang, Yuan-Hann; Chen, Kuan-Hsin; Chen, Wan-Ting; Dutta, Suchandra; Go, Apollo; Kuo, Chia-Ming; Li, Syue-Wei; Lin, Willis; Liu, Ming-Hsiung; Liu, Zong-Kai; Lu, Yun-Ju; Mekterovic, Darko; Wu, Jing-Han; Yu, Shin-Shan; Bartalini, Paolo; Chang, Paoti; Chang, You-Hao; Chang, Yu-Wei; Chao, Yuan; Chen, Kai-Feng; Hou, George Wei-Shu; Hsiung, Yee; Kao, Kai-Yi; Lei, Yeong-Jyi; Lu, Rong-Shyang; Shiu, Jing-Ge; Tzeng, Yeng-Ming; Wang, Minzu; Adiguzel, Aytul; Bakirci, Mustafa Numan; Cerci, Salim; Dozen, Candan; Dumanoglu, Isa; Eskut, Eda; Girgis, Semiray; Gokbulut, Gul; Guler, Yalcin; Gurpinar, Emine; Hos, Ilknur; Kangal, Evrim Ersin; Karaman, Turker; Kayis Topaksu, Aysel; Nart, Alisah; Onengut, Gulsen; Ozdemir, Kadri; Ozturk, Sertac; Polatoz, Ayse; Sogut, Kenan; Tali, Bayram; Topakli, Huseyin; Uzun, Dilber; Vergili, Latife Nukhet; Vergili, Mehmet; Zorbilmez, Caglar; Akin, Ilina Vasileva; Aliev, Takhmasib; Bilmis, Selcuk; Deniz, Muhammed; Gamsizkan, Halil; Guler, Ali Murat; Ocalan, Kadir; Ozpineci, Altug; Serin, Meltem; Sever, Ramazan; Surat, Ugur Emrah; Yildirim, Eda; Zeyrek, Mehmet; Deliomeroglu, Mehmet; Demir, Durmus; Gülmez, Erhan; Halu, Arda; Isildak, Bora; Kaya, Mithat; Kaya, Ozlem; Ozkorucuklu, Suat; Sonmez, Nasuf; Levchuk, Leonid; Bell, Peter; Bostock, Francis; Brooke, James John; Cheng, Teh Lee; Clement, Emyr; Cussans, David; Frazier, Robert; Goldstein, Joel; Grimes, Mark; Hansen, Maria; Hartley, Dominic; Heath, Greg P.; Heath, Helen F.; Huckvale, Benedickt; Jackson, James; Kreczko, Lukasz; Metson, Simon; Newbold, Dave M.; Nirunpong, Kachanon; Poll, Anthony; Senkin, Sergey; Smith, Vincent J.; Ward, Simon; Basso, Lorenzo; Bell, Ken W.; Belyaev, Alexander; Brew, Christopher; Brown, Robert M.; Camanzi, Barbara; Cockerill, David J.A.; Coughlan, John A.; Harder, Kristian; Harper, Sam; Kennedy, Bruce W.; Olaiya, Emmanuel; Petyt, David; Radburn-Smith, Benjamin Charles; Shepherd-Themistocleous, Claire; Tomalin, Ian R.; Womersley, William John; Worm, Steven; Bainbridge, Robert; Ball, Gordon; Ballin, Jamie; Beuselinck, Raymond; Buchmuller, Oliver; Colling, David; Cripps, Nicholas; Cutajar, Michael; Davies, Gavin; Della Negra, Michel; Fulcher, Jonathan; Futyan, David; Guneratne Bryer, Arlo; Hall, Geoffrey; Hatherell, Zoe; Hays, Jonathan; Iles, Gregory; Karapostoli, Georgia; Lyons, Louis; Magnan, Anne-Marie; Marrouche, Jad; Nandi, Robin; Nash, Jordan; Nikitenko, Alexander; Papageorgiou, Anastasios; Pesaresi, Mark; Petridis, Konstantinos; Pioppi, Michele; Raymond, David Mark; Rompotis, Nikolaos; Rose, Andrew; Ryan, Matthew John; Seez, Christopher; Sharp, Peter; Sparrow, Alex; Tapper, Alexander; Tourneur, Stephane; Vazquez Acosta, Monica; Virdee, Tejinder; Wakefield, Stuart; Wardrope, David; Whyntie, Tom; Barrett, Matthew; Chadwick, Matthew; Cole, Joanne; Hobson, Peter R.; Khan, Akram; Kyberd, Paul; Leslie, Dawn; Martin, William; Reid, Ivan; Teodorescu, Liliana; Hatakeyama, Kenichi; Bose, Tulika; Carrera Jarrin, Edgar; Clough, Andrew; Fantasia, Cory; Heister, Arno; St. John, Jason; Lawson, Philip; Lazic, Dragoslav; Rohlf, James; Sperka, David; Sulak, Lawrence; Avetisyan, Aram; Bhattacharya, Saptaparna; Chou, John Paul; Cutts, David; Ferapontov, Alexey; Heintz, Ulrich; Jabeen, Shabnam; Kukartsev, Gennadiy; Landsberg, Greg; Narain, Meenakshi; Nguyen, Duong; Segala, Michael; Speer, Thomas; Tsang, Ka Vang; Borgia, Maria Assunta; Breedon, Richard; Calderon De La Barca Sanchez, Manuel; Cebra, Daniel; Chauhan, Sushil; Chertok, Maxwell; Conway, John; Cox, Peter Timothy; Dolen, James; Erbacher, Robin; Friis, Evan; Ko, Winston; Kopecky, Alexandra; Lander, Richard; Liu, Haidong; Maruyama, Sho; Miceli, Tia; Nikolic, Milan; Pellett, Dave; Robles, Jorge; Salur, Sevil; Schwarz, Thomas; Searle, Matthew; Smith, John; Squires, Michael; Tripathi, Mani; Vasquez Sierra, Ricardo; Veelken, Christian; Andreev, Valeri; Arisaka, Katsushi; Cline, David; Cousins, Robert; Deisher, Amanda; Duris, Joseph; Erhan, Samim; Farrell, Chris; Hauser, Jay; Ignatenko, Mikhail; Jarvis, Chad; Plager, Charles; Rakness, Gregory; Schlein, Peter; Tucker, Jordan; Valuev, Vyacheslav; Babb, John; Clare, Robert; Ellison, John Anthony; Gary, J William; Giordano, Ferdinando; Hanson, Gail; Jeng, Geng-Yuan; Kao, Shih-Chuan; Liu, Feng; Liu, Hongliang; Luthra, Arun; Nguyen, Harold; Pasztor, Gabriella; Satpathy, Asish; Shen, Benjamin C.; Stringer, Robert; Sturdy, Jared; Sumowidagdo, Suharyo; Wilken, Rachel; Wimpenny, Stephen; Andrews, Warren; Branson, James G.; Cerati, Giuseppe Benedetto; Dusinberre, Elizabeth; Evans, David; Golf, Frank; Holzner, André; Kelley, Ryan; Lebourgeois, Matthew; Letts, James; Mangano, Boris; Muelmenstaedt, Johannes; Padhi, Sanjay; Palmer, Christopher; Petrucciani, Giovanni; Pi, Haifeng; Pieri, Marco; Ranieri, Riccardo; Sani, Matteo; Sharma, Vivek; Simon, Sean; Tu, Yanjun; Vartak, Adish; Würthwein, Frank; Yagil, Avraham; Barge, Derek; Bellan, Riccardo; Campagnari, Claudio; D'Alfonso, Mariarosaria; Danielson, Thomas; Flowers, Kristen; Geffert, Paul; Incandela, Joe; Justus, Christopher; Kalavase, Puneeth; Koay, Sue Ann; Kovalskyi, Dmytro; Krutelyov, Vyacheslav; Lowette, Steven; Mccoll, Nickolas; Pavlunin, Viktor; Rebassoo, Finn; Ribnik, Jacob; Richman, Jeffrey; Rossin, Roberto; Stuart, David; To, Wing; Vlimant, Jean-Roch; Bornheim, Adolf; Bunn, Julian; Chen, Yi; Gataullin, Marat; Kcira, Dorian; Litvine, Vladimir; Ma, Yousi; Mott, Alexander; Newman, Harvey B.; Rogan, Christopher; Timciuc, Vladlen; Traczyk, Piotr; Veverka, Jan; Wilkinson, Richard; Yang, Yong; Zhu, Ren-Yuan; Akgun, Bora; Carroll, Ryan; Ferguson, Thomas; Iiyama, Yutaro; Jang, Dong Wook; Jun, Soon Yung; Liu, Yueh-Feng; Paulini, Manfred; Russ, James; Terentyev, Nikolay; Vogel, Helmut; Vorobiev, Igor; Cumalat, John Perry; Dinardo, Mauro Emanuele; Drell, Brian Robert; Edelmaier, Christopher; Ford, William T.; Heyburn, Bernadette; Luiggi Lopez, Eduardo; Nauenberg, Uriel; Smith, James; Stenson, Kevin; Ulmer, Keith; Wagner, Stephen Robert; Zang, Shi-Lei; Agostino, Lorenzo; Alexander, James; Chatterjee, Avishek; Das, Souvik; Eggert, Nicholas; Fields, Laura Johanna; Gibbons, Lawrence Kent; Heltsley, Brian; Hopkins, Walter; Khukhunaishvili, Aleko; Kreis, Benjamin; Kuznetsov, Valentin; Nicolas Kaufman, Gala; Patterson, Juliet Ritchie; Puigh, Darren; Riley, Daniel; Ryd, Anders; Shi, Xin; Sun, Werner; Teo, Wee Don; Thom, Julia; Thompson, Joshua; Vaughan, Jennifer; Weng, Yao; Winstrom, Lucas; Wittich, Peter; Biselli, Angela; Cirino, Guy; Winn, Dave; Abdullin, Salavat; Albrow, Michael; Anderson, Jacob; Apollinari, Giorgio; Atac, Muzaffer; Bakken, Jon Alan; Banerjee, Sunanda; Bauerdick, Lothar A.T.; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C.; Bloch, Ingo; Borcherding, Frederick; Burkett, Kevin; Butler, Joel Nathan; Chetluru, Vasundhara; Cheung, Harry; Chlebana, Frank; Cihangir, Selcuk; Demarteau, Marcel; Eartly, David P.; Elvira, Victor Daniel; Esen, Selda; Fisk, Ian; Freeman, Jim; Gao, Yanyan; Gottschalk, Erik; Green, Dan; Gunthoti, Kranti; Gutsche, Oliver; Hahn, Alan; Hanlon, Jim; Harris, Robert M.; Hirschauer, James; Hooberman, Benjamin; James, Eric; Jensen, Hans; Johnson, Marvin; Joshi, Umesh; Khatiwada, Rakshya; Kilminster, Benjamin; Klima, Boaz; Kousouris, Konstantinos; Kunori, Shuichi; Kwan, Simon; Leonidopoulos, Christos; Limon, Peter; Lipton, Ron; Lykken, Joseph; Maeshima, Kaori; Marraffino, John Michael; Mason, David; McBride, Patricia; McCauley, Thomas; Miao, Ting; Mishra, Kalanand; Mrenna, Stephen; Musienko, Yuri; Newman-Holmes, Catherine; O'Dell, Vivian; Popescu, Sorina; Pordes, Ruth; Prokofyev, Oleg; Saoulidou, Niki; Sexton-Kennedy, Elizabeth; Sharma, Seema; Soha, Aron; Spalding, William J.; Spiegel, Leonard; Tan, Ping; Taylor, Lucas; Tkaczyk, Slawek; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vidal, Richard; Whitmore, Juliana; Wu, Weimin; Yang, Fan; Yumiceva, Francisco; Yun, Jae Chul; Acosta, Darin; Avery, Paul; Bourilkov, Dimitri; Chen, Mingshui; Di Giovanni, Gian Piero; Dobur, Didar; Drozdetskiy, Alexey; Field, Richard D.; Fisher, Matthew; Fu, Yu; Furic, Ivan-Kresimir; Gartner, Joseph; Goldberg, Sean; Kim, Bockjoo; Klimenko, Sergey; Konigsberg, Jacobo; Korytov, Andrey; Kropivnitskaya, Anna; Kypreos, Theodore; Matchev, Konstantin; Mitselmakher, Guenakh; Muniz, Lana; Pakhotin, Yuriy; Prescott, Craig; Remington, Ronald; Schmitt, Michael Houston; Scurlock, Bobby; Sellers, Paul; Skhirtladze, Nikoloz; Wang, Dayong; Yelton, John; Zakaria, Mohammed; Ceron, Cristobal; Gaultney, Vanessa; Kramer, Laird; Lebolo, Luis Miguel; Linn, Stephan; Markowitz, Pete; Martinez, German; Rodriguez, Jorge Luis; Adams, Todd; Askew, Andrew; Bandurin, Dmitry; Bochenek, Joseph; Chen, Jie; Diamond, Brendan; Gleyzer, Sergei V; Haas, Jeff; Hagopian, Sharon; Hagopian, Vasken; Jenkins, Merrill; Johnson, Kurtis F.; Prosper, Harrison; Quertenmont, Loic; Sekmen, Sezen; Veeraraghavan, Venkatesh; Baarmand, Marc M.; Dorney, Brian; Guragain, Samir; Hohlmann, Marcus; Kalakhety, Himali; Ralich, Robert; Vodopiyanov, Igor; Adams, Mark Raymond; Anghel, Ioana Maria; Apanasevich, Leonard; Bai, Yuting; Bazterra, Victor Eduardo; Betts, Russell Richard; Callner, Jeremy; Cavanaugh, Richard; Dragoiu, Cosmin; Garcia-Solis, Edmundo Javier; Gauthier, Lucie; Gerber, Cecilia Elena; Hofman, David Jonathan; Khalatyan, Samvel; Lacroix, Florent; Malek, Magdalena; O'Brien, Christine; Silvestre, Catherine; Smoron, Agata; Strom, Derek; Varelas, Nikos; Akgun, Ugur; Albayrak, Elif Asli; Bilki, Burak; Cankocak, Kerem; Clarida, Warren; Duru, Firdevs; Lae, Chung Khim; McCliment, Edward; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Newsom, Charles Ray; Norbeck, Edwin; Olson, Jonathan; Onel, Yasar; Ozok, Ferhat; Sen, Sercan; Wetzel, James; Yetkin, Taylan; Yi, Kai; Barnett, Bruce Arnold; Blumenfeld, Barry; Bonato, Alessio; Eskew, Christopher; Fehling, David; Giurgiu, Gavril; Gritsan, Andrei; Guo, Zijin; Hu, Guofan; Maksimovic, Petar; Rappoccio, Salvatore; Swartz, Morris; Tran, Nhan Viet; Whitbeck, Andrew; Baringer, Philip; Bean, Alice; Benelli, Gabriele; Grachov, Oleg; Murray, Michael; Noonan, Daniel; Radicci, Valeria; Sanders, Stephen; Wood, Jeffrey Scott; Zhukova, Victoria; Bolton, Tim; Chakaberia, Irakli; Ivanov, Andrew; Makouski, Mikhail; Maravin, Yurii; Shrestha, Shruti; Svintradze, Irakli; Wan, Zongru; Gronberg, Jeffrey; Lange, David; Wright, Douglas; Baden, Drew; Boutemeur, Madjid; Eno, Sarah Catherine; Ferencek, Dinko; Gomez, Jaime; Hadley, Nicholas John; Kellogg, Richard G.; Kirn, Malina; Lu, Ying; Mignerey, Alice; Rossato, Kenneth; Rumerio, Paolo; Santanastasio, Francesco; Skuja, Andris; Temple, Jeffrey; Tonjes, Marguerite; Tonwar, Suresh C.; Twedt, Elizabeth; Alver, Burak; Bauer, Gerry; Bendavid, Joshua; Busza, Wit; Butz, Erik; Cali, Ivan Amos; Chan, Matthew; Dutta, Valentina; Everaerts, Pieter; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Hahn, Kristan Allan; Harris, Philip; Kim, Yongsun; Klute, Markus; Lee, Yen-Jie; Li, Wei; Loizides, Constantinos; Luckey, Paul David; Ma, Teng; Nahn, Steve; Paus, Christoph; Ralph, Duncan; Roland, Christof; Roland, Gunther; Rudolph, Matthew; Stephans, George; Sumorok, Konstanty; Sung, Kevin; Wenger, Edward Allen; Xie, Si; Yang, Mingming; Yilmaz, Yetkin; Yoon, Sungho; Zanetti, Marco; Cole, Perrie; Cooper, Seth; Cushman, Priscilla; Dahmes, Bryan; De Benedetti, Abraham; Dudero, Phillip Russell; Franzoni, Giovanni; Haupt, Jason; Klapoetke, Kevin; Kubota, Yuichi; Mans, Jeremy; Rekovic, Vladimir; Rusack, Roger; Sasseville, Michael; Singovsky, Alexander; Cremaldi, Lucien Marcus; Godang, Romulus; Kroeger, Rob; Perera, Lalith; Rahmat, Rahmat; Sanders, David A; Summers, Don; Bloom, Kenneth; Bose, Suvadeep; Butt, Jamila; Claes, Daniel R.; Dominguez, Aaron; Eads, Michael; Keller, Jason; Kelly, Tony; Kravchenko, Ilya; Lazo-Flores, Jose; Lundstedt, Carl; Malbouisson, Helena; Malik, Sudhir; Snow, Gregory R.; Baur, Ulrich; Godshalk, Andrew; Iashvili, Ia; Jain, Supriya; Kharchilava, Avto; Kumar, Ashish; Shipkowski, Simon Peter; Smith, Kenneth; Alverson, George; Barberis, Emanuela; Baumgartel, Darin; Boeriu, Oana; Chasco, Matthew; Reucroft, Steve; Swain, John; Wood, Darien; Zhang, Jinzhong; Anastassov, Anton; Kubik, Andrew; Odell, Nathaniel; Ofierzynski, Radoslaw Adrian; Pollack, Brian; Pozdnyakov, Andrey; Schmitt, Michael Henry; Stoynev, Stoyan; Velasco, Mayda; Won, Steven; Antonelli, Louis; Berry, Douglas; Hildreth, Michael; Jessop, Colin; Karmgard, Daniel John; Kolb, Jeff; Kolberg, Ted; Lannon, Kevin; Luo, Wuming; Lynch, Sean; Marinelli, Nancy; Morse, David Michael; Pearson, Tessa; Ruchti, Randy; Slaunwhite, Jason; Valls, Nil; Warchol, Jadwiga; Wayne, Mitchell; Ziegler, Jill; Bylsma, Ben; Durkin, Lloyd Stanley; Gu, Jianhui; Hill, Christopher; Killewald, Phillip; Kotov, Khristian; Ling, Ta-Yung; Rodenburg, Marissa; Williams, Grayson; Adam, Nadia; Berry, Edmund; Elmer, Peter; Gerbaudo, Davide; Halyo, Valerie; Hebda, Philip; Hunt, Adam; Jones, John; Laird, Edward; Lopes Pegna, David; Marlow, Daniel; Medvedeva, Tatiana; Mooney, Michael; Olsen, James; Piroué, Pierre; Quan, Xiaohang; Saka, Halil; Stickland, David; Tully, Christopher; Werner, Jeremy Scott; Zuranski, Andrzej; Acosta, Jhon Gabriel; Huang, Xing Tao; Lopez, Angel; Mendez, Hector; Oliveros, Sandra; Ramirez Vargas, Juan Eduardo; Zatserklyaniy, Andriy; Alagoz, Enver; Barnes, Virgil E.; Bolla, Gino; Borrello, Laura; Bortoletto, Daniela; Everett, Adam; Garfinkel, Arthur F.; Gecse, Zoltan; Gutay, Laszlo; Hu, Zhen; Jones, Matthew; Koybasi, Ozhan; Laasanen, Alvin T.; Leonardo, Nuno; Liu, Chang; Maroussov, Vassili; Merkel, Petra; Miller, David Harry; Neumeister, Norbert; Shipsey, Ian; Silvers, David; Svyatkovskiy, Alexey; Yoo, Hwi Dong; Zablocki, Jakub; Zheng, Yu; Jindal, Pratima; Parashar, Neeti; Boulahouache, Chaouki; Cuplov, Vesna; Ecklund, Karl Matthew; Geurts, Frank J.M.; Liu, Jinghua H.; Padley, Brian Paul; Redjimi, Radia; Roberts, Jay; Zabel, James; Betchart, Burton; Bodek, Arie; Chung, Yeon Sei; Covarelli, Roberto; de Barbaro, Pawel; Demina, Regina; Eshaq, Yossof; Flacher, Henning; Garcia-Bellido, Aran; Goldenzweig, Pablo; Gotra, Yury; Han, Jiyeon; Harel, Amnon; Miner, Daniel Carl; Orbaker, Douglas; Petrillo, Gianluca; Vishnevskiy, Dmitry; Zielinski, Marek; Bhatti, Anwar; Ciesielski, Robert; Demortier, Luc; Goulianos, Konstantin; Lungu, Gheorghe; Mesropian, Christina; Yan, Ming; Atramentov, Oleksiy; Barker, Anthony; Duggan, Daniel; Gershtein, Yuri; Gray, Richard; Halkiadakis, Eva; Hidas, Dean; Hits, Dmitry; Lath, Amitabh; Panwalkar, Shruti; Patel, Rishi; Richards, Alan; Rose, Keith; Schnetzer, Steve; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Cerizza, Giordano; Hollingsworth, Matthew; Spanier, Stefan; Yang, Zong-Chang; York, Andrew; Asaadi, Jonathan; Eusebi, Ricardo; Gilmore, Jason; Gurrola, Alfredo; Kamon, Teruki; Khotilovich, Vadim; Montalvo, Roy; Nguyen, Chi Nhan; Osipenkov, Ilya; Pivarski, James; Safonov, Alexei; Sengupta, Sinjini; Tatarinov, Aysen; Toback, David; Weinberger, Michael; Akchurin, Nural; Bardak, Cemile; Damgov, Jordan; Jeong, Chiyoung; Kovitanggoon, Kittikul; Lee, Sung Won; Mane, Poonam; Roh, Youn; Sill, Alan; Volobouev, Igor; Wigmans, Richard; Yazgan, Efe; Appelt, Eric; Brownson, Eric; Engh, Daniel; Florez, Carlos; Gabella, William; Johns, Willard; Kurt, Pelin; Maguire, Charles; Melo, Andrew; Sheldon, Paul; Velkovska, Julia; Arenton, Michael Wayne; Balazs, Michael; Boutle, Sarah; Buehler, Marc; Conetti, Sergio; Cox, Bradley; Francis, Brian; Hirosky, Robert; Ledovskoy, Alexander; Lin, Chuanzhe; Neu, Christopher; Yohay, Rachel; Gollapinni, Sowjanya; Harr, Robert; Karchin, Paul Edmund; Lamichhane, Pramod; Mattson, Mark; Milstène, Caroline; Sakharov, Alexandre; Anderson, Michael; Bachtis, Michail; Bellinger, James Nugent; Carlsmith, Duncan; Dasu, Sridhara; Efron, Jonathan; Gray, Lindsey; Grogg, Kira Suzanne; Grothe, Monika; Hall-Wilton, Richard; Herndon, Matthew; Klabbers, Pamela; Klukas, Jeffrey; Lanaro, Armando; Lazaridis, Christos; Leonard, Jessica; Loveless, Richard; Mohapatra, Ajit; Reeder, Don; Ross, Ian; Savin, Alexander; Smith, Wesley H.; Swanson, Joshua; Weinberg, Marc
2011-01-01
Bose-Einstein correlations between identical particles are measured in samples of proton-proton collisions at 0.9 and 7 TeV centre-of-mass energies, recorded by the CMS experiment at the LHC. The signal is observed in the form of an enhancement of number of pairs of same-sign charged particles with small relative momentum. The dependence of this enhancement on kinematic and topological features of the event is studied.
A Historical Perspective of Influenza A(H1N2) Virus
Komadina, Naomi; McVernon, Jodie; Hall, Robert; Leder, Karin
2014-01-01
The emergence and transition to pandemic status of the influenza A(H1N1)A(H1N1)pdm09) virus in 2009 illustrated the potential for previously circulating human viruses to re-emerge in humans and cause a pandemic after decades of circulating among animals. Within a short time of the initial emergence of A(H1N1)pdm09 virus, novel reassortants were isolated from swine. In late 2011, a variant (v) H3N2 subtype was isolated from humans, and by 2012, the number of persons infected began to increase ...
International Nuclear Information System (INIS)
Zheng, R.K.; Dong, S.N.; Wu, Y.Q.; Zhu, Q.X.; Wang, Y.; Chan, H.L.W.; Li, X.M.; Luo, H.S.; Li, X.G.
2012-01-01
The authors constructed multiferroic structures by growing La 0.9 Ce 0.1 MnO 3 (LCEMO) thin films on piezoelectric 0.68Pb(Mg 1/3 Nb 2/3 )O 3 –0.32PbTiO 3 (PMN-PT) single-crystal substrates. Due to the efficient elastic coupling at the interface, the electric-field-induced piezoelectric strain in PMN-PT substrates is effectively transferred to LCEMO films and thus, leads to a decrease in the resistance and an increase in the magnetoresistance of the films. Particularly, it was found that the resistance-strain coefficient [(ΔR/R) film /(Δε zz ) film ] of the LCEMO film was considerably enhanced by the application of magnetic fields, demonstrating strong coupling between the lattice and the spin degrees of freedom. (ΔR/R) film /(Δε zz ) film at 122 K was enhanced by ∼ 28.8% by a magnetic field of 1.2 T. An analysis of the overall results demonstrates that the phase separation is crucial to understand strain-mediated modulation of electronic transport properties of manganite film/PMN-PT multiferroic structures. - Highlights: ► La 0.9 Ce 0.1 Mn O3 films were epitaxially grown on piezoelectric single crystals. ► Piezoelectric strain influences the electronic transport properties of films. ► Magnetic field enhances the piezoelectric strain effect. ► Phase separation is crucial to understand the piezoelectric strain effect.
Comparison of CT numbers between cone-beam CT and multi-detector CT
International Nuclear Information System (INIS)
Kim, Dong Soo; Han, Won Jeong; Kim, Eun Kyung
2010-01-01
To compare the CT numbers on 3 cone-beam CT (CBCT) images with those on multi-detector CT (MDCT) image using CT phantom and to develop linear regressive equations using CT numbers to material density for all the CT scanner each. Mini CT phantom comprised of five 1 inch thick cylindrical models with 1.125 inches diameter of materials with different densities (polyethylene, polystyrene, plastic water, nylon and acrylic) was used. It was scanned in 3 CBCTs (i-CAT, Alphard VEGA, Implagraphy SC) and 1 MDCT (Somatom Emotion). The images were saved as DICOM format and CT numbers were measured using OnDemand 3D. CT numbers obtained from CBCTs and MDCT images were compared and linear regression analysis was performed for the density, ρ(g/cm 3 ), as the dependent variable in terms of the CT numbers obtained from CBCTs and MDCT images. CT numbers on i-CAT and Implagraphy CBCT images were smaller than those on Somatom Emotion MDCT image (p<0.05). Linear relationship on a range of materials used for this study were ρ=0.001 H+1.07 with R2 value of 0.999 for Somatom Emotion, ρ=0.002 H+1.09 with R2 value of 0.991 for Alphard VEGA, ρ=0.001 H+1.43 with R2 value of 0.980 for i-CAT and ρ=0.001 H+1.30 with R2 value of 0.975 for Implagraphy. CT numbers on i-CAT and Implagraphy CBCT images were not same as those on Somatom Emotion MDCT image. The linear regressive equations to determine the density from the CT numbers with very high correlation coefficient were obtained on three CBCT and MDCT scan.
Comparison of CT numbers between cone-beam CT and multi-detector CT
Energy Technology Data Exchange (ETDEWEB)
Kim, Dong Soo; Han, Won Jeong; Kim, Eun Kyung [Department of Oral and Maxillofacial Radiology, School of Dentistry, Dankook University, Cheonan (Korea, Republic of)
2010-06-15
To compare the CT numbers on 3 cone-beam CT (CBCT) images with those on multi-detector CT (MDCT) image using CT phantom and to develop linear regressive equations using CT numbers to material density for all the CT scanner each. Mini CT phantom comprised of five 1 inch thick cylindrical models with 1.125 inches diameter of materials with different densities (polyethylene, polystyrene, plastic water, nylon and acrylic) was used. It was scanned in 3 CBCTs (i-CAT, Alphard VEGA, Implagraphy SC) and 1 MDCT (Somatom Emotion). The images were saved as DICOM format and CT numbers were measured using OnDemand 3D. CT numbers obtained from CBCTs and MDCT images were compared and linear regression analysis was performed for the density, {rho}(g/cm{sup 3}), as the dependent variable in terms of the CT numbers obtained from CBCTs and MDCT images. CT numbers on i-CAT and Implagraphy CBCT images were smaller than those on Somatom Emotion MDCT image (p<0.05). Linear relationship on a range of materials used for this study were {rho}=0.001 H+1.07 with R2 value of 0.999 for Somatom Emotion, {rho}=0.002 H+1.09 with R2 value of 0.991 for Alphard VEGA, {rho}=0.001 H+1.43 with R2 value of 0.980 for i-CAT and {rho}=0.001 H+1.30 with R2 value of 0.975 for Implagraphy. CT numbers on i-CAT and Implagraphy CBCT images were not same as those on Somatom Emotion MDCT image. The linear regressive equations to determine the density from the CT numbers with very high correlation coefficient were obtained on three CBCT and MDCT scan.
Enhanced conductivity in pulsed laser deposited Ce0.9Gd0.1O2−δ/SrTiO3 heterostructures
DEFF Research Database (Denmark)
Kant, K. Mohan; Esposito, Vincenzo; Pryds, Nini
2010-01-01
Significant enhancement in the electrical conductivity of Ce0.9Gd0.1O2−δ (CGO) thin films (250 and 500 nm) deposited on MgO(001) substrate is observed by introducing ∼ 50 nm thin SrTiO3 buffer layer film. Introduction of the buffer layer is found to form epitaxial films, leading to minimal grain...... boundary network that results in a free conduction path with near-zero blocking effects perpendicular to current flow. The in-plane conductivity measurements confirm increase in conductivity with increase in compressive strain on CGO films. © 2010 American Institute of Physics...
Review of proposed kaon factory facilities
International Nuclear Information System (INIS)
Macek, R.J.
1985-01-01
A number of proton accelerator facilities, popularly called ''Kaon Factories,'' have been proposed to extend the intensity frontier from about 1 GeV to higher energies in the range of 15 to 45 GeV. Seven proposed facilities - LAMPF II, TRIUMF II, SIN II, AGS II, KEK, MUNICH, and KYOTO - are reviewed with emphasis on capabilities of the experimental facilities. Costs and the choice of energy and current are also discussed. 7 refs., 29 figs., 7 tabs
Vitreoscilla hemoglobin promotes Salecan production by Agrobacterium sp. ZX09.
Chen, Yun-mei; Xu, Hai-yang; Wang, Yang; Zhang, Jian-fa; Wang, Shi-ming
2014-11-01
Salecan is a novel exopolysaccharide produced by the strain Agrobacterium sp. ZX09, and it is composed of only glucose monomers. The unique chemical composition and excellent physicochemical properties make Salecan a promising material for applications in coagulation, lubrication, protection against acute liver injury, and alleviating constipation. In this study, we cloned the Vitreoscilla hemoglobin gene into a broad-host-range plasmid pCM158. Without antibiotic selection, there was negligible loss of the plasmid in the host Agrobacterium sp. ZX09 after one passage of cultivation. The expression of Vitreoscilla hemoglobin was demonstrated by carbon monoxide (CO) difference spectrum. The engineered strain Agrobacterium sp. ZX09 increased Salecan yield by 30%. The other physiological changes included its elevated respiration rate and cellular invertase activity.
Core Knowledge, Language, and Number
Spelke, Elizabeth S.
2017-01-01
The natural numbers may be our simplest, most useful, and best-studied abstract concepts, but their origins are debated. I consider this debate in the context of the proposal, by Gallistel and Gelman, that natural number system is a product of cognitive evolution and the proposal, by Carey, that it is a product of human cultural history. I offer a…
Energy Technology Data Exchange (ETDEWEB)
Vinolin, Ada [Dept. of Physics, Madurai Kamaraj University College, Alagarkoil Road, Madurai-625002 (India); Peter, A. John, E-mail: a.john.peter@gmail.com [Dept. of Physics, Government Arts College, Melur-625106, Tamilnadu (India)
2014-04-24
Simultaneous effects of electric field and magnetic field on exciton binding energy as a function of dot radius in a cylindrical GaAs{sub 0.9}P{sub 0.1}/GaAs{sub 0.6}P{sub 0.4} strained quantum dot are investigated. The strain contribution includes the strong built-in electric field induced by the spontaneous and piezoelectric polarizations. Numerical calculations are performed using variational procedure within the single band effective mass approximation. Optical rectification in the GaAs{sub 0.9}P{sub 0.1}/GaAs{sub 0.6}P{sub 0.4} quantum dot is computed in the presence of electric and magnetic fields.
Measurement of $V^0$ production ratios in $pp$ collisions at $\\sqrt{s}$ = 0.9 and 7 TeV
Aaij, R.; Adinolfi, M.; Adrover, C.; Affolder, A.; Ajaltouni, Z.; Albrecht, J.; Alessio, F.; Alexander, M.; Alkhazov, G.; Alvarez Cartelle, P.; Alves Jr, A.A.; Amato, S.; Amhis, Y.; Anderson, J.; Appleby, R.B.; Aquines Gutierrez, O.; Arrabito, L.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Bachmann, S.; Back, J.J.; Bailey, D.S.; Balagura, V.; Baldini, W.; Barlow, R.J.; Barschel, C.; Barsuk, S.; Barter, W.; Bates, A.; Bauer, C.; Bauer, Th.; Bay, A.; Bediaga, I.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Benayoun, M.; Bencivenni, G.; Benson, S.; Bernet, R.; Bettler, M.O.; van Beuzekom, M.; Bien, A.; Bifani, S.; Bizzeti, A.; Bjornstad, P.M.; Blake, T.; Blanc, F.; Blanks, C.; Blouw, J.; Blusk, S.; Bobrov, A.; Bocci, V.; Bondar, A.; Bondar, N.; Bonivento, W.; Borghi, S.; Borgia, A.; Bowcock, T.J.V.; Bozzi, C.; Brambach, T.; van den Brand, J.; Bressieux, J.; Brett, D.; Brisbane, S.; Britsch, M.; Britton, T.; Brook, N.H.; Buchler-Germann, A.; Burducea, I.; Bursche, A.; Buytaert, J.; Cadeddu, S.; Caicedo Carvajal, J.M.; Callot, O.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Cattaneo, M.; Charles, M.; Charpentier, Ph.; Chiapolini, N.; Cid Vidal, X.; Ciezarek, G.; Clarke, P.E.L.; Clemencic, M.; Cliff, H.V.; Closier, J.; Coca, C.; Coco, V.; Cogan, J.; Collins, P.; Constantin, F.; Conti, G.; Contu, A.; Coombes, M.; Corti, G.; Cowan, G.A.; Currie, R.; D'Almagne, B.; D'Ambrosio, C.; David, P.; De Bonis, I.; De Capua, S.; De Cian, M.; De Lorenzi, F.; De Miranda, J.M.; De Paula, L.; De Simone, P.; Decamp, D.; Deckenhoff, M.; Degaudenzi, H.; Deissenroth, M.; Del Buono, L.; Deplano, C.; Deschamps, O.; Dettori, F.; Dickens, J.; Dijkstra, H.; Diniz Batista, P.; Dossett, D.; Dovbnya, A.; Dupertuis, F.; Dzhelyadin, R.; Eames, C.; Easo, S.; Egede, U.; Egorychev, V.; Eidelman, S.; van Eijk, D.; Eisele, F.; Eisenhardt, S.; Ekelhof, R.; Eklund, L.; Elsasser, Ch.; d'Enterria, D.G.; Esperante Pereira, D.; Esteve, L.; Falabella, A.; Fanchini, E.; Farber, C.; Fardell, G.; Farinelli, C.; Farry, S.; Fave, V.; Fernandez Albor, V.; Ferro-Luzzi, M.; Filippov, S.; Fitzpatrick, C.; Fontana, M.; Fontanelli, F.; Forty, R.; Frank, M.; Frei, C.; Frosini, M.; Furcas, S.; Gallas Torreira, A.; Galli, D.; Gandelman, M.; Gandini, P.; Gao, Y.; Garnier, J-C.; Garofoli, J.; Garra Tico, J.; Garrido, L.; Gaspar, C.; Gauvin, N.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gibson, V.; Gligorov, V.V.; Gobel, C.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gordon, H.; Grabalosa Gandara, M.; Graciani Diaz, R.; Granado Cardoso, L.A.; Grauges, E.; Graziani, G.; Grecu, A.; Gregson, S.; Gui, B.; Gushchin, E.; Guz, Yu.; Gys, T.; Haefeli, G.; Haen, C.; Haines, S.C.; Hampson, T.; Hansmann-Menzemer, S.; Harji, R.; Harnew, N.; Harrison, J.; Harrison, P.F.; He, J.; Heijne, V.; Hennessy, K.; Henrard, P.; Hernando Morata, J.A.; van Herwijnen, E.; Hofmann, W.; Holubyev, K.; Hopchev, P.; Hulsbergen, W.; Hunt, P.; Huse, T.; Huston, R.S.; Hutchcroft, D.; Hynds, D.; Iakovenko, V.; Ilten, P.; Imong, J.; Jacobsson, R.; Jaeger, A.; Jahjah Hussein, M.; Jans, E.; Jansen, F.; Jaton, P.; Jean-Marie, B.; Jing, F.; John, M.; Johnson, D.; Jones, C.R.; Jost, B.; Kandybei, S.; Karacson, M.; Karbach, T.M.; Keaveney, J.; Kerzel, U.; Ketel, T.; Keune, A.; Khanji, B.; Kim, Y.M.; Knecht, M.; Koblitz, S.; Koppenburg, P.; Kozlinskiy, A.; Kravchuk, L.; Kreplin, K.; Kreps, M.; Krocker, G.; Krokovny, P.; Kruse, F.; Kruzelecki, K.; Kucharczyk, M.; Kukulak, S.; Kumar, R.; Kvaratskheliya, T.; La Thi, V.N.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lambert, D.; Lambert, R.W.; Lanciotti, E.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Le Gac, R.; van Leerdam, J.; Lees, J.P.; Lefevre, R.; Leflat, A.; Lefrancois, J.; Leroy, O.; Lesiak, T.; Li, L.; Li, Y.Y.; Li Gioi, L.; Lieng, M.; Lindner, R.; Linn, C.; Liu, B.; Liu, G.; Lopes, J.H.; Lopez Asamar, E.; Lopez-March, N.; Luisier, J.; Machefert, F.; Machikhiliyan, I.V.; Maciuc, F.; Maev, O.; Magnin, J.; Malde, S.; Mamunur, R.M.D.; Manca, G.; Mancinelli, G.; Mangiafave, N.; Marconi, U.; Marki, R.; Marks, J.; Martellotti, G.; Martens, A.; Martin, L.; Martin Sanchez, A.; Martinez Santos, D.; Massafferri, A.; Mathe, Z.; Matteuzzi, C.; Matveev, M.; Maurice, E.; Maynard, B.; Mazurov, A.; McGregor, G.; McNulty, R.; Mclean, C.; Meissner, M.; Merk, M.; Merkel, J.; Messi, R.; Miglioranzi, S.; Milanes, D.A.; Minard, M.N.; Monteil, S.; Moran, D.; Morawski, P.; Morris, J.V.; Mountain, R.; Mous, I.; Muheim, F.; Muller, K.; Muresan, R.; Muryn, B.; Musy, M.; Naik, P.; Nakada, T.; Nandakumar, R.; Nardulli, J.; Nasteva, I.; Nedos, M.; Needham, M.; Neufeld, N.; Nguyen-Mau, C.; Nicol, M.; Nies, S.; Niess, V.; Nikitin, N.; Oblakowska-Mucha, A.; Obraztsov, V.; Oggero, S.; Ogilvy, S.; Okhrimenko, O.; Oldeman, R.; Orlandea, M.; Otalora Goicochea, J.M.; Owen, P.; Pal, B.; Palacios, J.; Palutan, M.; Panman, J.; Papanestis, A.; Pappagallo, M.; Parkes, C.; Parkinson, C.J.; Passaleva, G.; Patel, G.D.; Patel, M.; Paterson, S.K.; Patrick, G.N.; Patrignani, C.; Pavel-Nicorescu, C.; Pazos Alvarez, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Perego, D.L.; Perez Trigo, E.; Perez-Calero Yzquierdo, A.; Perret, P.; Perrin-Terrin, M.; Pessina, G.; Petrella, A.; Petrolini, A.; Pie Valls, B.; Pietrzyk, B.; Pilar, T.; Pinci, D.; Plackett, R.; Playfer, S.; Plo Casasus, M.; Polok, G.; Poluektov, A.; Polycarpo, E.; Popov, D.; Popovici, B.; Potterat, C.; Powell, A.; Pree, T.du; Prisciandaro, J.; Pugatch, V.; Puig Navarro, A.; Qian, W.; Rademacker, J.H.; Rakotomiaramanana, B.; Raniuk, I.; Raven, G.; Redford, S.; Reid, M.M.; Reis, A.C.dos; Ricciardi, S.; Rinnert, K.; Roa Romero, D.A.; Robbe, P.; Rodrigues, E.; Rodrigues, F.; Rodriguez Perez, P.; Rogers, G.J.; Romanovsky, V.; Rouvinet, J.; Ruf, T.; Ruiz, H.; Sabatino, G.; Saborido Silva, J.J.; Sagidova, N.; Sail, P.; Saitta, B.; Salzmann, C.; Sannino, M.; Santacesaria, R.; Santinelli, R.; Santovetti, E.; Sapunov, M.; Sarti, A.; Satriano, C.; Satta, A.; Savrie, M.; Savrina, D.; Schaack, P.; Schiller, M.; Schleich, S.; Schmelling, M.; Schmidt, B.; Schneider, O.; Schopper, A.; Schune, M.H.; Schwemmer, R.; Sciubba, A.; Seco, M.; Semennikov, A.; Senderowska, K.; Sepp, I.; Serra, N.; Serrano, J.; Seyfert, P.; Shao, B.; Shapkin, M.; Shapoval, I.; Shatalov, P.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, O.; Shevchenko, V.; Shires, A.; Silva Coutinho, R.; Skottowe, H.P.; Skwarnicki, T.; Smith, A.C.; Smith, N.A.; Sobczak, K.; Soler, F.J.P.; Solomin, A.; Soomro, F.; Souza De Paula, B.; Spaan, B.; Sparkes, A.; Spradlin, P.; Stagni, F.; Stahl, S.; Steinkamp, O.; Stoica, S.; Stone, S.; Storaci, B.; Straticiuc, M.; Straumann, U.; Styles, N.; Swientek, S.; Szczekowski, M.; Szczypka, P.; Szumlak, T.; T'Jampens, S.; Teodorescu, E.; Teubert, F.; Thomas, C.; Thomas, E.; van Tilburg, J.; Tisserand, V.; Tobin, M.; Topp-Joergensen, S.; Tran, M.T.; Tsaregorodtsev, A.; Tuning, N.; Ukleja, A.; Urquijo, P.; Uwer, U.; Vagnoni, V.; Valenti, G.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vecchi, S.; Velthuis, J.J.; Veltri, M.; Vervink, K.; Viaud, B.; Videau, I.; Vilasis-Cardona, X.; Visniakov, J.; Vollhardt, A.; Voong, D.; Vorobyev, A.; Voss, H.; Wacker, K.; Wandernoth, S.; Wang, J.; Ward, D.R.; Webber, A.D.; Websdale, D.; Whitehead, M.; Wiedner, D.; Wiggers, L.; Wilkinson, G.; Williams, M.P.; Williams, M.; Wilson, F.F.; Wishahi, J.; Witek, M.; Witzeling, W.; Wotton, S.A.; Wyllie, K.; Xie, Y.; Xing, F.; Yang, Z.; Young, R.; Yushchenko, O.; Zavertyaev, M.; Zhang, L.; Zhang, W.C.; Zhang, Y.; Zhelezov, A.; Zhong, L.; Zverev, E.
2011-01-01
The $\\bar{\\Lambda} / \\Lambda$ and $\\bar{\\Lambda} / K^0_\\mathrm{S}$ production ratios are measured by the LHCb detector from $0.3\\,\\mathrm{nb}^{-1}$ of $pp$ collisions delivered by the LHC at $\\sqrt{s} = 0.9$\\,TeV and $1.8\\,\\mathrm{nb}^{-1}$ at $\\sqrt{s} = 7$\\,TeV. Both ratios are presented as a function of transverse momentum, $p_\\mathrm{T}$, and rapidity, $y$, in the ranges {$0.15 < p_\\mathrm{T} < 2.50\\,\\mathrm{GeV}/c$} and {$2.0
First International Diagnosis Competition - DXC'09
Kurtoglu, tolga; Narasimhan, Sriram; Poll, Scott; Garcia, David; Kuhn, Lukas; deKleer, Johan; vanGemund, Arjan; Feldman, Alexander
2009-01-01
A framework to compare and evaluate diagnosis algorithms (DAs) has been created jointly by NASA Ames Research Center and PARC. In this paper, we present the first concrete implementation of this framework as a competition called DXC 09. The goal of this competition was to evaluate and compare DAs in a common platform and to determine a winner based on diagnosis results. 12 DAs (model-based and otherwise) competed in this first year of the competition in 3 tracks that included industrial and synthetic systems. Specifically, the participants provided algorithms that communicated with the run-time architecture to receive scenario data and return diagnostic results. These algorithms were run on extended scenario data sets (different from sample set) to compute a set of pre-defined metrics. A ranking scheme based on weighted metrics was used to declare winners. This paper presents the systems used in DXC 09, description of faults and data sets, a listing of participating DAs, the metrics and results computed from running the DAs, and a superficial analysis of the results.
Medical Surveillance Monthly Report (MSMR). Volume 15, Number 1, January 2008
2008-01-01
108.8 138.3 1.26 22.34 Idaho 60 99.8 51.9 1.16 13.40 Montana 69 119.5 49.9 1.38 33.13 New Mexico 72 78.6 79.1 0.91 -7.78 Nevada 96 142.3...May 2004. Note: Completeness and timeliness of reporting vary by facility. Shigella Hepatitis B Varicella Reporting locations Number of reports all... Varicella Reporting locations Number of reports all events† Food-borne Vaccine preventable Campylo- bacter Giardia Salmonella 24 VOL. 15 / NO. 1
18 CFR 1.102 - Words denoting number, gender and so forth.
2010-04-01
... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Words denoting number... Rules of Construction § 1.102 Words denoting number, gender and so forth. In determining the meaning of...) Words of one gender include the other gender. [Order 225, 47 FR 19022, May 3, 1982] ...
Torner, Nuria; Baricot, Maretva; Martínez, Ana; Toledo, Diana; Godoy, Pere; Dominguez, Ángela
2013-03-01
The aim of this study was to evaluate the outcome of a collaborative action between Public Health services and Primary Care in the context of a case-control study on effectiveness of pharmaceutical and non-pharmaceutical measures to prevent hospitalization in a pandemic situation. To carry out this research the collaborative action of the primary care physicians members of the Influenza surveillance network was needed, they had to recall clinical information from influenza A(H1N1)pmd09 confirmed outpatient cases and negative outpatient controls matching their corresponding hospitalized confirmed case. A survey questionnaire to assess involvement of Influenza Sentinel Surveillance Primary care physicians' Network of Catalonia (PIDIRAC) regarding the outpatient case and control outreach during the pandemic influenza season was performed. A total of 71,1% of completed surveys were received. Perception of pandemic activity was considered to be similar to seasonal influenza activity in 43.8% or higher but not unbearable in 37.5% of the replies. There was no nuisance reported from patients regarding neither the questions nor the surveyor. Collaborative research between Public Health services and Primary Care physicians enhances Public Health actions and research.
78 FR 22034 - Proposed Collection; Comment Request for Notice 2001-1
2013-04-12
... Notice 2001-1, Employer-designed Tip Reporting Program for the Food and Beverage Industry (EmTRAC). DATES... Program for the Food and Beverage Industry (EmTRAC). OMB Number: 1545-1716. Notice Number: Notice 2001-1...
Barcelona - Talent Latent 09 / Ahto Sooaru
Sooaru, Ahto
2010-01-01
Fotonäitusest "Talent Latent 09" Barcelonas Arts Santa Monica kunstikeskuses. Loetletud näitusel eksponeeritud fotode autorid. Pikemalt Rafael Milach'i (sünd. 1978), Lucia Ganieva, Javier Marquerie Thomas'i (sünd. 1986), Amaury da Cunha (sünd. 1976) töödest. Lühidalt ka teistest näitustest Arts Santa Monica kunstikeskuses
Copy number variation of KIR genes influences HIV-1 control
DEFF Research Database (Denmark)
Pelak, Kimberly; Need, Anna C; Fellay, Jacques
2011-01-01
A genome-wide screen for large structural variants showed that a copy number variant (CNV) in the region encoding killer cell immunoglobulin-like receptors (KIR) associates with HIV-1 control as measured by plasma viral load at set point in individuals of European ancestry. This CNV encompasses...... the KIR3DL1-KIR3DS1 locus, encoding receptors that interact with specific HLA-Bw4 molecules to regulate the activation of lymphocyte subsets including natural killer (NK) cells. We quantified the number of copies of KIR3DS1 and KIR3DL1 in a large HIV-1 positive cohort, and showed that an increase in KIR3...... amounts of these activating and inhibitory KIR play a role in regulating the peripheral expansion of highly antiviral KIR3DS1+ NK cells, which may determine differences in HIV-1 control following infection....
2011-01-14
... SECURITIES AND EXCHANGE COMMISSION [Release No. 34-63668; File No. SR-NSCC-2010-09] Self-Regulatory Organizations; National Securities Clearing Corporation; Order Approving Proposed Rule Change... Facility January 6, 2011. I. Introduction On August 30, 2010, the National Securities Clearing Corporation...
31 CFR 1.32 - Use and disclosure of social security numbers.
2010-07-01
... OF RECORDS Privacy Act § 1.32 Use and disclosure of social security numbers. (a) In general. An... such individual's refusal to disclose his social security number. (b) Exceptions. The provisions of... Federal statute, or (2) The disclosure of a social security number to any Federal, State, or local agency...
Proposal and Implementation of a Robust Sensing Method for DVB-T Signal
Song, Chunyi; Rahman, Mohammad Azizur; Harada, Hiroshi
This paper proposes a sensing method for TV signals of DVB-T standard to realize effective TV White Space (TVWS) Communication. In the TVWS technology trial organized by the Infocomm Development Authority (iDA) of Singapore, with regard to the sensing level and sensing time, detecting DVB-T signal at the level of -120dBm over an 8MHz channel with a sensing time below 1 second is required. To fulfill such a strict sensing requirement, we propose a smart sensing method which combines feature detection and energy detection (CFED), and is also characterized by using dynamic threshold selection (DTS) based on a threshold table to improve sensing robustness to noise uncertainty. The DTS based CFED (DTS-CFED) is evaluated by computer simulations and is also implemented into a hardware sensing prototype. The results show that the DTS-CFED achieves a detection probability above 0.9 for a target false alarm probability of 0.1 for DVB-T signals at the level of -120dBm over an 8MHz channel with the sensing time equals to 0.1 second.
Lincoln Laboratory Journal. Volume 22, Number 1, 2016
2016-06-09
different service models—infrastructure as a service (IaaS), platform as a service (PaaS), and software as a service ( SaaS )—that target system... SaaS Full-fledged applications Low Google Gmail, Microsoft Office 365, Facebook 126 LINCOLN LABORATORY JOURNAL n VOLUME 22, NUMBER 1, 2016 SECURE AND
European Science Notes. Volume 40, Number 1.
1986-01-01
Mass Spectrometry mers and copolymers of polyacrylate salt series edited by Professor J.F.J. Todd latex) rather than an inorganic or or- (University...changes in the popu- cy with two potassium dihydrogen phos- lation of a vibrational manifold were phate (KDP) crystals. Following a fil- determined by...AD-A162 235 EUROPEAN SCIENCE NOTES VOLUME 48 NUMBER I(U) OFFICE OF i/1 NAVAL RESEARCH LONDON (ENGLAND) L E SHAFFER JAN 86 UNCLASSIFIED F/G 5/2
Magnetic and Moessbauer study of Mg{sub 0.9}Mn{sub 0.1}Cr{sub x}Fe{sub 2-x}O{sub 4} ferrites
Energy Technology Data Exchange (ETDEWEB)
Elzain, M., E-mail: elzain@squ.edu.om; Widatallah, H.; Gismelseed, A.; Bouziane, K.; Yousif, A.; Al Rawas, A.; Al-Omari, I.; Sellai, A. [Sultan Qaboos University, Department of Physics, College of Science (Oman)
2006-02-15
The ferrites Mg{sub 0.9}Mn{sub 0.1}Cr{sub x}Fe{sub 2-x}O{sub 4} (0x0.9) were prepared using the conventional double sintering method. The XRD showed that the samples maintain a single spinel cubic phase. The Moessbauer measurements were carried out at room and liquid nitrogen temperatures. From the area ratios of the A and B sites, it was found that the Fe cation population of the A and B sites decreases in proportion to Cr concentration. The contact hyperfine fields at the A and B sites were found to decrease with increasing Cr contents. This was found to be in approximate agreement with the results of magnetization measurement. The distributions of Mg and Mn cations versus Cr concentration were also determined using the Moessbauer and magnetization results. The Curie temperatures were determined and found to agree with the reported values. As the Cr contents increases the relative magnetization, was found to increase at low temperatures and decreases at higher temperatures.
Influence of porosity on densification and grain growth kinetics of Ce0.9Gd0.1O1.95 tape
DEFF Research Database (Denmark)
Ni, De Wei; Esposito, Vincenzo; Foghmoes, Søren Preben Vagn
porous layer allowing gas flow is necessary in catalytic and in gas purification devices. During the sintering with shrinkage, the total solid volume is maintained to be a constant value but the shape and size of each particle change with the formation of grain boundaries. This change in solid particles...... is accompanied by the change of shape, size and fraction of pores in a given volume. Therefore, porosity can be treated as an extra phase during sintering study. In this work, we presented the densification and grain growth behaviour of Ce0.9Gd0.1O1.95 tape cast layers with different percentage of porosity....... The emphasis was put on the effect of porosity on densification and grain growth kinetics. Derived from the sintering constitutive laws, the densification and grain growth kinetics were experimentally characterized and analyzed. Furthermore, the activation energies for viscous flow were determined from master...
Energy Technology Data Exchange (ETDEWEB)
Cui, Xinyu; Gu, Hongmei [School of Public Health, Mudanjiang Medical University, Mudanjiang, Heilongjiang Province (China); Yin, Yuanyuan; Guan, Yue [Hongqi Hospital, Mudanjiang Medical University, Mudanjiang, Heilongjiang Province (China); Rong, Shengzhong; Yin, Yongkui; Chen, Yingying [School of Public Health, Mudanjiang Medical University, Mudanjiang, Heilongjiang Province (China); Wu, Qunhong; Hao, Yanhua [Department of Social Medicine, School of Health Management, Harbin Medical University, Harbin, Heilongjiang Province (China); Li, Miaojing, E-mail: limiaojing@aliyun.com [School of Public Health, Mudanjiang Medical University, Mudanjiang, Heilongjiang Province (China)
2015-04-15
Highlights: • Cu{sub 0.91}In{sub 0.09}S microspheres were deposited on TiO{sub 2} NTs by a photodeposition method. • The average diameter of Cu{sub 0.91}In{sub 0.09}S microspheres is 600 nm. • The TiO{sub 2} NTs/CIS shows high photocurrents and visible photocatalytic activity. - Abstract: TiO{sub 2} nanotube arrays sensitized with Cu{sub 0.91}In{sub 0.09}S microspheres (TiO{sub 2} NTs/CIS) were successfully fabricated by a two-step process of anodization and followed by an in situ photodeposition method. The structural investigation by scanning electron microscopy and transmission electron microscopy indicated that the Cu{sub 0.91}In{sub 0.09}S microspheres with average diameter of 600 nm grew on the surface of the TiO{sub 2} nanotubes. The TiO{sub 2} NTs/CIS exhibited more excellent photoelectrochemical properties and photocatalytic activities than those of TiO{sub 2} NTs under visible light irradiation, and the corresponding electron transformation was proposed in detail.
75 FR 61733 - Combined Notice of Filings #1
2010-10-06
... MBR Tariff making the required change. Filed Date: 09/27/2010. Accession Number: 20100928-0206... Grove MBR Baseline to be effective 9/27/2010. Filed Date: 09/27/2010. Accession Number: 20100927-5227..., LLC. Description: Champion Energy Services, LLC submits tariff filing per 35.12: MBR application to be...
Underlying event background in two-pion correlations in p + p collisions at √ s = 0.9 and 7 TeV
International Nuclear Information System (INIS)
Kisiel, A.
2011-01-01
When analyzing two-particle correlations for identical pions in p + p collisions at √ s = 0.9 and 7 TeV, significant background correlation structures are observed. The structures are also observed for pairs of nonidentical pions and are reproduced by Monte-Carlo simulations. We analyze these structures quantitatively and propose methods to account for their impact on the system sizes extracted from the fits to the identical pion correlation functions
76 FR 6815 - Proposed Information Collection, OMB Control Number 1004-NEW
2011-02-08
... resource protection and recreation goals set forth in the RMPs, BLM must gather accurate data regarding... about visitors' demographics and visitors' views on facilities, conflicts, existing and proposed... determine changes in visitor characteristics, including demographics, usage, user conflicts, and...
Multifold polar states in Zn-doped Sr0.9Ba0.1TiO3 ceramics
Guo, Yan-Yan; Guo, Yun-Jun; Wei, Tong; Liu, Jun-Ming
2015-12-01
We investigate the effect of Zn doping on the dielectricity and ferroelectricity of a series of polycrystalline Sr0.9-xZnxBa0.1TiO3 (0.0% ≤ x ≤ 5.0%) ceramics. It is surprisingly observed that the Zn doping will produce the multifold polar states, i.e., the Zn-doped ceramic will convert a reduced polar state into an enhanced polar state, and eventually into a stabilized polar state with increasing the doping level x. It is revealed that in the background of quantum fluctuations, the competition between the Zn-doping-induced lattice contraction and the Ba-doping-induced lattice expansion is responsible for both the reduced polar state and the enhanced polar state coming into being. Also, the addition of the antiferrodistortive effect, which is the antipolar interaction originating from the opposite tilted-TiO6 octahedra rotation, represents the core physics behind the stabilized polar state. Project supported by the National Natural Science Foundation of China (Grant Nos. 11304158, 51431006, 51102277, and 11104118), the Scientific Research Foundation of Nanjing University of Posts and Telecommunications, China (Grant No. NY213020), and the Qing Lan Project of Jiangsu Province, China.
Fully digital 1-D, 2-D and 3-D multiscroll chaos as hardware pseudo random number generators
Mansingka, Abhinav S.
2012-10-07
This paper introduces the first fully digital implementation of 1-D, 2-D and 3-D multiscroll chaos using the sawtooth nonlinearity in a 3rd order ODE with the Euler approximation. Systems indicate chaotic behaviour through phase space boundedness and positive Lyapunov exponent. Low-significance bits form a PRNG and pass all tests in the NIST SP. 800-22 suite without post-processing. Real-time control of the number of scrolls allows distinct output streams with 2-D and 3-D multiscroll chaos enabling greater controllability. The proposed PRNGs are experimentally verified on a Xilinx Virtex 4 FPGA with logic utilization less than 1.25%, throughput up to 5.25 Gbits/s and up to 512 distinct output streams with low cross-correlation.
Energy Technology Data Exchange (ETDEWEB)
Dinamarca, Robinson [Department of Physical Chemistry, Faculty of Chemical Sciences, University of Concepción, Concepción (Chile); Garcia, Ximena; Jimenez, Romel [Department of Chemical Engineering, Faculty of Engineering, University of Concepción, Concepción (Chile); Fierro, J.L.G. [Instituto de Catálisis y Petroleoquímica, CSIC, Cantoblanco, 28049 Madrid (Spain); Pecchi, Gina, E-mail: gpecchi@udec.cl [Department of Physical Chemistry, Faculty of Chemical Sciences, University of Concepción, Concepción (Chile)
2016-09-15
Highlights: • A-site defective perovskites increases the oxidation state of the B-cation. • Not always non-stoichiometric perovskites exhibit higher catalytic activity in soot combustion. • The highly symmetric cubic crystalline structure diminishes the redox properties of perovskites. - Abstract: The influence of lanthanum stoichiometry in Ag-doped (La{sub 1-x}Ag{sub x}Mn{sub 0.9}Co{sub 0.1}O{sub 3}) and A-site deficient (La{sub 1-x}Mn{sub 0.9}Co{sub 0.1}O{sub 3-δ}) perovskites with x equal to 10, 20 and 30 at.% has been investigated in catalysts for soot combustion. The catalysts were prepared by the amorphous citrate method and characterized by XRD, nitrogen adsorption, XPS, O{sub 2}-TPD and TPR. The formation of a rhombohedral excess-oxygen perovskite for Ag-doped and a cubic perovskite structure for an A-site deficient series is confirmed. The efficient catalytic performance of the larger Ag-doped perovskite structure is attributed to the rhombohedral crystalline structure, Ag{sub 2}O segregated phases and the redox pair Mn{sup 4+}/Mn{sup 3+}. A poor catalytic activity for soot combustion was observed with A-site deficient perovskites, despite the increase in the redox pair Mn{sup 4+}/Mn{sup 3+}, which is attributed to the cubic crystalline structure.
Elkind, Elina, 1982-
2009-01-01
Riigikohtu lahendist 3-1-1-36-09: Nikolai Galkovski kaitsja vandeadvokaat Anatoli Jaroslavski, Andrei Grišini kaitsja vandeadvokaat Leonid Olovjanišnikovi, Aleksandr Semjonovi kaitsja vandeadvokaat Oleg Nišajevi ja Dmitri Štšerbakovi kaitsja vandeadvokaat Toomas Alpi kassatsioonid Tallinna Ringkonnakohtu 24. novembri 2008. a kohtuotsuse peale kriminaalasjas Andrei Grišini süüdistuses KarS § 114 p-de 2, 3 ja 5 ja § 22 lg-te 2 ja 3, Dmitri Štšerbakovi süüdistuses KarS § 114 p-de 2, 3 ja 5, Aleksandr Semjonovi süüdistuses KarS § 114 p-de 2, 3 ja 5 ning Nikolai Galkovski süüdistuses KarS § 257, § 114 p-de 2, 3 ja 5 ja § 22 lg 3 järgi
Directory of Open Access Journals (Sweden)
Rebecca Stonawski
2013-08-01
Full Text Available This paper will examine the US government’s proposed changes to the H-1B visa, a dual-intent visa meant to bring highly-skilled individuals to the US labor market. It will first explain what the H-1B visa is and is not and what might happen to the H-1B visa in the future. The focus of the paper, however, will be on how the H-1B visa program is failing. The thesis of this article is that reform to the H-1B visa may be very good for the US employer and the US economy. However, the proposed legislation keeps a number of disadvantageous features for H-1B holders intact, rather than addressing them.
Dynamic Virtual Credit Card Numbers
Molloy, Ian; Li, Jiangtao; Li, Ninghui
Theft of stored credit card information is an increasing threat to e-commerce. We propose a dynamic virtual credit card number scheme that reduces the damage caused by stolen credit card numbers. A user can use an existing credit card account to generate multiple virtual credit card numbers that are either usable for a single transaction or are tied with a particular merchant. We call the scheme dynamic because the virtual credit card numbers can be generated without online contact with the credit card issuers. These numbers can be processed without changing any of the infrastructure currently in place; the only changes will be at the end points, namely, the card users and the card issuers. We analyze the security requirements for dynamic virtual credit card numbers, discuss the design space, propose a scheme using HMAC, and prove its security under the assumption the underlying function is a PRF.
Oxygen Exchange and Transport in (La0.6Sr0.4)0.98FeO3-d – Ce0.9Gd0.1O1.95 Dual-Phase Composites
DEFF Research Database (Denmark)
Ovtar, Simona; Søgaard, Martin; Norrman, Kion
2018-01-01
The chemical diffusion coefficient and the effective surface exchange coefficient (kex) of dual-phase (La0.6Sr0.4)0.98FeO3-d (LSF) − Ce0.9Gd0.1O1.95 (CGO) composites containing between 30 and 70 vol.% of CGO were determined by electrical conductivity relaxation (ECR) at high oxygen partial...... pressures (10−3 .../s for a 70 vol.% of CGO in the composite at 750°C for a pO2 change from 0.2 to 1.0 atm. The experiments demonstrate that the kex is enhanced due to a synergistic effect between the two phases, and suggest a direct involvement of CGO phase in the oxygen surface exchange reaction. Possible mechanisms...
Study of the Polarization Behavior of Ce0.9Gd0.1O2-δ Single Crystals below 350°C to Room Temperature
DEFF Research Database (Denmark)
Neuhaus, K.; Bernemann, M.; Hansen, Karin Vels
2016-01-01
was investigated by mapping the introduced defect gradient and its decay with time using Kelvin probe force microscopy. The generated surface potential gradients were found to have a diameter of up to 1 μm, which is explained by the local ionization of defect associates by the applied high electric field......Single crystalline ceria samples with the composition Ce0.9Gd0.1O2-δ were pre-polarized with ±5 V for up to 300 s using a Pt coated AFM tip as working electrode. The direct contact zone had a diameter of potential of the samples....... Measurements were performed at room temperature and 50°C. The polarization behavior of the Ce0.9Gd0.1O2-δ single crystals was compared to cyclovoltammetry and polarization-relaxation experiments at T ≤ 350°C and in dry air or nitrogen which were performed using a specially suited AFM (Controlled Atmosphere...
International Nuclear Information System (INIS)
Bishop, D.J.; Gammel, P.L.; Murray, C.A.; Mitzi, D.B.; Kapitulnik, A.
1991-01-01
We report observation of hexatic order in Abrikosov flus lattices in very clean crystals of the high-Tc superconductor Bi 2.1 Sr 1.9 Ca 0.9 Cu 2 O 8+δ (BSCCO). Our experiments consist of in situ magnetic decoration of the flux lattice at 4.2 K. Analysis of the decoration images shows that the positional order decays exponentially with a correlation length of a few lattice constants while the orientational order persists for hundreds of lattice constants and decays algebraically with an exponent η 6 =0.6±0.01. Our results confirm recent theoretical speculation that the positional order should be far more sensitive to disorder than the orientational order and that the low-temperature ordered phase of the flux lines in these systems might be an hexatic glass. (orig.)
International Nuclear Information System (INIS)
Bishop, D.J.; Gammel, P.L.; Murray, C.A.; Mitzi, D.B.; Kapitulnik, A.
1990-01-01
We report observation of hexatic order in Abrikosov flux lattices in very clean crystals of the high T c superconductor Bi 2.1 Sr 1.9 Ca 0.9 Cu 2 O 8+δ (BSCCO). Our experiments consist of in situ magnetic decoration of the flux lattice at 4.2 K. Analysis of the decoration images shows that the positional order decays exponentially with a correlation length of a few lattice constants while the orientational order persists for hundreds of lattice constants and decays algebraically with an exponent η 6 =0.06±0.01. Our results confirm recent theoretical speculation that the positional order should be far more sensitive to disorder than the orientational order and that the low temperature ordered phase of the flux lines in these systems might be an hexatic glass
International Nuclear Information System (INIS)
Murray, C.A.; Gammel, P.L.; Bishop, D.J.; Mitzi, D.B.; Kapitulnik, A.
1990-01-01
We report observation of hexatic order in Abrikosov flux lattices in very clean crystals of the high-T c superconductor Bi 2.1 Sr 1.9 Ca 0.9 Cu 2 O 8+δ . Our experiments consist of in situ magnetic decoration of the flux lattice at 4.2 K. Analysis of the decoration images shows that the positional order decays exponentially with a correlation length of a few lattice constants while the orientational order persists for hundreds of lattice constants and decays algebraically with an exponent η 6 =0.06±0.01. Our results confirm recent theoretical speculation that the positional order should be far more sensitive to disorder than the orientational order and that the low-temperature ordered phase of the flux lines in these systems might be a hexatic glass
Murray, C. A.; Gammel, P. L.; Bishop, D. J.; Mitzi, D. B.; Kapitulnik, A.
1990-05-01
Hexatic order is observed in Abrikosov flux lattices in very clean crystals of the high-Tc superconductor Bi(2.1)Sr(1.9)Ca(0.9)Cu2O(8 + delta) by in situ magnetic decoration of the flux lattice at 4.2 K. Analysis of the decoration images shows that the positional order decays exponentially with a correlation length of a few lattice constants, while the orientational order persists for hundreds of lattice constants and decays algebraically with an exponent eta6 = 0.06 + or - 0.01. These results confirm recent theoretical speculation that the positional order should be far more sensitive to disorder than the orientational order, and that the low-temperature ordered phase of the flux lines in these systems might be a hexatic glass.
Bishop, D. J.; Gammel, P. L.; Murray, C. A.; Mitzi, D. B.; Kapitulnik, A.
1991-02-01
We report observation of hexatic order in Abrikosov flux lattices in very clean crystals of the high- Tc superconductor Bi 2.1Sr 1.9Ca 0.9Cu 2O 8+δ (BSCCO). Our experiments consist of in situ magnetic decoration of the flux lattice at 4.2 K. Analysis of the decoration images shows that the positional order decays exponentially with a correlation length of a few lattice constants while the orientational order persists for hundreds of lattice constants and decays algebraically with an exponent η 6 = 0.6 ± 0.01. Our results confirm recent theoretical speculation that the positional order should be far more sensitive to disorder than the orientational order and that the low-temperature ordered phase of the flux lines in these systems might be an hexatic glass.
Bishop, D. J.; Gammel, P. L.; Murray, C. A.; Mitzi, D. B.; Kapitulnik, A.
1990-10-01
We report observation of hexatic order in Abrikosov flux lattices in very clean crystals of the high Tc superconductor Bi2.1Sr1.9Ca0.9Cu2O8+δ (BSCCO). Our experiments consist of in situ magnetic decoration of the flux lattice at 4.2 K. Analysis of the decoration images shows that the positional order decays exponentially with a correlation length of a few lattice constants while the orientational order persists for hundreds of lattice constants and decays algebraically with an exponent η6=0.06±0.01. Our results confirm recent theoretical speculation that the positional order should be far more sensitive to disorder than the orientational order and that the low temperature ordered phase of the flux lines in these systems might be an hexatic glass.
Characterization of the perovskite La0,9Sr0,1Ga0,2O2,85 prepared by cation complexation
International Nuclear Information System (INIS)
Reis, S.L.; Grosso, R.L.; Muccillo, E.N.S.
2012-01-01
Strontium and magnesium doped lanthanum gallate exhibits perovskite-type structure and high ionic conductivity. Other features of this ceramic material are large electrolytic regime and negligible electronic conductivity. These characteristics are responsible for the potential use of this solid electrolyte in solid oxide fuel cells operating at intermediate temperatures (~∼500-700 deg C). In this work, the composition La 0.9 Sr 0.1 Ga 0.8 Mg 0.2 O 2.85 was prepared by the cation complexation technique aiming to obtain powder and sintered specimens with good chemical and structural homogeneities. X-ray diffraction results evidence that single phase was obtained, within the limitations of the technique, in samples sintered at 1350 deg C/4 h, with relative density above 92%. (author)
W.T. Hendriksen (Wouter); N. Silva (Nuno); H.J. Bootsma (Hester); C.E. Blue (Clare); G.K. Paterson (Gavin); A.R. Kerr (Alison); A.S. de Jong (Arjan); O.P. Kuipers (Oscar); P.W.M. Hermans (Peter); T.J. Mitchell
2007-01-01
textabstractRecent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we
Hendriksen, Wouter T.; Silva, Nuno; Bootsma, Hester J.; Blue, Clare E.; Paterson, Gavin K.; Kerr, Alison R.; de Jong, Anne; Kuipers, Oscar P.; Hermans, Peter W. M.; Mitchell, Tim J.
Recent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we found that
Contract W911NF-09-1-0384 (Purdue University)
2012-10-27
spin system, Physical Review A , (02 2010): 22324. doi: 10.1103/PhysRevA.81.022324 08/31/2011 8.00 Sabre Kais, Anmer Daskin . Group leaders... a collection of information if it does not display a currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. a ...billions ) and developed new quantum algorithms to solve complex chemistry problems such as global optimization and excited states of molecules. ( a ) Papers
76 FR 16813 - Proposed Information Collection; OMB Control Number 1024-0038
2011-03-25
... 1993 Government Performance and Results Act, as amended. This request for OMB approval includes local... Report'' that includes the Cumulative Products Table (which compares actual to proposed performance), a.... This set of information collections has an impact on State, tribal, and local governments that wish to...
Energy Technology Data Exchange (ETDEWEB)
Chiu, J; Braunstein, S; McDermott, M; Sneed, P; Ma, L [University of California San Francisco, San Francisco, CA (United States); Pierce, M [Indiana University, Bloomington, IN (United States)
2016-06-15
Purpose: Sharp dose fall-off is the hallmark of brain radiosurgery to deliver a high dose of radiation to the target while minimizing dose to normal brain tissue. In this study, we developed a technique for the purpose of enhancing the peripheral dose gradient by magnifying the total number of beams focused toward each isocenter via patient head tilt and simultaneous beam intensity modulations. Methods: Computer scripting for the proposed beam number enhancement (BNE) technique was developed. The technique was tested and then implemented on a clinical treatment planning system for a dedicated brain radiosurgical system (GK Perfexion, Elekta Oncology). To study technical feasibility and dosimetric advantages of the technique, we compared treatment planning quality and delivery efficiency for 20 radiosurgical cases previously treated at our institution. These cases included relatively complex treatments such as acoustic schwannoma, meningioma, brain metastasis and mesial temporal lobe epilepsy. Results: The BNE treatment plans were found to produce nearly identical target volume coverage (absolute value < 0.5%, P > 0.2) and dose conformity (BNE CI= 1.41±0.15 versus 1.41±0.20, P>0.9) as the original treatment plans. The total beam-on time for theBNE treatment plans were comparable (within 1.0 min or 1.8%) with those of the original treatment plans for all the cases. However, BNE treatment plans significantly improved the mean gradient index (BNE GI = 2.9±0.3 versus original GI =3.0±0.3 p<0.0001) and low-level isodose volumes, e.g. 20-50% prescribed isodose volumes, by 2.0% to 5.0% (p<0.02). Furthermore, with 4 to 5-fold increase in the total number of beams, the GI decreased by as much as 20% or 0.5 in absolute values. Conclusion: BNE via head tilt and simultaneous beam intensity modulation is an effective and efficient technique that physically sharpens the peripheral dose gradient for brain radiosurgery.
Zhu, Liang; Liu, Yu; Su, Chao; Zhou, Wei; Liu, Meilin; Shao, Zongping
2016-08-08
We have synthesized and characterized perovskite-type SrCo0.9 Nb0.1 O3-δ (SCN) as a novel anion-intercalated electrode material for supercapacitors in an aqueous KOH electrolyte, demonstrating a very high volumetric capacitance of about 2034.6 F cm(-3) (and gravimetric capacitance of ca. 773.6 F g(-1) ) at a current density of 0.5 A g(-1) while maintaining excellent cycling stability with a capacity retention of 95.7 % after 3000 cycles. When coupled with an activated carbon (AC) electrode, the SCN/AC asymmetric supercapacitor delivered a specific energy density as high as 37.6 Wh kg(-1) with robust long-term stability. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Motzkin numbers out of Random Domino Automaton
Energy Technology Data Exchange (ETDEWEB)
Białecki, Mariusz, E-mail: bialecki@igf.edu.pl [Institute of Geophysics, Polish Academy of Sciences, ul. Ks. Janusza 64, 01-452 Warszawa (Poland)
2012-10-01
Motzkin numbers are derived from a special case of Random Domino Automaton – recently proposed a slowly driven system being a stochastic toy model of earthquakes. It is also a generalisation of 1D Drossel–Schwabl forest-fire model. A solution of the set of equations describing stationary state of Random Domino Automaton in inverse-power case is presented. A link with Motzkin numbers allows to present explicit form of asymptotic behaviour of the automaton. -- Highlights: ► Motzkin numbers are derived from stochastic cellular automaton with avalanches. ► Explicit solution of toy model of earthquakes is presented. ► Case with inverse-power distribution of avalanches is found.
International Nuclear Information System (INIS)
Dirksen, Martijn S.; Lamb, Hildo J.; Geest, Rob van der; Roos, Albert de
2003-01-01
A method is proposed for the quantitative assessment of coronary magnetic resonance angiography (MRA) acquisitions. The method is based on four parameters: signal-to-noise ratio (SNR); contrast-to-noise ratio (CNR); vessel length; and vessel-edge definition. A pig model (n=7) was used to illustrate the proposed quantitative analysis method. Three-dimensional gradient-echo coronary MRA was performed with and without exogenous contrast enhancement using a gadolinium-based blood-pool contrast agent (Vistarem, Guerbet, Aulnay-Sous-Bois, France). The acquired images could be well differentiated based on the four parameters. The SNR was calculated as 9.0±1.4 vs 10.4±2.1, the CNR as 6.2±0.8 vs 8.2±0.9, the vessel length as 48.2±11.6 vs 86.5±13.8 mm, and the vessel-edge definition as 4.9±1.5 vs 7.7±3.4. Different coronary MRA techniques can be evaluated objectively with the combined use of SNR, CNR, vessel length, and vessel-edge parameters. (orig.)
Wayne and Washtenaw Counties 1.0 PPSM LiDAR
National Oceanic and Atmospheric Administration, Department of Commerce — TASK NAME: Wayne and Washtenaw Counties 1.0 PPSM LiDAR LiDAR Data Acquisition and Processing Production Task USGS CONTRACT: 07CRCN0006 TASK ORDER NUMBER: G09PD00300...
SULT1A1 copy number variation: ethnic distribution analysis in an Indian population.
Almal, Suhani; Padh, Harish
2017-11-01
Cytosolic sulfotransferases (SULTs) are phase II detoxification enzymes involved in metabolism of numerous xenobiotics, drugs and endogenous compounds. Interindividual variation in sulfonation capacity is important for determining an individual's response to xenobiotics. SNPs in SULTs, mainly SULT1A1 have been associated with cancer risk and also with response to therapeutic agents. Copy number variation (CNVs) in SULT1A1 is found to be correlated with altered enzyme activity. This short report primarily focuses on CNV in SULT1A1 and its distribution among different ethnic populations around the globe. Frequency distribution of SULT1A1 copy number (CN) in 157 healthy Indian individuals was assessed using florescent-based quantitative PCR assay. A range of 1 to >4 copies, with a frequency of SULT1A1 CN =2 (64.9%) the highest, was observed in our (Indian) population. Upon comparative analysis of frequency distribution of SULT1A1 CN among diverse population groups, a statistically significant difference was observed between Indians (our data) and African-American (AA) (p = 0.0001) and South African (Tswana) (p populations. Distribution of CNV in the Indian population was found to be similar to that in European-derived populations of American and Japanese. CNV of SULT1A1 varies significantly among world populations and may be one of the determinants of health and diseases.
Bacillus velezensis CC09: A Potential 'Vaccine' for Controlling Wheat Diseases.
Kang, Xingxing; Zhang, Wanling; Cai, Xunchao; Zhu, Tong; Xue, Yarong; Liu, Changhong
2018-04-11
Biocontrol bacteria that can act like a "vaccine", stimulating plant resistance to pathogenic diseases, are still not fully elucidated. In this study, an endophytic bacterium, Bacillus velezensis CC09, labeled with green fluorescent protein, was tested for its colonization, migration, and expression of genes encoding iturin A synthetase within wheat tissues and organs as well as for protective effects against wheat take-all and spot blotch diseases. The results showed that strain CC09 not only formed biofilm on the root surface but was also widely distributed in almost every tissue, including the epidermis, cortex, and xylem vessels, and even migrated to stems and leaves, resulting in 66.67% disease-control efficacy (DCE) of take-all and 21.64% DCE of spot blotch. Moreover, the gene cluster encoding iturin A synthase under the control of the p itu promoter is expressed in B. velezensis CC09 in wheat tissues, which indicates that iturin A might contribute to the in-vivo antifungal activity and leads to the disease control. All these data suggested that strain CC09 can act like a 'vaccine' in the control of wheat diseases, with a single treatment inoculated on roots through multiple mechanisms.
Aespoe Hard Rock Laboratory. BIPS logging in borehole KAS09
Energy Technology Data Exchange (ETDEWEB)
Gustafsson, Jaana; Gustafsson, Christer (Malaa Geoscience AB (Sweden))
2010-01-15
This report includes the data gained in BIPS logging performed at the Aespoe Hard Rock Laboratory. The logging operation presented here includes BIPS logging in the core drilled borehole KAS09. The objective for the BIPS logging was to observe the condition of KAS09 in order to restore the borehole in the hydrogeological monitoring programme.All measurements were conducted by Malaa Geoscience AB on October 9th 2009. The objective of the BIPS logging is to achieve information of the borehole including occurrence of rock types as well as determination of fracture distribution and orientation. This report describes the equipment used as well as the measurement procedures and data gained. For the BIPS survey, the result is presented as images. The basic conditions of the BIPS logging for geological mapping and orientation of structures are satisfying for borehole KAS09, although induced affects from the drilling on the borehole walls limit the visibility
Aespoe Hard Rock Laboratory. BIPS logging in borehole KAS09
International Nuclear Information System (INIS)
Gustafsson, Jaana; Gustafsson, Christer
2010-01-01
This report includes the data gained in BIPS logging performed at the Aespoe Hard Rock Laboratory. The logging operation presented here includes BIPS logging in the core drilled borehole KAS09. The objective for the BIPS logging was to observe the condition of KAS09 in order to restore the borehole in the hydrogeological monitoring programme.All measurements were conducted by Malaa Geoscience AB on October 9th 2009. The objective of the BIPS logging is to achieve information of the borehole including occurrence of rock types as well as determination of fracture distribution and orientation. This report describes the equipment used as well as the measurement procedures and data gained. For the BIPS survey, the result is presented as images. The basic conditions of the BIPS logging for geological mapping and orientation of structures are satisfying for borehole KAS09, although induced affects from the drilling on the borehole walls limit the visibility
LENUS (Irish Health Repository)
Valenciano, Marta
2015-06-04
In the first five I-MOVE (Influenza Monitoring Vaccine Effectiveness in Europe) influenza seasons vaccine effectiveness (VE) results were relatively homogenous among participating study sites. In 2013-2014, we undertook a multicentre case-control study based on sentinel practitioner surveillance networks in six European Union (EU) countries to measure 2013-2014 influenza VE against medically-attended influenza-like illness (ILI) laboratory-confirmed as influenza. Influenza A(H3N2) and A(H1N1)pdm09 viruses co-circulated during the season.
A Variable Turbulent Schmidt Number Formulation for Scramjet Application
Xiao, X.; Edwards, J. R.; Hassan, H. A.; Cutler, A. D.
2004-01-01
In high speed engines, thorough turbulent mixing of fuel and air is required to obtain high performance and high efficiency. Thus, the ability to predict turbulent mixing is crucial in obtaining accurate numerical simulation of an engine and its performance. Current state of the art in CFD simulation is to assume both turbulent Prandtl number and Schmidt numbers to be constants. However, since the mixing of fuel and air is inversely proportional to the Schmidt number, a value of 0.45 for the Schmidt number will produce twice as much diffusion as that with a value of 0.9. Because of this, current CFD tools and models have not been able to provide the needed guidance required for the efficient design of a scramjet engine. The goal of this investigation is to develop the framework needed to calculate turbulent Prandtl and Schmidt numbers as part of the solution. This requires four additional equations: two for the temperature variance and its dissipation rate and two for the concentration variance and its dissipation rate. In the current investigation emphasis will be placed on studying mixing without reactions. For such flows, variable Prandtl number does not play a major role in determining the flow. This, however, will have to be addressed when combustion is present. The approach to be used is similar to that used to develop the k-zeta model. In this approach, relevant equations are derived from the exact Navier-Stokes equations and each individual correlation is modeled. This ensures that relevant physics is incorporated into the model equations. This task has been accomplished. The final set of equations have no wall or damping functions. Moreover, they are tensorially consistent and Galilean invariant. The derivation of the model equations is rather lengthy and thus will not be incorporated into this abstract, but will be included in the final paper. As a preliminary to formulating the proposed model, the original k-zeta model with constant turbulent Prandtl and
Performance of different metrics proposed to CIE TC 1-91
Directory of Open Access Journals (Sweden)
Pramod Bhusal
2017-12-01
Full Text Available The main aim of the article is to find out the performance of different metrics proposed to CIE TC 1-91. Currently, six different indexes have been proposed to CIE TC 1-91: Colour Quality Scale (CQS, Feeling of Contrast Index (FCI, Memory colour rendering index (MCRI, Preference of skin (PS, Relative gamut area index (RGAI and Illuminating Engineering society Method for evaluating light source colour rendition (IES TM-30. The evaluation and analysis are based on previously conducted experiment in lighting booth. The analysis showed the area based metric FCI was good subjective preference indicator. The subjective preference was measured in terms of naturalness of objects, colourfulness of colour checker chart, and the visual appearance of the lit scene in the booth.
International Nuclear Information System (INIS)
Farag, A.A.M.; Abdel Rafea, M.; Roushdy, N.; El-Shazly, O.; El-Wahidy, E.F.
2015-01-01
Highlights: • Highly uniform and good adhesion of nanocrystalline Zn 1−x Cd x S films were synthesized. • Small magnitude of optical electronegativity was calculated. • Third-order nonlinear optical susceptibility and molar polarizability were considered. - Abstract: Low cost dip coating technique was successfully used to deposit highly uniform and good adhesive nanocrystalline Zn 1−x Cd x S (0 ⩽ x ⩽ 0.9) thin films. The surface morphology and crystalline structural characteristics of Zn 1−x Cd x S were achieved by using atomic force microscopy (AFM) and transmission electron microscopy (TEM), respectively. Transmission spectra show red shifting of absorption edge as the Cd content increased. The optical constants were accurately determined by using reflectance and transmittance spectra. The effect of Cd-content on refractive index, extinction index and other optical dispersion parameters were also investigated. The dispersion of the refractive index was discussed in terms of single oscillator model. In addition, the ratio of free carrier concentration to its effective mass was estimated. The calculated value of oscillator energy E o obeys the empirical relation (E o ≈ 2 E g ), obtained from single oscillator model. Small magnitude of optical electronegativity (χ ∗ ) for Zn 1−x Cd x S (0 ⩽ x ⩽ 0.9) thin films and relatively high refractive index can be attributed to covalent nature, in agreement with β value, obtained from dispersion energy analysis. Moreover, molar polarizability and third-order nonlinear optical susceptibility were also considered
Modular Transformations, Order-Chaos Transitions and Pseudo-Random Number Generation
Bonelli, Antonio; Ruffo, Stefano
Successive pairs of pseudo-random numbers generated by standard linear congruential transformations display ordered patterns of parallel lines. We study the "ordered" and "chaotic" distribution of such pairs by solving the eigenvalue problem for two-dimensional modular transformations over integers. We conjecture that the optimal uniformity for pair distribution is obtained when the slope of linear modular eigenspaces takes the value n opt =maxint (p/√ {p-1}), where p is a prime number. We then propose a new generator of pairs of independent pseudo-random numbers, which realizes an optimal uniform distribution (in the "statistical" sense) of points on the unit square (0, 1] × (0, 1]. The method can be easily generalized to the generation of k-tuples of random numbers (with k>2).
Annual North Dakota Elevator Marketing Report, 2008-09
2009-12-01
The Annual North Dakota Elevator Marketing Report for 2008-09 was prepared by Kimberly Vachal and Laurel Benson, : Upper Great Plains Transportation Institute. The authors gratefully acknowledge the assistance of the North Dakota : Grain Dealers Asso...
He, Jie; Figueroa, Deborah A; Lim, Tze-Peng; Chow, Diana S; Tam, Vincent H
2010-07-15
The stability of polymyxin B sulfate in infusion bags containing 0.9% sodium chloride injection stored at 4 and 25 degrees C was studied. Seven manufacturing batches of polymyxin B from different sources were tested. The products were reconstituted in sterile water for injection, diluted in infusion bags containing 0.9% sodium chloride injection, and stored at room temperature (25 degrees C) or under refrigeration (4 degrees C). Samples were withdrawn at the same time on days 0, 1, 2, 3, 5, and 7. A modified microbiological assay was used to determine the concentrations, as indicated by zones of inhibition, of polymyxin B. Bordetella bronchiseptica served as the reference organism. Stability was defined as retention of >90% of the initial concentration. The decomposition kinetics of polymyxin B in 0.9% sodium chloride injection were evaluated by plotting the polymyxin B concentration remaining versus time. On average, the samples retained over 90% of their initial concentration for up to two days at both storage temperatures. All samples retained over 90% of their initial concentration at 24 hours. The decomposition kinetics of polymyxin B in infusion bags containing 0.9% sodium chloride injection exhibited pseudo-first-order kinetics, with rate constants of 0.024-0.075 day(-1) at 25 degrees C and 0.022-0.043 day(-1) at 4 degrees C (p > 0.05). Polymyxin B was stable for at least one day when stored at 4 or 25 degrees C in infusion bags containing 0.9% sodium chloride injection. Stability did not differ significantly between the two storage temperatures.
Profile of yttrium segregation in BaCe0,9Y0,1O3-δ as function of sintering temperature
International Nuclear Information System (INIS)
Hosken, C.M.; Souza, D.P.F. de
2010-01-01
Researches on solid oxide fuel cells indicate barium cerate perovskite as a very attractive material for using as electrolyte due to its high protonic conductivity. The objective of this work is investigate the yttrium segregation during sintering of BaCe 0,9 Y 0,1 O 3-δ doped with Zn O as a sintering aid. The powders were prepared by citrate process. Powders were isostatic pressed into pellets and sintered in air at 1200, 1275, 1325 and 1400 deg C. The samples were characterized by scanning electron microscopy, X-ray diffraction and impedance spectroscopy. Secondary phase containing Yttrium and Cerium was detected as sintering temperature increased. Increase of the lattice parameter and activation energy for electrical conductivity were also detected on samples sintered at 1400 deg C. (author)
Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number.
Price, Ric N; Uhlemann, Anne-Catrin; Brockman, Alan; McGready, Rose; Ashley, Elizabeth; Phaipun, Lucy; Patel, Rina; Laing, Kenneth; Looareesuwan, Sornchai; White, Nicholas J; Nosten, François; Krishna, Sanjeev
The borders of Thailand harbour the world's most multidrug resistant Plasmodium falciparum parasites. In 1984 mefloquine was introduced as treatment for uncomplicated falciparum malaria, but substantial resistance developed within 6 years. A combination of artesunate with mefloquine now cures more than 95% of acute infections. For both treatment regimens, the underlying mechanisms of resistance are not known. The relation between polymorphisms in the P falciparum multidrug resistant gene 1 (pfmdr1) and the in-vitro and in-vivo responses to mefloquine were assessed in 618 samples from patients with falciparum malaria studied prospectively over 12 years. pfmdr1 copy number was assessed by a robust real-time PCR assay. Single nucleotide polymorphisms of pfmdr1, P falciparum chloroquine resistance transporter gene (pfcrt) and P falciparum Ca2+ ATPase gene (pfATP6) were assessed by PCR-restriction fragment length polymorphism. Increased copy number of pfmdr1 was the most important determinant of in-vitro and in-vivo resistance to mefloquine, and also to reduced artesunate sensitivity in vitro. In a Cox regression model with control for known confounders, increased pfmdr1 copy number was associated with an attributable hazard ratio (AHR) for treatment failure of 6.3 (95% CI 2.9-13.8, p<0.001) after mefloquine monotherapy and 5.4 (2.0-14.6, p=0.001) after artesunate-mefloquine therapy. Single nucleotide polymorphisms in pfmdr1 were associated with increased mefloquine susceptibility in vitro, but not in vivo. Amplification in pfmdr1 is the main cause of resistance to mefloquine in falciparum malaria. Multidrug resistant P falciparum malaria is common in southeast Asia, but difficult to identify and treat. Genes that encode parasite transport proteins maybe involved in export of drugs and so cause resistance. In this study we show that increase in copy number of pfmdr1, a gene encoding a parasite transport protein, is the best overall predictor of treatment failure with
75 FR 11632 - Proposed Collection; Comment Request for Notice 2001-1
2010-03-11
... comments concerning Notice 2001-1, Employer-designed Tip Reporting Program for the Food and Beverage... Reporting Program for the Food and Beverage Industry (EmTRAC). OMB Number: 1545-1716. Notice Number: Notice...
Energy Technology Data Exchange (ETDEWEB)
Gao, Ning; Quan, Chuye [Key Laboratory for Organic Electronics & Information Displays (KLOEID), Synergetic Innovation Center for Organic Electronics and Information Displays (SICOEID), Institute of Advanced Materials - IAM, School of Materials Science and Engineering - SMSE, Nanjing University of Posts and Telecommunications - NUPT, Nanjing 210023 (China); Ma, Yuhui [Key Laboratory for Organic Electronics & Information Displays (KLOEID), Synergetic Innovation Center for Organic Electronics and Information Displays (SICOEID), Institute of Advanced Materials - IAM, School of Materials Science and Engineering - SMSE, Nanjing University of Posts and Telecommunications - NUPT, Nanjing 210023 (China); School of Science, Nanjing University of Posts and Telecommunications (NUPT), Nanjing 210023 (China); Key Laboratory of Flexible Electronics (KLOFE) & Institute of Advanced Materials (IAM), National Synergistic Innovation Center for Advanced Materials - SICAM, Nanjing Tech University - Nanjing Tech, 30 South Puzhu Road, Nanjing 211816 (China); Han, Yumin; Wu, Zhenli [Key Laboratory for Organic Electronics & Information Displays (KLOEID), Synergetic Innovation Center for Organic Electronics and Information Displays (SICOEID), Institute of Advanced Materials - IAM, School of Materials Science and Engineering - SMSE, Nanjing University of Posts and Telecommunications - NUPT, Nanjing 210023 (China); Mao, Weiwei [Key Laboratory for Organic Electronics & Information Displays - KLOEID, Synergetic Innovation Center for Organic Electronics and Information Displays (SICOEID), Institute of Advanced Materials (IAM), School of Materials Science and Engineering - SMSE, Nanjing University of Posts and Telecommunications - NUPT, Nanjing 210023 (China); School of Science, Nanjing University of Posts and Telecommunications (NUPT), Nanjing 210023 (China); and others
2016-01-15
We propose first-principles methods to study the structure, electronic, optical and magnetic properties of BiFeO{sub 3} (BFO) and Bi{sub 0.9}Ca{sub 0.1}FeO{sub 3} (BCFO). The morphology, optical band gap as well as magnetic hysteresis also have been investigated using experimental methods. X-ray diffraction data shows that Bi-site doping with Ca could result in a transition of crystal structure (from single phase rhombohedral (R3c) to two phase coexistence). Changing of Fermi level and decreasing of band gap indicating that the Ca-doped BFO exhibit a typical half-metallic nature. The optical absorption properties are related to the electronic structure and play the key role in determining their band gaps, also we have analyzed the inter-band contribution to the theory of optical properties such as absorption spectra, dielectric constant, energy-loss spectrum, absorption coefficient, optical reflectivity, and refractive index of BCFO. Enhancement of magnetic properties after doping is proved by both experimental and calculated result, which can be explained by size effect and structural distortion.
Darton, Thomas C; Jones, Claire; Blohmke, Christoph J; Waddington, Claire S; Zhou, Liqing; Peters, Anna; Haworth, Kathryn; Sie, Rebecca; Green, Christopher A; Jeppesen, Catherine A; Moore, Maria; Thompson, Ben A V; John, Tessa; Kingsley, Robert A; Yu, Ly-Mee; Voysey, Merryn; Hindle, Zoe; Lockhart, Stephen; Sztein, Marcelo B; Dougan, Gordon; Angus, Brian; Levine, Myron M; Pollard, Andrew J
2016-08-01
Typhoid persists as a major cause of global morbidity. While several licensed vaccines to prevent typhoid are available, they are of only moderate efficacy and unsuitable for use in children less than two years of age. Development of new efficacious vaccines is complicated by the human host-restriction of Salmonella enterica serovar Typhi (S. Typhi) and lack of clear correlates of protection. In this study, we aimed to evaluate the protective efficacy of a single dose of the oral vaccine candidate, M01ZH09, in susceptible volunteers by direct typhoid challenge. We performed a randomised, double-blind, placebo-controlled trial in healthy adult participants at a single centre in Oxford (UK). Participants were allocated to receive one dose of double-blinded M01ZH09 or placebo or 3-doses of open-label Ty21a. Twenty-eight days after vaccination, participants were challenged with 104CFU S. Typhi Quailes strain. The efficacy of M01ZH09 compared with placebo (primary outcome) was assessed as the percentage of participants reaching pre-defined endpoints constituting typhoid diagnosis (fever and/or bacteraemia) during the 14 days after challenge. Ninety-nine participants were randomised to receive M01ZH09 (n = 33), placebo (n = 33) or 3-doses of Ty21a (n = 33). After challenge, typhoid was diagnosed in 18/31 (58.1% [95% CI 39.1 to 75.5]) M01ZH09, 20/30 (66.7% [47.2 to 87.2]) placebo, and 13/30 (43.3% [25.5 to 62.6]) Ty21a vaccine recipients. Vaccine efficacy (VE) for one dose of M01ZH09 was 13% [95% CI -29 to 41] and 35% [-5 to 60] for 3-doses of Ty21a. Retrospective multivariable analyses demonstrated that pre-existing anti-Vi antibody significantly reduced susceptibility to infection after challenge; a 1 log increase in anti-Vi IgG resulting in a 71% decrease in the hazard ratio of typhoid diagnosis ([95% CI 30 to 88%], p = 0.006) during the 14 day challenge period. Limitations to the study included the requirement to limit the challenge period prior to treatment to 2
Electromagnetic design of a β=0.9, 650 MHz elliptic superconducting radio frequency cavity
International Nuclear Information System (INIS)
Jana, Arup Ratan; Kumar, V.
2011-01-01
We have recently performed two-dimensional (2D) electromagnetic design studies of a β=0.9, 650 MHz, elliptic superconducting radio frequency (SCRF) cavity using electromagnetic field solver code SUPERFISH. We have evolved the design starting from the design parameters of β=1, 1300 MHz, TESLA design SCRF cavity and then scaled it for the β=0.9 and 650 MHz case. The design has been optimized for minimizing the SCRF cavity power loss. One of the important parameters in the design of such elliptic SCRF cavities is the wall angle, which is defined as the vertical angle made by the common tangent to the iris and equator ellipses. Generally, there is a constraint on the minimum value of the wall angle, which is decided by the mechanical considerations, ease of chemical cleaning etc. In our optimization studies, we have first explored the case when there is no such constraint on wall angle. We find that from the point of view of low cavity power dissipation, the optimized design has a re-entrant geometry, where the wall angle is negative. We then perform design optimization, keeping the constraint that the wall angle should be greater than 5 degree. Keeping this constraint, we find that our optimized design parameters for the single cell match closely with the design parameters reported for Project-X. We discuss the results of 2D electromagnetic field calculations for this design using SUPERFISH. In the next, we have performed the design studies of the multi-cell β=0.9, 650 MHz, elliptic SCRF cavity. The design parameters of end-cells are optimized such that the frequency of the end-cell is matched to that of mid-cells. We have studied all the normal modes for the multi-cell cavity. The frequency of different normal modes is also calculated using a finite element code ANSYS and results are compared with those obtained using SUPERFISH. The field flatness, which is an important design criterion, is also studied. For multi-cell cavity, another important aspect is the cell
Estimating the number of people in crowded scenes
Kim, Minjin; Kim, Wonjun; Kim, Changick
2011-01-01
This paper presents a method to estimate the number of people in crowded scenes without using explicit object segmentation or tracking. The proposed method consists of three steps as follows: (1) extracting space-time interest points using eigenvalues of the local spatio-temporal gradient matrix, (2) generating crowd regions based on space-time interest points, and (3) estimating the crowd density based on the multiple regression. In experimental results, the efficiency and robustness of our proposed method are demonstrated by using PETS 2009 dataset.
2012-08-22
... DEPARTMENT OF JUSTICE Office of Justice Programs [OMB Number 1121-0021] Agency Information Collection Activities: Proposed Collection; Comments Requested: Accounting System and Financial Capability...: Accounting System and Financial Capability Questionnaire. (3) Agency form number 7120/1. Component Sponsoring...
Yingmin Zhu; Haijun Chen; Stephen Boulton; Fang Mei; Na Ye; Giuseppe Melacini; Jia Zhou; Xiaodong Cheng
2015-01-01
The cAMP signaling cascade is one of the most frequently targeted pathways for the development of pharmaceutics. A plethora of recent genetic and pharmacological studies suggest that exchange proteins directly activated by cAMP (EPACs) are implicated in multiple pathologies. Selective EPAC inhibitors have been recently developed. One specific inhibitor, ESI-09, has been shown to block EPAC activity and functions, as well as to recapitulate genetic phenotypes of EPAC knockout mice when applied...
Directory of Open Access Journals (Sweden)
Patrícia Prado Faria
2011-12-01
Full Text Available The fundamental role of knowledge creation is to serve as a reference for practitioners and for researchers. Therefore, the comprehension of the knowledge status referring to a certain subject, in a certain moment, is necessary for science evolution. This article is a bibliometric research, studying the state of art of the articles approved for publication in 2007-09 Enanpads in its Consumer Behaviour theme of interest in the Marketing Academic Division. The quantitative distribution of the articles was studied, along with the number of authors by article, the institutions that took part in the congresses considering their geographic region, their state and their capital origin, the frequency of the researchers´ participation, their affiliation, and methodological aspects of the articles. Among the various conclusions brought by this research, it was found that the referred theme remains important in the congress, that the government schools of southern and southeastern Brazil have a predominant presence, and that the quantitative approach remains dominant for researchersO papel fundamental da produção do conhecimento é o de servir de referência para praticantes e para estudiosos. Portanto, a compreensão do estado de conhecimento sobre determinado tema, em determinado momento, é necessária ao processo de evolução da ciência. Este artigo contribui com levantamento bibliométrico na área de Marketing, pesquisando o estado da arte dos trabalhos aprovados nos Enanpads do triênio 2007-09 na Divisão Acadêmica Marketing, especificamente no tema de interesse Comportamento do Consumidor. Foram avaliados a distribuição quantitativa dos trabalhos, o número de autores por trabalho, as instituições participantes dos eventos, suas representatividades estaduais, regionais e por origem do capital, a intensidade da participação dos pesquisadores por instituição de afiliação, e aspectos metodológicos dos artigos apresentados. Dentre as
Würschum, Tobias; Boeven, Philipp H G; Langer, Simon M; Longin, C Friedrich H; Leiser, Willmar L
2015-07-29
Copy number variation was found to be a frequent type of DNA polymorphism in the human genome often associated with diseases but its importance in crops and the effects on agronomic traits are still largely unknown. Here, we employed a large worldwide panel of 1110 winter wheat varieties to assess the frequency and the geographic distribution of copy number variants at the Photoperiod-B1 (Ppd-B1) and the Vernalization-A1 (Vrn-A1) loci as well as their effects on flowering time under field conditions. We identified a novel four copy variant of Vrn-A1 and based on the phylogenetic relationships among the lines show that the higher copy variants at both loci are likely to have arisen independently multiple times. In addition, we found that the frequency of the different copy number variants at both loci reflects the environmental conditions in the varieties' region of origin and based on multi-location field trials show that Ppd-B1 copy number has a substantial effect on the fine-tuning of flowering time. In conclusion, our results show the importance of copy number variation at Ppd-B1 and Vrn-A1 for the global adaptation of wheat making it a key factor for wheat success in a broad range of environments and in a wider context substantiate the significant role of copy number variation in crops.
Determination of transference numbers in ionic conductors by the EMF method with active load
International Nuclear Information System (INIS)
Gorelov, V.P.
1988-01-01
Method for determining transference numbers in ionic conductors by means of measuring EMF of concentration cell with accout of polarization resistance of electrodes is suggested. The method enables to determine easily very small transference numbers of electron component against the background of predominating ionic conductivity. To illustrate the method there were determined transference numbers for the sample of industrial solid electrolyte in the cell; O 2 Pt|0.91ZrO 2 +0.09Y 2 O 3 |Pt, air
76 FR 63291 - Combined Notice Of Filings #1
2011-10-12
... filing per 35: MBR Tariff to be effective 9/23/2011. Filed Date: 09/23/2011. Accession Number: 20110923.... submits tariff filing per 35: MBR Tariff to be effective 9/23/2011. Filed Date: 09/23/2011. Accession.... submits tariff filing per 35: MBR Tariff to be effective 9/23/2011. Filed Date: 09/23/2011. Accession...
International Nuclear Information System (INIS)
1995-03-01
The United States Department of Energy and United States Department of State are jointly proposing to adopt a policy to manage spent nuclear fuel from foreign research reactors. Only spent nuclear fuel containing uranium enriched in the United States would be covered by the proposed policy. The purpose of the proposed policy is to promote U.S. nuclear weapons nonproliferation policy objectives, specifically by seeking to reduce highly-enriched uranium from civilian commerce. Environmental effects and policy considerations of three Management Alternative approaches for implementation of the proposed policy are assessed. The three Management Alternatives analyzed are: (1) acceptance and management of the spent nuclear fuel by the Department of Energy in the United States, (2) management of the spent nuclear fuel at one or more foreign facilities (under conditions that satisfy United States nuclear weapons nonproliferation policy objectives), and (3) a combination of components of Management Alternatives 1 and 2 (Hybrid Alternative). A No Action Alternative is also analyzed. For each Management Alternative, there are a number of alternatives for its implementation. For Management Alternative 1, this document addresses the environmental effects of various implementation alternatives such as varied policy durations, management of various quantities of spent nuclear fuel, and differing financing arrangements. Environmental impacts at various potential ports of entry, along truck and rail transportation routes, at candidate management sites, and for alternate storage technologies are also examined. For Management Alternative 2, this document addresses two subalternatives: (1) assisting foreign nations with storage; and (2) assisting foreign nations with reprocessing of the spent nuclear fuel. Management Alternative 3 analyzes a hybrid alternative. This document is Vol. 1 of 2 plus summary volume
17 CFR 8.09 - Review of investigation report.
2010-04-01
... PROCEDURES FOR DISCIPLINARY, SUMMARY, AND MEMBERSHIP DENIAL ACTIONS Disciplinary Procedure § 8.09 Review of investigation report. The disciplinary committee shall promptly review each investigation report. In the event the disciplinary committee determines that additional investigation or evidence is needed, it shall...
Vegetable oil and fat viscosity forecast models based on iodine number and saponification number
International Nuclear Information System (INIS)
Toscano, G.; Riva, G.; Foppa Pedretti, E.; Duca, D.
2012-01-01
Vegetable oil and fats can be considered as an important renewable source for the energy production. There are many applications where these biofuels are used directly in engines. However, the use of pure vegetable oils causes some problems as consequence of its chemical and physical characteristic. Viscosity is one of the most important parameters affecting several physical and mechanical processes of the operation of the engine. The determination of this parameter at different tis important to determine the behavior of the vegetable oil and fats. In this work we investigated the effects of two analytical chemical parameters (iodine number and saponification number) and forecasting models have been proposed. -- Highlights: ► Vegetable oil and fat viscosity is predicted by mathematical model based on saponification number and iodine number. ► Unsaturated vegetable oils with small size molecules of fatty acids have a lower viscosity values. ► The models proposed show an average error lower than 12%
NRC regulatory agenda: Semiannual report, January--June 1997. Volume 16, Number 1
International Nuclear Information System (INIS)
1997-08-01
The Regulatory Agenda is a semiannual compilation of all rules on which the NRC has recently completed action, or has proposed action, or is considering action, and of all petitions for rulemaking that the NRC has received that are pending disposition. The agenda consists of two sections that have been updated through June 30, 1997. Section 1, ''Rules,'' includes (A) rules on which final action has been taken since December 31, 1996, the closing date of the last NRC Regulatory Agenda; (B) rules published previously as proposed rules on which the Commission has not taken final action; (C) rules published as advance notices of proposed rulemaking for which neither a proposed nor final rule has been issued; and (D) unpublished rules on which the NRC expects to take action. Section 2, ''Petitions for Rulemaking,'' includes (A) petitions denied or incorporated into final rules since December 31, 1996; (B) petitions incorporated into proposed rules; and (C) petitions pending staff review
NRC regulatory agenda: Semiannual report, January--June 1995. Volume 14, Number 1
International Nuclear Information System (INIS)
1995-09-01
The Regulatory Agenda is a semiannual compilation of all rules on which the NRC has recently completed action, or has proposed action, or is considering action, and of all petitions for rulemaking that the NRC has received that are pending disposition. The agenda consists of two sections that have been updated through June 30, 1995. Section 1, ''Rules,'' includes (A) rules on which final action has been taken since December 30, 1994, the closing date of the last NRC Regulatory Agenda; (B) rules published previously as proposed rules on which the Commission has not taken final action; (C) rules published as advance notices of proposed rulemaking for which neither a proposed nor final rule has been issued; and (D) unpublished rules on which the NRC expects to take action. Section 2, ''Petitions for Rulemaking,'' includes (A) petitions denied or incorporated into final rules since December 30, 1994; (B) petitions incorporated into proposed rules; (C) petitions pending staff review, and (D) petitions with deferred action
Performance of different colour quality metrics proposed to CIE TC 1-91
Bhusal, Pramod; Dangol, Rajendra
2017-01-01
The main aim of the article is to find out the performance of different metrics proposed to CIE TC 1-91. Currently, six different indexes have been proposed to CIE TC 1-91: Colour Quality Scale (CQS), Feeling of Contrast Index (FCI), Memory colour rendering index (MCRI), Preference of skin (PS), Relative gamut area index (RGAI) and Illuminating Engineering society Method for evaluating light source colour rendition (IES TM-30). The evaluation and analysis are based on previously conducted exp...
International Nuclear Information System (INIS)
Ribeiro, M.A.; Torquato, R.; Simoes, A.N.; Costa, A.C.F.M.; Gama, L.; Kiminami, R.H.G.A.
2009-01-01
Zinc oxide, due to the piezoelectric and electro-optical characteristics, is used in application such as, chemical sensor, varistor, transparent conductive thin film and DMS. The aim of this work is to evaluate and compare structural and morphological characteristics of nanometric powders of Zn 0,9 Mn 0,1 O prepared by chemical synthesis of combustion reaction and Pechini method. The powders were characterized by XRD, SEM and BET. The XRD data shown to both studied method the presence of ZnO phase with hexagonal structure and without second phase. The powder prepared by combustion reaction presented 9% of reduction in crystallinity and 42% of increase in surface area in comparison with the powder prepared by Pechini method. The morphological analysis of the powder showed that both method produce powders with soft agglomerates constituted by nano size particles. (author)
Copy Number Variations in Tilapia Genomes.
Li, Bi Jun; Li, Hong Lian; Meng, Zining; Zhang, Yong; Lin, Haoran; Yue, Gen Hua; Xia, Jun Hong
2017-02-01
Discovering the nature and pattern of genome variation is fundamental in understanding phenotypic diversity among populations. Although several millions of single nucleotide polymorphisms (SNPs) have been discovered in tilapia, the genome-wide characterization of larger structural variants, such as copy number variation (CNV) regions has not been carried out yet. We conducted a genome-wide scan for CNVs in 47 individuals from three tilapia populations. Based on 254 Gb of high-quality paired-end sequencing reads, we identified 4642 distinct high-confidence CNVs. These CNVs account for 1.9% (12.411 Mb) of the used Nile tilapia reference genome. A total of 1100 predicted CNVs were found overlapping with exon regions of protein genes. Further association analysis based on linear model regression found 85 CNVs ranging between 300 and 27,000 base pairs significantly associated to population types (R 2 > 0.9 and P > 0.001). Our study sheds first insights on genome-wide CNVs in tilapia. These CNVs among and within tilapia populations may have functional effects on phenotypes and specific adaptation to particular environments.
Multiplier less high-speed squaring circuit for binary numbers
Sethi, Kabiraj; Panda, Rutuparna
2015-03-01
The squaring operation is important in many applications in signal processing, cryptography etc. In general, squaring circuits reported in the literature use fast multipliers. A novel idea of a squaring circuit without using multipliers is proposed in this paper. Ancient Indian method used for squaring decimal numbers is extended here for binary numbers. The key to our success is that no multiplier is used. Instead, one squaring circuit is used. The hardware architecture of the proposed squaring circuit is presented. The design is coded in VHDL and synthesised and simulated in Xilinx ISE Design Suite 10.1 (Xilinx Inc., San Jose, CA, USA). It is implemented in Xilinx Vertex 4vls15sf363-12 device (Xilinx Inc.). The results in terms of time delay and area is compared with both modified Booth's algorithm and squaring circuit using Vedic multipliers. Our proposed squaring circuit seems to have better performance in terms of both speed and area.
12 CFR 27.1 - Scope and OMB control number.
2010-01-01
... Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY FAIR HOUSING HOME LOAN DATA SYSTEM § 27.1 Scope and OMB control number. (a) Scope. This part applies to the activities of national... information requirements contained in this part were approved by the Office of Management and Budget under OMB...
Topics in the theory of numbers
Erdős, Paul
2003-01-01
This rather unique book is a guided tour through number theory. While most introductions to number theory provide a systematic and exhaustive treatment of the subject, the authors have chosen instead to illustrate the many varied subjects by associating recent discoveries, interesting methods, and unsolved problems. In particular, we read about combinatorial problems in number theory, a branch of mathematics co-founded and popularized by Paul Erdös. Janos Suranyis vast teaching experience successfully complements Paul Erdös'ability to initiate new directions of research by suggesting new problems and approaches. This book will surely arouse the interest of the student and the teacher alike. Until his death in 1996, Professor Paul Erdös was one of the most prolific mathematicians ever, publishing close to 1,500 papers. While his papers contributed to almost every area of mathematics, his main research interest was in the area of combinatorics, graph theory, and number theory. He is most famous for proposing...
Myers, Alan L; Zhang, Yanping; Kawedia, Jitesh D; Shank, Brandon R; Deaver, Melissa A; Kramer, Mark A
2016-12-15
The chemical stability and physical compatibility of tacrolimus i.v. infusion solutions prepared in Excel bags and stored at 23 or 4 °C for up to nine days were studied. Tacrolimus admixtures (2, 4, and 8 μg/mL) were prepared in Excel bags using 0.9% sodium chloride injection and stored at 23 °C without protection from light or at 4 °C in the dark. Test samples were withdrawn from triplicate bag solutions immediately after preparation and at predetermined time intervals (1, 3, 5, 7, and 9 days). Chemical stability was assessed by measuring tacrolimus concentrations using a validated stability-indicating high-performance liquid chromatography assay. The physical stability of the admixtures was assessed by visual examination and by measuring turbidity, particle size, and drug content. All test solutions stored at 23 or 4 °C had a no greater than 6% loss of the initial tacrolimus concentration throughout the nine-day study period. All test samples of tacrolimus admixtures, under both storage conditions, were without precipitation and remained clear initially and throughout the nine-day observation period. Changes in turbidities were minor; measured particulates remained few in number in all samples throughout the study. Extemporaneously prepared infusion solutions of tacrolimus 2, 4, and 8 μg/mL in 0.9% sodium chloride injection in Excel bags were chemically and physically stable for at least nine days when stored at room temperature (23 °C) without protection from light and when stored in a refrigerator (4 °C) in the dark. Copyright © 2016 by the American Society of Health-System Pharmacists, Inc. All rights reserved.
76 FR 13410 - Agency Information Collection Activities: Proposed Collection; Comment Request
2011-03-11
... Culture.'' In accordance with the Paperwork Reduction Act, 44 U.S.C. 3501-3521, A1-IRQ invites the public...: Proposed Project Pilot Test of the Proposed Pharmacy Survey on Patient Safety Culture As the baby boomer... chronic diseases become more efficacious, the expected increase in the number of prescriptions and demand...
Determination of the Number of Fixture Locating Points for Sheet Metal By Grey Model
Directory of Open Access Journals (Sweden)
Yang Bo
2017-01-01
Full Text Available In the process of the traditional fixture design for sheet metal part based on the "N-2-1" locating principle, the number of fixture locating points is determined by trial and error or the experience of the designer. To that end, a new design method based on grey theory is proposed to determine the number of sheet metal fixture locating points in this paper. Firstly, the training sample set is generated by Latin hypercube sampling (LHS and finite element analysis (FEA. Secondly, the GM(1, 1 grey model is constructed based on the established training sample set to approximate the mapping relationship between the number of fixture locating points and the concerned sheet metal maximum deformation. Thirdly, the final number of fixture locating points for sheet metal can be inversely calculated under the allowable maximum deformation. Finally, a sheet metal case is conducted and the results indicate that the proposed approach is effective and efficient in determining the number of fixture locating points for sheet metal.
1964-06-01
266, 1958. 131. Houziaux, L., Spectres d’absorption infra-rouge de quelques verres naturels entr 2 et 24 microns (Infrared Absorption Spectra of...Taking Pb20L’ 1), Given as a Function of Time. reteorites was made in a work by M. M. Shats (Ref. 10). M. M. Shats de - termined the uranium and lead...billion years. Table 6. Age, l09 Type of Data of Published Meteorite Years Meteorite Source, Investi- gator Kashin 3.00 Chondrite 1951 (Ref. 14), E.K
Ranking Exponential Trapezoidal Fuzzy Numbers by Median Value
Directory of Open Access Journals (Sweden)
S. Rezvani
2013-12-01
Full Text Available In this paper, we want represented a method for ranking of two exponential trapezoidal fuzzy numbers. A median value is proposed for the ranking of exponential trapezoidal fuzzy numbers. For the validation the results of the proposed approach are compared with different existing approaches.
Energy Technology Data Exchange (ETDEWEB)
Thakur, Shweta; Rai, Radheshyam, E-mail: rshyam1273@gmail.com [School of Physics, Shoolini University, Himachal Pradesh (India); Bdikin, Igor [Centre for Mechanical Technology and Automation (TEMA), University of Aveiro (Portugal); Valente, Manuel Almeida [Departamento de Fisica, Universidade de Aveiro (Portugal)
2016-01-15
In this paper we present the impedance spectroscopy of ternary solid solutions of BiFeO{sub 3} , TbFeO{sub 3} and PbTiO{sub 3} , prepared by solid-state reaction method. The preliminary structural studies were carried out by X-ray diffraction technique, showing the formation of polycrystalline sample with ABO{sub 3} type of perovskite structure with hexagonal symmetry for Bi{sub 0.8}Tb{sub 0.1}Pb{sub 0.1}Fe{sub 0.9}Ti{sub 0.1}O{sub 3} system at room temperature. Dielectric and impedance study of this ceramic has been characterized in the temperature range 175 - 325 deg C and frequency range 100 Hz - 1 MHz. The maximum ferroelectric transition temperature (T{sub c} ) of this system was in the range 210 - 225 deg C with the dielectric constant having maximum value ∼ 2480 at 1 kHz. The complex impedance graph exhibited one impedance semicircle arc at all reported temperatures, which indicates that the impedance response is a Cole-Cole type relaxation. Single semicircle indicate that the grain effect of the bulk in ceramic. The bulk resistance of the material decreases with increasing temperature showing negative temperature showing a typical semiconducting property, i.e. negative temperature coefficient of resistance (NTCR) behavior. (author)
Innate or Acquired? – Disentangling Number Sense and Early Number Competencies
Directory of Open Access Journals (Sweden)
Julia Siemann
2018-04-01
Full Text Available The clinical profile termed developmental dyscalculia (DD is a fundamental disability affecting children already prior to arithmetic schooling, but the formal diagnosis is often only made during school years. The manifold associated deficits depend on age, education, developmental stage, and task requirements. Despite a large body of studies, the underlying mechanisms remain dubious. Conflicting findings have stimulated opposing theories, each presenting enough empirical support to remain a possible alternative. A so far unresolved question concerns the debate whether a putative innate number sense is required for successful arithmetic achievement as opposed to a pure reliance on domain-general cognitive factors. Here, we outline that the controversy arises due to ambiguous conceptualizations of the number sense. It is common practice to use early number competence as a proxy for innate magnitude processing, even though it requires knowledge of the number system. Therefore, such findings reflect the degree to which quantity is successfully transferred into symbols rather than informing about quantity representation per se. To solve this issue, we propose a three-factor account and incorporate it into the partly overlapping suggestions in the literature regarding the etiology of different DD profiles. The proposed view on DD is especially beneficial because it is applicable to more complex theories identifying a conglomerate of deficits as underlying cause of DD.
Innate or Acquired? – Disentangling Number Sense and Early Number Competencies
Siemann, Julia; Petermann, Franz
2018-01-01
The clinical profile termed developmental dyscalculia (DD) is a fundamental disability affecting children already prior to arithmetic schooling, but the formal diagnosis is often only made during school years. The manifold associated deficits depend on age, education, developmental stage, and task requirements. Despite a large body of studies, the underlying mechanisms remain dubious. Conflicting findings have stimulated opposing theories, each presenting enough empirical support to remain a possible alternative. A so far unresolved question concerns the debate whether a putative innate number sense is required for successful arithmetic achievement as opposed to a pure reliance on domain-general cognitive factors. Here, we outline that the controversy arises due to ambiguous conceptualizations of the number sense. It is common practice to use early number competence as a proxy for innate magnitude processing, even though it requires knowledge of the number system. Therefore, such findings reflect the degree to which quantity is successfully transferred into symbols rather than informing about quantity representation per se. To solve this issue, we propose a three-factor account and incorporate it into the partly overlapping suggestions in the literature regarding the etiology of different DD profiles. The proposed view on DD is especially beneficial because it is applicable to more complex theories identifying a conglomerate of deficits as underlying cause of DD. PMID:29725316
Registration of ‘CP 09-1822’ Sugarcane
‘CP 09-1822’ (Reg. No. __; PI 686942 sugarcane (a complex hybrid of Saccharum spp.) was released in June 2016 for commercial cultivation on sand (mineral) soils in Florida. This cultivar was developed through a collaborative sugarcane cultivar development program of the USDA-ARS, the University of F...
Directory of Open Access Journals (Sweden)
Silvana Romio
95% certainty that the number of excess GBS cases after influenza A(H1N1pdm09 vaccination would be more than 3 per million vaccinated.
Pressure effect on the transport properties of superconducting Li0.9MobO17bronze
International Nuclear Information System (INIS)
Filippini, C.E.; Boujida, M.; Marcus, J.; Schlenker, C.; Beille, J.
1989-01-01
The electrical resistivity of Li 0.9 Mo 6 O 17 single crystal has been studied between 1.5 K and 300 K under hydrostatic pressures up to 20 k bar. A large increase of the superconducting transition temperature, from 1.7 K to 2.5 K, is associated to a sharp decease of the temperature T m of the electronic, probably CDW instability
Directory of Open Access Journals (Sweden)
Thomas C Darton
2016-08-01
Full Text Available Typhoid persists as a major cause of global morbidity. While several licensed vaccines to prevent typhoid are available, they are of only moderate efficacy and unsuitable for use in children less than two years of age. Development of new efficacious vaccines is complicated by the human host-restriction of Salmonella enterica serovar Typhi (S. Typhi and lack of clear correlates of protection. In this study, we aimed to evaluate the protective efficacy of a single dose of the oral vaccine candidate, M01ZH09, in susceptible volunteers by direct typhoid challenge.We performed a randomised, double-blind, placebo-controlled trial in healthy adult participants at a single centre in Oxford (UK. Participants were allocated to receive one dose of double-blinded M01ZH09 or placebo or 3-doses of open-label Ty21a. Twenty-eight days after vaccination, participants were challenged with 104CFU S. Typhi Quailes strain. The efficacy of M01ZH09 compared with placebo (primary outcome was assessed as the percentage of participants reaching pre-defined endpoints constituting typhoid diagnosis (fever and/or bacteraemia during the 14 days after challenge. Ninety-nine participants were randomised to receive M01ZH09 (n = 33, placebo (n = 33 or 3-doses of Ty21a (n = 33. After challenge, typhoid was diagnosed in 18/31 (58.1% [95% CI 39.1 to 75.5] M01ZH09, 20/30 (66.7% [47.2 to 87.2] placebo, and 13/30 (43.3% [25.5 to 62.6] Ty21a vaccine recipients. Vaccine efficacy (VE for one dose of M01ZH09 was 13% [95% CI -29 to 41] and 35% [-5 to 60] for 3-doses of Ty21a. Retrospective multivariable analyses demonstrated that pre-existing anti-Vi antibody significantly reduced susceptibility to infection after challenge; a 1 log increase in anti-Vi IgG resulting in a 71% decrease in the hazard ratio of typhoid diagnosis ([95% CI 30 to 88%], p = 0.006 during the 14 day challenge period. Limitations to the study included the requirement to limit the challenge period prior to treatment to
Energy Technology Data Exchange (ETDEWEB)
Ribeiro, M A; Torquato, R; Simoes, A N; Costa, A C.F.M.; Gama, L [Universidade Federal de Campina Grande (DEMA/UFCG), PB (Brazil). Dept. de Engenharia dos Materiais; Kiminami, R H.G.A. [Universidade Federal de Sao Carlos (DEMA/UFSCar), SP (Brazil). Dept. de Engenharia de Materiais
2009-07-01
Zinc oxide, due to the piezoelectric and electro-optical characteristics, is used in application such as, chemical sensor, varistor, transparent conductive thin film and DMS. The aim of this work is to evaluate and compare structural and morphological characteristics of nanometric powders of Zn{sub 0,9}Mn{sub 0,1}O prepared by chemical synthesis of combustion reaction and Pechini method. The powders were characterized by XRD, SEM and BET. The XRD data shown to both studied method the presence of ZnO phase with hexagonal structure and without second phase. The powder prepared by combustion reaction presented 9% of reduction in crystallinity and 42% of increase in surface area in comparison with the powder prepared by Pechini method. The morphological analysis of the powder showed that both method produce powders with soft agglomerates constituted by nano size particles. (author)
Registration of ‘CP 09-1430’ Sugarcane
‘CP 09-1430’ (Reg. No. ; PI 686940 sugarcane (a complex hybrid of Saccharum spp.) was developed and released (6 Jun. 2016) through cooperative research conducted by the USDA-ARS Sugarcane Field Station , Canal Point, the University of Florida, and the Florida Sugar Cane League, Inc. for use on ...
International Nuclear Information System (INIS)
Fassbender, R; Böhringer, H; Nastasi, A; Šuhada, R; Mühlegger, M; Mohr, J J; Pierini, D; De Hoon, A; Kohnert, J; Lamer, G; Schwope, A D; Pratt, G W; Quintana, H; Rosati, P; Santos, J S
2011-01-01
We present the largest sample to date of spectroscopically confirmed x-ray luminous high-redshift galaxy clusters comprising 22 systems in the range 0.9 2 of non-contiguous deep archival XMM-Newton coverage, of which 49.4 deg 2 are part of the core survey with a quantifiable selection function and 17.7 deg 2 are classified as ‘gold’ coverage as the starting point for upcoming cosmological applications. Distant cluster candidates were followed up with moderately deep optical and near-infrared imaging in at least two bands to photometrically identify the cluster galaxy populations and obtain redshift estimates based on the colors of simple stellar population models. We test and calibrate the most promising redshift estimation techniques based on the R-z and z-H colors for efficient distant cluster identifications and find a good redshift accuracy performance of the z-H color out to at least z ∼ 1.5, while the redshift evolution of the R-z color leads to increasingly large uncertainties at z ≳ 0.9. Photometrically identified high-z systems are spectroscopically confirmed with VLT/FORS 2 with a minimum of three concordant cluster member redshifts. We present first details of two newly identified clusters, XDCP J0338.5+0029 at z = 0.916 and XDCP J0027.2+1714 at z = 0.959, and investigate the x-ray properties of SpARCS J003550-431224 at z = 1.335, which shows evidence for ongoing major merger activity along the line-of-sight. We provide x-ray properties and luminosity-based total mass estimates for the full sample of 22 high-z clusters, of which 17 are at z ⩾ 1.0 and seven populate the highest redshift bin at z > 1.3. The median system mass of the sample is M 200 ≃ 2 × 10 14 M ⊙ , while the probed mass range for the distant clusters spans approximately (0.7-7) × 10 14 M ⊙ . The majority (>70%) of the x-ray selected clusters show rather regular x-ray morphologies, albeit in most cases with a discernible elongation along one axis. In contrast to
Energy Technology Data Exchange (ETDEWEB)
Zhou, Qingjun [State Key Laboratory of Superhard Materials and College of Physics, Jilin University, Changchun 130012 (China); College of Science, Civil Aviation University of China, Tianjin 300300 (China); Zhang, Leilei; He, Tianmin [State Key Laboratory of Superhard Materials and College of Physics, Jilin University, Changchun 130012 (China)
2010-02-15
A cobalt-free cubic perovskite oxide, SrFe{sub 0.9}Nb{sub 0.1}O{sub 3-{delta}} (SFN) was investigated as a cathode for intermediate-temperature solid oxide fuel cells (IT-SOFCs). XRD results showed that SFN cathode was chemically compatible with the electrolyte Sm{sub 0.2}Ce{sub 0.8}O{sub 1.9} (SDC) for temperatures up to 1050 C. The electrical conductivity of SFN sample reached 34-70 S cm{sup -1} in the commonly operated temperatures of IT-SOFCs (600-800 C). The area specific resistance was 0.138 {omega} cm{sup 2} for SFN cathode on SDC electrolyte at 750 C. A maximum power density of 407 mW cm{sup -2} was obtained at 800 C for single-cell with 300 {mu}m thick SDC electrolyte and SFN cathode. (author)
Cornman, Stephen Q.; Zhou, Lei; Nakamoto, Nanae
2012-01-01
This documentation is for the revised file (Version 1b) of the National Center for Education Statistics' (NCES) Common Core of Data (CCD) National Public Education Financial Survey (NPEFS) for school year 2008-2009, fiscal year 2009 (FY 09). It contains a brief description of the data collection along with information required to understand and…
Proposed plan for interim remedial measures at the 100-KR-1 Operable Unit. Revision 1
International Nuclear Information System (INIS)
1995-09-01
This proposed plan identifies the preferred alternative for interim remedial measures for remedial action of radioactive liquid waste disposal sites that include contaminated soils and structures at the 100-KR-1 Operable Unit, located at the Hanford Site. It also summarizes other remedial alternatives evaluated for interim remedial measures in this Operable Unit. The intent of interim remedial measures is to speed up actions to address contaminated areas that pose potential threats to human health and the environment. This proposed plan is being issued by the US Environmental Protection Agency (EPA), the lead regulatory agency; the Washington State Department of Ecology (Ecology), the support regulatory agency; and the US Department of Energy (DOE), the responsible agency. The EPA, Ecology, and the DOE are issuing this proposed plan as part of their public participation responsibilities under Section 117(a) of the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA), commonly known as the ''Superfund Law.'' This proposed plan is intended to be a fact sheet for public review which briefly describes the remedial alternatives analyzed, identifies a preferred alternative, and summarizes the information relied upon to recommend the preferred alternative
Hearing loss in children in Østfold county 2000-09.
Nelson, Siri; Andersen, Ronny; Anderssen, Sven-Harald
2015-01-27
The Directorate of Health recommends hearing screening of all neonates with the aid of otoacoustic emissions (OAE). The goal is to achieve initiation of treatment before the child is six months old. Congenital hearing loss occurs in 1-3 per 1,000 newborns, and the purpose of this study was to identify the prevalence in a large Norwegian dataset. During the period 1 January 2000-31 December 2009, all children who were born in Østfold county, 29,485 neonates in total, were offered hearing screening with the aid of otoacoustic emissions. Those children in whom no emissions were detected were referred to the hearing centre. The dataset also includes children born during the same period who had normal emissions during their neonatal period, but later were diagnosed with hearing loss. The follow-up period of these children lasted until 31 December 2013. Altogether 568 children were referred to the hearing centre after screening. Of these, 73 children underwent brainstem response audiometry under anaesthesia, and 31 (0.11%) were diagnosed with hearing loss through absence of emissions at birth. Eleven (35%) of these received their diagnosis before the age of six months. The median age of diagnosis decreased from 13 (7-74) to 6 (3-23) months, while their number increased from nine to 22 from 2000-04 to 2005-09. Hearing loss after normal otoacoustic emissions at the neonatal stage was diagnosed in ten children (0.03%) and the median age of diagnosis among these was 36 (18-86) months. After the introduction of automated auditory brainstem response audiometry (AABR) during sleep, the use of auditory brainstem response audiometry (ABR) under narcosis fell by half. The prevalence of hearing loss is equal to other Norwegian and international figures. The age of diagnosis decreased during the period. Otoacoustic emissions appear to be an effective screening method in paediatric wards. The use of automated auditory brainstem response audiometry reduces the need for testing under
2017-09-01
GS-0895-09 Industrial Engineering Technician 23.04 7.56 GS-0810-09 Civil Engineering Developmental (Programming) 23.04 7.56 GS-0810-11 Civil ... Engineering –Programming 27.88 9.14 GS-0810-12 Civil Engineering –Design 33.41 10.96 GS-2210-09 Info Tech Spec (Network Systems/Customer Support) 23.04...USED IN THE NOVEMBER 2014 REQUEST FOR PROPOSAL FOR THE PROGRAM EXECUTIVE OFFICE SOLDIER SYSTEMS ENGINEERING AND TECHNICAL ASSISTANCE (SETA) CONTRACT
Microstructural Control and Characterization of Bi2V0.9Cu0.1O5.35 (BICUVOX) Ceramics
Razmyar, Soheil
2011-12-01
The widespread commercialization of solid-oxide fuel cells (SOFCs) and solid-oxide electrolyte cells (SOECs) is primarily limited by material degradation issues related to the required high temperature operation (>800°C). Applications of stabilized zirconia based electrolytes, which are the most commonly used oxide ion conductors, have been limited to this high temperature regime due to its low oxygen ion conductivity below 800°C. Solid electrolytes made of the BIMEVOX compositional family of materials (Bi2MexV 1-xO5.5-delta where Me=Cu, Co, Mg, Ni, Fe...) exhibit high oxide ionic conductivity similar to YSZ at a low temperature (300--600°C). Among these materials copper-substituted bismuth vanadate (Bi2V0.9Cu0.1O5.35, BICUVOX), was reported to have the highest ionic conductivity at 400°C (0.02 S/cm). It's one of the most important drawbacks of using BICUVOX, as a SOFC electrolyte is the low mechanical strength, which makes it unusable for most electrolyte supported applications. This research aims at improving mechanical strength by careful control of synthesis processing and sintering processes, thus making BICUVOX a viable material option for intermediate temperature SOFC. A co-precipitation method was used to synthesize submicron BICUVOX powder. The powder was utilized to fabricate a thin (< 250 microm) BICUVOX electrolyte membrane, with 2.5 cm2 active area and high mechanical strength. The fabricated BICUVOX membranes were densified to 97% theoretical density at lower sintering temperature and shorter time (675°C/1 h), and shows fine grain size (<1.5microm) and high mechanical strength (159 MPa).
Proposal for the construction of the staged Scyllac prototype
International Nuclear Information System (INIS)
Nunnally, W.C.; McDonald, T.E.
1975-07-01
After the completion of the present feedback experiment on Scyllac, the machine will be reconfigured into a toroidal staged theta pinch. A 0.9-m prototype of the Staged Scyllac experiment is proposed which will be used to test the components required for the implosion-heating and staging circuits in a system environment. In addition, various systems of the Staged Scyllac, such as the trigger system and the gap-monitoring system, can be developed on the prototype before installation on the full experiment. (auth)
Extended stability of intravenous 0.9% sodium chloride solution after prolonged heating or cooling.
Puertos, Enrique
2014-03-01
The primary objective of this study was to evaluate the stability and sterility of an intravenous 0.9% sodium chloride solution that had been cooled or heated for an extended period of time. Fifteen sterile 1 L bags of 0.9% sodium chloride solution were randomly selected for this experiment. Five bags were refrigerated at an average temperature of 5.2°C, 5 bags were heated at an average temperature of 39.2°C, and 5 bags were stored at an average room temperature of 21.8°C to serve as controls. All samples were protected from light and stored for a period of 199 days prior to being assayed and analyzed for microbial and fungal growth. There was no clinically significant difference in the mean sodium values between the refrigerated samples, the heated samples, and the control group. There were no signs of microbial or fungal growth for the duration of the study. A sterile intravenous solution of 0.9% sodium chloride that was heated or cooled remained stable and showed no signs of microbial or fungal growth for a period of 199 days. This finding will allow hospitals and emergency medical technicians to significantly extend the expiration date assigned to these fluids and therefore obviate the need to change out these fluids every 28 days as recommended by the manufacturer.
Cai, Xun-Chao; Liu, Chang-Hong; Wang, Bao-Tong; Xue, Ya-Rong
2017-03-01
Bacillus velezensis CC09, which was isolated from healthy leaves of Cinnamomum camphora and previously identified as Bacillus amyloliquefaciens CC09, shows great potential as a new biocontrol agent, in control of many phytopathogenic diseases. To extend our understanding of the potential antifungal capacities, we did a whole genome analysis of strain CC09. Result shows that strain CC09 has a relatively large genome size (4.17Mb) with an average GC content of 46.1%, and 4021 predicted genes. Thirteen secondary metabolites encoding clusters have been identified within the genome of B. velezensis CC09 using genome mining technique. Data of comparative genomic analysis indicated that 3 of the clusters are conserved by all strains of B. velezensis, B. amyloliquefaciens and B. subtilis 168, 9 by B. velezensis and B. amyloliquefaciens, and 2 by all strains of B. velezensis. Another 2 clusters encoding NRPS (Non-Ribosomal Peptide Synthetases) and NRPS-TransATPKS (NRPS and trans-Acyl Transferase Polyketide Synthetases) respectively are observed only in 15 B. velezensis strains, which might lead to the synthesis of novel bioactive compounds and could be explored as antimicrobial agents in the future. These clusters endow B. velezensis CC09 with strong and broad antimicrobial activities, for example, in control of wheat powdery mildew disease. Moreover, our data further confirmed the taxonomy of strain CC09 is a member of B. velezensis rather than a strain of B. amyloliquefaciens based on core genome sequence analysis using phylogenomic approach. Copyright © 2016 Elsevier GmbH. All rights reserved.
Accurate measurement of gene copy number for human alpha-defensin DEFA1A3.
Khan, Fayeza F; Carpenter, Danielle; Mitchell, Laura; Mansouri, Omniah; Black, Holly A; Tyson, Jess; Armour, John A L
2013-10-20
Multi-allelic copy number variants include examples of extensive variation between individuals in the copy number of important genes, most notably genes involved in immune function. The definition of this variation, and analysis of its impact on function, has been hampered by the technical difficulty of large-scale but accurate typing of genomic copy number. The copy-variable alpha-defensin locus DEFA1A3 on human chromosome 8 commonly varies between 4 and 10 copies per diploid genome, and presents considerable challenges for accurate high-throughput typing. In this study, we developed two paralogue ratio tests and three allelic ratio measurements that, in combination, provide an accurate and scalable method for measurement of DEFA1A3 gene number. We combined information from different measurements in a maximum-likelihood framework which suggests that most samples can be assigned to an integer copy number with high confidence, and applied it to typing 589 unrelated European DNA samples. Typing the members of three-generation pedigrees provided further reassurance that correct integer copy numbers had been assigned. Our results have allowed us to discover that the SNP rs4300027 is strongly associated with DEFA1A3 gene copy number in European samples. We have developed an accurate and robust method for measurement of DEFA1A3 copy number. Interrogation of rs4300027 and associated SNPs in Genome-Wide Association Study SNP data provides no evidence that alpha-defensin copy number is a strong risk factor for phenotypes such as Crohn's disease, type I diabetes, HIV progression and multiple sclerosis.
2012-08-13
... Information Technology Agreement: Advice and Information on the Proposed Expansion: Part 1; The Information Technology Agreement: Advice and Information on the Proposed Expansion: Part 2 AGENCY: United States... Technology Agreement: Advice and Information on the Proposed Expansion: Part 1, and investigation No. 332-536...
Res Sep 2014 Cover Tp 08.09.14.cdr
Indian Academy of Sciences (India)
Admin
2010). ISSN 0971-8044. Regn No.KRNAVBGE-340/2012-2014. Licenced to Post without prepayment No.6. Posted at MBC, GPO, Bangalore 560 001, 12.09.14. Registered with Registrar of Newspapers in India vide Regn. No. 66273/96.
Corrosion characteristics of the Sm2(Fe0.9Co0.1)17N2.9 magnets stabilized by zinc-coating
International Nuclear Information System (INIS)
Arlot, R.; Machida, K.; Adachi, G.; Rango, P. de; Fruchart, D.
1998-01-01
The effect of powder particle size and of zinc coatings ( 2 (Fe 0.9 Co 0.1 ) 17 N 2.9 magnets has been investigated and compared to those obtained for Sm 2 Fe 17 N 3 and Nd 2 Fe 14 B magnets. Potentiokinetic polarisation behaviour in 0.5 N H 2 SO 4 and in Ringer's solution was studied. It was found that in 0.5 N H 2 SO 4 solution, the corrosion resistance is very weak, whereas in Ringer's solution, Zn coating and epoxy embedding provided a very efficient protection to the magnet. This result is quite unexpected as regarding the very weak amount of Zn (0.73 wt%) and epoxy (2.5-5 wt%) used to stabilize those very reactive ground powders which easily burn in air. Also, we characterized the magnetic properties of severely corroded magnets. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Hosken, C.M.; Souza, D.P.F. de, E-mail: camila.hosken@gmail.co [Universidade Federal de Sao Carlos (LAPCEC/UFSCar), SP (Brazil). Programa de Pos-Graduacao em Ciencia e Engenharia de Materiais. Lab. de Preparacao e Caracterizacao Eletrica em Ceramicas
2010-07-01
Researches on solid oxide fuel cells indicate barium cerate perovskite as a very attractive material for using as electrolyte due to its high protonic conductivity. The objective of this work is investigate the yttrium segregation during sintering of BaCe{sub 0,9}Y{sub 0,1}O{sub 3-{delta}} doped with Zn O as a sintering aid. The powders were prepared by citrate process. Powders were isostatic pressed into pellets and sintered in air at 1200, 1275, 1325 and 1400 deg C. The samples were characterized by scanning electron microscopy, X-ray diffraction and impedance spectroscopy. Secondary phase containing Yttrium and Cerium was detected as sintering temperature increased. Increase of the lattice parameter and activation energy for electrical conductivity were also detected on samples sintered at 1400 deg C. (author)
Observation of magnetization reversal behavior in Sm0.9Gd0.1Cr0.85Mn0.15O3 orthochromites
Panwar, Neeraj; Joby, Jostin P.; Kumar, Surendra; Coondoo, Indrani; Vasundhara, M.; Kumar, Nitu; Palai, Ratnakar; Singhal, Rahul; Katiyar, Ram S.
2018-05-01
Impact of co-doping (Gd and Mn) on the magnetic properties has been systematically investigated in SmCrO3 compound. For the synthesized compound Sm0.9Gd0.1Cr0.85Mn0.15O3 (SGCMO), below the Neel transition temperature and under low applied magnetic field, temperature induced magnetization reversal at 105 K (crossover temperature) was noticed in the field cooled magnetization curve. Magnetization reversal attained maximum value of -1.03 emu/g at 17 K where spin reorientation occurred. The magnetization reversal disappeared under higher applied field. From the M-H plots an enhancement in the magnetization was observed due to Gd doping. Magnetocaloric effect at low temperatures measured through the magnetic entropy change was found sixteen times higher for this compound as compared to pristine SmCrO3 and twice to that of SmCr0.85Mn0.15O3 compound. The study reveals the importance of co-doping in tailoring the magnetic properties of rare-earth chromites.
International Nuclear Information System (INIS)
Yamamoto, Yoshinobu; Kunugi, Tomoaki
2015-01-01
Graphical abstract: - Highlights: • For the first time, the MHD heat transfer DNS database corresponding to the typical nondimensional parameters of the fusion blanket design using molten salt, were established. • MHD heat transfer correlation was proposed and about 20% of the heat transfer degradation was evaluated under the design conditions. • The contribution of the turbulent diffusion to heat transfer is increased drastically with increasing Hartmann number. - Abstract: The high-Prandtl number passive scalar transport of the turbulent channel flow imposed a wall-normal magnetic field is investigated through the large-scale direct numerical simulation (DNS). All essential turbulence scales of velocities and temperature are resolved by using 2048 × 870 × 1024 computational grid points in stream, vertical, and spanwise directions. The heat transfer phenomena for a Prandtl number of 25 were observed under the following flow conditions: the bulk Reynolds number of 14,000 and Hartman number of up to 28. These values were equivalent to the typical nondimensional parameters of the fusion blanket design proposed by Wong et al. As a result, a high-accuracy DNS database for the verification of magnetohydrodynamic turbulent heat transfer models was established for the first time, and it was confirmed that the heat transfer correlation for a Prandtl number of 5.25 proposed by Yamamoto and Kunugi was applicable to the Prandtl number of 25 used in this study
Energy Technology Data Exchange (ETDEWEB)
Yamamoto, Yoshinobu, E-mail: yamamotoy@yamanashi.ac.jp [Department of Mechanical Systems Engineering, University of Yamanashi, 4-3-11 Takeda, Kofu 400-8511 (Japan); Kunugi, Tomoaki [Department of Nuclear Engineering, Kyoto University Yoshida, Sakyo, Kyoto 606-8501 (Japan)
2015-01-15
Graphical abstract: - Highlights: • For the first time, the MHD heat transfer DNS database corresponding to the typical nondimensional parameters of the fusion blanket design using molten salt, were established. • MHD heat transfer correlation was proposed and about 20% of the heat transfer degradation was evaluated under the design conditions. • The contribution of the turbulent diffusion to heat transfer is increased drastically with increasing Hartmann number. - Abstract: The high-Prandtl number passive scalar transport of the turbulent channel flow imposed a wall-normal magnetic field is investigated through the large-scale direct numerical simulation (DNS). All essential turbulence scales of velocities and temperature are resolved by using 2048 × 870 × 1024 computational grid points in stream, vertical, and spanwise directions. The heat transfer phenomena for a Prandtl number of 25 were observed under the following flow conditions: the bulk Reynolds number of 14,000 and Hartman number of up to 28. These values were equivalent to the typical nondimensional parameters of the fusion blanket design proposed by Wong et al. As a result, a high-accuracy DNS database for the verification of magnetohydrodynamic turbulent heat transfer models was established for the first time, and it was confirmed that the heat transfer correlation for a Prandtl number of 5.25 proposed by Yamamoto and Kunugi was applicable to the Prandtl number of 25 used in this study.
2010-08-06
... DEPARTMENT OF THE INTERIOR Bureau of Land Management [CACA-48668, 49502, 49503, 49504, LLCAD09000.L51010000.FX0000, LVRWB09B2400] Notice of Availability of the Proposed California Desert Conservation Area Plan Amendment and Final Environmental Impact Statement for the Ivanpah Solar Electric Generating...
Vasylkiv, Oleg; Borodianska, Hanna; Badica, Petre; Zhen, Yongda; Tok, Alfred
2009-01-01
Four-cation nanograined strontium and magnesium doped lanthanum gallate (La0.8Sr0.2) (Ga0.9Mg0.1)O(3-delta) (LSGM) and its composite with 2 wt% of ceria (LSGM-Ce) were prepared. Morphologically homogeneous nanoreactors, i.e., complex intermediate metastable aggregates of desired composition were assembled by spray atomization technique, and subsequently loaded with nanoparticles of highly energetic C3H6N6O6. Rapid nanoblast calcination technique was applied and the final composition was synthesized within the preliminary localized volumes of each single nanoreactor on the first step of spark plasma treatment. Subsequent SPS consolidations of nanostructured extremely active LSGM and LSGM-Ce powders were achieved by rapid treatment under pressures of 90-110 MPa. This technique provided the heredity of the final structure of nanosize multimetal oxide, allowed the prevention of the uncontrolled agglomeration during multicomponent aggregates assembling, subsequent nanoblast calcination, and final ultra-rapid low-temperature SPS consolidation of nanostructured ceramics. LaSrGaMgCeO(3-delta) nanocrystalline powder consisting of approximately 11 nm crystallites was consolidated to LSGM-Ce nanoceramic with average grain size of approximately 14 nm by low-temperature SPS at 1250 degrees C. Our preliminary results indicate that nanostructured samples of (La0.8Sr0.2)(Ga0.9Mg0.1)O(3-delta) with 2 wt% of ceria composed of approximataley 14 nm grains can exhibit giant magnetoresistive effect in contrast to the usual paramagnetic properties measured on the samples with larger grain size.
Energy Technology Data Exchange (ETDEWEB)
Lim, Ae Ran, E-mail: aeranlim@hanmail.net [Department of Science Education, Jeonju University, Jeonju 560-759 (Korea, Republic of); Department of Carbon Fusion Engineering, Jeonju University, Jeonju 560-759 (Korea, Republic of)
2016-03-01
Temperature dependences of the chemical shift and spin-lattice relaxation time in the rotating frame T{sub 1ρ} were measured for {sup 1}H and {sup 13}C nuclei in mixed crystals of the form [N(CH{sub 3}){sub 4}]{sub 2}Zn{sub 1-x} Co{sub x}Cl{sub 4} (x = 0, 0.5, 0.7, 0.9, and 1). The mixed crystals varied in color according to the amount of Co{sup 2+} ions, whereas the phase transition temperatures remained nearly unchanged. [N(CH{sub 3}){sub 4}]{sub 2}ZnCl{sub 4} and [N(CH{sub 3}){sub 4}]{sub 2}CoCl{sub 4} crystals contain two nonequivalent types of a-N(CH{sub 3}){sub 4} and b-N(CH{sub 3}){sub 4}. The two crystallographically different ions a-N(CH{sub 3}){sub 4} and b-N(CH{sub 3}){sub 4} were distinguished using {sup 13}C CP/MAS NMR spectroscopy. The NMR spectrum and T{sub 1ρ} for {sup 1}H and {sup 13}C in case of x = 0.5 and x = 0.7 were similar to those for [N(CH{sub 3}){sub 4}]{sub 2}ZnCl{sub 4}, whereas those for x = 0.9 were absolutely different. Additionally, [N(CH{sub 3}){sub 4}]{sub 2}Zn{sub 0.1}Co{sub 0.9}Cl{sub 4} exhibited the structural properties of both [N(CH{sub 3}){sub 4}]{sub 2}ZnCl{sub 4} and [N(CH{sub 3}){sub 4}]{sub 2}CoCl{sub 4}. - Highlights: • Chemical shift and spin-lattice relaxation time in rotating frame. • Two crystallographically different ions a-N(CH{sub 3}){sub 4} and b-N(CH{sub 3}){sub 4}. • Structural properties of mixed crystals.
Reynolds-number dependence of turbulence enhancement on collision growth
Directory of Open Access Journals (Sweden)
R. Onishi
2016-10-01
Full Text Available This study investigates the Reynolds-number dependence of turbulence enhancement on the collision growth of cloud droplets. The Onishi turbulent coagulation kernel proposed in Onishi et al. (2015 is updated by using the direct numerical simulation (DNS results for the Taylor-microscale-based Reynolds number (Reλ up to 1140. The DNS results for particles with a small Stokes number (St show a consistent Reynolds-number dependence of the so-called clustering effect with the locality theory proposed by Onishi et al. (2015. It is confirmed that the present Onishi kernel is more robust for a wider St range and has better agreement with the Reynolds-number dependence shown by the DNS results. The present Onishi kernel is then compared with the Ayala–Wang kernel (Ayala et al., 2008a; Wang et al., 2008. At low and moderate Reynolds numbers, both kernels show similar values except for r2 ∼ r1, for which the Ayala–Wang kernel shows much larger values due to its large turbulence enhancement on collision efficiency. A large difference is observed for the Reynolds-number dependences between the two kernels. The Ayala–Wang kernel increases for the autoconversion region (r1, r2 < 40 µm and for the accretion region (r1 < 40 and r2 > 40 µm; r1 > 40 and r2 < 40 µm as Reλ increases. In contrast, the Onishi kernel decreases for the autoconversion region and increases for the rain–rain self-collection region (r1, r2 > 40 µm. Stochastic collision–coalescence equation (SCE simulations are also conducted to investigate the turbulence enhancement on particle size evolutions. The SCE with the Ayala–Wang kernel (SCE-Ayala and that with the present Onishi kernel (SCE-Onishi are compared with results from the Lagrangian Cloud Simulator (LCS; Onishi et al., 2015, which tracks individual particle motions and size evolutions in homogeneous isotropic turbulence. The SCE-Ayala and SCE-Onishi kernels show consistent
Defense AR Journal. Volume 18, Number 1, Issue 57
2011-01-01
Manual of the American Psychological Association ( 6th Edition ). For all other style questions, please refer to the Chicago Manual of Style (15th Edition ...112 Format Please submit your manuscript with references in APA format (author- date-page number form of citation) as outlined in the Publication ...Report Documentation Page Form ApprovedOMB No. 0704-0188 Public reporting burden for the collection of information is estimated to average 1 hour
Undergraduate Education with the WIYN 0.9-m Telescope
Pilachowski, Catherine A.
2017-01-01
Several models have been explored at Indiana University Bloomington for undergraduate student engagement in astronomy using the WIYN 0.9-m telescope at Kitt Peak. These models include individual student research projects using the telescope, student observations as part of an observational techniques course for majors, and enrichment activities for non-science majors in general education courses. Where possible, we arrange for students to travel to the telescope. More often, we are able to use simple online tools such as Skype and VNC viewers to give students an authentic observing experience. Experiences with the telescope motivate students to learn basic content in astronomy, including the celestial sphere, the electromagnetic spectrum, telescopes and detectors, the variety of astronomical objects, date reduction processes, image analysis, and color image creation and appreciation. The WIYN 0.9-m telescope is an essential tool for our program at all levels of undergraduate education
Screening for common copy-number variants in cancer genes.
Tyson, Jess; Majerus, Tamsin M O; Walker, Susan; Armour, John A L
2010-12-01
For most cases of colorectal cancer that arise without a family history of the disease, it is proposed that an appreciable heritable component of predisposition is the result of contributions from many loci. Although progress has been made in identifying single nucleotide variants associated with colorectal cancer risk, the involvement of low-penetrance copy number variants is relatively unexplored. We have used multiplex amplifiable probe hybridization (MAPH) in a fourfold multiplex (QuadMAPH), positioned at an average resolution of one probe per 2 kb, to screen a total of 1.56 Mb of genomic DNA for copy number variants around the genes APC, AXIN1, BRCA1, BRCA2, CTNNB1, HRAS, MLH1, MSH2, and TP53. Two deletion events were detected, one upstream of MLH1 in a control individual and the other in APC in a colorectal cancer patient, but these do not seem to correspond to copy number polymorphisms with measurably high population frequencies. In summary, by means of our QuadMAPH assay, copy number measurement data were of sufficient resolution and accuracy to detect any copy number variants with high probability. However, this study has demonstrated a very low incidence of deletion and duplication variants within intronic and flanking regions of these nine genes, in both control individuals and colorectal cancer patients. Copyright © 2010 Elsevier Inc. All rights reserved.
Copy number variation of KIR genes influences HIV-1 control
DEFF Research Database (Denmark)
Pelak, Kimberly; Need, Anna C; Fellay, Jacques
2011-01-01
A genome-wide screen for large structural variants showed that a copy number variant (CNV) in the region encoding killer cell immunoglobulin-like receptors (KIR) associates with HIV-1 control as measured by plasma viral load at set point in individuals of European ancestry. This CNV encompasses t...
Ueda, Yu; Odunayo, Adesola; Mann, F A
2013-01-01
To determine whether heparinized saline would be more effective in maintaining the patency of peripheral IV catheters in dogs compared to 0.9% sodium chloride. Prospective blinded randomized study. University Veterinary Teaching Hospital. Thirty healthy purpose bred dogs, intended for use in the junior surgery laboratory, were utilized. The dogs were randomized into 1 of 3 groups, 2 treatment groups and a control group. An 18-Ga cephalic catheter was placed in the cephalic vein of each dog. Each dog in the treatment group had their catheter flushed with either 10 IU/mL heparinized saline or 0.9% sodium chloride every 6 hours for 42 hours. The dogs in the control group did not have their catheters flushed until the end of the study period. Immediately prior to flushing catheters, each catheter was evaluated for patency by aspiration of blood and the catheter site was evaluated for phlebitis. All dogs in the heparinized saline and 0.9% sodium chloride group had catheters that flushed easily at each evaluation point. More dogs in the saline group had catheters from which blood could not be aspirated, but there was no significant difference between these groups. All dogs in the control group had catheters that flushed easily at the end of the assigned 6 hour interval except in 1 dog. Phlebitis was not detected in any dog. Flushes of 0.9% sodium chloride were found to be as effective as 10 IU/mL heparinized saline flushes in maintaining patency of 18-Ga peripheral venous catheters in dogs for up to 42 hours. For peripheral catheters placed with the intention of performing serial blood draws, heparinized flushes may be warranted. © Veterinary Emergency and Critical Care Society 2013.
Digital amateur observations of Venus at 0.9μm
Kardasis, E.
2017-09-01
Venus atmosphere is extremely dynamic, though it is very difficult to observe any features on it in the visible and even in the near-IR range. Digital observations with planetary cameras in recent years routinely produce high-quality images, especially in the near-infrared (0.7-1μm), since IR wavelengths are less influenced by Earth's atmosphere and Venus's atmosphere is partially transparent in this spectral region. Continuous observations over a few hours may track dark atmospheric features in the dayside and determine their motion. In this work we will present such observations and some dark-feature motion measurements at 0.9μm. Ground-based observations at this wavelength are rare and are complementary to in situ observations by JAXA's Akatsuki orbiter, that studies the atmospheric dynamics of Venus also in this band with the IR1 camera.
DEFF Research Database (Denmark)
Yap, Emily W.; Glaum, Julia; Oddershede, Jette
2018-01-01
The ferroelectric and piezoelectric properties of (Ba0.85Ca0.15)(Zr0.1Ti0.9)O3 (BCZT) ceramics were measured as a function of porosity. Porous BCZT ceramics were fabricated using the sacrificial fugitive technique. Two different pore morphologies were induced by adding polymeric microspheres...... and fibres as the pore-forming agents. Increasing porosity led to decreasing ferroelectric and piezoelectric properties due to a reduction of polarisable BCZT ceramic available. With the benefit of being a lead-free piezoelectric material, porous BCZT ceramics may be considered for acoustic impedance...
21 CFR 1.242 - What does assignment of a registration number mean?
2010-04-01
... 21 Food and Drugs 1 2010-04-01 2010-04-01 false What does assignment of a registration number mean? 1.242 Section 1.242 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL GENERAL ENFORCEMENT REGULATIONS Registration of Food Facilities Additional Provisions § 1...
Turbulence, raindrops and the l{sup 1/2} number density law
Energy Technology Data Exchange (ETDEWEB)
Lovejoy, S [Department of Physics, McGill University, 3600 University street, Montreal, Quebec, H3A 2T8 (Canada); Schertzer, D [Universite Paris-Est, ENPC/CEREVE, 77455 Marne-la-Vallee Cedex 2 (France)], E-mail: lovejoy@physics.mcgill.ca
2008-07-15
Using a unique data set of three-dimensional drop positions and masses (the HYDROP experiment), we show that the distribution of liquid water in rain displays a sharp transition between large scales which follow a passive scalar-like Corrsin-Obukhov (k{sup -5/3}) spectrum and a small-scale statistically homogeneous white noise regime. We argue that the transition scale l{sub c} is the critical scale where the mean Stokes number (= drop inertial time/turbulent eddy time) St{sub l} is unity. For five storms, we found l{sub c} in the range 45-75 cm with the corresponding dissipation scale St{sub {eta}} in the range 200-300. Since the mean interdrop distance was significantly smaller ({approx} 10 cm) than l{sub c} we infer that rain consists of 'patches' whose mean liquid water content is determined by turbulence with each patch being statistically homogeneous. For l>l{sub c}, we have St{sub l}<1 and due to the observed statistical homogeneity for l
76 FR 62047 - Proposed Information Collection Requests
2011-10-06
... Heightened Cash Monitoring 2 (HCM2). OMB Control Number: 1845-0089. Agency Form Number(s): N/A. Frequency of... payment for Reimbursement or Heightened Cash Monitoring 2 claims. Copies of the proposed information...
Directory of Open Access Journals (Sweden)
YUPING MA
2016-01-01
Full Text Available ABSTRACT A soil isolate, Penicillium janthinellum sw09 has been found to produce significant amounts of an extracellular pectinase subsequently characterized as exo-polygalacturonase (exo-PG. By optimizing growth conditions, P. janthinellum sw09 produced high amount of exo-PG (16.54 units/mL. The crude enzyme was purified by gel filtration chromatography and two exo-PG activity peaks (designated as PGI and PGII were revealed. On SDS-PAGE analysis, purified PGII using DEAE-Sepharose FF column, was found to be a single band with a molecular mass of 66.2 kDa. The purified PGII exhibited maximal activity at the temperature of 45 oC and pH 5.0. The stability profiles show that PGII is more stable in the pH range of 4.0-8.0 and below 60 oC. The Km and Vmax for the enzyme was 1.74 mg/mL and 18.08 μmol/ (mL•min, respectively. Due to this enzymatic characterization, this pectinase is an attractive candidate for applications in degradation of pectin.
A historical perspective of influenza A(H1N2) virus.
Komadina, Naomi; McVernon, Jodie; Hall, Robert; Leder, Karin
2014-01-01
The emergence and transition to pandemic status of the influenza A(H1N1)A(H1N1)pdm09) virus in 2009 illustrated the potential for previously circulating human viruses to re-emerge in humans and cause a pandemic after decades of circulating among animals. Within a short time of the initial emergence of A(H1N1)pdm09 virus, novel reassortants were isolated from swine. In late 2011, a variant (v) H3N2 subtype was isolated from humans, and by 2012, the number of persons infected began to increase with limited person-to-person transmission. During 2012 in the United States, an A(H1N2)v virus was transmitted to humans from swine. During the same year, Australia recorded its first H1N2 subtype infection among swine. The A(H3N2)v and A(H1N2)v viruses contained the matrix protein from the A(H1N1)pdm09 virus, raising the possibility of increased transmissibility among humans and underscoring the potential for influenza pandemics of novel swine-origin viruses. We report on the differing histories of A(H1N2) viruses among humans and animals.
Approximate particle number projection in hot nuclei
International Nuclear Information System (INIS)
Kosov, D.S.; Vdovin, A.I.
1995-01-01
Heated finite systems like, e.g., hot atomic nuclei have to be described by the canonical partition function. But this is a quite difficult technical problem and, as a rule, the grand canonical partition function is used in the studies. As a result, some shortcomings of the theoretical description appear because of the thermal fluctuations of the number of particles. Moreover, in nuclei with pairing correlations the quantum number fluctuations are introduced by some approximate methods (e.g., by the standard BCS method). The exact particle number projection is very cumbersome and an approximate number projection method for T ≠ 0 basing on the formalism of thermo field dynamics is proposed. The idea of the Lipkin-Nogami method to perform any operator as a series in the number operator powers is used. The system of equations for the coefficients of this expansion is written and the solution of the system in the next approximation after the BCS one is obtained. The method which is of the 'projection after variation' type is applied to a degenerate single j-shell model. 14 refs., 1 tab
True random numbers from amplified quantum vacuum.
Jofre, M; Curty, M; Steinlechner, F; Anzolin, G; Torres, J P; Mitchell, M W; Pruneri, V
2011-10-10
Random numbers are essential for applications ranging from secure communications to numerical simulation and quantitative finance. Algorithms can rapidly produce pseudo-random outcomes, series of numbers that mimic most properties of true random numbers while quantum random number generators (QRNGs) exploit intrinsic quantum randomness to produce true random numbers. Single-photon QRNGs are conceptually simple but produce few random bits per detection. In contrast, vacuum fluctuations are a vast resource for QRNGs: they are broad-band and thus can encode many random bits per second. Direct recording of vacuum fluctuations is possible, but requires shot-noise-limited detectors, at the cost of bandwidth. We demonstrate efficient conversion of vacuum fluctuations to true random bits using optical amplification of vacuum and interferometry. Using commercially-available optical components we demonstrate a QRNG at a bit rate of 1.11 Gbps. The proposed scheme has the potential to be extended to 10 Gbps and even up to 100 Gbps by taking advantage of high speed modulation sources and detectors for optical fiber telecommunication devices.
Recognition of sport players' numbers using fast-color segmentation
Verleysen, Cédric; De Vleeschouwer, Christophe
2012-01-01
This paper builds on a prior work for player detection, and proposes an efficient and effective method to distinguish among players based on the numbers printed on their jerseys. To extract the numbers, the dominant colors of the jersey are learnt during an initial phase and used to speed up the segmentation of the candidate digit regions. An additional set of criteria, considering the relative position and size (compared to the player bounding box) and the density (compared to the digit rectangular support) of the digit, are used to filter out the regions that obviously do not correspond to a digit. Once the plausible digit regions have been extracted, their recognition is based on feature-based classification. A number of original features are proposed to increase the robustness against digit appearance changes, resulting from the font thickness variability and from the deformations of the jersey during the game. Finally, the efficiency and the effectiveness of the proposed method are demonstrated on a real-life basketball dataset. It shows that the proposed segmentation runs about ten times faster than the mean-shift algorithm, but also outlines that the proposed additional features significantly increase the digit recognition accuracy. Despite significant deformations, 40% of the samples, that can be visually recognized as digits, are well classified as numbers. Out of these classified samples, more than 80% of them are correctly recognized. Besides, more than 95% of the samples, that are not numbers, are correctly identified as non-numbers.
Uncovering the Number and Clonal Dynamics of Mesp1 Progenitors during Heart Morphogenesis
Directory of Open Access Journals (Sweden)
Samira Chabab
2016-01-01
Full Text Available The heart arises from distinct sources of cardiac progenitors that independently express Mesp1 during gastrulation. The precise number of Mesp1 progenitors that are specified during the early stage of gastrulation, and their clonal behavior during heart morphogenesis, is currently unknown. Here, we used clonal and mosaic tracing of Mesp1-expressing cells combined with quantitative biophysical analysis of the clonal data to define the number of cardiac progenitors and their mode of growth during heart development. Our data indicate that the myocardial layer of the heart derive from ∼250 Mesp1-expressing cardiac progenitors born during gastrulation. Despite arising at different time points and contributing to different heart regions, the temporally distinct cardiac progenitors present very similar clonal dynamics. These results provide insights into the number of cardiac progenitors and their mode of growth and open up avenues to decipher the clonal dynamics of progenitors in other organs and tissues.
Transcriptional analysis of bla NDM-1 and copy number alteration under carbapenem stress
Directory of Open Access Journals (Sweden)
Deepjyoti Paul
2017-02-01
Full Text Available Abstract Background New Delhi metallo beta-lactamase is known to compromise carbapenem therapy and leading to treatment failure. However, their response to carbapenem stress is not clearly known. Here, we have investigated the transcriptional response of bla NDM-1 and plasmid copy number alteration under carbapenem exposure. Methods Three bla NDM-1 harboring plasmids representing three incompatibility types (IncFIC, IncA/C and IncK were inoculated in LB broth with and without imipenem, meropenem and ertapenem. After each 1 h total RNA was isolated, immediately reverse transcribed into cDNA and quantitative real time PCR was used for transcriptional expression of bla NDM-1. Horizontal transferability and stability of the plasmids encoding bla NDM-1 were also determined. Changes in copy number of bla NDM-1 harboring plasmids under the exposure of different carbapenems were determined by real time PCR. Clonal relatedness among the isolates was determined by pulsed field gel electrophoresis. Results Under carbapenem stress over an interval of time there was a sharp variation in the transcriptional expression of bla NDM-1 although it did not follow a specific pattern. All bla NDM-1 carrying plasmids were transferable by conjugation. These plasmids were highly stable and complete loss was observed between 92nd to 96th serial passages when antibiotic pressure was withdrawn. High copy number of bla NDM-1 was found for IncF type plasmids compared to the other replicon types. Conclusion This study suggests that the single dose of carbapenem pressure does not significantly influence the expression of bla NDM-1 and also focus on the stability of this gene as well as the change in copy number with respect to the incompatible type of plasmid harboring resistance determinant.
DEFF Research Database (Denmark)
Huang, Hua; Cheng, Shiyang; Gao, Jianfeng
2014-01-01
The dual-phase Ce0.9Gd0.1O1.95–La0.6Sr0.4Co0.2Fe0.8O3−δ asymmetric membrane was prepared via a phase-inversion tape-casting method. The membrane consisted of a thicker porous support layer and a thinner dense layer. When the dense side of the membrane was coated with a La0.6Sr0.4CoO3−δ catalytic...
Galindo, Danielle; Villanueva, Linda; Nguyen, Cathy; Patel, Milan; Borbridge, Lisa; Attar, Mayssa; Schiffman, Rhett M.; Hollander, David A.
2011-01-01
Abstract Purpose Anti-inflammatory activity of topical nonsteroidal anti-inflammatory drugs is mediated by suppression of cyclooxygenase (COX) isoenzymes. This study compared ocular penetration and inflammation suppression of topical ketorolac 0.45% and bromfenac 0.09% ophthalmic solutions in a rabbit model. Methods At hour 0, 36 rabbits received ketorolac 0.45%, bromfenac 0.09%, or an artificial tear 3 times once every 20 min. Half of the rabbits in each group then received intravenous injections of lipopolysaccharide (LPS) and fluorescein isothiocyanate (FITC)–dextran at hour 1, and the other half at hour 10. Aqueous and iris-ciliary body (ICB) samples were collected in the former group at hour 2 (peak) and in the latter group at hour 11 (trough) An additional group of 6 animals received only FITC-dextran, and samples were collected 1 h later. Peak and trough nonsteroidal anti-inflammatory drug concentrations were compared with previously determined half-maximal inhibitory concentrations (IC50) for COX isoenzymes. Results Peak and trough aqueous and ICB concentrations of ketorolac were at least 7-fold or greater than those of bromfenac. At peak levels, both ketorolac 0.45% and bromfenac 0.09% significantly inhibited LPS-induced aqueous prostaglandin E2 and FITC-dextran elevation (P < 0.01). At trough, both study drugs significantly inhibited LPS-induced aqueous prostaglandin E2 elevation (P < 0.05), but only ketorolac 0.45% significantly reduced LPS-induced aqueous FITC-dextran elevation (P < 0.01). Aqueous and ICB ketorolac concentrations exceeded its IC50 for COX-1 and COX-2 at peak and trough. Aqueous and ICB bromfenac levels exceeded its IC50 for COX-2 at peak and trough, but not for COX-1 at trough aqueous levels and peak and trough ICB levels. Conclusions Both ketorolac 0.45% and bromfenac 0.09% effectively suppressed inflammation at peak. At trough, only ketorolac 0.45% effectively suppressed inflammation as measured by FITC
International Nuclear Information System (INIS)
Nobile, A.; Dropinski, S.C.; Edwards, J.M.; Rivera, G.; Margevicius, R.W.; Sebring, R.J.; Olson, R. E.; Tanner, D.L.
2004-01-01
Beryllium-copper alloy (Be0.9%Cu) ICF capsules are being developed for the pursuit of thermonuclear ignition at the National Ignition Facility (NIF). Success of this capsule material requires that its shock propagation and radiation burnthrough characteristics be accurately understood. To this end, experiments are being conducted to measure the shock propagation and radiation burnthrough properties of Be0.9%Cu alloy. These experiments involve measurements on small Be0.9%Cu wedge, step and flat samples. Samples are mounted on 1.6-mm-diameter x 1.2-mm-length hohlraums that are illuminated by the OMEGA laser at the University of Rochester. X-rays produced by the hohlraum drive the sample. A streaked optical pyrometer detects breakout of the shock produced by the X-ray pulse. In this paper we describe synthesis of the alloy material, fabrication and characterization of samples, and assembly of the targets. Samples were produced from Be0.9%Cu alloy that was synthesized by hot isostatic pressing of Be powder and copper flake. Samples were 850 μm diameter disks with varying thickness in the case of wedge and step samples, and uniform thickness in the case of flat samples. Sample thickness varied in the range 10-90 μm. Samples were prepared by precision lathe machining and electric discharge machining. The samples were characterized by a Veeco white light interferometer and an optical thickness measurement device that simultaneously measured the upper and lower surface contours of samples using two confocal laser probes. Several campaigns with these samples have been conducted over the past two years
International Nuclear Information System (INIS)
Akbari-Fakhrabadi, A.; Avila, Ricardo E.; Carrasco, Hector E.; Ananthakumar, S.; Mangalaraja, R.V.
2012-01-01
Highlights: ► Combustion synthesis was followed to prepare NiO–GDC nanocomposite. ► NiO–GDC anode was applied over GDC electrolyte to fabricate a semi-cell. ► Electrical conductivity of the semi-cell was characterized. ► Structure, composition, particle size and morphology of NiO–GDC were studied. - Abstract: NiO–Ce 0.9 Gd 0.1 O 1.95 (NiO–10GDC) nanocomposite anode material was synthesized through combustion technique for possible low temperature solid oxide fuel cells (LT–SOFCs). A low weight loss is seen in the TG/DTA thermogram that indicates the complete combustion of the reactant mixtures. The powder X-ray diffraction patterns showed that the presence of NiO, GDC and Ni crystallite phases in the as combusted product. Upon calcination at 600 °C, the metallic Ni oxidized to NiO. TEM images showed a wide size distribution of fine spherical GDC and large irregularly shaped NiO particles. This NiO–10GDC anode material was applied over GDC electrolyte as a porous thin layer. Using this surface engineered GDC electrolyte a semi-cell (electrode/electrolyte structure) was fabricated. The electrical conductivity of the semi-cell was characterized with respect to temperature.
2013-09-24
...: Furnishing Identifying Number of Tax Return Preparer AGENCY: Internal Revenue Service (IRS), Treasury. ACTION... IRS is soliciting comments concerning furnishing identifying number of tax return preparer. DATES.... ADDRESSES: Direct all written comments to Yvette Lawrence, Internal Revenue Service, Room 6129, 1111...
Maheu, Christine; Bouhnik, Anne-Deborah; Nogues, Catherine; Mouret-Fourme, Emmanuelle; Stoppa-Lyonnet, Dominique; Lasset, Christine; Berthet, Pascaline; Fricker, Jean-Pierre; Caron, Olivier; Luporsi, Elizabeth; Gladieff, Laurence; Julian-Reynier, Claire
2014-04-01
The aim of this study is to prospectively determine the factors contributing to whether unaffected women from BRCA1/2 families reported that clinicians proposed psychological consultations and that they had attended these consultations during the genetic testing process. A prospective study was performed on a national cohort, using self-administered questionnaires to determine the rates of proposal and use of psychological services at the time of BRCA1/2 test result disclosure (N = 533) and during the first year after disclosure (N = 478) among unaffected French women from BRCA1/2 families who had undergone genetic testing for BRCA1/2. Multivariate adjustment was carried out using logistic regression models fitted using generalized estimation equations, with the genetic testing centre as the clustering variable. At the time of BRCA1/2 test result disclosure, a psychological consultation was proposed by cancer geneticists to 72% and 32% of the carriers (N = 232) and noncarriers (N = 301), respectively (p disclosure, 21% of the carriers had consulted a psychologist, versus 9% of the noncarriers (p distress they experienced about their genetic test results (proposal AOR: 1.02; 95% CI 1.01-1.03; uptake AOR: 1.04; 95% CI 1.02-1.06) CONCLUSIONS: Determinants of the proposal/uptake of psychological consultations in the BRCA1/2 testing process highlight the need for inventive strategies to reach the different types of women's profiles. Copyright © 2013 John Wiley & Sons, Ltd.
Verification testing of the Terre Hill Concrete Products Terre Kleen™ 09 was conducted on a 1.27 acre portion of the City of Harrisburg, Pennsylvania Department of Public Works facility. The Terre Kleen™ devices combines primary and secondary chambers, baffles, a screen, and incl...
22 CFR 231.09 - No acceleration of Eligible Notes.
2010-04-01
... Section 231.09 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ARAB REPUBLIC OF EGYPT LOAN GUARANTEES ISSUED UNDER THE EMERGENCY WARTIME SUPPLEMENTAL APPROPRIATIONS ACT OF 2003, PUBLIC LAW 108-11... have the right to pay any amounts in respect of the Eligible Notes other than in accordance with the...
Shen, Chong-Heng; Wang, Qin; Fu, Fang; Huang, Ling; Lin, Zhou; Shen, Shou-Yu; Su, Hang; Zheng, Xiao-Mei; Xu, Bin-Bin; Li, Jun-Tao; Sun, Shi-Gang
2014-04-23
In this work, the Li-rich oxide Li1.23Ni0.09Co0.12Mn0.56O2 was synthesized through a facile route called aqueous solution-evaporation route that is simple and without waste water. The as-prepared Li1.23Ni0.09Co0.12Mn0.56O2 oxide was confirmed to be a layered LiMO2-Li2MnO3 solid solution through ex situ X-ray diffraction (ex situ XRD) and transmission electron microscopy (TEM). Electrochemical results showed that the Li-rich oxide Li1.23Ni0.09Co0.12Mn0.56O2 material can deliver a discharge capacity of 250.8 mAhg(-1) in the 1st cycle at 0.1 C and capacity retention of 86.0% in 81 cycles. In situ X-ray diffraction technique (in situ XRD) and ex situ TEM were applied to study structural changes of the Li-rich oxide Li1.23Ni0.09Co0.12Mn0.56O2 material during charge-discharge cycles. The study allowed observing experimentally, for the first time, the existence of β-MnO2 phase that is appeared near 4.54 V in the first charge process, and a phase transformation of the β-MnO2 to layered Li0.9MnO2 is occurred in the initial discharge process by evidence of in situ XRD pattrens and selected area electron diffraction (SAED) patterns at different states of the initial charge and discharge process. The results illustrated also that the variation of the in situ X-ray reflections during charge-discharge cycling are clearly related to the changes of lattice parameters of the as-prepared Li-rich oxide during the charge-discharge cycles.
Braun, Dorothee; Schmidbauer, Martin; Hanke, Michael; Schwarzkopf, Jutta
2018-01-01
The formation process of a ferroelectric multi-rank domain pattern in the thickness range of 7-52 nm is investigated for monoclinic K0.9Na0.1NbO3 strained epitaxial films on (110) NdScO3 substrates. Although the elastic strain energy density is degenerated for two pseudocubic orientations, a distinctive hierarchy of domain evolution is observed with exclusive in-plane a1a2 domains for very thin films and the retarded onset of a ferroelectric MC phase at larger film thickness. This is accompanied by a thickness dependent transformation from stripe domains to a herringbone pattern and, eventually, for the thickest film, to a checkerboard-like structure. These transformations in the domain arrangement and width are correlated to energetic aspects as depolarization field and anisotropic strain relaxation in the film. While for the MC domains plastic strain relaxation is throughout observed, the a1a2 domains show a two-step strain relaxation mechanism starting with an in-plane elastic shearing, which is followed by plastic lattice relaxation. Our results highlight a pathway for engineering and patterning of periodic ferroelectric domain structures.
Sharma, Sarita; Sharma, Hakikat; Negi, N. S.
2018-05-01
Lead free Ba0.85Ca0.15Zr0.1Ti0.9O3(BCTZ) ceramic has been synthesized by sol-gel method. Properties of material are studied at different sintering temperatures for 5 hours. Structural and microstructural properties are analyzed by using X-ray diffractrometer (XRD) and scanning electron microscopy (SEM) at annealing temperature of 850°C and 1050°C XRD pattern confirm the perovskite structure of the material without any unwanted phases crystalinity increased with increase of sintering temperature so as roughness and porosity is decreased as shown by SEM micrographs. There is large improvement in density with rise of sintering temperature which also leads to drastic change in ferroelectric and dielectric properties.
DEFF Research Database (Denmark)
Hjalmarsson, Per; Hallinder, Jonathan; Mogensen, Mogens Bjerg
2012-01-01
A bi-continuous porous cathode consisting of nano-particles of strontium substituted lanthanum cobaltite (LSC) covering the surface of a Ce0.9Gd0.1O1.95 (CGO10) backbone has been produced. The polarization resistance (R (P)) of this cathode was measured to similar to 35 m Omega cm(2) at 650...... A degrees C. The area-specific resistance at 650 A degrees C (ASR) when applied onto an anode supported cell (ASC) was found to increase from 540 to 730 m Omega cm(2) when subjected to a thermal cycle to 850 A degrees C. This effect was attributed to particles coarsening but also to a reaction...
Number names and number understanding
DEFF Research Database (Denmark)
Ejersbo, Lisser Rye; Misfeldt, Morten
2014-01-01
This paper concerns the results from the first year of a three-year research project involving the relationship between Danish number names and their corresponding digits in the canonical base 10 system. The project aims to develop a system to help the students’ understanding of the base 10 syste...... the Danish number names are more complicated than in other languages. Keywords: A research project in grade 0 and 1th in a Danish school, Base-10 system, two-digit number names, semiotic, cognitive perspectives....
33 CFR 88.09 - Temporary exemption from light and shape requirements when operating under bridges.
2010-07-01
... and shape requirements when operating under bridges. 88.09 Section 88.09 Navigation and Navigable... Temporary exemption from light and shape requirements when operating under bridges. A vessel's navigation lights and shapes may be lowered if necessary to pass under a bridge. ...
Energy Technology Data Exchange (ETDEWEB)
Reis, S.L.; Grosso, R.L.; Muccillo, E.N.S., E-mail: shirley.reis@usp.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)
2012-07-01
Strontium and magnesium doped lanthanum gallate exhibits perovskite-type structure and high ionic conductivity. Other features of this ceramic material are large electrolytic regime and negligible electronic conductivity. These characteristics are responsible for the potential use of this solid electrolyte in solid oxide fuel cells operating at intermediate temperatures (~∼500-700 deg C). In this work, the composition La{sub 0.9}Sr{sub 0.1}Ga{sub 0.8}Mg{sub 0.2}O{sub 2.85} was prepared by the cation complexation technique aiming to obtain powder and sintered specimens with good chemical and structural homogeneities. X-ray diffraction results evidence that single phase was obtained, within the limitations of the technique, in samples sintered at 1350 deg C/4 h, with relative density above 92%. (author)
Directory of Open Access Journals (Sweden)
Zhang X
2013-03-01
C carriers had decreased REC/SPT with a HR of 0.09 (95% CI 0.01–0.71 and increased REC/SPT-free survival compared with those with haplotype P-498C--426A--339T. The P-498C--426A--339T-containing reporter construct had significantly increased luciferase expression. These results suggest that the GSTM1 CNV and promoter haplotype are better predictors of REC/SPTs of head and neck cancer than just measuring the presence/absence of GSTM1.Keywords: GSTM1, copy number variant, REC, SPT, single nucleotide polymorphism
78 FR 14822 - Proposed Information Collection; National Park Service Concessions
2013-03-07
... together with, if requested by the NPS, a written certification from a certified public accountant (CPA... and respondent burden, we invite the general public and other Federal agencies to take this...: (1) Proposals (partially approved under OMB Control Number 1024- 0125). The public solicitation...
26 CFR 31.3406(j)-1 - Taxpayer Identification Number (TIN) matching program.
2010-04-01
... 26 Internal Revenue 15 2010-04-01 2010-04-01 false Taxpayer Identification Number (TIN) matching program. 31.3406(j)-1 Section 31.3406(j)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... COLLECTION OF INCOME TAX AT SOURCE Collection of Income Tax at Source § 31.3406(j)-1 Taxpayer Identification...
ATLAS Monte Carlo tunes for MC09
The ATLAS collaboration
2010-01-01
This note describes the ATLAS tunes of underlying event and minimum bias description for the main Monte Carlo generators used in the MC09 production. For the main shower generators, pythia and herwig (with jimmy), the MRST LO* parton distribution functions (PDFs) were used for the first time in ATLAS. Special studies on the performance of these, conceptually new, PDFs for high pt physics processes at LHC energies are presented. In addition, a tune of jimmy for CTEQ6.6 is presented, for use with MC@NLO.
Reina, Jordi; Morales, Carmen; Busquets, María; Norte, Cristina
2017-06-07
Acute respiratory infections of viral cause are very frequent entities. The difficulty in evaluating the detection of a virus in these entities could be solved by determining the viral load. A prospective study on the mean Ct value (cycle threshold value) detected against RSV-A, RSV-B and influenza A (H1N1)pdm09, A (H3N2) and B viruses in patients of different origin and age was performed. Detection was performed using a commercial molecular amplification (RT-PCR) technique. Different mean Ct values were detected for each virus. In RSV infections, no differences were observed between those caused by RSV-A or RSV-B in children. Depending on the patient's age, the only statistical significance was observed in those included in the 0-4 month groups for RSV-A and this group and the 5-12 months group for RSV-B (higher values). A lower viral load was detected in adult patients than in paediatric patients. In influenza infections, no statistical significance was observed in the mean values detected in patients from the Red Centinela («sentinel network», a Spanish network of doctors aimed at research and surveillance of diseases), those diagnosed in the adult emergency room or in hospital admissions. In the adult patients admitted to the ICU, only a slightly lower mean value was observed in those infected with influenza A (H1N1)pdm09, but without statistical significance. There were no patients admitted to the ICU with influenza B infection. The detection of viral load could be a good tool for the evaluation, monitoring and prognosis of acute viral respiratory infections. With the exception of those caused by RSV, no significant differences were observed in influenza infections except in younger paediatric patients. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.
2012-06-18
... the FHA insurance fund. Agency form numbers, if applicable: HUD-92563I, HUD 92563A, HUD 92564-CN... to the proposal by name and/or OMB Control Number and should be sent to: Reports Liaison Officer... number for the Federal Information Relay Service (1-800-877-8339). FOR FURTHER INFORMATION CONTACT: Karin...
Low AMY1 Gene Copy Number Is Associated with Increased Body Mass Index in Prepubertal Boys.
Directory of Open Access Journals (Sweden)
M Loredana Marcovecchio
Full Text Available Genome-wide association studies have identified more than 60 single nucleotide polymorphisms associated with Body Mass Index (BMI. Additional genetic variants, such as copy number variations (CNV, have also been investigated in relation to BMI. Recently, the highly polymorphic CNV in the salivary amylase (AMY1 gene, encoding an enzyme implicated in the first step of starch digestion, has been associated with obesity in adults and children. We assessed the potential association between AMY1 copy number and a wide range of BMI in a population of Italian school-children.744 children (354 boys, 390 girls, mean age (±SD: 8.4±1.4years underwent anthropometric assessments (height, weight and collection of saliva samples for DNA extraction. AMY1 copies were evaluated by quantitative PCR.A significant increase of BMI z-score by decreasing AMY1 copy number was observed in boys (β: -0.117, p = 0.033, but not in girls. Similarly, waist circumference (β: -0.155, p = 0.003, adjusted for age was negatively influenced by AMY1 copy number in boys. Boys with 8 or more AMY1 copy numbers presented a significant lower BMI z-score (p = 0.04 and waist circumference (p = 0.01 when compared to boys with less than 8 copy numbers.In this pediatric-only, population-based study, a lower AMY1 copy number emerged to be associated with increased BMI in boys. These data confirm previous findings from adult studies and support a potential role of a higher copy number of the salivary AMY1 gene in protecting from excess weight gain.
Energy Technology Data Exchange (ETDEWEB)
Vinolin, Ada [Dept. of Physics, Madurai Kamaraj University College, Alagarkoil Road, Madurai-625002. India (India); Peter, A. John, E-mail: a.john.peter@gmail.com [Dept. of Physics, Govt. Arts College, Melur-625106. Madurai. India (India)
2015-06-24
Magneto-LO-polaron in a cylindrical GaAs{sub 0.9} P{sub 0.1} / GaAs{sub 0.6} P{sub 0.4} quantum dot is investigated taking into consideration of geometrical confinement effect. The effects of phonon on the exciton binding energy and the interband emission energy as a function of dot radius are found. The calculations are performed within the single band effective mass approximation using the variational method based on the Lee-Low-Pine LLP transformation.
Béthermin, M.; Dole, H.; Beelen, A.; Aussel, H.
2010-03-01
Aims: We aim to place stronger lower limits on the cosmic infrared background (CIB) brightness at 24 μm, 70 μm and 160 μm and measure the extragalactic number counts at these wavelengths in a homogeneous way from various surveys. Methods: Using Spitzer legacy data over 53.6 deg2 of various depths, we build catalogs with the same extraction method at each wavelength. Completeness and photometric accuracy are estimated with Monte-Carlo simulations. Number count uncertainties are estimated with a counts-in-cells moment method to take galaxy clustering into account. Furthermore, we use a stacking analysis to estimate number counts of sources not detected at 70 μm and 160 μm. This method is validated by simulations. The integration of the number counts gives new CIB lower limits. Results: Number counts reach 35 μJy, 3.5 mJy and 40 mJy at 24 μm, 70 μm, and 160 μm, respectively. We reach deeper flux densities of 0.38 mJy at 70, and 3.1 at 160 μm with a stacking analysis. We confirm the number count turnover at 24 μm and 70 μm, and observe it for the first time at 160 μm at about 20 mJy, together with a power-law behavior below 10 mJy. These mid- and far-infrared counts: 1) are homogeneously built by combining fields of different depths and sizes, providing a legacy over about three orders of magnitude in flux density; 2) are the deepest to date at 70 μm and 160 μm; 3) agree with previously published results in the common measured flux density range; 4) globally agree with the Lagache et al. (2004) model, except at 160 μm, where the model slightly overestimates the counts around 20 and 200 mJy. Conclusions: These counts are integrated to estimate new CIB firm lower limits of 2.29-0.09+0.09 nW m-2 sr-1, 5.4-0.4+0.4 nW m-2 sr-1, and 8.9-1.1+1.1 nW m-2 sr-1 at 24 μm, 70 μm, and 160 μm, respectively, and extrapolated to give new estimates of the CIB due to galaxies of 2.86-0.16+0.19 nW m-2 sr-1, 6.6-0.6+0.7 nW m-2 sr-1, and 14.6-2.9+7.1 nW m-2 sr-1
Energy Technology Data Exchange (ETDEWEB)
Mondal, Tanusree [Functional Ceramics Laboratory, Department of Applied Physics, Indian Institute of Technology (ISM), Dhanbad 826004 (India); Das, Sayantani [Department of Physics, University of Calcutta, 92, Acharya Prafulla Chandra Road, Kolkata 700009 (India); Badapanda, T. [Department of Physics, C.V. Raman College of Engineering, Bhubaneswar, Odisha 7520544 (India); Sinha, T.P. [Department of Physics, Bose Institute, 93/1, Acharya Prafulla Chandra Road, Kolkata 700009 (India); Sarun, P.M., E-mail: sarun.res@gmail.com [Functional Ceramics Laboratory, Department of Applied Physics, Indian Institute of Technology (ISM), Dhanbad 826004 (India)
2017-03-01
The Ca modified Ba{sub 1−x}Ca{sub x}Zr{sub 0.1}Ti{sub 0.9}O{sub 3} (BCZT) system for x=0.00–0.20 is synthesized by the high-temperature conventional solid state reaction method. The morphotropic phase boundary (MPB) between the tetragonal and cubic structure is obtained at room temperature for the composition x=0.15. The doping of Ca facilitates the enhancement of the homogeneity of microstructure and growth of the grain size. The phase transition is also confirmed by Raman spectroscopy. In order to explore the effect of Ca concentration variation on the conduction mechanism of BaZr{sub 0.1}Ti{sub 0.9}O{sub 3} (BZT) ceramic, the frequency dependent ac impedance spectroscopy technique is used at various temperatures. The effect of Ca doping on the electrical properties of BZT is clearly noticeable. The resistance of the grain (bulk) and the grain boundary is increased as a consequence of the increase in the activation energy of Ca substituted BZT samples. The enhanced resistivity of the Ca substituted BZT ceramics is explained in terms of the decrease in the mobility of the charge carriers associated with the lattice distortion. The electric modulus analysis reveals the enhanced capacitance of BCZT ceramics which is in good agreement with the results obtained from complex impedance analysis.
Higher first Chern numbers in one-dimensional Bose-Fermi mixtures
Knakkergaard Nielsen, Kristian; Wu, Zhigang; Bruun, G. M.
2018-02-01
We propose to use a one-dimensional system consisting of identical fermions in a periodically driven lattice immersed in a Bose gas, to realise topological superfluid phases with Chern numbers larger than 1. The bosons mediate an attractive induced interaction between the fermions, and we derive a simple formula to analyse the topological properties of the resulting pairing. When the coherence length of the bosons is large compared to the lattice spacing and there is a significant next-nearest neighbour hopping for the fermions, the system can realise a superfluid with Chern number ±2. We show that this phase is stable in a large region of the phase diagram as a function of the filling fraction of the fermions and the coherence length of the bosons. Cold atomic gases offer the possibility to realise the proposed system using well-known experimental techniques.
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the CAPE HATTERAS in the Gulf of Mexico from 2010-09-04 to 2010-09-15 in response to the...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-04 to 2010-09-08 in response to the...
Energy Technology Data Exchange (ETDEWEB)
Bartlett, Jennifer L.; Finch, Charlie T. [U.S. Naval Observatory, Washington, DC 20392 (United States); Lurie, John C. [Department of Astronomy, University of Washington, Seattle, WA 98195 (United States); Riedel, Adric [California Institute of Technology, Pasadena, CA 91125 (United States); Ianna, Philip A.; Henry, Todd J. [RECONS Institute, Chambersburg, PA 17201 (United States); Jao, Wei-Chun [Department of Physics and Astronomy, Georgia State University, Atlanta, GA 30302 (United States); Winters, Jennifer G. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Subasavage, John P., E-mail: jennifer.bartlett@navy.mil, E-mail: charlie.finch@usno.navy.mil, E-mail: lurie@uw.edu, E-mail: adric.riedel@gmail.com, E-mail: philianna3@gmail.com, E-mail: thenry@chara.gsu.edu, E-mail: jao@chara.gsu.edu, E-mail: jennifer.winters@cfa.harvard.edu, E-mail: jsubasavage@nofs.usno.navy.mil [U.S. Naval Observatory, Flagstaff, AZ 86001 (United States)
2017-10-01
As a step toward completing and characterizing the census of the solar neighborhood, we present astrometric, photometric, and spectroscopic observations of 32 systems observed with the Cerro Tololo Inter-American Observatory 0.9 m and 1.5 m telescopes. Astrometry from the 0.9 m indicates that among the 17 systems that had no previous published trigonometric parallaxes, 14 are within 25 pc. In the full sample, nine systems have proper motions larger than 0.″5 yr{sup −1}, including 2MASS J02511490-0352459, which exceeds 2.″0 yr{sup −1}. VRI photometry from the 0.9 m and optical spectra from the 1.5 m indicate that the targets have V = 11–22 mag and spectral types M3.0V–L3.0V. For 2MASS J23062928-0502285 (TRAPPIST-1), we present updated astrometry and photometric variability based on over 12 years of observations. Of the nine binaries in the sample, two promise mass determinations in the next decade: LHS 6167AB, an M4.5V system for which we present an accurate parallax placing the binary at 9.7 pc, and 2MASS J23515048-2537367AB, an M8.5V system at 21.1 pc for which we present the first evidence of an unseen, low-mass companion. Most importantly, Na i and K i gravity indicators, H α measurements, long-term photometric variability, locations on the H-R diagram, and kinematic assessments indicate that as many as 13 of the systems are young, including candidate members of young moving groups, with ages less than ∼120 Myr.
Bartlett, Jennifer L.; Lurie, John C.; Riedel, Adric; Ianna, Philip A.; Jao, Wei-Chun; Henry, Todd J.; Winters, Jennifer G.; Finch, Charlie T.; Subasavage, John P.
2017-10-01
As a step toward completing and characterizing the census of the solar neighborhood, we present astrometric, photometric, and spectroscopic observations of 32 systems observed with the Cerro Tololo Inter-American Observatory 0.9 m and 1.5 m telescopes. Astrometry from the 0.9 m indicates that among the 17 systems that had no previous published trigonometric parallaxes, 14 are within 25 pc. In the full sample, nine systems have proper motions larger than 0.″5 yr-1, including 2MASS J02511490-0352459, which exceeds 2.″0 yr-1. VRI photometry from the 0.9 m and optical spectra from the 1.5 m indicate that the targets have V = 11-22 mag and spectral types M3.0V-L3.0V. For 2MASS J23062928-0502285 (TRAPPIST-1), we present updated astrometry and photometric variability based on over 12 years of observations. Of the nine binaries in the sample, two promise mass determinations in the next decade: LHS 6167AB, an M4.5V system for which we present an accurate parallax placing the binary at 9.7 pc, and 2MASS J23515048-2537367AB, an M8.5V system at 21.1 pc for which we present the first evidence of an unseen, low-mass companion. Most importantly, Na I and K I gravity indicators, Hα measurements, long-term photometric variability, locations on the H-R diagram, and kinematic assessments indicate that as many as 13 of the systems are young, including candidate members of young moving groups, with ages less than ˜120 Myr.
National Oceanic and Atmospheric Administration, Department of Commerce — Physical and profile oceanographic data were collected aboard the Brooks McCall in the Gulf of Mexico from 2010-09-02 to 2010-09-06 in response to the Deepwater...
Diluted Ising spin 1/2 lattice with an arbitrary coordination number
International Nuclear Information System (INIS)
Bach Thanh Cong; El Amraoui, Y.
1993-01-01
A useful representation for the Callen identity in the case of spin 1/2 is introduced by a simple technique. The phase diagrams, percolation problems of the diluted Ising lattice with arbitrary coordination number z are also discussed. (author). 12 refs, 5 figs
Effect of blades number to performance of Savonius water turbine in water pipe
Hamzah, Imron; Prasetyo, Ari; Tjahjana, D. D. D. Prija; Hadi, Syamsul
2018-02-01
Savonius is usually known as a wind turbine that works efficiently at low wind speed. In this research, the Savonius turbine is proposed for a pico hydro power plant that is installed straightly on the 3-inch vertical pipeline of rainwater and household waste. The Savonius water turbine was designed with blade curvature angle of 70°, the aspect ratio of 1, turbine diameter of 82 mm, and endplate ratio of 1,1. The experimental study investigated the effect of blades number to the performance of Savonius turbine on various volume flow rate of water. Savonius turbine with three blades number generated the highest coefficient of performance of 0.23 on tip speed ratio of 1.7 compared to turbines with the number of other blades.
Tailoring of EIA-649-1: Definition of Major (Class I) Engineering Change Proposal
2015-05-15
MISSILE SYSTEMS CENTER TAILORING TAILORING OF EIA -649-1: DEFINITION OF MAJOR (CLASS I) ENGINEERING CHANGE PROPOSAL APPROVED FOR...PUBLIC RELEASE; DISTRIBUTION IS UNLIMITED 1 Tailoring of EIA -649-1: Definition of Major (Class I) ECP. 1. Intent of this Tailoring Document...This tailoring document remedies a requirements gap in the industry consensus standard, EIA -649-1: 2015. Specifically, this tailoring provides a
Atomic Fisher information versus atomic number
International Nuclear Information System (INIS)
Nagy, A.; Sen, K.D.
2006-01-01
It is shown that the Thomas-Fermi Fisher information is negative. A slightly more sophisticated model proposed by Gaspar provides a qualitatively correct expression for the Fisher information: Gaspar's Fisher information is proportional to the two-third power of the atomic number. Accurate numerical calculations show an almost linear dependence on the atomic number
Dicty_cDB: Contig-U16175-1 [Dicty_cDB
Lifescience Database Archive (English)
Full Text Available se ... 76 4e-09 1 ( FE846729 ) CAFI888.fwd CAFI Pichia stipitis aerobic dextrose... 76 4e-09 1 ( FE846728 ) ...CAFI888.rev CAFI Pichia stipitis aerobic dextrose... 76 4e-09 1 ( FE846485 ) CAFI759.fwd CAFI Pichia stipitis aerobic dextrose...... 76 4e-09 1 ( FE846484 ) CAFI759.rev CAFI Pichia stipitis aerobic dextrose...... 76 4e-09 1 ( FE845925 ) CAFI458.fwd CAFI Pichia stipitis aerobic dextrose... 76 4e-09 1 ( ...FE845924 ) CAFI458.rev CAFI Pichia stipitis aerobic dextrose... 76 4e-09 1 ( FE845522 ) CAFI1010.fwd CAFI Pi
PREFACE: International Conference on Computing in High Energy and Nuclear Physics (CHEP'09)
Gruntorad, Jan; Lokajicek, Milos
2010-11-01
The 17th International Conference on Computing in High Energy and Nuclear Physics (CHEP) was held on 21-27 March 2009 in Prague, Czech Republic. CHEP is a major series of international conferences for physicists and computing professionals from the worldwide High Energy and Nuclear Physics community, Computer Science, and Information Technology. The CHEP conference provides an international forum to exchange information on computing experience and needs for the community, and to review recent, ongoing and future activities. Recent conferences were held in Victoria, Canada 2007, Mumbai, India in 2006, Interlaken, Switzerland in 2004, San Diego, USA in 2003, Beijing, China in 2001, Padua, Italy in 2000. The CHEP'09 conference had 600 attendees with a program that included plenary sessions of invited oral presentations, a number of parallel sessions comprising 200 oral and 300 poster presentations, and an industrial exhibition. We thanks all the presenters, for the excellent scientific content of their contributions to the conference. Conference tracks covered topics on Online Computing, Event Processing, Software Components, Tools and Databases, Hardware and Computing Fabrics, Grid Middleware and Networking Technologies, Distributed Processing and Analysis and Collaborative Tools. The conference included excursions to Prague and other Czech cities and castles and a banquet held at the Zofin palace in Prague. The next CHEP conference will be held in Taipei, Taiwan on 18-22 October 2010. We would like thank the Ministry of Education Youth and Sports of the Czech Republic and the EU ACEOLE project for the conference support, further to commercial sponsors, the International Advisory Committee, the Local Organizing Committee members representing the five collaborating Czech institutions Jan Gruntorad (co-chair), CESNET, z.s.p.o., Prague Andrej Kugler, Nuclear Physics Institute AS CR v.v.i., Rez Rupert Leitner, Charles University in Prague, Faculty of Mathematics and