WorldWideScience

Sample records for promoter sequences enhance

  1. Draft Genome Sequence of Halomonas elongata Strain K4, an Endophytic Growth-Promoting Bacterium Enhancing Salinity Tolerance In Planta

    KAUST Repository

    Lafi, Feras Fawzi

    2016-11-04

    Halomonas elongata strain K4 is an endophytic bacterial strain that was isolated from roots of Cyperus conglomeratus collected at the Red Sea coast in Thuwal, Saudi Arabia. Here, we present a draft genome sequence of this strain, highlighting a number of pathways involved in plant growth promotion under salt stress.

  2. Draft Genome Sequence of Halomonas elongata Strain K4, an Endophytic Growth-Promoting Bacterium Enhancing Salinity Tolerance In Planta

    KAUST Repository

    Lafi, Feras Fawzi; Ramirez Prado, Juan Sebastian; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2016-01-01

    Halomonas elongata strain K4 is an endophytic bacterial strain that was isolated from roots of Cyperus conglomeratus collected at the Red Sea coast in Thuwal, Saudi Arabia. Here, we present a draft genome sequence of this strain, highlighting a number of pathways involved in plant growth promotion under salt stress.

  3. Compilation and analysis of Escherichia coli promoter DNA sequences.

    OpenAIRE

    Hawley, D K; McClure, W R

    1983-01-01

    The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...

  4. Enhancement of RNA synthesis by promoter duplication in tombusviruses

    International Nuclear Information System (INIS)

    Panavas, T.; Panaviene, Z.; Pogany, J.; Nagy, P.D.

    2003-01-01

    Replication of tombusviruses, small plus-strand RNA viruses of plants, is regulated by cis-acting elements present in the viral RNA. The role of cis-acting elements can be studied in vitro by using a partially purified RNA-dependent RNA polymerase (RdRp) preparation obtained from tombusvirus-infected plants , Virology 276, 279- 288). Here, we demonstrate that the minus-strand RNA of tombusviruses contains, in addition to the 3'-terminal minimal plus-strand initiation promoter, a second cis-acting element, termed the promoter proximal enhancer (PPE). The PPE element enhanced RNA synthesis by almost threefold from the adjacent minimal promoter in the in vitro assay. The sequence of the PPE element is 70% similar to the minimal promoter, suggesting that sequence duplication of the minimal promoter may have been the mechanism leading to the generation of the PPE. Consistent with this proposal, replacement of the PPE element with the minimal promoter, which resulted in a perfectly duplicated promoter region, preserved its enhancer-like function. In contrast, mutagenesis of the PPE element or its replacement with an artificial G/C-rich sequence abolished its stimulative effect on initiation of RNA synthesis in vitro. In vivo experiments are also consistent with the role of the PPE element in enhancement of tombusvirus replication. Sequence comparison of several tombusviruses and related carmoviruses further supports the finding that duplication of minimal promoter sequences may have been an important mechanism during the evolution of cis-acting elements in tombusviruses and related RNA viruses

  5. Enhanced throughput for infrared automated DNA sequencing

    Science.gov (United States)

    Middendorf, Lyle R.; Gartside, Bill O.; Humphrey, Pat G.; Roemer, Stephen C.; Sorensen, David R.; Steffens, David L.; Sutter, Scott L.

    1995-04-01

    Several enhancements have been developed and applied to infrared automated DNA sequencing resulting in significantly higher throughput. A 41 cm sequencing gel (31 cm well- to-read distance) combines high resolution of DNA sequencing fragments with optimized run times yielding two runs per day of 500 bases per sample. A 66 cm sequencing gel (56 cm well-to-read distance) produces sequence read lengths of up to 1000 bases for ds and ss templates using either T7 polymerase or cycle-sequencing protocols. Using a multichannel syringe to load 64 lanes allows 16 samples (compatible with 96-well format) to be visualized for each run. The 41 cm gel configuration allows 16,000 bases per day (16 samples X 500 bases/sample X 2 ten hour runs/day) to be sequenced with the advantages of infrared technology. Enhancements to internal labeling techniques using an infrared-labeled dATP molecule (Boehringer Mannheim GmbH, Penzberg, Germany; Sequenase (U.S. Biochemical) have also been made. The inclusion of glycerol in the sequencing reactions yields greatly improved results for some primer and template combinations. The inclusion of (alpha) -Thio-dNTP's in the labeling reaction increases signal intensity two- to three-fold.

  6. Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution

    Science.gov (United States)

    Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira

    2012-01-01

    Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569

  7. The sequence of spacers between the consensus sequences modulates the strength of procaryotic promoters

    DEFF Research Database (Denmark)

    Jensen, Peter Ruhdal; Hammer, Karin

    1998-01-01

    A library of synthetic promoters for Lactococcus lactis was constructed, in which the known consensus sequences were kept constant while the sequences of the separating spacers were randomized. The library consists of 38 promoters which differ in strength from 0.3 relative units, and up to more t......-reactors and cell factories....

  8. Effect of promoter strength and signal sequence on the periplasmic ...

    African Journals Online (AJOL)

    Two plasmids, pFLAG-ATS and pET 26b(+), were studied for the periplasmic expression of recombinant human interferon-2b (IFN-2b) in Escherichia coli. The pFLAG-ATS contains ompA signal sequence and tac promoter while pET 26b(+) contains pelB signal sequence and T7lac promoter. It was observed that periplasmic ...

  9. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    Science.gov (United States)

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-11

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

  10. Promoter2.0: for the recognition of PolII promoter sequences

    DEFF Research Database (Denmark)

    Knudsen, Steen; Knudsen, Steen

    1999-01-01

    Motivation : A new approach to the prediction of eukaryotic PolII promoters from DNA sequence takesadvantage of a combination of elements similar to neural networks and genetic algorithms to recognize a set ofdiscrete subpatterns with variable separation as one pattern: a promoter. The neural...... of optimization, the algorithm was able todiscriminate between vertebrate promoter and non-promoter sequences in a test set with a correlationcoefficient of 0.63. In addition, all five known transcription start sites on the plus strand of the completeadenovirus genome were within 161 bp of 35 predicted...

  11. Functional analysis of bipartite begomovirus coat protein promoter sequences

    International Nuclear Information System (INIS)

    Lacatus, Gabriela; Sunter, Garry

    2008-01-01

    We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters

  12. Effective Feature Selection for Classification of Promoter Sequences.

    Directory of Open Access Journals (Sweden)

    Kouser K

    Full Text Available Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine, KNN (K Nearest Neighbor and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species.

  13. Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

    Science.gov (United States)

    Amirhaeri, S; Wohlrab, F; Wells, R D

    1995-02-17

    The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

  14. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    OpenAIRE

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-01

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to ...

  15. Halotolerant rhizobacteria promote growth and enhance salinity tolerance in peanut

    Directory of Open Access Journals (Sweden)

    Sandeep Sharma

    2016-10-01

    Full Text Available Use of Plant growth promoting rhizobacteria (PGPR is a promising strategy to improve the crop production under optimal or sub-optimal conditions. In the present study, five diazotrophic salt tolerant bacteria were isolated from the roots of a halophyte, Arthrocnemum indicum. The isolates were partially characterized in vitro for plant growth promoting traits and evaluated for their potential to promote growth and enhanced salt tolerance in peanut. The 16S rRNA gene sequence homology indicated that these bacterial isolates belong to the genera, Klebisiella, Pseudomonas, Agrobacterium and Ochrobactrum. All isolates were nifH positive and able to produce indole -3-acetic acid (ranging from 11.5 to 19.1 µg ml-1. The isolates showed phosphate solubilisation activity (ranging from 1.4 to 55.6 µg phosphate /mg dry weight, 1-aminocyclopropane-1-carboxylate deaminase activity (0.1 to 0.31 µmol α-kB/µg protein/h and were capable of reducing acetylene in acetylene reduction assay (ranging from 0.95 to 1.8 µmol C2H4 mg protein/h. These isolates successfully colonized the peanut roots and were capable of promoting the growth under non-stress condition. A significant increase in total nitrogen (N content (up to 76% was observed over the non-inoculated control. All isolates showed tolerance to NaCl ranging from 4-8% in nutrient broth medium. Under salt stress, inoculated peanut seedlings maintained ion homeostasis, accumulated less reactive oxygen species (ROS and showed enhanced growth compared to non-inoculated seedlings. Overall, the present study has characterized several potential bacterial strains that showed an enhanced growth promotion effect on peanut under control as well as saline conditions. The results show the possibility to reduce chemical fertilizer inputs and may promote the use of bio-inoculants.

  16. Enhanced Dynamic Algorithm of Genome Sequence Alignments

    OpenAIRE

    Arabi E. keshk

    2014-01-01

    The merging of biology and computer science has created a new field called computational biology that explore the capacities of computers to gain knowledge from biological data, bioinformatics. Computational biology is rooted in life sciences as well as computers, information sciences, and technologies. The main problem in computational biology is sequence alignment that is a way of arranging the sequences of DNA, RNA or protein to identify the region of similarity and relationship between se...

  17. Cued memory reactivation during slow-wave sleep promotes explicit knowledge of a motor sequence.

    Science.gov (United States)

    Cousins, James N; El-Deredy, Wael; Parkes, Laura M; Hennies, Nora; Lewis, Penelope A

    2014-11-26

    Memories are gradually consolidated after initial encoding, and this can sometimes lead to a transition from implicit to explicit knowledge. The exact physiological processes underlying this reorganization remain unclear. Here, we used a serial reaction time task to determine whether targeted memory reactivation (TMR) of specific memory traces during slow-wave sleep promotes the emergence of explicit knowledge. Human participants learned two 12-item sequences of button presses (A and B). These differed in both cue order and in the auditory tones associated with each of the four fingers (one sequence had four higher-pitched tones). Subsequent overnight sleep was monitored, and the tones associated with one learned sequence were replayed during slow-wave sleep. After waking, participants demonstrated greater explicit knowledge (p = 0.005) and more improved procedural skill (p = 0.04) for the cued sequence relative to the uncued sequence. Furthermore, fast spindles (13.5-15 Hz) at task-related motor regions predicted overnight enhancement in procedural skill (r = 0.71, p = 0.01). Auditory cues had no effect on post-sleep memory performance in a control group who received TMR before sleep. These findings suggest that TMR during sleep can alter memory representations and promote the emergence of explicit knowledge, supporting the notion that reactivation during sleep is a key mechanism in this process. Copyright © 2014 Cousins et al.

  18. Cis-acting regulatory sequences promote high-frequency gene conversion between repeated sequences in mammalian cells.

    Science.gov (United States)

    Raynard, Steven J; Baker, Mark D

    2004-01-01

    In mammalian cells, little is known about the nature of recombination-prone regions of the genome. Previously, we reported that the immunoglobulin heavy chain (IgH) mu locus behaved as a hotspot for mitotic, intrachromosomal gene conversion (GC) between repeated mu constant (Cmu) regions in mouse hybridoma cells. To investigate whether elements within the mu gene regulatory region were required for hotspot activity, gene targeting was used to delete a 9.1 kb segment encompassing the mu gene promoter (Pmu), enhancer (Emu) and switch region (Smu) from the locus. In these cell lines, GC between the Cmu repeats was significantly reduced, indicating that this 'recombination-enhancing sequence' (RES) is necessary for GC hotspot activity at the IgH locus. Importantly, the RES fragment stimulated GC when appended to the same Cmu repeats integrated at ectopic genomic sites. We also show that deletion of Emu and flanking matrix attachment regions (MARs) from the RES abolishes GC hotspot activity at the IgH locus. However, no stimulation of ectopic GC was observed with the Emu/MARs fragment alone. Finally, we provide evidence that no correlation exists between the level of transcription and GC promoted by the RES. We suggest a model whereby Emu/MARS enhances mitotic GC at the endogenous IgH mu locus by effecting chromatin modifications in adjacent DNA.

  19. Prevalence of transcription promoters within archaeal operons and coding sequences.

    Science.gov (United States)

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  20. Enhancer-promoter interference and its prevention in transgenic plants

    Science.gov (United States)

    Transcriptional enhancer elements have been shown to override the specificity of nearby promoters in a position- and orientation-independent manner. This is problematic when multiple enhancers/promoters co-exist within a single transgenic construct as it has the potential to cause the mis-expressio...

  1. Enhanced learning of natural visual sequences in newborn chicks.

    Science.gov (United States)

    Wood, Justin N; Prasad, Aditya; Goldman, Jason G; Wood, Samantha M W

    2016-07-01

    To what extent are newborn brains designed to operate over natural visual input? To address this question, we used a high-throughput controlled-rearing method to examine whether newborn chicks (Gallus gallus) show enhanced learning of natural visual sequences at the onset of vision. We took the same set of images and grouped them into either natural sequences (i.e., sequences showing different viewpoints of the same real-world object) or unnatural sequences (i.e., sequences showing different images of different real-world objects). When raised in virtual worlds containing natural sequences, newborn chicks developed the ability to recognize familiar images of objects. Conversely, when raised in virtual worlds containing unnatural sequences, newborn chicks' object recognition abilities were severely impaired. In fact, the majority of the chicks raised with the unnatural sequences failed to recognize familiar images of objects despite acquiring over 100 h of visual experience with those images. Thus, newborn chicks show enhanced learning of natural visual sequences at the onset of vision. These results indicate that newborn brains are designed to operate over natural visual input.

  2. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    Directory of Open Access Journals (Sweden)

    R. Lakshmi

    2016-06-01

    Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.

  3. Strengthen Context To Enhance Health Promotion Effectiveness.

    Science.gov (United States)

    Sofian, Neal; Newton, Daniel; DeClaire, Joan

    2003-01-01

    Highlights one strategy to improve health promotion delivery and generate better outcomes by creating "Microcultures of Meaning" (MOMs), which are intended to provide a context to help people learn and take action. The issue introduces key theoretical concepts associated with the MOM methodology, describes the scientific rationale, discusses…

  4. In Vivo Enhancer Analysis Chromosome 16 Conserved NoncodingSequences

    Energy Technology Data Exchange (ETDEWEB)

    Pennacchio, Len A.; Ahituv, Nadav; Moses, Alan M.; Nobrega,Marcelo; Prabhakar, Shyam; Shoukry, Malak; Minovitsky, Simon; Visel,Axel; Dubchak, Inna; Holt, Amy; Lewis, Keith D.; Plajzer-Frick, Ingrid; Akiyama, Jennifer; De Val, Sarah; Afzal, Veena; Black, Brian L.; Couronne, Olivier; Eisen, Michael B.; Rubin, Edward M.

    2006-02-01

    The identification of enhancers with predicted specificitiesin vertebrate genomes remains a significant challenge that is hampered bya lack of experimentally validated training sets. In this study, weleveraged extreme evolutionary sequence conservation as a filter toidentify putative gene regulatory elements and characterized the in vivoenhancer activity of human-fish conserved and ultraconserved1 noncodingelements on human chromosome 16 as well as such elements from elsewherein the genome. We initially tested 165 of these extremely conservedsequences in a transgenic mouse enhancer assay and observed that 48percent (79/165) functioned reproducibly as tissue-specific enhancers ofgene expression at embryonic day 11.5. While driving expression in abroad range of anatomical structures in the embryo, the majority of the79 enhancers drove expression in various regions of the developingnervous system. Studying a set of DNA elements that specifically droveforebrain expression, we identified DNA signatures specifically enrichedin these elements and used these parameters to rank all ~;3,400human-fugu conserved noncoding elements in the human genome. The testingof the top predictions in transgenic mice resulted in a three-foldenrichment for sequences with forebrain enhancer activity. These datadramatically expand the catalogue of in vivo-characterized human geneenhancers and illustrate the future utility of such training sets for avariety of iological applications including decoding the regulatoryvocabulary of the human genome.

  5. Intragenic HIV-1 env sequences that enhance gag expression

    International Nuclear Information System (INIS)

    Suptawiwat, Ornpreya; Sutthent, Ruengpung; Lee, T.-H.; Auewarakul, Prasert

    2003-01-01

    Expression of HIV-1 genes is regulated at multiple levels including the complex RNA splicing and transport mechanisms. Multiple cis-acting elements involved in these regulations have been previously identified in various regions of HIV-1 genome. Here we show that another cis-acting element was present in HIV-1 env region. This element enhanced the expression of Gag when inserted together with Rev response element (RRE) into a truncated HIV-1 genome in the presence of Rev. The enhancing activity was mapped to a 263-bp fragment in the gp41 region downstream to RRE. RNA analysis showed that it might function by promoting RNA stability and Rev-dependent RNA export. The enhancement was specific to Rev-dependent expression, since it did not enhance Gag expression driven by Sam68, a cellular protein that has been shown to be able to substitute for Rev in RNA export function

  6. Genome Sequence of Bacillus velezensis S141, a New Strain of Plant Growth-Promoting Rhizobacterium Isolated from Soybean Rhizosphere.

    Science.gov (United States)

    Sibponkrung, Surachat; Kondo, Takahiko; Tanaka, Kosei; Tittabutr, Panlada; Boonkerd, Nantakorn; Teaumroong, Neung; Yoshida, Ken-Ichi

    2017-11-30

    Bacillus velezensis strain S141 is a plant growth-promoting rhizobacterium isolated from soybean ( Glycine max ) rhizosphere that enhances soybean growth, nodulation, and N 2 fixation efficiency by coinoculation with Bradyrhizobium diazoefficiens USDA110. The S141 genome was identified to comprise a 3,974,582-bp-long circular DNA sequence encoding at least 3,817 proteins. Copyright © 2017 Sibponkrung et al.

  7. Characterization and sequence analysis of the F2 promoter from corynephage BFK20

    International Nuclear Information System (INIS)

    Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.

    1994-01-01

    F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)

  8. Promoter2.0: for the recognition of PolII promoter sequences

    DEFF Research Database (Denmark)

    Knudsen, Steen; Knudsen, Steen

    1999-01-01

    transcription start sites. On standardized test setsconsisting of human genomic DNA, the performance of Promoter2.0 compares well with other softwaredeveloped for the same purpose. Availability : Promoter2.0 is available as a Web server at http://www.cbs.dtu.dk/services/promoter/ Contact : steen@cbs.dtu.dk...

  9. Draft Genome Sequence of Ochrobactrum intermedium Strain SA148, a Plant Growth-Promoting Desert Rhizobacterium

    KAUST Repository

    Lafi, Feras Fawzi

    2017-03-03

    Ochrobactrum intermedium strain SA148 is a plant growth-promoting bacterium isolated from sandy soil in the Jizan area of Saudi Arabia. Here, we report the 4.9-Mb draft genome sequence of this strain, highlighting different pathways characteristic of plant growth promotion activity and environmental adaptation of SA148.

  10. Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence

    International Nuclear Information System (INIS)

    Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.

    2015-01-01

    The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)

  11. Enhanced regulatory sequence prediction using gapped k-mer features.

    Science.gov (United States)

    Ghandi, Mahmoud; Lee, Dongwon; Mohammad-Noori, Morteza; Beer, Michael A

    2014-07-01

    Oligomers of length k, or k-mers, are convenient and widely used features for modeling the properties and functions of DNA and protein sequences. However, k-mers suffer from the inherent limitation that if the parameter k is increased to resolve longer features, the probability of observing any specific k-mer becomes very small, and k-mer counts approach a binary variable, with most k-mers absent and a few present once. Thus, any statistical learning approach using k-mers as features becomes susceptible to noisy training set k-mer frequencies once k becomes large. To address this problem, we introduce alternative feature sets using gapped k-mers, a new classifier, gkm-SVM, and a general method for robust estimation of k-mer frequencies. To make the method applicable to large-scale genome wide applications, we develop an efficient tree data structure for computing the kernel matrix. We show that compared to our original kmer-SVM and alternative approaches, our gkm-SVM predicts functional genomic regulatory elements and tissue specific enhancers with significantly improved accuracy, increasing the precision by up to a factor of two. We then show that gkm-SVM consistently outperforms kmer-SVM on human ENCODE ChIP-seq datasets, and further demonstrate the general utility of our method using a Naïve-Bayes classifier. Although developed for regulatory sequence analysis, these methods can be applied to any sequence classification problem.

  12. Enhanced regulatory sequence prediction using gapped k-mer features.

    Directory of Open Access Journals (Sweden)

    Mahmoud Ghandi

    2014-07-01

    Full Text Available Oligomers of length k, or k-mers, are convenient and widely used features for modeling the properties and functions of DNA and protein sequences. However, k-mers suffer from the inherent limitation that if the parameter k is increased to resolve longer features, the probability of observing any specific k-mer becomes very small, and k-mer counts approach a binary variable, with most k-mers absent and a few present once. Thus, any statistical learning approach using k-mers as features becomes susceptible to noisy training set k-mer frequencies once k becomes large. To address this problem, we introduce alternative feature sets using gapped k-mers, a new classifier, gkm-SVM, and a general method for robust estimation of k-mer frequencies. To make the method applicable to large-scale genome wide applications, we develop an efficient tree data structure for computing the kernel matrix. We show that compared to our original kmer-SVM and alternative approaches, our gkm-SVM predicts functional genomic regulatory elements and tissue specific enhancers with significantly improved accuracy, increasing the precision by up to a factor of two. We then show that gkm-SVM consistently outperforms kmer-SVM on human ENCODE ChIP-seq datasets, and further demonstrate the general utility of our method using a Naïve-Bayes classifier. Although developed for regulatory sequence analysis, these methods can be applied to any sequence classification problem.

  13. Matlab enhanced multi-threaded tomography optimization sequence (MEMTOS)

    International Nuclear Information System (INIS)

    Lum, Edward S.; Pope, Chad L.

    2016-01-01

    Highlights: • Monte Carlo simulation of spent nuclear fuel assembly neutron computed tomography. • Optimized parallel calculations conducted from within the MATLAB environment. • Projection difference technique used to identify anomalies in spent nuclear fuel assemblies. - Abstract: One challenge associated with spent nuclear fuel assemblies is the lack of non-destructive analysis techniques to determine if fuel pins have been removed or replaced or if there are significant defects associated with fuel pins deep within a fuel assembly. Neutron computed tomography is a promising technique for addressing these qualitative issues. Monte Carlo simulation of spent nuclear fuel neutron computed tomography allows inexpensive process investigation and optimization. The main purpose of this work is to provide a fully automated advanced simulation framework for the analysis of spent nuclear fuel inspection using neutron computed tomography. The simulation framework, called Matlab Enhanced Multi-Threaded Tomography Optimization Sequence (MEMTOS) not only automates the simulation process, but also generates superior tomography image results. MEMTOS is written in the MATLAB scripting language and addresses file management, parallel Monte Carlo execution, results extraction, and tomography image generation. This paper describes the mathematical basis for neutron computed tomography, the Monte Carlo technique used to simulate neutron computed tomography, and the overall tomography simulation optimization algorithm. Sequence results presented include overall simulation speed enhancement, tomography and image results obtained for Experimental Breeder Reactor II spent fuel assemblies and light water reactor fuel assemblies. Optimization using a projection difference technique are also described.

  14. In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

    OpenAIRE

    W.S.I. de Silva; M.M.N. Perera; K.L.N.S. Perera; A.M. Wickramasuriya; G.A.U. Jayasekera

    2017-01-01

    The promoter region of a drought and abscisic acid (ABA) inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involv...

  15. Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

    Science.gov (United States)

    He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

    2013-09-04

    To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

  16. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences

    OpenAIRE

    Lescot, Magali; Déhais, Patrice; Thijs, Gert; Marchal, Kathleen; Moreau, Yves; Van de Peer, Yves; Rouzé, Pierre; Rombauts, Stephane

    2002-01-01

    PlantCARE is a database of plant cis-acting regulatory elements, enhancers and repressors. Regulatory elements are represented by positional matrices, consensus sequences and individual sites on particular promoter sequences. Links to the EMBL, TRANSFAC and MEDLINE databases are provided when available. Data about the transcription sites are extracted mainly from the literature, supplemented with an increasing number of in silico predicted data. Apart from a general description for specific t...

  17. In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

    Directory of Open Access Journals (Sweden)

    W.S.I. de Silva

    2017-07-01

    Full Text Available The promoter region of a drought and abscisic acid (ABA inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involved in regulation of osr40c1 expression under different conditions were found in the 5′-upstream region of osr40c1. These are ABA-responsive element, light-responsive elements (ATCT-motif, Box I, G-box, GT1-motif, Gap-box and Sp1, myeloblastosis oncogene response element (CCAAT-box, auxin responsive element (TGA-element, gibberellin-responsive element (GARE-motif and fungal-elicitor responsive elements (Box E and Box-W1. A putative regulatory element, required for endosperm-specific pattern of gene expression designated as Skn-1 motif, was also detected in the Pokkali osr40c1 promoter region. In conclusion, the bioinformatic analysis of osr40c1 promoter region isolated from indica rice variety Pokkali led to the identification of several important stress-responsive cis-acting regulatory elements, and therefore, the isolated promoter sequence could be employed in rice genetic transformation to mediate expression of abiotic stress induced genes.

  18. Gene activation regresses atherosclerosis, promotes health, and enhances longevity

    Directory of Open Access Journals (Sweden)

    Luoma Pauli V

    2010-07-01

    Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.

  19. Draft Genome Sequence of Ochrobactrum intermedium Strain SA148, a Plant Growth-Promoting Desert Rhizobacterium

    KAUST Repository

    Lafi, Feras Fawzi; Alam, Intikhab; Geurts, Rene; Bisseling, Ton; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Ochrobactrum intermedium strain SA148 is a plant growth-promoting bacterium isolated from sandy soil in the Jizan area of Saudi Arabia. Here, we report the 4.9-Mb draft genome sequence of this strain, highlighting different pathways characteristic

  20. Perception Enhancement using Visual Attributes in Sequence Motif Visualization

    OpenAIRE

    Oon, Yin; Lee, Nung; Kok, Wei

    2016-01-01

    Sequence logo is a well-accepted scientific method to visualize the conservation characteristics of biological sequence motifs. Previous studies found that using sequence logo graphical representation for scientific evidence reports or arguments could seriously cause biases and misinterpretation by users. This study investigates on the visual attributes performance of a sequence logo in helping users to perceive and interpret the information based on preattentive theories and Gestalt principl...

  1. CaMV-35S promoter sequence-specific DNA methylation in lettuce.

    Science.gov (United States)

    Okumura, Azusa; Shimada, Asahi; Yamasaki, Satoshi; Horino, Takuya; Iwata, Yuji; Koizumi, Nozomu; Nishihara, Masahiro; Mishiba, Kei-ichiro

    2016-01-01

    We found 35S promoter sequence-specific DNA methylation in lettuce. Additionally, transgenic lettuce plants having a modified 35S promoter lost methylation, suggesting the modified sequence is subjected to the methylation machinery. We previously reported that cauliflower mosaic virus 35S promoter-specific DNA methylation in transgenic gentian (Gentiana triflora × G. scabra) plants occurs irrespective of the copy number and the genomic location of T-DNA, and causes strong gene silencing. To confirm whether 35S-specific methylation can occur in other plant species, transgenic lettuce (Lactuca sativa L.) plants with a single copy of the 35S promoter-driven sGFP gene were produced and analyzed. Among 10 lines of transgenic plants, 3, 4, and 3 lines showed strong, weak, and no expression of sGFP mRNA, respectively. Bisulfite genomic sequencing of the 35S promoter region showed hypermethylation at CpG and CpWpG (where W is A or T) sites in 9 of 10 lines. Gentian-type de novo methylation pattern, consisting of methylated cytosines at CpHpH (where H is A, C, or T) sites, was also observed in the transgenic lettuce lines, suggesting that lettuce and gentian share similar methylation machinery. Four of five transgenic lettuce lines having a single copy of a modified 35S promoter, which was modified in the proposed core target of de novo methylation in gentian, exhibited 35S hypomethylation, indicating that the modified sequence may be the target of the 35S-specific methylation machinery.

  2. Gift from statistical learning: Visual statistical learning enhances memory for sequence elements and impairs memory for items that disrupt regularities.

    Science.gov (United States)

    Otsuka, Sachio; Saiki, Jun

    2016-02-01

    Prior studies have shown that visual statistical learning (VSL) enhances familiarity (a type of memory) of sequences. How do statistical regularities influence the processing of each triplet element and inserted distractors that disrupt the regularity? Given that increased attention to triplets induced by VSL and inhibition of unattended triplets, we predicted that VSL would promote memory for each triplet constituent, and degrade memory for inserted stimuli. Across the first two experiments, we found that objects from structured sequences were more likely to be remembered than objects from random sequences, and that letters (Experiment 1) or objects (Experiment 2) inserted into structured sequences were less likely to be remembered than those inserted into random sequences. In the subsequent two experiments, we examined an alternative account for our results, whereby the difference in memory for inserted items between structured and random conditions is due to individuation of items within random sequences. Our findings replicated even when control letters (Experiment 3A) or objects (Experiment 3B) were presented before or after, rather than inserted into, random sequences. Our findings suggest that statistical learning enhances memory for each item in a regular set and impairs memory for items that disrupt the regularity. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. The complete genome sequence of the plant growth-promoting bacterium Pseudomonas sp. UW4.

    Directory of Open Access Journals (Sweden)

    Jin Duan

    Full Text Available The plant growth-promoting bacterium (PGPB Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated "housekeeping" genes (16S rRNA, gyrB, rpoB and rpoD of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup.

  4. The Complete Genome Sequence of the Plant Growth-Promoting Bacterium Pseudomonas sp. UW4

    Science.gov (United States)

    Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J.; Glick, Bernard R.

    2013-01-01

    The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated “housekeeping” genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524

  5. Pulse sequences for contrast-enhanced magnetic resonance imaging

    International Nuclear Information System (INIS)

    Graves, Martin J.

    2007-01-01

    The theory and application of magnetic resonance imaging (MRI) pulse sequences following the administration of an exogenous contrast agent are discussed. Pulse sequences are categorised according to the contrast agent mechanism: changes in proton density, relaxivity, magnetic susceptibility and resonant frequency shift. Applications in morphological imaging, magnetic resonance angiography, dynamic imaging and cell labelling are described. The importance of optimising the pulse sequence for each application is emphasised

  6. Distinct Prion Domain Sequences Ensure Efficient Amyloid Propagation by Promoting Chaperone Binding or Processing In Vivo.

    Directory of Open Access Journals (Sweden)

    Christine R Langlois

    2016-11-01

    Full Text Available Prions are a group of proteins that can adopt a spectrum of metastable conformations in vivo. These alternative states change protein function and are self-replicating and transmissible, creating protein-based elements of inheritance and infectivity. Prion conformational flexibility is encoded in the amino acid composition and sequence of the protein, which dictate its ability not only to form an ordered aggregate known as amyloid but also to maintain and transmit this structure in vivo. But, while we can effectively predict amyloid propensity in vitro, the mechanism by which sequence elements promote prion propagation in vivo remains unclear. In yeast, propagation of the [PSI+] prion, the amyloid form of the Sup35 protein, has been linked to an oligopeptide repeat region of the protein. Here, we demonstrate that this region is composed of separable functional elements, the repeats themselves and a repeat proximal region, which are both required for efficient prion propagation. Changes in the numbers of these elements do not alter the physical properties of Sup35 amyloid, but their presence promotes amyloid fragmentation, and therefore maintenance, by molecular chaperones. Rather than acting redundantly, our observations suggest that these sequence elements make complementary contributions to prion propagation, with the repeat proximal region promoting chaperone binding to and the repeats promoting chaperone processing of Sup35 amyloid.

  7. Sequencing of DC-SIGN promoter indicates an association between promoter variation and risk of nasopharyngeal carcinoma in cantonese

    Directory of Open Access Journals (Sweden)

    Liu Wen-Sheng

    2010-11-01

    Full Text Available Abstract Background The dendritic cell-specific intercellular adhesion molecule 3 grabbing non-integrin (DC-SIGN is an important pathogen recognition receptor of the innate immune system. DC-SIGN promoter variants play important role in the susceptibility to various infectious diseases. Nasopharyngeal carcinoma (NPC is a malignancy that is common in southern China and whether DC-SIGN promoter variants have effects on susceptibility to NPC is still unknown. The aim of this study is to ascertain the potential involvement of DC-SIGN promoter single nucleotide polymorphisms (SNPs in NPC susceptibility. Methods We conducted a case control study based on Cantonese population including 444 NPC patients and 464 controls matched on age and sex. The 1041 bp of DC-SIGN promoter region was directly sequenced for all samples. Sequence alignment and SNP search were inspected using DNAStar analysis programs and haplotype frequencies were estimated in Haploview V 4.0. The associations between the SNPs and the risk of NPC were analyzed using chi-square test and non-conditional logistic regression analysis with SPSS 13.0 software. Results A total of six variants were observed in the DC-SIGN promoter region and DC-SIGN -139 GG and -939 AA were significantly associated with NPC risk with adjusted Odds Ratios (ORs of 2.10 (95% confidence interval [CI] = 1.23-3.59; P = 0.006 and 2.52 (1.29-4.93; P = 0.007 respectively and subjects carrying the risk allele DC-SIGN -871 G had 1.47-fold (95% CI = 1.14-1.90 increased risks of developing NPC (P = 0.003. Haplotype analysis revealed that h1 'AAAG' was significantly associated with protection against NPC (OR = 0.69; P = 0.0002 and the association was still significant when using 1000 permutation test runs (P = 0.001. Conclusions Our study indicated that DC-SIGN promoter variants appear to be involved in the susceptibility to NPC and the detailed mechanism of this effect need further studies.

  8. Isolation and sequencing analysis on the seed-specific promoter from soybean

    Institute of Scientific and Technical Information of China (English)

    CAIYIN Qinggele; LI Mingchun; WEI Dongsheng; CAI Yi; XING Laijun

    2007-01-01

    The low level of foreign genes' expression in transgenic plants is a key factor that limits plant genetic engineering.Because of the critical regulatory activity of the promoters on gene transcription,they are studied extensively to improve the efficiency of the plant transgenic system.The constitutive promoters,such as CaMV 35S promoter,are usually used in plant genetic engineering.But those constitutive promoters continuously express their downstream genes during the whole life span in all the tissues of the host plants.This is not only wasteful to host plant's energy,but also harmful to host plants and usually affects their agronomic characteristics.In contrast,the seed-specific promoter only expresses its downstream genes from mid to late stage of seed maturation,and there is no expression or much lower expression in other tissues.So the seed-specific promoters are distinguished for their improvement and what they have brought to plant quality engineering.The aim of this article is to characterize a new seed-specific promoter and improve grain quality.The promoter region of β-conglycinin α-subunit gene was isolated from the genomic DNA of soybean Jilin 43 by PCR method,and successfully extended this fragment by TAIL PCR method and obtained the promoter fragment BCSP666.Sequencing analysis showed that the cloned fragment BCSP666 contained all of the motifs,such as RY repeat element,AG/CCCCA motif,TACACAT motif,ACGTmotif,A/T rich motif and E-box etc.,which constituted the seed-specific promoter activity.Based on this sequencing analysis,the seed-specific promoter activity of the fragment BCSP666 was predicted.And then the seed-specific expression vector pBI121-666,which contained GUS reporter gene,was constructed with the fragment BCSP666.Transformation of Arabidopsis thaliana plants by Agrobacterium-mediated floral-dip method with the recombined vector pBI121-666was conducted.The transgenic plants were selected on the kanamycin-resistant MS medium

  9. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  10. Effect of adenovirus infection on transgene expression under the adenoviral MLP/TPL and the CMVie promoter/enhancer in CHO cells

    Directory of Open Access Journals (Sweden)

    Mohamed A. El-Mogy

    2017-06-01

    Full Text Available The adenovirus major late promoter (MLP and its translational regulator – the tripartite leader (TPL sequence – can actively drive efficient gene expression during adenoviral infection. However, both elements have not been widely tested in transgene expression outside of the adenovirus genome context. In this study, we tested whether the combination of MLP and TPL would enhance transgene expression beyond that of the most widely used promoter in transgene expression in mammalian cells, the cytomegalovirus immediate early (CMVie promoter/enhancer. The activity of these two regulatory elements was compared in Chinese hamster ovary (CHO cells. Although transient expression was significantly higher under the control of the CMVie promoter/enhance compared to the MLP/TPL, this difference was greater at the level of transcription (30 folds than translation (11 folds. Even with adenovirus infection to provide additional elements (in trans, CMVie promoter/enhancer exhibited significantly higher activity relative to MLP/TPL. Interestingly, the CMVie promoter/enhancer was 1.9 folds more active in adenovirus-infected cells than in non-infected cells. Our study shows that the MLP-TPL drives lower transgene expression than the CMVie promoter/enhancer particularly at the transcription level. The data also highlight the utility of the TPL sequence at the translation level and/or possible overwhelming of the cellular translational machinery by the high transcription activity of the CMVie promoter/enhancer. In addition, here we present data that show stimulation of the CMVie promoter/enhancer by adenovirus infection, which may prove interesting in future work to test the combination of CMVie/TPL sequence, and additional adenovirus elements, for transgene expression.

  11. Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.

    Science.gov (United States)

    Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A

    1999-08-01

    Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.

  12. Pd enhanced WC catalyst to promote heterogeneous methane combustion

    International Nuclear Information System (INIS)

    Terracciano, Anthony Carmine; De Oliveira, Samuel; Siddhanti, Deepti; Blair, Richard; Vasu, Subith S.; Orlovskaya, Nina

    2017-01-01

    Highlights: • Pd enhanced WC catalyst particles were synthesized via mechanochemical alloying. • Catalyst was characterized by XRD, XRF, SEM, and EDS. • Catalyst was deposited on porous ZrO_2 and evaluated in heterogeneous combustion. • During combustion temperature profiles and spectral emissions were collected. - Abstract: The efficiency of combustion for low cost heat production could be greatly enhanced if an active and low cost catalyst would be used to facilitate the chemical reactions occurring during combustor operation. Within this work an experimental study of palladium (Pd) enhanced tungsten carbide (WC) catalyst, synthesized via high energy ball milling and deposited by dip coating onto a magnesia partially stabilized zirconia (MgO-ZrO_2) porous matrix of 10 ppin was evaluated in heterogeneous methane combustion. The synthesized powder was characterized by X-ray Diffraction (XRD), Scanning Electron Microscopy (SEM) coupled with Energy Dispersive Spectroscopy (EDS) analysis, as well as by X-ray Fluorescence (XRF); and the morphology of the deposited WC-Pd coating was also characterized using SEM and EDS. Performance evaluation of the heterogeneous combustor with WC-Pd coated MgO-ZrO_2 porous media was conducted at constant air flow rate and various equivalence ratios of methane/air gaseous mixtures, while monitoring axial temperature profiles within the combustion chamber using thermocouples, as well as thermal radiative and acoustic emissions from the combustor exhaust using an externally placed CCD camera and a microphone. It was found that there is a strong dependence of flame position and maximum temperature on equivalence ratio (φ) over the range of 0.47 ± 0.02 ⩽ φ ⩽ 0.75 ± 0.02. Additionally it was found that over the same equivalence ratio range, there is a characteristic 4 peak acoustic signature between 200 and 500 Hz. It was found that at higher equivalence ratios 0.51 ± 0.02 ⩽ φ ⩽ 0.75 ± 0.02 the performance of combustor

  13. Transcriptome Sequencing Revealed Significant Alteration of Cortical Promoter Usage and Splicing in Schizophrenia

    Science.gov (United States)

    Wu, Jing Qin; Wang, Xi; Beveridge, Natalie J.; Tooney, Paul A.; Scott, Rodney J.; Carr, Vaughan J.; Cairns, Murray J.

    2012-01-01

    Background While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression. Methodology/Principal Findings The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22) from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDRschizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia. PMID:22558445

  14. Enhanced Methods for Local Ancestry Assignment in Sequenced Admixed Individuals

    Science.gov (United States)

    Brown, Robert; Pasaniuc, Bogdan

    2014-01-01

    Inferring the ancestry at each locus in the genome of recently admixed individuals (e.g., Latino Americans) plays a major role in medical and population genetic inferences, ranging from finding disease-risk loci, to inferring recombination rates, to mapping missing contigs in the human genome. Although many methods for local ancestry inference have been proposed, most are designed for use with genotyping arrays and fail to make use of the full spectrum of data available from sequencing. In addition, current haplotype-based approaches are very computationally demanding, requiring large computational time for moderately large sample sizes. Here we present new methods for local ancestry inference that leverage continent-specific variants (CSVs) to attain increased performance over existing approaches in sequenced admixed genomes. A key feature of our approach is that it incorporates the admixed genomes themselves jointly with public datasets, such as 1000 Genomes, to improve the accuracy of CSV calling. We use simulations to show that our approach attains accuracy similar to widely used computationally intensive haplotype-based approaches with large decreases in runtime. Most importantly, we show that our method recovers comparable local ancestries, as the 1000 Genomes consensus local ancestry calls in the real admixed individuals from the 1000 Genomes Project. We extend our approach to account for low-coverage sequencing and show that accurate local ancestry inference can be attained at low sequencing coverage. Finally, we generalize CSVs to sub-continental population-specific variants (sCSVs) and show that in some cases it is possible to determine the sub-continental ancestry for short chromosomal segments on the basis of sCSVs. PMID:24743331

  15. Sequence conservation and combinatorial complexity of Drosophila neural precursor cell enhancers

    Directory of Open Access Journals (Sweden)

    Kuzin Alexander

    2008-08-01

    Full Text Available Abstract Background The presence of highly conserved sequences within cis-regulatory regions can serve as a valuable starting point for elucidating the basis of enhancer function. This study focuses on regulation of gene expression during the early events of Drosophila neural development. We describe the use of EvoPrinter and cis-Decoder, a suite of interrelated phylogenetic footprinting and alignment programs, to characterize highly conserved sequences that are shared among co-regulating enhancers. Results Analysis of in vivo characterized enhancers that drive neural precursor gene expression has revealed that they contain clusters of highly conserved sequence blocks (CSBs made up of shorter shared sequence elements which are present in different combinations and orientations within the different co-regulating enhancers; these elements contain either known consensus transcription factor binding sites or consist of novel sequences that have not been functionally characterized. The CSBs of co-regulated enhancers share a large number of sequence elements, suggesting that a diverse repertoire of transcription factors may interact in a highly combinatorial fashion to coordinately regulate gene expression. We have used information gained from our comparative analysis to discover an enhancer that directs expression of the nervy gene in neural precursor cells of the CNS and PNS. Conclusion The combined use EvoPrinter and cis-Decoder has yielded important insights into the combinatorial appearance of fundamental sequence elements required for neural enhancer function. Each of the 30 enhancers examined conformed to a pattern of highly conserved blocks of sequences containing shared constituent elements. These data establish a basis for further analysis and understanding of neural enhancer function.

  16. Inverted repeats in the promoter as an autoregulatory sequence for TcrX in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Bhattacharya, Monolekha; Das, Amit Kumar

    2011-01-01

    Highlights: ► The regulatory sequences recognized by TcrX have been identified. ► The regulatory region comprises of inverted repeats segregated by 30 bp region. ► The mode of binding of TcrX with regulatory sequence is unique. ► In silico TcrX–DNA docked model binds one of the inverted repeats. ► Both phosphorylated and unphosphorylated TcrX binds regulatory sequence in vitro. -- Abstract: TcrY, a histidine kinase, and TcrX, a response regulator, constitute a two-component system in Mycobacterium tuberculosis. tcrX, which is expressed during iron scarcity, is instrumental in the survival of iron-dependent M. tuberculosis. However, the regulator of tcrX/Y has not been fully characterized. Crosslinking studies of TcrX reveal that it can form oligomers in vitro. Electrophoretic mobility shift assays (EMSAs) show that TcrX recognizes two regions in the promoter that are comprised of inverted repeats separated by ∼30 bp. The dimeric in silico model of TcrX predicts binding to one of these inverted repeat regions. Site-directed mutagenesis and radioactive phosphorylation indicate that D54 of TcrX is phosphorylated by H256 of TcrY. However, phosphorylated and unphosphorylated TcrX bind the regulatory sequence with equal efficiency, which was shown with an EMSA using the D54A TcrX mutant.

  17. Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9

    Energy Technology Data Exchange (ETDEWEB)

    Neupane, Saraswoti [Uppsala University, Uppsala, Sweden; Hogberg, Nils [Uppsala University, Uppsala, Sweden; Alstrom, Sadhna [Uppsala University, Uppsala, Sweden; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Han, James [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Lu, Megan [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Fiebig, Anne [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Finlay, Roger D. [Uppsala University, Uppsala, Sweden

    2012-01-01

    Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010).

  18. Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638

    Science.gov (United States)

    Taghavi, Safiyh; van der Lelie, Daniel; Hoffman, Adam; Zhang, Yian-Biao; Walla, Michael D.; Vangronsveld, Jaco; Newman, Lee; Monchy, Sébastien

    2010-01-01

    Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa×deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plant roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT–PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to

  19. A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter

    Directory of Open Access Journals (Sweden)

    Ma Weiwei

    2009-01-01

    Full Text Available RNA interference (RNAi is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene.

  20. A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter

    Science.gov (United States)

    Weiwei, Ma; Zhenhua, Xie; Feng, Liu; Hang, Ning; Yuyang, Jiang

    2009-01-01

    RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. PMID:19859553

  1. The Evolution of Bony Vertebrate Enhancers at Odds with Their Coding Sequence Landscape.

    Science.gov (United States)

    Yousaf, Aisha; Sohail Raza, Muhammad; Ali Abbasi, Amir

    2015-08-06

    Enhancers lie at the heart of transcriptional and developmental gene regulation. Therefore, changes in enhancer sequences usually disrupt the target gene expression and result in disease phenotypes. Despite the well-established role of enhancers in development and disease, evolutionary sequence studies are lacking. The current study attempts to unravel the puzzle of bony vertebrates' conserved noncoding elements (CNE) enhancer evolution. Bayesian phylogenetics of enhancer sequences spotlights promising interordinal relationships among placental mammals, proposing a closer relationship between humans and laurasiatherians while placing rodents at the basal position. Clock-based estimates of enhancer evolution provided a dynamic picture of interspecific rate changes across the bony vertebrate lineage. Moreover, coelacanth in the study augmented our appreciation of the vertebrate cis-regulatory evolution during water-land transition. Intriguingly, we observed a pronounced upsurge in enhancer evolution in land-dwelling vertebrates. These novel findings triggered us to further investigate the evolutionary trend of coding as well as CNE nonenhancer repertoires, to highlight the relative evolutionary dynamics of diverse genomic landscapes. Surprisingly, the evolutionary rates of enhancer sequences were clearly at odds with those of the coding and the CNE nonenhancer sequences during vertebrate adaptation to land, with land vertebrates exhibiting significantly reduced rates of coding sequence evolution in comparison to their fast evolving regulatory landscape. The observed variation in tetrapod cis-regulatory elements caused the fine-tuning of associated gene regulatory networks. Therefore, the increased evolutionary rate of tetrapods' enhancer sequences might be responsible for the variation in developmental regulatory circuits during the process of vertebrate adaptation to land. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for

  2. Endoplasmic reticulum targeting sequence enhances HBV-specific cytotoxic T lymphocytes induced by a CTL epitope-based DNA vaccine

    International Nuclear Information System (INIS)

    Xu Wei; Chu Yiwei; Zhang Ruihua; Xu Huanbin; Wang Ying; Xiong Sidong

    2005-01-01

    CD8 + T cells play a critical role in protective immunity against Hepatitis B Virus (HBV). Epitope-based DNA vaccines expressing HBV-dominant CTL epitopes can be used as candidate vaccines capable of inducing cytotoxic T Lymphocytes (CTL) responses. A plasmid DNA encoding a CTL epitope of HBV core antigen, HBc 18-27 , was constructed. Intramuscular immunization of C57BL/6 mice with this DNA vaccine resulted in successful induction of HBV-specific CTL responses. In order to promote transportation of the peptide into endoplasmic reticulum (ER) to bind to MHC class I molecules for optimal class I antigen presentation, an ER targeting sequence (ERTS) was fused with the C 18-27 encoding gene. ERTS fusion significantly enhanced specific CD8 + T cell responses in terms of CTL cytolysis as well as IFN-γ secretion. This enhancement was correlated with promoted epitope presentation on target cell surface. We report here an enhanced immunogenicity of an epitope-based DNA vaccine using an ER targeting signal sequence, which has significant implications for future design of therapeutic HBV vaccine

  3. 9 CFR 3.81 - Environment enhancement to promote psychological well-being.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Environment enhancement to promote..., Treatment, and Transportation of Nonhuman Primates 2 Facilities and Operating Standards § 3.81 Environment..., document, and follow an appropriate plan for environment enhancement adequate to promote the psychological...

  4. Transcriptome sequencing revealed significant alteration of cortical promoter usage and splicing in schizophrenia.

    Directory of Open Access Journals (Sweden)

    Jing Qin Wu

    Full Text Available While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression.The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22 from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDR<0.05. Both types of transcriptional isoforms were exemplified by reads aligned to the neurodevelopmentally significant doublecortin-like kinase 1 (DCLK1 gene.This study provided the first deep and un-biased analysis of schizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia.

  5. A multi-slice gradient sequence for contrast enhanced MR diagnosis of intracranial tumours

    International Nuclear Information System (INIS)

    Schoerner, W.; Sander, B.; Kornmesser, W.; Laniado, M.; Nakamura, T.; Felix, R.

    1988-01-01

    A multi-slice gradient echo sequence (FLASH) was compared with a conventional spin-echo (SE) technique with regard to its value for contrast enhanced MR diagnosis. In 28 patients with cerebral tumours, SE images (SE 400/30; four images/3.4 minutes) and FLASH images (FLASH 315/14; 15 images/1.4 minutes) were obtained before and after gadolinium DTPA. After gadolinium-DTPA results were comparable for both techniques with respect to contrast enhancement, tumor contrast and delineation. Because of the higher efficiency of the FLASH 315/14 technique, this sequence is the method of choice for contrast enhanced cerebral MR imaging. (orig.) [de

  6. Plant Growth Promoting Rhizobacteria and Silicon Synergistically Enhance Salinity Tolerance of Mung Bean

    KAUST Repository

    Mahmood, Sajid; Daur, Ihsanullah; Al-Solaimani, Samir G.; Ahmad, Shakeel; Madkour, Mohamed H.; Yasir, Muhammad; Hirt, Heribert; Ali, Shawkat; Ali, Zahir

    2016-01-01

    The present study explored the eco-friendly approach of utilizing plant-growth-promoting rhizobacteria (PGPR) inoculation and foliar application of silicon (Si) to improve the physiology, growth, and yield of mung bean under saline conditions. We isolated 18 promising PGPR from natural saline soil in Saudi Arabia, and screened them for plant-growth-promoting activities. Two effective strains were selected from the screening trial, and were identified as Enterobacter cloacae and Bacillus drentensis using matrix-assisted laser desorption ionization-time-of-flight mass spectrometry and 16S rRNA gene sequencing techniques, respectively. Subsequently, in a 2-year mung bean field trial, using a randomized complete block design with a split-split plot arrangement, we evaluated the two PGPR strains and two Si levels (1 and 2 kg ha−1), in comparison with control treatments, under three different saline irrigation conditions (3.12, 5.46, and 7.81 dS m−1). The results indicated that salt stress substantially reduced stomatal conductance, transpiration rate, relative water content (RWC), total chlorophyll content, chlorophyll a, chlorophyll b, carotenoid content, plant height, leaf area, dry biomass, seed yield, and salt tolerance index. The PGPR strains and Si levels independently improved all the aforementioned parameters. Furthermore, the combined application of the B. drentensis strain with 2 kg Si ha−1 resulted in the greatest enhancement of mung bean physiology, growth, and yield. Overall, the results of this study provide important information for the benefit of the agricultural industry.

  7. Plant Growth Promoting Rhizobacteria and Silicon Synergistically Enhance Salinity Tolerance of Mung Bean

    KAUST Repository

    Mahmood, Sajid

    2016-06-17

    The present study explored the eco-friendly approach of utilizing plant-growth-promoting rhizobacteria (PGPR) inoculation and foliar application of silicon (Si) to improve the physiology, growth, and yield of mung bean under saline conditions. We isolated 18 promising PGPR from natural saline soil in Saudi Arabia, and screened them for plant-growth-promoting activities. Two effective strains were selected from the screening trial, and were identified as Enterobacter cloacae and Bacillus drentensis using matrix-assisted laser desorption ionization-time-of-flight mass spectrometry and 16S rRNA gene sequencing techniques, respectively. Subsequently, in a 2-year mung bean field trial, using a randomized complete block design with a split-split plot arrangement, we evaluated the two PGPR strains and two Si levels (1 and 2 kg ha−1), in comparison with control treatments, under three different saline irrigation conditions (3.12, 5.46, and 7.81 dS m−1). The results indicated that salt stress substantially reduced stomatal conductance, transpiration rate, relative water content (RWC), total chlorophyll content, chlorophyll a, chlorophyll b, carotenoid content, plant height, leaf area, dry biomass, seed yield, and salt tolerance index. The PGPR strains and Si levels independently improved all the aforementioned parameters. Furthermore, the combined application of the B. drentensis strain with 2 kg Si ha−1 resulted in the greatest enhancement of mung bean physiology, growth, and yield. Overall, the results of this study provide important information for the benefit of the agricultural industry.

  8. Functional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation

    International Nuclear Information System (INIS)

    Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio

    2005-01-01

    Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells

  9. An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR

    Directory of Open Access Journals (Sweden)

    Davis Thomas M

    2010-03-01

    Full Text Available Abstract Background Although technological advances allow for the economical acquisition of whole genome sequences, many organisms' genomes remain unsequenced, and fully sequenced genomes may contain gaps. Researchers reliant upon partial genomic or heterologous sequence information require methods for obtaining unknown sequences from loci of interest. Various PCR based techniques are available for sequence walking - i.e., the acquisition of unknown DNA sequence adjacent to known sequence. Many such methods require rigid, elaborate protocols and/or impose narrowly confined options in the choice of restriction enzymes for necessary genomic digests. We describe a new method, TOPO® Vector-Ligation PCR (or TVL-PCR that innovatively integrates available tools and familiar concepts to offer advantages as a means of both targeted sequence walking and paralog mining. Findings TVL-PCR exploits the ligation efficiency of the pCR®4-TOPO® (Invitrogen, Carlsbad, California vector system to capture fragments of unknown sequence by creating chimeric molecules containing defined priming sites at both ends. Initially, restriction enzyme-digested genomic DNA is end-repaired to create 3' adenosine overhangs and is then ligated to pCR4-TOPO vectors. The ligation product pool is used directly as a template for nested PCR, using specific primers to target orthologous sequences, or degenerate primers to enable capture of paralogous gene family members. We demonstrated the efficacy of this method by capturing entire coding and partial promoter sequences of several strawberry Superman-like genes. Conclusions TVL-PCR is a convenient and efficient method for DNA sequence walking and paralog mining that is applicable to any organism for which relevant DNA sequence is available as a basis for primer design.

  10. Enhancing Resources at the Workplace with Health-Promoting Leadership.

    Science.gov (United States)

    Jiménez, Paul; Bregenzer, Anita; Kallus, K Wolfgang; Fruhwirth, Bianca; Wagner-Hartl, Verena

    2017-10-20

    Leaders engaging in health-promoting leadership can influence their employees' health directly by showing health awareness or indirectly by changing working conditions. With health-promoting leadership, leaders are able to support a healthy working environment by providing resource-oriented working conditions for their employees to support their health. Changing working conditions in a health-supportive way can prevent possible negative consequences from critical working conditions (e.g., burnout risk). The present study examined the relationship between health-promoting leadership and the employees' resources, stress and burnout. To analyze our proposed model, structural equation modelling was conducted in two samples. The resulting model from the first sample of 228 Austrian workers was cross-validated and could be verified with the second sample (N = 263 Austrian workers). The results supported a model in which health-promoting leadership has a strong direct effect on the employees' resources and an indirect effect on stress and burnout, which was mediated by resources. The results indicate that health-promoting leadership describes the leaders' capability and dedication creating the right working conditions for their employees by increasing the employees' resources at the workplace. This in turn minimizes the risk of experiencing burnout.

  11. Enhancing Resources at the Workplace with Health-Promoting Leadership

    Directory of Open Access Journals (Sweden)

    Paul Jiménez

    2017-10-01

    Full Text Available Leaders engaging in health-promoting leadership can influence their employees’ health directly by showing health awareness or indirectly by changing working conditions. With health-promoting leadership, leaders are able to support a healthy working environment by providing resource-oriented working conditions for their employees to support their health. Changing working conditions in a health-supportive way can prevent possible negative consequences from critical working conditions (e.g., burnout risk. The present study examined the relationship between health-promoting leadership and the employees’ resources, stress and burnout. To analyze our proposed model, structural equation modelling was conducted in two samples. The resulting model from the first sample of 228 Austrian workers was cross-validated and could be verified with the second sample (N = 263 Austrian workers. The results supported a model in which health-promoting leadership has a strong direct effect on the employees’ resources and an indirect effect on stress and burnout, which was mediated by resources. The results indicate that health-promoting leadership describes the leaders’ capability and dedication creating the right working conditions for their employees by increasing the employees’ resources at the workplace. This in turn minimizes the risk of experiencing burnout.

  12. Enhanced activation of the left hemisphere promotes normative decision making.

    Science.gov (United States)

    Corser, Ryan; Jasper, John D

    2014-01-01

    Previous studies have reported that enhanced activation of the left cerebral hemisphere reduces risky-choice, attribute, and goal-framing effects relative to enhanced activation of the right cerebral hemisphere. The present study sought to extend these findings and show that enhanced activation of the left hemisphere also reduces violations of other normative principles, besides the invariance principle. Participants completed ratio bias (Experiment 1, N = 296) and base rate neglect problems (Experiment 2, N = 145) under normal (control) viewing or with the right or left hemisphere primarily activated by imposing a unidirectional gaze. In Experiment 1 we found that enhanced left hemispheric activation reduced the ratio bias relative to normal viewing and a group experiencing enhanced right hemispheric activation. In Experiment 2 enhanced left hemispheric activation resulted in using base rates more than normal viewing, but not significantly more than enhanced right hemispheric activation. Results suggest that hemispheric asymmetries can affect higher-order cognitive processes, such as decision-making biases. Possible theoretical accounts are discussed as well as implications for dual-process theories.

  13. Transcriptional activation signals found in the Epstein-Barr virus (EBV) latency C promoter are conserved in the latency C promoter sequences from baboon and Rhesus monkey EBV-like lymphocryptoviruses (cercopithicine herpesviruses 12 and 15).

    Science.gov (United States)

    Fuentes-Pananá, E M; Swaminathan, S; Ling, P D

    1999-01-01

    The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (-1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates.

  14. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  15. Genome Sequencing of a Mung Bean Plant Growth Promoting Strain of P. aeruginosa with Biocontrol Ability

    Directory of Open Access Journals (Sweden)

    Devaraj Illakkiam

    2014-01-01

    Full Text Available Pseudomonas aeruginosa PGPR2 is a mung bean rhizosphere strain that produces secondary metabolites and hydrolytic enzymes contributing to excellent antifungal activity against Macrophomina phaseolina, one of the prevalent fungal pathogens of mung bean. Genome sequencing was performed using the Ion Torrent Personal Genome Machine generating 1,354,732 reads (6,772,433 sequenced bases achieving ~25-fold coverage of the genome. Reference genome assembly using MIRA 3.4.0 yielded 198 contigs. The draft genome of PGPR2 encoded 6803 open reading frames, of which 5314 were genes with predicted functions, 1489 were genes of known functions, and 80 were RNA-coding genes. Strain specific and core genes of P. aeruginosa PGPR2 that are relevant to rhizospheric habitat were identified by pangenome analysis. Genes involved in plant growth promoting function such as synthesis of ACC deaminase, indole-3-acetic acid, trehalose, mineral scavenging siderophores, hydrogen cyanide, chitinases, acyl homoserine lactones, acetoin, 2,3-butanediol, and phytases were identified. In addition, niche-specific genes such as phosphate solubilising 3-phytase, adhesins, pathway-specific transcriptional regulators, a diguanylate cyclase involved in cellulose synthesis, a receptor for ferrienterochelin, a DEAD/DEAH-box helicase involved in stress tolerance, chemotaxis/motility determinants, an HtpX protease, and enzymes involved in the production of a chromanone derivative with potent antifungal activity were identified.

  16. A New Approach to Sequence Analysis Exemplified by Identification of cis-Elements in Abscisic Acid Inducible Promoters

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Hallin, Peter Fischer; Salomon, Jesper

    -regulatory elements. We have developed a method for identifying short, conserved motifs in biological sequences such as proteins, DNA and RNA5. This method was used for analysis of approximately 2000 Arabidopsis thaliana promoters that have been shown by DNA array analysis to be induced by abscisic acid6....... These promoters were compared to 28000 promoters that are not induced by abscisic acid. The analysis identified previously described ABA-inducible promoter elements such as ABRE, CE3 and CRT1 but also new cis-elements were found. Furthermore, the list of DNA elements could be used to predict ABA...

  17. Diagnostic accuracy of unenhanced, contrast-enhanced perfusion and angiographic MRI sequences for pulmonary embolism diagnosis: results of independent sequence readings

    Energy Technology Data Exchange (ETDEWEB)

    Revel, Marie Pierre [Hopital Europeen Georges Pompidou, APHP, Departments of Radiology, Paris (France); Universite Paris Descartes Sorbonne Paris Cite, Paris (France); Hotel-Dieu, Service de Radiologie, Paris (France); Sanchez, Olivier; Meyer, Guy [Hopital Europeen Georges Pompidou, APHP, Respiratory and intensive care and, Paris (France); Universite Paris Descartes Sorbonne Paris Cite, Paris (France); INSERM Unite 765, Paris (France); Lefort, Catherine; Couchon, Sophie; Hernigou, Anne; Frija, Guy [Hopital Europeen Georges Pompidou, APHP, Departments of Radiology, Paris (France); Niarra, Ralph [Hopital Europeen Georges Pompidou, APHP, Clinical Epidemiology, Paris (France); Universite Paris Descartes Sorbonne Paris Cite, Paris (France); Chatellier, Gilles [Hopital Europeen Georges Pompidou, APHP, Clinical Epidemiology, Paris (France); Universite Paris Descartes Sorbonne Paris Cite, Paris (France); INSERM CIC-EC E4, Paris (France)

    2013-09-15

    To independently evaluate unenhanced, contrast-enhanced perfusion and angiographic MR sequences for pulmonary embolism (PE) diagnosis. Prospective investigation, including 274 patients who underwent perfusion, unenhanced 2D steady-state-free-precession (SSFP) and contrast-enhanced 3D angiographic MR sequences on a 1.5-T unit, in addition to CTA (CT angiography). Two independent readers evaluated each sequence independently in random order. Sensitivity, specificity, predictive values and inter-reader agreement were calculated for each sequence, excluding sequences judged inconclusive. Sensitivity was also calculated according to PE location. Contrast-enhanced angiographic sequences showed the highest sensitivity (82.9 and 89.7 %, reader 1 and reader 2, respectively), specificity (98.5 and 100 %) and agreement (kappa value 0.77). Unenhanced angiographic sequences, although less sensitive overall (68.7 and 76.4 %), were sensitive for the detection of proximal PE (92.7 and 100 %) and showed high specificity (96.1 and 99.1 %) and good agreement (kappa value 0.62). Perfusion sequences showed lower sensitivity (75.0 and 79.3 %), specificity (84.8 and 89.7 %) and agreement (kappa value 0.51), and a negative predictive value of 84.8 % at best. Compared with contrast-enhanced angiographic sequences, unenhanced sequences demonstrate lower sensitivity, except for proximal PE, but high specificity and agreement. The negative predictive value of perfusion sequences was insufficient to safely rule out PE. (orig.)

  18. A tandem sequence motif acts as a distance-dependent enhancer in a set of genes involved in translation by binding the proteins NonO and SFPQ

    Directory of Open Access Journals (Sweden)

    Roepcke Stefan

    2011-12-01

    Full Text Available Abstract Background Bioinformatic analyses of expression control sequences in promoters of co-expressed or functionally related genes enable the discovery of common regulatory sequence motifs that might be involved in co-ordinated gene expression. By studying promoter sequences of the human ribosomal protein genes we recently identified a novel highly specific Localized Tandem Sequence Motif (LTSM. In this work we sought to identify additional genes and LTSM-binding proteins to elucidate potential regulatory mechanisms. Results Genome-wide analyses allowed finding a considerable number of additional LTSM-positive genes, the products of which are involved in translation, among them, translation initiation and elongation factors, and 5S rRNA. Electromobility shift assays then showed specific signals demonstrating the binding of protein complexes to LTSM in ribosomal protein gene promoters. Pull-down assays with LTSM-containing oligonucleotides and subsequent mass spectrometric analysis identified the related multifunctional nucleotide binding proteins NonO and SFPQ in the binding complex. Functional characterization then revealed that LTSM enhances the transcriptional activity of the promoters in dependency of the distance from the transcription start site. Conclusions Our data demonstrate the power of bioinformatic analyses for the identification of biologically relevant sequence motifs. LTSM and the here found LTSM-binding proteins NonO and SFPQ were discovered through a synergistic combination of bioinformatic and biochemical methods and are regulators of the expression of a set of genes of the translational apparatus in a distance-dependent manner.

  19. Use of promoters to enhance hydrodenitrogenation and hydrodeoxygenation catalysis

    Energy Technology Data Exchange (ETDEWEB)

    Hirschon, A.S.; Ackerman, L.L.; Laine, R.M.; Wilson, R.B. Jr. (SRI International, Menlo Park, CA (USA). Inorganic and Organometallic Chemistry Program)

    1989-10-01

    Results demonstrate that addition of an active transalkylation catalyst such as ruthenium to a CoMo catalyst greatly increased the HDN activity and selectivity to aromatic products, using quinoline as a model compound. Although the non-promoted CoMo was a better HDO catalyst, in the presence of both nitrogen and oxygen containing models, the RuCoMo was the superior HDO in terms of both activity and selectivity. 5 refs., 4 tabs.

  20. Sympathetic Innervation Promotes Arterial Fate by Enhancing Endothelial ERK Activity.

    Science.gov (United States)

    Pardanaud, Luc; Pibouin-Fragner, Laurence; Dubrac, Alexandre; Mathivet, Thomas; English, Isabel; Brunet, Isabelle; Simons, Michael; Eichmann, Anne

    2016-08-19

    Arterial endothelial cells are morphologically, functionally, and molecularly distinct from those found in veins and lymphatic vessels. How arterial fate is acquired during development and maintained in adult vessels is incompletely understood. We set out to identify factors that promote arterial endothelial cell fate in vivo. We developed a functional assay, allowing us to monitor and manipulate arterial fate in vivo, using arteries isolated from quails that are grafted into the coelom of chick embryos. Endothelial cells migrate out from the grafted artery, and their colonization of host arteries and veins is quantified. Here we show that sympathetic innervation promotes arterial endothelial cell fate in vivo. Removal of sympathetic nerves decreases arterial fate and leads to colonization of veins, whereas exposure to sympathetic nerves or norepinephrine imposes arterial fate. Mechanistically, sympathetic nerves increase endothelial ERK (extracellular signal-regulated kinase) activity via adrenergic α1 and α2 receptors. These findings show that sympathetic innervation promotes arterial endothelial fate and may lead to novel approaches to improve arterialization in human disease. © 2016 American Heart Association, Inc.

  1. OPTIMAL practice conditions enhance the benefits of gradually increasing error opportunities on retention of a stepping sequence task.

    Science.gov (United States)

    Levac, Danielle; Driscoll, Kate; Galvez, Jessica; Mercado, Kathleen; O'Neil, Lindsey

    2017-12-01

    Physical therapists should implement practice conditions that promote motor skill learning after neurological injury. Errorful and errorless practice conditions are effective for different populations and tasks. Errorful learning provides opportunities for learners to make task-relevant choices. Enhancing learner autonomy through choice opportunities is a key component of the Optimizing Performance through Intrinsic Motivation and Attention for Learning (OPTIMAL) theory of motor learning. The objective of this study was to evaluate the interaction between error opportunity frequency and OPTIMAL (autonomy-supportive) practice conditions during stepping sequence acquisition in a virtual environment. Forty healthy young adults were randomized to autonomy-supportive or autonomy-controlling practice conditions, which differed in instructional language, focus of attention (external vs internal) and positive versus negative nature of verbal and visual feedback. All participants practiced 40 trials of 4, six-step stepping sequences in a random order. Each of the 4 sequences offered different amounts of choice opportunities about the next step via visual cue presentation (4 choices; 1 choice; gradually increasing [1-2-3-4] choices, and gradually decreasing [4-3-2-1] choices). Motivation and engagement were measured by the Intrinsic Motivation Inventory (IMI) and the User Engagement Scale (UES). Participants returned 1-3 days later for retention tests, where learning was measured by time to complete each sequence. No choice cues were offered on retention. Participants in the autonomy-supportive group outperformed the autonomy-controlling group at retention on all sequences (mean difference 2.88s, p errorful (4 choice) sequence (p error opportunities over time, suggest that participants relied on implicit learning strategies for this full body task and that feedback about successes minimized errors and reduced their potential information-processing benefits. Subsequent

  2. Discriminative identification of transcriptional responses of promoters and enhancers after stimulus

    KAUST Repository

    Kleftogiannis, Dimitrios A.

    2016-10-17

    Promoters and enhancers regulate the initiation of gene expression and maintenance of expression levels in spatial and temporal manner. Recent findings stemming from the Cap Analysis of Gene Expression (CAGE) demonstrate that promoters and enhancers, based on their expression profiles after stimulus, belong to different transcription response subclasses. One of the most promising biological features that might explain the difference in transcriptional response between subclasses is the local chromatin environment. We introduce a novel computational framework, PEDAL, for distinguishing effectively transcriptional profiles of promoters and enhancers using solely histone modification marks, chromatin accessibility and binding sites of transcription factors and co-activators. A case study on data from MCF-7 cell-line reveals that PEDAL can identify successfully the transcription response subclasses of promoters and enhancers from two different stimulations. Moreover, we report subsets of input markers that discriminate with minimized classification error MCF-7 promoter and enhancer transcription response subclasses. Our work provides a general computational approach for identifying effectively cell-specific and stimulation-specific promoter and enhancer transcriptional profiles, and thus, contributes to improve our understanding of transcriptional activation in human.

  3. Promoter or enhancer, what's the difference? Deconstruction of established distinctions and presentation of a unifying model

    DEFF Research Database (Denmark)

    Andersson, Robin

    2015-01-01

    Gene transcription is strictly controlled by the interplay of regulatory events at gene promoters and gene-distal regulatory elements called enhancers. Despite extensive studies of enhancers, we still have a very limited understanding of their mechanisms of action and their restricted spatio......-temporal activities. A better understanding would ultimately lead to fundamental insights into the control of gene transcription and the action of regulatory genetic variants involved in disease. Here, I review and discuss pros and cons of state-of-the-art genomics methods to localize and infer the activity...... of enhancers. Among the different approaches, profiling of enhancer RNAs yields the highest specificity and may be superior in detecting in vivo activity. I discuss their apparent similarities to promoters, which challenge the established view of enhancers and promoters as distinct entities, and present...

  4. Enhanced spatio-temporal alignment of plantar pressure image sequences using B-splines.

    Science.gov (United States)

    Oliveira, Francisco P M; Tavares, João Manuel R S

    2013-03-01

    This article presents an enhanced methodology to align plantar pressure image sequences simultaneously in time and space. The temporal alignment of the sequences is accomplished using B-splines in the time modeling, and the spatial alignment can be attained using several geometric transformation models. The methodology was tested on a dataset of 156 real plantar pressure image sequences (3 sequences for each foot of the 26 subjects) that was acquired using a common commercial plate during barefoot walking. In the alignment of image sequences that were synthetically deformed both in time and space, an outstanding accuracy was achieved with the cubic B-splines. This accuracy was significantly better (p align real image sequences with unknown transformation involved, the alignment based on cubic B-splines also achieved superior results than our previous methodology (p alignment on the dynamic center of pressure (COP) displacement was also assessed by computing the intraclass correlation coefficients (ICC) before and after the temporal alignment of the three image sequence trials of each foot of the associated subject at six time instants. The results showed that, generally, the ICCs related to the medio-lateral COP displacement were greater when the sequences were temporally aligned than the ICCs of the original sequences. Based on the experimental findings, one can conclude that the cubic B-splines are a remarkable solution for the temporal alignment of plantar pressure image sequences. These findings also show that the temporal alignment can increase the consistency of the COP displacement on related acquired plantar pressure image sequences.

  5. Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli.

    Science.gov (United States)

    Urtecho, Guillaume; Tripp, Arielle D; Insigne, Kimberly; Kim, Hwangbeom; Kosuri, Sriram

    2018-02-01

    Promoters are the key drivers of gene expression and are largely responsible for the regulation of cellular responses to time and environment. In E. coli , decades of studies have revealed most, if not all, of the sequence elements necessary to encode promoter function. Despite our knowledge of these motifs, it is still not possible to predict the strength and regulation of a promoter from primary sequence alone. Here we develop a novel multiplexed assay to study promoter function in E. coli by building a site-specific genomic recombination-mediated cassette exchange (RMCE) system that allows for the facile construction and testing of large libraries of genetic designs integrated into precise genomic locations. We build and test a library of 10,898 σ70 promoter variants consisting of all combinations of a set of eight -35 elements, eight -10 elements, three UP elements, eight spacers, and eight backgrounds. We find that the -35 and -10 sequence elements can explain approximately 74% of the variance in promoter strength within our dataset using a simple log-linear statistical model. Neural network models can explain greater than 95% of the variance in our dataset, and show the increased power is due to nonlinear interactions of other elements such as the spacer, background, and UP elements.

  6. Contrast-enhanced dynamic MR imaging of parasellar tumor using fast spin-echo sequence

    International Nuclear Information System (INIS)

    Kusunoki, Katsusuke; Ohue, Shiro; Ichikawa, Haruhisa; Saito, Masahiro; Sadamoto, Kazuhiko; Sakaki, Saburo; Miki, Hitoshi.

    1995-01-01

    We have applied a new dynamic MRI technique that uses a fast spin-echo sequence to parasellar tumors. This sequence has less susceptible effect and better spatial resolution than a gradient echo sequence, providing faster images than a short spin-echo sequence does. Image was obtained in the coronal or sagittal plane using a 1.5T clinical MRI system, and then, dynamic MR images were acquired every 10 to 20 sec after administration of Gd-DTPA (0.1 mmol/kg). The subjects were 12 patients (5 microadenomas, 5 macroadenomas and 2 Rathke's cleft cysts) and 5 normal volunteers. As for volunteers, the cavernous sinus, pituitary stalk and posterior pituitary gland were contrasted on the first image, followed by visualization of the proximal portion adjacent to the junction of the infundibulum and the anterior pituitary gland, and finally by contrasting the distal portion of the anterior pituitary gland. There was a difference with respect to tumor contrast between microadenomas and macroadenomas. In the case of the macroadenomas, the tumor was contrasted at the same time as, or faster than the anterior pituitary gland, while with the microadenomas the tumor was enhanced later than the anterior pituitary gland. No enhancement with contrast medium was seen in Rathke's cleft cysts. In addition, it was possible to differentiate a recurrent tumor from a piece of muscle placed at surgery since the images obtained by the fast spin-echo sequence were clearer than those obtained by gradient echo sequence. (author)

  7. Sequence comparison for non-enhanced MRA of the lower extremity arteries at 7 Tesla.

    Directory of Open Access Journals (Sweden)

    Sören Johst

    Full Text Available In this study three sequences for non-contrast-enhanced MRA of the lower extremity arteries at 7T were compared. Cardiac triggering was used with the aim to reduce signal variations in the arteries. Two fast single-shot 2D sequences, a modified Ultrafast Spoiled Gradient Echo (UGRE sequence and a variant of the Quiescent-Interval Single-Shot (QISS sequence were triggered via phonocardiogram and compared in volunteer examinations to a non-triggered 2D gradient echo (GRE sequence. For image acquisition, a 16-channel transmit/receive coil and a manually positionable AngioSURF table were used. To tackle B1 inhomogeneities at 7T, Time-Interleaved Acquisition of Modes (TIAMO was integrated in GRE and UGRE. To compare the three sequences quantitatively, a vessel-to-background ratio (VBR was measured in all volunteers and stations. In conclusion, cardiac triggering was able to suppress flow artifacts satisfactorily. The modified UGRE showed only moderate image artifacts. Averaged over all volunteers and stations, GRE reached a VBR of 4.18±0.05, UGRE 5.20±0.06, and QISS 2.72±0.03. Using cardiac triggering and TIAMO imaging technique was essential to perform non-enhanced MRA of the lower extremities vessels at 7T. The modified UGRE performed best, as observed artifacts were only moderate and the highest average VBR was reached.

  8. Differential evolution optimization combined with chaotic sequences for image contrast enhancement

    Energy Technology Data Exchange (ETDEWEB)

    Santos Coelho, Leandro dos [Industrial and Systems Engineering Graduate Program, LAS/PPGEPS, Pontifical Catholic University of Parana, PUCPR Imaculada Conceicao, 1155, 80215-901 Curitiba, Parana (Brazil)], E-mail: leandro.coelho@pucpr.br; Sauer, Joao Guilherme [Industrial and Systems Engineering Graduate Program, LAS/PPGEPS, Pontifical Catholic University of Parana, PUCPR Imaculada Conceicao, 1155, 80215-901 Curitiba, Parana (Brazil)], E-mail: joao.sauer@gmail.com; Rudek, Marcelo [Industrial and Systems Engineering Graduate Program, LAS/PPGEPS, Pontifical Catholic University of Parana, PUCPR Imaculada Conceicao, 1155, 80215-901 Curitiba, Parana (Brazil)], E-mail: marcelo.rudek@pucpr.br

    2009-10-15

    Evolutionary Algorithms (EAs) are stochastic and robust meta-heuristics of evolutionary computation field useful to solve optimization problems in image processing applications. Recently, as special mechanism to avoid being trapped in local minimum, the ergodicity property of chaotic sequences has been used in various designs of EAs. Three differential evolution approaches based on chaotic sequences using logistic equation for image enhancement process are proposed in this paper. Differential evolution is a simple yet powerful evolutionary optimization algorithm that has been successfully used in solving continuous problems. The proposed chaotic differential evolution schemes have fast convergence rate but also maintain the diversity of the population so as to escape from local optima. In this paper, the image contrast enhancement is approached as a constrained nonlinear optimization problem. The objective of the proposed chaotic differential evolution schemes is to maximize the fitness criterion in order to enhance the contrast and detail in the image by adapting the parameters using a contrast enhancement technique. The proposed chaotic differential evolution schemes are compared with classical differential evolution to two testing images. Simulation results on three images show that the application of chaotic sequences instead of random sequences is a possible strategy to improve the performance of classical differential evolution optimization algorithm.

  9. The Ties That Bind: Mapping the Dynamic Enhancer-Promoter Interactome.

    Science.gov (United States)

    Spurrell, Cailyn H; Dickel, Diane E; Visel, Axel

    2016-11-17

    Coupling chromosome conformation capture to molecular enrichment for promoter-containing DNA fragments enables the systematic mapping of interactions between individual distal regulatory sequences and their target genes. In this Minireview, we describe recent progress in the application of this technique and related complementary approaches to gain insight into the lineage- and cell-type-specific dynamics of interactions between regulators and gene promoters. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    Directory of Open Access Journals (Sweden)

    Tatsuya eKon

    2014-11-01

    Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

  11. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

    Science.gov (United States)

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

    1987-01-01

    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  12. Targets of DNA-binding proteins in bacterial promoter regions present enhanced probabilities for spontaneous thermal openings

    International Nuclear Information System (INIS)

    Apostolaki, Angeliki; Kalosakas, George

    2011-01-01

    We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties

  13. [Brd3 promotes IL-6 production via enhancing acetylase CBP recruitment and histone 3 acetylation within IL6 promoter].

    Science.gov (United States)

    Ren, Wenhui; Sun, Donghao; Wang, Chunmei; Li, Nan

    2016-10-01

    Objective To investigate the role of bromodomain containing 3 (Brd3) in LPS-triggered interleukin-6 (IL-6) production in macrophages and the underlying mechanism. Methods CRISPR-Cas9 technology was used to screen an RAW264.7 cell line with Brd3 knockout (Brd3 -/- ). The Brd3 -/- cells were used as an experimental group, and the parential cells expressing wide-type Brd3 as a control group. The IL-6 level in cell culture supernatant was detected by ELISA after 100 ng/mL LPS challenging. Effect of Brd3 knockout on the expression and activation of signal pathways involved in IL-6 expression, including the NF-κB and mitogen-activated protein kinase (MAPK) pathways were examined by Western blot analysis. Chromatin immunoprecipitation (ChIP) assay was used to evaluate the recruitment of acetylase CREB-binding protein (CBP) to IL6 gene promoter and the acetylation level of histone 3 within IL6 gene promoter. Results LPS treatment significantly downregulated Brd3 expression in mouse peritoneal macrophages. LPS-induced production of IL-6 was significantly inhibited in Brd3 -/- macrophages. The expressions and activation of signal molecules within NF-κB and MAPK pathways were barely affected. Brd3 knockout significantly decreased the recruitment of acetylase CBP to IL6 gene promoter, and the acetylation level of histone3 within IL6 gene promoter was also repressed. Conclusion Brd3 promotes LPS-triggered IL-6 production via promoting the recruitment of CBP to IL6 promoter and enhancing the acetylation level of histone 3 within IL6 promoter.

  14. Draft Genome Sequence of Bacillus velezensis Lzh-a42, a Plant Growth-Promoting Rhizobacterium Isolated from Tomato Rhizosphere.

    Science.gov (United States)

    Li, Zhenghua; Chen, Mei; Ran, Kun; Wang, Jihua; Zeng, Qiangcheng; Song, Feng

    2018-03-22

    The plant growth-promoting rhizobacterium Bacillus velezensis strain Lzh-a42, which has antimicrobial activity, was isolated from tomato rhizosphere. Here, we report its genome sequence, which includes several predicted functional genes related to secondary metabolite biosynthesis, antimicrobial activity, and biofilm synthesis. Copyright © 2018 Li et al.

  15. Complete Genome Sequence of Bacillus velezensis GQJK49, a Plant Growth-Promoting Rhizobacterium with Antifungal Activity.

    Science.gov (United States)

    Ma, Jinjin; Liu, Hu; Liu, Kai; Wang, Chengqiang; Li, Yuhuan; Hou, Qihui; Yao, Liangtong; Cui, Yanru; Zhang, Tongrui; Wang, Haide; Wang, Beibei; Wang, Yun; Ge, Ruofei; Xu, Baochao; Yao, Gan; Xu, Wenfeng; Fan, Lingchao; Ding, Yanqin; Du, Binghai

    2017-08-31

    Bacillus velezensis GQJK49 is a plant growth-promoting rhizobacterium with antifungal activity, which was isolated from Lycium barbarum L. rhizosphere. Here, we report the complete genome sequence of B. velezensis GQJK49. Twelve gene clusters related to its biosynthesis of secondary metabolites, including antifungal and antibacterial antibiotics, were predicted. Copyright © 2017 Ma et al.

  16. Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis

    Energy Technology Data Exchange (ETDEWEB)

    Koeberl, Martina; White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele

    2015-08-13

    The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activities against plant pathogenic fungi, bacteria and nematodes, consists of a single 3.9 Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

  17. Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents.

    Science.gov (United States)

    Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z

    2014-03-01

    The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.

  18. Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites

    DEFF Research Database (Denmark)

    Tornøe, Jens; Kusk, P.; Johansen, T.E.

    2002-01-01

    The development of a set of synthetic mammalian promoters with different specific activities is described. The library is based on a synthetic promoter, JeT, constructed as a 200 bp chimeric promoter built from fragments of the viral SV40 early promoter and the human beta-actin and ubiquitin C...

  19. Polyandry promotes enhanced offspring survival in decorated crickets.

    Science.gov (United States)

    Ivy, Tracie M; Sakaluk, Scott K

    2005-01-01

    Although female multiple mating is ubiquitous in insects, its adaptive significance remains poorly understood. Benefits to multiple mating can accrue via direct material benefits, indirect genetic benefits, or both. We investigated the effects of multiple mating in the decorated cricket, Gryllodes sigillatus, by simultaneously varying the number of times that females mated and the number of different males with which they mated, measuring aspects of female fecundity and elements of offspring performance and viability. Multiple matings resulted in enhanced female fitness relative to single matings when females mated with different partners, but not when females mated repeatedly with the same male. Specifically, polyandrous females produced significantly more offspring surviving to reproductive maturity than did monogamous females mating once or mating repeatedly with the same male. These results suggest that the benefit females gain from multiple mating is influenced primarily by genetic and not material benefits.

  20. Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites

    DEFF Research Database (Denmark)

    Tornøe, Jens; Kusk, P.; Johansen, T.E.

    2002-01-01

    The development of a set of synthetic mammalian promoters with different specific activities is described. The library is based on a synthetic promoter, JeT, constructed as a 200 bp chimeric promoter built from fragments of the viral SV40 early promoter and the human beta-actin and ubiquitin C......, was obtained. The measured activity of each promoter in the library was highly specific and reproducible when tested in HiB5 and ARPE-19 cell culture....

  1. Placental Growth Factor Promotes Cardiac Muscle Repair via Enhanced Neovascularization

    Directory of Open Access Journals (Sweden)

    Jianfeng Zhang

    2015-06-01

    Full Text Available Background/Aims: Transplantation of mesenchymal stem cells (MSCs improves post-injury cardiac muscle repair using ill-defined mechanisms. Recently, we have shown that production and secretion of placental growth factor (PLGF by MSCs play a critical role in the MSCs-mediated post-injury cardiac muscle repair. In this study, we addressed the underlying molecular mechanisms, focusing specifically on the interactions between MSCs, macrophages and endothelial cells. Methods: We isolated macrophages (BM-MΦ from mouse bone-marrow derived cells based on F4/80 expression by flow cytometry. BM-MΦ were treated with different doses of PLGF. Cell number was analyzed by a MTT assay. Macrophage polarization was examined based on CD206 expression by flow cytometry. PLGF levels in macrophage subpopulations were analyzed by RT-qPCR and ELISA. Effects of macrophages on vascularization were evaluated by a collagen gel assay using Human umbilical vein endothelial cells (HUVECs co-cultured with PLGF-treated macrophages. Results: PLGF did not increase macrophage number, but dose-dependently polarized macrophages into a M2 subpopulation. M2 macrophages expressed high levels of PLGF. PLGF-polarized M2 macrophages significantly increased tubular structures in the collagen gel assay. Conclusion: Our data suggest that MSCs-derived PLGF may induce macrophage polarization into a M2 subpopulation, which in turn releases more PLGF to promote local neovascularization for augmenting post-injury cardiac muscle repair. This study thus sheds novel light on the role of PLGF in cardiac muscle regeneration.

  2. Using social media to enhance career development opportunities for health promotion professionals.

    Science.gov (United States)

    Roman, Leah A

    2014-07-01

    For health promotion professionals, social media offers many ways to engage with a broader range of colleagues; participate in professional development events; promote expertise, products, or services; and learn about career-enhancing opportunities such as funding and fellowships. Previous work has recommended "building networking into what you are already doing." This article provides updated and new social media resources, as well as practical examples and strategies to promote effective use of social media. Social media offers health promotion professionals cost-effective opportunities to enhance their career by building communities of practice, participating in professional development events, and enriching classroom learning. Developing the skills necessary to use social media for networking is important in the public health workforce, especially as social media is increasingly used in academic and practice settings. © 2014 Society for Public Health Education.

  3. A Synthetic Oligo Library and Sequencing Approach Reveals an Insulation Mechanism Encoded within Bacterial σ54 Promoters

    Directory of Open Access Journals (Sweden)

    Lior Levy

    2017-10-01

    Full Text Available We use an oligonucleotide library of >10,000 variants to identify an insulation mechanism encoded within a subset of σ54 promoters. Insulation manifests itself as reduced protein expression for a downstream gene that is expressed by transcriptional readthrough. It is strongly associated with the presence of short CT-rich motifs (3–5 bp, positioned within 25 bp upstream of the Shine-Dalgarno (SD motif of the silenced gene. We provide evidence that insulation is triggered by binding of the ribosome binding site (RBS to the upstream CT-rich motif. We also show that, in E. coli, insulator sequences are preferentially encoded within σ54 promoters, suggesting an important regulatory role for these sequences in natural contexts. Our findings imply that sequence-specific regulatory effects that are sparsely encoded by short motifs may not be easily detected by lower throughput studies. Such sequence-specific phenomena can be uncovered with a focused oligo library (OL design that mitigates sequence-related variance, as exemplified herein.

  4. MR of normal pancreas : comparison of five pulse sequences and enhancing patterns on dynamic imaging

    International Nuclear Information System (INIS)

    Jang, Hyun Jung; Kim, Tae Kyoung; Hong, Sung Hwan; Han, Joon Koo; Choi, Byung Ihn

    1997-01-01

    To compare T1-weighted FLASH and turbo spin echo (SE) T2-weighted sequences with conventional T1- and T2-weighted sequences in imaging normal pancreas and to describe the enhancing patterns on dynamic MR imging. Forty-four patients with presumed hepatic hemangiomas were studied at 1.0T or 1.5T by using conventional SE sequences (T1-weighted, T2-weighted, and heavily T2-weighted), turbo-SE T2-weighted sequences, and breath-hold T1-weighted FLASH sequences acquired before, immediately on, and at 1, 2, 3, and 5 or 10 minutes after injection of a bolus of gadopentetate dimeglumine. No patients had either a history or its clinical features of pancreatic disease. Images were quantitatively analyzed for signal-difference-to noise ratios (SD/Ns) between the pancreas and peripancreatic fat. Percentage enhancement of the pancreas was measured on each dynamic MR image. Conspicuity of the pancreatic border was qualitatively evaluated according to a consensus, reached by three radiologists. Turbo-SE T2-weighted images had a significantly higher SD/N ratio (p<0.001) and better conspicuity of the pancreatic border (p<0.001) than SE T2- and heavily T2-weighted images;T1-weighted SE images had a significantly higher SD/N ratio than T1-weighted FLASH images (p<0.001), but there was no significant difference between tham in qualitative analysis (p=0.346). Percentage enhancement immediately on and at 1, 2, 3, 5, and 10 minutes after administration of contrast material was 39.9%, 44.5%, 42.9%, 40.8%, 36.3%, 29.9%, respectively, with peak enhancement at 1 minute. In MR imaging of normal pancreas, turbo-SE T2-weighted imaging is superior to SE T2- and heavily T2- weighted imaging, and SE T1-weighted imaging is superior to T1-weighted FLASH imaging. On serial gadolinium-enhanced FLASH imaging, normal pancreas shows peak enhancement at 1 minute

  5. Rationally designed turn promoting mutation in the amyloid-β peptide sequence stabilizes oligomers in solution.

    Directory of Open Access Journals (Sweden)

    Jayakumar Rajadas

    Full Text Available Enhanced production of a 42-residue beta amyloid peptide (Aβ(42 in affected parts of the brain has been suggested to be the main causative factor for the development of Alzheimer's Disease (AD. The severity of the disease depends not only on the amount of the peptide but also its conformational transition leading to the formation of oligomeric amyloid-derived diffusible ligands (ADDLs in the brain of AD patients. Despite being significant to the understanding of AD mechanism, no atomic-resolution structures are available for these species due to the evanescent nature of ADDLs that hinders most structural biophysical investigations. Based on our molecular modeling and computational studies, we have designed Met35Nle and G37p mutations in the Aβ(42 peptide (Aβ(42Nle35p37 that appear to organize Aβ(42 into stable oligomers. 2D NMR on the Aβ(42Nle35p37 peptide revealed the occurrence of two β-turns in the V24-N27 and V36-V39 stretches that could be the possible cause for the oligomer stability. We did not observe corresponding NOEs for the V24-N27 turn in the Aβ(21-43Nle35p37 fragment suggesting the need for the longer length amyloid peptide to form the stable oligomer promoting conformation. Because of the presence of two turns in the mutant peptide which were absent in solid state NMR structures for the fibrils, we propose, fibril formation might be hindered. The biophysical information obtained in this work could aid in the development of structural models for toxic oligomer formation that could facilitate the development of therapeutic approaches to AD.

  6. Simultaneous activation of parallel sensory pathways promotes a grooming sequence in Drosophila

    Science.gov (United States)

    Hampel, Stefanie; McKellar, Claire E

    2017-01-01

    A central model that describes how behavioral sequences are produced features a neural architecture that readies different movements simultaneously, and a mechanism where prioritized suppression between the movements determines their sequential performance. We previously described a model whereby suppression drives a Drosophila grooming sequence that is induced by simultaneous activation of different sensory pathways that each elicit a distinct movement (Seeds et al., 2014). Here, we confirm this model using transgenic expression to identify and optogenetically activate sensory neurons that elicit specific grooming movements. Simultaneous activation of different sensory pathways elicits a grooming sequence that resembles the naturally induced sequence. Moreover, the sequence proceeds after the sensory excitation is terminated, indicating that a persistent trace of this excitation induces the next grooming movement once the previous one is performed. This reveals a mechanism whereby parallel sensory inputs can be integrated and stored to elicit a delayed and sequential grooming response. PMID:28887878

  7. Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

    Directory of Open Access Journals (Sweden)

    Yasuhito Ohsaka

    2010-01-01

    Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

  8. Mapping the transcription start points of the Staphylococcus aureus eap, emp, and vwb promoters reveals a conserved octanucleotide sequence that is essential for expression of these genes.

    Science.gov (United States)

    Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan

    2008-01-01

    Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.

  9. Functional assessment of human enhancer activities using whole-genome STARR-sequencing.

    Science.gov (United States)

    Liu, Yuwen; Yu, Shan; Dhiman, Vineet K; Brunetti, Tonya; Eckart, Heather; White, Kevin P

    2017-11-20

    Genome-wide quantification of enhancer activity in the human genome has proven to be a challenging problem. Recent efforts have led to the development of powerful tools for enhancer quantification. However, because of genome size and complexity, these tools have yet to be applied to the whole human genome.  In the current study, we use a human prostate cancer cell line, LNCaP as a model to perform whole human genome STARR-seq (WHG-STARR-seq) to reliably obtain an assessment of enhancer activity. This approach builds upon previously developed STARR-seq in the fly genome and CapSTARR-seq techniques in targeted human genomic regions. With an improved library preparation strategy, our approach greatly increases the library complexity per unit of starting material, which makes it feasible and cost-effective to explore the landscape of regulatory activity in the much larger human genome. In addition to our ability to identify active, accessible enhancers located in open chromatin regions, we can also detect sequences with the potential for enhancer activity that are located in inaccessible, closed chromatin regions. When treated with the histone deacetylase inhibitor, Trichostatin A, genes nearby this latter class of enhancers are up-regulated, demonstrating the potential for endogenous functionality of these regulatory elements. WHG-STARR-seq provides an improved approach to current pipelines for analysis of high complexity genomes to gain a better understanding of the intricacies of transcriptional regulation.

  10. Sequence analysis of the Epstein-Barr virus (EBV) latent membrane protein-1 gene and promoter region

    DEFF Research Database (Denmark)

    Sandvej, Kristian; Gratama, J W; Munch, M

    1997-01-01

    Sequence variations in the Epstein-Barr virus (EBV) encoded latent membrane protein-1 (LMP-1) gene have been described in a Chinese nasopharyngeal carcinoma-derived isolate (CAO), and in viral isolates from various EBV-associated tumors. It has been suggested that these genetic changes, which...... include loss of a Xho I restriction site (position 169425) and a C-terminal 30-base pair (bp) deletion (position 168287-168256), define EBV genotypes associated with increased tumorigenicity or with disease among particular geographic populations. To determine the frequency of LMP-1 variations in European...... wild-type virus isolates, we sequenced the LMP-1 promoter and gene in EBV from lymphoblastoid cell lines from healthy carriers and patients without EBV-associated disease. Sequence changes were often present, and defined at least four main groups of viral isolates, which we designate Groups A through D...

  11. First draft genome sequencing of indole acetic acid producing and plant growth promoting fungus Preussia sp. BSL10.

    Science.gov (United States)

    Khan, Abdul Latif; Asaf, Sajjad; Khan, Abdur Rahim; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung

    2016-05-10

    Preussia sp. BSL10, family Sporormiaceae, was actively producing phytohormone (indole-3-acetic acid) and extra-cellular enzymes (phosphatases and glucosidases). The fungus was also promoting the growth of arid-land tree-Boswellia sacra. Looking at such prospects of this fungus, we sequenced its draft genome for the first time. The Illumina based sequence analysis reveals an approximate genome size of 31.4Mbp for Preussia sp. BSL10. Based on ab initio gene prediction, total 32,312 coding sequences were annotated consisting of 11,967 coding genes, pseudogenes, and 221 tRNA genes. Furthermore, 321 carbohydrate-active enzymes were predicted and classified into many functional families. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

    Directory of Open Access Journals (Sweden)

    Hoorig Nassanian

    2007-08-01

    Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.

  13. Discriminative identification of transcriptional responses of promoters and enhancers after stimulus

    KAUST Repository

    Kleftogiannis, Dimitrios A.; Kalnis, Panos; Arner, Erik; Bajic, Vladimir B.

    2016-01-01

    factors and co-activators. A case study on data from MCF-7 cell-line reveals that PEDAL can identify successfully the transcription response subclasses of promoters and enhancers from two different stimulations. Moreover, we report subsets of input markers

  14. Music and Sign Language to Promote Infant and Toddler Communication and Enhance Parent-Child Interaction

    Science.gov (United States)

    Colwell, Cynthia; Memmott, Jenny; Meeker-Miller, Anne

    2014-01-01

    The purpose of this study was to determine the efficacy of using music and/or sign language to promote early communication in infants and toddlers (6-20 months) and to enhance parent-child interactions. Three groups used for this study were pairs of participants (care-giver(s) and child) assigned to each group: 1) Music Alone 2) Sign Language…

  15. Using a Synchronous Online Learning Environment to Promote and Enhance Transactional Engagement beyond the Classroom

    Science.gov (United States)

    Wdowik, Steven

    2014-01-01

    Purpose: The purpose of this paper is to create a synchronous online learning community through the use of "Blackboard Collaborate!" to promote and enhance transactional engagement outside the classroom. Design/methodology/approach: This paper employs a quantitative and qualitative approach where data were sourced from a third year…

  16. Stakeholder Capability Enhancement as a Path to Promote Human Dignity and Cooperative Advantage

    NARCIS (Netherlands)

    Westermann-Behaylo, M.K.; Van Buren III, H.J.; Berman, S.L.

    2016-01-01

    Promoting dignity is at the heart of the human capability approach to development. We introduce the concept of stakeholder capability enhancement, beginning with a discussion of the capability approach to development proposed by Sen (1985) and further advanced by Nussbaum (1990) to incorporate

  17. Alternative growth promoters alter broiler gut microbiome and enhance body weight gain

    Science.gov (United States)

    Antibiotic growth promoters (AGPs) have commonly been used to enhance growth in poultry production. However, there has been increasing concern over the impact of AGPs use in food production on acquisition of antibiotic resistance in zoonotic bacterial pathogens through inter-bacterial transfer of an...

  18. Genome dynamics of short oligonucleotides: the example of bacterial DNA uptake enhancing sequences.

    Directory of Open Access Journals (Sweden)

    Mohammed Bakkali

    Full Text Available Among the many bacteria naturally competent for transformation by DNA uptake-a phenomenon with significant clinical and financial implications- Pasteurellaceae and Neisseriaceae species preferentially take up DNA containing specific short sequences. The genomic overrepresentation of these DNA uptake enhancing sequences (DUES causes preferential uptake of conspecific DNA, but the function(s behind this overrepresentation and its evolution are still a matter for discovery. Here I analyze DUES genome dynamics and evolution and test the validity of the results to other selectively constrained oligonucleotides. I use statistical methods and computer simulations to examine DUESs accumulation in Haemophilus influenzae and Neisseria gonorrhoeae genomes. I analyze DUESs sequence and nucleotide frequencies, as well as those of all their mismatched forms, and prove the dependence of DUESs genomic overrepresentation on their preferential uptake by quantifying and correlating both characteristics. I then argue that mutation, uptake bias, and weak selection against DUESs in less constrained parts of the genome combined are sufficient enough to cause DUESs accumulation in susceptible parts of the genome with no need for other DUES function. The distribution of overrepresentation values across sequences with different mismatch loads compared to the DUES suggests a gradual yet not linear molecular drive of DNA sequences depending on their similarity to the DUES. Other genomically overrepresented sequences, both pro- and eukaryotic, show similar distribution of frequencies suggesting that the molecular drive reported above applies to other frequent oligonucleotides. Rare oligonucleotides, however, seem to be gradually drawn to genomic underrepresentation, thus, suggesting a molecular drag. To my knowledge this work provides the first clear evidence of the gradual evolution of selectively constrained oligonucleotides, including repeated, palindromic and protein

  19. Enhancing promotional strategies within social marketing programs: use of Web 2.0 social media.

    Science.gov (United States)

    Thackeray, Rosemary; Neiger, Brad L; Hanson, Carl L; McKenzie, James F

    2008-10-01

    The second generation of Internet-based applications (i.e., Web 2.0), in which users control communication, holds promise to significantly enhance promotional efforts within social marketing campaigns. Web 2.0 applications can directly engage consumers in the creative process by both producing and distributing information through collaborative writing, content sharing, social networking, social bookmarking, and syndication. Web 2.0 can also enhance the power of viral marketing by increasing the speed at which consumers share experiences and opinions with progressively larger audiences. Because of the novelty and potential effectiveness of Web 2.0, social marketers may be enticed to prematurely incorporate related applications into promotional plans. However, as strategic issues such as priority audience preferences, selection of appropriate applications, tracking and evaluation, and related costs are carefully considered, Web 2.0 will expand to allow health promotion practitioners more direct access to consumers with less dependency on traditional communication channels.

  20. Ginsenoside compound K promotes β-amyloid peptide clearance in primary astrocytes via autophagy enhancement.

    Science.gov (United States)

    Guo, Jinhui; Chang, Li; Zhang, Xin; Pei, Sujuan; Yu, Meishuang; Gao, Jianlian

    2014-10-01

    The aim of the present study was to investigate the effect of ginsenoside compound K on β-amyloid (Aβ) peptide clearance in primary astrocytes. Aβ degradation in primary astrocytes was determined using an intracellular Aβ clearance assay. Aggregated LC3 in astrocyte cells, which is a marker for the level of autophagy, was detected using laser scanning confocal microscope. The effect of compound K on the mammalian target of rapamycin (mTOR)/autophagy pathway was determined using western blot analysis, and an enzyme-linked immunosorbent assay was used for Aβ detection. The results demonstrated that compound K promoted the clearance of Aβ and enhanced autophagy in primary astrocytes. In addition, it was found that phosphorylation of mTOR was inhibited by compound K, which may have contributed to the enhanced autophagy. In conclusion, compound K promotes Aβ clearance by enhancing autophagy via the mTOR signaling pathway in primary astrocytes.

  1. Complete Genome Sequence Analysis of Enterobacter sp. SA187, a Plant Multi-Stress Tolerance Promoting Endophytic Bacterium

    KAUST Repository

    Andres-Barrao, Cristina

    2017-10-20

    Enterobacter sp. SA187 is an endophytic bacterium that has been isolated from root nodules of the indigenous desert plant Indigofera argentea. SA187 could survive in the rhizosphere as well as in association with different plant species, and was able to provide abiotic stress tolerance to Arabidopsis thaliana. The genome sequence of SA187 was obtained by using Pacific BioScience (PacBio) single-molecule sequencing technology, with average coverage of 275X. The genome of SA187 consists of one single 4,429,597 bp chromosome, with an average 56% GC content and 4,347 predicted protein coding DNA sequences (CDS), 153 ncRNA, 7 rRNA, and 84 tRNA. Functional analysis of the SA187 genome revealed a large number of genes involved in uptake and exchange of nutrients, chemotaxis, mobilization and plant colonization. A high number of genes were also found to be involved in survival, defense against oxidative stress and production of antimicrobial compounds and toxins. Moreover, different metabolic pathways were identified that potentially contribute to plant growth promotion. The information encoded in the genome of SA187 reveals the characteristics of a dualistic lifestyle of a bacterium that can adapt to different environments and promote the growth of plants. This information provides a better understanding of the mechanisms involved in plant-microbe interaction and could be further exploited to develop SA187 as a biological agent to improve agricultural practices in marginal and arid lands.

  2. Complete Genome Sequence Analysis of Enterobacter sp. SA187, a Plant Multi-Stress Tolerance Promoting Endophytic Bacterium

    KAUST Repository

    Andres-Barrao, Cristina; Lafi, Feras Fawzi; Alam, Intikhab; Zé licourt, Axel de; Eida, Abdul Aziz; Bokhari, Ameerah; Alzubaidy, Hanin S.; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Enterobacter sp. SA187 is an endophytic bacterium that has been isolated from root nodules of the indigenous desert plant Indigofera argentea. SA187 could survive in the rhizosphere as well as in association with different plant species, and was able to provide abiotic stress tolerance to Arabidopsis thaliana. The genome sequence of SA187 was obtained by using Pacific BioScience (PacBio) single-molecule sequencing technology, with average coverage of 275X. The genome of SA187 consists of one single 4,429,597 bp chromosome, with an average 56% GC content and 4,347 predicted protein coding DNA sequences (CDS), 153 ncRNA, 7 rRNA, and 84 tRNA. Functional analysis of the SA187 genome revealed a large number of genes involved in uptake and exchange of nutrients, chemotaxis, mobilization and plant colonization. A high number of genes were also found to be involved in survival, defense against oxidative stress and production of antimicrobial compounds and toxins. Moreover, different metabolic pathways were identified that potentially contribute to plant growth promotion. The information encoded in the genome of SA187 reveals the characteristics of a dualistic lifestyle of a bacterium that can adapt to different environments and promote the growth of plants. This information provides a better understanding of the mechanisms involved in plant-microbe interaction and could be further exploited to develop SA187 as a biological agent to improve agricultural practices in marginal and arid lands.

  3. Curtobacterium sp. Genome Sequencing Underlines Plant Growth Promotion-Related Traits.

    Science.gov (United States)

    Bulgari, Daniela; Minio, Andrea; Casati, Paola; Quaglino, Fabio; Delledonne, Massimo; Bianco, Piero A

    2014-07-17

    Endophytic bacteria are microorganisms residing in plant tissues without causing disease symptoms. Here, we provide the high-quality genome sequence of Curtobacterium sp. strain S6, isolated from grapevine plant. The genome assembly contains 2,759,404 bp in 13 contigs and 2,456 predicted genes. Copyright © 2014 Bulgari et al.

  4. A 1-kb bacteriophage lambda fragment functions as an insulator to effectively block enhancer-promoter interactions in Arabidopsis thaliana

    Science.gov (United States)

    The 35S cauliflower mosaic virus (CaMV) promoter contains an enhancer element that is able to override the tissue-, organ- and developmental-stage specificity of nearby promoters. Consequently, the precise control of transgene expression in transgenic plants, which often contain the 35S CaMV promot...

  5. Synthetic cold-inducible promoter enhances recombinant protein accumulation during Agrobacterium-mediated transient expression in Nicotiana excelsior at chilling temperatures.

    Science.gov (United States)

    Gerasymenko, I M; Sheludko, Y V

    2017-07-01

    To exploit cold-inducible biochemical processes beneficial for foreign mRNA transcription, translation and storage, as well as protein product stability, during Agrobacterium-mediated transient expression. The efficiency of three different 5'-regulatory sequences to achieve transient expression of the GFP-based reporter gene under chilling conditions (6-8 °C since the 3rd day post inoculation) was compared. We studied the upstream sequences of a cold-inducible Arabidopsis thaliana cor15a gene, the core element of 35S CaMV promoter fused to the TMV omega 5'-UTR, and the synthetic promoter including the 35S core sequence and two binding sites for cold-inducible CBF transcription factors (P_DRE::35S). Cultivation of plants transiently expressing reporter gene under control of the synthetic P_DRE::35S promoter under chilling conditions since the 3rd dpi led to the reliably higher reporter accumulation as compared to the other tested regulatory sequences under chilling or greenhouse conditions. Reporter protein fluorescence under chilling conditions using P_DRE::35S reached 160% as compared to the transient expression in the greenhouse. Period of transient expression considerably extended if plants were cultivated at chilling temperature since the 3rd dpi: reporter protein fluorescence reached its maximum at the 20th dpi and was detected in leaves up to the 65th dpi. The enhanced protein accumulation at low temperature was accompanied by the prolonged period of corresponding mRNA accumulation. Transient expression under chilling conditions using synthetic cold-inducible promoter enhances target protein accumulation and may decrease greenhouse heating expenses.

  6. Designing and evaluating a context-based lesson sequence promoting conceptual coherence in biology

    NARCIS (Netherlands)

    Ummels, M. H J; Kamp, M. J A; De Kroon, H.; Boersma, K. Th|info:eu-repo/dai/nl/073043141

    2015-01-01

    Context-based education, in which students deal with biological concepts in a meaningful way, is showing promise in promoting the development of students conceptual coherence. However, literature gives little guidance about how this kind of education should be designed. Therefore, our study aims at

  7. Characterization of the promoter and upstream activating sequence from the Pseudomonas alcaligenes lipase gene

    NARCIS (Netherlands)

    Cox, M; Gerritse, G; Dankmeyer, L; Quax, W.J.

    2001-01-01

    Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and

  8. Mapping of the methylation pattern of the hMSH2 promoter in colon cancer, using bisulfite genomic sequencing

    Directory of Open Access Journals (Sweden)

    Zhang Hua

    2006-08-01

    Full Text Available Abstract The detailed methylation status of CpG sites in the promoter region of hMSH2 gene has yet not to be reported. We have mapped the complete methylation status of the hMSH2 promoter, a region that contains 75 CpG sites, using bisulfite genomic sequencing in 60 primary colorectal cancers. And the expression of hMSH2 was detected by immunohistochemistry. The hypermethylation of hMSH2 was detected in 18.33% (11/60 of tumor tissues. The protein of hMSH2 was detected in 41.67% (25/60 of tumor tissues. No hypermethylation of hMSH2 was detected in normal tissues. The protein of hMSH2 was detected in all normal tissues. Our study demonstrated that hMSH2 hypermethylation and protein expression were associated with the development of colorectal cancer.

  9. Research on dragons: a teaching sequence to promote the understanding of Nature of Science at Secondary School

    Directory of Open Access Journals (Sweden)

    Romero Ariza, Marta

    2013-01-01

    Full Text Available This paper presents a teaching sequence explicitly designed to improve the understanding of Nature of Science and support Secondary School students to acquire adequate understanding about scientific hypothesis, theories and laws. The instructional intervention engages students in an inquiry process where they have to formulate hypothesis, analyse data and draw conclusions based on evidence. It is a student-centred methodology where teachers act as facilitators and guides, promoting the development of scientific competences and the meaningful understanding of the terms hypothesis, law and theory.

  10. MGMT DNA repair gene promoter/enhancer haplotypes alter transcription factor binding and gene expression.

    Science.gov (United States)

    Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z

    2016-10-01

    The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.

  11. A novel approach to enhance biological nutrient removal using a culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (Rpf) in SBR process.

    Science.gov (United States)

    Liu, Yindong; Su, Xiaomei; Lu, Lian; Ding, Linxian; Shen, Chaofeng

    2016-03-01

    A culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (SRpf) was used to enhance the biological nutrient removal of potentially functional bacteria. The obtained results suggest that SRpf accelerated the start-up process and significantly enhanced the biological nutrient removal in sequencing batch reactor (SBR). PO4 (3-)-P removal efficiency increased by over 12 % and total nitrogen removal efficiency increased by over 8 % in treatment reactor acclimated by SRpf compared with those without SRpf addition. The Illumina high-throughput sequencing analysis showed that SRpf played an essential role in shifts in the composition and diversity of bacterial community. The phyla of Proteobacteria and Actinobacteria, which were closely related to biological nutrient removal, were greatly abundant after SRpf addition. This study demonstrates that SRpf acclimation or addition might hold great potential as an efficient and cost-effective alternative for wastewater treatment plants (WWTPs) to meet more stringent operation conditions and legislations.

  12. The inhibition of IGF-1 signaling promotes proteostasis by enhancing protein aggregation and deposition.

    Science.gov (United States)

    Moll, Lorna; Ben-Gedalya, Tziona; Reuveni, Hadas; Cohen, Ehud

    2016-04-01

    The discovery that the alteration of aging by reducing the activity of the insulin/IGF-1 signaling (IIS) cascade protects nematodes and mice from neurodegeneration-linked, toxic protein aggregation (proteotoxicity) raises the prospect that IIS inhibitors bear therapeutic potential to counter neurodegenerative diseases. Recently, we reported that NT219, a highly efficient IGF-1 signaling inhibitor, protects model worms from the aggregation of amyloid β peptide and polyglutamine peptides that are linked to the manifestation of Alzheimer's and Huntington's diseases, respectively. Here, we employed cultured cell systems to investigate whether NT219 promotes protein homeostasis (proteostasis) in mammalian cells and to explore its underlying mechanisms. We found that NT219 enhances the aggregation of misfolded prion protein and promotes its deposition in quality control compartments known as "aggresomes." NT219 also elevates the levels of certain molecular chaperones but, surprisingly, reduces proteasome activity and impairs autophagy. Our findings show that IGF-1 signaling inhibitors in general and NT219 in particular can promote proteostasis in mammalian cells by hyperaggregating hazardous proteins, thereby bearing the potential to postpone the onset and slow the progression of neurodegenerative illnesses in the elderly.-Moll, L., Ben-Gedalya, T., Reuveni, H., Cohen, E. The inhibition of IGF-1 signaling promotes proteostasis by enhancing protein aggregation and deposition. © FASEB.

  13. Enhancing dopaminergic signaling and histone acetylation promotes long-term rescue of deficient fear extinction

    Science.gov (United States)

    Whittle, N; Maurer, V; Murphy, C; Rainer, J; Bindreither, D; Hauschild, M; Scharinger, A; Oberhauser, M; Keil, T; Brehm, C; Valovka, T; Striessnig, J; Singewald, N

    2016-01-01

    Extinction-based exposure therapy is used to treat anxiety- and trauma-related disorders; however, there is the need to improve its limited efficacy in individuals with impaired fear extinction learning and to promote greater protection against return-of-fear phenomena. Here, using 129S1/SvImJ mice, which display impaired fear extinction acquisition and extinction consolidation, we revealed that persistent and context-independent rescue of deficient fear extinction in these mice was associated with enhanced expression of dopamine-related genes, such as dopamine D1 (Drd1a) and -D2 (Drd2) receptor genes in the medial prefrontal cortex (mPFC) and amygdala, but not hippocampus. Moreover, enhanced histone acetylation was observed in the promoter of the extinction-regulated Drd2 gene in the mPFC, revealing a potential gene-regulatory mechanism. Although enhancing histone acetylation, via administering the histone deacetylase (HDAC) inhibitor MS-275, does not induce fear reduction during extinction training, it promoted enduring and context-independent rescue of deficient fear extinction consolidation/retrieval once extinction learning was initiated as shown following a mild conditioning protocol. This was associated with enhanced histone acetylation in neurons of the mPFC and amygdala. Finally, as a proof-of-principle, mimicking enhanced dopaminergic signaling by L-dopa treatment rescued deficient fear extinction and co-administration of MS-275 rendered this effect enduring and context-independent. In summary, current data reveal that combining dopaminergic and epigenetic mechanisms is a promising strategy to improve exposure-based behavior therapy in extinction-impaired individuals by initiating the formation of an enduring and context-independent fear-inhibitory memory. PMID:27922638

  14. P1 interneurons promote a persistent internal state that enhances inter-male aggression in Drosophila

    Science.gov (United States)

    Hoopfer, Eric D; Jung, Yonil; Inagaki, Hidehiko K; Rubin, Gerald M; Anderson, David J

    2015-01-01

    How brains are hardwired to produce aggressive behavior, and how aggression circuits are related to those that mediate courtship, is not well understood. A large-scale screen for aggression-promoting neurons in Drosophila identified several independent hits that enhanced both inter-male aggression and courtship. Genetic intersections revealed that 8-10 P1 interneurons, previously thought to exclusively control male courtship, were sufficient to promote fighting. Optogenetic experiments indicated that P1 activation could promote aggression at a threshold below that required for wing extension. P1 activation in the absence of wing extension triggered persistent aggression via an internal state that could endure for minutes. High-frequency P1 activation promoted wing extension and suppressed aggression during photostimulation, whereas aggression resumed and wing extension was inhibited following photostimulation offset. Thus, P1 neuron activation promotes a latent, internal state that facilitates aggression and courtship, and controls the overt expression of these social behaviors in a threshold-dependent, inverse manner. DOI: http://dx.doi.org/10.7554/eLife.11346.001 PMID:26714106

  15. T1 Gd-enhanced compared with CISS sequences in retinoblastoma: superiority of T1 sequences in evaluation of tumour extension

    Energy Technology Data Exchange (ETDEWEB)

    Gizewski, Elke R.; Wanke, Isabel; Guengoer, Ali-Riza; Forsting, Michael [University Hospital, Department of Diagnostic and Interventional Neuroradiology, Essen (Germany); Jurklies, Christine [University Hospital Essen, Department of Ophthalmology (Germany)

    2005-01-01

    Background As adequate therapy for retinoblastoma in young children depends on infiltration of extra-retinal structures, diagnostic modalities play an essential role. Methods: In this widely extended study, 80 children with retinoblastoma were studied with MRI (standard fat-suppressed Gd-enhanced T1, T2 thin-slice sequences (additionally with small loop surface coil), constructive interference in steady state (CISS) sequence covering the orbita). The images were analysed by two blinded neuroradiologists. Histology was used as the gold standard. MRI assumed infiltration of extra-retinal structures in 13 of 80 patients of which ten were confirmed by histology. Affected extra-retinal structures were: optic nerve (five, of which two were on CISS and three on T1 with higher image resolution using the surface coil), scleral infiltration (five, of which four on CISS and T1) and ciliary body infiltration (one on CISS and T1). Another 61 enucleated patients did not have any extra-retinal infiltration in histology. The CISS sequence with multiplanar reconstruction was mainly helpful in revealing exact three-dimensional tumour extension with excellent clinical acceptance and pre-surgical planning but T1 fat-suppressed Gd-enhanced images were superior in revealing exact tumour extension. CISS sequences allow to produce excellent anatomical images and to perform multiplanar reconstruction to better demonstrate tumour extension. However, T1-weighted sequences after contrast application are more sensitive (60 versus 40%) in detecting infiltration of the optic nerve but equal in detecting scleral infiltration. (orig.)

  16. Pokemon promotes the invasiveness of hepatocellular carcinoma by enhancing MEF2D transcription.

    Science.gov (United States)

    Kong, Jing; Liu, Xiaoping; Li, Xiangqian; Wu, Jinsheng; Wu, Ning; Chen, Jun; Fang, Fang

    2016-05-01

    Pokemon, a master oncogene crucial for the tumorigenicity and progression of a variety of cancers, has been demonstrated to enhance the proliferation and survival of hepatocellular carcinoma (HCC). However, the contribution of Pokemon to the invasiveness of HCC has not yet been studied. In this study, we employed HCC cells to investigate the role of Pokemon in the invasion of HCC with multidisciplinary approaches. Pokemon overexpression was found to be closely associated with invasion and intrahepatic metastasis of HCC in clinical specimens. Suppression of Pokemon attenuated the invasion of HCC cells by in vitro transwell and wound-healing assays. Myocyte enhancer factor 2D (MEF2D), an oncogene that can promote the invasiveness of HCC, was found to be underexpressed during Pokemon silencing in HCC cells. Restoration of MEF2D abolished the effect of Pokemon downregulation on the migration of HCC cells. Further experiments verified that Pokemon binds two putative recognition sites located within the upstream region of the MEF2D promoter and enhances its transcription. The association between Pokemon and MEF2D was further confirmed in HCC specimens. Animal experiments further confirmed that Pokemon downregulation attenuated the metastasis of HCC cells in mice. Collectively, Pokemon was found to enhance the migration and invasion of HCC by increasing MEF2D expression. Thus, targeting Pokemon and MEF2D may be an effective strategy to suppress the metastasis of HCC.

  17. Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

    Science.gov (United States)

    Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

    1998-06-01

    Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

  18. Efficiency of Transcription from Promoter Sequence Variants in Lactobacillus Is Both Strain and Context Dependent

    OpenAIRE

    McCracken, Andrea; Timms, Peter

    1999-01-01

    The introduction of consensus −35 (TTGACA) and −10 (TATAAT) hexamers and a TG motif into the Lactobacillus acidophilus ATCC 4356 wild-type slpA promoter resulted in significant improvements (4.3-, 4.1-, and 10.7-fold, respectively) in transcriptional activity in Lactobacillus fermentum BR11. In contrast, the same changes resulted in decreased transcription in Lactobacillus rhamnosus GG. The TG motif was shown to be important in the context of weak −35 and −10 hexamers (L. fermentum BR11) or a...

  19. In situ detection of a heat-shock regulatory element binding protein using a soluble short synthetic enhancer sequence

    Energy Technology Data Exchange (ETDEWEB)

    Harel-Bellan, A; Brini, A T; Farrar, W L [National Cancer Institute, Frederick, MD (USA); Ferris, D K [Program Resources, Inc., Frederick, MD (USA); Robin, P [Institut Gustave Roussy, Villejuif (France)

    1989-06-12

    In various studies, enhancer binding proteins have been successfully absorbed out by competing sequences inserted into plasmids, resulting in the inhibition of the plasmid expression. Theoretically, such a result could be achieved using synthetic enhancer sequences not inserted into plasmids. In this study, a double stranded DNA sequence corresponding to the human heat shock regulatory element was chemically synthesized. By in vitro retardation assays, the synthetic sequence was shown to bind specifically a protein in extracts from the human T cell line Jurkat. When the synthetic enhancer was electroporated into Jurkat cells, not only the enhancer was shown to remain undegraded into the cells for up to 2 days, but also its was shown to bind intracellularly a protein. The binding was specific and was modulated upon heat shock. Furthermore, the binding protein was shown to be of the expected molecular weight by UV crosslinking. However, when the synthetic enhancer element was co-electroporated with an HSP 70-CAT reporter construct, the expression of the reporter plasmid was consistently enhanced in the presence of the exogenous synthetic enhancer.

  20. Fat-saturated, contrast-enhanced spin echo sequences in magnetic resonance tomographic diagnosis of peritoneal carcinosis

    International Nuclear Information System (INIS)

    Ricke, J.; Hosten, N.; Stroszczynski, C.; Amthauer, H.; Felix, R.; Sehouli, J.; Buchmann, E.; Rieger, J.

    1999-01-01

    Purpose: To evaluate contrast-enhanced, fat-saturated spin echo sequences for the detection of peritoneal carcinosis with MRI. Material and Methods: 61 patients, 35 with and 26 without peritoneal carcinosis, were examined with abdominal MRI. Fat-saturated, T 1 -weighted spin echo sequences were performed before and after administration of Gd-DTPA. In addition, 22 patients with peritoneal carcinosis were examined with contrast-enhanced abdominal CT. Results: 32 of 35 patients with peritoneal carcinosis demonstrated contrast enhancement of the visceral and 30 to 35 enhancement of the parietal peritoneum (91 and 86%, respectively). Wall thickening of the intestine or parietal peritoneum were noted in 21 and 20 of 35 patients (60 and 57%, respectively), ascites in 18 of 35 patients (51%). False positive contrast enhancement of the peritoneum was noted in 4 of 26 patients (15%). In the direct comparison of MRI and CT, 22 of 22 patients versus 7 of 22 patients showed contrast enhancement of the visceral peritoneum (100 and 32%, respectively). For other signs of peritoneal carcinosis (e.g., ascites, peritoneal seedings), no differences in diagnostic reliability were demonstrated. Conclusions: The use of fat-saturated, spin echo sequences facilitates the diagnosis of peritoneal carcinosis by artifact reduction and improved detection of peritoneal contrast enhancement. MRI with fat-saturated sequences was superior to CT. (orig.) [de

  1. Video Enhancement and Dynamic Range Control of HDR Sequences for Automotive Applications

    Directory of Open Access Journals (Sweden)

    Giovanni Ramponi

    2007-01-01

    Full Text Available CMOS video cameras with high dynamic range (HDR output are particularly suitable for driving assistance applications, where lighting conditions can strongly vary, going from direct sunlight to dark areas in tunnels. However, common visualization devices can only handle a low dynamic range, and thus a dynamic range reduction is needed. Many algorithms have been proposed in the literature to reduce the dynamic range of still pictures. Anyway, extending the available methods to video is not straightforward, due to the peculiar nature of video data. We propose an algorithm for both reducing the dynamic range of video sequences and enhancing its appearance, thus improving visual quality and reducing temporal artifacts. We also provide an optimized version of our algorithm for a viable hardware implementation on an FPGA. The feasibility of this implementation is demonstrated by means of a case study.

  2. Prospecting plant growth promoting bacteria and cyanobacteria as options for enrichment of macro- and micronutrients in grains in rice–wheat cropping sequence

    Directory of Open Access Journals (Sweden)

    Anuj Rana

    2015-12-01

    Full Text Available The influence of plant growth promoting bacteria (PGPB and cyanobacteria, alone and in combination, was investigated on micronutrient enrichment and yield in rice–wheat sequence, over a period of two years. Analysis of variance (ANOVA in both crops indicated significant differences in soil dehydrogenase activity and micronutrient enrichment in grains (Fe, Zn in rice, and Cu, Mn in wheat. The combined inoculation of Anabaena oscillarioides CR3, Brevundimonas diminuta PR7, and Ochrobactrum anthropi PR10 (T6 significantly increased nitrogen, phosphorus, and potassium (NPK content and improved rice yield by 21.2%, as compared to the application of recommended dose of NPK fertilizers (T2. The treatment T5 (Providencia sp. PR3 + B. diminuta PR7 + O. anthropi PR10 recorded an enhancement of 13–16% in Fe, Zn, Cu, and Mn concentrations, respectively, in rice grains. In wheat, Providencia sp. PW5 (T6 recorded the highest yield (5.23 Mg ha−1 and significantly higher enrichment of Fe and Cu (44–45% in the grains. This study highlighted the promise of combinations of cyanobacteria/bacteria and their synergistic action in biofortification and providing savings of 40–60 kg N ha−1. Future focus needs to be towards integrating such promising environment-friendly and environmentally sustainable options in nutrient management strategies for this cropping sequence.

  3. Plasmid origin of replication of herpesvirus papio: DNA sequence and enhancer function.

    Science.gov (United States)

    Loeb, D D; Sung, N S; Pesano, R L; Sexton, C J; Hutchison, C; Pagano, J S

    1990-01-01

    Herpesvirus papio (HVP) is a lymphotropic virus of baboons which is related to Epstein-Barr virus (EBV) and produces latent infection. The nucleotide sequence of the 5,775-base-pair (bp) EcoRI K fragment of HVP, which has previously been shown to confer the ability to replicate autonomously, has been determined. Within this DNA fragment is a region which bears structural and sequence similarity to the ori-P region of EBV. The HVP ori-P region has a 10- by 26-bp tandem array which is related to the 20- by 30-bp tandem array from the EBV ori-P region. In HVP there is an intervening region of 764 bp followed by five partial copies of the 26-bp monomer. Both the EBV and HVP 3' regions have the potential to form dyad structures which, however, differ in arrangement. We also demonstrate that a transcriptional enhancer which requires transactivation by a virus-encoded factor is present in the HVP ori-P. Images PMID:2159548

  4. MEG3 is a prognostic factor for CRC and promotes chemosensitivity by enhancing oxaliplatin-induced cell apoptosis.

    Science.gov (United States)

    Li, Lixia; Shang, Jian; Zhang, Yupeng; Liu, Shi; Peng, Yanan; Zhou, Zhou; Pan, Huaqing; Wang, Xiaobing; Chen, Lipng; Zhao, Qiu

    2017-09-01

    A major reason for the failure of advanced colorectal cancer (CRC) treatment is the occurrence of chemoresistance to oxaliplatin-based chemotherapy. Recently, studies have shown that long non-coding RNAs (lncRNAs) play an important role in drug resistance. Using HiSeq sequencing methods, we identified that lncRNAs show differential expression levels in oxaliplatin-resistant (OxR) and non-resistant CRC patients. RT-qPCR was then performed in tissues and serum samples, and lncRNA MEG3 was verified to be downregulated in non-responding patients and to have considerable discriminating potential to identify responding patients from non-responding patients. Moreover, decreased serum MEG3 expression was associated with poor chemoresponse and low survival rate in CRC patients receiving oxaliplatin treatment. Subsequently, OxR cell lines were established, and MEG3 was significantly downregulated in HT29 OxR and SW480 OxR cells. In addition, overexpression of MEG3 with pMEG3 reversed oxaliplatin resistance in both CRC cell lines. Flow cytometric apoptosis analysis indicated that MEG3 promoted CRC cell apoptosis. More importantly, MEG3 enhanced oxaliplatin‑induced cell cytotoxicity in CRC. In conclusion, our integrated approach demonstrated that decreased expression of lncRNA MEG3 in CRC confers potent poor therapeutic efficacy, and that MEG3 promotes chemosensitivity by enhancing oxaliplatin-induced cell apoptosis. Thus, overexpression of MEG3 may be a future direction by which to develop a novel therapeutic strategy to overcome oxaliplatin resistance of CRC patients.

  5. A functional variant in the stearoyl-CoA desaturase gene promoter enhances fatty acid desaturation in pork.

    Directory of Open Access Journals (Sweden)

    Joan Estany

    Full Text Available There is growing public concern about reducing saturated fat intake. Stearoyl-CoA desaturase (SCD is the lipogenic enzyme responsible for the biosynthesis of oleic acid (18 ∶ 1 by desaturating stearic acid (18 ∶ 0. Here we describe a total of 18 mutations in the promoter and 3' non-coding region of the pig SCD gene and provide evidence that allele T at AY487830:g.2228T>C in the promoter region enhances fat desaturation (the ratio 18 ∶ 1/18 ∶ 0 in muscle increases from 3.78 to 4.43 in opposite homozygotes without affecting fat content (18 ∶ 0+18 ∶ 1, intramuscular fat content, and backfat thickness. No mutations that could affect the functionality of the protein were found in the coding region. First, we proved in a purebred Duroc line that the C-T-A haplotype of the 3 single nucleotide polymorphisms (SNPs (g.2108C>T; g.2228T>C; g.2281A>G of the promoter region was additively associated to enhanced 18 ∶ 1/18 ∶ 0 both in muscle and subcutaneous fat, but not in liver. We show that this association was consistent over a 10-year period of overlapping generations and, in line with these results, that the C-T-A haplotype displayed greater SCD mRNA expression in muscle. The effect of this haplotype was validated both internally, by comparing opposite homozygote siblings, and externally, by using experimental Duroc-based crossbreds. Second, the g.2281A>G and the g.2108C>T SNPs were excluded as causative mutations using new and previously published data, restricting the causality to g.2228T>C SNP, the last source of genetic variation within the haplotype. This mutation is positioned in the core sequence of several putative transcription factor binding sites, so that there are several plausible mechanisms by which allele T enhances 18 ∶ 1/18 ∶ 0 and, consequently, the proportion of monounsaturated to saturated fat.

  6. Bioaggregate of photo-fermentative bacteria for enhancing continuous hydrogen production in a sequencing batch photobioreactor.

    Science.gov (United States)

    Xie, Guo-Jun; Liu, Bing-Feng; Wang, Rui-Qing; Ding, Jie; Ren, Hong-Yu; Zhou, Xu; Ren, Nan-Qi

    2015-11-05

    Hydrogen recovery through solar-driven biomass conversion by photo-fermentative bacteria (PFB) has been regarded as a promising way for sustainable energy production. However, a considerable fraction of organic substrate was consumed for the growth of PFB as biocatalysts, furthermore, these PFB were continuously washed out from the photobioreactor in continuous operation because of their poor flocculation. In this work, PFB bioaggregate induced by L-cysteine was applied in a sequencing batch photobioreactor to enhance continuous hydrogen production and reduce biomass washout. The effects of the hydraulic retention time (HRT), influent concentration and light intensity on hydrogen production of the photobioreactor were investigated. The maximum hydrogen yield (3.35 mol H2/mol acetate) and production rate (1044 ml/l/d) were obtained at the HRT of 96 h, influent concentration of 3.84 g COD/l, and light intensity of 200 W/m(2). With excellent settling ability, biomass accumulated in the photobioreactor and reached 2.15 g/l under the optimum conditions. Structural analysis of bioaggregate showed that bacterial cells were covered and tightly linked together by extracellular polymeric substances, and formed a stable structure. Therefore, PFB bioaggregate induced by L-cysteine is an efficient strategy to improve biomass retention capacity of the photobioreactor and enhance hydrogen recovery efficiency from organic wastes.

  7. Bioaggregate of photo-fermentative bacteria for enhancing continuous hydrogen production in a sequencing batch photobioreactor

    Science.gov (United States)

    Xie, Guo-Jun; Liu, Bing-Feng; Wang, Rui-Qing; Ding, Jie; Ren, Hong-Yu; Zhou, Xu; Ren, Nan-Qi

    2015-11-01

    Hydrogen recovery through solar-driven biomass conversion by photo-fermentative bacteria (PFB) has been regarded as a promising way for sustainable energy production. However, a considerable fraction of organic substrate was consumed for the growth of PFB as biocatalysts, furthermore, these PFB were continuously washed out from the photobioreactor in continuous operation because of their poor flocculation. In this work, PFB bioaggregate induced by L-cysteine was applied in a sequencing batch photobioreactor to enhance continuous hydrogen production and reduce biomass washout. The effects of the hydraulic retention time (HRT), influent concentration and light intensity on hydrogen production of the photobioreactor were investigated. The maximum hydrogen yield (3.35 mol H2/mol acetate) and production rate (1044 ml/l/d) were obtained at the HRT of 96 h, influent concentration of 3.84 g COD/l, and light intensity of 200 W/m2. With excellent settling ability, biomass accumulated in the photobioreactor and reached 2.15 g/l under the optimum conditions. Structural analysis of bioaggregate showed that bacterial cells were covered and tightly linked together by extracellular polymeric substances, and formed a stable structure. Therefore, PFB bioaggregate induced by L-cysteine is an efficient strategy to improve biomass retention capacity of the photobioreactor and enhance hydrogen recovery efficiency from organic wastes.

  8. Electroacupuncture promotes post-stroke functional recovery via enhancing endogenous neurogenesis in mouse focal cerebral ischemia.

    Directory of Open Access Journals (Sweden)

    Yu Ri Kim

    Full Text Available To investigate the question of whether electroacupuncture (EA promotes functional recovery via enhancement of proliferation and differentiation of neuronal stem cells (NSCs in ischemic stroke, EA stimulation with 2 Hz was applied at bilateral acupoints to Baihui (GV20 and Dazhui (GV14 in middle cerebral artery occlusion (MCAO mice. EA stimulation improved neuromotor function and cognitive ability after ischemic stroke. EA stimulation resulted in an increase in the number of proliferated cells, especially in the subventricular zone (SVZ of the ipsilateral hemisphere. Although a very limited number of NSCs survived and differentiated into neurons or astrocytes, EA treatment resulted in a significant increase in the number of proliferative cells and differentiated cells in the hippocampus and SVZ of the ipsilateral hemisphere compared to MCAO mice. EA stimulation resulted in significantly increased mRNA expression of brain-derived neurotrophic factor (BDNF and vascular endothelial growth factor (VEGF. Protein levels of these factors were confirmed in the ipsilateral hippocampus and SVZ by immunohistochemical and Western blotting analyses. Expression of phosphorylated phosphatidylinositol-3-kinase, BDNF, and VEGF-mediated down-stream were enhanced by EA stimulation in newly formed neuroblasts. These results indicate that EA treatment after ischemic stroke may promote post-stroke functional recovery by enhancement of proliferation and differentiation of NSCs via the BDNF and VEGF signaling pathway.

  9. Predicting stimulation-dependent enhancer-promoter interactions from ChIP-Seq time course data

    Directory of Open Access Journals (Sweden)

    Tomasz Dzida

    2017-09-01

    Full Text Available We have developed a machine learning approach to predict stimulation-dependent enhancer-promoter interactions using evidence from changes in genomic protein occupancy over time. The occupancy of estrogen receptor alpha (ERα, RNA polymerase (Pol II and histone marks H2AZ and H3K4me3 were measured over time using ChIP-Seq experiments in MCF7 cells stimulated with estrogen. A Bayesian classifier was developed which uses the correlation of temporal binding patterns at enhancers and promoters and genomic proximity as features to predict interactions. This method was trained using experimentally determined interactions from the same system and was shown to achieve much higher precision than predictions based on the genomic proximity of nearest ERα binding. We use the method to identify a genome-wide confident set of ERα target genes and their regulatory enhancers genome-wide. Validation with publicly available GRO-Seq data demonstrates that our predicted targets are much more likely to show early nascent transcription than predictions based on genomic ERα binding proximity alone.

  10. Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

    Science.gov (United States)

    Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

    2016-02-09

    Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

  11. A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection.

    Science.gov (United States)

    Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike; Khan, Arifa S

    2018-01-01

    developed a new reference viral database (RVDB) that provides a broad representation of different virus species from eukaryotes by including all viral, virus-like, and virus-related sequences (excluding bacteriophages), regardless of their size. In particular, RVDB contains endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Sequences were clustered to reduce redundancy while retaining high viral sequence diversity. A particularly useful feature of RVDB is the reduction of cellular sequences, which can enhance the run efficiency of large transcriptomic and genomic data analysis and increase the specificity of virus detection.

  12. Identification of hamster inducible nitric oxide synthase (iNOS) promoter sequences that influence basal and inducible iNOS expression

    Science.gov (United States)

    Saldarriaga, Omar A.; Travi, Bruno L.; Choudhury, Goutam Ghosh; Melby, Peter C.

    2012-01-01

    IFN-γ/LPS-activated hamster (Mesocricetus auratus) macrophages express significantly less iNOS (NOS2) than activated mouse macrophages, which contributes to the hamster's susceptibility to intracellular pathogens. We determined a mechanism responsible for differences in iNOS promoter activity in hamsters and mice. The HtPP (1.2 kb) showed low basal and inducible promoter activity when compared with the mouse, and sequences within a 100-bp region (−233 to −133) of the mouse and hamster promoters influenced this activity. Moreover, within this 100 bp, we identified a smaller region (44 bp) in the mouse promoter, which recovered basal promoter activity when swapped into the hamster promoter. The mouse homolog (100-bp region) contained a cis-element for NF-IL-6 (−153/−142), which was absent in the hamster counterpart. EMSA and supershift assays revealed that the hamster sequence did not support the binding of NF-IL-6. Introduction of a functional NF-IL-6 binding sequence into the hamster promoter or its alteration in the mouse promoter revealed the critical importance of this transcription factor for full iNOS promoter activity. Furthermore, the binding of NF-IL-6 to the iNOS promoter (−153/−142) in vivo was increased in mouse cells but was reduced in hamster cells after IFN-γ/LPS stimulation. Differences in the activity of the iNOS promoters were evident in mouse and hamster cells, so they were not merely a result of species-specific differences in transcription factors. Thus, we have identified unique DNA sequences and a critical transcription factor, NF-IL-6, which contribute to the overall basal and inducible expression of hamster iNOS. PMID:22517919

  13. Bioinformatic analysis of neurotropic HIV envelope sequences identifies polymorphisms in the gp120 bridging sheet that increase macrophage-tropism through enhanced interactions with CCR5

    International Nuclear Information System (INIS)

    Mefford, Megan E.; Kunstman, Kevin; Wolinsky, Steven M.; Gabuzda, Dana

    2015-01-01

    Macrophages express low levels of the CD4 receptor compared to T-cells. Macrophage-tropic HIV strains replicating in brain of untreated patients with HIV-associated dementia (HAD) express Envs that are adapted to overcome this restriction through mechanisms that are poorly understood. Here, bioinformatic analysis of env sequence datasets together with functional studies identified polymorphisms in the β3 strand of the HIV gp120 bridging sheet that increase M-tropism. D197, which results in loss of an N-glycan located near the HIV Env trimer apex, was detected in brain in some HAD patients, while position 200 was estimated to be under positive selection. D197 and T/V200 increased fusion and infection of cells expressing low CD4 by enhancing gp120 binding to CCR5. These results identify polymorphisms in the HIV gp120 bridging sheet that overcome the restriction to macrophage infection imposed by low CD4 through enhanced gp120–CCR5 interactions, thereby promoting infection of brain and other macrophage-rich tissues. - Highlights: • We analyze HIV Env sequences and identify amino acids in beta 3 of the gp120 bridging sheet that enhance macrophage tropism. • These amino acids at positions 197 and 200 are present in brain of some patients with HIV-associated dementia. • D197 results in loss of a glycan near the HIV Env trimer apex, which may increase exposure of V3. • These variants may promote infection of macrophages in the brain by enhancing gp120–CCR5 interactions

  14. Bioinformatic analysis of neurotropic HIV envelope sequences identifies polymorphisms in the gp120 bridging sheet that increase macrophage-tropism through enhanced interactions with CCR5

    Energy Technology Data Exchange (ETDEWEB)

    Mefford, Megan E., E-mail: megan_mefford@hms.harvard.edu [Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Boston, MA (United States); Kunstman, Kevin, E-mail: kunstman@northwestern.edu [Northwestern University Medical School, Chicago, IL (United States); Wolinsky, Steven M., E-mail: s-wolinsky@northwestern.edu [Northwestern University Medical School, Chicago, IL (United States); Gabuzda, Dana, E-mail: dana_gabuzda@dfci.harvard.edu [Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Boston, MA (United States); Department of Neurology (Microbiology and Immunobiology), Harvard Medical School, Boston, MA (United States)

    2015-07-15

    Macrophages express low levels of the CD4 receptor compared to T-cells. Macrophage-tropic HIV strains replicating in brain of untreated patients with HIV-associated dementia (HAD) express Envs that are adapted to overcome this restriction through mechanisms that are poorly understood. Here, bioinformatic analysis of env sequence datasets together with functional studies identified polymorphisms in the β3 strand of the HIV gp120 bridging sheet that increase M-tropism. D197, which results in loss of an N-glycan located near the HIV Env trimer apex, was detected in brain in some HAD patients, while position 200 was estimated to be under positive selection. D197 and T/V200 increased fusion and infection of cells expressing low CD4 by enhancing gp120 binding to CCR5. These results identify polymorphisms in the HIV gp120 bridging sheet that overcome the restriction to macrophage infection imposed by low CD4 through enhanced gp120–CCR5 interactions, thereby promoting infection of brain and other macrophage-rich tissues. - Highlights: • We analyze HIV Env sequences and identify amino acids in beta 3 of the gp120 bridging sheet that enhance macrophage tropism. • These amino acids at positions 197 and 200 are present in brain of some patients with HIV-associated dementia. • D197 results in loss of a glycan near the HIV Env trimer apex, which may increase exposure of V3. • These variants may promote infection of macrophages in the brain by enhancing gp120–CCR5 interactions.

  15. Promoting Active Learning in Calculus and General Physics through Interactive and Media-Enhanced Lectures

    Directory of Open Access Journals (Sweden)

    Guoqing Tang

    2004-02-01

    Full Text Available In this paper we present an approach of incorporating interactive and media-enhanced lectures to promote active learning in Calculus and General Physics courses. The pedagogical practice of using interactive techniques in lectures to require "heads-on" and "hands-on" learning, and involve students more as active participants than passive receivers is a part of academic curricular reform efforts undertaken currently by the mathematics, physics and chemistry departments at North Carolina A&T State University under the NSF funded project "Talent-21: Gateway for Advancing Science and Mathematics Talents."

  16. Enhancement of the Enterocin CRL35 Activity by a Synthetic Peptide Derived from the NH2-Terminal Sequence

    Science.gov (United States)

    Saavedra, Lucila; Minahk, Carlos; de Ruiz Holgado, Aída P.; Sesma, Fernando

    2004-01-01

    The enterocin CRL35 biosynthetic gene cluster was cloned and sequenced. The sequence was revealed to be highly identical to that of the mundticin KS gene cluster (S. Kawamoto, J. Shima, R. Sato, T. Eguchi, S. Ohmomo, J. Shibato, N. Horikoshi, K. Takeshita, and T. Sameshima, Appl. Environ. Microbiol. 68:3830-3840, 2002). Short synthetic peptides were designed based on the bacteriocin sequence and were evaluated in antimicrobial competitive assays. The peptide KYYGNGVSCNKKGCS produced an enhancement of enterocin CRL35 antimicrobial activity in a buffer system. PMID:15215149

  17. Herpes simplex virus latency-associated transcript sequence downstream of the promoter influences type-specific reactivation and viral neurotropism.

    Science.gov (United States)

    Bertke, Andrea S; Patel, Amita; Krause, Philip R

    2007-06-01

    Herpes simplex virus (HSV) establishes latency in sensory nerve ganglia during acute infection and may later periodically reactivate to cause recurrent disease. HSV type 1 (HSV-1) reactivates more efficiently than HSV-2 from trigeminal ganglia while HSV-2 reactivates more efficiently than HSV-1 from lumbosacral dorsal root ganglia (DRG) to cause recurrent orofacial and genital herpes, respectively. In a previous study, a chimeric HSV-2 that expressed the latency-associated transcript (LAT) from HSV-1 reactivated similarly to wild-type HSV-1, suggesting that the LAT influences the type-specific reactivation phenotype of HSV-2. To further define the LAT region essential for type-specific reactivation, we constructed additional chimeric HSV-2 viruses by replacing the HSV-2 LAT promoter (HSV2-LAT-P1) or 2.5 kb of the HSV-2 LAT sequence (HSV2-LAT-S1) with the corresponding regions from HSV-1. HSV2-LAT-S1 was impaired for reactivation in the guinea pig genital model, while its rescuant and HSV2-LAT-P1 reactivated with a wild-type HSV-2 phenotype. Moreover, recurrences of HSV-2-LAT-S1 were frequently fatal, in contrast to the relatively mild recurrences of the other viruses. During recurrences, HSV2-LAT-S1 DNA increased more in the sacral cord compared to its rescuant or HSV-2. Thus, the LAT sequence region, not the LAT promoter region, provides essential elements for type-specific reactivation of HSV-2 and also plays a role in viral neurotropism. HSV-1 DNA, as quantified by real-time PCR, was more abundant in the lumbar spinal cord, while HSV-2 DNA was more abundant in the sacral spinal cord, which may provide insights into the mechanism for type-specific reactivation and different patterns of central nervous system infection of HSV-1 and HSV-2.

  18. Prenylcoumarins in One or Two Steps by a Microwave-Promoted Tandem Claisen Rearrangement/Wittig Olefination/Cyclization Sequence.

    Science.gov (United States)

    Schultze, Christiane; Schmidt, Bernd

    2018-05-04

    The one-pot synthesis of 8-prenylcoumarins from 1,1-dimethylallylated salicylaldehydes and the stabilized ylide [(ethoxycarbonyl)methylene]triphenylphosphorane under microwave conditions was found to have a limited scope. The sequence suffers from a difficult and sometimes low-yielding synthesis of the precursors and from a competing deprenylation upon microwave irradiation. This side reaction occurs in particular with electron rich arenes with two or more alkoxy groups at adjacent positions, a prominent substitution pattern in naturally occurring 8-prenylcoumarins. Both limitations of this one-step sequence were overcome by a two-step synthesis consisting of a microwave-promoted tandem allyl ether Claisen rearrangement/Wittig olefination and a subsequent olefin cross metathesis with 2-methyl-2-butene. The cross metathesis step proceeds with a high selectivity and yields exclusively the desired prenyl, rather than the alternative crotyl substituent. Several naturally occurring 8-prenylcoumarins that were previously inaccessible have been synthesized in good overall yields along this route.

  19. A Randomized Trial of SMART Goal Enhanced Debriefing after Simulation to Promote Educational Actions

    Directory of Open Access Journals (Sweden)

    Amish Aghera

    2017-12-01

    Full Text Available Introduction Goal setting is used in education to promote learning and performance. Debriefing after clinical scenario-based simulation is a well-established practice that provides learners a defined structure to review and improve performance. Our objective was to integrate formal learning goal generation, using the SMART framework (Specific, Measurable, Attainable, Realistic, and Time-bound, into standard debriefing processes (i.e., “SMART Goal Enhanced Debriefing” and subsequently measure the impact on the development of learning goals and execution of educational actions. Methods This was a prospective multicenter randomized controlled study of 80 emergency medicine residents at three academic hospitals comparing the effectiveness of SMART Goal Enhanced Debriefing to a standard debriefing. Residents were block randomized on a rolling basis following a simulation case. SMART Goal Enhanced Debriefing included five minutes of formal instruction on the development of SMART learning goals during the summary/application phase of the debrief. Outcome measures included the number of recalled learning goals, self-reported executed educational actions, and quality of each learning goal and educational action after a two-week follow-up period. Results The mean number of reported learning goals was similar in the standard debriefing group (mean 2.05 goals, SD 1.13, n=37 residents, and in the SMART Goal Enhanced Debriefing group (mean 1.93, SD 0.96, n=43, with no difference in learning goal quality. Residents receiving SMART Goal Enhanced Debriefing completed more educational actions on average (Control group actions completed 0.97 (SD 0.87, SMART debrief group 1.44 (SD 1.03 p=0.03. Conclusion The number and quality of learning goals reported by residents was not improved as a result of SMART Goal Enhanced Debriefing. Residents did, however, execute more educational actions, which is consistent with the overarching intent of any educational

  20. Detection of hepatic VX2 carcinomas with ferucarbotran-enhanced magnetic resonance imaging in rabbits: Comparison of nine pulse sequences

    International Nuclear Information System (INIS)

    Kim, Seong Hyun; Choi, Dongil; Lim, Hyo K.; Kim, Min Ju; Jang, Kyung Mi; Kim, Seung Hoon; Lee, Won Jae; Lee, Jongmee; Jeon, Yong Hwan; Lim, Jae Hoon

    2006-01-01

    Objective: To compare the diagnostic performance of a variety of magnetic resonance imaging (MRI) sequences, in order to identify the most effective ferucarbotran-enhanced sequence for the detection of multiple small hepatic VX2 carcinomas in rabbits. Methods: Fifteen rabbits with experimentally induced 135 VX2 carcinomas in the liver underwent ferucarbotran-enhanced MRI using the following nine pulse sequences: a fat-suppressed fast spin-echo (FSE) sequence with two echo times (TE) (proton density- and T2-weighted images), four different T2*-weighted fast multiplanar GRASS (gradient-recalled acquisition in the steady state) (FMPGR) with the combination of three TEs (9, 12, 15 ms, respectively) and two flip angles (20 deg., 80 deg., respectively), T2*-weighted fast multiplanar spoiled GRASS (FMPSPGR), T1-weighted FMPSPGR, and dynamic T1-weighted FMPSPGR. All images were reviewed by three radiologists with quantitative and qualitative analysis. Results: Tumor-to-liver contrast-to-noise ratio of the proton density-weighted FSE sequence was significantly higher than those of the others (p o ) images were superior to those of the others and for the detection of very small hepatic tumors of less than 5 mm, the sensitivities of these sequences were less than 30%. Conclusion: Ferucarbotran-enhanced T2- and proton density-weighted FSE and T2*-weighed FMPGR (TE/flip angle, 12/20 o ) images were found to be the most effective pulse sequences for the detection of multiple small hepatic VX2 carcinomas but these sequences were limited in the detection of very small hepatic tumors of less than 5 mm in size

  1. Enhanced production of recombinant proteins with Corynebacterium glutamicum by deletion of insertion sequences (IS elements).

    Science.gov (United States)

    Choi, Jae Woong; Yim, Sung Sun; Kim, Min Jeong; Jeong, Ki Jun

    2015-12-29

    In most bacteria, various jumping genetic elements including insertion sequences elements (IS elements) cause a variety of genetic rearrangements resulting in harmful effects such as genome and recombinant plasmid instability. The genetic stability of a plasmid in a host is critical for high-level production of recombinant proteins, and in this regard, the development of an IS element-free strain could be a useful strategy for the enhanced production of recombinant proteins. Corynebacterium glutamicum, which is a workhorse in the industrial-scale production of various biomolecules including recombinant proteins, also has several IS elements, and it is necessary to identify the critical IS elements and to develop IS element deleted strain. From the cultivation of C. glutamicum harboring a plasmid for green fluorescent protein (GFP) gene expression, non-fluorescent clones were isolated by FACS (fluorescent activated cell sorting). All the isolated clones had insertions of IS elements in the GFP coding region, and two major IS elements (ISCg1 and ISCg2 families) were identified. By co-cultivating cells harboring either the isolated IS element-inserted plasmid or intact plasmid, it was clearly confirmed that cells harboring the IS element-inserted plasmids became dominant during the cultivation due to their growth advantage over cells containing intact plasmids, which can cause a significant reduction in recombinant protein production during cultivation. To minimize the harmful effects of IS elements on the expression of heterologous genes in C. glutamicum, two IS element free C. glutamicum strains were developed in which each major IS element was deleted, and enhanced productivity in the engineered C. glutamicum strain was successfully demonstrated with three models: GFP, poly(3-hydroxybutyrate) [P(3HB)] and γ-aminobutyrate (GABA). Our findings clearly indicate that the hopping of IS elements could be detrimental to the production of recombinant proteins in C

  2. Optimal pulse sequence for ferumoxides-enhanced MR imaging used in the detection of hepatocellular carcinoma: a comparative study using seven pulse sequences

    International Nuclear Information System (INIS)

    Kim, Seung Hoon; Choi, Dongil; Lim, Jae Hoon; Lee, Won Jae; Jang, Hyun Jung; Lim, Kyo Keun; Lee, Soon Jin; Cho, Jae Min; Kim, Seung Kwon; Kim, Gab Chul

    2002-01-01

    To identify the optimal pulse sequence for ferumoxides-enhanced magnetic resonance (MR) imaging in the detection of hepatocelluar carcinomas (HCCs). Sixteen patients with 25 HCCs underwent MR imaging following intravenous infusion of ferumoxides. All MR studies were performed on a 1.5-T MR system, using a phased-array coil. Ferumoxides (Feridex IV) at a dose of 15 μmol/Kg was slowly infused intravenously, and axial images of seven sequences were obtained 30 minutes after the end of infusion. The MR protocol included fast spin-echo (FSE) with two echo times (TR3333-8571/TE18 and 90-117), singleshot FSE (SSFSE) with two echo times (TR∞/TE39 and 98), T2-weighted gradient-recalled acquisition in the steady state (GRASS) (TR216/TE20), T2-weighted fast multiplanar GRASS (FMPGR) (TR130/TE8.4-9.5), and T2-weighted fast multiplanar spoiled GRASS (FMPSPGR) (TR130/TE8.4-9.5). Contrast-to-noise ratios (CNRs) of HCCs determined during the imaging sequences formed the basis of quantitative analysis, and images were qualitatively assessed in terms of lesion conspicuity and image artifacts. The diagnostic accuracy of all sequences was assessed using receiver operating characteristic (ROC) analysis. Quantitative analysis revealed that the CNRs of T2-weighted FMPGR and T2-weighted FMPSPGR were significantly higher than those of the other sequences, while qualitative analysis showed that image artifacts were prominent at T2-weighted GRASS imaging. Lesion conspicuity was statistically significantly less clear at SSFSE imaging. In term of lesion detection, T-weighted FMPGR, T2- weighted FMPSPGR, and proton density FSE imaging were statistically superior to the others. T2-weighted FMPGR, T2- weighted FMPSPGR, and proton density FSE appear to be the optimal pulse sequences for ferumoxidesenhanced MR imaging in the detection of HCCs

  3. Effect of BRCA2 sequence variants predicted to disrupt exonic splice enhancers on BRCA2 transcripts

    Directory of Open Access Journals (Sweden)

    Brewster Brooke L

    2010-05-01

    Full Text Available Abstract Background Genetic screening of breast cancer patients and their families have identified a number of variants of unknown clinical significance in the breast cancer susceptibility genes, BRCA1 and BRCA2. Evaluation of such unclassified variants may be assisted by web-based bioinformatic prediction tools, although accurate prediction of aberrant splicing by unclassified variants affecting exonic splice enhancers (ESEs remains a challenge. Methods This study used a combination of RT-PCR analysis and splicing reporter minigene assays to assess five unclassified variants in the BRCA2 gene that we had previously predicted to disrupt an ESE using bioinformatic approaches. Results Analysis of BRCA2 c.8308 G > A (p.Ala2770Thr by mRNA analysis, and BRCA2 c.8962A > G (p.Ser2988Gly, BRCA2 c.8972G > A (p.Arg2991His, BRCA2 c.9172A > G (p.Ser3058Gly, and BRCA2 c.9213G > T (p.Glu3071Asp by a minigene assay, revealed no evidence for aberrant splicing. Conclusions These results illustrate the need for improved methods for predicting functional ESEs and the potential consequences of sequence variants contained therein.

  4. Exploring plant growth-promotion actinomycetes from vermicompost and rhizosphere soil for yield enhancement in chickpea

    Science.gov (United States)

    Sreevidya, M.; Gopalakrishnan, S.; Kudapa, H.; Varshney, R.K.

    2016-01-01

    The main objective of the present study was to isolate and characterize actinomycetes for their plant growth-promotion in chickpea. A total of 89 actinomycetes were screened for their antagonism against fungal pathogens of chickpea by dual culture and metabolite production assays. Four most promising actinomycetes were evaluated for their physiological and plant growth-promotion properties under in vitro and in vivo conditions. All the isolates exhibited good growth at temperatures from 20 °C to 40 °C, pH range of 7–11 and NaCl concentrations up to 8%. These were also found highly tolerant to Bavistin, slightly tolerant to Thiram and Captan (except VAI-7 and VAI-40) but susceptible to Benlate and Ridomil at field application levels and were found to produce siderophore, cellulase, lipase, protease, chitinase (except VAI-40), hydrocyanic acid (except VAI-7 and VAI-40), indole acetic acid and β-1,3-glucanase. When the four actinomycetes were evaluated for their plant growth-promotion properties under field conditions on chickpea, all exhibited increase in nodule number, shoot weight and yield. The actinomycetes treated plots enhanced total N, available P and organic C over the un-inoculated control. The scanning electron microscope studies exhibited extensive colonization by actinomycetes on the root surface of chickpea. The expression profiles for indole acetic acid, siderophore and β-1,3-glucanase genes exhibited up-regulation for all three traits and in all four isolates. The actinomycetes were identified as Streptomyces but different species in the 16S rDNA analysis. It was concluded that the selected actinomycetes have good plant growth-promotion and biocontrol potentials on chickpea. PMID:26887230

  5. Exploring plant growth-promotion actinomycetes from vermicompost and rhizosphere soil for yield enhancement in chickpea

    Directory of Open Access Journals (Sweden)

    M. Sreevidya

    2016-03-01

    Full Text Available Abstract The main objective of the present study was to isolate and characterize actinomycetes for their plant growth-promotion in chickpea. A total of 89 actinomycetes were screened for their antagonism against fungal pathogens of chickpea by dual culture and metabolite production assays. Four most promising actinomycetes were evaluated for their physiological and plant growth-promotion properties under in vitro and in vivo conditions. All the isolates exhibited good growth at temperatures from 20 °C to 40 °C, pH range of 7–11 and NaCl concentrations up to 8%. These were also found highly tolerant to Bavistin, slightly tolerant to Thiram and Captan (except VAI-7 and VAI-40 but susceptible to Benlate and Ridomil at field application levels and were found to produce siderophore, cellulase, lipase, protease, chitinase (except VAI-40, hydrocyanic acid (except VAI-7 and VAI-40, indole acetic acid and β-1,3-glucanase. When the four actinomycetes were evaluated for their plant growth-promotion properties under field conditions on chickpea, all exhibited increase in nodule number, shoot weight and yield. The actinomycetes treated plots enhanced total N, available P and organic C over the un-inoculated control. The scanning electron microscope studies exhibited extensive colonization by actinomycetes on the root surface of chickpea. The expression profiles for indole acetic acid, siderophore and β-1,3-glucanase genes exhibited up-regulation for all three traits and in all four isolates. The actinomycetes were identified as Streptomyces but different species in the 16S rDNA analysis. It was concluded that the selected actinomycetes have good plant growth-promotion and biocontrol potentials on chickpea.

  6. Acute Sleep Deprivation Enhances Post-Infection Sleep and Promotes Survival during Bacterial Infection in Drosophila

    Science.gov (United States)

    Kuo, Tzu-Hsing; Williams, Julie A.

    2014-01-01

    Study Objectives: Sleep is known to increase as an acute response to infection. However, the function of this behavioral response in host defense is not well understood. To address this problem, we evaluated the effect of acute sleep deprivation on post-infection sleep and immune function in Drosophila. Setting: Laboratory. Participants: Drosophila melanogaster. Methods and Results: Flies were subjected to sleep deprivation before (early DEP) or after (late DEP) bacterial infection. Relative to a non-deprived control, flies subjected to early DEP had enhanced sleep after infection as well as increased bacterial clearance and survival outcome. Flies subjected to late DEP experienced enhanced sleep following the deprivation period, and showed a modest improvement in survival outcome. Continuous DEP (early and late DEP) throughout infection also enhanced sleep later during infection and improved survival. However, improved survival in flies subjected to late or continuous DEP did not occur until after flies had experienced sleep. During infection, both early and late DEP enhanced NFκB transcriptional activity as measured by a luciferase reporter (κB-luc) in living flies. Early DEP also increased NFκB activity prior to infection. Flies that were deficient in expression of either the Relish or Dif NFκB transcription factors showed normal responses to early DEP. However, the effect of early DEP on post-infection sleep and survival was abolished in double mutants, which indicates that Relish and Dif have redundant roles in this process. Conclusions: Acute sleep deprivation elevated NFκB-dependent activity, increased post-infection sleep, and improved survival during bacterial infection. Citation: Kuo TH, Williams JA. Acute sleep deprivation enhances post-infection sleep and promotes survival during bacterial infection in Drosophila. SLEEP 2014;37(5):859-869. PMID:24790264

  7. Hypoxia-induced mitogenic factor enhances angiogenesis by promoting proliferation and migration of endothelial cells

    International Nuclear Information System (INIS)

    Tong Qiangsong; Zheng Liduan; Li Bo; Wang Danming; Huang Chuanshu; Matuschak, George M.; Li Dechun

    2006-01-01

    Our previous studies have indicated that hypoxia-induced mitogenic factor (HIMF) has angiogenic properties in an in vivo matrigel plug model and HIMF upregulates expression of vascular endothelial growth factor (VEGF) in mouse lungs and cultured lung epithelial cells. However, whether HIMF exerts angiogenic effects through modulating endothelial cell function remains unknown. In this study, mouse aortic rings cultured with recombinant HIMF protein resulted in enhanced vascular sprouting and increased endothelial cell spreading as confirmed by Dil-Ac-LDL uptake, von Willebrand factor and CD31 staining. In cultured mouse endothelial cell line SVEC 4-10, HIMF dose-dependently enhanced cell proliferation, in vitro migration and tubulogenesis, which was not attenuated by SU1498, a VEGFR2/Flk-1 receptor tyrosine kinase inhibitor. Moreover, HIMF stimulation resulted in phosphorylation of Akt, p38 and ERK1/2 kinases in SVEC 4-10 cells. Treatment of mouse aortic rings and SVEC 4-10 cells with LY294002, but not SB203580, PD098059 or U0126, abolished HIMF-induced vascular sprouting and angiogenic responses. In addition, transfection of a dominant-negative mutant of phosphatidylinositol 3-kinase (PI-3K), Δp85, blocked HIMF-induced phosphorylation of Akt, endothelial activation and tubulogenesis. These results indicate that HIMF enhances angiogenesis by promoting proliferation and migration of endothelial cells via activation of the PI-3K/Akt pathways

  8. TaALMT1 promoter sequence compositions, acid tolerance, and Al tolerance in wheat cultivars and landraces from Sichuan in China.

    Science.gov (United States)

    Han, C; Dai, S F; Liu, D C; Pu, Z J; Wei, Y M; Zheng, Y L; Wen, D J; Zhao, L; Yan, Z H

    2013-11-18

    Previous genetic studies on wheat from various sources have indicated that aluminum (Al) tolerance may have originated independently in USA, Brazil, and China. Here, TaALMT1 promoter sequences of 92 landraces and cultivars from Sichuan, China, were sequenced. Five promoter types (I', II, III, IV, and V) were observed in 39 cultivars, and only three promoter types (I, II, and III) were observed in 53 landraces. Among the wheat collections worldwide, only the Chinese Spring (CS) landrace native to Sichuan, China, carried the TaALMT1 promoter type III. Besides CS, two other Sichuan-bred landraces and six cultivars with TaALMT1 promoter type III were identified in this study. In the phylogenetic tree constructed based on the TaALMT1 promoter sequences, type III formed a separate branch, which was supported by a high bootstrap value. It is likely that TaALMT1 promoter type III originated from Sichuan-bred wheat landraces of China. In addition, the landraces with promoter type I showed the lowest Al tolerance among all landraces and cultivars. Furthermore, the cultivars with promoter type IV showed better Al tolerance than landraces with promoter type II. A comparison of acid tolerance and Al tolerance between cultivars and landraces showed that the landraces had better acid tolerance than the cultivars, whereas the cultivars showed better Al tolerance than the landraces. Moreover, significant difference in Al tolerance was also observed between the cultivars raised by the National Ministry of Agriculture and by Sichuan Province. Among the landraces from different regions, those from the East showed better acid tolerance and Al tolerance than those from the South and West of Sichuan. Additional Al-tolerant and acid-tolerant wheat lines were also identified.

  9. Mechanical Stretching Promotes Skin Tissue Regeneration via Enhancing Mesenchymal Stem Cell Homing and Transdifferentiation.

    Science.gov (United States)

    Liang, Xiao; Huang, Xiaolu; Zhou, Yiwen; Jin, Rui; Li, Qingfeng

    2016-07-01

    Skin tissue expansion is a clinical procedure for skin regeneration to reconstruct cutaneous defects that can be accompanied by severe complications. The transplantation of mesenchymal stem cells (MSCs) has been proven effective in promoting skin expansion and helping to ameliorate complications; however, systematic understanding of its mechanism remains unclear. MSCs from luciferase-Tg Lewis rats were intravenously transplanted into a rat tissue expansion model to identify homing and transdifferentiation. To clarify underlying mechanisms, a systematic approach was used to identify the differentially expressed genes between mechanically stretched human MSCs and controls. The biological significance of these changes was analyzed through bioinformatic methods. We further investigated genes and pathways of interest to disclose their potential role in mechanical stretching-induced skin regeneration. Cross sections of skin samples from the expanded group showed significantly more luciferase(+) and stromal cell-derived factor 1α (SDF-1α)(+), luciferase(+)keratin 14(+), and luciferase(+)CD31(+) cells than the control group, indicating MSC transdifferentiation into epidermal basal cells and endothelial cells after SDF-1α-mediated homing. Microarray analysis suggested upregulation of genes related to hypoxia, vascularization, and cell proliferation in the stretched human MSCs. Further investigation showed that the homing of MSCs was blocked by short interfering RNA targeted against matrix metalloproteinase 2, and that mechanical stretching-induced vascular endothelial growth factor A upregulation was related to the Janus kinase/signal transducer and activator of transcription (Jak-STAT) and Wnt signaling pathways. This study determines that mechanical stretching might promote skin regeneration by upregulating MSC expression of genes related to hypoxia, vascularization, and cell proliferation; enhancing transplanted MSC homing to the expanded skin; and

  10. Chunk concatenation evolves with practice and sleep-related enhancement consolidation in a complex arm movement sequence

    Directory of Open Access Journals (Sweden)

    Blischke Klaus

    2016-06-01

    Full Text Available This paper addresses the notion of chunk concatenation being associated with sleep-related enhancement consolidation of motor sequence memory, thereby essentially contributing to improvements in sequence execution speed. To this end, element movement times of a multi-joint arm movement sequence incorporated in a recent study by Malangré et al. (2014 were reanalyzed. As sequence elements differed with respect to movement distance, element movement times had to be purged from differences solely due to varying trajectory lengths. This was done by dividing each element movement time per subject and trial block by the respective “reference movement time” collected from subjects who had extensively practiced each sequence element in isolation. Any differences in these “relative element movement times” were supposed to reflect element-specific “production costs” imposed solely by the sequence context. Across all subjects non-idiosyncratic, lasting sequence segmentation was shown, and four possible concatenation points (i.e. transition points between successive chunks within the original arm movement sequence were identified. Based on theoretical suppositions derived from previous work with the discrete sequence production task and the dual processor model (Abrahamse et al., 2013, significantly larger improvements in transition speed occurring at these four concatenation points as compared to the five fastest transition positions within the sequence (associated with mere element execution were assumed to indicate increased chunk concatenation. As a result, chunk concatenation was shown to proceed during acquisition with physical practice, and, most importantly, to significantly progress some more during retention following a night of sleep, but not during a waking interval.

  11. Identification of TNF-α-responsive promoters and enhancers in the intestinal epithelial cell model Caco-2

    DEFF Research Database (Denmark)

    Boyd, Mette; Coskun, Mehmet; Lilje, Berit

    2014-01-01

    The Caco-2 cell line is one of the most important in vitro models for enterocytes, and is used to study drug absorption and disease, including inflammatory bowel disease and cancer. In order to use the model optimally, it is necessary to map its functional entities. In this study, we have generated...... genome-wide maps of active transcription start sites (TSSs), and active enhancers in Caco-2 cells with or without tumour necrosis factor (TNF)-α stimulation to mimic an inflammatory state. We found 520 promoters that significantly changed their usage level upon TNF-α stimulation; of these, 52...... promoters. As a case example, we characterize an enhancer regulating the laminin-5 γ2-chain (LAMC2) gene by nuclear factor (NF)-κB binding. This report is the first to present comprehensive TSS and enhancer maps over Caco-2 cells, and highlights many novel inflammation-specific promoters and enhancers....

  12. Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

    Science.gov (United States)

    Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

    1993-12-22

    The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

  13. SNBRFinder: A Sequence-Based Hybrid Algorithm for Enhanced Prediction of Nucleic Acid-Binding Residues.

    Science.gov (United States)

    Yang, Xiaoxia; Wang, Jia; Sun, Jun; Liu, Rong

    2015-01-01

    Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder) by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.

  14. Promoting communication with older adults: protocols for resolving interpersonal conflicts and for enhancing interactions with doctors.

    Science.gov (United States)

    Weitzman, Patricia Flynn; Weitzman, Eben A

    2003-07-01

    In this paper, we review the importance of effective communication in older adulthood, and ideas for promoting it. We focus on theoretical and applied work in two communicative encounters that have particular relevance for older adult health, i.e., interpersonal conflict and visits with a healthcare provider. Little applied work has aimed to adapt training protocols for older adults in these two areas. We will present training protocols we have developed in constructive conflict resolution for older adults, and on enhancing doctor-patient communication. We present these protocols to stimulate ideas on the part of the reader on how to further develop and refine training efforts for older adults in effective communication.

  15. Sfp-type PPTase inactivation promotes bacterial biofilm formation and ability to enhance wheat drought tolerance

    Directory of Open Access Journals (Sweden)

    Salme eTimmusk

    2015-05-01

    Full Text Available Paenibacillus polymyxa is a common soil bacterium with broad range of practical applications. An important group of secondary metabolites in P. polymyxa are nonribosomal peptide and polyketide derived metabolites (NRP/PK. Modular nonribosomal peptide synthetases catalyse main steps in the biosynthesis of the complex secondary metabolites. Here we report on the inactivation of an A26 sfp-type phosphopantetheinyl transferase. The inactivation of the gene resulted in loss of NRP/PK production. In contrast to the former Bacillus spp. model the mutant strain compared to wild type showed greatly enhanced biofilm formation ability. Its biofilm promotion is directly mediated by NRP/PK, as exogenous addition of the wild type metabolite extracts restores its biofilm formation level. Wheat inoculation with bacteria that had lost their sfp-type PPTase gene resulted in two times higher plant survival and about three times increased biomass under severe drought stress compared to wild type.

  16. Plant Growth-Promoting Rhizobacteria Enhance Salinity Stress Tolerance in Okra through ROS-Scavenging Enzymes

    Directory of Open Access Journals (Sweden)

    Sheikh Hasna Habib

    2016-01-01

    Full Text Available Salinity is a major environmental stress that limits crop production worldwide. In this study, we characterized plant growth-promoting rhizobacteria (PGPR containing 1-aminocyclopropane-1-carboxylate (ACC deaminase and examined their effect on salinity stress tolerance in okra through the induction of ROS-scavenging enzyme activity. PGPR inoculated okra plants exhibited higher germination percentage, growth parameters, and chlorophyll content than control plants. Increased antioxidant enzyme activities (SOD, APX, and CAT and upregulation of ROS pathway genes (CAT, APX, GR, and DHAR were observed in PGPR inoculated okra plants under salinity stress. With some exceptions, inoculation with Enterobacter sp. UPMR18 had a significant influence on all tested parameters under salt stress, as compared to other treatments. Thus, the ACC deaminase-containing PGPR isolate Enterobacter sp. UPMR18 could be an effective bioresource for enhancing salt tolerance and growth of okra plants under salinity stress.

  17. Enhancing potency of siRNA targeting fusion genes by optimization outside of target sequence.

    Science.gov (United States)

    Gavrilov, Kseniya; Seo, Young-Eun; Tietjen, Gregory T; Cui, Jiajia; Cheng, Christopher J; Saltzman, W Mark

    2015-12-01

    Canonical siRNA design algorithms have become remarkably effective at predicting favorable binding regions within a target mRNA, but in some cases (e.g., a fusion junction site) region choice is restricted. In these instances, alternative approaches are necessary to obtain a highly potent silencing molecule. Here we focus on strategies for rational optimization of two siRNAs that target the junction sites of fusion oncogenes BCR-ABL and TMPRSS2-ERG. We demonstrate that modifying the termini of these siRNAs with a terminal G-U wobble pair or a carefully selected pair of terminal asymmetry-enhancing mismatches can result in an increase in potency at low doses. Importantly, we observed that improvements in silencing at the mRNA level do not necessarily translate to reductions in protein level and/or cell death. Decline in protein level is also heavily influenced by targeted protein half-life, and delivery vehicle toxicity can confound measures of cell death due to silencing. Therefore, for BCR-ABL, which has a long protein half-life that is difficult to overcome using siRNA, we also developed a nontoxic transfection vector: poly(lactic-coglycolic acid) nanoparticles that release siRNA over many days. We show that this system can achieve effective killing of leukemic cells. These findings provide insights into the implications of siRNA sequence for potency and suggest strategies for the design of more effective therapeutic siRNA molecules. Furthermore, this work points to the importance of integrating studies of siRNA design and delivery, while heeding and addressing potential limitations such as restricted targetable mRNA regions, long protein half-lives, and nonspecific toxicities.

  18. Enhanced biological phosphorus removal in a sequencing batch reactor using propionate as the sole carbon source.

    Science.gov (United States)

    Pijuan, M; Saunders, A M; Guisasola, A; Baeza, J A; Casas, C; Blackall, L L

    2004-01-05

    An enhanced biological phosphorus removal (EBPR) system was developed in a sequencing batch reactor (SBR) using propionate as the sole carbon source. The microbial community was followed using fluorescence in situ hybridization (FISH) techniques and Candidatus 'Accumulibacter phosphatis' were quantified from the start up of the reactor until steady state. A series of SBR cycle studies was performed when 55% of the SBR biomass was Accumulibacter, a confirmed polyphosphate accumulating organism (PAO) and when Candidatus 'Competibacter phosphatis', a confirmed glycogen-accumulating organism (GAO), was essentially undetectable. These experiments evaluated two different carbon sources (propionate and acetate), and in every case, two different P-release rates were detected. The highest rate took place while there was volatile fatty acid (VFA) in the mixed liquor, and after the VFA was depleted a second P-release rate was observed. This second rate was very similar to the one detected in experiments performed without added VFA.A kinetic and stoichiometric model developed as a modification of Activated Sludge Model 2 (ASM2) including glycogen economy, was fitted to the experimental profiles. The validation and calibration of this model was carried out with the cycle study experiments performed using both VFAs. The effect of pH from 6.5 to 8.0 on anaerobic P-release and VFA-uptake and aerobic P-uptake was also studied using propionate. The optimal overall working pH was around 7.5. This is the first study of the microbial community involved in EBPR developed with propionate as a sole carbon source along with detailed process performance investigations of the propionate-utilizing PAOs. Copyright 2003 Wiley Periodicals, Inc.

  19. ΔNp73 enhances promoter activity of TGF-β induced genes.

    Directory of Open Access Journals (Sweden)

    Maarten Niemantsverdriet

    Full Text Available The p53 homolog p73 is frequently overexpressed in cancers. Especially the transactivation domain truncated isoform ΔNp73 has oncogenic properties and its upregulation is associated with poor patient survival. It has been shown that ΔNp73 has an inhibitory effect on the transactivation capacity of p53 and other p73 isoforms. Here, we confirm this finding but surprisingly find that ΔNp73 may also stimulate the expression of TGF-β signaling targets. Promoter-reporter analysis indicated that the presence of Smad Binding Elements (SBE in the promoter is sufficient for stimulation of gene expression by ΔNp73. TGF-β signaling was less efficient in ΔNp73 downregulated cells, whereas tetracycline induced ΔNp73 increased expression of endogenous TGF-β regulated genes PAI-1 and Col1a1. Pull-down assays with SBE DNA suggest that ΔNp73 enhances smad3/4 binding to SBEs, thereby stimulating TGF-β signaling. Chromatin immunoprecipitation assays confirmed a direct interaction between ΔNp73 and SBE. Given the role of TGF-β signaling in carcinogenesis, tumor invasion and metastasis via targets like PAI-1 and Col1a1, our data suggest a model on how this effect of ΔNp73 could be a contributing factor in cancer progression.

  20. Geoheritage, Geotourism and the Cultural Landscape: Enhancing the Visitor Experience and Promoting Geoconservation

    Directory of Open Access Journals (Sweden)

    John E. Gordon

    2018-04-01

    Full Text Available Geotourism spans a range of visitor interests, from the specialist geotourist to the more general visitor. As well as supporting geoconservation outcomes, it provides economic, cultural, relational and social benefits for both visitors and host communities. The interconnections between geoheritage and the cultural components of the landscape have antecedents in concepts of landscape aesthetics in different cultures. These interconnections provide a range of opportunities for enhancing the geotourist experience and promoting geoconservation and geoeducation by means of activities that involve aesthetic and emotional experiences and interpretation through different cultural filters that encourage the rediscovery of a sense of wonder both about the geological stories in the landscape and the human interactions. A cultural ecosystem services framework provides a holistic approach for informing conservation policy, management and planning for geotourism, enabling assessment of multiple benefits and trade-offs for visitors and communities based on the values of the geoheritage assets. Geotourism studies could also benefit from integration of existing theory, conceptual analysis and practice from broader heritage and nature-based tourism and closer collaboration with relevant social sciences. Adhering to sound geoethical practice is an essential part of geotourism, which can also play a role in the promotion of geoethics among the public and professionals.

  1. The N-terminus of TDP-43 promotes its oligomerization and enhances DNA binding affinity

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Chung-ke [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Wu, Tzong-Huah [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Chemical Biology and Molecular Biophysics Program, Taiwan International Graduate Program, Institute of Biochemistry, Academia Sinica, Taipei 115, Taiwan (China); Institute of Bioinformatics and Structural Biology, National Tsing Hua University, Hsinchu 300, Taiwan (China); Wu, Chu-Ya [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Graduate Institute of Engineering, National Taiwan University of Science and Technology, Taipei 106, Taiwan (China); Chiang, Ming-hui; Toh, Elsie Khai-Woon [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Hsu, Yin-Chih; Lin, Ku-Feng [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Liao, Yu-heng [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Huang, Tai-huang, E-mail: bmthh@gate.sinica.edu.tw [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Department of Physics, National Taiwan Normal University, Taipei 106, Taiwan (China); Huang, Joseph Jen-Tse, E-mail: jthuang@chem.sinica.edu.tw [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China)

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer The N-terminus of TDP-43 contains an independently folded structural domain (NTD). Black-Right-Pointing-Pointer The structural domains of TDP-43 are arranged in a beads-on-a-string fashion. Black-Right-Pointing-Pointer The NTD promotes TDP-43 oligomerization in a concentration-dependent manner. Black-Right-Pointing-Pointer The NTD may assist nucleic acid-binding activity of TDP-43. -- Abstract: TDP-43 is a DNA/RNA-binding protein associated with different neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD-U). Here, the structural and physical properties of the N-terminus on TDP-43 have been carefully characterized through a combination of nuclear magnetic resonance (NMR), circular dichroism (CD) and fluorescence anisotropy studies. We demonstrate for the first time the importance of the N-terminus in promoting TDP-43 oligomerization and enhancing its DNA-binding affinity. An unidentified structural domain in the N-terminus is also disclosed. Our findings provide insights into the N-terminal domain function of TDP-43.

  2. Inactivation of p27kip1 Promoted Nonspecific Inflammation by Enhancing Macrophage Proliferation in Islet Transplantation.

    Science.gov (United States)

    Li, Yang; Ding, Xiaoming; Fan, Ping; Guo, Jian; Tian, Xiaohui; Feng, Xinshun; Zheng, Jin; Tian, Puxun; Ding, Chenguang; Xue, Wujun

    2016-11-01

    Islet transplantation suffers from low efficiency caused by nonspecific inflammation-induced graft loss after transplantation. This study reports increased islet loss and enhanced inflammatory response in p27-deficient mice (p27-/-) and proposes a possible mechanism. Compared with wild type, p27-/- mice showed more severe functional injury of islet, with increased serum levels of inflammatory cytokines IL-1 and TNF-α, inducing macrophage proliferation. Furthermore, the increased number, proapoptotic proteins, and nuclear factor-kappa b (NF-κB) phosphorylation status of the infiltrating macrophages were accompanied by increased TNF-α mRNA level of islet graft site in p27-/- mice. Moreover, in vitro, we found that macrophages were still activated and cocultured with islet and promoted islet loss even blocking the direct effect of TNF-α on islets. Malondialdehyde (MDA, an end product of lipid peroxidation) in islet and media were increased after cocultured with macrophages. p27 deficiency also increased macrophage proliferation and islet injury. Therefore, p27 inactivation promotes injury islet graft loss via the elevation of proliferation and inflammatory cytokines secretion in infiltrating macrophages which induced nonspecific inflammation independent of TNF-α/nuclear factor-kappa b pathway. This potentially represents a promising therapeutic target in improving islet graft survival.

  3. Plant growth promoting rhizobacteria reduce aphid population and enhance the productivity of bread wheat.

    Science.gov (United States)

    Naeem, Muhammad; Aslam, Zubair; Khaliq, Abdul; Ahmed, Jam Nazir; Nawaz, Ahmad; Hussain, Mubshar

    2018-04-24

    Plant growth promoting rhizobacteria increase plant growth and give protection against insect pests and pathogens. Due to the negative impact of chemical pesticides on environment, alternatives to these chemicals are needed. In this scenario, the biological methods of pest control offer an eco-friendly and an attractive option. In this study, the effect of two plant growth promoting rhizobacterial strains (Bacillus sp. strain 6 and Pseudomonas sp. strain 6K) on aphid population and wheat productivity was evaluated in an aphid susceptible (Pasban-90) and resistant (Inqlab-91) wheat cultivar. The seeds were inoculated with each PGPR strain, separately or the combination of both. The lowest aphid population (2.1tiller -1 ), and highest plant height (85.8cm), number of spikelets per spike (18), grains per spike (44), productive tillers (320m -2 ), straw yield (8.6Mgha -1 ), and grain yield (4.8Mgha -1 ) were achieved when seeds were inoculated with Bacillus sp. strain 6+Pseudomonas sp. strain 6K. The grain yield of both varieties was enhanced by 35.5-38.9% with seed inoculation with both bacterial strains. Thus, the combine use of both PGPR strains viz. Bacillus sp. strain 6+Pseudomonas sp. strain 6K offers an attractive option to reduce aphid population tied with better wheat productivity. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  4. Evaluation of a health-promoting school program to enhance correct medication use in Taiwan

    Directory of Open Access Journals (Sweden)

    Hsueh-Yun Chi

    2014-06-01

    Full Text Available This study was an evaluation of the Health Promoting School (HPS program in Taiwan and its effectiveness in enhancing students' knowledge and abilities with regard to correct medication usage. In 2011, baseline and follow-up self-administered online surveys were received from 3520 middle-school and primary students from intervention schools, and 3738 students from comparison primary and secondary schools completed the same survey. The results indicated that after implementing the correct medication use HPS program, students' knowledge and abilities concerning correct medication usage (i.e., the need to express clearly personal conditions to physicians, to check information on the medication packages, to take medication correctly and adhere to prescribed medication regimens, not to buy or acquire medication from unlicensed sources, and to consult pharmacists/physicians were significantly increased among the students in the intervention schools (p < 0.001. In addition, students' knowledge and abilities concerning correct medication usage were significantly higher in the intervention schools compared with the comparison schools (p < 0.001. In conclusion, the correct medication use HPS program significantly enhanced students' knowledge and abilities concerning correct medication usage.

  5. Biomaterials that promote cell-cell interactions enhance the paracrine function of MSCs.

    Science.gov (United States)

    Qazi, Taimoor H; Mooney, David J; Duda, Georg N; Geissler, Sven

    2017-09-01

    Mesenchymal stromal cells (MSCs) secrete paracrine factors that play crucial roles during tissue regeneration. Whether this paracrine function is influenced by the properties of biomaterials in general, and those used for cell delivery in particular, largely remains unexplored. Here, we investigated if three-dimensional culture in distinct microenvironments - nanoporous hydrogels (mean pore size ∼5 nm) and macroporous scaffolds (mean pore size ∼120 μm) - affects the secretion pattern of MSCs, and consequently leads to differential paracrine effects on target progenitor cells such as myoblasts. We report that compared to MSCs encapsulated in hydrogels, scaffold seeded MSCs show an enhanced secretion profile and exert beneficial paracrine effects on various myoblast functions including migration and proliferation. Additionally, we show that the heightened paracrine effects of scaffold seeded cells can in part be attributed to N-cadherin mediated cell-cell interactions during culture. In hydrogels, this physical interaction between cells is prevented by the encapsulating matrix. Functionally blocking N-cadherin negatively affected the secretion profile and paracrine effects of MSCs on myoblasts, with stronger effects observed for scaffold seeded compared to hydrogel encapsulated cells. Together, these findings demonstrate that the therapeutic potency of MSCs can be enhanced by biomaterials that promote cell-cell interactions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty.

    Science.gov (United States)

    Toro, Carlos A; Wright, Hollis; Aylwin, Carlos F; Ojeda, Sergio R; Lomniczi, Alejandro

    2018-01-04

    Polycomb group (PcG) proteins control the timing of puberty by repressing the Kiss1 gene in hypothalamic arcuate nucleus (ARC) neurons. Here we identify two members of the Trithorax group (TrxG) of modifiers, mixed-lineage leukemia 1 (MLL1), and 3 (MLL3), as central components of an activating epigenetic machinery that dynamically counteracts PcG repression. Preceding puberty, MLL1 changes the chromatin configuration at the promoters of Kiss1 and Tac3, two genes required for puberty to occur, from repressive to permissive. Concomitantly, MLL3 institutes a chromatin structure that changes the functional status of a Kiss1 enhancer from poised to active. RNAi-mediated, ARC-specific Mll1 knockdown reduced Kiss1 and Tac3 expression, whereas CRISPR-Cas9-directed epigenome silencing of the Kiss1 enhancer selectively reduced Kiss1 activity. Both interventions delay puberty and disrupt reproductive cyclicity. Our results demonstrate that an epigenetic switch from transcriptional repression to activation is crucial to the regulatory mechanism controlling the timing of mammalian puberty.

  7. Hypoxia Enhances Immunosuppression by Inhibiting CD4+ Effector T Cell Function and Promoting Treg Activity

    Directory of Open Access Journals (Sweden)

    Astrid M. Westendorf

    2017-03-01

    Full Text Available Background/Aims: Hypoxia occurs in many pathological conditions, including inflammation and cancer. Within this context, hypoxia was shown to inhibit but also to promote T cell responses. Due to this controversial function, we aimed to explore whether an insufficient anti-tumour response during colitis-associated colon cancer could be ascribed to a hypoxic microenvironment. Methods: Colitis-associated colon cancer was induced in wildtype mice, and hypoxia as well as T cell immunity were analysed in the colonic tumour tissues. In addition, CD4+ effector T cells and regulatory T cells were cultured under normoxic and hypoxic conditions and examined regarding their phenotype and function. Results: We observed severe hypoxia in the colon of mice suffering from colitis-associated colon cancer that was accompanied by a reduced differentiation of CD4+ effector T cells and an enhanced number and suppressive activity of regulatory T cells. Complementary ex vivo and in vitro studies revealed that T cell stimulation under hypoxic conditions inhibited the differentiation, proliferation and IFN-γ production of TH1 cells and enhanced the suppressive capacity of regulatory T cells. Moreover, we identified an active role for HIF-1α in the modulation of CD4+ T cell functions under hypoxic conditions. Conclusion: Our data indicate that oxygen availability can function as a local modulator of CD4+ T cell responses and thus influences tumour immune surveillance in inflammation-associated colon cancer.

  8. Test-enhanced learning: the potential for testing to promote greater learning in undergraduate science courses.

    Science.gov (United States)

    Brame, Cynthia J; Biel, Rachel

    2015-01-01

    Testing within the science classroom is commonly used for both formative and summative assessment purposes to let the student and the instructor gauge progress toward learning goals. Research within cognitive science suggests, however, that testing can also be a learning event. We present summaries of studies that suggest that repeated retrieval can enhance long-term learning in a laboratory setting; various testing formats can promote learning; feedback enhances the benefits of testing; testing can potentiate further study; and benefits of testing are not limited to rote memory. Most of these studies were performed in a laboratory environment, so we also present summaries of experiments suggesting that the benefits of testing can extend to the classroom. Finally, we suggest opportunities that these observations raise for the classroom and for further research. © 2015 C. J. Brame and R. Biel. CBE—Life Sciences Education © 2015 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  9. Diuretic-enhanced gadolinium excretory MR urography: comparison of conventional gradient-echo sequences and echo-planar imaging

    Energy Technology Data Exchange (ETDEWEB)

    Nolte-Ernsting, C.C.A.; Tacke, J.; Adam, G.B.; Haage, P.; Guenther, R.W. [Univ. of Technology, Aachen (Germany). Dept. of Diagnostic Radiology; Jung, P.; Jakse, G. [Univ. of Technology, Aachen (Germany). Dept. of Urology

    2001-01-01

    The aim of this study was to investigate the utility of different gadolinium-enhanced T1-weighted gradient-echo techniques in excretory MR urography. In 74 urologic patients, excretory MR urography was performed using various T1-weighted gradient-echo (GRE) sequences after injection of gadolinium-DTPA and low-dose furosemide. The examinations included conventional GRE sequences and echo-planar imaging (GRE EPI), both obtained with 3D data sets and 2D projection images. Breath-hold acquisition was used primarily. In 20 of 74 examinations, we compared breath-hold imaging with respiratory gating. Breath-hold imaging was significantly superior to respiratory gating for the visualization of pelvicaliceal systems, but not for the ureters. Complete MR urograms were obtained within 14-20 s using 3D GRE EPI sequences and in 20-30 s with conventional 3D GRE sequences. Ghost artefacts caused by ureteral peristalsis often occurred with conventional 3D GRE imaging and were almost completely suppressed in EPI sequences (p < 0.0001). Susceptibility effects were more pronounced on GRE EPI MR urograms and calculi measured 0.8-21.7% greater in diameter compared with conventional GRE sequences. Increased spatial resolution degraded the image quality only in GRE-EPI urograms. (orig.)

  10. Draft Genome Sequence of the Plant Growth-Promoting Cupriavidus gilardii Strain JZ4 Isolated from the Desert Plant Tribulus terrestris

    KAUST Repository

    Lafi, Feras Fawzi

    2016-07-28

    We isolated the plant endophytic bacterium Cupriavidus gilardii strain JZ4 from the roots of the desert plant Tribulus terrestris, collected from the Jizan region, Saudi Arabia. We report here the draft genome sequence of JZ4, together with several enzymes related to plant growth-promoting activity, environmental adaption, and antifungal activity.

  11. Draft Genome Sequence of the Plant Growth–Promoting Rhizobacterium Acinetobacter radioresistens Strain SA188 Isolated from the Desert Plant Indigofera argentea

    KAUST Repository

    Lafi, Feras Fawzi

    2017-03-03

    Acinetobacter radioresistens strain SA188 is a plant endophytic bacterium, isolated from root nodules of the desert plants Indigofera spp., collected in Jizan, Saudi Arabia. Here, we report the 3.2-Mb draft genome sequence of strain SA188, highlighting characteristic pathways for plant growth–promoting activity and environmental adaptation.

  12. Draft Genome Sequence of the Plant Growth-Promoting Cupriavidus gilardii Strain JZ4 Isolated from the Desert Plant Tribulus terrestris

    KAUST Repository

    Lafi, Feras Fawzi; Bokhari, Ameerah; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2016-01-01

    We isolated the plant endophytic bacterium Cupriavidus gilardii strain JZ4 from the roots of the desert plant Tribulus terrestris, collected from the Jizan region, Saudi Arabia. We report here the draft genome sequence of JZ4, together with several enzymes related to plant growth-promoting activity, environmental adaption, and antifungal activity.

  13. Draft Genome Sequence of the Plant Growth–Promoting Rhizobacterium Acinetobacter radioresistens Strain SA188 Isolated from the Desert Plant Indigofera argentea

    KAUST Repository

    Lafi, Feras Fawzi; Alam, Intikhab; Bisseling, Ton; Geurts, Rene; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Acinetobacter radioresistens strain SA188 is a plant endophytic bacterium, isolated from root nodules of the desert plants Indigofera spp., collected in Jizan, Saudi Arabia. Here, we report the 3.2-Mb draft genome sequence of strain SA188, highlighting characteristic pathways for plant growth–promoting activity and environmental adaptation.

  14. Enhanced arbovirus surveillance with deep sequencing: Identification of novel rhabdoviruses and bunyaviruses in Australian mosquitoes.

    Science.gov (United States)

    Coffey, Lark L; Page, Brady L; Greninger, Alexander L; Herring, Belinda L; Russell, Richard C; Doggett, Stephen L; Haniotis, John; Wang, Chunlin; Deng, Xutao; Delwart, Eric L

    2014-01-05

    Viral metagenomics characterizes known and identifies unknown viruses based on sequence similarities to any previously sequenced viral genomes. A metagenomics approach was used to identify virus sequences in Australian mosquitoes causing cytopathic effects in inoculated mammalian cell cultures. Sequence comparisons revealed strains of Liao Ning virus (Reovirus, Seadornavirus), previously detected only in China, livestock-infecting Stretch Lagoon virus (Reovirus, Orbivirus), two novel dimarhabdoviruses, named Beaumont and North Creek viruses, and two novel orthobunyaviruses, named Murrumbidgee and Salt Ash viruses. The novel virus proteomes diverged by ≥ 50% relative to their closest previously genetically characterized viral relatives. Deep sequencing also generated genomes of Warrego and Wallal viruses, orbiviruses linked to kangaroo blindness, whose genomes had not been fully characterized. This study highlights viral metagenomics in concert with traditional arbovirus surveillance to characterize known and new arboviruses in field-collected mosquitoes. Follow-up epidemiological studies are required to determine whether the novel viruses infect humans. © 2013 Elsevier Inc. All rights reserved.

  15. SNBRFinder: A Sequence-Based Hybrid Algorithm for Enhanced Prediction of Nucleic Acid-Binding Residues.

    Directory of Open Access Journals (Sweden)

    Xiaoxia Yang

    Full Text Available Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.

  16. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  17. Assessment of Rice Associated Bacterial Ability to Enhance Rice Seed Germination and Rice Growth Promotion

    Directory of Open Access Journals (Sweden)

    R. Gholamalizadeh

    2017-08-01

    Full Text Available ABSTRACT The application of beneficial bacteria has recently been used for sustainable agriculture. In current research, 71 bacterial isolates were obtained from rice plant and the rhizosphere soil of different paddy fields in Guilan province, Iran. After primitive investigation, 40 bacteria with typical predominant characteristics were selected. By PCR-RFLP of their 16S r-DNA gene, 8 Operational Taxonomic Units (OTUs totally consisted of 33 isolates were obtained. From all of them, 8 isolates were selected for rice seed germination experiment, then, effective isolates were used for pot experiment to evaluate their ability for promoting rice growth. All of them were able to increase rice growth and yield, but in different potential. These tested isolates were identified as Alcaligenes faecalis (DEp8, O1R4, Pantoea ananatis (AEn1, Bacillus vietnamensis (MR5, Bacillus idriensis (MR2 and Stenotrophomonas maltophilia by partial sequencing of their 16S r-DNA gene. Among them, AEn1 and MR5 produced indole-3- acetic acid (IAA in larger amounts than the other isolates and the isolates AEn1 and O1R4 were able to solubilize phosphate in higher amounts. According to the results obtained, it can be concluded that AEn1, O1R4 and MR5 can be considered as bacterial inoculants to use as alternatives for chemical fertilizers.

  18. SPIO-enhanced MR imaging for HCC detection in cirrhotic patient : comparison of various techniques for optimal sequence selection

    International Nuclear Information System (INIS)

    Kim, In Hwan; Lee, Jeong Min; Kwak, Hyo Sung; Kim, Chong Soo; Yu, Hee Chul; Kim, Tae Kon; Lee Soo Tiek

    2000-01-01

    To compare the efficacy of breathhold and non-breathhold sequences in the detection of hepatocellular carcinoma (HCC) in cirrhotic patients using superparamagnetic iron oxide (SPIO)-enhanced MR imaging, and to determine the optimal sequence combination. By means of unenhanced and iron-oxide-enhanced MRI, 29 patients with 49 nodular HCCs were evaluated for the presence of HCC nodules. Twenty-one were male and eight were female, and their ages ranged from 38 to 71 (mean, 56) years. Eight different MR sequences were used, including four non-breath-hold sequences and four breath-hold, and images were obtained before and after the administration of SPIO particles. Non-breath-hold sequences included T2-, proton density-weighted SE, and TSE imaging, while breath-hold sequences comprised T1-weighted fast low-angle shot (T1w FLASH), half-Fourier acquisition single shot turbo spine echo (HASTE), T2-weighted fast imaging with steady-state free precession (T2 * wFISP) and T2-weighted breath-hold TSE (T2wBHTSE). Image analysis involved both quantitative and qualitative analysis. The quantitative parameters calculated were signal-to noise (S/N) ratios for livers and tumors, contrast to noise (C/N) ratios for tumors seen on precontrast and postcontrast images, and percentage of signal intensity loss (PSIL) after SPIO injection. Images were analysed qualitatively in terms of image artifacts and lesion conspicuity, and prior to calculating sensitivity, the number of lesions detected using various pulse sequences were counted. SPIO had a marked effect on liver S/N ratio but a minimal effect on tumor S/N ratio. PSIL was best in T2 * wFISP images, while T2wSE images showed the second-best results (p less than 0.05). Tumor-to-liver C/N values were also highest with T2 * wFISP, while T2wTSE and HASTE images were next. Qualitative study showed that non-breath hold images and FISP were better than breath hold images in terms of lesion conspicuity. The latter, however, were much better

  19. Enhancing the use of research in health-promoting, anti-racism policy.

    Science.gov (United States)

    Ferdinand, Angeline S; Paradies, Yin; Kelaher, Margaret

    2017-07-11

    The Localities Embracing and Accepting Diversity (LEAD) programme was established to improve the health of ethnic minority communities through the reduction of racial discrimination. Local governments in the state of Victoria, Australia, were at the forefront of LEAD implementation in collaboration with leading state and national organisations. Key aims included expanding the available evidence regarding effective anti-racism interventions and facilitating the uptake of this evidence in organisational policies and practices. One rural and one metropolitan local government areas were selected to participate in LEAD. Key informant interviews and discussions were conducted with individuals who had participated in LEAD implementation and members of LEAD governance structures. Data were also collected on programme processes and implementation, partnership formation and organisational assessments. The LEAD model demonstrated both strengths and weaknesses in terms of facilitating the use of evidence in a complex, community-based health promotion initiative. Representation of implementing, funding and advisory bodies at different levels of governance enabled the input of technical advice and guidance alongside design and implementation. The representation structure assisted in ensuring the development of a programme that was acceptable to all partners and informed by the best available evidence. Simultaneous evaluation also enhanced perceived validity of the intervention, allowed for strategy correction when necessary and supported the process of double-loop organisational learning. However, due to the model's demand for simultaneous and intensive effort by various organisations, when particular elements of the intervention were not functional, there was a considerable loss of time and resources across the partner organisations. The complexity of the model also presented a challenge in ensuring clarity regarding roles, functions and the direction of the programme. The

  20. Research based teaching sequence for enhancing electrical capacitance understanding at first fist year of university

    Directory of Open Access Journals (Sweden)

    Jenaro Guisasola

    2011-04-01

    Full Text Available In the electricity curriculum for introductory university physics courses and final secondary school courses, no provision is normally made for a teaching sequence which analyses the transition of specific charges to charged bodies, thus preventing the construction of a model able to explain the aspects connected with the process of charging a body, accumulating the charge and its relation to the potential acquired. This constituted a relevant historical problem and demanded the introduction of a new concept, that of electrical capacitance, to solve it. The aim of the work presented here is to design and assess a teaching sequence which endeavours to overcome the difficulties in learning found in the bibliography. The structure of the sequence was established in activities following a “problematised structure” design. The problems defining the sequence appeared when a step-by-step analysis of the transfer of charges from one body to another was made, by establishing connections between the movement of charges (microscopic level. The results of implementing the sequence indicate that a considerable number of students have achieved a more satisfactory understanding of the electrical capacitance of bodies and charging processes. This seems to confirm that the aspects highlighted in the sequence are relevant to the objectives specified.

  1. Daytime sleep enhances consolidation of the spatial but not motoric representation of motor sequence memory.

    Directory of Open Access Journals (Sweden)

    Geneviève Albouy

    Full Text Available Motor sequence learning is known to rely on more than a single process. As the skill develops with practice, two different representations of the sequence are formed: a goal representation built under spatial allocentric coordinates and a movement representation mediated through egocentric motor coordinates. This study aimed to explore the influence of daytime sleep (nap on consolidation of these two representations. Through the manipulation of an explicit finger sequence learning task and a transfer protocol, we show that both allocentric (spatial and egocentric (motor representations of the sequence can be isolated after initial training. Our results also demonstrate that nap favors the emergence of offline gains in performance for the allocentric, but not the egocentric representation, even after accounting for fatigue effects. Furthermore, sleep-dependent gains in performance observed for the allocentric representation are correlated with spindle density during non-rapid eye movement (NREM sleep of the post-training nap. In contrast, performance on the egocentric representation is only maintained, but not improved, regardless of the sleep/wake condition. These results suggest that motor sequence memory acquisition and consolidation involve distinct mechanisms that rely on sleep (and specifically, spindle or simple passage of time, depending respectively on whether the sequence is performed under allocentric or egocentric coordinates.

  2. Genome-Wide Mapping Targets of the Metazoan Chromatin Remodeling Factor NURF Reveals Nucleosome Remodeling at Enhancers, Core Promoters and Gene Insulators.

    Directory of Open Access Journals (Sweden)

    So Yeon Kwon

    2016-04-01

    Full Text Available NURF is a conserved higher eukaryotic ISWI-containing chromatin remodeling complex that catalyzes ATP-dependent nucleosome sliding. By sliding nucleosomes, NURF is able to alter chromatin dynamics to control transcription and genome organization. Previous biochemical and genetic analysis of the specificity-subunit of Drosophila NURF (Nurf301/Enhancer of Bithorax (E(bx has defined NURF as a critical regulator of homeotic, heat-shock and steroid-responsive gene transcription. It has been speculated that NURF controls pathway specific transcription by co-operating with sequence-specific transcription factors to remodel chromatin at dedicated enhancers. However, conclusive in vivo demonstration of this is lacking and precise regulatory elements targeted by NURF are poorly defined. To address this, we have generated a comprehensive map of in vivo NURF activity, using MNase-sequencing to determine at base pair resolution NURF target nucleosomes, and ChIP-sequencing to define sites of NURF recruitment. Our data show that, besides anticipated roles at enhancers, NURF interacts physically and functionally with the TRF2/DREF basal transcription factor to organize nucleosomes downstream of active promoters. Moreover, we detect NURF remodeling and recruitment at distal insulator sites, where NURF functionally interacts with and co-localizes with DREF and insulator proteins including CP190 to establish nucleosome-depleted domains. This insulator function of NURF is most apparent at subclasses of insulators that mark the boundaries of chromatin domains, where multiple insulator proteins co-associate. By visualizing the complete repertoire of in vivo NURF chromatin targets, our data provide new insights into how chromatin remodeling can control genome organization and regulatory interactions.

  3. Alternative Growth Promoters Modulate Broiler Gut Microbiome and Enhance Body Weight Gain

    Science.gov (United States)

    Salaheen, Serajus; Kim, Seon-Woo; Haley, Bradd J.; Van Kessel, Jo Ann S.; Biswas, Debabrata

    2017-01-01

    Antibiotic growth promoters (AGPs) are frequently used to enhance weight-gain in poultry production. However, there has been increasing concern over the impact of AGP on the emergence of antibiotic resistance in zoonotic bacterial pathogens in the microbial community of the poultry gut. In this study, we adopted mass-spectrophotometric, phylogenetic, and shotgun-metagenomic approaches to evaluate bioactive phenolic extracts (BPE) from blueberry (Vaccinium corymbosum) and blackberry (Rubus fruticosus) pomaces as AGP alternatives in broilers. We conducted two trials with 100 Cobb-500 broiler chicks (in each trial) in four equal groups that were provided water with no supplementation, supplemented with AGP (tylosin, neomycin sulfate, bacitracin, erythromycin, and oxytetracycline), or supplemented with 0.1 g Gallic acid equivalent (GAE)/L or 1.0 g GAE/L (during the last 72 h before euthanasia) of BPE for 6 weeks. When compared with the control group (water only), the chickens supplemented with AGP and 0.1 g GAE/L of BPE gained 9.5 and 5.8% more body weight, respectively. The microbiomes of both the AGP- and BPE-treated chickens had higher Firmicutes to Bacteroidetes ratios. AGP supplementation appeared to be associated with higher relative abundance of bacteriophages and unique cecal resistomes compared with BPE supplementation or control. Functional characterization of cecal microbiomes revealed significant animal-to-animal variation in the relative abundance of genes involved in energy and carbohydrate metabolism. These findings established a baseline upon which mechanisms of plant-based performance enhancers in regulation of animal growth can be investigated. In addition, the data will aid in designing alternate strategies to improve animal growth performance and consequently production. PMID:29123512

  4. Alternative Growth Promoters Modulate Broiler Gut Microbiome and Enhance Body Weight Gain

    Directory of Open Access Journals (Sweden)

    Serajus Salaheen

    2017-10-01

    Full Text Available Antibiotic growth promoters (AGPs are frequently used to enhance weight-gain in poultry production. However, there has been increasing concern over the impact of AGP on the emergence of antibiotic resistance in zoonotic bacterial pathogens in the microbial community of the poultry gut. In this study, we adopted mass-spectrophotometric, phylogenetic, and shotgun-metagenomic approaches to evaluate bioactive phenolic extracts (BPE from blueberry (Vaccinium corymbosum and blackberry (Rubus fruticosus pomaces as AGP alternatives in broilers. We conducted two trials with 100 Cobb-500 broiler chicks (in each trial in four equal groups that were provided water with no supplementation, supplemented with AGP (tylosin, neomycin sulfate, bacitracin, erythromycin, and oxytetracycline, or supplemented with 0.1 g Gallic acid equivalent (GAE/L or 1.0 g GAE/L (during the last 72 h before euthanasia of BPE for 6 weeks. When compared with the control group (water only, the chickens supplemented with AGP and 0.1 g GAE/L of BPE gained 9.5 and 5.8% more body weight, respectively. The microbiomes of both the AGP- and BPE-treated chickens had higher Firmicutes to Bacteroidetes ratios. AGP supplementation appeared to be associated with higher relative abundance of bacteriophages and unique cecal resistomes compared with BPE supplementation or control. Functional characterization of cecal microbiomes revealed significant animal-to-animal variation in the relative abundance of genes involved in energy and carbohydrate metabolism. These findings established a baseline upon which mechanisms of plant-based performance enhancers in regulation of animal growth can be investigated. In addition, the data will aid in designing alternate strategies to improve animal growth performance and consequently production.

  5. Dermatopontin interacts with fibronectin, promotes fibronectin fibril formation, and enhances cell adhesion.

    Science.gov (United States)

    Kato, Aiko; Okamoto, Osamu; Ishikawa, Kazushi; Sumiyoshi, Hideaki; Matsuo, Noritaka; Yoshioka, Hidekatsu; Nomizu, Motoyoshi; Shimada, Tatsuo; Fujiwara, Sakuhei

    2011-04-29

    We report that dermatopontin (DP), an abundant dermal extracellular matrix protein, is found in the fibrin clot and in the wound fluid, which comprise the provisional matrix at the initial stage of wound healing. DP was also found in the serum but at a lower concentration than that in wound fluid. DP co-localized with both fibrin and fibronectin on fibrin fibers and interacted with both proteins. Both normal fibroblast and HT1080 cell adhesion to the fibrin-fibronectin matrix were dose-dependently enhanced by DP, and the adhesion was mediated by α5β1 integrin. The cytoskeleton was more organized in the cells that adhered to the fibrin-fibronectin-DP complex. When incubated with DP, fibronectin formed an insoluble complex of fibronectin fibrils as visualized by electron microscopy. The interacting sites of fibronectin with DP were the first, thirteenth, and fourteenth type III repeats (III(1), III(13), and III(14)), with III(13) and III(14) assumed to be the major sites. The interaction between III(2-3) and III(12-14) was inhibited by DP, whereas the interaction between I(1-5) and III(12-14) was specifically and strongly enhanced by DP. Because the interaction between III(2-3) and III(12-14) is involved in forming a globular conformation of fibronectin, and that between I(1-5) and III(12-14) is required for forming fibronectin fibrils, DP promotes fibronectin fibril formation probably by changing the fibronectin conformation. These results suggest that DP has an accelerating role in fibroblast cell adhesion to the provisional matrix in the initial stage of wound healing.

  6. Substitution of wild-type yellow fever Asibi sequences for 17D vaccine sequences in ChimeriVax-dengue 4 does not enhance infection of Aedes aegypti mosquitoes.

    Science.gov (United States)

    McGee, Charles E; Tsetsarkin, Konstantin; Vanlandingham, Dana L; McElroy, Kate L; Lang, Jean; Guy, Bruno; Decelle, Thierry; Higgs, Stephen

    2008-03-01

    To address concerns that a flavivirus vaccine/wild-type recombinant virus might have a high mosquito infectivity phenotype, the yellow fever virus (YFV) 17D backbone of the ChimeriVax-dengue 4 virus was replaced with the corresponding gene sequences of the virulent YFV Asibi strain. Field-collected and laboratory-colonized Aedes aegypti mosquitoes were fed on blood containing each of the viruses under investigation and held for 14 days after infection. Infection and dissemination rates were based on antigen detection in titrated body or head triturates. Our data indicate that, even in the highly unlikely event of recombination or substantial backbone reversion, virulent sequences do not enhance the transmissibility of ChimeriVax viruses. In light of the low-level viremias that have been observed after vaccination in human volunteers coupled with low mosquito infectivity, it is predicted that the risk of mosquito infection and transmission of ChimeriVax vaccine recombinant/revertant viruses in nature is minimal.

  7. Self-enhancement of hepatitis C virus replication by promotion of specific sphingolipid biosynthesis.

    Directory of Open Access Journals (Sweden)

    Yuichi Hirata

    Full Text Available Lipids are key components in the viral life cycle that affect host-pathogen interactions. In this study, we investigated the effect of HCV infection on sphingolipid metabolism, especially on endogenous SM levels, and the relationship between HCV replication and endogenous SM molecular species. We demonstrated that HCV induces the expression of the genes (SGMS1 and 2 encoding human SM synthases 1 and 2. We observed associated increases of both total and individual sphingolipid molecular species, as assessed in human hepatocytes and in the detergent-resistant membrane (DRM fraction in which HCV replicates. SGMS1 expression had a correlation with HCV replication. Inhibition of sphingolipid biosynthesis with a hepatotropic serine palmitoyltransferase (SPT inhibitor, NA808, suppressed HCV-RNA production while also interfering with sphingolipid metabolism. Further, we identified the SM molecular species that comprise the DRM fraction and demonstrated that these endogenous SM species interacted with HCV nonstructural 5B polymerase to enhance viral replication. Our results reveal that HCV alters sphingolipid metabolism to promote viral replication, providing new insights into the formation of the HCV replication complex and the involvement of host lipids in the HCV life cycle.

  8. Self-enhancement of hepatitis C virus replication by promotion of specific sphingolipid biosynthesis.

    Science.gov (United States)

    Hirata, Yuichi; Ikeda, Kazutaka; Sudoh, Masayuki; Tokunaga, Yuko; Suzuki, Akemi; Weng, Leiyun; Ohta, Masatoshi; Tobita, Yoshimi; Okano, Ken; Ozeki, Kazuhisa; Kawasaki, Kenichi; Tsukuda, Takuo; Katsume, Asao; Aoki, Yuko; Umehara, Takuya; Sekiguchi, Satoshi; Toyoda, Tetsuya; Shimotohno, Kunitada; Soga, Tomoyoshi; Nishijima, Masahiro; Taguchi, Ryo; Kohara, Michinori

    2012-01-01

    Lipids are key components in the viral life cycle that affect host-pathogen interactions. In this study, we investigated the effect of HCV infection on sphingolipid metabolism, especially on endogenous SM levels, and the relationship between HCV replication and endogenous SM molecular species. We demonstrated that HCV induces the expression of the genes (SGMS1 and 2) encoding human SM synthases 1 and 2. We observed associated increases of both total and individual sphingolipid molecular species, as assessed in human hepatocytes and in the detergent-resistant membrane (DRM) fraction in which HCV replicates. SGMS1 expression had a correlation with HCV replication. Inhibition of sphingolipid biosynthesis with a hepatotropic serine palmitoyltransferase (SPT) inhibitor, NA808, suppressed HCV-RNA production while also interfering with sphingolipid metabolism. Further, we identified the SM molecular species that comprise the DRM fraction and demonstrated that these endogenous SM species interacted with HCV nonstructural 5B polymerase to enhance viral replication. Our results reveal that HCV alters sphingolipid metabolism to promote viral replication, providing new insights into the formation of the HCV replication complex and the involvement of host lipids in the HCV life cycle.

  9. Potential of wheat bran to promote indigenous microbial enhanced oil recovery.

    Science.gov (United States)

    Zhan, Yali; Wang, Qinghong; Chen, Chunmao; Kim, Jung Bong; Zhang, Hongdan; Yoza, Brandon A; Li, Qing X

    2017-06-01

    Microbial enhanced oil recovery (MEOR) is an emerging oil extraction technology that utilizes microorganisms to facilitate recovery of crude oil in depleted petroleum reservoirs. In the present study, effects of wheat bran utilization were investigated on stimulation of indigenous MEOR. Biostimulation conditions were optimized with the response surface methodology. The co-application of wheat bran with KNO 3 and NH 4 H 2 PO 4 significantly promoted indigenous MEOR (IMEOR) and exhibited sequential aerobic (O-), facultative (A n -) and anaerobic (A 0 -) metabolic stages. The surface tension of fermented broth decreased by approximately 35%, and the crude oil was highly emulsified. Microbial community structure varied largely among and in different IMEOR metabolic stages. Pseudomonas sp., Citrobacter sp., and uncultured Burkholderia sp. dominated the O-, A n - and early A 0 -stages. Bacillus sp., Achromobacter sp., Rhizobiales sp., Alcaligenes sp. and Clostridium sp. dominated the later A 0 -stage. This study illustrated occurrences of microbial community succession driven by wheat bran stimulation and its industrial potential.

  10. Deletion of the LTR enhancer/promoter has no impact on the integration profile of MLV vectors in human hematopoietic progenitors.

    Directory of Open Access Journals (Sweden)

    Arianna Moiani

    Full Text Available Moloney murine leukemia virus (MLV-derived gamma-retroviral vectors integrate preferentially near transcriptional regulatory regions in the human genome, and are associated with a significant risk of insertional gene deregulation. Self-inactivating (SIN vectors carry a deletion of the U3 enhancer and promoter in the long terminal repeat (LTR, and show reduced genotoxicity in pre-clinical assays. We report a high-definition analysis of the integration preferences of a SIN MLV vector compared to a wild-type-LTR MLV vector in the genome of CD34(+ human hematopoietic stem/progenitor cells (HSPCs. We sequenced 13,011 unique SIN-MLV integration sites and compared them to 32,574 previously generated MLV sites in human HSPCs. The SIN-MLV vector recapitulates the integration pattern observed for MLV, with the characteristic clustering of integrations around enhancer and promoter regions associated to H3K4me3 and H3K4me1 histone modifications, specialized chromatin configurations (presence of the H2A.Z histone variant and binding of RNA Pol II. SIN-MLV and MLV integration clusters and hot spots overlap in most cases and are generated at a comparable frequency, indicating that the reduced genotoxicity of SIN-MLV vectors in hematopoietic cells is not due to a modified integration profile.

  11. EPA Participates in Energy Roundtable with States, Tribes, Businesses and Environmental Groups to Enhance Coordination and Promote Responsible Domestic Production of Oil and Gas Resources

    Science.gov (United States)

    EPA News Release: EPA Participates in Energy Roundtable with States, Tribes, Businesses and Environmental Groups to Enhance Coordination and Promote Responsible Domestic Production of Oil and Gas Resources

  12. Enhancement of aerobic granulation by zero-valent iron in sequencing batch airlift reactor

    Energy Technology Data Exchange (ETDEWEB)

    Kong, Qiang, E-mail: kongqiang0531@hotmail.com [College of Life Science, Shandong Normal University, 88 Wenhua Donglu, Jinan 250014, Shandong (China); Ngo, Huu Hao [School of Civil and Environmental Engineering, University of Technology Sydney, Broadway, NSW 2007 (Australia); Shu, Li [School of Engineering, Faculty of Science, Engineering and Built Environment, Deakin University, Geelong, Victoria 3216 (Australia); Fu, Rong-shu; Jiang, Chun-hui [College of Life Science, Shandong Normal University, 88 Wenhua Donglu, Jinan 250014, Shandong (China); Miao, Ming-sheng, E-mail: mingshengmiao@163.com [College of Life Science, Shandong Normal University, 88 Wenhua Donglu, Jinan 250014, Shandong (China)

    2014-08-30

    Highlights: • Zero-valent iron (ZVI) was used firstly to enhance the aerobic granulation. • ZVI significantly decreased the start-up time of the aerobic granulation. • ZVI had the function of enhancing organic material diversity identified by 3-D EEM. • ZVI could enhance the diversity of microbial community. - Abstract: This study elucidates the enhancement of aerobic granulation by zero-valent iron (ZVI). A reactor augmented with ZVI had a start-up time of aerobic granulation (43 days) that was notably less than that for a reactor without augmentation (64 days). The former reactor also had better removal efficiencies for chemical oxygen demand and ammonium. Moreover, the mature granules augmented with ZVI had better physical characteristics and produced more extracellular polymeric substances (especially of protein). Three-dimensional-excitation emission matrix fluorescence showed that ZVI enhanced organic material diversity. Additionally, ZVI enhanced the diversity of the microbial community. Fe{sup 2+} dissolution from ZVI helped reduce the start-up time of aerobic granulation and increased the extracellular polymeric substance content. Conclusively, the use of ZVI effectively enhanced aerobic granulation.

  13. Enhancement of aerobic granulation by zero-valent iron in sequencing batch airlift reactor

    International Nuclear Information System (INIS)

    Kong, Qiang; Ngo, Huu Hao; Shu, Li; Fu, Rong-shu; Jiang, Chun-hui; Miao, Ming-sheng

    2014-01-01

    Highlights: • Zero-valent iron (ZVI) was used firstly to enhance the aerobic granulation. • ZVI significantly decreased the start-up time of the aerobic granulation. • ZVI had the function of enhancing organic material diversity identified by 3-D EEM. • ZVI could enhance the diversity of microbial community. - Abstract: This study elucidates the enhancement of aerobic granulation by zero-valent iron (ZVI). A reactor augmented with ZVI had a start-up time of aerobic granulation (43 days) that was notably less than that for a reactor without augmentation (64 days). The former reactor also had better removal efficiencies for chemical oxygen demand and ammonium. Moreover, the mature granules augmented with ZVI had better physical characteristics and produced more extracellular polymeric substances (especially of protein). Three-dimensional-excitation emission matrix fluorescence showed that ZVI enhanced organic material diversity. Additionally, ZVI enhanced the diversity of the microbial community. Fe 2+ dissolution from ZVI helped reduce the start-up time of aerobic granulation and increased the extracellular polymeric substance content. Conclusively, the use of ZVI effectively enhanced aerobic granulation

  14. Dynamic MRI of tumours in head and neck with a contrast-enhanced FLASH-2D sequence

    International Nuclear Information System (INIS)

    Maeurer, J.; Rausch, M.; Richter, W.S.; Boeck, J.C.; Steinkamp, H.J.; Vogl, T.J.; Felix, R.

    1995-01-01

    The purpose of this study was to evaluate the utility of a dynamic contrast enhanced FLASH-2D sequence for differential diagnosis of tumours in head and neck in 93 patients. Initially, the localization of the lesion and the selection of four representative slices for the dynamic study were obtained by a T2-weighted spin-echo sequence (TR 2000-3000 ms; TE 25/90 ms). After IV bolus injection of the contrast agent 10 images were acquired during a period of 3 min by a FLASH-2D sequence (TR 60 ms; TE 6 ms; flip angle 40 ; matrix 256 x 256; one acquisition). The percentage signal intensity (SI) increase (r) and the slope (S) of the curve were calculated on the basis of the SI time curve of the pathological lesion and of muscle. Inflammatory processes could be differentiated from malignant or benign tumours by means of a higher contrast enhancement. The time of the maximum SI was not specific for the different lesions. In comparison with muscle the maximum SI change was achieved earlier in a pathological process. (orig.)

  15. Power enhancing by reversing mode sequence in tuned mass-spring unit attached vibration energy harvester

    Directory of Open Access Journals (Sweden)

    Jae Eun Kim

    2013-07-01

    Full Text Available We propose a vibration energy harvester consisting of an auxiliary frequency-tuned mass unit and a piezoelectric vibration energy harvesting unit for enhancing output power. The proposed integrated system is so configured that its out-of-phase mode can appear at the lowest eigenfrequency unlike in the conventional system using a tuned unit. Such an arrangement makes the resulting system distinctive: enhanced output power at or near the target operating frequency and very little eigenfrequency separation, not observed in conventional eigenfrequency-tuned vibration energy harvesters. The power enhancement of the proposed system is theoretically examined with and without tip mass normalization or footprint area normalization.

  16. Characterization of the FoxL2 proximal promoter and coding sequence from the common snapping turtle (Chelydra serpentina).

    Science.gov (United States)

    Guo, Lei; Rhen, Turk

    2017-10-01

    Sex is determined by temperature during embryogenesis in snapping turtles, Chelydra serpentina. Previous studies in this species show that dihydrotestosterone (DHT) induces ovarian development at temperatures that normally produce males or mixed sex ratios. The feminizing effect of DHT is associated with increased expression of FoxL2, suggesting that androgens regulate transcription of FoxL2. To test this hypothesis, we cloned the proximal promoter (1.6kb) and coding sequence for snapping turtle FoxL2 (tFoxL2) in frame with mCherry to produce a fluorescent reporter. The tFoxL2-mCherry fusion plasmid or mCherry control plasmid were stably transfected into mouse KK1 granulosa cells. These cells were then treated with 0, 1, 10, or 100nM DHT to assess androgen effects on tFoxL2-mCherry expression. In contrast to the main hypothesis, DHT did not alter expression of the tFoxL2-mCherry reporter. However, normal serum increased expression of tFoxL2-mCherry when compared to charcoal-stripped serum, indicating that the cloned region of tFoxL2 contains cis regulatory elements. We also used the tFoxL2-mCherry plasmid as an expression vector to test the hypothesis that DHT and tFoxL2 interact to regulate expression of endogenous genes in granulosa cells. While tFoxL2-mCherry and DHT had independent effects on mouse FoxL2, FshR, GnRHR, and StAR expression, tFoxL2-mCherry potentiated low concentration DHT effects on mouse aromatase expression. Further studies will be required to determine whether synergistic regulation of aromatase by DHT and FoxL2 also occurs in turtle gonads during the sex-determining period, which would explain the feminizing effect of DHT in this species. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter

    International Nuclear Information System (INIS)

    Dávalos-Salas, Mercedes; Furlan-Magaril, Mayra; González-Buendía, Edgar; Valdes-Quezada, Christian; Ayala-Ortega, Erandi; Recillas-Targa, Félix

    2011-01-01

    Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb) gene promoter in different tumoral cell lines. To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing

  18. Automatic gallbladder segmentation using combined 2D and 3D shape features to perform volumetric analysis in native and secretin-enhanced MRCP sequences.

    Science.gov (United States)

    Gloger, Oliver; Bülow, Robin; Tönnies, Klaus; Völzke, Henry

    2017-11-24

    We aimed to develop the first fully automated 3D gallbladder segmentation approach to perform volumetric analysis in volume data of magnetic resonance (MR) cholangiopancreatography (MRCP) sequences. Volumetric gallbladder analysis is performed for non-contrast-enhanced and secretin-enhanced MRCP sequences. Native and secretin-enhanced MRCP volume data were produced with a 1.5-T MR system. Images of coronal maximum intensity projections (MIP) are used to automatically compute 2D characteristic shape features of the gallbladder in the MIP images. A gallbladder shape space is generated to derive 3D gallbladder shape features, which are then combined with 2D gallbladder shape features in a support vector machine approach to detect gallbladder regions in MRCP volume data. A region-based level set approach is used for fine segmentation. Volumetric analysis is performed for both sequences to calculate gallbladder volume differences between both sequences. The approach presented achieves segmentation results with mean Dice coefficients of 0.917 in non-contrast-enhanced sequences and 0.904 in secretin-enhanced sequences. This is the first approach developed to detect and segment gallbladders in MR-based volume data automatically in both sequences. It can be used to perform gallbladder volume determination in epidemiological studies and to detect abnormal gallbladder volumes or shapes. The positive volume differences between both sequences may indicate the quantity of the pancreatobiliary reflux.

  19. Mutations in Cas9 Enhance the Rate of Acquisition of Viral Spacer Sequences during the CRISPR-Cas Immune Response.

    Science.gov (United States)

    Heler, Robert; Wright, Addison V; Vucelja, Marija; Bikard, David; Doudna, Jennifer A; Marraffini, Luciano A

    2017-01-05

    CRISPR loci and their associated (Cas) proteins encode a prokaryotic immune system that protects against viruses and plasmids. Upon infection, a low fraction of cells acquire short DNA sequences from the invader. These sequences (spacers) are integrated in between the repeats of the CRISPR locus and immunize the host against the matching invader. Spacers specify the targets of the CRISPR immune response through transcription into short RNA guides that direct Cas nucleases to the invading DNA molecules. Here we performed random mutagenesis of the RNA-guided Cas9 nuclease to look for variants that provide enhanced immunity against viral infection. We identified a mutation, I473F, that increases the rate of spacer acquisition by more than two orders of magnitude. Our results highlight the role of Cas9 during CRISPR immunization and provide a useful tool to study this rare process and develop it as a biotechnological application. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. MiR-21/PTEN Axis Promotes Skin Wound Healing by Dendritic Cells Enhancement.

    Science.gov (United States)

    Han, Zhaofeng; Chen, Ya; Zhang, Yile; Wei, Aizhou; Zhou, Jian; Li, Qian; Guo, Lili

    2017-10-01

    A number of miRNAs associated with wound repair have been identified and characterized, but the mechanism has not been fully clarified. MiR-21 is one of wound-related lncRNAs, and the study aimed to explore the functional involvement of miR-21 and its concrete mechanism in wound healing. In this study, the rat model of skin wounds was established. The expression of miR-21, PTEN and related molecules of wound tissues or cells was determined by quantitative real-time PCR and Western blot, respectively. The regulatory role of miR-21 on PTEN was examined by luciferase reporter gene assay. Flow cytometry assay was applied to measure cell number changes. MiR-21 was upregulated at 6, 24, 48, 72 h after model establishment, and the increase reached a maximum at 24 h in wound tissues. MMP-9 expression presented the same tread as miR-21 and was significantly enhanced within 6 h of wound formation, and then remained to be increased to the maximum at 24 h. The increase of miR-21 was accompanied by the increase of cell total number and DCs ratio in wound fluids. MiR-21 overexpression significantly improved the healing of skin wounds and increased the ratio of DCs in rats. The results of using FL confirmed that miR-21 overexpression obviously promoted DCs differentiation. Additionally, miR-21 could activate AKT/PI3K signaling pathway via inhibition of PTEN. MiR-21 contributes to wound healing via inhibition of PTEN that activated AKT/PI3K signaling pathway to increase DCs. J. Cell. Biochem. 118: 3511-3519, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  1. AML1/ETO trans-activates c-KIT expression through the long range interaction between promoter and intronic enhancer.

    Science.gov (United States)

    Tian, Ying; Wang, Genjie; Hu, Qingzhu; Xiao, Xichun; Chen, Shuxia

    2018-04-01

    The AML1/ETO onco-fusion protein is crucial for the genesis of t(8;21) acute myeloid leukemia (AML) and is well documented as a transcriptional repressor through dominant-negative effect. However, little is known about the transactivation mechanism of AML1/ETO. Through large cohort of patient's expression level data analysis and a series of experimental validation, we report here that AML1/ETO transactivates c-KIT expression through directly binding to and mediating the long-range interaction between the promoter and intronic enhancer regions of c-KIT. Gene expression analyses verify that c-KIT expression is significantly high in t(8;21) AML. Further ChIP-seq analysis and motif scanning identify two regulatory regions located in the promoter and intronic enhancer region of c-KIT, respectively. Both regions are enriched by co-factors of AML1/ETO, such as AML1, CEBPe, c-Jun, and c-Fos. Further luciferase reporter assays show that AML1/ETO trans-activates c-KIT promoter activity through directly recognizing the AML1 motif and the co-existence of co-factors. The induction of c-KIT promoter activity is reinforced with the existence of intronic enhancer region. Furthermore, ChIP-3C-qPCR assays verify that AML1/ETO mediates the formation of DNA-looping between the c-KIT promoter and intronic enhancer region through the long-range interaction. Collectively, our data uncover a novel transcriptional activity mechanism of AML1/ETO and enrich our knowledge of the onco-fusion protein mediated transcription regulation. © 2017 Wiley Periodicals, Inc.

  2. Correlation between high resolution sequence stratigraphy and mechanical stratigraphy for enhanced fracture characteristic prediction

    Science.gov (United States)

    Al Kharusi, Laiyyan M.

    Sequence stratigraphy relates changes in vertical and lateral facies distribution to relative changes in sea level. These relative changes in carbonates effect early diagenesis, types of pores, cementation and dissolution patterns. As a result, in carbonates, relative changes in sea level significantly impact the lithology, porosity, diagenesis, bed and bounding surfaces which are all factors that control fracture patterns. This study explores these relationships by integrating stratigraphy with fracture analysis and petrophysical properties. A special focus is given to the relationship between mechanical boundaries and sequence stratigraphic boundaries in three different settings: (1) Mississippian strata in Sheep Mountain Anticline, Wyoming, (2) Mississippian limestones in St. Louis, Missouri, and (3) Pennsylvanian limestones intermixed with elastics in the Paradox Basin, Utah. The analysis of these sections demonstrate that a fracture hierarchy exists in relation to the sequence stratigraphic hierarchy. The majority of fractures (80%) terminate at genetic unit boundaries or the internal flooding surface that separates the transgressive from regressive hemicycle. Fractures (20%) that do not terminate at genetic unit boundaries or their internal flooding surface terminate at lower order sequence stratigraphic boundaries or their internal flooding surfaces. Secondly, the fracture spacing relates well to bed thickness in mechanical units no greater than 0.5m in thickness but with increasing bed thickness a scatter from the linear trend is observed. In the Paradox Basin the influence of strain on fracture density is illustrated by two sections measured in different strain regimes. The folded strata at Raplee Anticline has higher fracture densities than the flat-lying beds at the Honaker Trail. Cemented low porosity rocks in the Paradox Basin do not show a correlation between fracture pattern and porosity. However velocity and rock stiffness moduli's display a slight

  3. Triple helix-forming oligonucleotide corresponding to the polypyrimidine sequence in the rat alpha 1(I) collagen promoter specifically inhibits factor binding and transcription.

    Science.gov (United States)

    Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V

    1996-01-19

    Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.

  4. Enhancing Next-Generation Sequencing-Guided Cancer Care Through Cognitive Computing.

    Science.gov (United States)

    Patel, Nirali M; Michelini, Vanessa V; Snell, Jeff M; Balu, Saianand; Hoyle, Alan P; Parker, Joel S; Hayward, Michele C; Eberhard, David A; Salazar, Ashley H; McNeillie, Patrick; Xu, Jia; Huettner, Claudia S; Koyama, Takahiko; Utro, Filippo; Rhrissorrakrai, Kahn; Norel, Raquel; Bilal, Erhan; Royyuru, Ajay; Parida, Laxmi; Earp, H Shelton; Grilley-Olson, Juneko E; Hayes, D Neil; Harvey, Stephen J; Sharpless, Norman E; Kim, William Y

    2018-02-01

    Using next-generation sequencing (NGS) to guide cancer therapy has created challenges in analyzing and reporting large volumes of genomic data to patients and caregivers. Specifically, providing current, accurate information on newly approved therapies and open clinical trials requires considerable manual curation performed mainly by human "molecular tumor boards" (MTBs). The purpose of this study was to determine the utility of cognitive computing as performed by Watson for Genomics (WfG) compared with a human MTB. One thousand eighteen patient cases that previously underwent targeted exon sequencing at the University of North Carolina (UNC) and subsequent analysis by the UNCseq informatics pipeline and the UNC MTB between November 7, 2011, and May 12, 2015, were analyzed with WfG, a cognitive computing technology for genomic analysis. Using a WfG-curated actionable gene list, we identified additional genomic events of potential significance (not discovered by traditional MTB curation) in 323 (32%) patients. The majority of these additional genomic events were considered actionable based upon their ability to qualify patients for biomarker-selected clinical trials. Indeed, the opening of a relevant clinical trial within 1 month prior to WfG analysis provided the rationale for identification of a new actionable event in nearly a quarter of the 323 patients. This automated analysis took potentially improve patient care by providing a rapid, comprehensive approach for data analysis and consideration of up-to-date availability of clinical trials. The results of this study demonstrate that the interpretation and actionability of somatic next-generation sequencing results are evolving too rapidly to rely solely on human curation. Molecular tumor boards empowered by cognitive computing can significantly improve patient care by providing a fast, cost-effective, and comprehensive approach for data analysis in the delivery of precision medicine. Patients and physicians who

  5. Comprehensive benchmarking reveals H2BK20 acetylation as a distinctive signature of cell-state-specific enhancers and promoters.

    Science.gov (United States)

    Kumar, Vibhor; Rayan, Nirmala Arul; Muratani, Masafumi; Lim, Stefan; Elanggovan, Bavani; Xin, Lixia; Lu, Tess; Makhija, Harshyaa; Poschmann, Jeremie; Lufkin, Thomas; Ng, Huck Hui; Prabhakar, Shyam

    2016-05-01

    Although over 35 different histone acetylation marks have been described, the overwhelming majority of regulatory genomics studies focus exclusively on H3K27ac and H3K9ac. In order to identify novel epigenomic traits of regulatory elements, we constructed a benchmark set of validated enhancers by performing 140 enhancer assays in human T cells. We tested 40 chromatin signatures on this unbiased enhancer set and identified H2BK20ac, a little-studied histone modification, as the most predictive mark of active enhancers. Notably, we detected a novel class of functionally distinct enhancers enriched in H2BK20ac but lacking H3K27ac, which was present in all examined cell lines and also in embryonic forebrain tissue. H2BK20ac was also unique in highlighting cell-type-specific promoters. In contrast, other acetylation marks were present in all active promoters, regardless of cell-type specificity. In stimulated microglial cells, H2BK20ac was more correlated with cell-state-specific expression changes than H3K27ac, with TGF-beta signaling decoupling the two acetylation marks at a subset of regulatory elements. In summary, our study reveals a previously unknown connection between histone acetylation and cell-type-specific gene regulation and indicates that H2BK20ac profiling can be used to uncover new dimensions of gene regulation. © 2016 Kumar et al.; Published by Cold Spring Harbor Laboratory Press.

  6. Strong transcription blockage mediated by R-loop formation within a G-rich homopurine-homopyrimidine sequence localized in the vicinity of the promoter.

    Science.gov (United States)

    Belotserkovskii, Boris P; Soo Shin, Jane Hae; Hanawalt, Philip C

    2017-06-20

    Guanine-rich (G-rich) homopurine-homopyrimidine nucleotide sequences can block transcription with an efficiency that depends upon their orientation, composition and length, as well as the presence of negative supercoiling or breaks in the non-template DNA strand. We report that a G-rich sequence in the non-template strand reduces the yield of T7 RNA polymerase transcription by more than an order of magnitude when positioned close (9 bp) to the promoter, in comparison to that for a distal (∼250 bp) location of the same sequence. This transcription blockage is much less pronounced for a C-rich sequence, and is not significant for an A-rich sequence. Remarkably, the blockage is not pronounced if transcription is performed in the presence of RNase H, which specifically digests the RNA strands within RNA-DNA hybrids. The blockage also becomes less pronounced upon reduced RNA polymerase concentration. Based upon these observations and those from control experiments, we conclude that the blockage is primarily due to the formation of stable RNA-DNA hybrids (R-loops), which inhibit successive rounds of transcription. Our results could be relevant to transcription dynamics in vivo (e.g. transcription 'bursting') and may also have practical implications for the design of expression vectors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Secretion of mature mouse interleukin-2 by Saccharomyces cerevisiae: use of a general secretion vector containing promoter and leader sequences of the mating pheromone alpha-factor.

    Science.gov (United States)

    Miyajima, A; Bond, M W; Otsu, K; Arai, K; Arai, N

    1985-01-01

    We have constructed a general expression vector which allows the synthesis and secretion of processed gene products in Saccharomyces cerevisiae. This vector contains yeast DNA, including the promoter of the mating pheromone (alpha-factor), its downstream leader sequence, and the TRP5 terminator. A cDNA [encoding mature mouse interleukin-2 (IL-2); Yokota et al., Proc. Natl. Acad. Sci. USA 82 (1984) 68-72] was fused immediately downstream to the alpha-factor leader sequence. The resulting recombinant plasmid directed the synthesis of mature mouse IL-2 in S. cerevisiae, with most of the T-cell growth-factor (TCGF) activity secreted into the culture fluid and extracellular space. TCGF activities in the cell extract, as well as in the culture fluid, increased in parallel with cell growth. Production of mature mouse IL-2 was inhibited by tunicamycin (TM), with precursor molecules accumulating in the cell extract. The precursor was processed accurately at the junction between the alpha-factor peptide leader sequence and the coding sequence downstream, yielding mature IL-2. The Mr of the secreted mouse IL-2 determined by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) was 17 kDal, a value expected for the mature mouse IL-2 polypeptide based on the nucleotide (nt) sequence.

  8. Genome-scale regression analysis reveals a linear relationship for promoters and enhancers after combinatorial drug treatment

    KAUST Repository

    Rapakoulia, Trisevgeni

    2017-08-09

    Motivation: Drug combination therapy for treatment of cancers and other multifactorial diseases has the potential of increasing the therapeutic effect, while reducing the likelihood of drug resistance. In order to reduce time and cost spent in comprehensive screens, methods are needed which can model additive effects of possible drug combinations. Results: We here show that the transcriptional response to combinatorial drug treatment at promoters, as measured by single molecule CAGE technology, is accurately described by a linear combination of the responses of the individual drugs at a genome wide scale. We also find that the same linear relationship holds for transcription at enhancer elements. We conclude that the described approach is promising for eliciting the transcriptional response to multidrug treatment at promoters and enhancers in an unbiased genome wide way, which may minimize the need for exhaustive combinatorial screens.

  9. The application of powerful promoters to enhance gene expression in industrial microorganisms.

    Science.gov (United States)

    Zhou, Shenghu; Du, Guocheng; Kang, Zhen; Li, Jianghua; Chen, Jian; Li, Huazhong; Zhou, Jingwen

    2017-02-01

    Production of useful chemicals by industrial microorganisms has been attracting more and more attention. Microorganisms screened from their natural environment usually suffer from low productivity, low stress resistance, and accumulation of by-products. In order to overcome these disadvantages, rational engineering of microorganisms to achieve specific industrial goals has become routine. Rapid development of metabolic engineering and synthetic biology strategies provide novel methods to improve the performance of industrial microorganisms. Rational regulation of gene expression by specific promoters is essential to engineer industrial microorganisms for high-efficiency production of target chemicals. Identification, modification, and application of suitable promoters could provide powerful switches at the transcriptional level for fine-tuning of a single gene or a group of genes, which are essential for the reconstruction of pathways. In this review, the characteristics of promoters from eukaryotic, prokaryotic, and archaea microorganisms are briefly introduced. Identification of promoters based on both traditional biochemical and systems biology routes are summarized. Besides rational modification, de novo design of promoters to achieve gradient, dynamic, and logic gate regulation are also introduced. Furthermore, flexible application of static and dynamic promoters for the rational engineering of industrial microorganisms is highlighted. From the perspective of powerful promoters in industrial microorganisms, this review will provide an extensive description of how to regulate gene expression in industrial microorganisms to achieve more useful goals.

  10. Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

    International Nuclear Information System (INIS)

    Depto, A.S.; Stenberg, R.M.

    1989-01-01

    To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene

  11. Receptor protein tyrosine phosphatase alpha enhances rheumatoid synovial fibroblast signaling and promotes arthritis in mice

    NARCIS (Netherlands)

    Stanford, Stephanie M; Svensson, Mattias N D; Sacchetti, Cristiano; Pilo, Caila A; Wu, Dennis J; Kiosses, William B; Hellvard, Annelie; Bergum, Brith; Aleman Muench, German R; Elly, Christian; Liu, Yun-Cai; den Hertog, Jeroen; Elson, Ari; Sap, Jan; Mydel, Piotr; Boyle, David L; Corr, Maripat; Firestein, Gary S; Bottini, Nunzio

    2016-01-01

    OBJECTIVE: During rheumatoid arthritis (RA), fibroblast-like synoviocytes (FLS) critically promote disease pathogenesis by aggressively invading the joint extracellular matrix. The focal adhesion kinase (FAK) signaling pathway is emerging as a contributor to RA FLS anomalous behavior. The receptor

  12. ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

    Science.gov (United States)

    Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

    2008-07-01

    Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

  13. Sequencing and promoter analysis of the nifENXorf3orf5fdxAnifQ operon from Azospirillum brasilense Sp7

    Directory of Open Access Journals (Sweden)

    Potrich D.P.

    2001-01-01

    Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.

  14. Regulation of HFE expression by poly(ADP-ribose) polymerase-1 (PARP1) through an inverted repeat DNA sequence in the distal promoter.

    Science.gov (United States)

    Pelham, Christopher; Jimenez, Tamara; Rodova, Marianna; Rudolph, Angela; Chipps, Elizabeth; Islam, M Rafiq

    2013-12-01

    Hereditary hemochromatosis (HH) is a common autosomal recessive disorder of iron overload among Caucasians of northern European descent. Over 85% of all cases with HH are due to mutations in the hemochromatosis protein (HFE) involved in iron metabolism. Although the importance in iron homeostasis is well recognized, the mechanism of sensing and regulating iron absorption by HFE, especially in the absence of iron response element in its gene, is not fully understood. In this report, we have identified an inverted repeat sequence (ATGGTcttACCTA) within 1700bp (-1675/+35) of the HFE promoter capable to form cruciform structure that binds PARP1 and strongly represses HFE promoter. Knockdown of PARP1 increases HFE mRNA and protein. Similarly, hemin or FeCl3 treatments resulted in increase in HFE expression by reducing nuclear PARP1 pool via its apoptosis induced cleavage, leading to upregulation of the iron regulatory hormone hepcidin mRNA. Thus, PARP1 binding to the inverted repeat sequence on the HFE promoter may serve as a novel iron sensing mechanism as increased iron level can trigger PARP1 cleavage and relief of HFE transcriptional repression. © 2013.

  15. TiO2 promoted by two different non-noble metal cocatalysts for enhanced photocatalytic H2 evolution

    International Nuclear Information System (INIS)

    Lin, Jing-Dong; Yan, Shi; Huang, Qin-Dong; Fan, Mei-Ting; Yuan, You-Zhu; Tan, Timothy Thatt-Yang; Liao, Dai-Wei

    2014-01-01

    TiO 2 photocatalysts modified by cobalt and nickel cocatalysts were prepared via polymerized complex method (PCM) and evaluated by photocatalytic hydrogen evolution. Hydrogen generation in 6 h for the TiO 2 promoted by cobalt and nickel (0.1%Co + 0.2%Ni/TiO 2 ) is about two times (2456 μmol H 2 ) compared to that of TiO 2 promoted only by cobalt (1180 μmol H 2 for 0.1%Co/TiO 2 ) or nickel (1127 μmol H 2 for 0.2%Ni/TiO 2 ), and mechanically mixed TiO 2 promoted by cobalt and TiO 2 promoted by nickel (0.1%Co/TiO 2 :0.2%Ni/TiO 2 = 1:1 (m/m), 1282 μmol H 2 ). The high photocatalytic H 2 evolution activity over TiO 2 promoted by cobalt and nickel is ascribed to enhanced photo response due to the presence of cobalt and nickel impurity level, and effective separation of photogenerated electrons and holes due to the synergistic effect of cobalt and nickel, which serve as active sites for H 2 evolution reaction (HER) and oxidation reaction (OR) respectively. This study demonstrates a viable strategy to design more active photocatalysts for photocatalytic H 2 evolution by substituting noble metals with more abundant elements using as HER and OR cocatalysts, respectively.

  16. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  17. Draft Genome Sequence of Plant Growth–Promoting Micrococcus luteus Strain K39 Isolated from Cyperus conglomeratus in Saudi Arabia

    KAUST Repository

    Lafi, Feras Fawzi

    2017-01-27

    Micrococcus luteus strain K39 is an endophyte bacterium isolated from roots of the desert plant Cyperus conglomeratus collected from the Red Sea shore, Thuwal, Saudi Arabia. The draft genome sequence of strain K39 revealed a number of enzymes involved in salinity and oxidative stress tolerance or having herbicide-resistance activity.

  18. Draft Genome Sequence of Plant Growth–Promoting Micrococcus luteus Strain K39 Isolated from Cyperus conglomeratus in Saudi Arabia

    KAUST Repository

    Lafi, Feras Fawzi; Ramirez Prado, Juan Sebastian; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Micrococcus luteus strain K39 is an endophyte bacterium isolated from roots of the desert plant Cyperus conglomeratus collected from the Red Sea shore, Thuwal, Saudi Arabia. The draft genome sequence of strain K39 revealed a number of enzymes involved in salinity and oxidative stress tolerance or having herbicide-resistance activity.

  19. The Enhancement Seminar Model as a Strategy to Promote Diversity and Student Success in MSW Programs

    Science.gov (United States)

    Watson, Larry D.; Rycraft, Joan R.

    2010-01-01

    This study evaluates the effectiveness of an enhancement program by examining a cohort of 57 students admitted on probationary status to an MSW program in 2002 and required to participate in the enhancement program. The demographics for students admitted on probation demonstrate that the program is effective in increasing the diversity of the…

  20. Violation of an evolutionarily conserved immunoglobulin diversity gene sequence preference promotes production of dsDNA-specific IgG antibodies.

    Directory of Open Access Journals (Sweden)

    Aaron Silva-Sanchez

    Full Text Available Variability in the developing antibody repertoire is focused on the third complementarity determining region of the H chain (CDR-H3, which lies at the center of the antigen binding site where it often plays a decisive role in antigen binding. The power of VDJ recombination and N nucleotide addition has led to the common conception that the sequence of CDR-H3 is unrestricted in its variability and random in its composition. Under this view, the immune response is solely controlled by somatic positive and negative clonal selection mechanisms that act on individual B cells to promote production of protective antibodies and prevent the production of self-reactive antibodies. This concept of a repertoire of random antigen binding sites is inconsistent with the observation that diversity (DH gene segment sequence content by reading frame (RF is evolutionarily conserved, creating biases in the prevalence and distribution of individual amino acids in CDR-H3. For example, arginine, which is often found in the CDR-H3 of dsDNA binding autoantibodies, is under-represented in the commonly used DH RFs rearranged by deletion, but is a frequent component of rarely used inverted RF1 (iRF1, which is rearranged by inversion. To determine the effect of altering this germline bias in DH gene segment sequence on autoantibody production, we generated mice that by genetic manipulation are forced to utilize an iRF1 sequence encoding two arginines. Over a one year period we collected serial serum samples from these unimmunized, specific pathogen-free mice and found that more than one-fifth of them contained elevated levels of dsDNA-binding IgG, but not IgM; whereas mice with a wild type DH sequence did not. Thus, germline bias against the use of arginine enriched DH sequence helps to reduce the likelihood of producing self-reactive antibodies.

  1. Endothelial cell SHP-2 negatively regulates neutrophil adhesion and promotes transmigration by enhancing ICAM-1-VE-cadherin interaction.

    Science.gov (United States)

    Yan, Meiping; Zhang, Xinhua; Chen, Ao; Gu, Wei; Liu, Jie; Ren, Xiaojiao; Zhang, Jianping; Wu, Xiaoxiong; Place, Aaron T; Minshall, Richard D; Liu, Guoquan

    2017-11-01

    Intercellular adhesion molecule-1 (ICAM-1) mediates the firm adhesion of leukocytes to endothelial cells and initiates subsequent signaling that promotes their transendothelial migration (TEM). Vascular endothelial (VE)-cadherin plays a critical role in endothelial cell-cell adhesion, thereby controlling endothelial permeability and leukocyte transmigration. This study aimed to determine the molecular signaling events that originate from the ICAM-1-mediated firm adhesion of neutrophils that regulate VE-cadherin's role as a negative regulator of leukocyte transmigration. We observed that ICAM-1 interacts with Src homology domain 2-containing phosphatase-2 (SHP-2), and SHP-2 down-regulation via silencing of small interfering RNA in endothelial cells enhanced neutrophil adhesion to endothelial cells but inhibited neutrophil transmigration. We also found that VE-cadherin associated with the ICAM-1-SHP-2 complex. Moreover, whereas the activation of ICAM-1 leads to VE-cadherin dissociation from ICAM-1 and VE-cadherin association with actin, SHP-2 down-regulation prevented ICAM-1-VE-cadherin association and promoted VE-cadherin-actin association. Furthermore, SHP-2 down-regulation in vivo promoted LPS-induced neutrophil recruitment in mouse lung but delayed neutrophil extravasation. These results suggest that SHP-2- via association with ICAM-1-mediates ICAM-1-induced Src activation and modulates VE-cadherin switching association with ICAM-1 or actin, thereby negatively regulating neutrophil adhesion to endothelial cells and enhancing their TEM.-Yan, M., Zhang, X., Chen, A., Gu, W., Liu, J., Ren, X., Zhang, J., Wu, X., Place, A. T., Minshall, R. D., Liu, G. Endothelial cell SHP-2 negatively regulates neutrophil adhesion and promotes transmigration by enhancing ICAM-1-VE-cadherin interaction. © FASEB.

  2. Superselective Particle Embolization Enhances Efficacy of Radiofrequency Ablation: Effects of Particle Size and Sequence of Action

    International Nuclear Information System (INIS)

    Tanaka, Toshihiro; Isfort, Peter; Braunschweig, Till; Westphal, Saskia; Woitok, Anna; Penzkofer, Tobias; Bruners, Philipp; Kichikawa, Kimihiko; Schmitz-Rode, Thomas; Mahnken, Andreas H.

    2013-01-01

    Purpose. To evaluate the effects of particle size and course of action of superselective bland transcatheter arterial embolization (TAE) on the efficacy of radiofrequency ablation (RFA). Methods. Twenty pigs were divided into five groups: group 1a, 40-μm bland TAE before RFA; group 1b, 40-μm bland TAE after RFA; group 2a, 250-μm bland TAE before RFA; group 2b, 250-μm bland TAE after RFA and group 3, RFA alone. A total of 40 treatments were performed with a combined CT and angiography system. The sizes of the treated zones were measured from contrast-enhanced CTs on days 1 and 28. Animals were humanely killed, and the treated zones were examined pathologically. Results. There were no complications during procedures and follow-up. The short-axis diameter of the ablation zone in group 1a (mean ± standard deviation, 3.19 ± 0.39 cm) was significantly larger than in group 1b (2.44 ± 0.52 cm; P = 0.021), group 2a (2.51 ± 0.32 cm; P = 0.048), group 2b (2.19 ± 0.44 cm; P = 0.02), and group 3 (1.91 ± 0.55 cm; P 3 ). At histology, 40-μm microspheres were observed to occlude smaller and more distal arteries than 250-μm microspheres. Conclusion. Bland TAE is more effective before RFA than postablation embolization. The use of very small 40-μm microspheres enhances the efficacy of RFA more than the use of larger particles.

  3. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Science.gov (United States)

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  4. Enhanced incorporation of radioactive inorganic phosphate into phospholipids of HeLa cells by tumor promoters

    International Nuclear Information System (INIS)

    Nishino, H.; Fujiki, H.; Terada, M.; Sato, S.

    1983-01-01

    Teleocidin, a new tumor promoter, increased incorporation of radioactive inorganic phosphate ( 32 P/sub i/) into phospholipids in HeLa cells. This effect was detected within 1 h on incubation of the cells in medium containing teleocidin. The half-maximum effective dose of teleocidin was approximately 10 ng/ml. The main effect of teleocidin was on the incorporation of 32 P/sub i/ into the phosphatidylcholine fraction, with a lesser effect on 32 P/sub i/ incorporation into other phospholipid fractions. Increased incorporation of 32 P/sub i/ into phospholipids was also observed on incubation of the cells with 12-O-tetradecanoylphorbol-13-acetate (TPA), dihydroteleocidin B, or lyngbyatoxin A, which are all complete tumor promoters, and also with mezerein, which is an incomplete and second stage promoter. On the other hand, at concentrations of up to 1 microgram/ml, 4-O-methyl TPA and C/sub a/ 2 + ionophore A23187, which are incomplete and first stage promoters, and phorbol, which has no promoting activity in skin carcinogenesis, did not cause any increased incorporation of 32 P/sub i/ into phospholipid fractions of HeLa cells

  5. Investigations of Escherichia coli promoter sequences with artificial neural networks: new signals discovered upstream of the transcriptional startpoint

    DEFF Research Database (Denmark)

    Pedersen, Anders Gorm; Engelbrecht, Jacob

    1995-01-01

    We present a novel method for using the learning ability of a neural network as a measure of information in local regions of input data. Using the method to analyze Escherichia coli promoters, we discover all previously described signals, and furthermore find new signals that are regularly spaced...

  6. A novel type of DNA-binding protein interacts with a conserved sequence in an early nodulin ENOD12 promoter.

    NARCIS (Netherlands)

    Christiansen, H.; Hansen, A.C.; Vijn, I.; Pallisgaard, N.; Larsen, K.; Yang, W.C.; Bisseling, T.; Marcker, K.A.; Jensen, E.O.

    1996-01-01

    The pea genes PsENOD12A and PsENOD12B are expressed in the root hairs shortly after infection with the nitrogen-fixing bacterium Rhizobium leguminosarum bv. viciae or after application of purified Nod factors. A 199 bp promoter fragment of the PsENOD12B gene contains sufficient information for Nod

  7. Multiple regulatory mechanisms of hepatocyte growth factor expression in malignant cells with a short poly(dA) sequence in the HGF gene promoter.

    Science.gov (United States)

    Sakai, Kazuko; Takeda, Masayuki; Okamoto, Isamu; Nakagawa, Kazuhiko; Nishio, Kazuto

    2015-01-01

    Hepatocyte growth factor (HGF) expression is a poor prognostic factor in various types of cancer. Expression levels of HGF have been reported to be regulated by shorter poly(dA) sequences in the promoter region. In the present study, the poly(dA) mononucleotide tract in various types of human cancer cell lines was examined and compared with the HGF expression levels in those cells. Short deoxyadenosine repeat sequences were detected in five of the 55 cell lines used in the present study. The H69, IM95, CCK-81, Sui73 and H28 cells exhibited a truncated poly(dA) sequence in which the number of poly(dA) repeats was reduced by ≥5 bp. Two of the cell lines exhibited high HGF expression, determined by reverse transcription quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. The CCK-81, Sui73 and H28 cells with shorter poly(dA) sequences exhibited low HGF expression. The cause of the suppression of HGF expression in the CCK-81, Sui73 and H28 cells was clarified by two approaches, suppression by methylation and single nucleotide polymorphisms in the HGF gene. Exposure to 5-Aza-dC, an inhibitor of DNA methyltransferase 1, induced an increased expression of HGF in the CCK-81 cells, but not in the other cells. Single-nucleotide polymorphism (SNP) rs72525097 in intron 1 was detected in the Sui73 and H28 cells. Taken together, it was found that the defect of poly(dA) in the HGF promoter was present in various types of cancer, including lung, stomach, colorectal, pancreas and mesothelioma. The present study proposes the negative regulation mechanisms by methylation and SNP in intron 1 of HGF for HGF expression in cancer cells with short poly(dA).

  8. A Million Steps: Developing a Health Promotion Program at the Workplace to Enhance Physical Activity.

    Science.gov (United States)

    González-Dominguez, María Eugenia; Romero-Sánchez, José Manuel; Ares-Camerino, Antonio; Marchena-Aparicio, Jose Carlos; Flores-Muñoz, Manuel; Infantes-Guzmán, Inés; León-Asuero, José Manuel; Casals-Martín, Fernando

    2017-11-01

    The workplace is a key setting for the prevention of occupational risks and for promoting healthy activities such as physical activity. Developing a physically active lifestyle results in many health benefits, improving both well-being and quality of life. This article details the experience of two Spanish companies that implemented a program to promote physical exercise in the workplace, called "A Million Steps." This program aimed to increase the physical activity of participants, challenging them to reach at least a million steps in a month through group walks. Participant workers reached the set goal and highlighted the motivational and interpersonal functions of the program.

  9. Sequence specific DNA binding by P53 is enhanced by ionizing radiation and is mediated via DNA-PK activity

    International Nuclear Information System (INIS)

    Kachnic, L.A.; Wunsch, H.; Mekeel, K.L.; De Frank, J.S.; Powell, S.N.

    1996-01-01

    Purpose: P53 is known to be involved in the cellular response to DNA damage. It mediates many of its effects by acting as a transcription factor via sequence-specific DNA binding. The half-life of p53 is prolonged following DNA damage, and this results in elevated levels of p53 for a period of 2-8 hours. The increase in p53 is often relatively small, but this produces significant stimulation of a downstream gene such as p21(WAF1/cip1). We investigated post-translational modification of p53 following ionizing radiation damage. Materials and Methods: The response of normal Balb-C mouse fibroblasts (FC) to ionizing radiation (IR, 8 Gy) was measured at 0,3,6,9 and 24 hours, by the levels of p53, p21, flow cytometry and the electrophoretic mobility shift assay (EMSA). EMSA utilized a 26 bp consensus sequence end-labeled oligonucleotide to measure sequence-specific p53 binding. P53 specificity was confirmed by an enhanced mobility shift (retardation) when using p53 antibody. Comparison was made with scid fibroblasts (FS) and FC cells transfected with a plasmid (CX3) containing mutant p53 (alanine-143) or infected with a retrovirus containing the E6 protein of human papilloma virus type 16. Results: The response of p53 to DNA damage shows a 3-fold increase at 3-6 hours, and was not significantly different between FC and FS. FC-CX3 showed detectable basal levels of p53, and a 2-fold further induction of p53 after IR. FC-E6 showed no detectable levels of p53 before or after IR. No induction of p21 or G1/S arrest was seen in FC-CX3 or FC-E6, as has been observed previously. The induction of p21 in FS cells was attenuated and delayed: a 2-3-fold increase seen maximally at 9 hours, compared with a 5-fold increase seen maximally at 3-6 hours in FC cells. The accumulation of cells at the G1/S junction after IR showed the same kinetics as p21 induction: the peak of cells in G1 occurs at 3-6 hours in FC, but not until 9-24 hours in FS. The response is reminiscent of that seen in

  10. Estrogen receptor α enhances the transcriptional activity of ETS-1 and promotes the proliferation, migration and invasion of neuroblastoma cell in a ligand dependent manner

    International Nuclear Information System (INIS)

    Cao, Peng; Feng, Fan; Dong, Guofu; Yu, Chunyong; Feng, Sizhe; Song, Erlin; Shi, Guobing; Liang, Yong; Liang, Guobiao

    2015-01-01

    It is well known that estrogen receptor α (ERα) participates in the pathogenic progress of breast cancer, hepatocellular carcinoma and head and neck squamous cell carcinoma. In neuroblastoma cells and related cancer clinical specimens, moreover, the ectopic expression of ERα has been identified. However, the detailed function of ERα in the proliferation of neuroblastoma cell is yet unclear. The transcriptional activity of ETS-1 (E26 transformation specific sequence 1) was measured by luciferase analysis. Western blot assays and Real-time RT-PCR were used to examine the expression of ERα, ETS-1 and its targeted genes. The protein-protein interaction between ERα and ETS-1 was determined by co-IP and GST-Pull down assays. The accumulation of ETS-1 in nuclear was detected by western blot assays, and the recruitment of ETS-1 to its targeted gene’s promoter was tested by ChIP assays. Moreover, SH-SY5Y cells’ proliferation, anchor-independent growth, migration and invasion were quantified using the MTT, soft agar or Trans-well assay, respectively. The transcriptional activity of ETS-1 was significantly increased following estrogen treatment, and this effect was related to ligand-mediated activation of ERα. The interaction between the ERα and ETS-1 was identified, and enhancement of ERα activation would up-regulate the ETS-1 transcription factor activity via modulating its cytoplasm/nucleus translocation and the recruitment of ETS-1 to its target gene’s promoter. Furthermore, treatment of estrogen increased proliferation, migration and invasion of neuroblastoma cells, whereas the antagonist of ERα reduced those effects. In this study, we provided evidences that activation of ERα promoted neuroblastoma cells proliferation and up-regulated the transcriptional activity of ETS-1. By investigating the role of ERα in the ETS-1 activity regulation, we demonstrated that ERα may be a novel ETS-1 co-activator and thus a potential therapeutic target in human

  11. Sequence, taste and umami-enhancing effect of the peptides separated from soy sauce.

    Science.gov (United States)

    Zhuang, Mingzhu; Lin, Lianzhu; Zhao, Mouming; Dong, Yi; Sun-Waterhouse, Dongxiao; Chen, Huiping; Qiu, Chaoying; Su, Guowan

    2016-09-01

    Five tasty peptides were separated from soy sauce, by sensory-guided fractionation, using macroporous resin, medium-pressure liquid chromatography and reverse phase-high performance liquid chromatography, and identified by ultra-performance liquid chromatography tandem mass-spectrometry as ALPEEV, LPEEV, AQALQAQA, EQQQQ and EAGIQ (which originated from glycinin A1bB2-445, glycinin A1bB2-445, cobyric acid synthase, leucine-tRNA ligase and glycoprotein glucosyltransferase, respectively). LPEEV, AQALQAQA and EQQQQ tasted umami with threshold values of 0.43, 1.25 and 0.76mmol/l, respectively. ALPEEV and EAGIQ had minimal umami taste, but ALPEEV, EAGIQ and LPEEV showed umami-enhancement with a threshold estimated at 1.52, 1.94 and 3.41mmol/l, respectively. In addition, the synthetic peptides showed much better sensory taste than mixtures of their constitutive amino acids. It indicated that peptides might play an important role in the umami taste of soy sauce. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. An efficient sequence for fetal brain imaging at 3T with enhanced T1 contrast and motion robustness.

    Science.gov (United States)

    Ferrazzi, Giulio; Price, Anthony N; Teixeira, Rui Pedro A G; Cordero-Grande, Lucilio; Hutter, Jana; Gomes, Ana; Padormo, Francesco; Hughes, Emer; Schneider, Torben; Rutherford, Mary; Kuklisova Murgasova, Maria; Hajnal, Joseph V

    2018-07-01

    Ultrafast single-shot T 2 -weighted images are common practice in fetal MR exams. However, there is limited experience with fetal T 1 -weighted acquisitions. This study aims at establishing a robust framework that allows fetal T 1 -weighted scans to be routinely acquired in utero at 3T. A 2D gradient echo sequence with an adiabatic inversion was optimized to be robust to fetal motion and maternal breathing optimizing grey/white matter contrast at the same time. This was combined with slice to volume registration and super resolution methods to produce volumetric reconstructions. The sequence was tested on 22 fetuses. Optimized grey/white matter contrast and robustness to fetal motion and maternal breathing were achieved. Signal from cerebrospinal fluid (CSF) and amniotic fluid was nulled and 0.75 mm isotropic anatomical reconstructions of the fetal brain were obtained using slice-to-volume registration and super resolution techniques. Total acquisition time for a single stack was 56 s, all acquired during free breathing. Enhanced sensitivity to normal anatomy and pathology with respect to established methods is demonstrated. A direct comparison with a 3D spoiled gradient echo sequence and a controlled motion experiment run on an adult volunteer are also shown. This paper describes a robust framework to perform T 1 -weighted acquisitions and reconstructions of the fetal brain in utero. Magn Reson Med 80:137-146, 2018. © 2017 The Authors Magnetic Resonance in Medicine published by Wiley Periodicals, Inc. on behalf of International Society for Magnetic Resonance in Medicine. This is an open access article under the terms of the Creative Commons Attribution NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes. © 2017 The Authors Magnetic Resonance in Medicine published by Wiley Periodicals, Inc. on behalf of International Society for Magnetic

  13. MRI evaluation of myometrial invasion by endometrial carcinoma. Comparison between fast-spin-echo T2W and coronal FMPSPGR Gadolinium-Dota-Enhanced Sequences

    International Nuclear Information System (INIS)

    Nasi, Francesca; Fiocchi, Federica; Pecchi, Annarita; Torricelli, Pietro; Rivasi, Francesco

    2005-01-01

    Purpose. The depth of myometrial invasion by endometrial carcinoma strongly affects the incidence of metastasis to regional nodes and influences the surgical strategies. The aim of this paper is to compare the results of FSE T2-w and Gadolinium-enhanced FMPSGR MR sequences in assessing the depth of myometrial invasion by endometrial cancer. Materials and methods. Forty-five women with histopathologically-proven endometrial carcinoma underwent preoperative MRI. Axial SE TI w, axial, sagittal and para-coronal FSE T2w and para-coronal Gadolinium enhanced FMPSGR sequences were performed using a high field strength magnet (1.5T). Within one month of MR all patients underwent hysterectomy, and anatomical evaluation of the surgical specimen was done sectioning the uterus along the short axis. Based upon the results of the histological evaluation the results of the FSE T2w and Gadolinium-enhanced sequences were compared and the statistical difference between the results obtained was statistically evaluated. Results. The histological evaluation showed intra mucosal neoplasm in 11 patients, myometrial infiltration less than 50% in 31 patients, myometrial infiltration more than 50% in 12 patients and transmural cancer 1 patient. Statistical evaluation showed that the FSE T2w sequence had a global sensitivity and specificity of 80.6% and 87.6%, respectively, with a mean Negative Predictive Value of 92.6% and a mean Positive Predictive Value of 86%. Gadolinium-enhanced FMPSPGR sequence had a global sensitivity and specificity of 90.6% and 93.3%, respectively, with a mean Negative Predictive Value of 96,3% and a mean Positive Predictive Value of 88%. The staging accuracy (χ 2 test) on FMPSPGR images (95%) was higher than that on FSE T2w images (78%). Conclusions. In our experience Gadolinium-enhanced dynamic sequences increase the accuracy of MR imaging in diagnosing the depth of myometrial invasion. In particular they improve the visualisation of the inner myometrium, the so

  14. Strategy for complete NMR assignment of disordered proteins with highly repetitive sequences based on resolution-enhanced 5D experiments

    Energy Technology Data Exchange (ETDEWEB)

    Motackova, Veronika; Novacek, Jiri [Masaryk University, Faculty of Science, National Centre for Biomolecular Research (Czech Republic); Zawadzka-Kazimierczuk, Anna; Kazimierczuk, Krzysztof [University of Warsaw, Faculty of Chemistry (Poland); Zidek, Lukas, E-mail: lzidek@chemi.muni.c [Masaryk University, Faculty of Science, National Centre for Biomolecular Research (Czech Republic); Sanderova, Hana; Krasny, Libor [Academy of Sciences of the Czech Republic, Laboratory of Molecular Genetics of Bacteria and Department of Bacteriology, Institute of Microbiology (Czech Republic); Kozminski, Wiktor [University of Warsaw, Faculty of Chemistry (Poland); Sklenar, Vladimir [Masaryk University, Faculty of Science, National Centre for Biomolecular Research (Czech Republic)

    2010-11-15

    A strategy for complete backbone and side-chain resonance assignment of disordered proteins with highly repetitive sequence is presented. The protocol is based on three resolution-enhanced NMR experiments: 5D HN(CA)CONH provides sequential connectivity, 5D HabCabCONH is utilized to identify amino acid types, and 5D HC(CC-TOCSY)CONH is used to assign the side-chain resonances. The improved resolution was achieved by a combination of high dimensionality and long evolution times, allowed by non-uniform sampling in the indirect dimensions. Random distribution of the data points and Sparse Multidimensional Fourier Transform processing were used. Successful application of the assignment procedure to a particularly difficult protein, {delta} subunit of RNA polymerase from Bacillus subtilis, is shown to prove the efficiency of the strategy. The studied protein contains a disordered C-terminal region of 81 amino acids with a highly repetitive sequence. While the conventional assignment methods completely failed due to a very small differences in chemical shifts, the presented strategy provided a complete backbone and side-chain assignment.

  15. Does decentralisation enhance a school's role of promoting social cohesion? Bosnian school leaders' perceptions of school governance

    Science.gov (United States)

    Komatsu, Taro

    2014-05-01

    This study seeks to understand whether and how decentralised school governance in Bosnia and Herzegovina (BiH) enhances the schools' role of promoting social cohesion. This includes increasing "horizontal" trust among different ethnic groups and "vertical" trust between civilians and public institutes. The study examined secondary school leaders' perceptions regarding school board influence on social cohesion policies and practices, their interactions with school board members, and their accountability to the school-based governing body. The results show that school leaders and school boards, supposedly representing the interests of local stakeholders, did not appear to be actively engaged in the deliberate process of promoting social cohesion. While school directors tended to view themselves as being independent from the school boards, ethnically diverse school boards provided important support to proactive school leaders for their inter-group activities. Given that the central level is not providing initiatives to promote social cohesion and that BiH citizens appear to generally support social cohesion, decentralised school governance has the potential to improve social trust from the bottom up. To promote participatory school governance, the study recommends that BiH school leaders should be provided with opportunities to re-examine and redefine their professional accountability and to assist local stakeholders to improve their involvement in school governance.

  16. Mining Halophytes for Plant Growth-Promoting Halotolerant Bacteria to Enhance the Salinity Tolerance of Non-halophytic Crops

    Directory of Open Access Journals (Sweden)

    Hassan Etesami

    2018-02-01

    Full Text Available Salinity stress is one of the major abiotic stresses limiting crop production in arid and semi-arid regions. Interest is increasing in the application of PGPRs (plant growth promoting rhizobacteria to ameliorate stresses such as salinity stress in crop production. The identification of salt-tolerant, or halophilic, PGPRs has the potential to promote saline soil-based agriculture. Halophytes are a useful reservoir of halotolerant bacteria with plant growth-promoting capabilities. Here, we review recent studies on the use of halophilic PGPRs to stimulate plant growth and increase the tolerance of non-halophytic crops to salinity. These studies illustrate that halophilic PGPRs from the rhizosphere of halophytic species can be effective bio-inoculants for promoting the production of non-halophytic species in saline soils. These studies support the viability of bioinoculation with halophilic PGPRs as a strategy for the sustainable enhancement of non-halophytic crop growth. The potential of this strategy is discussed within the context of ensuring sustainable food production for a world with an increasing population and continuing climate change. We also explore future research needs for using halotolerant PGPRs under salinity stress.

  17. Direct interactions of OCA-B and TFII-I regulate immunoglobulin heavy-chain gene transcription by facilitating enhancer-promoter communication.

    Science.gov (United States)

    Ren, Xiaodi; Siegel, Rachael; Kim, Unkyu; Roeder, Robert G

    2011-05-06

    B cell-specific coactivator OCA-B, together with Oct-1/2, binds to octamer sites in promoters and enhancers to activate transcription of immunoglobulin (Ig) genes, although the mechanisms underlying their roles in enhancer-promoter communication are unknown. Here, we demonstrate a direct interaction of OCA-B with transcription factor TFII-I, which binds to DICE elements in Igh promoters, that affects transcription at two levels. First, OCA-B relieves HDAC3-mediated Igh promoter repression by competing with HDAC3 for binding to promoter-bound TFII-I. Second, and most importantly, Igh 3' enhancer-bound OCA-B and promoter-bound TFII-I mediate promoter-enhancer interactions, in both cis and trans, that are important for Igh transcription. These and other results reveal an important function for OCA-B in Igh 3' enhancer function in vivo and strongly favor an enhancer mechanism involving looping and facilitated factor recruitment rather than a tracking mechanism. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Enhancement of extracellular expression of Bacillus naganoensis pullulanase from recombinant Bacillus subtilis: Effects of promoter and host.

    Science.gov (United States)

    Song, Wan; Nie, Yao; Mu, Xiao Qing; Xu, Yan

    2016-08-01

    Pullulanase plays an important role in industrial applications of starch processing. However, extracellular production of pullulanase from recombinant Bacillus subtilis is yet limited due to the issues on regulatory elements of B. subtilis expression system. In this study, the gene encoding B. naganoensis pullulanase (PUL) was expressed in B. subtilis WB800 under the promoter PHpaII in the shuttle vector pMA0911. The extracellular activity of expressed pullulanase was 3.9 U ml(-1) from the recombinant B. subtilis WB800/pMA0911-PHpaII-pul. To further enhance the yield of PUL, the promoter PHpaII in pMA0911 was replaced by a stronger constitutive promoter P43. Then the activity was increased to 8.7 U ml(-1) from the recombinant B. subtilis WB800/pMA0911-P43-pul. Effect of host on pullulanase expression was further investigated by comparison between B. subtilis WB600 and B. subtilis WB800. In addition to the available B. subtilis WB800 recombinants, the constructed plasmids pMA0911-PHpaII-pul and pMA0911-P43-pul were transformed into B. subtilis WB600, respectively. Consequently, the extracellular production of PUL was significantly enhanced by B. subtilis WB600/pMA0911-P43-pul, resulting in the extracellular pullulanase activity of 24.5 U ml(-1). Therefore, promoter and host had an impact on pullulanase expression and their optimization would be useful to improve heterologous protein expression in B. subtilis. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Contrast-enhanced Magnetic Resonance Imaging of Pelvic Bone Metastases at 3.0 T: Comparison Between 3-dimensional T1-weighted CAIPIRINHA-VIBE Sequence and 2-dimensional T1-weighted Turbo Spin-Echo Sequence.

    Science.gov (United States)

    Yoon, Min A; Hong, Suk-Joo; Lee, Kyu-Chong; Lee, Chang Hee

    2018-06-12

    This study aimed to compare 3-dimensional T1-weighted gradient-echo sequence (CAIPIRINHA-volumetric interpolated breath-hold examination [VIBE]) with 2-dimensional T1-weighted turbo spin-echo sequence for contrast-enhanced magnetic resonance imaging (MRI) of pelvic bone metastases at 3.0 T. Thirty-one contrast-enhanced MRIs of pelvic bone metastases were included. Two contrast-enhanced sequences were evaluated for the following parameters: overall image quality, sharpness of pelvic bone, iliac vessel clarity, artifact severity, and conspicuity and edge sharpness of the smallest metastases. Quantitative analysis was performed by calculating signal-to-noise ratio and contrast-to-noise ratio of the smallest metastases. Significant differences between the 2 sequences were assessed. CAIPIRINHA-VIBE had higher scores for overall image quality, pelvic bone sharpness, iliac vessel clarity, and edge sharpness of the metastatic lesions, and had less artifacts (all P 0.05). Our results suggest that CAIPIRINHA-VIBE may be superior to turbo spin-echo for contrast-enhanced MRI of pelvic bone metastases at 3.0 T.

  20. Enhanced expression of membrane proteins in E. coli with a PBAD promoter mutant: synergies with chaperone pathway engineering strategies

    Directory of Open Access Journals (Sweden)

    Nannenga Brent L

    2011-12-01

    Full Text Available Abstract Background Membrane proteins (MPs populate 20-30% of genomes sequenced to date and hold potential as therapeutic targets as well as for practical applications in bionanotechnology. However, MP toxicity and low yields in normally robust expression hosts such as E. coli has curtailed progress in our understanding of their structure and function. Results Using the seven transmembrane segments H. turkmenica deltarhodopsin (HtdR as a reporter, we isolated a spontaneous mutant in the arabinose-inducible PBAD promoter leading to improved cell growth and a twofold increase in the recovery of active HtdR at 37°C. A single transversion in a conserved region of the cyclic AMP receptor protein binding site caused the phenotype by reducing htdR transcript levels by 65%. When the mutant promoter was used in conjunction with a host lacking the molecular chaperone Trigger Factor (Δtig cells, toxicity was further suppressed and the amount of correctly folded HtdR was 4-fold that present in the membranes of control cells. More importantly, while improved growth barely compensated for the reduction in transcription rates when another polytopic membrane protein (N. pharonis sensory rhodopsin II was expressed under control of the mutant promoter in wild type cells, a 4-fold increase in productivity could be achieved in a Δtig host. Conclusions Our system, which combines a downregulated version of the tightly repressed PBAD promoter with a TF-deficient host may prove a valuable alternative to T7-based expression for the production of membrane proteins that have so far remained elusive targets.

  1. Qualitative and quantitative comparison of contrast-enhanced fluid-attenuated inversion recovery, magnetization transfer spin echo, and fat-saturation T1-weighted sequences in infectious meningitis

    International Nuclear Information System (INIS)

    Azad, Rajiv; Tayal, Mohit; Azad, Sheenam; Sharma, Garima; Srivastava, Rajendra Kumar

    2017-01-01

    To compare the contrast-enhanced fluid-attenuated inversion recovery (CE-FLAIR), the CE T1-weighted (CE-T1W) sequence with fat suppression (FS) and magnetization transfer (MT) for early detection and characterization of infectious meningitis. Fifty patients and 10 control subjects were evaluated with the CE-FLAIR and the CE-T1W sequences with FS and MT. Qualitative assessment was done by two observers for presence and grading of abnormal leptomeningeal enhancement. Quantitative assessment included computation of net meningeal enhancement, using single pixel signal intensity software. A newly devised FLAIR based scoring system, based on certain imaging features including ventricular dilatation, ependymal enhancement, infarcts and subdural effusions was used to indicate the etiology. Data were analysed using the Student's t test, Cohen's Kappa coefficient, Pearson's correlation coefficient, the intraclass correlation coefficient, one way analysis of variance, and Fisher's exact test with Bonferroni correction as the post hoc test. The CE-FLAIR sequence demonstrated a better sensitivity (100%), diagnostic accuracy (95%), and a stronger correlation with the cerebrospinal fluid, total leukocyte count (r = 0.75), protein (r = 0.77), adenosine deaminase (r = 0.81) and blood glucose (r = -0.6) values compared to the CE-T1W sequences. Qualitative grades and quantitative meningeal enhancement on the CE-FLAIR sequence were also significantly greater than those on the other sequences. The FLAIR based scoring system yielded a diagnostic accuracy of 91.6% and a sensitivity of 96%. A strong inverse Pearson's correlation (r = -0.95) was found between the assigned score and patient's Glasgow Coma Scale at the time of admission. The CE-FLAIR sequence is better suited for evaluating infectious meningitis and could be included as a part of the routine MR imaging protocol

  2. Qualitative and quantitative comparison of contrast-enhanced fluid-attenuated inversion recovery, magnetization transfer spin echo, and fat-saturation T1-weighted sequences in infectious meningitis

    Energy Technology Data Exchange (ETDEWEB)

    Azad, Rajiv; Tayal, Mohit; Azad, Sheenam; Sharma, Garima; Srivastava, Rajendra Kumar [SGRR Institute of Medical and Health Sciences, Patel Nagar, Dehradun (India)

    2017-11-15

    To compare the contrast-enhanced fluid-attenuated inversion recovery (CE-FLAIR), the CE T1-weighted (CE-T1W) sequence with fat suppression (FS) and magnetization transfer (MT) for early detection and characterization of infectious meningitis. Fifty patients and 10 control subjects were evaluated with the CE-FLAIR and the CE-T1W sequences with FS and MT. Qualitative assessment was done by two observers for presence and grading of abnormal leptomeningeal enhancement. Quantitative assessment included computation of net meningeal enhancement, using single pixel signal intensity software. A newly devised FLAIR based scoring system, based on certain imaging features including ventricular dilatation, ependymal enhancement, infarcts and subdural effusions was used to indicate the etiology. Data were analysed using the Student's t test, Cohen's Kappa coefficient, Pearson's correlation coefficient, the intraclass correlation coefficient, one way analysis of variance, and Fisher's exact test with Bonferroni correction as the post hoc test. The CE-FLAIR sequence demonstrated a better sensitivity (100%), diagnostic accuracy (95%), and a stronger correlation with the cerebrospinal fluid, total leukocyte count (r = 0.75), protein (r = 0.77), adenosine deaminase (r = 0.81) and blood glucose (r = -0.6) values compared to the CE-T1W sequences. Qualitative grades and quantitative meningeal enhancement on the CE-FLAIR sequence were also significantly greater than those on the other sequences. The FLAIR based scoring system yielded a diagnostic accuracy of 91.6% and a sensitivity of 96%. A strong inverse Pearson's correlation (r = -0.95) was found between the assigned score and patient's Glasgow Coma Scale at the time of admission. The CE-FLAIR sequence is better suited for evaluating infectious meningitis and could be included as a part of the routine MR imaging protocol.

  3. Liver acquisition with acceleration volume acquisition gadolinium-enhanced magnetic resonance combined with T2 sequences in the diagnosis of local recurrence of rectal cancer.

    Science.gov (United States)

    Cao, Wuteng; Li, Fangqian; Gong, Jiaying; Liu, Dechao; Deng, Yanhong; Kang, Liang; Zhou, Zhiyang

    2016-11-22

    To investigate the efficacy of liver acquisition with acceleration volume acquisition (LAVA) gadolinium-enhanced magnetic resonance (MR) sequences and to assess its added accuracy in diagnosing local recurrence (LR) of rectal cancer with conventional T2-weighted fast spin echo (FSE) sequences. Pelvic MRI, including T2-weighted FSE sequences, gadolinium-enhanced sequences of LAVA and T1-weighted FSE with fat suppression, was performed on 225 patients with postoperative rectal cancer. Two readers evaluated the presence of LR according to "T2" (T2 sequences only), "T2 + LAVA-Gad" (LAVA and T2 imaging), and "T2 + T1-fs-Gad" (T1 fat suppression-enhanced sequence with T2 images). To evaluate diagnostic efficiency, imaging quality with LAVA and T1-fs-Gad by subjective scores and the signal intensity (SI) ratio. In the result, the SI ratio of LAVA was significantly higher than that of T1-fs-Gad (p = 0.0001). The diagnostic efficiency of "T2 + LAVA-Gad" was better than that of "T2 + T1-fs-Gad" (p = 0.0016 for Reader 1, p = 0.0001 for Reader 2) and T2 imaging only (p = 0.0001 for Reader 1; p = 0.0001 for Reader 2). Therefore, LAVA gadolinium-enhanced MR increases the accuracy of diagnosis of LR from rectal cancer and could replace conventional T1 gadolinium-enhanced sequences in the postoperative pelvic follow-up of rectal cancer.

  4. Purification, crystallization and preliminary X-ray crystallographic analysis of the ETS domain of human Ergp55 in complex with the cfos promoter DNA sequence

    International Nuclear Information System (INIS)

    Gangwar, Shanti P.; Meena, Sita R.; Saxena, Ajay K.

    2012-01-01

    The ETS domain of human Ergp55 was purified and crystallized in native, complexes with E74, and cfos promoter DNA sequences. The X-ray intensity data set was collected on ETS–cfos promoter DNA complex crystal at 3.1 Å resolution to analyze the structure by molecular replacement technique. The Ergp55 protein belongs to the Ets family of transciption factors. The Ets transcription factors are involved in various developmental processes and the regulation of cancer metabolism. They contain a highly similar DNA-binding domain known as the ETS domain and have diverse functions in oncogenesis and physiology. The Ets transcription factors differ in their DNA-binding preference at the ETS site and the mechanisms by which they target genes are not clearly understood. To understand its DNA-binding mechanism, the ETS domain of Ergp55 was expressed and purified. The ETS domain was crystallized in the native form and in complex forms with DNA sequences from the E74 and cfos promoters. An X-ray diffraction data set was collected from an ETS–cfos DNA complex crystal at a wavelength of 0.9725 Å on the BM14 synchrotron beamline at the ESRF, France. The ETS–cfos DNA complex crystal belonged to space group C222 1 , with four molecules in the asymmetric unit. For structure analysis, initial phases for the ETS–cfos DNA complex were obtained by the molecular-replacement technique with Phaser in the CCP4 suite using the coordinates of Fli-1 protein and cfos DNA as search models. Structure analysis of the ETS–cfos DNA complex may possibly explain the DNA-binding specificity and its mechanism of interaction with the ETS domain of Ergp55

  5. A novel type of DNA-binding protein interacts with a conserved sequence in an early nodulin ENOD12 promoter

    DEFF Research Database (Denmark)

    Christiansen, H; Hansen, A C; Vijn, I

    1996-01-01

    The pea genes PsENOD12A and PsENOD12B are expressed in the root hairs shortly after infection with the nitrogen-fixing bacterium Rhizobium leguminosarum bv. viciae or after application of purified Nod factors. A 199 bp promoter fragment of the PsENOD12B gene contains sufficient information for Nod...... factor-induced tissue-specific expression. We have isolated a Vicia sativa cDNA encoding a 1641 amino acid protein, ENBP1, that interacts with the 199 bp ENOD12 promoter. Two different DNA-binding domains were identified in ENBP1. A domain containing six AT-hooks interacts specifically with an AT...... of the ENBP1 transcript in cells expressing ENOD12 strongly suggest that ENBP1 is a transcription factor involved in the regulation of ENOD12. Finally, the C-terminal region of ENBP1 shows strong homology to a protein from rat that is specifically expressed in testis tissue. Udgivelsesdato: 1996-Dec...

  6. Centrically reordered inversion recovery half-Fourier single-shot turbo spin-echo sequence: improvement of the image quality of oxygen-enhanced MRI

    International Nuclear Information System (INIS)

    Ohno, Yoshiharu; Hatabu, Hiroto; Higashino, Takanori; Kawamitsu, Hideaki; Watanabe, Hirokazu; Takenaka, Daisuke; Cauteren, Marc van; Sugimura, Kazuro

    2004-01-01

    Purpose: The purpose of the study presented here was to determine the improvement in image quality of oxygen-enhanced magnetic resonance (MR) subtraction imaging obtained with a centrically reordered inversion recovery half-Fourier single-shot turbo spin-echo (c-IR-HASTE) sequence compared with that obtained with a conventional sequentially reordered inversion recovery single-shot HASTE (s-IR-HASTE) sequence for pulmonary imaging. Materials and methods: Oxygen-enhanced MR imaging using a 1.5 T whole body scanner was performed on 12 healthy, non-smoking volunteers. Oxygen-enhanced MR images were obtained with the coronal two-dimensional (2D) c-IR-HASTE sequence and 2D s-IR-HASTE sequence combined with respiratory triggering. For a 256x256 matrix, 132 phase-encoding steps were acquired including four steps for phase correction. Inter-echo spacing for each sequence was 4.0 ms. The effective echo time (TE) for c-IR-HASTE was 4.0 ms, and 16 ms for s-IR-HASTE. The inversion time (TI) was 900 ms. To determine the improvement in oxygen-enhanced MR subtraction imaging by c-IR-HASTE, CNRs of subtraction image, overall image quality, and image degradation of the c-IR-HASTE and s-IR-HASTE techniques were statistically compared. Results: CNR, overall image quality, and image degradation of c-IR-HASTE images showed significant improvement compared to those s-IR-HASTE images (P<0.05). Conclusion: Centrically reordered inversion recovery half-Fourier single-shot turbo spin-echo (c-IR-HASTE) sequence enhanced the signal from the lung and improved the image quality of oxygen-enhanced MR subtraction imaging

  7. Vaccine-induced anti-HA2 antibodies promote virus fusion and enhance influenza virus respiratory disease.

    Science.gov (United States)

    Khurana, Surender; Loving, Crystal L; Manischewitz, Jody; King, Lisa R; Gauger, Phillip C; Henningson, Jamie; Vincent, Amy L; Golding, Hana

    2013-08-28

    Vaccine-induced disease enhancement has been described in connection with several viral vaccines in animal models and in humans. We investigated a swine model to evaluate mismatched influenza vaccine-associated enhanced respiratory disease (VAERD) after pH1N1 infection. Vaccinating pigs with whole inactivated H1N2 (human-like) virus vaccine (WIV-H1N2) resulted in enhanced pneumonia and disease after pH1N1 infection. WIV-H1N2 immune sera contained high titers of cross-reactive anti-pH1N1 hemagglutinin (HA) antibodies that bound exclusively to the HA2 domain but not to the HA1 globular head. No hemagglutination inhibition titers against pH1N1 (challenge virus) were measured. Epitope mapping using phage display library identified the immunodominant epitope recognized by WIV-H1N2 immune sera as amino acids 32 to 77 of pH1N1-HA2 domain, close to the fusion peptide. These cross-reactive anti-HA2 antibodies enhanced pH1N1 infection of Madin-Darby canine kidney cells by promoting virus membrane fusion activity. The enhanced fusion activity correlated with lung pathology in pigs. This study suggests a role for fusion-enhancing anti-HA2 antibodies in VAERD, in the absence of receptor-blocking virus-neutralizing antibodies. These findings should be considered during the evaluation of universal influenza vaccines designed to elicit HA2 stem-targeting antibodies.

  8. Cardiac-Specific Gene Expression Facilitated by an Enhanced Myosin Light Chain Promoter

    Directory of Open Access Journals (Sweden)

    Wolfgang Boecker

    2004-04-01

    Full Text Available Background: Adenoviral gene transfer has been shown to be effective in cardiac myocytes in vitro and in vivo. A major limitation of myocardial gene therapy is the extracardiac transgene expression. Methods: To minimize extracardiac gene expression, we have constructed a tissue-specific promoter for cardiac gene transfer, namely, the 250-bp fragment of the myosin light chain-2v (MLC-2v gene, which is known to be expressed in a tissue-specific manner in ventricular myocardium followed by a luciferase (luc reporter gene (Ad.4 × MLC250.Luc. Rat cardiomyocytes, liver and kidney cells were infected with Ad.4 × MLC.Luc or control vectors. For in vivo testing, Ad.4 × MLC250.Luc was injected into the myocardium or in the liver of rats. Kinetics of promoter activity were monitored over 8 days using a cooled CCD camera. Results: In vitro: By infecting hepatic versus cardiomyocyte cells, we found that the promoter specificity ratio (luc activity in cardiomyocytes per liver cells was 20.4 versus 0.9 (Ad.4 × MLC250.Luc vs. Ad.CMV. In vivo: Ad.4 × MLC250.Luc significantly reduced luc activity in liver (38.4-fold, lung (16.1-fold, and kidney (21.8-fold versus Ad.CMV (p = .01; whereas activity in the heart was only 3.8-fold decreased. The gene expression rate of cardiomyocytes versus hepatocytes was 7:1 (Ad.4 × MLC.Luc versus 1:1.4 (Ad.CMV.Luc. Discussion: This new vector may be useful to validate therapeutic approaches in animal disease models and offers the perspective for selective expression of therapeutic genes in the diseased heart.

  9. Triptolide Promotes the Clearance of α-Synuclein by Enhancing Autophagy in Neuronal Cells.

    Science.gov (United States)

    Hu, Guanzheng; Gong, Xiaoli; Wang, Le; Liu, Mengru; Liu, Yang; Fu, Xia; Wang, Wei; Zhang, Ting; Wang, Xiaomin

    2017-04-01

    Parkinson's disease (PD) is an aging-associated neurodegenerative disease with a characteristic feature of α-synuclein accumulation. Point mutations (A53T, A30P) that increase the aggregation propensity of α-synuclein result in familial early onset PD. The abnormal metabolism of α-synuclein results in aberrant level changes of α-synuclein in PD. In pathological conditions, α-synuclein is degraded mainly by the autophagy-lysosome pathway. Triptolide (T10) is a monomeric compound isolated from a traditional Chinese herb. Our group demonstrated for the first time that T10 possesses potent neuroprotective properties both in vitro and in vivo PD models. In the present study, we reported T10 as a potent autophagy inducer in neuronal cells, which helped to promote the clearance of various forms of α-synuclein in neuronal cells. We transfected neuronal cells with A53T mutant (A53T) or wild-type (WT) α-synuclein plasmids and found T10 attenuated the cytotoxicity induced by pathogenic A53T α-synuclein overexpression. We observed that T10 significantly reduced both A53T and WT α-synuclein level in neuronal cell line, as well as in primary cultured cortical neurons. Excluding the changes of syntheses, secretion, and aggregation of α-synuclein, we further added autophagy inhibitor or proteasome inhibitor with T10, and we noticed that T10 promoted the clearance of α-synuclein mainly by the autophagic pathway. Lastly, we observed increased autophagy marker LC3-II expression and autophagosomes by GFP-LC3-II accumulation and ultrastructural characterization. However, the lysosome activity and cell viability were not modulated by T10. Our study revealed that T10 could induce autophagy and promote the clearance of both WT and A53T α-synuclein in neurons. These results provide evidence of T10 as a promising mean to treat PD and other neurodegenerative diseases by reducing pathogenic proteins in neurons.

  10. Enhancing Indigenous Health Promotion Research Through Two-Eyed Seeing: A Hermeneutic Relational Process.

    Science.gov (United States)

    Hovey, Richard B; Delormier, Treena; McComber, Alex M; Lévesque, Lucie; Martin, Debbie

    2017-07-01

    The intention of this article is to demonstrate how Indigenous and allied health promotion researchers learned to work together through a process of Two-Eyed Seeing. This process was first introduced as a philosophical hermeneutic research project on diabetes prevention within an Indigenous community in Quebec Canada. We, as a research team, became aware that hermeneutics and the principles of Haudenosaunee decision making were characteristic of Two-Eyed Seeing. This article describes our experiences while working with each other. Our learning from these interactions emphasized the relational aspects needed to ensure that we became a highly functional research team while working together and becoming Two-Eyed Seeing partners.

  11. A Role for the Fifth G-Track in G-Quadruplex Forming Oncogene Promoter Sequences during Oxidative Stress: Do These "Spare Tires" Have an Evolved Function?

    Science.gov (United States)

    Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J

    2015-08-26

    Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.

  12. Combining brain stimulation and video game to promote long-term transfer of learning and cognitive enhancement.

    Science.gov (United States)

    Looi, Chung Yen; Duta, Mihaela; Brem, Anna-Katharine; Huber, Stefan; Nuerk, Hans-Christoph; Cohen Kadosh, Roi

    2016-02-23

    Cognitive training offers the potential for individualised learning, prevention of cognitive decline, and rehabilitation. However, key research challenges include ecological validity (training design), transfer of learning and long-term effects. Given that cognitive training and neuromodulation affect neuroplasticity, their combination could promote greater, synergistic effects. We investigated whether combining transcranial direct current stimulation (tDCS) with cognitive training could further enhance cognitive performance compared to training alone, and promote transfer within a short period of time. Healthy adults received real or sham tDCS over their dorsolateral prefrontal cortices during two 30-minute mathematics training sessions involving body movements. To examine the role of training, an active control group received tDCS during a non-mathematical task. Those who received real tDCS performed significantly better in the game than the sham group, and showed transfer effects to working memory, a related but non-numerical cognitive domain. This transfer effect was absent in active and sham control groups. Furthermore, training gains were more pronounced amongst those with lower baseline cognitive abilities, suggesting the potential for reducing cognitive inequalities. All effects associated with real tDCS remained 2 months post-training. Our study demonstrates the potential benefit of this approach for long-term enhancement of human learning and cognition.

  13. Deficiency of thioredoxin binding protein-2 (TBP-2 enhances TGF-β signaling and promotes epithelial to mesenchymal transition.

    Directory of Open Access Journals (Sweden)

    So Masaki

    Full Text Available Transforming growth factor beta (TGF-β has critical roles in regulating cell growth, differentiation, apoptosis, invasion and epithelial-mesenchymal transition (EMT of various cancer cells. TGF-β-induced EMT is an important step during carcinoma progression to invasion state. Thioredoxin binding protein-2 (TBP-2, also called Txnip or VDUP1 is downregulated in various types of human cancer, and its deficiency results in the earlier onset of cancer. However, it remains unclear how TBP-2 suppresses the invasion and metastasis of cancer.In this study, we demonstrated that TBP-2 deficiency increases the transcriptional activity in response to TGF-β and also enhances TGF-β-induced Smad2 phosphorylation levels. Knockdown of TBP-2 augmented the TGF-β-responsive expression of Snail and Slug, transcriptional factors related to TGF-β-mediated induction of EMT, and promoted TGF-β-induced spindle-like morphology consistent with the depletion of E-Cadherin in A549 cells.Our results indicate that TBP-2 deficiency enhances TGF-β signaling and promotes TGF-β-induced EMT. The control of TGF-β-induced EMT is critical for the inhibition of the invasion and metastasis. Thus TBP-2, as a novel regulatory molecule of TGF-β signaling, is likely to be a prognostic indicator or a potential therapeutic target for preventing tumor progression.

  14. Enhanced precipitation promotes decomposition and soil C stabilization in semiarid ecosystems, but seasonal timing of wetting matters

    Science.gov (United States)

    Campos, Xochi; Germino, Matthew; de Graaff, Marie-Anne

    2017-01-01

    AimsChanging precipitation regimes in semiarid ecosystems will affect the balance of soil carbon (C) input and release, but the net effect on soil C storage is unclear. We asked how changes in the amount and timing of precipitation affect litter decomposition, and soil C stabilization in semiarid ecosystems.MethodsThe study took place at a long-term (18 years) ecohydrology experiment located in Idaho. Precipitation treatments consisted of a doubling of annual precipitation (+200 mm) added either in the cold-dormant season or in the growing season. Experimental plots were planted with big sagebrush (Artemisia tridentata), or with crested wheatgrass (Agropyron cristatum). We quantified decomposition of sagebrush leaf litter, and we assessed organic soil C (SOC) in aggregates, and silt and clay fractions.ResultsWe found that: (1) increased precipitation applied in the growing season consistently enhanced decomposition rates relative to the ambient treatment, and (2) precipitation applied in the dormant season enhanced soil C stabilization.ConclusionsThese data indicate that prolonged increases in precipitation can promote soil C storage in semiarid ecosystems, but only if these increases happen at times of the year when conditions allow for precipitation to promote plant C inputs rates to soil.

  15. Acute sleep deprivation enhances post-infection sleep and promotes survival during bacterial infection in Drosophila.

    Science.gov (United States)

    Kuo, Tzu-Hsing; Williams, Julie A

    2014-05-01

    Sleep is known to increase as an acute response to infection. However, the function of this behavioral response in host defense is not well understood. To address this problem, we evaluated the effect of acute sleep deprivation on post-infection sleep and immune function in Drosophila. Laboratory. Drosophila melanogaster. Flies were subjected to sleep deprivation before (early DEP) or after (late DEP) bacterial infection. Relative to a non-deprived control, flies subjected to early DEP had enhanced sleep after infection as well as increased bacterial clearance and survival outcome. Flies subjected to late DEP experienced enhanced sleep following the deprivation period, and showed a modest improvement in survival outcome. Continuous DEP (early and late DEP) throughout infection also enhanced sleep later during infection and improved survival. However, improved survival in flies subjected to late or continuous DEP did not occur until after flies had experienced sleep. During infection, both early and late DEP enhanced NFκB transcriptional activity as measured by a luciferase reporter (κB-luc) in living flies. Early DEP also increased NFκB activity prior to infection. Flies that were deficient in expression of either the Relish or Dif NFκB transcription factors showed normal responses to early DEP. However, the effect of early DEP on post-infection sleep and survival was abolished in double mutants, which indicates that Relish and Dif have redundant roles in this process. Acute sleep deprivation elevated NFκB-dependent activity, increased post-infection sleep, and improved survival during bacterial infection.

  16. Designing a Culturally Appropriate Visually Enhanced Low-Text Mobile Health App Promoting Physical Activity for Latinos: A Qualitative Study.

    Science.gov (United States)

    Bender, Melinda S; Martinez, Suzanna; Kennedy, Christine

    2016-07-01

    Rapid proliferation of smartphone ownership and use among Latinos offers a unique opportunity to employ innovative visually enhanced low-text (VELT) mobile health applications (mHealth app) to promote health behavior change for Latinos at risk for lifestyle-related diseases. Using focus groups and in-depth interviews with 16 promotores and 5 health care providers recruited from California clinics, this qualitative study explored perceptions of visuals for a VELT mHealth app promoting physical activity (PA) and limiting sedentary behavior (SB) for Latinos. In this Phase 1 study, participants endorsed visuals portraying PA guidelines and recommended visuals depicting family and socially oriented PA. Overall, participants supported a VELT mHealth app as an alternative to text-based education. Findings will inform the future Phase 2 study development of a culturally appropriate VELT mHealth app to promote PA for Latinos, improve health literacy, and provide an alternative to traditional clinic text-based health education materials. © The Author(s) 2015.

  17. Polymer nanocomposites enhance S-nitrosoglutathione intestinal absorption and promote the formation of releasable nitric oxide stores in rat aorta.

    Science.gov (United States)

    Wu, Wen; Perrin-Sarrado, Caroline; Ming, Hui; Lartaud, Isabelle; Maincent, Philippe; Hu, Xian-Ming; Sapin-Minet, Anne; Gaucher, Caroline

    2016-10-01

    Alginate/chitosan nanocomposite particles (GSNO-acNCPs), i.e. S-nitrosoglutathione (GSNO) loaded polymeric nanoparticles incorporated into an alginate and chitosan matrix, were developed to increase the effective GSNO loading capacity, a nitric oxide (NO) donor, and to sustain its release from the intestine following oral administration. Compared with free GSNO and GSNO loaded nanoparticles, GSNO-acNCPs promoted 2.7-fold GSNO permeation through a model of intestinal barrier (Caco-2 cells). After oral administration to Wistar rats, GSNO-acNCPs promoted NO storage into the aorta during at least 17h, as highlighted by (i) a long-lasting hyporeactivity to phenylephrine (decrease in maximum vasoconstrictive effect of aortic rings) and (ii) N-acetylcysteine (a thiol which can displace NO from tissues)-induced vasodilation of aorxxtic rings preconstricted with phenylephrine. In conclusion, GSNO-acNCPs enhance GSNO intestinal absorption and promote the formation of releasable NO stores into the rat aorta. GSNO-acNCPs are promising carriers for chronic oral application devoted to the treatment of cardiovascular diseases. Copyright © 2016. Published by Elsevier Inc.

  18. Promotion of multi-electron transfer for enhanced photocatalysis: A review focused on oxygen reduction reaction

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Changhua [Centre for Advanced Optoelectronic Functional Materials Research, and Key Laboratory for UV-Emitting Materials and Technology of Ministry of Education, Northeast Normal University, Changchun 130024 (China); College of Chemistry and Biology, Beihua University, Jilin 132013 (China); Zhang, Xintong, E-mail: xtzhang@nenu.edu.cn [Centre for Advanced Optoelectronic Functional Materials Research, and Key Laboratory for UV-Emitting Materials and Technology of Ministry of Education, Northeast Normal University, Changchun 130024 (China); Liu, Yichun [Centre for Advanced Optoelectronic Functional Materials Research, and Key Laboratory for UV-Emitting Materials and Technology of Ministry of Education, Northeast Normal University, Changchun 130024 (China)

    2015-12-15

    Highlights: • Oxygen reduction reaction (ORR) in photocatalysis process is focused. • Multi-electron transfer ORR is reviewed. • This review provides a guide to access to enhanced photocatalysis via multi-electron transfer. - Abstract: Semiconductor photocatalysis has attracted significant interest for solar light induced environmental remediation and solar fuel generation. As is well known, photocatalytic performance is determined by three steps: photoexcitation, separation and transport of photogenerated charge carriers, and surface reactions. To achieve higher efficiency, significant efforts have been made on improvement of efficiency of above first two steps, which have been well documented in recent review articles. In contrast, this review intends to focus on strategies moving onto the third step of improvement for enhanced photocatalysis wherein active oxygen species including superoxide radical, hydrogen peroxide, hydroxyl radical are in situ detected. Particularly, surface electron-transfer reduction of oxygen over single component photocatalysts is reviewed and systems enabling multi-electron transfer induced oxygen reduction reaction (ORR) are highlighted. It is expected this review could provide a guideline for readers to better understand the critical role of ORR over photocatalyst in charge carrier separation and transfer and obtain reliable results for enhanced aerobic photocatalysis.

  19. Stromal Adipocyte Enhancer-binding Protein (AEBP1) Promotes Mammary Epithelial Cell Hyperplasia via Proinflammatory and Hedgehog Signaling*

    Science.gov (United States)

    Holloway, Ryan W.; Bogachev, Oleg; Bharadwaj, Alamelu G.; McCluskey, Greg D.; Majdalawieh, Amin F.; Zhang, Lei; Ro, Hyo-Sung

    2012-01-01

    Disruption of mammary stromal-epithelial communication leads to aberrant mammary gland development and induces mammary tumorigenesis. Macrophages have been implicated in carcinogenesis primarily by creating an inflammatory microenvironment, which promotes growth of the adjacent epithelial cells. Adipocyte enhancer-binding protein 1 (AEBP1), a novel proinflammatory mediator, promotes macrophage inflammatory responsiveness by inducing NF-κB activity, which has been implicated in tumor cell growth and survival by aberrant sonic hedgehog (Shh) expression. Here, we show that stromal macrophage AEBP1 overexpression results in precocious alveologenesis in the virgin AEBP1 transgenic (AEBP1TG) mice, and the onset of ductal hyperplasia was accelerated in AEBP1TG mice fed a high fat diet, which induces endogenous AEBP1 expression. Transplantation of AEBP1TG bone marrow cells into non-transgenic (AEBP1NT) mice resulted in alveolar hyperplasia with up-regulation of NF-κB activity and TNFα expression as displayed in the AEBP1TG mammary macrophages and epithelium. Shh expression was induced in AEBP1TG macrophages and RAW264.7 macrophages overexpressing AEBP1. The Shh target genes Gli1 and Bmi1 expression was induced in the AEBP1TG mammary epithelium and HC11 mammary epithelial cells co-cultured with AEBP1TG peritoneal macrophages. The conditioned AEBP1TG macrophage culture media promoted NF-κB activity and survival signal, Akt activation, in HC11 cells, whereas such effects were abolished by TNFα neutralizing antibody treatment. Furthermore, HC11 cells displayed enhanced proliferation in response to AEBP1TG macrophages and their conditioned media. Our findings highlight the role of AEBP1 in the signaling pathways regulating the cross-talk between mammary epithelium and stroma that could predispose the mammary tissue to tumorigenesis. PMID:22995915

  20. Stromal adipocyte enhancer-binding protein (AEBP1) promotes mammary epithelial cell hyperplasia via proinflammatory and hedgehog signaling.

    Science.gov (United States)

    Holloway, Ryan W; Bogachev, Oleg; Bharadwaj, Alamelu G; McCluskey, Greg D; Majdalawieh, Amin F; Zhang, Lei; Ro, Hyo-Sung

    2012-11-09

    Disruption of mammary stromal-epithelial communication leads to aberrant mammary gland development and induces mammary tumorigenesis. Macrophages have been implicated in carcinogenesis primarily by creating an inflammatory microenvironment, which promotes growth of the adjacent epithelial cells. Adipocyte enhancer-binding protein 1 (AEBP1), a novel proinflammatory mediator, promotes macrophage inflammatory responsiveness by inducing NF-κB activity, which has been implicated in tumor cell growth and survival by aberrant sonic hedgehog (Shh) expression. Here, we show that stromal macrophage AEBP1 overexpression results in precocious alveologenesis in the virgin AEBP1 transgenic (AEBP1(TG)) mice, and the onset of ductal hyperplasia was accelerated in AEBP1(TG) mice fed a high fat diet, which induces endogenous AEBP1 expression. Transplantation of AEBP1(TG) bone marrow cells into non-transgenic (AEBP1(NT)) mice resulted in alveolar hyperplasia with up-regulation of NF-κB activity and TNFα expression as displayed in the AEBP1(TG) mammary macrophages and epithelium. Shh expression was induced in AEBP1(TG) macrophages and RAW264.7 macrophages overexpressing AEBP1. The Shh target genes Gli1 and Bmi1 expression was induced in the AEBP1(TG) mammary epithelium and HC11 mammary epithelial cells co-cultured with AEBP1(TG) peritoneal macrophages. The conditioned AEBP1(TG) macrophage culture media promoted NF-κB activity and survival signal, Akt activation, in HC11 cells, whereas such effects were abolished by TNFα neutralizing antibody treatment. Furthermore, HC11 cells displayed enhanced proliferation in response to AEBP1(TG) macrophages and their conditioned media. Our findings highlight the role of AEBP1 in the signaling pathways regulating the cross-talk between mammary epithelium and stroma that could predispose the mammary tissue to tumorigenesis.

  1. TRIM24 promotes glioma progression and enhances chemoresistance through activation of the PI3K/Akt signaling pathway.

    Science.gov (United States)

    Zhang, L-H; Yin, A-A; Cheng, J-X; Huang, H-Y; Li, X-M; Zhang, Y-Q; Han, N; Zhang, X

    2015-01-29

    The tripartite motif protein TRIM24 (tripartite motif-containing 24) has been found to play distinct roles in tumor development and progression, according to different tumor contexts. However, it remains elusive whether TRIM24 plays a role in malignant gliomas that are the most common and deadly primary brain tumors in adults. We report here that TRIM24 expression is positively correlated with glioma malignancy and is negatively associated with prognosis of patients with newly diagnosed glioblastoma, which is the most malignant form of gliomas but displays highly heterogeneous clinical outcome. The multivariate Cox regression analysis demonstrates the independent predictive value of TRIM24 expression level for overall and progression-free survival. Knockdown of TRIM24 suppresses cell proliferation, cell cycle progression, clone formation and in vivo tumor development, whereas overexpression of TRIM24 promotes cell growth. Chromatin immunoprecipitation, real-time reverse transcription-PCR and mutation analyses demonstrate that TRIM24 binds to the PIK3CA promoter via its PHD-Bromo domain to activate the transcription of PIK3CA gene, thus enhancing phosphatidylinositide 3-kinase (PI3K)/Akt signaling. The pan-PI3K inhibitor LY294002 and small interfering RNA targeting PIK3CA both abrogate the growth-promoting effect of TRIM24. Moreover, TRIM24 regulates the expression of DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT) through PI3K/Akt/nuclear factor-κB signaling transduction and enhances resistance to temozolomide, the standard chemotherapeutic agent for glioblastoma. Finally, glioblastoma patients with low TRIM24 expression benefit from chemotherapy, whereas those with high TRIM24 expression do not have such benefit. Our results suggest that TRIM24 might serve as a potential prognostic marker and therapeutic target for the management of malignant gliomas.

  2. Zinc deficiency promotes cystitis-related bladder pain by enhancing function and expression of Cav3.2 in mice.

    Science.gov (United States)

    Ozaki, Tomoka; Matsuoka, Junki; Tsubota, Maho; Tomita, Shiori; Sekiguchi, Fumiko; Minami, Takeshi; Kawabata, Atsufumi

    2018-01-15

    Ca v 3.2 T-type Ca 2+ channel activity is suppressed by zinc that binds to the extracellular histidine-191 of Ca v 3.2, and enhanced by H 2 S that interacts with zinc. Ca v 3.2 in nociceptors is upregulated in an activity-dependent manner. The enhanced Ca v 3.2 activity by H 2 S formed by the upregulated cystathionine-γ-lyase (CSE) is involved in the cyclophosphamide (CPA)-induced cystitis-related bladder pain in mice. We thus asked if zinc deficiency affects the cystitis-related bladder pain in mice by altering Ca v 3.2 function and/or expression. Dietary zinc deficiency for 2 weeks greatly decreased zinc concentrations in the plasma but not bladder tissue, and enhanced the bladder pain/referred hyperalgesia (BP/RH) following CPA at 200mg/kg, a subeffective dose, but not 400mg/kg, a maximal dose, an effect abolished by pharmacological blockade or gene silencing of Ca v 3.2. Acute zinc deficiency caused by systemic N,N,N',N'-tetrakis-(2-pyridylmethyl)-ethylendiamine (TPEN), a zinc chelator, mimicked the dietary zinc deficiency-induced Ca v 3.2-dependent promotion of BP/RH following CPA at 200mg/kg. CPA at 400mg/kg alone or TPEN plus CPA at 200mg/kg caused Ca v 3.2 overexpression accompanied by upregulation of Egr-1 and USP5, known to promote transcriptional expression and reduce proteasomal degradation of Ca v 3.2, respectively, in the dorsal root ganglia (DRG). The CSE inhibitor, β-cyano-l-alanine, prevented the BP/RH and upregulation of Ca v 3.2, Egr-1 and USP5 in DRG following TPEN plus CPA at 200mg/kg. Together, zinc deficiency promotes bladder pain accompanying CPA-induced cystitis by enhancing function and expression of Ca v 3.2 in nociceptors, suggesting a novel therapeutic avenue for treatment of bladder pain, such as zinc supplementation. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Development of a gene therapy strategy to target hepatocellular carcinoma based inhibition of protein phosphatase 2A using the α-fetoprotein promoter enhancer and pgk promoter: an in vitro and in vivo study

    International Nuclear Information System (INIS)

    Li, Wei; Tao, Min; Li, Dao-Ming; Chen, Kai; Chen, Zheng; Zong, Yang; Yin, Hong; Xu, Ze-Kuan; Zhu, Yi; Gong, Fei-Ran

    2012-01-01

    Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related deaths worldwide. Current therapies are insufficient, making HCC an intractable disease. Our previous studies confirmed that inhibition of protein phosphatase 2A (PP2A) may provide a promising therapeutic strategy for cancer. Unfortunately, constitutive expression of PP2A in normal tissues limits the application of PP2A inhibition. Thus, a HCC-specific gene delivery system should be developed. The α-fetoprotein (AFP) promoter is commonly used in HCC-specific gene therapy strategies; however, the utility of this approach is limited due to the weak activity of the AFP promoter. It has been shown that linking the AFP enhancer with the promoter of the non-tissue-specific, human housekeeping phosphoglycerate kinase (pgk) gene can generate a strong and HCC-selective promoter. We constructed a HCC-specific gene therapy system to target PP2A using the AFP enhancer/pgk promoter, and evaluated the efficiency and specificity of this system both in vitro and in vivo. AFP enhancer/pgk promoter-driven expression of the dominant negative form of the PP2A catalytic subunit α (DN-PP2Acα) exerted cytotoxic effects against an AFP-positive human hepatoma cell lines (HepG2 and Hep3B), but did not affect AFP-negative human hepatoma cells (SK-HEP-1) or normal human liver cells (L-02). Moreover, AFP enhancer/pgk promoter driven expression of DN-PP2Acα inhibited the growth of AFP-positive HepG2 tumors in nude mice bearing solid tumor xenografts, but did not affect AFP-negative SK-HEP-1 tumors. The novel approach of AFP enhancer/pgk promoter-driven expression of DN-PP2Acα may provide a useful cancer gene therapy strategy to selectively target HCC

  4. Physiotherapy students enhance awareness of motivational interviewing skills needed in health promotion

    DEFF Research Database (Denmark)

    Ringby, Betina

    suggested by the teachers. Students emphasized the importance of the learning environment being safe, appreciative and inclusive. All 23 students stated that they learned from playing, observing and/or giving feedback. Learnings were focused around personal issues such as seeing one self and others from......Background Health professionals who are skilled at communicating are a prerequisite for providing services of high quality. Physiotherapists work within health promotion and support people in change of lifestyle. The aim of this project was to gain insight into physiotherapy students’ motivation...... questionnaire. 23 students completed the questionnaire (46%). A content analysis of data was made, themes categorized and developed. Findings Students expressed personal development and working with own cases as important motivational factors for coming to class. 83 % had read all or parts of the literature...

  5. Hypoxia promotes uveal melanoma invasion through enhanced Notch and MAPK activation.

    Directory of Open Access Journals (Sweden)

    Laura Asnaghi

    Full Text Available The transcriptional response promoted by hypoxia-inducible factors has been associated with metastatic spread of uveal melanoma. We found expression of hypoxia-inducible factor 1α (HIF-1α protein in well-vascularized tumor regions as well as in four cell lines grown in normoxia, thus this pathway may be important even in well-oxygenated uveal melanoma cells. HIF-1α protein accumulation in normoxia was inhibited by rapamycin. As expected, hypoxia (1% pO2 further induced HIF-1α protein levels along with its target genes VEGF and LOX. Growth in hypoxia significantly increased cellular invasion of all 5 uveal melanoma lines tested, as did the introduction of an oxygen-insensitive HIF-1α mutant into Mel285 cells with low HIF-1α baseline levels. In contrast, HIF-1α knockdown using shRNA significantly decreased growth in hypoxia, and reduced by more than 50% tumor invasion in four lines with high HIF-1α baseline levels. Pharmacologic blockade of HIF-1α protein expression using digoxin dramatically suppressed cellular invasion both in normoxia and in hypoxia. We found that Notch pathway components, including Jag1-2 ligands, Hes1-Hey1 targets and the intracellular domain of Notch1, were increased in hypoxia, as well as the phosphorylation levels of Erk1-2 and Akt. Pharmacologic and genetic inhibition of Notch largely blocked the hypoxic induction of invasion as did the pharmacologic suppression of Erk1-2 activity. In addition, the increase in Erk1-2 and Akt phosphorylation by hypoxia was partially reduced by inhibiting Notch signaling. Our findings support the functional importance of HIF-1α signaling in promoting the invasive capacity of uveal melanoma cells in both hypoxia and normoxia, and suggest that pharmacologically targeting HIF-1α pathway directly or through blockade of Notch or Erk1-2 pathways can slow tumor spread.

  6. Thromboxane A(2 receptor stimulation promotes closure of the rat ductus arteriosus through enhancing neointima formation.

    Directory of Open Access Journals (Sweden)

    Tomohiro Yokota

    Full Text Available Ductus arteriosus (DA closure follows constriction and remodeling of the entire vessel wall. Patent ductus arteriosus occurs when the DA does not close after birth, and this condition is currently treated using cyclooxygenase inhibitors. However, the efficacy of cyclooxygenase inhibitors is often limited. Our previous study demonstrated that low-dose thromboxane A2 receptor (TP stimulation constricted the DA with minimal adverse effects in rat neonates. However, its effect on DA remodeling remains unknown. In this study, we focused on the impact of the exogenous TP stimulation on the DA remodeling, especially intimal thickening. Using DA explants from rat fetuses at embryonic day 19 as a ex vivo model and primary cultured rat DA smooth muscle cells from embryonic day 21 as a in vitro model, we evaluated the effect of TP stimulation on the DA remodeling. The selective TP agonists U46619 and I-BOP promoted neointima formation in the ex vivo DA explants, and TP stimulation increased DA SMC migration in a dose-dependent manner. Both effects were inhibited by the selective TP antagonist SQ29548 or the siRNA against TP. TP stimulation also increased DA SMC proliferation in the presence of 10% fetal bovine serum. LC/MS/MS analysis revealed that TP stimulation increased secretion of several extracellular matrix proteins that may contribute to an increase in neointima formation. In conclusion, we uncovered that exogenous administration of TP agonist promotes neointima formation through the induction of migration and proliferation of DA SMC, which could contribute to DA closure and also to its vasoconstrictive action.

  7. Suppression of LFA-1 expression by spermine is associated with enhanced methylation of ITGAL, the LFA-1 promoter area.

    Directory of Open Access Journals (Sweden)

    Yoshihiko Kano

    Full Text Available Spermine and spermidine, natural polyamines, suppress lymphocyte function-associated antigen 1 (LFA-1 expression and its associated cellular functions through mechanisms that remain unknown. Inhibition of ornithine decarboxylase, which is required for polyamine synthesis, in Jurkat cells by 3 mM D,L-alpha-difluoromethylornithine hydrochloride (DFMO significantly decreased spermine and spermidine concentrations and was associated with decreased DNA methyltransferase (Dnmt activity, enhanced demethylation of the LFA-1 gene (ITGAL promoter area, and increased CD11a expression. Supplementation with extracellular spermine (500 µM of cells pretreated with DFMO significantly increased polyamine concentrations, increased Dnmt activity, enhanced methylation of the ITGAL promoter, and decreased CD11a expression. It has been shown that changes in intracellular polyamine concentrations affect activities of -adenosyl-L-methionine-decaroboxylase, and, as a result, affect concentrations of the methyl group donor, S-adenosylmethionine (SAM, and of the competitive Dnmt inhibitor, decarboxylated SAM. Additional treatments designed to increase the amount of SAM and decrease the amount of decarboxylated SAM-such as treatment with methylglyoxal bis-guanylhydrazone (an inhibitor of S-adenosyl-L-methionine-decaroboxylase and SAM supplementation-successfully decreased CD11a expression. Western blot analyses revealed that neither DFMO nor spermine supplementation affected the amount of active Ras-proximate-1, a member of the Ras superfamily of small GTPases and a key protein for regulation of CD11a expression. The results of this study suggest that polyamine-induced suppression of LFA-1 expression occurs via enhanced methylation of ITGAL.

  8. ENHANCE: Design and rationale of a randomized controlled trial for promoting enduring happiness & well-being.

    Science.gov (United States)

    Kushlev, Kostadin; Heintzelman, Samantha J; Lutes, Lesley D; Wirtz, Derrick; Oishi, Shigehiro; Diener, Ed

    2017-01-01

    Individuals who are higher in subjective well-being not only feel happier, they are more likely have fulfilling relationships, increased work performance and income, better physical health, and longer lives. Over the past several decades, the science of subjective well-being has produced insights into these benefits of happiness, and-recognizing their importance-has begun to examine the factors that lead to greater well-being, from cultivating strong relationships to pursuing meaningful goals. However, studies to date have typically focused on improving subjective well-being by intervening with singular constructs, using primarily college student populations, and were short-term in nature. Moreover, little is understood about the impact of a well-being treatment delivered online vs. in-person. In the present article, we describe a comprehensive intervention program including 3-month initial treatment followed by a 3-month follow-up, ENHANCE: Enduring Happiness and Continued Self-Enhancement. One-hundred and sixty participants will be recruited from two different sites to participate in one of two versions of ENHANCE: in-person (n=30) vs. wait-list control (n=30); or online (n=50) vs. wait-list control (n=50). Assessments will be completed at baseline, three months and six months. Our primary outcome is change in subjective well-being across treatment (3months) and follow-up (6months). Secondary outcomes include self-report and objective measures of health, as well as a psychological mediators (e.g., psychological needs) and moderators (e.g., personality) of treatment outcomes. We hope to provide researchers, practitioners, and individuals with an evidence-based treatment to improve happiness and subjective well-being. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Flavonoid fisetin promotes ERK-dependent long-term potentiation and enhances memory

    Science.gov (United States)

    Maher, Pamela; Akaishi, Tatsuhiro; Abe, Kazuho

    2006-01-01

    Small molecules that activate signaling pathways used by neurotrophic factors could be useful for treating CNS disorders. Here we show that the flavonoid fisetin activates ERK and induces cAMP response element-binding protein (CREB) phosphorylation in rat hippocampal slices, facilitates long-term potentiation in rat hippocampal slices, and enhances object recognition in mice. Together, these data demonstrate that the natural product fisetin can facilitate long-term memory, and therefore it may be useful for treating patients with memory disorders. PMID:17050681

  10. V(D)J recombination frequency is affected by the sequence interposed between a pair of recombination signals: sequence comparison reveals a putative recombinational enhancer element

    DEFF Research Database (Denmark)

    Roch, F A; Hobi, R; Berchtold, M W

    1997-01-01

    respectively, can markedly affect the frequency of V(D)J recombination. We report that the entire Emu, the Emu core as well as its flanking 5' and 3' matrix associated regions (5' and 3' MARs) upregulate V(D)J recombination while the downstream section of the 3' MAR of Emu does not. Also, prokaryotic sequences...

  11. Enhanced treatment efficiency of an anaerobic sequencing batch reactor (ASBR) for cassava stillage with high solids content.

    Science.gov (United States)

    Luo, Gang; Xie, Li; Zhou, Qi

    2009-06-01

    Cassava stillage is a high strength organic wastewater with high suspended solids (SS) content. The efficiency of cassava stillage treatment using an anaerobic sequencing batch reactor (ASBR) was significantly enhanced by discharging settled sludge to maintain a lower sludge concentration (about 30 g/L) in the reactor. Three hydraulic retention times (HRTs), namely 10 d, 7.5 d, 5 d, were evaluated at this condition. The study demonstrated that at an HRT of 5 d and an organic loading rate (OLR) of 11.3 kg COD/(m(3) d), the total chemical oxygen demand (TCOD) and soluble COD (SCOD) removal efficiency can still be maintained at above 80%. The settleability of digested cassava stillage was improved significantly, and thus only a small amount of settled sludge needed to be discharged to maintain the sludge concentration in the reactor. Furthermore, the performance of ASBR operated at low and high sludge concentration (about 79.5 g/L without sludge discharged) was evaluated at an HRT of 5 d. The TCOD removal efficiency and SS in the effluent were 61% and 21.9 g/L respectively at high sludge concentration, while the values were 85.1% and 2.4 g/L at low sludge concentration. Therefore, low sludge concentration is recommended for ASBR treating cassava stillage at an HRT 5 d due to lower TCOD and SS in the effluent, which could facilitate post-treatment.

  12. Enhancement the conditioning of waste activated sludge through a sequence of freeze/thaw-electro-Fenton process

    Directory of Open Access Journals (Sweden)

    Shahheidar Narjes

    2018-03-01

    Full Text Available Sludge conditioning is an important stage in sludge management. In the present study, a sequence of freeze/thaw-electro-Fenton process was designed and specific resistance filtration (SRF was monitored during sludge conditioning as an important factor in sludge dewaterability. Furthermore, protein and polysaccharide concentrations were measured during the experiments. Results showed that the lowest SRF value contributed to −10°C in freezing process which showed a reducing trend by decreasing solution pH. In addition, results revealed that solution pH less than 3 caused a significant improvement in sludge dewatering; so the lowest SRF has been registered at pH = 2. By increasing current intensity from 0.5 to 1A, SRF values were reduced and then followed by an enhancement with increasing current intensity to 3.2 A. The lowest SRF value (6.1 × 104 m/kg was obtained at H2O2 = 30 mg/L which was the best conditions for sludge dewatering.

  13. Cortical mechanisms underlying sensorimotor enhancement promoted by walking with haptic inputs in a virtual environment.

    Science.gov (United States)

    Sangani, Samir; Lamontagne, Anouk; Fung, Joyce

    2015-01-01

    Sensorimotor integration is a complex process in the central nervous system that produces task-specific motor output based on selective and rapid integration of sensory information from multiple sources. This chapter reviews briefly the role of haptic cues in postural control during tandem stance and locomotion, focusing on sensorimotor enhancement of locomotion post stroke. The use of mixed-reality systems incorporating both haptic cues and virtual reality technology in gait rehabilitation post stroke is discussed. Over the last decade, researchers and clinicians have shown evidence of cerebral reorganization that underlies functional recovery after stroke based on results from neuroimaging techniques such as positron emission tomography and functional magnetic resonance imaging. These imaging modalities are however limited in their capacity to measure cortical changes during extensive body motions in upright stance. Functional near-infrared spectroscopy (fNIRS) on the other hand provides a unique opportunity to measure cortical activity associated with postural control during locomotion. Evidence of cortical changes associated with sensorimotor enhancement induced by haptic touch during locomotion is revealed through fNIRS in a pilot study involving healthy individuals and a case study involving a chronic stroke patient. © 2015 Elsevier B.V. All rights reserved.

  14. APOBEC3G enhances lymphoma cell radioresistance by promoting cytidine deaminase-dependent DNA repair.

    Science.gov (United States)

    Nowarski, Roni; Wilner, Ofer I; Cheshin, Ori; Shahar, Or D; Kenig, Edan; Baraz, Leah; Britan-Rosich, Elena; Nagler, Arnon; Harris, Reuben S; Goldberg, Michal; Willner, Itamar; Kotler, Moshe

    2012-07-12

    APOBEC3 proteins catalyze deamination of cytidines in single-stranded DNA (ssDNA), providing innate protection against retroviral replication by inducing deleterious dC > dU hypermutation of replication intermediates. APOBEC3G expression is induced in mitogen-activated lymphocytes; however, no physiologic role related to lymphoid cell proliferation has yet to be determined. Moreover, whether APOBEC3G cytidine deaminase activity transcends to processing cellular genomic DNA is unknown. Here we show that lymphoma cells expressing high APOBEC3G levels display efficient repair of genomic DNA double-strand breaks (DSBs) induced by ionizing radiation and enhanced survival of irradiated cells. APOBEC3G transiently accumulated in the nucleus in response to ionizing radiation and was recruited to DSB repair foci. Consistent with a direct role in DSB repair, inhibition of APOBEC3G expression or deaminase activity resulted in deficient DSB repair, whereas reconstitution of APOBEC3G expression in leukemia cells enhanced DSB repair. APOBEC3G activity involved processing of DNA flanking a DSB in an integrated reporter cassette. Atomic force microscopy indicated that APOBEC3G multimers associate with ssDNA termini, triggering multimer disassembly to multiple catalytic units. These results identify APOBEC3G as a prosurvival factor in lymphoma cells, marking APOBEC3G as a potential target for sensitizing lymphoma to radiation therapy.

  15. UGGT1 enhances enterovirus 71 pathogenicity by promoting viral RNA synthesis and viral replication.

    Directory of Open Access Journals (Sweden)

    Peng-Nien Huang

    2017-05-01

    Full Text Available Positive-strand RNA virus infections can induce the stress-related unfolded protein response (UPR in host cells. This study found that enterovirus A71 (EVA71 utilizes host UDP-glucose glycoprotein glucosyltransferase 1 (UGGT1, a key endoplasmic reticulum protein (ER involved in UPR, to enhance viral replication and virulence. EVA71 forms replication complexes (RCs on cellular membranes that contain a mix of host and viral proteins to facilitate viral replication, but the components and processes involved in the assembly and function of RCs are not fully understood. Using EVA71 as a model, this study found that host UGGT1 and viral 3D polymerase co-precipitate along with other factors on membranous replication complexes to enhance viral replication. Increased UGGT1 levels elevated viral growth rates, while viral pathogenicity was observed to be lower in heterozygous knockout mice (Uggt1 +/- mice. These findings provide important insight on the role of UPR and host UGGT1 in regulating RNA virus replication and pathogenicity.

  16. Enhanced Dentate Neurogenesis after Brain Injury Undermines Long-Term Neurogenic Potential and Promotes Seizure Susceptibility

    Directory of Open Access Journals (Sweden)

    Eric J. Neuberger

    2017-09-01

    Full Text Available Hippocampal dentate gyrus is a focus of enhanced neurogenesis and excitability after traumatic brain injury. Increased neurogenesis has been proposed to aid repair of the injured network. Our data show that an early increase in neurogenesis after fluid percussion concussive brain injury is transient and is followed by a persistent decrease compared with age-matched controls. Post-injury changes in neurogenesis paralleled changes in neural precursor cell proliferation and resulted in a long-term decline in neurogenic capacity. Targeted pharmacology to restore post-injury neurogenesis to control levels reversed the long-term decline in neurogenic capacity. Limiting post-injury neurogenesis reduced early increases in dentate excitability and seizure susceptibility. Our results challenge the assumption that increased neurogenesis after brain injury is beneficial and show that early post-traumatic increases in neurogenesis adversely affect long-term outcomes by exhausting neurogenic potential and enhancing epileptogenesis. Treatments aimed at limiting excessive neurogenesis can potentially restore neuroproliferative capacity and limit epilepsy after brain injury.

  17. Three-dimensional gradient echo versus spin echo sequence in contrast-enhanced imaging of the pituitary gland at 3 T

    Energy Technology Data Exchange (ETDEWEB)

    Kakite, Suguru, E-mail: sugkaki@med.tottori-u.ac.jp [Division of Radiology, Department of Pathophysiological and Therapeutic Science, Faculty of Medicine, Tottori University, 36-1, Nishicho, Yonago 683-8503 (Japan); Fujii, Shinya [Division of Radiology, Department of Pathophysiological and Therapeutic Science, Faculty of Medicine, Tottori University, 36-1, Nishicho, Yonago 683-8503 (Japan); Kurosaki, Masamichi [Department of Neurosurgery, Faculty of Medicine, Tottori University, 36-1, Nishicho, Yonago 683-8503 (Japan); Kanasaki, Yoshiko; Matsusue, Eiji; Kaminou, Toshio; Ogawa, Toshihide [Division of Radiology, Department of Pathophysiological and Therapeutic Science, Faculty of Medicine, Tottori University, 36-1, Nishicho, Yonago 683-8503 (Japan)

    2011-07-15

    Introduction: To clarify whether a three-dimensional-gradient echo (3D-GRE) or spin echo (SE) sequence is more useful for evaluating sellar lesions on contrast-enhanced T1-weighted MR imaging at 3.0 Tesla (T). Methods: We retrospectively assessed contrast-enhanced T1-weighted images using 3D-GRE and SE sequences at 3.0 T obtained from 33 consecutive patients with clinically suspected sellar lesions. Two experienced neuroradiologists evaluated the images qualitatively in terms of the following criteria: boundary edge of the cavernous sinus and pituitary gland, border of sellar lesions, delineation of the optic nerve and cranial nerves within the cavernous sinus, susceptibility and flow artifacts, and overall image quality. Results: At 3.0 T, 3D-GRE provided significantly better images than the SE sequence in terms of the border of sellar lesions, delineation of cranial nerves, and overall image quality; there was no significant difference regarding the boundary edge of the cavernous sinus and pituitary gland. In addition, the 3D-GRE sequence showed fewer pulsation artifacts but more susceptibility artifacts. Conclusion: Our results indicate that 3D-GRE is the more suitable sequence for evaluating sellar lesions on contrast-enhanced T1-weighted imaging at 3.0 T.

  18. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  19. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Science.gov (United States)

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  20. Is there an added value of T1-weighted contrast-enhanced fat-suppressed spin-echo MR sequences compared to STIR sequences in MRI of the foot and ankle?

    International Nuclear Information System (INIS)

    Zubler, Veronika; Zanetti, Marco; Dietrich, Tobias J.; Pfirrmann, Christian W.; Mamisch-Saupe, Nadja; Espinosa, Norman

    2017-01-01

    To prospectively compare T1-weighted fat-suppressed spin-echo magnetic resonance (MR) sequences after gadolinium application (T1wGdFS) to STIR sequences in patients with acute and chronic foot pain. In 51 patients referred for MRI of the foot and ankle, additional transverse and sagittal T1wGdFS sequences were obtained. Two sets of MR images (standard protocol with STIR or T1wGdFS) were analysed. Diagnosis, diagnostic confidence, and localization of the abnormality were noted. Standard of reference was established by an expert panel of two experienced MSK radiologists and one experienced foot surgeon based on MR images, clinical charts and surgical reports. Patients reported prospectively localization of pain. Descriptive statistics, McNemar test and Kappa test were used. Diagnostic accuracy with STIR protocol was 80% for reader 1, 67% for reader 2, with contrast-protocol 84%, both readers. Significance was found for reader 2. Diagnostic confidence for reader 1 was 1.7 with STIR, 1.3 with contrast-protocol; reader 2: 2.1/1.7. Significance was found for reader 1. Pain location correlated with STIR sequences in 64% and 52%, with gadolinium sequences in 70% and 71%. T1-weighted contrast material-enhanced fat-suppressed spin-echo magnetic resonance sequences improve diagnostic accuracy, diagnostic confidence and correlation of MR abnormalities with pain location in MRI of the foot and ankle. However, the additional value is small. (orig.)

  1. Is there an added value of T1-weighted contrast-enhanced fat-suppressed spin-echo MR sequences compared to STIR sequences in MRI of the foot and ankle?

    Energy Technology Data Exchange (ETDEWEB)

    Zubler, Veronika; Zanetti, Marco; Dietrich, Tobias J.; Pfirrmann, Christian W.; Mamisch-Saupe, Nadja [University of Zurich, Faculty of Medicine, Zurich (Switzerland); Orthopedic University Hospital Balgrist, Department of Radiology, Zurich (Switzerland); Espinosa, Norman [University of Zurich, Faculty of Medicine, Zurich (Switzerland); Orthopedic University Hospital Balgrist, Orthopedic Surgery, Zurich (Switzerland)

    2017-08-15

    To prospectively compare T1-weighted fat-suppressed spin-echo magnetic resonance (MR) sequences after gadolinium application (T1wGdFS) to STIR sequences in patients with acute and chronic foot pain. In 51 patients referred for MRI of the foot and ankle, additional transverse and sagittal T1wGdFS sequences were obtained. Two sets of MR images (standard protocol with STIR or T1wGdFS) were analysed. Diagnosis, diagnostic confidence, and localization of the abnormality were noted. Standard of reference was established by an expert panel of two experienced MSK radiologists and one experienced foot surgeon based on MR images, clinical charts and surgical reports. Patients reported prospectively localization of pain. Descriptive statistics, McNemar test and Kappa test were used. Diagnostic accuracy with STIR protocol was 80% for reader 1, 67% for reader 2, with contrast-protocol 84%, both readers. Significance was found for reader 2. Diagnostic confidence for reader 1 was 1.7 with STIR, 1.3 with contrast-protocol; reader 2: 2.1/1.7. Significance was found for reader 1. Pain location correlated with STIR sequences in 64% and 52%, with gadolinium sequences in 70% and 71%. T1-weighted contrast material-enhanced fat-suppressed spin-echo magnetic resonance sequences improve diagnostic accuracy, diagnostic confidence and correlation of MR abnormalities with pain location in MRI of the foot and ankle. However, the additional value is small. (orig.)

  2. Enhanced Protein Production in Escherichia coli by Optimization of Cloning Scars at the Vector-Coding Sequence Junction

    DEFF Research Database (Denmark)

    Mirzadeh, Kiavash; Martinez, Virginia; Toddo, Stephen

    2015-01-01

    are poorly expressed even when they are codon-optimized and expressed from vectors with powerful genetic elements. In this study, we show that poor expression can be caused by certain nucleotide sequences (e.g., cloning scars) at the junction between the vector and the coding sequence. Since these sequences...

  3. Transcriptional coactivator NT-PGC-1α promotes gluconeogenic gene expression and enhances hepatic gluconeogenesis.

    Science.gov (United States)

    Chang, Ji Suk; Jun, Hee-Jin; Park, Minsung

    2016-10-01

    The transcriptional coactivator PGC-1α plays a central role in hepatic gluconeogenesis. We previously reported that alternative splicing of the PGC-1α gene produces an additional transcript encoding the truncated protein NT-PGC-1α NT-PGC-1α is co-expressed with PGC-1α and highly induced by fasting in the liver. NT-PGC-1α regulates tissue-specific metabolism, but its role in the liver has not been investigated. Thus, the objective of this study was to determine the role of hepatic NT-PGC-1α in the regulation of gluconeogenesis. Adenovirus-mediated expression of NT-PGC-1α in primary hepatocytes strongly stimulated the expression of key gluconeogenic enzyme genes (PEPCK and G6Pase), leading to increased glucose production. To further understand NT-PGC-1α function in hepatic gluconeogenesis in vivo, we took advantage of a previously reported FL-PGC-1α -/- mouse line that lacks full-length PGC-1α (FL-PGC-1α) but retains a slightly shorter and functionally equivalent form of NT-PGC-1α (NT-PGC-1α 254 ). In FL-PGC-1α -/- mice, NT-PGC-1α 254 was induced by fasting in the liver and recruited to the promoters of PEPCK and G6Pase genes. The enrichment of NT-PGC-1α 254 at the promoters was closely associated with fasting-induced increase in PEPCK and G6Pase gene expression and efficient production of glucose from pyruvate during a pyruvate tolerance test in FL-PGC-1α -/- mice. Moreover, FL-PGC-1α -/- primary hepatocytes showed a significant increase in gluconeogenic gene expression and glucose production after treatment with dexamethasone and forskolin, suggesting that NT-PGC-1α 254 is sufficient to stimulate the gluconeogenic program in the absence of FL-PGC-1α Collectively, our findings highlight the role of hepatic NT-PGC-1α in stimulating gluconeogenic gene expression and glucose production. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  4. 1 Outreach, Education and Domestic Market Enhancement 2 Export Promotion and Assistance

    Energy Technology Data Exchange (ETDEWEB)

    Geothermal Energy Association

    2004-03-15

    Geothermal Energy Association supports the US geothermal industry in its efforts to bring more clean geothermal energy on-line throughout the world. Activities designed to accomplish this goal include: (1) developing and maintaining data bases, web pages, (2) commissioning of special studies and reports, (3) preparing, printing and distributing brochures and newsletters, (4) developing exhibits and displays, and participating in trade shows, (5) designing, producing and disseminating audio-video materials, (6) monitoring and coordinating programs carried out by US DOE and other Federal agencies, (7) holding workshops to facilitate communication between researchers and industry and to encourage their recognition of emerging markets for geothermal technology, (8) attending conferences, making speeches and presentation, and otherwise interacting with environmental and other renewable energy organizations and coalitions, (9) hosting events in Washington, DC and other appropriate locations to educate Federal, State and local representatives, environmental groups, the news media, and other about the status and potential of geothermal energy, (10) conducting member services such as the preparation and distribution of a member newsletter related to operating and maintaining s useful and viable association, and (11) performing similar kinds of activities designed to inform others about geothermal energy. The activities of the export promotion aim to assist industry in accomplishing the goal of successfully penetrating and developing energy in country with existing geothermal resources and a desire to develop them. Activities including in export promotion are: (1)needs analysis and assessment involve monitoring the progress of developing markets and projects overseas and working with US industry to determine what future activities by GEA would be of greatest assistance, (2) outreach includes the preparation and dissemination of brochures and videos for foreign professionals

  5. Technical innovation in dynamic contrast-enhanced magnetic resonance imaging of musculoskeletal tumors: an MR angiographic sequence using a sparse k-space sampling strategy.

    Science.gov (United States)

    Fayad, Laura M; Mugera, Charles; Soldatos, Theodoros; Flammang, Aaron; del Grande, Filippo

    2013-07-01

    We demonstrate the clinical use of an MR angiography sequence performed with sparse k-space sampling (MRA), as a method for dynamic contrast-enhanced (DCE)-MRI, and apply it to the assessment of sarcomas for treatment response. Three subjects with sarcomas (2 with osteosarcoma, 1 with high-grade soft tissue sarcomas) underwent MRI after neoadjuvant therapy/prior to surgery, with conventional MRI (T1-weighted, fluid-sensitive, static post-contrast T1-weighted sequences) and DCE-MRI (MRA, time resolution = 7-10 s, TR/TE 2.4/0.9 ms, FOV 40 cm(2)). Images were reviewed by two observers in consensus who recorded image quality (1 = diagnostic, no significant artifacts, 2 = diagnostic, 75 % with good response, >75 % with poor response). DCE-MRI findings were concordant with histological response (arterial enhancement with poor response, no arterial enhancement with good response). Unlike conventional DCE-MRI sequences, an MRA sequence with sparse k-space sampling is easily integrated into a routine musculoskeletal tumor MRI protocol, with high diagnostic quality. In this preliminary work, tumor enhancement characteristics by DCE-MRI were used to assess treatment response.

  6. Technical innovation in dynamic contrast-enhanced magnetic resonance imaging of musculoskeletal tumors: an MR angiographic sequence using a sparse k-space sampling strategy

    International Nuclear Information System (INIS)

    Fayad, Laura M.; Mugera, Charles; Grande, Filippo del; Soldatos, Theodoros; Flammang, Aaron

    2013-01-01

    We demonstrate the clinical use of an MR angiography sequence performed with sparse k-space sampling (MRA), as a method for dynamic contrast-enhanced (DCE)-MRI, and apply it to the assessment of sarcomas for treatment response. Three subjects with sarcomas (2 with osteosarcoma, 1 with high-grade soft tissue sarcomas) underwent MRI after neoadjuvant therapy/prior to surgery, with conventional MRI (T1-weighted, fluid-sensitive, static post-contrast T1-weighted sequences) and DCE-MRI (MRA, time resolution = 7-10 s, TR/TE 2.4/0.9 ms, FOV 40 cm 2 ). Images were reviewed by two observers in consensus who recorded image quality (1 = diagnostic, no significant artifacts, 2 = diagnostic, 75 % with good response, >75 % with poor response). DCE-MRI findings were concordant with histological response (arterial enhancement with poor response, no arterial enhancement with good response). Unlike conventional DCE-MRI sequences, an MRA sequence with sparse k-space sampling is easily integrated into a routine musculoskeletal tumor MRI protocol, with high diagnostic quality. In this preliminary work, tumor enhancement characteristics by DCE-MRI were used to assess treatment response. (orig.)

  7. Glutamate transporter activity promotes enhanced Na+/K+-ATPase -mediated extracellular K+ management during neuronal activity

    DEFF Research Database (Denmark)

    Larsen, Brian R; Holm, Rikke; Vilsen, Bente

    2016-01-01

    , in addition, Na+ /K+ -ATPase-mediated K+ clearance could be governed by astrocytic [Na+ ]i . During most neuronal activity, glutamate is released in the synaptic cleft and is re-absorbed by astrocytic Na+ -coupled glutamate transporters, thereby elevating [Na+ ]i . It thus remains unresolved whether...... the different Na+ /K+ -ATPase isoforms are controlled by [K+ ]o or [Na+ ]i during neuronal activity. Hippocampal slice recordings of stimulus-induced [K+ ]o transients with ion-sensitive microelectrodes revealed reduced Na+ /K+ -ATPase-mediated K+ management upon parallel inhibition of the glutamate transporter......+ affinity to the α1 and α2 isoforms than the β2 isoform. In summary, enhanced astrocytic Na+ /K+ -ATPase-dependent K+ clearance was obtained with parallel glutamate transport activity. The astrocytic Na+ /K+ -ATPase isoform constellation α2β1 appeared to be specifically geared to respond to the [Na+ ]i...

  8. Cow placenta extract promotes murine hair growth through enhancing the insulin - like growth factor-1

    Directory of Open Access Journals (Sweden)

    Dongliang Zhang

    2011-01-01

    Full Text Available Background: Hair loss is seen as an irreversible process. Most research concentrates on how to elongate the anagen, reduce the negative factors of obstructing hair growth and improve the hair number and size. Aim: In our experiment, we tried to prove that the cow placenta extract can promote hair growth by elongating hair shaft and increasing hair follicle number. Materials and Methods: Cow placenta extract (CPE, water and minoxidil applied separately on the back of depilated B57CL/6 mice for the case, negative and positive control respectively. We checked the proliferation of cells which are resident in hair sheath, and the expression of a few growth factors which stimulate hair growth. Results: Result shows that placenta extract more efficiently accelerates cell division and growth factor expression, by raising the insulin-like growth factor (IGF-1 mRNA and protein level to increase HF size and hair length. Conclusions: The extract is not a purified product; so, it is less effective than minoxidil, which is approved by the US FDA for the treatment of male pattern baldness. If refinement is done, the placenta extract would be a good candidate medicine for hair loss.

  9. Complete genome sequence of Bacillus velezensis S3-1, a potential biological pesticide with plant pathogen inhibiting and plant promoting capabilities.

    Science.gov (United States)

    Jin, Qing; Jiang, Qiuyue; Zhao, Lei; Su, Cuizhu; Li, Songshuo; Si, Fangyi; Li, Shanshan; Zhou, Chenhao; Mu, Yonglin; Xiao, Ming

    2017-10-10

    Antagonistic soil microorganisms, which are non-toxic, harmless non-pollutants, can effectively reduce the density of pathogenic species by some ways. Bacillus velezensis strain S3-1 was isolated from the rhizosphere soil of cucumber, and was shown to inhibit plant pathogens, promote plant growth and efficiently colonize rhizosphere soils. The strain produced 13 kinds of lipopeptide antibiotics, belonging to the surfactin, iturin and fengycin families. Here, we presented the complete genome sequence of S3-1. The genome consists of one chromosome without plasmids and also contains the biosynthetic gene cluster that encodes difficidin, macrolactin, surfactin and fengycin. The genome contains 86 tRNA genes, 27 rRNA genes and 57 antibiotic-related genes. The complete genome sequence of B. velezensis S3-1 provides useful information to further detect the molecular mechanisms behind antifungal actions, and will facilitate its potential as a biological pesticide in the agricultural industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Molecular population dynamics of DNA structures in a bcl-2 promoter sequence is regulated by small molecules and the transcription factor hnRNP LL.

    Science.gov (United States)

    Cui, Yunxi; Koirala, Deepak; Kang, HyunJin; Dhakal, Soma; Yangyuoru, Philip; Hurley, Laurence H; Mao, Hanbin

    2014-05-01

    Minute difference in free energy change of unfolding among structures in an oligonucleotide sequence can lead to a complex population equilibrium, which is rather challenging for ensemble techniques to decipher. Herein, we introduce a new method, molecular population dynamics (MPD), to describe the intricate equilibrium among non-B deoxyribonucleic acid (DNA) structures. Using mechanical unfolding in laser tweezers, we identified six DNA species in a cytosine (C)-rich bcl-2 promoter sequence. Population patterns of these species with and without a small molecule (IMC-76 or IMC-48) or the transcription factor hnRNP LL are compared to reveal the MPD of different species. With a pattern recognition algorithm, we found that IMC-48 and hnRNP LL share 80% similarity in stabilizing i-motifs with 60 s incubation. In contrast, IMC-76 demonstrates an opposite behavior, preferring flexible DNA hairpins. With 120-180 s incubation, IMC-48 and hnRNP LL destabilize i-motifs, which has been previously proposed to activate bcl-2 transcriptions. These results provide strong support, from the population equilibrium perspective, that small molecules and hnRNP LL can modulate bcl-2 transcription through interaction with i-motifs. The excellent agreement with biochemical results firmly validates the MPD analyses, which, we expect, can be widely applicable to investigate complex equilibrium of biomacromolecules. © 2014 The Author(s). Published by Oxford University Press [on behalf of Nucleic Acids Research].

  11. Sequencing of IncX-plasmids suggests ubiquity of mobile forms of a biofilm-promoting gene cassette recruited from Klebsiella pneumoniae.

    Directory of Open Access Journals (Sweden)

    Mette Burmølle

    Full Text Available Plasmids are a highly effective means with which genetic traits that influence human health, such as virulence and antibiotic resistance, are disseminated through bacterial populations. The IncX-family is a hitherto sparsely populated group of plasmids that are able to thrive within Enterobacteriaceae. In this study, a replicon-centric screening method was used to locate strains from wastewater sludge containing plasmids belonging to the IncX-family. A transposon aided plasmid capture method was then employed to transport IncX-plasmids from their original hosts (and co-hosted plasmids into a laboratory strain (Escherichia coli Genehogs® for further study. The nucleotide sequences of the three newly isolated IncX-plasmids (pLN126_33, pMO17_54, pMO440_54 and the hitherto un-sequenced type-plasmid R485 revealed a remarkable occurrence of whole or partial gene cassettes that promote biofilm-formation in Klebsiella pneumonia or E. coli, in all four instances. Two of the plasmids (R485 and pLN126_33 were shown to directly induce biofilm formation in a crystal violet retention assay in E. coli. Sequence comparison revealed that all plasmid-borne forms of the type 3 fimbriae encoding gene cassette mrkABCDF were variations of a composite transposon Tn6011 first described in the E. coli IncX plasmid pOLA52. In conclusion, IncX-plasmids isolated from Enterobacteriaceae over almost 40 years and on three different continents have all been shown to carry a type 3 fimbriae gene cassette mrkABCDF stemming from pathogenic K. pneumoniae. Apart from contributing general knowledge about IncX-plasmids, this study also suggests an apparent ubiquity of a mobile form of an important virulence factor and is an illuminating example of the recruitment, evolution and dissemination of genetic traits through plasmid-mediated horizontal gene transfer.

  12. Sequencing of IncX-plasmids suggests ubiquity of mobile forms of a biofilm-promoting gene cassette recruited from Klebsiella pneumoniae.

    Science.gov (United States)

    Burmølle, Mette; Norman, Anders; Sørensen, Søren J; Hansen, Lars Hestbjerg

    2012-01-01

    Plasmids are a highly effective means with which genetic traits that influence human health, such as virulence and antibiotic resistance, are disseminated through bacterial populations. The IncX-family is a hitherto sparsely populated group of plasmids that are able to thrive within Enterobacteriaceae. In this study, a replicon-centric screening method was used to locate strains from wastewater sludge containing plasmids belonging to the IncX-family. A transposon aided plasmid capture method was then employed to transport IncX-plasmids from their original hosts (and co-hosted plasmids) into a laboratory strain (Escherichia coli Genehogs®) for further study. The nucleotide sequences of the three newly isolated IncX-plasmids (pLN126_33, pMO17_54, pMO440_54) and the hitherto un-sequenced type-plasmid R485 revealed a remarkable occurrence of whole or partial gene cassettes that promote biofilm-formation in Klebsiella pneumonia or E. coli, in all four instances. Two of the plasmids (R485 and pLN126_33) were shown to directly induce biofilm formation in a crystal violet retention assay in E. coli. Sequence comparison revealed that all plasmid-borne forms of the type 3 fimbriae encoding gene cassette mrkABCDF were variations of a composite transposon Tn6011 first described in the E. coli IncX plasmid pOLA52. In conclusion, IncX-plasmids isolated from Enterobacteriaceae over almost 40 years and on three different continents have all been shown to carry a type 3 fimbriae gene cassette mrkABCDF stemming from pathogenic K. pneumoniae. Apart from contributing general knowledge about IncX-plasmids, this study also suggests an apparent ubiquity of a mobile form of an important virulence factor and is an illuminating example of the recruitment, evolution and dissemination of genetic traits through plasmid-mediated horizontal gene transfer.

  13. Co-expression of interleukin 12 enhances antitumor effects of a novel chimeric promoter-mediated suicide gene therapy in an immunocompetent mouse model

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Yu, E-mail: xuyu1001@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liu, Zhengchun, E-mail: l135027@126.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Kong, Haiyan, E-mail: suppleant@163.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Sun, Wenjie, E-mail: wendy11240325@163.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liao, Zhengkai, E-mail: fastbeta@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Zhou, Fuxiang, E-mail: happyzhoufx@sina.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Xie, Conghua, E-mail: chxie_65@hotmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); and others

    2011-09-09

    Highlights: {yields} A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. {yields} The promoter was characterized with radiation-inducibility and tumor-specificity. {yields} Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. {yields} Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.

  14. Co-expression of interleukin 12 enhances antitumor effects of a novel chimeric promoter-mediated suicide gene therapy in an immunocompetent mouse model

    International Nuclear Information System (INIS)

    Xu, Yu; Liu, Zhengchun; Kong, Haiyan; Sun, Wenjie; Liao, Zhengkai; Zhou, Fuxiang; Xie, Conghua

    2011-01-01

    Highlights: → A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. → The promoter was characterized with radiation-inducibility and tumor-specificity. → Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. → Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.

  15. University and community partnerships in South Sulawesi, Indonesia: Enhancing community capacity and promoting democratic governance

    Directory of Open Access Journals (Sweden)

    Sri Mastuti

    2014-06-01

    Full Text Available South Sulawesi is a province in Indonesia where the majority of the population is Muslim, with many variant interpretations of Islam. Alauddin State Islamic University is not just a place for teaching and study but also plays a role in helping to unify the differences among these different Islamic groups. Its changing of status from institute to university in 2005, and later the support of the Canadian-assisted SILE Project beginning in 2010, have made this university an example of reform in the way it implements its functions. Since 2011, Alauddin State Islamic University has been developing a new approach in university-community outreach/engagement. What was formerly separated between teaching, research and community service is now linked under one institutional umbrella. The new university-community outreach approach has also adopted some new tools like Asset Based Community Development (ABCD and Results Based Management (RBM. It seeks to promote democratic governance, gender equality and a sustainable environment. The university also works in partnership with civil society organisations (CSOs in South Sulawesi, including Islamic-based organizsations, secular organisations and women’s organisations. The model for the partnership is a working group (abbreviated to pokja in Indonesian, which comprises lecturers from a faculty in the university and members of a CSO. We discuss the opportunities and challenges faced by these working groups. Opportunities include increased advantages from pooling their organisational capacities and experience in working with communities. Sharing their networks and resources makes them stronger and makes their work more sustainable. The challenge lies in changing the mindset from a needs-based, project-oriented approach to an asset-based facilitative approach, comprehending the tools, managing time to work together and building effective teamwork. Keywords: university-community outreach, democratic governance

  16. Enhanced Heme Function and Mitochondrial Respiration Promote the Progression of Lung Cancer Cells

    Science.gov (United States)

    Alam, Md Maksudul; Shah, Ajit; Cao, Thai M.; Sullivan, Laura A.; Brekken, Rolf; Zhang, Li

    2013-01-01

    Lung cancer is the leading cause of cancer-related mortality, and about 85% of the cases are non-small-cell lung cancer (NSCLC). Importantly, recent advance in cancer research suggests that altering cancer cell bioenergetics can provide an effective way to target such advanced cancer cells that have acquired mutations in multiple cellular regulators. This study aims to identify bioenergetic alterations in lung cancer cells by directly measuring and comparing key metabolic activities in a pair of cell lines representing normal and NSCLC cells developed from the same patient. We found that the rates of oxygen consumption and heme biosynthesis were intensified in NSCLC cells. Additionally, the NSCLC cells exhibited substantially increased levels in an array of proteins promoting heme synthesis, uptake and function. These proteins include the rate-limiting heme biosynthetic enzyme ALAS, transporter proteins HRG1 and HCP1 that are involved in heme uptake, and various types of oxygen-utilizing hemoproteins such as cytoglobin and cytochromes. Several types of human tumor xenografts also displayed increased levels of such proteins. Furthermore, we found that lowering heme biosynthesis and uptake, like lowering mitochondrial respiration, effectively reduced oxygen consumption, cancer cell proliferation, migration and colony formation. In contrast, lowering heme degradation does not have an effect on lung cancer cells. These results show that increased heme flux and function are a key feature of NSCLC cells. Further, increased generation and supply of heme and oxygen-utilizing hemoproteins in cancer cells will lead to intensified oxygen consumption and cellular energy production by mitochondrial respiration, which would fuel cancer cell proliferation and progression. The results show that inhibiting heme and respiratory function can effectively arrest the progression of lung cancer cells. Hence, understanding heme function can positively impact on research in lung cancer

  17. Contribution for new genetic markers of rheumatoid arthritis activity and severity: sequencing of the tumor necrosis factor-alpha gene promoter.

    Science.gov (United States)

    Fonseca, João Eurico; Cavaleiro, João; Teles, José; Sousa, Elsa; Andreozzi, Valeska L; Antunes, Marília; Amaral-Turkman, Maria A; Canhão, Helena; Mourão, Ana F; Lopes, Joana; Caetano-Lopes, Joana; Weinmann, Pamela; Sobral, Marta; Nero, Patrícia; Saavedra, Maria J; Malcata, Armando; Cruz, Margarida; Melo, Rui; Braña, Araceli; Miranda, Luis; Patto, José V; Barcelos, Anabela; da Silva, José Canas; Santos, Luís M; Figueiredo, Guilherme; Rodrigues, Mário; Jesus, Herberto; Quintal, Alberto; Carvalho, Teresa; da Silva, José A Pereira; Branco, Jaime; Queiroz, Mário Viana

    2007-01-01

    The objective of this study was to assess whether clinical measures of rheumatoid arthritis activity and severity were influenced by tumor necrosis factor-alpha (TNF-alpha) promoter genotype/haplotype markers. Each patient's disease activity was assessed by the disease activity score using 28 joint counts (DAS28) and functional capacity by the Health Assessment Questionnaire (HAQ) score. Systemic manifestations, radiological damage evaluated by the Sharp/van der Heijde (SvdH) score, disease-modifying anti-rheumatic drug use, joint surgeries, and work disability were also assessed. The promoter region of the TNF-alpha gene, between nucleotides -1,318 and +49, was sequenced using an automated platform. Five hundred fifty-four patients were evaluated and genotyped for 10 single-nucleotide polymorphism (SNP) markers, but 5 of these markers were excluded due to failure to fall within Hardy-Weinberg equilibrium or to monomorphism. Patients with more than 10 years of disease duration (DD) presented significant associations between the -857 SNP and systemic manifestations, as well as joint surgeries. Associations were also found between the -308 SNP and work disability in patients with more than 2 years of DD and radiological damage in patients with less than 10 years of DD. A borderline effect was found between the -238 SNP and HAQ score and radiological damage in patients with 2 to 10 years of DD. An association was also found between haplotypes and the SvdH score for those with more than 10 years of DD. An association was found between some TNF-alpha promoter SNPs and systemic manifestations, radiological progression, HAQ score, work disability, and joint surgeries, particularly in some classes of DD and between haplotypes and radiological progression for those with more than 10 years of DD.

  18. Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Margarida Carrolo

    Full Text Available Streptococcus pneumoniae (pneumococcus is able to form biofilms in vivo and previous studies propose that pneumococcal biofilms play a relevant role both in colonization and infection. Additionally, pneumococci recovered from human infections are characterized by a high prevalence of lysogenic bacteriophages (phages residing quiescently in their host chromosome. We investigated a possible link between lysogeny and biofilm formation. Considering that extracellular DNA (eDNA is a key factor in the biofilm matrix, we reasoned that prophage spontaneous activation with the consequent bacterial host lysis could provide a source of eDNA, enhancing pneumococcal biofilm development. Monitoring biofilm growth of lysogenic and non-lysogenic pneumococcal strains indicated that phage-infected bacteria are more proficient at forming biofilms, that is their biofilms are characterized by a higher biomass and cell viability. The presence of phage particles throughout the lysogenic strains biofilm development implicated prophage spontaneous induction in this effect. Analysis of lysogens deficient for phage lysin and the bacterial major autolysin revealed that the absence of either lytic activity impaired biofilm development and the addition of DNA restored the ability of mutant strains to form robust biofilms. These findings establish that limited phage-mediated host lysis of a fraction of the bacterial population, due to spontaneous phage induction, constitutes an important source of eDNA for the S. pneumoniae biofilm matrix and that this localized release of eDNA favors biofilm formation by the remaining bacterial population.

  19. Extrinsic factors promoting insulin producing cell-differentiation and insulin expression enhancement-hope for diabetics.

    Science.gov (United States)

    Dave, Shruti

    2013-11-01

    Diabetes mellitus (DM) is considered to be an autoimmune disorder leading to destruction of beta-cells resulting in to a loss of blood sugar control. Attempts using many pharmacological compositions including exogenous insulin have failed to show tight control of glycemia and associated manifestations. Stem cells are considered a potential tool for the supply of insulin-producing cells (IPC) generation in vitro. Stem cell differentiation in to pancreatic lineages requires influence of both intrinsic and extrinsic factors. Application of islet growth factors is considered to be potential for enhancement of beta-cell replication, function and survival. Use of certain extrinsic factors is known to facilitate expression of transcription factors known to be important for beta-cell differentiation and production of insulin enabling IPC generation. Hierarchies of secreted signals and transcription factors have been identified by studies from several laboratories that guide cell differentiation in to IPC. This knowledge provides insights for in vitro IPC differentiation from stem cells. Current advancement in medical knowledge promises an insulin independency for DM patients. The review sheds light on few specific extrinsic factors which facilitate differentiation of stem cells in to IPC in vitro have been discussed; which can be proven as a potential therapeutic option for treatment of DM and associated diseases.

  20. BAMBI Promotes C2C12 Myogenic Differentiation by Enhancing Wnt/β-Catenin Signaling

    Directory of Open Access Journals (Sweden)

    Qiangling Zhang

    2015-08-01

    Full Text Available Bone morphogenic protein and activin membrane-bound inhibitor (BAMBI is regarded as an essential regulator of cell proliferation and differentiation that represses transforming growth factor-β and enhances Wnt/β-catenin signaling in various cell types. However, its role in skeletal muscle remains largely unknown. In the current study, we found that the expression level of BAMBI peaked in the early differentiation phase of the C2C12 rodent myoblast cell line. Knockdown of BAMBI via siRNA inhibited C2C12 differentiation, indicated by repressed MyoD, MyoG, and MyHC expression as well as reductions in the differentiation and fusion indices. BAMBI knockdown reduced the activity of Wnt/β-catenin signaling, as characterized by the decreased nuclear translocation of β-catenin and the lowered transcription of Axin2, which is a well-documented target gene of the Wnt/β-catenin signaling pathway. Furthermore, treatment with LiCl, an activator of Wnt/β-catenin signaling, rescued the reduction in C2C12 differentiation caused by BAMBI siRNA. Taken together, our data suggest that BAMBI is required for normal C2C12 differentiation, and that its role in myogenesis is mediated by the Wnt/β-catenin pathway.

  1. HMGB1 Promotes Systemic Lupus Erythematosus by Enhancing Macrophage Inflammatory Response

    Directory of Open Access Journals (Sweden)

    Mudan Lu

    2015-01-01

    Full Text Available Background/Purpose. HMGB1, which may act as a proinflammatory mediator, has been proposed to contribute to the pathogenesis of multiple chronic inflammatory and autoimmune diseases including systemic lupus erythematosus (SLE; however, the precise mechanism of HMGB1 in the pathogenic process of SLE remains obscure. Method. The expression of HMGB1 was measured by ELISA and western blot. The ELISA was also applied to detect proinflammatory cytokines levels. Furthermore, nephritic pathology was evaluated by H&E staining of renal tissues. Results. In this study, we found that HMGB1 levels were significantly increased and correlated with SLE disease activity in both clinical patients and murine model. Furthermore, gain- and loss-of-function analysis showed that HMGB1 exacerbated the severity of SLE. Of note, the HMGB1 levels were found to be associated with the levels of proinflammatory cytokines such as TNF-α and IL-6 in SLE patients. Further study demonstrated that increased HMGB1 expression deteriorated the severity of SLE via enhancing macrophage inflammatory response. Moreover, we found that receptor of advanced glycation end products played a critical role in HMGB1-mediated macrophage inflammatory response. Conclusion. These findings suggested that HMGB1 might be a risk factor for SLE, and manipulation of HMGB1 signaling might provide a therapeutic strategy for SLE.

  2. A Sparsity-Promoted Method Based on Majorization-Minimization for Weak Fault Feature Enhancement.

    Science.gov (United States)

    Ren, Bangyue; Hao, Yansong; Wang, Huaqing; Song, Liuyang; Tang, Gang; Yuan, Hongfang

    2018-03-28

    Fault transient impulses induced by faulty components in rotating machinery usually contain substantial interference. Fault features are comparatively weak in the initial fault stage, which renders fault diagnosis more difficult. In this case, a sparse representation method based on the Majorzation-Minimization (MM) algorithm is proposed to enhance weak fault features and extract the features from strong background noise. However, the traditional MM algorithm suffers from two issues, which are the choice of sparse basis and complicated calculations. To address these challenges, a modified MM algorithm is proposed in which a sparse optimization objective function is designed firstly. Inspired by the Basis Pursuit (BP) model, the optimization function integrates an impulsive feature-preserving factor and a penalty function factor. Second, a modified Majorization iterative method is applied to address the convex optimization problem of the designed function. A series of sparse coefficients can be achieved through iterating, which only contain transient components. It is noteworthy that there is no need to select the sparse basis in the proposed iterative method because it is fixed as a unit matrix. Then the reconstruction step is omitted, which can significantly increase detection efficiency. Eventually, envelope analysis of the sparse coefficients is performed to extract weak fault features. Simulated and experimental signals including bearings and gearboxes are employed to validate the effectiveness of the proposed method. In addition, comparisons are made to prove that the proposed method outperforms the traditional MM algorithm in terms of detection results and efficiency.

  3. Enhancing excitability of dopamine neurons promotes motivational behaviour through increased action initiation.

    Science.gov (United States)

    Boekhoudt, Linde; Wijbrans, Ellen C; Man, Jodie H K; Luijendijk, Mieneke C M; de Jong, Johannes W; van der Plasse, Geoffrey; Vanderschuren, Louk J M J; Adan, Roger A H

    2018-01-01

    Motivational deficits are a key symptom in multiple psychiatric disorders, including major depressive disorder, schizophrenia and addiction. A likely neural substrate for these motivational deficits is the brain dopamine (DA) system. In particular, DA signalling in the nucleus accumbens, which originates from DA neurons in the ventral tegmental area (VTA), has been identified as a crucial substrate for effort-related and activational aspects of motivation. Unravelling how VTA DA neuronal activity relates to motivational behaviours is required to understand how motivational deficits in psychiatry can be specifically targeted. In this study, we therefore used designer receptors exclusively activated by designer drugs (DREADD) in TH:Cre rats, in order to determine the effects of chemogenetic DA neuron activation on different aspects of motivational behaviour. We found that chemogenetic activation of DA neurons in the VTA, but not substantia nigra, significantly increased responding for sucrose under a progressive ratio schedule of reinforcement. More specifically, high effort exertion was characterized by increased initiations of reward-seeking actions. This effect was dependent on effort requirements and instrumental contingencies, but was not affected by sucrose pre-feeding. Together, these findings indicate that VTA DA neuronal activation drives motivational behaviour by facilitating action initiation. With this study, we show that enhancing excitability of VTA DA neurons is a viable strategy to improve motivational behaviour. Copyright © 2017 Elsevier B.V. and ECNP. All rights reserved.

  4. Overexpression of plasma membrane H+-ATPase in guard cells promotes light-induced stomatal opening and enhances plant growth.

    Science.gov (United States)

    Wang, Yin; Noguchi, Ko; Ono, Natsuko; Inoue, Shin-ichiro; Terashima, Ichiro; Kinoshita, Toshinori

    2014-01-07

    Stomatal pores surrounded by a pair of guard cells in the plant epidermis control gas exchange between plants and the atmosphere in response to light, CO2, and the plant hormone abscisic acid. Light-induced stomatal opening is mediated by at least three key components: the blue light receptor phototropin (phot1 and phot2), plasma membrane H(+)-ATPase, and plasma membrane inward-rectifying K(+) channels. Very few attempts have been made to enhance stomatal opening with the goal of increasing photosynthesis and plant growth, even though stomatal resistance is thought to be the major limiting factor for CO2 uptake by plants. Here, we show that transgenic Arabidopsis plants overexpressing H(+)-ATPase using the strong guard cell promoter GC1 showed enhanced light-induced stomatal opening, photosynthesis, and plant growth. The transgenic plants produced larger and increased numbers of rosette leaves, with ∼42-63% greater fresh and dry weights than the wild type in the first 25 d of growth. The dry weights of total flowering stems of 45-d-old transgenic plants, including seeds, siliques, and flowers, were ∼36-41% greater than those of the wild type. In addition, stomata in the transgenic plants closed normally in response to darkness and abscisic acid. In contrast, the overexpression of phototropin or inward-rectifying K(+) channels in guard cells had no effect on these phenotypes. These results demonstrate that stomatal aperture is a limiting factor in photosynthesis and plant growth, and that manipulation of stomatal opening by overexpressing H(+)-ATPase in guard cells is useful for the promotion of plant growth.

  5. Finding Sales Promotion and Making Decision for New Product Based on Group Analysis of Edge-Enhanced Product Networks

    Science.gov (United States)

    Huang, Yi; Tan, Jianbin; Wu, Bin

    A novel method is proposed in this paper to find the promotive relationship of products from a network point of view. Firstly, a product network is built based on the dataset of handsets’ sale information collected from all outlets of a telecom operator of one province of China, with a period from Jan. 2006 to Jul. 2008. Then the edge enhanced model is applied on product network to divide all the products into several groups, according to which each outlet is assigned to class A or class B for a certain handset. Class A is defined as the outlet which sell the certain handset and contains all of handsets of its group, while other situation for class B which sell the certain handset too. It’s shown from the result of analysis on these two kinds of outlets that many handsets are sold better in outlets of class A than that of class B, even though the sales revenue of all these outlets in the time period is close. That is to say the handsets within a group would promote the sale for each other. Furthermore, a method proposed in this paper gives a way to find out the important attributes of the handsets which lead them to br divided into the same group, and it also explains how to add a new handset to an existing group and where would the new handset be sold best.

  6. Plant growth-promoting actinobacteria: a new strategy for enhancing sustainable production and protection of grain legumes.

    Science.gov (United States)

    Sathya, Arumugam; Vijayabharathi, Rajendran; Gopalakrishnan, Subramaniam

    2017-06-01

    Grain legumes are a cost-effective alternative for the animal protein in improving the diets of the poor in South-East Asia and Africa. Legumes, through symbiotic nitrogen fixation, meet a major part of their own N demand and partially benefit the following crops of the system by enriching soil. In realization of this sustainability advantage and to promote pulse production, United Nations had declared 2016 as the "International Year of pulses". Grain legumes are frequently subjected to both abiotic and biotic stresses resulting in severe yield losses. Global yields of legumes have been stagnant for the past five decades in spite of adopting various conventional and molecular breeding approaches. Furthermore, the increasing costs and negative effects of pesticides and fertilizers for crop production necessitate the use of biological options of crop production and protection. The use of plant growth-promoting (PGP) bacteria for improving soil and plant health has become one of the attractive strategies for developing sustainable agricultural systems due to their eco-friendliness, low production cost and minimizing consumption of non-renewable resources. This review emphasizes on how the PGP actinobacteria and their metabolites can be used effectively in enhancing the yield and controlling the pests and pathogens of grain legumes.

  7. Genetic Ablation of miR-33 Increases Food Intake, Enhances Adipose Tissue Expansion, and Promotes Obesity and Insulin Resistance

    Directory of Open Access Journals (Sweden)

    Nathan L. Price

    2018-02-01

    Full Text Available While therapeutic modulation of miRNAs provides a promising approach for numerous diseases, the promiscuous nature of miRNAs raises concern over detrimental off-target effects. miR-33 has emerged as a likely target for treatment of cardiovascular diseases. However, the deleterious effects of long-term anti-miR-33 therapies and predisposition of miR-33−/− mice to obesity and metabolic dysfunction exemplify the possible pitfalls of miRNA-based therapies. Our work provides an in-depth characterization of miR-33−/− mice and explores the mechanisms by which loss of miR-33 promotes insulin resistance in key metabolic tissues. Contrary to previous reports, our data do not support a direct role for SREBP-1-mediated lipid synthesis in promoting these effects. Alternatively, in adipose tissue of miR-33−/− mice, we observe increased pre-adipocyte proliferation, enhanced lipid uptake, and impaired lipolysis. Moreover, we demonstrate that the driving force behind these abnormalities is increased food intake, which can be prevented by pair feeding with wild-type animals.

  8. The ABA receptor PYL8 promotes lateral root growth by enhancing MYB77-dependent transcription of auxin-responsive genes.

    Science.gov (United States)

    Zhao, Yang; Xing, Lu; Wang, Xingang; Hou, Yueh-Ju; Gao, Jinghui; Wang, Pengcheng; Duan, Cheng-Guo; Zhu, Xiaohong; Zhu, Jian-Kang

    2014-06-03

    The phytohormone abscisic acid (ABA) regulates plant growth, development, and abiotic stress responses. ABA signaling is mediated by a group of receptors known as the PYR1/PYL/RCAR family, which includes the pyrabactin resistance 1-like protein PYL8. Under stress conditions, ABA signaling activates SnRK2 protein kinases to inhibit lateral root growth after emergence from the primary root. However, even in the case of persistent stress, lateral root growth eventually recovers from inhibition. We showed that PYL8 is required for the recovery of lateral root growth, following inhibition by ABA. PYL8 directly interacted with the transcription factors MYB77, MYB44, and MYB73. The interaction of PYL8 and MYB77 increased the binding of MYB77 to its target MBSI motif in the promoters of multiple auxin-responsive genes. Compared to wild-type seedlings, the lateral root growth of pyl8 mutant seedlings and myb77 mutant seedlings was more sensitive to inhibition by ABA. The recovery of lateral root growth was delayed in pyl8 mutant seedlings in the presence of ABA, and the defect was rescued by exposing pyl8 mutant seedlings to the auxin IAA (3-indoleacetic acid). Thus, PYL8 promotes lateral root growth independently of the core ABA-SnRK2 signaling pathway by enhancing the activities of MYB77 and its paralogs, MYB44 and MYB73, to augment auxin signaling. Copyright © 2014, American Association for the Advancement of Science.

  9. HMGB1 exacerbates experimental mouse colitis by enhancing innate lymphoid cells 3 inflammatory responses via promoted IL-23 production.

    Science.gov (United States)

    Chen, Xiangyu; Li, Lingyun; Khan, Muhammad Noman; Shi, Lifeng; Wang, Zhongyan; Zheng, Fang; Gong, Feili; Fang, Min

    2016-11-01

    In inflammatory bowel diseases (IBD), high mobility group box 1 (HMGB1), as an endogenous inflammatory molecule, can promote inflammatory cytokines secretion by acting on TLR2/4 resulting in tissue damage. The underlying mechanisms remain unclear. Here we report a novel role of HMGB1 in controlling the maintenance and function of intestine-resident group-3 innate lymphoid cells (ILC3s) that are important innate effector cells implicated in mucosal homeostasis and IBD pathogenesis. We showed that mice treated with anti-HMGB1 Ab, or genetically deficient for TLR2 -/- or TLR4 -/- mice, displayed reduced intestinal inflammation. In these mice, the numbers of colonic ILC3s were significantly reduced, and the levels of IL-17 and IL-22 that can be secreted by ILC3s were also decreased in the colon tissues. Furthermore, HMGB1 promoted DCs via TLR2/4 signaling to produce IL-23, activating ILC3s to produce IL-17 and IL-22. Our data thus indicated that the HMGB1-TLR2/4-DCs-IL-23 cascade pathway enhances the functions of ILC3s to produce IL-17 and IL-22, and this signal way might play a vital role in the development of IBD.

  10. Enhanced M1/M2 macrophage ratio promotes orthodontic root resorption.

    Science.gov (United States)

    He, D; Kou, X; Luo, Q; Yang, R; Liu, D; Wang, X; Song, Y; Cao, H; Zeng, M; Gan, Y; Zhou, Y

    2015-01-01

    Mechanical force-induced orthodontic root resorption is a major clinical challenge in orthodontic treatment. Macrophages play an important role in orthodontic root resorption, but the underlying mechanism remains unclear. In this study, we examined the mechanism by which the ratio of M1 to M2 macrophage polarization affects root resorption during orthodontic tooth movement. Root resorption occurred when nickel-titanium coil springs were applied on the upper first molars of rats for 3 to 14 d. Positively stained odontoclasts or osteoclasts with tartrate-resistant acid phosphatase were found in resorption areas. Meanwhile, M1-like macrophages positive for CD68 and inducible nitric oxide synthase (iNOS) persistently accumulated on the compression side of periodontal tissues. In addition, the expressions of the M1 activator interferon-γ and the M1-associated pro-inflammatory cytokine tumor necrosis factor (TNF)-α were upregulated on the compression side of periodontal tissues. When the coil springs were removed at the 14th day after orthodontic force application, root resorption was partially rescued. The number of CD68(+)CD163(+) M2-like macrophages gradually increased on the compression side of periodontal tissues. The levels of M2 activator interleukin (IL)-4 and the M2-associated anti-inflammatory cytokine IL-10 also increased. Systemic injection of the TNF-α inhibitor etanercept or IL-4 attenuated the severity of root resorption and decreased the ratio of M1 to M2 macrophages. These data imply that the balance between M1 and M2 macrophages affects orthodontic root resorption. Root resorption was aggravated by an enhanced M1/M2 ratio but was partially rescued by a reduced M1/M2 ratio. © International & American Associations for Dental Research 2014.

  11. Promoter-enhancer interactions identified from Hi-C data using probabilistic models and hierarchical topological domains.

    Science.gov (United States)

    Ron, Gil; Globerson, Yuval; Moran, Dror; Kaplan, Tommy

    2017-12-21

    Proximity-ligation methods such as Hi-C allow us to map physical DNA-DNA interactions along the genome, and reveal its organization into topologically associating domains (TADs). As the Hi-C data accumulate, computational methods were developed for identifying domain borders in multiple cell types and organisms. Here, we present PSYCHIC, a computational approach for analyzing Hi-C data and identifying promoter-enhancer interactions. We use a unified probabilistic model to segment the genome into domains, which we then merge hierarchically and fit using a local background model, allowing us to identify over-represented DNA-DNA interactions across the genome. By analyzing the published Hi-C data sets in human and mouse, we identify hundreds of thousands of putative enhancers and their target genes, and compile an extensive genome-wide catalog of gene regulation in human and mouse. As we show, our predictions are highly enriched for ChIP-seq and DNA accessibility data, evolutionary conservation, eQTLs and other DNA-DNA interaction data.

  12. Bacillus pumilus ES4: candidate plant growth-promoting bacterium to enhance establishment of plants in mine tailings

    Science.gov (United States)

    de-Bashan, Luz E.; Hernandez, Juan-Pablo; Bashan, Yoav; Maier, Raina

    2014-01-01

    Three plant growth-promoting bacteria (PGPB; Bacillus pumilus ES4, B. pumilus RIZO1, and Azospirillum brasilense Cd) were tested for their ability to enhance plant growth and development of the native Sonoran Desert shrub quailbush (Atriplex lentiformis) and for their effect on the native bacterial community in moderately acidic, high-metal content (AHMT) and in neutral, low metal content natural tailings (NLMT) in controlled greenhouse experiments. Inoculation of quailbush with all three PGPB significantly enhanced plant growth parameters, such as germination, root length, dry weight of shoots and roots, and root/shoot ratio in both types of tailings. The effect of inoculation on the indigenous bacterial community by the most successful PGPB Bacillus pumilus ES4 was evaluated by denaturating gradient gel electrophoresis (PCR-DGGE) fingerprinting and root colonization was followed by specific fluorescent in situ hybridization (FISH). Inoculation with this strain significantly changed the bacterial community over a period of 60 days. FISH analysis showed that the preferred site of colonization was the root tips and root elongation area. This study shows that inoculation of native perennial plants with PGPB can be used for developing technologies for phytostabilizing mine tailings. PMID:25009362

  13. Dipalmitoleoylphosphoethanolamine as a PP2A enhancer obstructs insulin signaling by promoting Ser/Thr dephosphorylation of Akt.

    Science.gov (United States)

    Tsuchiya, Ayako; Kanno, Takeshi; Nishizaki, Tomoyuki

    2014-01-01

    The phospholipid phosphatidylethanolamine is implicated in the regulation of a variety of cellular processes. The present study investigated the effect of phosphatidylethanolamines such as 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE), 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine (DLPE), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and 1,2-dipalmitoleoyl-sn-glycero-3-phosphoethanolamine (DPPE) on protein phosphatases, Akt1/2 activity, GLUT4 mobilizations, and glucose uptake into cells. Activity of protein phosphatase 2A (PP2A) was assayed under the cell-free conditions, and Western blotting, intracellular GLUT4 trafficking, and glucose uptake into cells were monitored using differentiated 3T3-L1-GLUT4myc adipocytes. Of the investigated phosphatidylethanolamines, DLPE and DPPE significantly enhanced PP2A activity. DPPE inhibited insulin-induced phosphorylation of Akt1/2 at Thr308/309 and Ser473/474 in differentiated 3T3-L1-GLUT4myc adipocytes. DPPE also inhibited insulin-stimulated GLUT4 translocation to the cell surface and reduced insulin-stimulated glucose uptake into adipocytes. The results of the present study indicate that the PP2A enhancer DPPE obstructs insulin signaling by promoting serine/threonine dephosphorylation of Akt1/2, resulting in the suppression of GLUT4 translocation to the cell surface and glucose uptake into adipocytes. © 2014 S. Karger AG, Basel.

  14. Dipalmitoleoylphosphoethanolamine as a PP2A Enhancer Obstructs Insulin Signaling by Promoting Ser/Thr Dephosphorylation of Akt

    Directory of Open Access Journals (Sweden)

    Ayako Tsuchiya

    2014-08-01

    Full Text Available Background/Aims: The phospholipid phosphatidylethanolamine is implicated in the regulation of a variety of cellular processes. The present study investigated the effect of phosphatidylethanolamines such as 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine (DLPE, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE, and 1,2-dipalmitoleoyl-sn-glycero-3-phosphoethanolamine (DPPE on protein phosphatases, Akt1/2 activity, GLUT4 mobilizations, and glucose uptake into cells. Methods: Activity of protein phosphatase 2A (PP2A was assayed under the cell-free conditions, and Western blotting, intracellular GLUT4 trafficking, and glucose uptake into cells were monitored using differentiated 3T3-L1-GLUT4myc adipocytes. Results: Of the investigated phosphatidylethanolamines, DLPE and DPPE significantly enhanced PP2A activity. DPPE inhibited insulin-induced phosphorylation of Akt1/2 at Thr308/309 and Ser473/474 in differentiated 3T3-L1-GLUT4myc adipocytes. DPPE also inhibited insulin-stimulated GLUT4 translocation to the cell surface and reduced insulin-stimulated glucose uptake into adipocytes. Conclusion: The results of the present study indicate that the PP2A enhancer DPPE obstructs insulin signaling by promoting serine/threonine dephosphorylation of Akt1/2, resulting in the suppression of GLUT4 translocation to the cell surface and glucose uptake into adipocytes.

  15. Oncogenic IDH1 Mutations Promote Enhanced Proline Synthesis through PYCR1 to Support the Maintenance of Mitochondrial Redox Homeostasis

    Directory of Open Access Journals (Sweden)

    Kate E.R. Hollinshead

    2018-03-01

    Full Text Available Summary: Since the discovery of mutations in isocitrate dehydrogenase 1 (IDH1 in gliomas and other tumors, significant efforts have been made to gain a deeper understanding of the consequences of this oncogenic mutation. One aspect of the neomorphic function of the IDH1 R132H enzyme that has received less attention is the perturbation of cellular redox homeostasis. Here, we describe a biosynthetic pathway exhibited by cells expressing mutant IDH1. By virtue of a change in cellular redox homeostasis, IDH1-mutated cells synthesize excess glutamine-derived proline through enhanced activity of pyrroline 5-carboxylate reductase 1 (PYCR1, coupled to NADH oxidation. Enhanced proline biosynthesis partially uncouples the electron transport chain from tricarboxylic acid (TCA cycle activity through the maintenance of a lower NADH/NAD+ ratio and subsequent reduction in oxygen consumption. Thus, we have uncovered a mechanism by which tumor cell survival may be promoted in conditions associated with perturbed redox homeostasis, as occurs in IDH1-mutated glioma. : Hollinshead et al. demonstrate a role for PYCR1 in control of mitochondrial redox homeostasis. Expression of IDH1 R132H mutation leads to increased NADH-coupled proline biosynthesis, mediated by PYCR1. The resulting metabolic phenotype partially uncouples mitochondrial NADH oxidation from respiration, representing an oxygen-sparing metabolic phenotype. Keywords: glioma, IDH1, redox, metabolism, proline

  16. Combined use of alkane-degrading and plant growth-promoting bacteria enhanced phytoremediation of diesel contaminated soil.

    Science.gov (United States)

    Tara, Nain; Afzal, Muhammad; Ansari, Tariq M; Tahseen, Razia; Iqbal, Samina; Khan, Qaiser M

    2014-01-01

    Inoculation of plants with pollutant-degrading and plant growth-promoting microorganisms is a simple strategy to enhance phytoremediation activity. The objective of this study was to determine the effect of inoculation of different bacterial strains, possessing alkane-degradation and 1-amino-cyclopropane-1 -carboxylic acid (ACC) deaminase activity, on plant growth and phytoremediation activity. Carpet grass (Axonopus affinis) was planted in soil spiked with diesel (1% w/w) for 90 days and inoculated with different bacterial strains, Pseudomonas sp. ITRH25, Pantoea sp. BTRH79 and Burkholderia sp. PsJN, individually and in combination. Generally, bacterial application increased total numbers of culturable hydrocarbon-degrading bacteria in the rhizosphere ofcarpet grass, plant biomass production, hydrocarbon degradation and reduced genotoxicity. Bacterial strains possessing different beneficial traits affect plant growth and phytoremediation activity in different ways. Maximum bacterial population, plant biomass production and hydrocarbon degradation were achieved when carpet grass was inoculated with a consortium of three strains. Enhanced plant biomass production and hydrocarbon degradation were associated with increased numbers of culturable hydrocarbon-degrading bacteria in the rhizosphere of carpet grass. The present study revealed that the combined use of different bacterial strains, exhibiting different beneficial traits, is a highly effective strategy to improve plant growth and phytoremediation activity.

  17. Chronic ethanol feeding promotes azoxymethane and dextran sulfate sodium-induced colonic tumorigenesis potentially by enhancing mucosal inflammation

    International Nuclear Information System (INIS)

    Shukla, Pradeep K.; Chaudhry, Kamaljit K.; Mir, Hina; Gangwar, Ruchika; Yadav, Nikki; Manda, Bhargavi; Meena, Avtar S.; Rao, RadhaKrishna

    2016-01-01

    Alcohol consumption is one of the major risk factors for colorectal cancer. However, the mechanism involved in this effect of alcohol is unknown. We evaluated the effect of chronic ethanol feeding on azoxymethane and dextran sulfate sodium (AOM/DSS)-induced carcinogenesis in mouse colon. Inflammation in colonic mucosa was assessed at a precancerous stage by evaluating mucosal infiltration of neutrophils and macrophages, and analysis of cytokine and chemokine gene expression. Chronic ethanol feeding significantly increased the number and size of polyps in colon of AOM/DSS treated mice. Confocal microscopic and immunoblot analyses showed a significant elevation of phospho-Smad, VEGF and HIF1α in the colonic mucosa. RT-PCR analysis at a precancerous stage indicated that ethanol significantly increases the expression of cytokines IL-1α, IL-6 and TNFα, and the chemokines CCL5/RANTES, CXCL9/MIG and CXCL10/IP-10 in the colonic mucosa of AOM/DSS treated mice. Confocal microscopy showed that ethanol feeding induces a dramatic elevation of myeloperoxidase, Gr1 and CD68-positive cells in the colonic mucosa of AOM/DSS-treated mice. Ethanol feeding enhanced AOM/DSS-induced suppression of tight junction protein expression and elevated cell proliferation marker, Ki-67 in the colonic epithelium. This study demonstrates that chronic ethanol feeding promotes colonic tumorigenesis potentially by enhancing inflammation and elevation of proinflammatory cytokines and chemokines

  18. NFATC3-PLA2G15 Fusion Transcript Identified by RNA Sequencing Promotes Tumor Invasion and Proliferation in Colorectal Cancer Cell Lines.

    Science.gov (United States)

    Jang, Jee-Eun; Kim, Hwang-Phill; Han, Sae-Won; Jang, Hoon; Lee, Si-Hyun; Song, Sang-Hyun; Bang, Duhee; Kim, Tae-You

    2018-06-14

    This study was designed to identify novel fusion transcripts (FTs) and their functional significance in colorectal cancer lines. We performed paired-end RNA sequencing of 28 colorectal cancer (CRC) cell lines. FT candidates were identified using TopHat-fusion, ChimeraScan, and FusionMap tools and further experimental validation was conducted through reverse transcription-polymerase chain reaction and Sanger sequencing. FT was depleted in human CRC line and the effects on cell proliferation, cell migration, and cell invasion were analyzed. 1,380 FT candidates were detected through bioinformatics filtering. We selected 6 candidate FTs, including 4 inter-chromosomal and 2 intra-chromosomal FTs and each FT was found in at least 1 of the 28 cell lines. Moreover, when we tested 19 pairs of CRC tumor and adjacent normal tissue samples, NFATC3-PLA2G15 FT was found in 2. Knockdown of NFATC3-PLA2G15 using siRNA reduced mRNA expression of epithelial-mesenchymal transition (EMT) markers such as vimentin, twist, and fibronectin and increased mesenchymal-epithelial transition markers of E-cadherin, claudin-1, and FOXC2 in colo-320 cell line harboring NFATC3-PLA2G15 FT. The NFATC3-PLA2G15 knockdown also inhibited invasion, colony formation capacity, and cell proliferation. These results suggest that that NFATC3-PLA2G15 FTs may contribute to tumor progression by enhancing invasion by EMT and proliferation.

  19. "The devil's in the detail": Release of an expanded, enhanced and dynamically revised forensic STR Sequence Guide.

    Science.gov (United States)

    Phillips, C; Gettings, K Butler; King, J L; Ballard, D; Bodner, M; Borsuk, L; Parson, W

    2018-05-01

    The STR sequence template file published in 2016 as part of the considerations from the DNA Commission of the International Society for Forensic Genetics on minimal STR sequence nomenclature requirements, has been comprehensively revised and audited using the latest GRCh38 genome assembly. The list of forensic STRs characterized was expanded by including supplementary autosomal, X- and Y-chromosome microsatellites in less common use for routine DNA profiling, but some likely to be adopted in future massively parallel sequencing (MPS) STR panels. We outline several aspects of sequence alignment and annotation that required care and attention to detail when comparing sequences to GRCh37 and GRCh38 assemblies, as well as the necessary matching of MPS-based allele descriptions to previously established repeat region structures described in initial sequencing studies of the less well known forensic STRs. The revised sequence guide is now available in a dynamically updated FTP format from the STRidER website with a date-stamped change log to allow users to explore their own MPS data with the most up-to-date forensic STR sequence information compiled in a simple guide. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  1. Whole genome sequencing and analysis of plant growth promoting bacteria isolated from the rhizosphere of plantation crops coconut, cocoa and arecanut.

    Directory of Open Access Journals (Sweden)

    Alka Gupta

    Full Text Available Coconut, cocoa and arecanut are commercial plantation crops that play a vital role in the Indian economy while sustaining the livelihood of more than 10 million Indians. According to 2012 Food and Agricultural organization's report, India is the third largest producer of coconut and it dominates the production of arecanut worldwide. In this study, three Plant Growth Promoting Rhizobacteria (PGPR from coconut (CPCRI-1, cocoa (CPCRI-2 and arecanut (CPCRI-3 characterized for the PGP activities have been sequenced. The draft genome sizes were 4.7 Mb (56% GC, 5.9 Mb (63.6% GC and 5.1 Mb (54.8% GB for CPCRI-1, CPCRI-2, CPCRI-3, respectively. These genomes encoded 4056 (CPCRI-1, 4637 (CPCRI-2 and 4286 (CPCRI-3 protein-coding genes. Phylogenetic analysis revealed that both CPCRI-1 and CPCRI-3 belonged to Enterobacteriaceae family, while, CPCRI-2 was a Pseudomonadaceae family member. Functional annotation of the genes predicted that all three bacteria encoded genes needed for mineral phosphate solubilization, siderophores, acetoin, butanediol, 1-aminocyclopropane-1-carboxylate (ACC deaminase, chitinase, phenazine, 4-hydroxybenzoate, trehalose and quorum sensing molecules supportive of the plant growth promoting traits observed in the course of their isolation and characterization. Additionally, in all the three CPCRI PGPRs, we identified genes involved in synthesis of hydrogen sulfide (H2S, which recently has been proposed to aid plant growth. The PGPRs also carried genes for central carbohydrate metabolism indicating that the bacteria can efficiently utilize the root exudates and other organic materials as energy source. Genes for production of peroxidases, catalases and superoxide dismutases that confer resistance to oxidative stresses in plants were identified. Besides these, genes for heat shock tolerance, cold shock tolerance and glycine-betaine production that enable bacteria to survive abiotic stress were also identified.

  2. Secrets of long life: cross-cultural explorations in sustainably enhancing vitality and promoting longevity via elders' practice wisdom.

    Science.gov (United States)

    Pesek, Todd; Reminick, Ronald; Nair, Murali

    2010-01-01

    In searching for different patterns of practice, lifestyle, and environment supportive of optimal health, we look to our elders around the world, who in the wisdom that has sustained them, we learn from with careful attention. Thirty-seven elders who live by their traditions participated in the present study. They assisted in the refinement of the methodology and collections and preparation of these data. These participants are well-respected, representative elders and traditional healers of their regions. These data, from study sites of the Eastern Afromontane and Albertine Rift region of Ethiopia, Africa; the Maya Mountains region of Belize, Central America; the Western Ghats region of India; and the Appalachian Mountains region of the United States, were grouped into three major categories: (1) philosophy, attitudes, and outlook, (2) lifestyle practices, and (3) dietary and nutritional practices. These elders demonstrate a relatively comprehensive but simple set of practices that can enhance our vitality and promote longevity sustainably. In essence, these practices, or practice wisdom, of our longest living elders, promote propagation of healthful lifestyles by following traditional ways and taking care of body, mind, spirit and our environment. Further field research among a larger cohort is required to fully generalize the findings of this study, but much of it is consistent with what we already know should be done. These data begin illustration of practice wisdom for implementation and serve to engage our universities, our hospitals, our industries, and our students, who we must position toward social change. Copyright © 2010 Elsevier Inc. All rights reserved.

  3. Enhancement of the HIF-1α/15-LO/15-HETE axis promotes hypoxia-induced endothelial proliferation in preeclamptic pregnancy.

    Directory of Open Access Journals (Sweden)

    Dandan Yuan

    Full Text Available Preeclampsia (PE is an extremely serious condition in pregnant women and the leading cause of maternal and fetal morbidity and mortality. Despite active research, the etiological factors of this disorder remain elusive. The increased release of 15-hydroxyeicosatetraenoic acid (15-HETE in the placenta of preeclamptic patients has been studied, but its exact role in PE pathogenesis remains unknown. Mounting evidence shows that PE is associated with placental hypoxia, impaired placental angiogenesis, and endothelial dysfunction. In this study, we confirmed the upregulated expression of hypoxia-inducible factor 1α (HIF-1α and 15-lipoxygenase-1/2 (15-LO-1/2 in patients with PE. Production of the arachidonic acid metabolite, 15-HETE, also increased in the preeclamptic placenta, which suggests enhanced activation of the HIF-1α-15-LO-15-HETE axis. Furthermore, this study is the first to show that the umbilical cord of preeclamptic women contains significantly higher serum concentrations of 15-HETE than that of healthy pregnant women. The results also show that expression of 15-LO-1/2 is upregulated in both human umbilical vein endothelial cells (HUVECs collected from preeclamptic women and in those cultured under hypoxic conditions. Exogenous 15-HETE promotes the migration of HUVECs and in vitro tube formation and promotes cell cycle progression from the G0/G1 phase to the G2/M + S phase, whereas the 15-LO inhibitor, NDGA, suppresses these effects. The HIF-1α/15-LO/15-HETE pathway is therefore significantly associated within the pathology of PE.

  4. Cycling Hypoxia Induces a Specific Amplified Inflammatory Phenotype in Endothelial Cells and Enhances Tumor-Promoting Inflammation In Vivo

    Directory of Open Access Journals (Sweden)

    Céline Tellier

    2015-01-01

    Full Text Available Abnormal architecture of the tumor blood network, as well as heterogeneous erythrocyte flow, leads to temporal fluctuations in tissue oxygen tension exposing tumor and stromal cells to cycling hypoxia. Inflammation is another feature of tumor microenvironment and is considered as a new enabling characteristic of tumor progression. As cycling hypoxia is known to participate in tumor aggressiveness, the purpose of this study was to evaluate its role in tumor-promoting inflammation. Firstly, we assessed the impact of cycling hypoxia in vitro on endothelial inflammatory response induced by tumor necrosis factor α. Results showed that endothelial cells exposed to cycling hypoxia displayed an amplified proinflammatory phenotype, characterized by an increased expression of inflammatory cytokines, namely, interleukin (IL-6 and IL-8; by an increased expression of adhesion molecules, in particular intercellular adhesion molecule–1 (ICAM-1; and consequently by an increase in THP-1 monocyte adhesion. This exacerbation of endothelial inflammatory phenotype occurs through nuclear factor–κB overactivation. Secondly, the role of cycling hypoxia was studied on overall tumor inflammation in vivo in tumor-bearing mice. Results showed that cycling hypoxia led to an enhanced inflammation in tumors as prostaglandin-endoperoxide synthase 2 (PTGS2, IL-6, CXCL1 (C-X-C motif ligand 1, and macrophage inflammatory protein 2 (murine IL-8 functional homologs mRNA expression was increased and as a higher leukocyte infiltration was evidenced. Furthermore, cycling hypoxia–specific inflammatory phenotype, characterized by a simultaneous (baculoviral inhibitor of apoptosis repeat-containing 5low/PTGS2high/ICAM-1high/IL-6high/IL-8high expression, is associated with a poor prognosis in human colon cancer. This new phenotype could thus be used in clinic to more precisely define prognosis for colon cancer patients. In conclusion, our findings evidenced for the first time the

  5. [Macrophage colony stimulating factor enhances non-small cell lung cancer invasion and metastasis by promoting macrophage M2 polarization].

    Science.gov (United States)

    Li, Y J; Yang, L; Wang, L P; Zhang, Y

    2017-06-23

    Objective: To investigate the key cytokine which polarizes M2 macrophages and promotes invasion and metastasis in non-small cell lung cancer (NSCLC). Methods: After co-culture with A549 cells in vitro, the proportion of CD14(+) CD163(+) M2 macrophages in monocytes and macrophage colony stimulating factor (M-CSF) levels in culture supernatant were detected by flow cytometry, ELISA assay and real-time qPCR, respectively. The effects of CD14(+) CD163(+) M2 macrophages on invasion of A549 cells and angiogenesis of HUVEC cells were measured by transwell assay and tubule formation assay, respectively. The clinical and prognostic significance of M-CSF expression in NSCLC was further analyzed. Results: The percentage of CD14(+) CD163(+) M2 macrophages in monocytes and the concentration of M-CSF in the supernatant followed by co-culture was (12.03±0.46)% and (299.80±73.76)pg/ml, respectively, which were significantly higher than those in control group [(2.80±1.04)% and (43.07±11.22)pg/ml, respectively, P macrophages in vitro . M2 macrophages enhanced the invasion of A549 cells (66 cells/field vs. 26 cells/field) and the angiogenesis of HUVEC cells (22 tubes/field vs. 8 tubes/field). The mRNA expression of M-CSF in stage Ⅰ-Ⅱ patients (16.23±4.83) was significantly lower than that in stage Ⅲ-Ⅳ (53.84±16.08; P macrophages, which can further promote the metastasis and angiogenesis of NSCLC. M-CSF could be used as a potential therapeutic target of NSCLC.

  6. Body protective compound-157 enhances alkali-burn wound healing in vivo and promotes proliferation, migration, and angiogenesis in vitro

    Science.gov (United States)

    Huang, Tonglie; Zhang, Kuo; Sun, Lijuan; Xue, Xiaochang; Zhang, Cun; Shu, Zhen; Mu, Nan; Gu, Jintao; Zhang, Wangqian; Wang, Yukun; Zhang, Yingqi; Zhang, Wei

    2015-01-01

    Chemical burns take up a high proportion of burns admissions and can penetrate deep into tissues. Various reagents have been applied in the treatment of skin chemical burns; however, no optimal reagent for skin chemical burns currently exists. The present study investigated the effect of topical body protective compound (BPC)-157 treatment on skin wound healing, using an alkali burn rat model. Topical treatment with BPC-157 was shown to accelerate wound closure following an alkali burn. Histological examination of skin sections with hematoxylin–eosin and Masson staining showed better granulation tissue formation, reepithelialization, dermal remodeling, and a higher extent of collagen deposition when compared to the model control group on the 18th day postwounding. BPC-157 could promote vascular endothelial growth factor expression in wounded skin tissues. Furthermore, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and cell cycle analysis demonstrated that BPC-157 enhanced the proliferation of human umbilical vein endothelial cells (HUVECs). Transwell assay and wound healing assay showed that BPC-157 significantly promoted migration of HUVECs. We also observed that BPC-157 upregulated the expression of VEGF-a and accelerated vascular tube formation in vitro. Moreover, further studies suggested that BPC-157 regulated the phosphorylation level of extracellular signal-regulated kinases 1 and 2 (ERK1/2) as well as its downstream targets, including c-Fos, c-Jun, and Egr-1, which are key molecules involved in cell growth, migration, and angiogenesis. Altogether, our results indicated that BPC-157 treatment may accelerate wound healing in a model of alkali burn-induced skin injury. The therapeutic mechanism may be associated with accelerated granulation tissue formation, reepithelialization, dermal remodeling, and collagen deposition through ERK1/2 signaling pathway. PMID:25995620

  7. Quantitative assessment of hepatic function: modified look-locker inversion recovery (MOLLI) sequence for T1 mapping on Gd-EOB-DTPA-enhanced liver MR imaging

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Jeong Hee [Seoul National University Hospital, Department of Radiology, Seoul (Korea, Republic of); Lee, Jeong Min; Han, Joon Koo; Choi, Byung Ihn [Seoul National University Hospital, Department of Radiology, Seoul (Korea, Republic of); Seoul National University College of Medicine, Institute of Radiation Medicine, Jongno-gu, Seoul (Korea, Republic of); Paek, Munyoung [Siemens Healthcare, Seoul (Korea, Republic of)

    2016-06-15

    To determine whether multislice T1 mapping of the liver using a modified look-locker inversion recovery (MOLLI) sequence on gadoxetic acid-enhanced magnetic resonance imaging (MRI) can be used as a quantitative tool to estimate liver function and predict the presence of oesophageal or gastric varices. Phantoms filled with gadoxetic acid were scanned three times using MOLLI sequence to test repeatability. Patients with chronic liver disease or liver cirrhosis who underwent gadoxetic acid-enhanced liver MRI including MOLLI sequence at 3 T were included (n = 343). Pre- and postcontrast T1 relaxation times of the liver (T1liver), changes between pre- and postcontrast T1liver (ΔT1liver), and adjusted postcontrast T1liver (postcontrast T1liver-T1spleen/T1spleen) were compared among Child-Pugh classes. In 62 patients who underwent endoscopy, all T1 parameters and spleen sizes were correlated with varices. Phantom study showed excellent repeatability of MOLLI sequence. As Child-Pugh scores increased, pre- and postcontrast T1liver were significantly prolonged (P < 0.001), and ΔT1liver and adjusted postcontrast T1liver decreased (P< 0.001). Adjusted postcontrast T1liver and spleen size were independently associated with varices (R{sup 2} = 0.29, P < 0.001). T1 mapping of the liver using MOLLI sequence on gadoxetic acid-enhanced MRI demonstrated potential in quantitatively estimating liver function, and adjusted postcontrast T1liver was significantly associated with varices. (orig.)

  8. Production of recombinant AAV vectors encoding insulin-like growth factor I is enhanced by interaction among AAV rep regulatory sequences

    Directory of Open Access Journals (Sweden)

    Dilley Robert

    2009-01-01

    Full Text Available Abstract Background Adeno-associated virus (AAV vectors are promising tools for gene therapy. Currently, their potential is limited by difficulties in producing high vector yields with which to generate transgene protein product. AAV vector production depends in part upon the replication (Rep proteins required for viral replication. We tested the hypothesis that mutations in the start codon and upstream regulatory elements of Rep78/68 in AAV helper plasmids can regulate recombinant AAV (rAAV vector production. We further tested whether the resulting rAAV vector preparation augments the production of the potentially therapeutic transgene, insulin-like growth factor I (IGF-I. Results We constructed a series of AAV helper plasmids containing different Rep78/68 start codon in combination with different gene regulatory sequences. rAAV vectors carrying the human IGF-I gene were prepared with these vectors and the vector preparations used to transduce HT1080 target cells. We found that the substitution of ATG by ACG in the Rep78/68 start codon in an AAV helper plasmid (pAAV-RC eliminated Rep78/68 translation, rAAV and IGF-I production. Replacement of the heterologous sequence upstream of Rep78/68 in pAAV-RC with the AAV2 endogenous p5 promoter restored translational activity to the ACG mutant, and restored rAAV and IGF-I production. Insertion of the AAV2 p19 promoter sequence into pAAV-RC in front of the heterologous sequence also enabled ACG to function as a start codon for Rep78/68 translation. The data further indicate that the function of the AAV helper construct (pAAV-RC, that is in current widespread use for rAAV production, may be improved by replacement of its AAV2 unrelated heterologous sequence with the native AAV2 p5 promoter. Conclusion Taken together, the data demonstrate an interplay between the start codon and upstream regulatory sequences in the regulation of Rep78/68 and indicate that selective mutations in Rep78/68 regulatory elements

  9. Promoting interprofessional learning and enhancing the pre-registration student experience through reciprocal cross professional peer tutoring.

    Science.gov (United States)

    McLeod, Fiona; Jamison, Caroline; Treasure, Karen

    2018-05-01

    To improve collaboration and the quality of care, healthcare programmes are increasingly promoting interprofessional education thereby enabling students to learn with, from and about each other. A reciprocal peer learning model has developed among pre-registration physiotherapy and adult nursing students at Plymouth University, England. Embedded within the curriculum, it provides voluntary opportunities for year two students to become cross professional peer tutors to year one students while enhancing interprofessional understanding and skills acquisition. To explore participant experiences of two cross professional peer tutored clinical skills workshops delivered to a cohort of nursing (n = 67) and physiotherapy (n = 53) students in 2015. A mixed methods approach generated qualitative and quantitative data. Qualitative data was gathered via focus groups and individual interviews of peer tutors and learners (n = 27). These were recorded, transcribed and thematically analysed. The Readiness for Interprofessional Learning Scale questionnaire (n = 84) was completed before and after the workshops to consider any influence on students' attitudes towards interprofessional learning. Four themes evolved from thematic analysis; benefits of cross professional peer tutoring, interprofessional teamwork, quality of care and factors influencing the delivery of the workshops. Data showed students felt they developed greater understanding of interprofessional roles and acquired new skills. Peer tutors developed confidence in representing their profession while appearing to inspire early stage students. The Readiness for Interprofessional Learning Scale questionnaire data identified very positive attitudes towards interprofessional learning among the majority of students in both cohorts before and after the workshop. This study endorses the utility of enhancing the Higher Education experience by offering voluntary peer tutoring opportunities. Participating students

  10. Methylation-sensitive linking libraries enhance gene-enriched sequencing of complex genomes and map DNA methylation domains

    Directory of Open Access Journals (Sweden)

    Bharti Arvind K

    2008-12-01

    Full Text Available Abstract Background Many plant genomes are resistant to whole-genome assembly due to an abundance of repetitive sequence, leading to the development of gene-rich sequencing techniques. Two such techniques are hypomethylated partial restriction (HMPR and methylation spanning linker libraries (MSLL. These libraries differ from other gene-rich datasets in having larger insert sizes, and the MSLL clones are designed to provide reads localized to "epigenetic boundaries" where methylation begins or ends. Results A large-scale study in maize generated 40,299 HMPR sequences and 80,723 MSLL sequences, including MSLL clones exceeding 100 kb. The paired end reads of MSLL and HMPR clones were shown to be effective in linking existing gene-rich sequences into scaffolds. In addition, it was shown that the MSLL clones can be used for anchoring these scaffolds to a BAC-based physical map. The MSLL end reads effectively identified epigenetic boundaries, as indicated by their preferential alignment to regions upstream and downstream from annotated genes. The ability to precisely map long stretches of fully methylated DNA sequence is a unique outcome of MSLL analysis, and was also shown to provide evidence for errors in gene identification. MSLL clones were observed to be significantly more repeat-rich in their interiors than in their end reads, confirming the correlation between methylation and retroelement content. Both MSLL and HMPR reads were found to be substantially gene-enriched, with the SalI MSLL libraries being the most highly enriched (31% align to an EST contig, while the HMPR clones exhibited exceptional depletion of repetitive DNA (to ~11%. These two techniques were compared with other gene-enrichment methods, and shown to be complementary. Conclusion MSLL technology provides an unparalleled approach for mapping the epigenetic status of repetitive blocks and for identifying sequences mis-identified as genes. Although the types and natures of

  11. P22 Arc repressor: enhanced expression of unstable mutants by addition of polar C-terminal sequences.

    OpenAIRE

    Milla, M. E.; Brown, B. M.; Sauer, R. T.

    1993-01-01

    Many mutant variants of the P22 Arc repressor are subject to intracellular proteolysis in Escherichia coli, which precludes their expression at levels sufficient for purification and subsequent biochemical characterization. Here we examine the effects of several different C-terminal extension sequences on the expression and activity of a set of Arc mutants. We show that two tail sequences, KNQHE (st5) and H6KNQHE (st11), increase the expression levels of most mutants from 10- to 20-fold and, ...

  12. Added value of diffusion-weighted MRI in detection of cervical cancer recurrence: comparison with morphologic and dynamic contrast-enhanced MRI sequences.

    Science.gov (United States)

    Lucas, Rita; Lopes Dias, João; Cunha, Teresa Margarida

    2015-01-01

    We aimed to evaluate the added value of diffusion-weighted imaging (DWI) to standard magnetic resonance imaging (MRI) for detecting post-treatment cervical cancer recurrence. The detection accuracy of T2-weighted (T2W) images was compared with that of T2W MRI combined with either dynamic contrast-enhanced (DCE) MRI or DWI. Thirty-eight women with clinically suspected uterine cervical cancer recurrence more than six months after treatment completion were examined with 1.5 Tesla MRI including T2W, DCE, and DWI sequences. Disease was confirmed histologically and correlated with MRI findings. The diagnostic performance of T2W imaging and its combination with either DCE or DWI were analyzed. Sensitivity, positive predictive value, and accuracy were calculated. Thirty-six women had histologically proven recurrence. The accuracy for recurrence detection was 80% with T2W/DCE MRI and 92.1% with T2W/DWI. The addition of DCE sequences did not significantly improve the diagnostic ability of T2W imaging, and this sequence combination misclassified two patients as falsely positive and seven as falsely negative. The T2W/DWI combination revealed a positive predictive value of 100% and only three false negatives. The addition of DWI to T2W sequences considerably improved the diagnostic ability of MRI. Our results support the inclusion of DWI in the initial MRI protocol for the detection of cervical cancer recurrence, leaving DCE sequences as an option for uncertain cases.

  13. Promoted Fixation of Molecular Nitrogen with Surface Oxygen Vacancies on Plasmon-Enhanced TiO2 Photoelectrodes.

    Science.gov (United States)

    Li, Chengcheng; Wang, Tuo; Zhao, Zhi-Jian; Yang, Weimin; Li, Jian-Feng; Li, Ang; Yang, Zhilin; Ozin, Geoffrey A; Gong, Jinlong

    2018-02-19

    A hundred years on, the energy-intensive Haber-Bosch process continues to turn the N 2 in air into fertilizer, nourishing billions of people while causing pollution and greenhouse gas emissions. The urgency of mitigating climate change motivates society to progress toward a more sustainable method for fixing N 2 that is based on clean energy. Surface oxygen vacancies (surface O vac ) hold great potential for N 2 adsorption and activation, but introducing O vac on the very surface without affecting bulk properties remains a great challenge. Fine tuning of the surface O vac by atomic layer deposition is described, forming a thin amorphous TiO 2 layer on plasmon-enhanced rutile TiO 2 /Au nanorods. Surface O vac in the outer amorphous TiO 2 thin layer promote the adsorption and activation of N 2 , which facilitates N 2 reduction to ammonia by excited electrons from ultraviolet-light-driven TiO 2 and visible-light-driven Au surface plasmons. The findings offer a new approach to N 2 photofixation under ambient conditions (that is, room temperature and atmospheric pressure). © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53

    DEFF Research Database (Denmark)

    Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice

    2016-01-01

    The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion...... in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically...... associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell...

  15. Hypocretin 1/orexin A in the ventral tegmental area enhances dopamine responses to cocaine and promotes cocaine self-administration.

    Science.gov (United States)

    España, Rodrigo A; Melchior, James R; Roberts, David C S; Jones, Sara R

    2011-03-01

    Recent evidence indicates that the hypocretin/orexin system participates in the regulation of reinforcement and addiction processes. For example, manipulations that decrease hypocretin neurotransmission result in disruptions of neurochemical and behavioral responses to cocaine. To further assess the relationship between the hypocretin system and cocaine reinforcement, the current studies used microdialysis and in vivo voltammetry to examine the effects of hypocretin 1 on cocaine-induced enhancement of dopamine signaling in the nucleus accumbens core. Fixed ratio, discrete trials, and progressive ratio self-administration procedures were also used to assess whether hypocretin 1 promotes cocaine self-administration behavior. Infusions of hypocretin 1 into the ventral tegmental area increased the effects of cocaine on tonic and phasic dopamine signaling and increased the motivation to self-administer cocaine on the discrete trials and progressive ratio schedules. Together with previous observations demonstrating that a hypocretin 1 receptor antagonist disrupts dopamine signaling and reduces self-administration of cocaine, the current observations further indicate that the hypocretin system participates in reinforcement processes likely through modulation of the mesolimbic dopamine system.

  16. Synergistic use of biochar, compost and plant growth-promoting rhizobacteria for enhancing cucumber growth under water deficit conditions.

    Science.gov (United States)

    Nadeem, Sajid M; Imran, Muhammad; Naveed, Muhammad; Khan, Muhammad Y; Ahmad, Maqshoof; Zahir, Zahir A; Crowley, David E

    2017-12-01

    Limited information is available about the effectiveness of biochar with plant growth-promoting rhizobacteria (PGPR) and compost. A greenhouse study was conducted to evaluate the effect of biochar in combination with compost and PGPR (Pseudomonas fluorescens) for alleviating water deficit stress. Both inoculated and un-inoculated cucumber seeds were sown in soil treated with biochar, compost and biochar + compost. Three water levels - field capacity (D0), 75% field capacity (D1) and 50% field capacity (D2) - were maintained. The results showed that water deficit stress significantly suppressed the growth of cucumber; however, synergistic use of biochar, compost and PGPR mitigated the negative impact of stress. At D2, the synergistic use of biochar, compost and PGPR caused significant increases in shoot length, shoot biomass, root length and root biomass, which were respectively 88, 77, 89 and 74% more than in the un-inoculated control. Significant improvements in chlorophyll and relative water contents as well as reduction in leaf electrolyte leakage demonstrated the effectiveness of this approach. Moreover, the highest population of P. fluorescens was observed where biochar and compost were applied together. These results suggest that application of biochar with PGPR and/or compost could be an effective strategy for enhancing plant growth under stress. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  17. Enhancing Collegiate Women’s Soccer Psychosocial and Performance Outcomes by Promoting Intrinsic Sources of Sport Enjoyment

    Directory of Open Access Journals (Sweden)

    Scott P. Barnicle, Damon Burton

    2016-12-01

    Full Text Available This study examined the effectiveness of an applied mental skills training (MST intervention utilizing mental skills to enhance intrinsic sources of enjoyment (ISOEs as a means of promoting self-confidence, motivational style, and athletic performance, while also decreasing trait anxiety. The intervention project was designed to increase intrinsic SOE using a systematic and individualized mental training protocol, and then examine its relationships to mental skills and soccer performance. A Division 1 collegiate women’s soccer team was randomly assigned to treatment (n = 8 and control (n = 11 groups, equally distributed by academic year, position, and pre-season coach-evaluated starters and non-starts. Results revealed that the MST intervention significantly increased intrinsic enjoyment targeted psychological and competitive outcomes, both in practice and competition within the treatment group as compared to the control group. This study’s support for the impact mental skills training may have had on ISOEs, as well as other psychosocial outcomes and athletic performance can serve to highlight a mental skill often overlooked by consultants and coaches.

  18. MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53.

    Science.gov (United States)

    Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias

    2016-01-07

    The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Enhanced differentiation of neural stem cells to neurons and promotion of neurite outgrowth by oxygen-glucose deprivation.

    Science.gov (United States)

    Wang, Qin; Yang, Lin; Wang, Yaping

    2015-06-01

    Stroke has become the leading cause of mortality worldwide. Hypoxic or ischemic insults are crucial factors mediating the neural damage in the brain tissue of stroke patients. Neural stem cells (NSCs) have been recognized as a promising tool for the treatment of ischemic stroke and other neurodegenerative diseases due to their inducible pluripotency. In this study, we aim to mimick the cerebral hypoxic-ischemic injury in vitro using oxygen-glucose deprivation (OGD) strategy, and evaluate the effects of OGD on the NSC's neural differentiation, as well as the differentiated neurite outgrowth. Our data showed that NSCs under the short-term 2h OGD treatment are able to maintain cell viability and the capability to form neurospheres. Importantly, this moderate OGD treatment promotes NSC differentiation to neurons and enhances the performance of the mature neuronal networks, accompanying increased neurite outgrowth of differentiated neurons. However, long-term 6h and 8h OGD exposures in NSCs lead to decreased cell survival, reduced differentiation and diminished NSC-derived neurite outgrowth. The expressions of neuron-specific microtubule-associated protein 2 (MAP-2) and growth associated protein 43 (GAP-43) are increased by short-term OGD treatments but suppressed by long-term OGD. Overall, our results demonstrate that short-term OGD exposure in vitro induces differentiation of NSCs while maintaining their proliferation and survival, providing valuable insights of adopting NSC-based therapy for ischemic stroke and other neurodegenerative disorders. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Comparison of multi-echo and single-echo gradient-recalled echo sequences for SPIO-enhanced Liver MRI at 3 T

    International Nuclear Information System (INIS)

    Choi, J.S.; Kim, M.-J.; Kim, J.H.; Choi, J.-Y.; Chung, Y.E.; Park, M.-S.; Kim, K.W.

    2010-01-01

    Aim: To assess the utility of a T2*-weighted, multi-echo data imaging combination sequenced on superparamagnetic iron oxide (SPIO)-enhanced liver magnetic resonance imaging (MRI) using a 3 T system. Materials and methods: Fifty patients underwent SPIO-enhanced MRI at 3 T using T2*-weighted, single-echo, gradient-recalled echo (GRE) sequences [fast imaging with steady precession; repetition time (TR)/echo time (TE), 126 ms/9 ms; flip angle, 30 o ] and multi-echo GRE (multi-echo data image combination) sequences (TR/TE, 186 ms/9 ms; flip angle, 30 o ). Three radiologists independently reviewed the images in a random order. The sensitivity and accuracy for the detection of focal hepatic lesions (a total of 76 lesions in 33 patients; 48 solid lesions, 28 non-solid lesions) were compared by analysing the area under the receiver operating characteristic curves. Image artefacts (flow artefacts, susceptibility artefacts, dielectric artefacts, and motion artefacts), lesion conspicuity, and overall image quality were evaluated according to a four-point scale: 1, poor; 2, fair; 3, good; 4, excellent. The signal-to-noise ratio (SNR) and contrast-to-noise ratio (CNR) of the lesions were compared. Results: Image artefacts were more frequent with single-echo GRE (p < 0.05). The mean scale of image quality assessment for flow, susceptibility, dielectric, and motion artefacts were 2.76, 3.13, 3.42, and 2.89 with singe-echo, respectively, compared with 3.47, 3.43, 3.47, and 3.39, respectively, with multi-echo GRE. There was no significant difference in lesion conspicuity between single-echo (3.15) and multi-echo (3.30) GRE sequences. The overall image quality was significantly (p < 0.05) better with multi-echo (3.37) than with single-echo GRE (2.89). The mean SNR and CNR of the lesions were significantly (p < 0.05) higher on multi-echo (79 ± 23 and 128 ± 59, respectively) images than on single-echo (38 ± 11 and 102 ± 44, respectively) images. Lesion detection accuracy and

  1. Petunia AGAMOUS enhancer-derived chimeric promoters specify a carpel-, stamen- and petal-specific expression pattern sufficient for engineering male and female sterility in tobacco

    Science.gov (United States)

    Previous studies have shown that the AtAGIP promoter derived from the Arabidopsis AGAMOUS (AG) second intron/enhancer specifies a carpel- and stamen-specific pattern of expression in its native host species but not in heterologous species, such as tobacco which restricts its application in the engin...

  2. Comparison of the Effectiveness of Two Forms of the Enhancing Relationships in School Communities Project for Promoting Cooperative Conflict Resolution Education in Australian Primary Schools

    Science.gov (United States)

    Trinder, Margot; Wertheim, Eleanor H.; Freeman, Elizabeth; Sanson, Ann; Richardson, Shanel; Hunt, Sue

    2010-01-01

    This study evaluated the Enhancing Relationships in School Communities (ERIS) Project which aimed to promote constructive conflict resolution (CR) in Australian primary school communities through professional development for core teams of three-five staff (n = 33 teachers). Twelve schools were randomly assigned to a full intervention (FI) group or…

  3. A Peptide Derived from the HIV-1 gp120 Coreceptor-Binding Region Promotes Formation of PAP248-286 Amyloid Fibrils to Enhance HIV-1 Infection.

    Directory of Open Access Journals (Sweden)

    Jinquan Chen

    Full Text Available Semen is a major vehicle for HIV transmission. Prostatic acid phosphatase (PAP fragments, such as PAP248-286, in human semen can form amyloid fibrils to enhance HIV infection. Other endogenous or exogenous factors present during sexual intercourse have also been reported to promote the formation of seminal amyloid fibrils.Here, we demonstrated that a synthetic 15-residue peptide derived from the HIV-1 gp120 coreceptor-binding region, designated enhancing peptide 2 (EP2, can rapidly self-assemble into nanofibers. These EP2-derivated nanofibers promptly accelerated the formation of semen amyloid fibrils by PAP248-286, as shown by Thioflavin T (ThT and Congo red assays. The amyloid fibrils presented similar morphology, assessed via transmission electron microscopy (TEM, in the presence or absence of EP2. Circular dichroism (CD spectroscopy revealed that EP2 accelerates PAP248-286 amyloid fibril formation by promoting the structural transition of PAP248-286 from a random coil into a cross-β-sheet. Newly formed semen amyloid fibrils effectively enhanced HIV-1 infection in TZM-bl cells and U87 cells by promoting the binding of HIV-1 virions to target cells.Nanofibers composed of EP2 promote the formation of PAP248-286 amyloid fibrils and enhance HIV-1 infection.

  4. 3D Whole-Heart Coronary MR Angiography at 1.5T in Healthy Volunteers: Comparison between Unenhanced SSFP and Gd-Enhanced FLASH Sequences

    International Nuclear Information System (INIS)

    Gweon, Hye Mi; Kim, Sang Jin; Lee, Sang Min; Hong, Yoo Jin; Kim, Tae Hoon

    2011-01-01

    To validate the optimal cardiac phase and appropriate acquisition window for three-dimensional (3D) whole-heart coronary magnetic resonance angiography (MRA) with a steady-state free precession (SSFP) sequence, and to compare image quality between SSFP and Gd-enhanced fast low-angle shot (FLASH) MR techniques at 1.5 Tesla (T). Thirty healthy volunteers (M:F 25:5; mean age, 35 years; range, 24-54 years) underwent a coronary MRA at 1.5T. 3D whole-heart coronary MRA with an SSFP was performed at three different times: 1) at end-systole with a narrow (120-msec) acquisition window (ESN), 2) mid-diastole with narrow acquisition (MDN); and 3) mid-diastole with wide (170-msec) acquisition (MDW). All volunteers underwent a contrast enhanced coronary MRA after undergoing an unenhanced 3D true fast imaging with steady-state precession (FISP) MRA three times. A contrast enhanced coronary MRA with FLASH was performed during MDN. Visibility of the coronary artery and image quality were evaluated for 11 segments, as suggested by the American Heart Association. Image quality was scored by a five-point scale (1 = not visible to 5 = excellent). The signal-to-noise ratio (SNR) and contrast-to-noise ratio (CNR) were evaluated at the proximal coronary arteries. The SSFP sequence rendered higher visibility coronary segments, higher image quality, as well as higher SNR and CNR than the Gd-enhanced FLASH technique at 1.5T (p < 0.05). The visibility of coronary segments, image quality, SNR and CNR in the ESN, MDN and MDW with SSFP sequence did not differ significantly. An SSFP sequence provides an excellent method for the 3D whole-heart coronary MRA at 1.5T. Contrast enhanced coronary MRA using the FLASH sequence does not help improve the visibility of coronary segments, image quality, SNR or CNR on the 3D whole-heart coronary MRA.

  5. Comparison of different magnetic resonance cholangiography techniques in living liver donors including Gd-EOB-DTPA enhanced T1-weighted sequences.

    Directory of Open Access Journals (Sweden)

    Sonja Kinner

    Full Text Available Preoperative evaluation of potential living liver donors (PLLDs includes the assessment of the biliary anatomy to avoid postoperative complications. Aim of this study was to compare T2-weighted (T2w and Gd-EOB-DTPA enhanced T1-weighted (T1w magnetic resonance cholangiography (MRC techniques in the evaluation of PLLDs.30 PLLDs underwent MRC on a 1.5 T Magnetom Avanto (Siemens, Erlangen, Germany using (A 2D T2w HASTE (Half Fourier Acquisition Single Shot Turbo Spin Echo fat saturated (fs in axial plane, (B 2D T2w HASTE fs thick slices in coronal plane, (C free breathing 3D T2w TSE (turbo spin echo RESTORE (high-resolution navigator corrected plus (D maximum intensity projections (MIPs, (E T2w SPACE (sampling perfection with application optimized contrasts using different flip angle evolutions plus (F MIPs and (G T2w TSE BLADE as well as Gd-EOB-DTPA T1w images without (G and with (H inversion recovery. Contrast enhanced CT cholangiography served as reference imaging modality. Two independent reviewers evaluated the biliary tract anatomy on a 5-point scale subjectively and objectively. Data sets were compared using a Mann-Whitney-U-test. Kappa values were also calculated.Source images and maximum intensity projections of 3D T2w TSE sequences (RESTORE and SPACE proved to be best for subjective and objective evaluation directly followed by 2D HASTE sequences. Interobserver variabilities were good to excellent (k = 0.622-0.804.3D T2w sequences are essential for preoperative biliary tract evaluation in potential living liver donors. Furthermore, our results underline the value of different MRCP sequence types for the evaluation of the biliary anatomy in PLLDs including Gd-EOB-DTPA enhanced T1w MRC.

  6. Evaluation of Dixon Sequence on Hybrid PET/MR Compared with Contrast-Enhanced PET/CT for PET-Positive Lesions

    International Nuclear Information System (INIS)

    Jeong, Ju Hye; Cho, Ihn Ho; Kong, Eun Jung; Chun, Kyung Ah

    2014-01-01

    Hybrid positron emission tomography and magnetic resonance (PET/MR) imaging performs a two-point Dixon MR sequence for attenuation correction. However, MR data in hybrid PET/MR should provide anatomic and morphologic information as well as an attenuation map. We evaluated the Dixon sequence of hybrid PET/MR for anatomic correlation of PET-positive lesions compared with contrast-enhanced PET/computed tomography (CT) in patients with oncologic diseases. Twelve patients underwent a single injection, dual imaging protocol. PET/CT was performed with an intravenous contrast agent (85±13 min after 18 F-FDG injection of 403± 45 MBq) and then (125±19 min after injection) PET/MR was performed. Attenuation correction and anatomic allocation of PET were performed using contrast-enhanced CT for PET/CT and Dixon MR sequence for hybrid PET/MR. The Dixon MR sequence and contrast-enhanced CT were compared for anatomic correlation of PET-positive lesions (scoring scale ranging from 0 to 3 for visual ratings). Additionally, standardized uptake values (SUVs) for the detected lesions were assessed for quantitative comparison. Both hybrid PET/MR and contrast-enhanced PET/CT identified 55 lesions with increased FDG uptake in ten patients. In total, 28 lymph nodes, 11 bone lesions, 3 dermal nodules, 3 pleural thickening lesions, 2 thyroid nodules, 1 pancreas, 1 liver, 1 ovary, 1 uterus, 1 breast, 1 soft tissue and 2 lung lesions were present. The best performance was observed for anatomic correlation of PET findings by the contrast-enhanced CT scans (contrast-enhanced CT, 2.64± 0.70; in-phase, 1.29±1.01; opposed-phase, 1.29±1.15; water-weighted, 1.71±1.07; fat weighted, 0.56±1.03). A significant difference was observed between the scores obtained from the contrast-enhanced CT and all four coregistered Dixon MR images. Quantitative evaluation revealed a high correlation between the SUVs measured with hybrid PET/MR (SUVmean, 2.63±1.62; SUVmax, 4.30±2.88) and contrast-enhanced PET

  7. Evaluation of Dixon Sequence on Hybrid PET/MR Compared with Contrast-Enhanced PET/CT for PET-Positive Lesions

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Ju Hye; Cho, Ihn Ho; Kong, Eun Jung; Chun, Kyung Ah [Yeungnam Univ. Hospital, Daegu (Korea, Republic of)

    2014-03-15

    Hybrid positron emission tomography and magnetic resonance (PET/MR) imaging performs a two-point Dixon MR sequence for attenuation correction. However, MR data in hybrid PET/MR should provide anatomic and morphologic information as well as an attenuation map. We evaluated the Dixon sequence of hybrid PET/MR for anatomic correlation of PET-positive lesions compared with contrast-enhanced PET/computed tomography (CT) in patients with oncologic diseases. Twelve patients underwent a single injection, dual imaging protocol. PET/CT was performed with an intravenous contrast agent (85±13 min after {sup 18}F-FDG injection of 403± 45 MBq) and then (125±19 min after injection) PET/MR was performed. Attenuation correction and anatomic allocation of PET were performed using contrast-enhanced CT for PET/CT and Dixon MR sequence for hybrid PET/MR. The Dixon MR sequence and contrast-enhanced CT were compared for anatomic correlation of PET-positive lesions (scoring scale ranging from 0 to 3 for visual ratings). Additionally, standardized uptake values (SUVs) for the detected lesions were assessed for quantitative comparison. Both hybrid PET/MR and contrast-enhanced PET/CT identified 55 lesions with increased FDG uptake in ten patients. In total, 28 lymph nodes, 11 bone lesions, 3 dermal nodules, 3 pleural thickening lesions, 2 thyroid nodules, 1 pancreas, 1 liver, 1 ovary, 1 uterus, 1 breast, 1 soft tissue and 2 lung lesions were present. The best performance was observed for anatomic correlation of PET findings by the contrast-enhanced CT scans (contrast-enhanced CT, 2.64± 0.70; in-phase, 1.29±1.01; opposed-phase, 1.29±1.15; water-weighted, 1.71±1.07; fat weighted, 0.56±1.03). A significant difference was observed between the scores obtained from the contrast-enhanced CT and all four coregistered Dixon MR images. Quantitative evaluation revealed a high correlation between the SUVs measured with hybrid PET/MR (SUVmean, 2.63±1.62; SUVmax, 4.30±2.88) and contrast-enhanced

  8. Cerebral staging of lung cancer: is one single contrast-enhanced T1-weighted three-dimensional gradient-echo sequence sufficient?

    Energy Technology Data Exchange (ETDEWEB)

    Ohana, Mickael; Jeung, Mi-Young; Roy, Catherine [Nouvel Hopital Civil-Hopitaux Universitaires de Strasbourg, Service de Radiologie B/Radiology Department, Strasbourg (France); Bazille, Gauthier [Clinique Saint Anne-Groupe Radiologique MIM, Strasbourg (France)

    2014-08-15

    Gadolinium-enhanced magnetic resonance imaging (MRI) is the gold standard for cerebral staging in thoracic oncology. We hypothesize that a minimalist examination, consisting of a single contrast-enhanced T1-weighted three-dimensional gradient-echo sequence (CE 3D-GRE), would be sufficient for the cerebral staging of nonsymptomatic lung cancer patients. Seventy nonsymptomatic patients (50 % men; 62 years ± 10.2) referred for cerebral staging of a lung cancer were retrospectively included. All underwent a standard 3 T MRI examination with T1, FLAIR, T2* GRE, diffusion, and CE 3D-GRE sequences, for a total examination time of 20 min. The sole CE 3D-GRE (acquisition time: 6 min) was extracted and blindly interpreted by two radiologists in search of brain metastases. Hemorrhagic features of potential lesions and relevant incidental findings were also noted. Discrepant cases were reviewed by a third reader. The full MRI examination and follow-up studies were used as a reference to calculate sensitivity and specificity of the sole CE 3D-GRE. Thirty-eight point six percent (27 out of 70) of the patients had brain metastases. Performances and reader's agreement with the sole CE 3D-GRE sequence were excellent for the diagnosis of brain metastases (sensitivity = 96.3 %, specificity = 100 %, κ = 0.91) and incidental findings (sensitivity = 85.7 %, specificity = 100 %, κ = 0.62) but insufficient for the identification of hemorrhages within the metastases (sensitivity = 33.3 %, specificity = 85.7 %, κ = 0.47). In the specific case of lung cancer, cerebral staging in nonsymptomatic patients can be efficiently achieved with a minimalistic protocol consisting of a single CE 3D-GRE sequence, completed if positive with a T2* sequence for hemorrhagic assessment, thus halving appointment delays. (orig.)

  9. Gadolinium-enhanced MR imaging of the wrist in rheumatoid arthritis: value of fat suppression pulse sequences

    International Nuclear Information System (INIS)

    Nakahara, N.; Uetani, M.; Hayashi, K.; Kawahara, Y.; Matsumoto, T.; Oda, J.

    1996-01-01

    Objective. To determine the usefulness of fat-suppressed gadolinium (Gd)-enhanced MR imaging of the wrist in patients with rheumatoid arthritis (RA). Design and patients. Fat-suppressed Gd-enhanced T1-weighted spin-echo (SE) images were obtained and compared with other standard techniques in 38 wrists of 27 patients (22-77 years) with RA. Scoring based on the degree of synovial enhancement of each joint was developed and the total scores (J-score) were correlated with radiographic stage, C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), and symptomatic change in the follow-up study. Results. Synovial proliferations showed marked enhancement in all the wrists. In addition, contrast enhancement in the bone marrow and tenosynovium was seen in 36 and eight wrists respectively. Fat-suppressed Gd-enhanced T1-weighted images demonstrated these abnormalities better than other techniques. The J-scores correlated well with values of CRP (P=0.0034), but not with radiographic stages and ESR. Conclusion. Fat-suppressed Gd-enhanced T1-weighted SE images can clearly demonstrate most of the essential lesions in RA including the proliferative synovium, bone erosion, bone marrow inflammatory change, and tenosynovitis. Scoring based on the extent of Gd-enhancement of synovium can be useful in the assessment of the inflammatory status. (orig.). With 8 figs

  10. Gadolinium-enhanced MR imaging of the wrist in rheumatoid arthritis: value of fat suppression pulse sequences

    Energy Technology Data Exchange (ETDEWEB)

    Nakahara, N. [Department of Radiology, Nagasaki University School of Medicine, Sakamoto 1-7-1, Nagasaki 852 (Japan); Uetani, M. [Department of Radiology, Nagasaki University School of Medicine, Sakamoto 1-7-1, Nagasaki 852 (Japan); Hayashi, K. [Department of Radiology, Nagasaki University School of Medicine, Sakamoto 1-7-1, Nagasaki 852 (Japan); Kawahara, Y. [Department of Radiology, Nagasaki University School of Medicine, Sakamoto 1-7-1, Nagasaki 852 (Japan); Matsumoto, T. [Department of Orthopedics, Nagasaki University School of Medicine, Nagasaki (Japan); Oda, J. [Department of Orthopedics, Nagasaki University School of Medicine, Nagasaki (Japan)

    1996-10-01

    Objective. To determine the usefulness of fat-suppressed gadolinium (Gd)-enhanced MR imaging of the wrist in patients with rheumatoid arthritis (RA). Design and patients. Fat-suppressed Gd-enhanced T1-weighted spin-echo (SE) images were obtained and compared with other standard techniques in 38 wrists of 27 patients (22-77 years) with RA. Scoring based on the degree of synovial enhancement of each joint was developed and the total scores (J-score) were correlated with radiographic stage, C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), and symptomatic change in the follow-up study. Results. Synovial proliferations showed marked enhancement in all the wrists. In addition, contrast enhancement in the bone marrow and tenosynovium was seen in 36 and eight wrists respectively. Fat-suppressed Gd-enhanced T1-weighted images demonstrated these abnormalities better than other techniques. The J-scores correlated well with values of CRP (P=0.0034), but not with radiographic stages and ESR. Conclusion. Fat-suppressed Gd-enhanced T1-weighted SE images can clearly demonstrate most of the essential lesions in RA including the proliferative synovium, bone erosion, bone marrow inflammatory change, and tenosynovitis. Scoring based on the extent of Gd-enhancement of synovium can be useful in the assessment of the inflammatory status. (orig.). With 8 figs.

  11. A transformation booster sequence (TBS) from Petunia hybrida functions as an enhancer-blocking insulator in Arabidopsis thaliana

    Science.gov (United States)

    While a great deal of research has been dedicated towards the identification and characterization of enhancer-blocking insulators in animal systems, there is a paucity of information concerning these elements in plants. Because there appears to be some overlap in the properties of enhancer-blocking...

  12. Intergenic sequence between Arabidopsis caseinolytic protease B-cytoplasmic/heat shock protein100 and choline kinase genes functions as a heat-inducible bidirectional promoter.

    Science.gov (United States)

    Mishra, Ratnesh Chandra; Grover, Anil

    2014-11-01

    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling. © 2014 American Society of Plant Biologists. All Rights Reserved.

  13. Body protective compound-157 enhances alkali-burn wound healing in vivo and promotes proliferation, migration, and angiogenesis in vitro

    Directory of Open Access Journals (Sweden)

    Huang T

    2015-04-01

    Full Text Available Tonglie Huang,1,* Kuo Zhang,2,* Lijuan Sun,3 Xiaochang Xue,1 Cun Zhang,1 Zhen Shu,1 Nan Mu,1 Jintao Gu,1 Wangqian Zhang,1 Yukun Wang,1 Yingqi Zhang,1 Wei Zhang1 1State Key Laboratory of Cancer Biology, Department of Biopharmaceutics, School of Pharmacy, The Fourth Military Medical University, 2National Engineering Research Center for Miniaturized Detection Systems, School of Life Sciences, Northwest University, 3Department of Ophthalmology, Xijing Hospital, The Fourth Military Medical University, Xi’an, People’s Republic of China *These authors contributed equally to this work Abstract: Chemical burns take up a high proportion of burns admissions and can penetrate deep into tissues. Various reagents have been applied in the treatment of skin chemical burns; however, no optimal reagent for skin chemical burns currently exists. The present study investigated the effect of topical body protective compound (BPC-157 treatment on skin wound healing, using an alkali burn rat model. Topical treatment with BPC-157 was shown to accelerate wound closure following an alkali burn. Histological examination of skin sections with hematoxylin–eosin and Masson staining showed better granulation tissue formation, reepithelialization, dermal remodeling, and a higher extent of collagen deposition when compared to the model control group on the 18th day postwounding. BPC-157 could promote vascular endothelial growth factor expression in wounded skin tissues. Furthermore, 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide and cell cycle analysis demonstrated that BPC-157 enhanced the proliferation of human umbilical vein endothelial cells (HUVECs. Transwell assay and wound healing assay showed that BPC-157 significantly promoted migration of HUVECs. We also observed that BPC-157 upregulated the expression of VEGF-a and accelerated vascular tube formation in vitro. Moreover, further studies suggested that BPC-157 regulated the phosphorylation level of

  14. Using an Inducible Promoter of a Gene Encoding Penicillium verruculosum Glucoamylase for Production of Enzyme Preparations with Enhanced Cellulase Performance.

    Directory of Open Access Journals (Sweden)

    Alexander G Bulakhov

    Full Text Available Penicillium verruculosum is an efficient producer of highly active cellulase multienzyme system. One of the approaches for enhancing cellulase performance in hydrolysis of cellulosic substrates is to enrich the reaction system with β -glucosidase and/or accessory enzymes, such as lytic polysaccharide monooxygenases (LPMO displaying a synergism with cellulases.Genes bglI, encoding β-glucosidase from Aspergillus niger (AnBGL, and eglIV, encoding LPMO (formerly endoglucanase IV from Trichoderma reesei (TrLPMO, were cloned and expressed by P. verruculosum B1-537 strain under the control of the inducible gla1 gene promoter. Content of the heterologous AnBGL in the secreted multienzyme cocktails (hBGL1, hBGL2 and hBGL3 varied from 4 to 10% of the total protein, while the content of TrLPMO in the hLPMO sample was ~3%. The glucose yields in 48-h hydrolysis of Avicel and milled aspen wood by the hBGL1, hBGL2 and hBGL3 preparations increased by up to 99 and 80%, respectively, relative to control enzyme preparations without the heterologous AnBGL (at protein loading 5 mg/g substrate for all enzyme samples. The heterologous TrLPMO in the hLPMO preparation boosted the conversion of the lignocellulosic substrate by 10-43%; however, in hydrolysis of Avicel the hLPMO sample was less effective than the control preparations. The highest product yield in hydrolysis of aspen wood was obtained when the hBGL2 and hLPMO preparations were used at the ratio 1:1.The enzyme preparations produced by recombinant P. verruculosum strains, expressing the heterologous AnBGL or TrLPMO under the control of the gla1 gene promoter in a starch-containing medium, proved to be more effective in hydrolysis of a lignocellulosic substrate than control enzyme preparations without the heterologous enzymes. The enzyme composition containing both AnBGL and TrLPMO demonstrated the highest performance in lignocellulose hydrolysis, providing a background for developing a fungal strain capable

  15. High-throughput sequencing enhanced phage display enables the identification of patient-specific epitope motifs in serum

    DEFF Research Database (Denmark)

    Christiansen, Anders; Kringelum, Jens Vindahl; Hansen, Christian Skjødt

    2015-01-01

    of the bioinformatic approach was demonstrated by identifying epitopes of a prominent peanut allergen, Ara h 1, in sera from patients with severe peanut allergy. The identified epitopes were confirmed by high-density peptide micro-arrays. The present study demonstrates that high-throughput sequencing can empower phage...

  16. Eliminating HIV-1 Packaging Sequences from Lentiviral Vector Proviruses Enhances Safety and Expedites Gene Transfer for Gene Therapy.

    Science.gov (United States)

    Vink, Conrad A; Counsell, John R; Perocheau, Dany P; Karda, Rajvinder; Buckley, Suzanne M K; Brugman, Martijn H; Galla, Melanie; Schambach, Axel; McKay, Tristan R; Waddington, Simon N; Howe, Steven J

    2017-08-02

    Lentiviral vector genomic RNA requires sequences that partially overlap wild-type HIV-1 gag and env genes for packaging into vector particles. These HIV-1 packaging sequences constitute 19.6% of the wild-type HIV-1 genome and contain functional cis elements that potentially compromise clinical safety. Here, we describe the development of a novel lentiviral vector (LTR1) with a unique genomic structure designed to prevent transfer of HIV-1 packaging sequences to patient cells, thus reducing the total HIV-1 content to just 4.8% of the wild-type genome. This has been achieved by reconfiguring the vector to mediate reverse-transcription with a single strand transfer, instead of the usual two, and in which HIV-1 packaging sequences are not copied. We show that LTR1 vectors offer improved safety in their resistance to remobilization in HIV-1 particles and reduced frequency of splicing into human genes. Following intravenous luciferase vector administration to neonatal mice, LTR1 sustained a higher level of liver transgene expression than an equivalent dose of a standard lentivirus. LTR1 vectors produce reverse-transcription products earlier and start to express transgenes significantly quicker than standard lentiviruses after transduction. Finally, we show that LTR1 is an effective lentiviral gene therapy vector as demonstrated by correction of a mouse hemophilia B model. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  17. A Study on the Promotion of the Participation in the IAEA Cooperative Research Programme and the Enhancement of Technical Cooperation

    International Nuclear Information System (INIS)

    Kim, Kyoung Pyo; Juhn, P. E.; Shim, J. S.; Kang, S. B.; Choi, P. H.; Kim, M. R.; Seo, M. W.; Lee, J. K.; Cho, C.; Jung, S. H.

    2005-12-01

    The trend of the IAEA major programmes for 2004-2005 and their major changes were reviewed and a planning direction for the 2006-2007 programmes was analyzed. Also, major stumbling blocks for a future participation in the CRP and the areas in which Korea can take initiatives in the future were identified by analyzing the current status of the 2004 IAEA CRP. Various efforts such as an earlier receipt of information about an application for next year, publication and distribution of an application guide book, holding an explanation session to provide guidance on drafting an application and the complementary application documents have been made to increase the number of applications and an effective project management to increase the acceptance rate, has been conducted. Especially, active and efficient promotion activities for new participations in the CRP have maximized the effects for enhancing the participation in the CRP through posting the CPR application information on the domestic nuclear related organizations web sites. It is expected that the suggested recommendations such as an analysis of the benefits from a participation in the program, ways to expand participation in the new projects and its effective operation will be a great asset for establishing a nuclear policy in the future. In addition, the analysis of problems which are barriers to applications for a new program by analyzing the current status of the CRP programs that the IAEA has already implemented or is now implementing will be utilized for understanding which areas the IAEA will focus on and in identifying the projects which Korea should play a leading role in their implementation, thus leading to an increase in the acceptance rate of Korea's applications to the IAEA CRP program

  18. GLP-1 analogs reduce hepatocyte steatosis and improve survival by enhancing the unfolded protein response and promoting macroautophagy.

    Directory of Open Access Journals (Sweden)

    Shvetank Sharma

    Full Text Available Nonalcoholic fatty liver disease (NAFLD is a known outcome of hepatosteatosis. Free fatty acids (FFA induce the unfolded protein response (UPR or endoplasmic reticulum (ER stress that may induce apoptosis. Recent data indicate ER stress to be a major player in the progression of fatty liver to more aggressive lesions. Autophagy on the other hand has been demonstrated to be protective against ER stress-induced cell death. We hypothesized that exendin-4 (GLP-1 analog treatment of fat loaded hepatocytes can reduce steatosis by autophagy which leads to reduced ER stress-related hepatocyte apoptosis.Primary human hepatocytes were loaded with saturated, cis- and trans-unsaturated fatty acids (palmitic, oleic and elaidic acid respectively. Steatosis, induced with all three fatty acids, was significantly resolved after exendin-4 treatment. Exendin-4 sustained levels of GRP78 expression in fat-loaded cells when compared to untreated fat-loaded cells alone. In contrast, CHOP (C/EBP homologous protein; the penultimate protein that leads to ER stress-related cell death was significantly decreased by exendin-4 in hepatocytes loaded with fatty acids. Finally, exendin-4 in fat loaded hepatocytes clearly promoted gene products associated with macroautophagy as measured by enhanced production of both Beclin-1 and LC3B-II, markers for autophagy; and visualized by transmission electron microscopy (TEM. Similar observations were made in mouse liver lysates after mice were fed with high fat high fructose diet and treated with a long acting GLP-1 receptor agonist, liraglutide.GLP-1 proteins appear to protect hepatocytes from fatty acid-related death by prohibition of a dysfunctional ER stress response; and reduce fatty acid accumulation, by activation of both macro-and chaperone-mediated autophagy. These findings provide a novel role for GLP-1 proteins in halting the progression of more aggressive lesions from underlying steatosis in humans afflicted with NAFLD.

  19. Genome Sequence and Transcriptome Analyses of Chrysochromulina tobin: Metabolic Tools for Enhanced Algal Fitness in the Prominent Order Prymnesiales (Haptophyceae.

    Directory of Open Access Journals (Sweden)

    Blake T Hovde

    Full Text Available Haptophytes are recognized as seminal players in aquatic ecosystem function. These algae are important in global carbon sequestration, form destructive harmful blooms, and given their rich fatty acid content, serve as a highly nutritive food source to a broad range of eco-cohorts. Haptophyte dominance in both fresh and marine waters is supported by the mixotrophic nature of many taxa. Despite their importance the nuclear genome sequence of only one haptophyte, Emiliania huxleyi (Isochrysidales, is available. Here we report the draft genome sequence of Chrysochromulina tobin (Prymnesiales, and transcriptome data collected at seven time points over a 24-hour light/dark cycle. The nuclear genome of C. tobin is small (59 Mb, compact (∼ 40% of the genome is protein coding and encodes approximately 16,777 genes. Genes important to fatty acid synthesis, modification, and catabolism show distinct patterns of expression when monitored over the circadian photoperiod. The C. tobin genome harbors the first hybrid polyketide synthase/non-ribosomal peptide synthase gene complex reported for an algal species, and encodes potential anti-microbial peptides and proteins involved in multidrug and toxic compound extrusion. A new haptophyte xanthorhodopsin was also identified, together with two "red" RuBisCO activases that are shared across many algal lineages. The Chrysochromulina tobin genome sequence provides new information on the evolutionary history, ecology and economic importance of haptophytes.

  20. Classical Mus musculus Igκ enhancers support transcription but not high level somatic hypermutation from a V-lambda promoter in chicken DT40 cells.

    Directory of Open Access Journals (Sweden)

    Naga Rama Kothapalli

    2011-04-01

    Full Text Available Somatic hypermutation (SHM of immunoglobulin genes is initiated by activation-induced cytidine deaminase (AID in activated B cells. This process is strictly dependent on transcription. Hence, cis-acting transcriptional control elements have been proposed to target SHM to immunoglobulin loci. The Mus musculus Igκ locus is regulated by the intronic enhancer (iE/MAR and the 3' enhancer (3'E, and multiple studies using transgenic and knock-out approaches in mice and cell lines have reported somewhat contradictory results about the function of these enhancers in AID-mediated sequence diversification. Here we show that the M. musculus iE/MAR and 3'E elements are active solely as transcriptional enhancer when placed in the context of the IGL locus in Gallus gallus DT40 cells, but they are very inefficient in targeting AID-mediated mutation events to this locus. This suggests that either key components of the cis-regulatory targeting elements reside outside the murine Igκ transcriptional enhancer sequences, or that the targeting of AID activity to Ig loci occurs by largely species-specific mechanisms.

  1. Detection of liver lesions with gadolinium-enhanced VIBE sequence in comparison with SPIO-enhanced MRI; Detektion von Leberlaesionen mit der Gadolinium-verstaerkten VIBE-Sequenz im Vergleich zur SPIO-verstaerkten MRT

    Energy Technology Data Exchange (ETDEWEB)

    Heim, P.; Steiner, P.; Dieckmann, C.; Adam, G. [Universitaetsklinikum Hamburg-Eppendorf (Germany). Klinik und Poliklinik fuer Diagnostische und Interventionelle Radiologie; Schoder, V. [Universitaetsklinikum Hamburg-Eppendorf (Germany). Inst. fuer Medizinische Biometrie und Epidemiologie; Kuhlencordt, R. [Universitaetsklinikum Hamburg-Eppendorf (Germany). Klinik und Poliklinik fuer Allgemein-, Viszeral-, und Thoraxchirurgie

    2003-10-01

    Purpose: Detection of malignant liver lesions with gadolinium-enhanced volumetric interpolated breath-hold examination (VIBE) in comparison with SPIO-enhanced MRT (four different SPIO-enhanced T2w sequences) and histological and imaging follow-up in non-cirrhotic livers at 1.5 T. Patients and methods: Twenty-two patients with suspected focal liver lesions prospectively underwent a gadolinium-enhanced 3D VIBE. Four T2w sequences (HASTE sequence, fast spin-echo-sequence with and without fat-saturation, FLASH 2D gradient echo-sequence) after administration of superparamagnetic iron oxide (SPIO) served as gold standard combined with histological work-up in 17 patients and histological and imaging follow-up in five patients. The image quality was evaluated and the detectability of intrahepatic lesions was rated by the alternative free-response receiver operating characteristic (AFROC) analysis. In addition, the contrast-to-noise ration was compared. Results: Altogether 49 malignant and 35 benign liver lesions were found. Concerning the image quality, VIBE turned out to be of slightly poorer image quality than the SPIO-enhanced examination with HASTE sequence (4.95 vs. 5.0). The fast spin-echo-sequence without fat-saturation demonstrated the highest contrast-to-noise ratio. All sequences showed a comparable certainty in detecting lesion (area under the curve 0.68-0.74) and identifying malignant liver lesions. Conclusions: Despite the small number of patients, VIBE seems to be a comparable, inexpensive and fast method in diagnosing malignant liver lesions. (orig.) [German] Ziel: Detektion maligner Leberlaesionen mit der Gadolinium-verstaerkten 3D-Gradientenecho-Sequenz in Atemanhaltetechnik (VIBE-Sequenz) im Vergleich mit der SPIO-verstaerkten MRT (vier verschiedene SPIO-verstaerkte T2-gew. Sequenzen) sowie histologischen und bildgebenden (Verlaufs-) Untersuchungen in nicht-zirrhotischen Lebern bei 1,5 T. Patienten und Methoden: 22 Patienten mit Verdacht auf maligne

  2. Tectonic uplift-influenced monsoonal changes promoted hominin occupation of the Luonan Basin: Insights from a loess-paleosol sequence, eastern Qinling Mountains, central China

    Science.gov (United States)

    Fang, Qian; Hong, Hanlie; Zhao, Lulu; Furnes, Harald; Lu, Huayu; Han, Wen; Liu, Yao; Jia, Zhuoyue; Wang, Chaowen; Yin, Ke; Algeo, Thomas J.

    2017-08-01

    Quaternary soil deposits from northern and southern China are distinctly different, reflecting variability of the East Asian monsoon north and south of the Qinling Mountains. Coeval sediments from the transitional climatic zone of central China, which are little studied to date, have the potential to improve our understanding of Quaternary monsoon changes and associated influences on hominin occupation of this region. Here, we investigate in detail a well-preserved and continuous Quaternary loess-paleosol sequence (Shangbaichuan) from the Luonan Basin, using a variety of weathering indices including major and trace element ratios, clay mineralogy, and Fe-oxide mineralogy. The whole-rock samples display similar rare earth element patterns characterized by upper continental crustal ratios: (La/Yb)N ≈ 9.5 and Eu/Eu* ≈ 0.65. Elemental data such as (La/Yb)N, La/Th and Eu/Eu* ratios show a high degree of homogeneity, suggesting that dust in the source region may have been thoroughly mixed and recycled, resulting in all samples having a uniform initial composition. Indices for pedogenic weathering such as Na/K, Ba/Sr, Rb/Sr, CIA, CIW, CPA, PIA, kaolinite/illite, (kaolinite + smectite)/illite, and hematite/(hematite + goethite) exhibit similar secular trends and reveal a four-stage accumulation history. The indices also indicate that the climate was warmer and wetter during the most recent interglacial stage, compared with coeval environments of the Chinese Loess Plateau. Secular changes in weathering intensity can be related to stepwise uplift of the Qinling Mountains and variation in East Asian monsoon intensity, both of which played significant roles in controlling climate evolution in the Luonan Basin. Furthermore, intensified aridity and winter monsoon strength in dust source areas, as evidenced by mineralogic and geochemical changes, may have been due to the mid-Pleistocene climate transition. Based on temporal correlation of warmer and wetter climatic conditions

  3. Comparison between gadolinium-enhanced 2D T1-weighted gradient-echo and spin-echo sequences in the detection of active multiple sclerosis lesions on 3.0T MRI

    Energy Technology Data Exchange (ETDEWEB)

    Aymerich, F.X. [Hospital Universitari Vall d' Hebron, Universitat Autonoma de Barcelona, MR Unit. Department of Radiology (IDI), Barcelona (Spain); Universitat Politecnica de Catalunya - Barcelona Tech (UPC), Department of Automatic Control (ESAII), Barcelona (Spain); Auger, C.; Alcaide-Leon, P.; Pareto, D.; Huerga, E.; Corral, J.F.; Mitjana, R.; Rovira, A. [Hospital Universitari Vall d' Hebron, Universitat Autonoma de Barcelona, MR Unit. Department of Radiology (IDI), Barcelona (Spain); Sastre-Garriga, J.; Montalban, X. [Hospital Universitari Vall d' Hebron, Universitat Autonoma de Barcelona, Centre d' Esclerosi Multiple de Catalunya (Cemcat), Department of Neurology/Neuroimmunology, Barcelona (Spain)

    2017-04-15

    To compare the sensitivity of enhancing multiple sclerosis (MS) lesions in gadolinium-enhanced 2D T1-weighted gradient-echo (GRE) and spin-echo (SE) sequences, and to assess the influence of visual conspicuity and laterality on detection of these lesions. One hundred MS patients underwent 3.0T brain MRI including gadolinium-enhanced 2D T1-weighted GRE and SE sequences. The two sets of contrast-enhanced scans were evaluated in random fashion by three experienced readers. Lesion conspicuity was assessed by the image contrast ratio (CR) and contrast-to-noise ratio (CNR). The intracranial region was divided into four quadrants and the impact of lesion location on detection was assessed in each slice. Six hundred and seven gadolinium-enhancing MS lesions were identified. GRE images were more sensitive for lesion detection (0.828) than SE images (0.767). Lesions showed a higher CR in SE than in GRE images, whereas the CNR was higher in GRE than SE. Most misclassifications occurred in the right posterior quadrant. The gadolinium-enhanced 2D T1-weighted GRE sequence at 3.0T MRI enables detection of enhancing MS lesions with higher sensitivity and better lesion conspicuity than 2D T1-weighted SE. Hence, we propose the use of gadolinium-enhanced GRE sequences rather than SE sequences for routine scanning of MS patients at 3.0T. (orig.)

  4. Evidence that phosphatidylcholine-specific phospholipase C is a key molecule mediating insulin-induced enhancement of gene expression from human cytomegalovirus promoter in CHO cells

    OpenAIRE

    Zhang, Yingpei; Katakura, Yoshinori; Seto, Perry; Shirahata, Sanetaka

    1997-01-01

    The signal transduction from insulin to its receptors and Ras has been extensively studied, while little has been reported beyond these steps. We found that the expression of human interleukin 6 gene under the control of immediate early gene promoter of human cytomegalovirus was enhanced by insulin sitmulation in Chinese hamster ovary cells. The induction effect of insulin was not significantly affected by inhibitors or activators of conventional protein kinase C, cAMP dependent protein kinas...

  5. Perspectives on enhancing physical activity and diet for health promotion among at-risk urban UK South Asian communities: a qualitative study

    OpenAIRE

    Cross-Bardell, Laura; George, Tracey; Bhoday, Mandeep; Tuomainen, Helena; Qureshi, Nadeem; Kai, Joe

    2015-01-01

    Objectives \\ud \\ud To explore perspectives on enhancing physical activity and diet among South Asians in urban deprived communities at high risk of chronic disease and to inform development of culturally appropriate health promotion intervention. \\ud \\ud Design\\ud \\ud Qualitative study using semistructured one-to-one and family group interviews with thematic analysis of data. \\ud \\ud \\ud Setting \\ud \\ud Urban disadvantaged communities in the East Midlands of the UK. \\ud \\ud \\ud Participants \\...

  6. The upstream regulatory sequence of the light harvesting complex Lhcf2 gene of the marine diatom Phaeodactylum tricornutum enhances transcription in an orientation- and distance-independent fashion.

    Science.gov (United States)

    Russo, Monia Teresa; Annunziata, Rossella; Sanges, Remo; Ferrante, Maria Immacolata; Falciatore, Angela

    2015-12-01

    Diatoms are a key phytoplankton group in the contemporary ocean, showing extraordinary adaptation capacities to rapidly changing environments. The recent availability of whole genome sequences from representative species has revealed distinct features in their genomes, like novel combinations of genes encoding distinct metabolisms and a significant number of diatom-specific genes. However, the regulatory mechanisms driving diatom gene expression are still largely uncharacterized. Considering the wide variety of fields of study orbiting diatoms, ranging from ecology, evolutionary biology to biotechnology, it is thus essential to increase our understanding of fundamental gene regulatory processes such as transcriptional regulation. To this aim, we explored the functional properties of the 5'-flanking region of the Phaeodatylum tricornutum Lhcf2 gene, encoding a member of the Light Harvesting Complex superfamily and we showed that this region enhances transcription of a GUS reporter gene in an orientation- and distance-independent fashion. This represents the first example of a cis-regulatory sequence with enhancer-like features discovered in diatoms and it is instrumental for the generation of novel genetic tools and diatom exploitation in different areas of study. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2002-10-15

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  8. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2003-03-04

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  9. Evaluation of iron colloid-enhanced T{sub 2}-weighted fast MR imaging of hepatocellular carcinoma. Comparison of SE, TSE and TGSE sequences

    Energy Technology Data Exchange (ETDEWEB)

    Sugihara, Shuji; Suto, Yuji; Kamba, Masayuki; Yoshida, Kotarou; Ohta, Yoshio [Tottori Univ., Yonago (Japan). Faculty of Medicine

    1996-06-01

    We have applied chondroitin sulfate iron colloid (CSIC) as a contrast agent for MRI in detecting hepatocellular carcinoma (HCC) on conventional spin-echo sequences (SE). In this report, we evaluated CSIC-enhanced T{sub 2}-weighted fast MR imaging of HCC. MR imaging were performed before and after i.v. administration of CSIC in 15 patients with 46 HCCs. T{sub 2}-weighted SE (1800/80/2, 210 x 256 matrix), T{sub 2}-weighted turbo spin-echo (TSE1800) (1800/90/5, echo train length=7, 252 x 256 matrix), TSE (3500/90/5, echo train length=7, 252 x 256 matrix) (TSE7), TSE (3500/99/5, echo train length=11, 242 x 256 matrix) (TSE11) and T{sub 2}-weighted turbo-gradient spine-echo (TGSE) (4500/108/4, echo train length=33, 252 x 256 matrix) images were compared quantitatively and qualitatively. In all sequences, liver signal-to-noise ratio (SNR) was significantly decreased and lesion-to-liver contrast-to-noise ratio (CNR) was significantly increased after CSIC administration. Although decreased ratio in liver and tumor SNR caused by CSIC was smaller on TSE sequences compared with SE and TGSE, increased ratio in lesion-to-liver CNR was largest on TSE7. Either before or after i.v. administration of CSIC, the number of detectable lesions was largest on TSE7. TSE with used longer TR, TE and decreased echo factor was useful method for CSIC-enhanced abdominal MR imaging. (author)

  10. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    Science.gov (United States)

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  11. Deep developmental transcriptome sequencing uncovers numerous new genes and enhances gene annotation in the sponge Amphimedon queenslandica.

    Science.gov (United States)

    Fernandez-Valverde, Selene L; Calcino, Andrew D; Degnan, Bernard M

    2015-05-15

    The demosponge Amphimedon queenslandica is amongst the few early-branching metazoans with an assembled and annotated draft genome, making it an important species in the study of the origin and early evolution of animals. Current gene models in this species are largely based on in silico predictions and low coverage expressed sequence tag (EST) evidence. Amphimedon queenslandica protein-coding gene models are improved using deep RNA-Seq data from four developmental stages and CEL-Seq data from 82 developmental samples. Over 86% of previously predicted genes are retained in the new gene models, although 24% have additional exons; there is also a marked increase in the total number of annotated 3' and 5' untranslated regions (UTRs). Importantly, these new developmental transcriptome data reveal numerous previously unannotated protein-coding genes in the Amphimedon genome, increasing the total gene number by 25%, from 30,060 to 40,122. In general, Amphimedon genes have introns that are markedly smaller than those in other animals and most of the alternatively spliced genes in Amphimedon undergo intron-retention; exon-skipping is the least common mode of alternative splicing. Finally, in addition to canonical polyadenylation signal sequences, Amphimedon genes are enriched in a number of unique AT-rich motifs in their 3' UTRs. The inclusion of developmental transcriptome data has substantially improved the structure and composition of protein-coding gene models in Amphimedon queenslandica, providing a more accurate and comprehensive set of genes for functional and comparative studies. These improvements reveal the Amphimedon genome is comprised of a remarkably high number of tightly packed genes. These genes have small introns and there is pervasive intron retention amongst alternatively spliced transcripts. These aspects of the sponge genome are more similar unicellular opisthokont genomes than to other animal genomes.

  12. DNA-mediated dimerization on a compact sequence signature controls enhancer engagement and regulation by FOXA1.

    Science.gov (United States)

    Wang, Xuecong; Srivastava, Yogesh; Jankowski, Aleksander; Malik, Vikas; Wei, Yuanjie; Del Rosario, Ricardo C H; Cojocaru, Vlad; Prabhakar, Shyam; Jauch, Ralf

    2018-04-14

    FOXA1 is a transcription factor capable to bind silenced chromatin to direct context-dependent cell fate conversion. Here, we demonstrate that a compact palindromic DNA element (termed 'DIV' for its diverging half-sites) induces the homodimerization of FOXA1 with strongly positive cooperativity. Alternative structural models are consistent with either an indirect DNA-mediated cooperativity or a direct protein-protein interaction. The cooperative homodimer formation is strictly constrained by precise half-site spacing. Re-analysis of chromatin immunoprecipitation sequencing data indicates that the DIV is effectively targeted by FOXA1 in the context of chromatin. Reporter assays show that FOXA1-dependent transcriptional activity declines when homodimeric binding is disrupted. In response to phosphatidylinositol-3 kinase inhibition DIV sites pre-bound by FOXA1 such as at the PVT1/MYC locus exhibit a strong increase in accessibility suggesting a role of the DIV configuration in the chromatin closed-open dynamics. Moreover, several disease-associated single nucleotide polymorphisms map to DIV elements and show allelic differences in FOXA1 homodimerization, reporter gene expression and are annotated as quantitative trait loci. This includes the rs541455835 variant at the MAPT locus encoding the Tau protein associated with Parkinson's disease. Collectively, the DIV guides chromatin engagement and regulation by FOXA1 and its perturbation could be linked to disease etiologies.

  13. Draft genome sequence of Burkholderia sordidicola S170, a potential plant growth promoter isolated from coniferous forest soil in the Czech Republic

    DEFF Research Database (Denmark)

    Lladó, Salvador; Xu, Zhuofei; Sørensen, Søren Johannes

    2014-01-01

    Burkholderia species are key players in the accumulation of carbon from cellulose decomposition in coniferous forest ecosystems. We report here the draft genome of Burkholderia sordidicola strain S170, containing features associated with known genes involved in plant growth promotion...

  14. The hTERT promoter enhances the antitumor activity of an oncolytic adenovirus under a hypoxic microenvironment.

    Directory of Open Access Journals (Sweden)

    Yuuri Hashimoto

    Full Text Available Hypoxia is a microenvironmental factor that contributes to the invasion, progression and metastasis of tumor cells. Hypoxic tumor cells often show more resistance to conventional chemoradiotherapy than normoxic tumor cells, suggesting the requirement of novel antitumor therapies to efficiently eliminate the hypoxic tumor cells. We previously generated a tumor-specific replication-competent oncolytic adenovirus (OBP-301: Telomelysin, in which the human telomerase reverse transcriptase (hTERT promoter drives viral E1 expression. Since the promoter activity of the hTERT gene has been shown to be upregulated by hypoxia, we hypothesized that, under hypoxic conditions, the antitumor effect of OBP-301 with the hTERT promoter would be more efficient than that of the wild-type adenovirus 5 (Ad5. In this study, we investigated the antitumor effects of OBP-301 and Ad5 against human cancer cells under a normoxic (20% oxygen or a hypoxic (1% oxygen condition. Hypoxic condition induced nuclear accumulation of the hypoxia-inducible factor-1α and upregulation of hTERT promoter activity in human cancer cells. The cytopathic activity of OBP-301 was significantly higher than that of Ad5 under hypoxic condition. Consistent with their cytopathic activity, the replication of OBP-301 was significantly higher than that of Ad5 under the hypoxic condition. OBP-301-mediated E1A was expressed within hypoxic areas of human xenograft tumors in mice. These results suggest that the cytopathic activity of OBP-301 against hypoxic tumor cells is mediated through hypoxia-mediated activation of the hTERT promoter. Regulation of oncolytic adenoviruses by the hTERT promoter is a promising antitumor strategy, not only for induction of tumor-specific oncolysis, but also for efficient elimination of hypoxic tumor cells.

  15. The Arsenic Resistance-Associated Listeria Genomic Island LGI2 Exhibits Sequence and Integration Site Diversity and a Propensity for Three Listeria monocytogenes Clones with Enhanced Virulence.

    Science.gov (United States)

    Lee, Sangmi; Ward, Todd J; Jima, Dereje D; Parsons, Cameron; Kathariou, Sophia

    2017-11-01

    In the foodborne pathogen Listeria monocytogenes , arsenic resistance is encountered primarily in serotype 4b clones considered to have enhanced virulence and is associated with an arsenic resistance gene cluster within a 35-kb chromosomal region, Listeria genomic island 2 (LGI2). LGI2 was first identified in strain Scott A and includes genes putatively involved in arsenic and cadmium resistance, DNA integration, conjugation, and pathogenicity. However, the genomic localization and sequence content of LGI2 remain poorly characterized. Here we investigated 85 arsenic-resistant L. monocytogenes strains, mostly of serotype 4b. All but one of the 70 serotype 4b strains belonged to clonal complex 1 (CC1), CC2, and CC4, three major clones associated with enhanced virulence. PCR analysis suggested that 53 strains (62.4%) harbored an island highly similar to LGI2 of Scott A, frequently (42/53) in the same location as Scott A ( LMOf2365_2257 homolog). Random-primed PCR and whole-genome sequencing revealed seven novel insertion sites, mostly internal to chromosomal coding sequences, among strains harboring LGI2 outside the LMOf2365_2257 homolog. Interestingly, many CC1 strains harbored a noticeably diversified LGI2 (LGI2-1) in a unique location ( LMOf2365_0902 homolog) and with a novel additional gene. With few exceptions, the tested LGI2 genes were not detected in arsenic-resistant strains of serogroup 1/2, which instead often harbored a Tn 554 -associated arsenic resistance determinant not encountered in serotype 4b. These findings indicate that in L. monocytogenes , LGI2 has a propensity for certain serotype 4b clones, exhibits content diversity, and is highly promiscuous, suggesting an ability to mobilize various accessory genes into diverse chromosomal loci. IMPORTANCE Listeria monocytogenes is widely distributed in the environment and causes listeriosis, a foodborne disease with high mortality and morbidity. Arsenic and other heavy metals can powerfully shape the

  16. Bivalent promoter marks and a latent enhancer may prime the leukaemia oncogene LMO1 for ectopic expression in T-cell leukaemia.

    Science.gov (United States)

    Oram, S H; Thoms, J; Sive, J I; Calero-Nieto, F J; Kinston, S J; Schütte, J; Knezevic, K; Lock, R B; Pimanda, J E; Göttgens, B

    2013-06-01

    LMO1 is a transcriptional regulator and a T-acute lymphoblastic leukaemia (T-ALL) oncogene. Although first identified in association with a chromosomal translocation in T-ALL, the ectopic expression of LMO1 occurs far more frequently in the absence of any known mutation involving its locus. Given that LMO1 is barely expressed in any haematopoietic lineage, and activation of transcriptional drivers in leukaemic cells is not well described, we investigated the regulation of this gene in normal haematopoietic and leukaemic cells. We show that LMO1 has two promoters that drive reporter gene expression in transgenic mice to neural tissues known to express endogenous LMO1. The LMO1 promoters display bivalent histone marks in multiple blood lineages including T-cells, and a 3' flanking region at LMO1 +57 contains a transcriptional enhancer that is active in developing blood cells in transgenic mouse embryos. The LMO1 promoters become activated in T-ALL together with the 3' enhancer, which is bound in primary T-ALL cells by SCL/TAL1 and GATA3. Taken together, our results show that LMO1 is poised for expression in normal progenitors, where activation of SCL/TAL1 together with a breakdown of epigenetic repression of LMO1 regulatory elements induces ectopic LMO1 expression that contributes to the development and maintenance of T-ALL.

  17. Resistance to BmNPV via overexpression of an exogenous gene controlled by an inducible promoter and enhancer in transgenic silkworm, Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Liang Jiang

    Full Text Available The hycu-ep32 gene of Hyphantria cunea NPV can inhibit Bombyx mori nucleopolyhedrovirus (BmNPV multiplication in co-infected cells, but it is not known whether the overexpression of the hycu-ep32 gene has an antiviral effect in the silkworm, Bombyx mori. Thus, we constructed four transgenic vectors, which were under the control of the 39 K promoter of BmNPV (39 KP, Bombyx mori A4 promoter (A4P, hr3 enhancer of BmNPV combined with 39 KP, and hr3 combined with A4P. Transgenic lines were created via embryo microinjection using practical diapause silkworm. qPCR revealed that the expression level of hycu-ep32 could be induced effectively after BmNPV infection in transgenic lines where hycu-ep32 was controlled by hr3 combined with 39 KP (i.e., HEKG. After oral inoculation of BmNPV with 3 × 10(5 occlusion bodies per third instar, the mortality with HEKG-B was approximately 30% lower compared with the non-transgenic line. The economic characteristics of the transgenic lines remained unchanged. These results suggest that overexpression of an exogenous antiviral gene controlled by an inducible promoter and enhancer is a feasible method for breeding silkworms with a high antiviral capacity.

  18. The dipeptide Pro-Asp promotes IGF-1 secretion and expression in hepatocytes by enhancing JAK2/STAT5 signaling pathway.

    Science.gov (United States)

    Wang, Songbo; Wang, Guoqing; Zhang, Mengyuan; Zhuang, Lu; Wan, Xiaojuan; Xu, Jingren; Wang, Lina; Zhu, Xiaotong; Gao, Ping; Xi, Qianyun; Zhang, Yongliang; Shu, Gang; Jiang, Qingyan

    2016-11-15

    It has been implicated that IGF-1 secretion can be regulated by dietary protein. However, whether the dipeptides, one of digested products of dietary protein, have influence on IGF-1 secretion remain largely unknown. Our study aimed to investigate the effects of the dipeptide Pro-Asp on IGF-1 secretion and expression in hepatocytes and to explore the possible underlying mechanisms. Our findings demonstrated that Pro-Asp promoted the secretion and gene expression of IGF-1 in HepG2 cells and primary porcine hepatocytes. Meanwhile, Pro-Asp activated the ERK and Akt signaling pathways, downstream of IGF-1. In addition, Pro-Asp enhanced GH-mediated JAK2/STAT5 signaling pathway, while inhibition of JAK2/STAT5 blocked the promotive effect of Pro-Asp on IGF-1 secretion and expression. Moreover, acute injection of Pro-Asp stimulated IGF-1 expression and activated JAK2/STAT5 signaling pathway in mice liver. Together, these results suggested that the dipeptide Pro-Asp promoted IGF-1 secretion and expression in hepatocytes by enhancing GH-mediated JAK2/STAT5 signaling pathway. Copyright © 2016. Published by Elsevier Ireland Ltd.

  19. Receptor Protein Tyrosine Phosphatase α-Mediated Enhancement of Rheumatoid Synovial Fibroblast Signaling and Promotion of Arthritis in Mice

    NARCIS (Netherlands)

    Stanford, Stephanie M; Svensson, Mattias N D; Sacchetti, Cristiano; Pilo, Caila A; Wu, Dennis J; Kiosses, William B; Hellvard, Annelie; Bergum, Brith; Muench, German R Aleman; Elly, Christian; Liu, Yun-Cai; den Hertog, Jeroen; Elson, Ari; Sap, Jan; Mydel, Piotr; Boyle, David L; Corr, Maripat; Firestein, Gary S; Bottini, Nunzio

    OBJECTIVE: During rheumatoid arthritis (RA), fibroblast-like synoviocytes (FLS) critically promote disease pathogenesis by aggressively invading the extracellular matrix of the joint. The focal adhesion kinase (FAK) signaling pathway is emerging as a contributor to the anomalous behavior of RA FLS.

  20. Enhancing Parent-Child Shared Book Reading Interactions: Promoting References to the Book's Plot and Socio-Cognitive Themes

    Science.gov (United States)

    Aram, Dorit; Fine, Yaara; Ziv, Margalit

    2013-01-01

    The study examined the efficacy of an intervention designed to promote parents' and preschoolers' references to storybooks' plot and socio-cognitive themes during shared reading within a sample of 58 families from low-SES background. All parents were given four books, one new book weekly, and were instructed to read each book four times per week…

  1. Enhancing Established Counting Routines to Promote Place-Value Understanding: An Empirical Study in Early Elementary Classrooms

    Science.gov (United States)

    Fraivillig, Judith L.

    2018-01-01

    Understanding place value is a critical and foundational competency for elementary mathematics. Classroom teachers who endeavor to promote place-value development adopt a variety of established practices to varying degrees of effectiveness. In parallel, researchers have validated models of how young children acquire place-value understanding.…

  2. Promoting Social Inclusion: A Structured Intervention for Enhancing Interpersonal Problem-Solving Skills in Children with Mild Intellectual Disabilities

    Science.gov (United States)

    Vlachou, Anastasia; Stavroussi, Panayiota

    2016-01-01

    There has been increasing interest in providing students with disabilities, who are at risk of social isolation, with opportunities to develop social competence and self-determination. Specifically, the provision of opportunities for teaching these students to promote social problem-solving skills is potentially useful for facilitating their…

  3. The promoter of the Arabidopsis thaliana plastocyanin gene contains a far upstream enhancer-like element involved in chloroplast-dependent expression.

    Science.gov (United States)

    Vorst, O; Kock, P; Lever, A; Weterings, B; Weisbeek, P; Smeekens, S

    1993-12-01

    Plastocyanin is part of the photosynthetic electron transport chain in the chloroplast and is encoded in the nucleus. Expression of the Arabidopsis thaliana plastocyanin gene is organ specific: high mRNA levels are observed in young green parts of the plant. Furthermore, expression is dependent on the presence of light and functional chloroplasts. When grown in the presence of norflurazon under white light conditions, resulting in the photo-oxidative destruction of the chloroplast, plastocyanin mRNA levels are strongly reduced. A -1579 to -9 promoter fragment confers light-regulated and chloroplast-dependent expression to the beta-glucuronidase reporter gene in transgenic tobacco plants. This suggests that regulation takes place at the level of transcription. A plastocyanin promoter deletion series ranging from -1579 to -121 which was also tested in tobacco, revealed the presence of a strong positive regulating element (PRE) in the -1579 to -705 region. Deletion of this part of the promoter resulted in a approximately 100-fold reduction of GUS expression as measured in mature leaves. Surprisingly, this enhancer-like element was capable of stimulating transcription from a position downstream of its reporter. Moreover, it could also activate a truncated CaMV 35S promoter. Deletion of this element coincides with the loss of chloroplast-dependency of reporter gene expression, as judged by norflurazon treatment of transgenic seedlings. So, the activity of the PRE itself might depend on the presence of functional chloroplasts.

  4. Gadolinium-enhanced MR imaging of normal renal transplants. An evaluation of a T1-weighted dynamic echo-planar sequence

    International Nuclear Information System (INIS)

    Dupas, B.; Blancho, G.; Havet, T.; Leaute, F.

    1999-01-01

    Purpose: To evaluate the potential usefulness of dynamic MR with echoplanar imaging (EPI) in assessing the renal function in patients with renal allografts. Material and methods: Using a T1-weighted sequence, EPI was performed after injection of a Gd-chelate in 17 patients with normally functioning renal allografts. Time-intensity curves were plotted from the signal intensity (SI) measurements of the cortex and the medulla. Results: The pattern of corticomedullar differentiation (CMD) observed after constrast enhancement was divided into four phases using the T1-EPI. After a rapid decrease in the SI of cortical structures, and a subsequent return to precontrast levels, a gradual fall in the SI of the medulla was observed. The average time between the two periods of signal loss was 60 s. Conclusion: This study illustrated the potential use of dynamic T1-EPI to demonstrate contrast-induced CMD in renal allografts. (orig.)

  5. Development of normal fetal brain by MRI with a half-Fourier rapid acquisition with relaxation enhancement sequence

    International Nuclear Information System (INIS)

    Li Meilan; Liu Xuejun; Wang Jianhong; Zhao Cheng; Li Xiang

    2006-01-01

    Objective: To evaluate normal maturation of the fetal brain with half-Fourier rapid acquisition with relaxation enhancement (RARE) MRI. Methods: The normal brains of 25 fetuses of 12-38 weeks gestational age were examined in utero with half-Fourier RARE imaging. Gyrus maturation, gray and white matter differentiation, ventricle-to-brain diameter ratio, and subarachnoid space size were evaluated with respect to gestational age. Results: At 12-23 weeks, the brain had a smooth surface, and two or three layers were differentiated in the cerebral cortex. At 24-26 weeks, only a few shallow grooves were seen in the central sulcus, and three layers, including the immature cortex, intermediate zone, and germinal matrix, were differentiated in all fetuses. At 27-29 weeks, sulcus formation was observed in various regions of the brain parenchyma, and the germinal matrix became invisible. Sulcation was seen in the whole cerebral cortex from 30 weeks on. However, the cortex did not undergo infolding, and opercular formation was not seen before 33 weeks. At 23 weeks and earlier, the cerebral ventricles were large; thereafter, they gradually became smaller. The subarachnoid space overlying the cortical convexities was slightly dilated at all gestational ages, most markedly at 21-26 weeks. Conclusion: Changes in brain maturation proceed through stages in an orderly and predictable fashion and can be evaluated reliably with half-Fourier RARE MRI. (authors)

  6. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  7. Brain histamine depletion enhances the behavioural sequences complexity of mice tested in the open-field: Partial reversal effect of the dopamine D2/D3 antagonist sulpiride.

    Science.gov (United States)

    Santangelo, Andrea; Provensi, Gustavo; Costa, Alessia; Blandina, Patrizio; Ricca, Valdo; Crescimanno, Giuseppe; Casarrubea, Maurizio; Passani, M Beatrice

    2017-02-01

    Markers of histaminergic dysregulation were found in several neuropsychiatric disorders characterized by repetitive behaviours, thoughts and stereotypies. We analysed the effect of acute histamine depletion by means of i. c.v. injections of alpha-fluoromethylhistidine, a blocker of histidine decarboxylase, on the temporal organization of motor sequences of CD1 mice behaviour in the open-field test. An ethogram encompassing 9 behavioural components was employed. Durations and frequencies were only slightly affected by treatments. However, as revealed by multivariate t-pattern analysis, histamine depletion was associated with a striking increase in the number of behavioural patterns. We found 42 patterns of different composition occurring, on average, 520.90 ± 50.23 times per mouse in the histamine depleted (HD) group, whereas controls showed 12 different patterns occurring on average 223.30 ± 20.64 times. Exploratory and grooming behaviours clustered separately, and the increased pattern complexity involved exclusively exploratory patterns. To test the hypothesis of a histamine-dopamine interplay on behavioural pattern phenotype, non-sedative doses of the D2/D3 antagonist sulpiride (12.5-25-50 mg/kg) were additionally administered to different groups of HD mice. Sulpiride counterbalanced the enhancement of exploratory patterns of different composition, but it did not affect the mean number of patterns at none of the doses used. Our results provide new insights on the role of histamine on repetitive behavioural sequences of freely moving mice. Histamine deficiency is correlated with a general enhancement of pattern complexity. This study supports a putative involvement of histamine in the pathophysiology of tics and related disorders. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. [Ru(bipy)3]2+ nanoparticle-incorporate dental light cure resin to promote photobiomodulation therapy for enhanced vital pulp tissue repair

    Science.gov (United States)

    Mosca, Rodrigo C.; Young, Nicholas; Zeituni, Carlos A.; Arany, Praveen R.

    2018-02-01

    The use of nanoparticle on dental light cure resin is not new, currently several compounds (nanoadditives) are used to promote better communication between the restorative material and biological tissues. The interest for this application is growing up to enhance mechanical proprieties to dental tissue cells regeneration. Bioactive nanoparticles and complex compounds with multiple functions are the major target for optimizing the restorative materials. In this work, we incorporate [Ru(bipy)3]2+ nanoparticles, that absorbs energy at 450 nm (blue-light) and emits strongly at 620 nm (red-light), in PLGA Microspheres and insert it in Dental Light Cure Resin to promote the Photobiomodulation Therapy (PBM) effects to accelerate dental pulp repair by in vitro using cytotoxicity and proliferation assay.

  9. Expression of a maize Myb transcription factor driven by a putative silk-specific promoter significantly enhances resistance to Helicoverpa zea in transgenic maize.

    Science.gov (United States)

    Johnson, Eric T; Berhow, Mark A; Dowd, Patrick F

    2007-04-18

    Hi II maize (Zea mays) plants were engineered to express maize p1 cDNA, a Myb transcription factor, controlled by a putative silk specific promoter, for secondary metabolite production and corn earworm resistance. Transgene expression did not enhance silk color, but about half of the transformed plant silks displayed browning when cut, which indicated the presence of p1-produced secondary metabolites. Levels of maysin, a secondary metabolite with insect toxicity, were highest in newly emerged browning silks. The insect resistance of transgenic silks was also highest at emergence, regardless of maysin levels, which suggests that other unidentified p1-induced molecules likely contributed to larval mortality. Mean survivor weights of corn earworm larvae fed mature browning transgenic silks were significantly lower than weights of those fed mature nonbrowning transgenic silks. Some transgenic pericarps browned with drying and contained similar molecules found in pericarps expressing a dominant p1 allele, suggesting that the promoter may not be silk-specific.

  10. Assessment of myocardial infarction in mice by Late Gadolinium Enhancement MR imaging using an inversion recovery pulse sequence at 9.4T

    Directory of Open Access Journals (Sweden)

    Herlihy Amy H

    2008-01-01

    Full Text Available Abstract Purpose To demonstrate the feasibility of using an inversion recovery pulse sequence and to define the optimal inversion time (TI to assess myocardial infarction in mice by late gadolinium enhancement (LGE MRI at 9.4T, and to obtain the maximal contrast between the infarcted and the viable myocardium. Methods MRI was performed at 9.4T in mice, two days after induction of myocardial infarction (n = 4. For cardiovascular MR imaging, a segmented magnetization-prepared fast low angle shot (MP-FLASH sequence was used with varied TIs ranging from 40 to 420 ms following administration of gadolinium-DTPA at 0.6 mmol/kg. Contrast-to-noise (CNR and signal-to-noise ratio (SNR were measured and compared for each myocardial region of interest (ROI. Results The optimal TI, which corresponded to a minimum SNR in the normal myocardium, was 268 ms ± 27.3. The SNR in the viable myocardium was significantly different from that found in the infarcted myocardium (17.2 ± 2.4 vs 82.1 ± 10.8; p = 0.006 leading to a maximal relative SI (Signal Intensity between those two areas (344.9 ± 60.4. Conclusion Despite the rapid heart rate in mice, our study demonstrates that LGE MRI can be performed at 9.4T using a protocol similar to the one used for clinical MR diagnosis of myocardial infarction.

  11. A String Number-Line Lesson Sequence to Promote Students' Relative Thinking and Understanding of Scale, Key Elements of Proportional Reasoning

    Science.gov (United States)

    Hilton, Annette; Hilton, Geoff

    2018-01-01

    This article describes part of a study in which researchers designed lesson sequences based around using a string number line to help teachers support children's development of relative thinking and understanding of linear scale. In the first year of the study, eight teachers of Years 3-5 participated in four one-day professional development…

  12. Dual‑sensitive HRE/Egr1 promoter regulates Smac overexpression and enhances radiation‑induced A549 human lung adenocarcinoma cell death under hypoxia.

    Science.gov (United States)

    Li, Chang-Feng; Chen, Li-Bo; Li, Dan-Dan; Yang, Lei; Zhang, Bao-Gang; Jin, Jing-Peng; Zhang, Ying; Zhang, Bin

    2014-08-01

    The aim of this study was to construct an expression vector carrying the hypoxia/radiation dual‑sensitive chimeric hypoxia response element (HRE)/early growth response 1 (Egr‑1) promoter in order to overexpress the therapeutic second mitochondria‑derived activator of caspases (Smac). Using this expression vector, the present study aimed to explore the molecular mechanism underlying radiotherapy‑induced A549 human lung adenocarcinoma cell death and apoptosis under hypoxia. The plasmids, pcDNA3.1‑Egr1‑Smac (pE‑Smac) and pcDNA3.1‑HRE/Egr-1‑Smac (pH/E‑Smac), were constructed and transfected into A549 human lung adenocarcinoma cells using the liposome method. CoCl2 was used to chemically simulate hypoxia, followed by the administration of 2 Gy X‑ray irradiation. An MTT assay was performed to detect cell proliferation and an Annexin V‑fluorescein isothiocyanate apoptosis detection kit was used to detect apoptosis. Quantitative polymerase chain reaction and western blot analyses were used for the detection of mRNA and protein expression, respectively. Infection with the pE‑Smac and pH/E‑Smac plasmids in combination with radiation and/or hypoxia was observed to enhance the expression of Smac. Furthermore, Smac overexpression was found to enhance the radiation‑induced inhibition of cell proliferation and promotion of cycle arrest and apoptosis. The cytochrome c/caspase‑9/caspase‑3 pathway was identified to be involved in this regulation of apoptosis. Plasmid infection in combination with X‑ray irradiation was found to markedly induce cell death under hypoxia. In conclusion, the hypoxia/radiation dual‑sensitive chimeric HRE/Egr‑1 promoter was observed to enhance the expression of the therapeutic Smac, as well as enhance the radiation‑induced inhibition of cell proliferation and promotion of cycle arrest and apoptosis under hypoxia. This apoptosis was found to involve the mitochondrial pathway.

  13. Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

    Science.gov (United States)

    Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

    1993-12-01

    Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

  14. Hydration properties of natural and synthetic DNA sequences with methylated adenine or cytosine bases in the R.DpnI target and BDNF promoter studied by molecular dynamics simulations

    Science.gov (United States)

    Shanak, Siba; Helms, Volkhard

    2014-12-01

    Adenine and cytosine methylation are two important epigenetic modifications of DNA sequences at the levels of the genome and transcriptome. To characterize the differential roles of methylating adenine or cytosine with respect to their hydration properties, we performed conventional MD simulations and free energy perturbation calculations for two particular DNA sequences, namely the brain-derived neurotrophic factor (BDNF) promoter and the R.DpnI-bound DNA that are known to undergo methylation of C5-methyl cytosine and N6-methyl adenine, respectively. We found that a single methylated cytosine has a clearly favorable hydration free energy over cytosine since the attached methyl group has a slightly polar character. In contrast, capping the strongly polar N6 of adenine with a methyl group gives a slightly unfavorable contribution to its free energy of solvation. Performing the same demethylation in the context of a DNA double-strand gave quite similar results for the more solvent-accessible cytosine but much more unfavorable results for the rather buried adenine. Interestingly, the same demethylation reactions are far more unfavorable when performed in the context of the opposite (BDNF or R.DpnI target) sequence. This suggests a natural preference for methylation in a specific sequence context. In addition, free energy calculations for demethylating adenine or cytosine in the context of B-DNA vs. Z-DNA suggest that the conformational B-Z transition of DNA transition is rather a property of cytosine methylated sequences but is not preferable for the adenine-methylated sequences investigated here.

  15. The mechanism of enhanced wastewater nitrogen removal by photo-sequencing batch reactors based on comprehensive analysis of system dynamics within a cycle.

    Science.gov (United States)

    Ye, Jianfeng; Liang, Junyu; Wang, Liang; Markou, Giorgos

    2018-07-01

    To understand the mechanism of enhanced nitrogen removal by photo-sequencing batch reactors (photo-SBRs), which incorporated microalgal photosynthetic oxygenation into the aerobic phases of a conventional cycle, this study performed comprehensive analysis of one-cycle dynamics. Under a low aeration intensity (about 0.02 vvm), a photo-SBR, illuminated with light at 92.27 μ·mol·m -2 ·s -1 , could remove 99.45% COD, 99.93% NH 4 + -N, 90.39% TN, and 95.17% TP, while the control SBR could only remove 98.36% COD, 83.51% NH 4 + -N, 78.96% TN, and 97.75% TP, for a synthetic domestic sewage. The specific oxygen production rate (SOPR) of microalgae in the photo-SBR could reach 6.63 fmol O 2 ·cell -1 ·h -1 . One-cycle dynamics shows that the enhanced nitrogen removal by photo-SBRs is related to photosynthetic oxygenation, resulting in strengthened nitrification, instead of direct nutrient uptake by microalgae. A too high light or aeration intensity could deteriorate anoxic conditions and thus adversely affect the removal of TN and TP in photo-SBRs. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Primary structure and promoter analysis of leghemoglobin genes of the stem-nodulated tropical legume Sesbania rostrata: conserved coding sequences, cis-elements and trans-acting factors

    DEFF Research Database (Denmark)

    Metz, B A; Welters, P; Hoffmann, H J

    1988-01-01

    The primary structure of a leghemoglobin (lb) gene from the stem-nodulated, tropical legume Sesbania rostrata and two lb gene promoter regions was analysed. The S. rostrata lb gene structure and Lb amino acid composition were found to be highly conserved with previously described lb genes and Lb ...

  17. Draft Genome Sequence of the Plant Growth–Promoting Pseudomonas punonensis Strain D1-6 Isolated from the Desert Plant Erodium hirtum in Jordan

    KAUST Repository

    Lafi, Feras Fawzi

    2017-01-13

    Pseudomonas punonensis strain D1-6 was isolated from roots of the desert plant Erodium hirtum, near the Dead Sea in Jordan. The genome of strain D1-6 reveals several key plant growth-promoting and herbicide-resistance genes, indicating a possible specialized role for this endophyte.

  18. Draft Genome Sequence of the Plant Growth–Promoting Pseudomonas punonensis Strain D1-6 Isolated from the Desert Plant Erodium hirtum in Jordan

    KAUST Repository

    Lafi, Feras Fawzi; AL Bladi, Maha Lafi Saleh; Salem, Nida M.; Al-Banna, Luma; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Pseudomonas punonensis strain D1-6 was isolated from roots of the desert plant Erodium hirtum, near the Dead Sea in Jordan. The genome of strain D1-6 reveals several key plant growth-promoting and herbicide-resistance genes, indicating a possible specialized role for this endophyte.

  19. Draft Genome Sequence of Bacillus amyloliquefaciens EBL11, a New Strain of Plant Growth-Promoting Bacterium Isolated from Rice Rhizosphere

    Science.gov (United States)

    Wang, Yinghuan; Greenfield, Paul; Jin, Decai

    2014-01-01

    Bacillus amyloliquefaciens strain EBL11 is a bacterium that can promote plant growth by inhibiting the growth of fungi on plant surfaces and providing nutrients as a nonchemical biofertilizer. The estimated genome of this strain is 4.05 Mb in size and harbors 3,683 coding genes (CDSs). PMID:25059875

  20. A protein binding AT-rich sequence in the soybean leghemoglobin c3 promoter is a general cis element that requires proximal DNA elements to stimulate transcription

    DEFF Research Database (Denmark)

    Laursen, N B; Larsen, K; Knudsen, J Y

    1994-01-01

    in combination with other trans-acting factor(s) to increase expression. The finding of NAT2-like binding activities in different plant organs and the specific expression of the hybrid NAT2 BS1/-312 rbcS-8B promoter in leaves suggest that NAT2 is a general activator of transcription. Udgivelsesdato: 1994-May...

  1. Identification of the promoter region required for human adiponectin gene transcription: Association with CCAAT/enhancer binding protein-β and tumor necrosis factor-α

    International Nuclear Information System (INIS)

    Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi

    2005-01-01

    Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β

  2. Enhanced

    Directory of Open Access Journals (Sweden)

    Martin I. Bayala

    2014-06-01

    Full Text Available Land Surface Temperature (LST is a key parameter in the energy balance model. However, the spatial resolution of the retrieved LST from sensors with high temporal resolution is not accurate enough to be used in local-scale studies. To explore the LST–Normalised Difference Vegetation Index relationship potential and obtain thermal images with high spatial resolution, six enhanced image sharpening techniques were assessed: the disaggregation procedure for radiometric surface temperatures (TsHARP, the Dry Edge Quadratic Function, the Difference of Edges (Ts∗DL and three models supported by the relationship of surface temperature and water stress of vegetation (Normalised Difference Water Index, Normalised Difference Infrared Index and Soil wetness index. Energy Balance Station data and in situ measurements were used to validate the enhanced LST images over a mixed agricultural landscape in the sub-humid Pampean Region of Argentina (PRA, during 2006–2010. Landsat Thematic Mapper (TM and Moderate Resolution Imaging Spectroradiometer (EOS-MODIS thermal datasets were assessed for different spatial resolutions (e.g., 960, 720 and 240 m and the performances were compared with global and local TsHARP procedures. Results suggest that the Ts∗DL technique is the most adequate for simulating LST to high spatial resolution over the heterogeneous landscape of a sub-humid region, showing an average root mean square error of less than 1 K.

  3. Hepatitis B spliced protein (HBSP) promotes the carcinogenic effects of benzo [alpha] pyrene by interacting with microsomal epoxide hydrolase and enhancing its hydrolysis activity

    International Nuclear Information System (INIS)

    Chen, Jin-Yan; Chen, Wan-Nan; Jiao, Bo-Yan; Lin, Wan-Song; Wu, Yun-Li; Liu, Ling-Ling; Lin, Xu

    2014-01-01

    The risk of hepatocellular carcinoma (HCC) increases in chronic hepatitis B surface antigen (HBsAg) carriers who often have concomitant increase in the levels of benzo[alpha]pyrene-7,8-diol-9,10-epoxide(±) (BPDE)-DNA adduct in liver tissues, suggesting a possible co-carcinogenesis of Hepatitis B virus (HBV) and benzo[alpha]pyrene in HCC; however the exact mechanisms involved are unclear. The interaction between hepatitis B spliced protein (HBSP) and microsomal epoxide hydrolase (mEH) was confirmed using GST pull-down, co-immunoprecipitation and mammalian two-hybrid assay; the effects of HBSP on mEH-mediated B[alpha]P metabolism was examined by high performance liquid chromatography (HPLC); and the influences of HBSP on B[alpha]P carcinogenicity were evaluated by bromodeoxyuridine cell proliferation, anchorage-independent growth and tumor xenograft. HBSP could interact with mEH in vitro and in vivo, and this interaction was mediated by the N terminal 47 amino acid residues of HBSP. HBSP could greatly enhance the hydrolysis activity of mEH in cell-free mouse liver microsomes, thus accelerating the metabolism of benzo[alpha]pyrene to produce more ultimate carcinnogen, BPDE, and this effect of HBSP requires the intact HBSP molecule. Expression of HBSP significantly increased the formation of BPDE-DNA adduct in benzo[alpha]pyrene-treated Huh-7 hepatoma cells, and this enhancement was blocked by knockdown of mEH. HBSP could enhance the cell proliferation, accelerate the G1/S transition, and promote cell transformation and tumorigenesis of B[alpha]P-treated Huh-7 hepatoma cells. Our results demonstrated that HBSP could promote carcinogenic effects of B[alpha]P by interacting with mEH and enhancing its hydrolysis activity

  4. High Glucose Concentration Promotes Vancomycin-Enhanced Biofilm Formation of Vancomycin-Non-Susceptible Staphylococcus aureus in Diabetic Mice.

    Directory of Open Access Journals (Sweden)

    Chi-Yu Hsu

    Full Text Available We previously demonstrated that vancomycin treatment increased acquisition of eDNA and enhanced biofilm formation of drug-resistant Staphylococcus aureus through a cidA-mediated autolysis mechanism. Recently we found that such enhancement became more significant under a higher glucose concentration in vitro. We propose that besides improper antibiotic treatment, increased glucose concentration environment in diabetic animals may further enhance biofilm formation of drug-resistant S. aureus. To address this question, the diabetic mouse model infected by vancomycin-resistant S. aureus (VRSA was used under vancomycin treatment. The capacity to form biofilms was evaluated through a catheter-associated biofilm assay. A 10- and 1000-fold increase in biofilm-bound bacterial colony forming units was observed in samples from diabetic mice without and with vancomycin treatment, respectively, compared to healthy mice. By contrast, in the absence of glucose vancomycin reduced propensity to form biofilms in vitro through the increased production of proteases and DNases from VRSA. Our study highlights the potentially important role of increased glucose concentration in enhancing biofilm formation in vancomycin-treated diabetic mice infected by drug-resistant S. aureus.

  5. [Clonage of the "malA" region of "Escherichia coli" K12: nucleotide sequence of the regulatory region and the promoters, identification and purification of the MalT-activator protein (author's transl)].

    Science.gov (United States)

    Raibaud, O; Débarbouillé, M; Cossart, P

    1982-01-01

    A 5,800-bp (base pair) HindIII-EcoRI DNA fragment containing malT, the positive regulator gene of the maltose regulon, and most of malP, the structural gene for maltodextrin phosphorylase, was cloned into pBR322. A sequence of 802 bp was established in a DNA segment containing the promotor for malPQ and the promoter for malT. A total of 611 bp separates the initiation codons for these two genes, which are transcribed in opposite directions. The malT product was identified as a 94,000 dalton polypeptide.

  6. Hes1 promotes the IL-22-mediated antimicrobial response by enhancing STAT3-dependent transcription in human intestinal epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Murano, Tatsuro [Department of Gastroenterology and Hepatology, Graduate School, Tokyo Medical and Dental University, Tokyo (Japan); Okamoto, Ryuichi, E-mail: rokamoto.gast@tmd.ac.jp [Department of Gastroenterology and Hepatology, Graduate School, Tokyo Medical and Dental University, Tokyo (Japan); Department of Advanced GI Therapeutics, Graduate School, Tokyo Medical and Dental University, Tokyo (Japan); Ito, Go; Nakata, Toru; Hibiya, Shuji; Shimizu, Hiromichi; Fujii, Satoru; Kano, Yoshihito; Mizutani, Tomohiro; Yui, Shiro; Akiyama-Morio, Junko; Nemoto, Yasuhiro [Department of Gastroenterology and Hepatology, Graduate School, Tokyo Medical and Dental University, Tokyo (Japan); Tsuchiya, Kiichiro; Nakamura, Tetsuya [Department of Gastroenterology and Hepatology, Graduate School, Tokyo Medical and Dental University, Tokyo (Japan); Department of Advanced GI Therapeutics, Graduate School, Tokyo Medical and Dental University, Tokyo (Japan); Watanabe, Mamoru [Department of Gastroenterology and Hepatology, Graduate School, Tokyo Medical and Dental University, Tokyo (Japan)

    2014-01-17

    Highlights: •Hes1 enhances IL-22-STAT3 signaling in human intestinal epithelial cells. •Hes1 enhances REG family gene induction by IL-22-STAT3 signaling. •Protein level of Hes1 restricts the response to IL-22. •Present regulation of a cytokine signal represents a new mode of Hes1 function. -- Abstract: Notch signaling plays an essential role in the proliferation and differentiation of intestinal epithelial cells (IECs). We have previously shown that Notch signaling is up-regulated in the inflamed mucosa of ulcerative colitis (UC) and thereby plays an indispensable role in tissue regeneration. Here we show that in addition to Notch signaling, STAT3 signaling is highly activated in the inflamed mucosa of UC. Forced expression of the Notch target gene Hes1 dramatically enhanced the IL-22-mediated STAT3-dependent transcription in human IECs. This enhancement of STAT3-dependent transcription was achieved by the extended phosphorylation of STAT3 by Hes1. Microarray analysis revealed that Hes1-mediated enhancement of IL-22-STAT3 signaling significantly increased the induction of genes encoding antimicrobial peptides, such as REG1A, REG3A and REG3G, in human IECs. Conversely, the reduction of Hes1 protein levels with a γ-secretase inhibitor significantly down-regulated the induction of those genes in IECs, resulting in a markedly poor response to IL-22. Our present findings identify a new role for the molecular function of Hes1 in which the protein can interact with cytokine signals and regulate the immune response of IECs.

  7. Does Academic Blogging Enhance Promotion and Tenure? A Survey of US and Canadian Medicine and Pediatric Department Chairs.

    Science.gov (United States)

    Cameron, Christian Blake; Nair, Vinay; Varma, Manu; Adams, Martha; Jhaveri, Kenar D; Sparks, Matthew A

    2016-06-23

    Electronic educational (e-learning) technology usage continues to grow. Many medical journals operate companion blogs (an application of e-learning technology) that enable rapid dissemination of scientific knowledge and discourse. Faculty members participating in promotion and tenure academic tracks spend valuable time and effort contributing, editing, and directing these medical journal blogs. We sought to understand whether chairs of medicine and pediatric departments acknowledge blog authorship as academic achievement. The authors surveyed 267 chairs of US and Canadian medicine and pediatric departments regarding their attitudes toward the role of faculty participation in e-learning and blogging in the promotion and tenure process. The survey completion rate was 22.8% (61/267). A majority of respondents (87%, 53/61) viewed educational scholarship as either important or very important for promotion. However, only 23% (14/61) perceived importance to faculty effort in producing content for journal-based blogs. If faculty were to participate in blog authorship, 72% (44/61) of surveyed chairs favored involvement in a journal-based versus a society-based or a personal (nonaffiliated) blog. We identified a "favorable group" of chairs (19/59, 32%), who rated leadership roles in e-learning tools as important or very important, and an "unfavorable group" of chairs (40/59, 68%), who rated leadership roles in e-learning tools as somewhat important or not important. The favorable group were more likely to be aware of faculty bloggers within their departments (58%, 11/19 vs 25%, 10/40), viewed serving on editorial boards of e-learning tools more favorably (79%, 15/19 vs 31%, 12/39), and were more likely to value effort spent contributing to journal-based blogs (53%, 10/19 vs 10%, 4/40). Our findings demonstrate that although the majority of department chairs value educational scholarship, only a minority perceive value in faculty blogging effort.

  8. SCM-198 Ameliorates Cognitive Deficits, Promotes Neuronal Survival and Enhances CREB/BDNF/TrkB Signaling without Affecting Aβ Burden in AβPP/PS1 Mice

    Directory of Open Access Journals (Sweden)

    Zhen-Yi Hong

    2015-08-01

    Full Text Available SCM-198 is an alkaloid found only in Herba leonuri and it has been reported to possess considerable neuroprotective effects in animal models of ischemic stroke, Parkinson’s disease and Alzheimer’s disease (AD. In this study, we demonstrated for the first time that 3-month oral SCM-198 treatment could significantly improve both recognition and spatial memory, inhibit microgliosis and promote neuronal survival in amyloid-β protein precursor and presenilin-1(AβPP/PS1 double-transgenic mice without affecting amyloid-β (Aβ burden. In addition, decreases in cAMP-response element-binding protein (CREB phosphorylation, brain-derived neurotrophic factor (BDNF and tropomyosin-related kinase B (TrkB phosphorylation were attenuated by SCM-198 both in vivo and in primary cortical neurons, which could be blocked by protein kinase A (PKA inhibitors, suggesting the involvement of upstream PKA in enhancing the BDNF/TrkB/CREB signaling by SCM-198. Our results indicate that SCM-198, a drug that could promote neuronal survival and enhance BDNF/TrkB/CREB signaling, has beneficial effects on behavioral and biochemical alterations without affecting Aβ burden in AβPP/PS1 mice and might become a potential drug candidate for AD treatment in the future.

  9. SCM-198 Ameliorates Cognitive Deficits, Promotes Neuronal Survival and Enhances CREB/BDNF/TrkB Signaling without Affecting Aβ Burden in AβPP/PS1 Mice.

    Science.gov (United States)

    Hong, Zhen-Yi; Yu, Shuang-Shuang; Wang, Zhi-Jun; Zhu, Yi-Zhun

    2015-08-07

    SCM-198 is an alkaloid found only in Herba leonuri and it has been reported to possess considerable neuroprotective effects in animal models of ischemic stroke, Parkinson's disease and Alzheimer's disease (AD). In this study, we demonstrated for the first time that 3-month oral SCM-198 treatment could significantly improve both recognition and spatial memory, inhibit microgliosis and promote neuronal survival in amyloid-β protein precursor and presenilin-1(AβPP/PS1) double-transgenic mice without affecting amyloid-β (Aβ) burden. In addition, decreases in cAMP-response element-binding protein (CREB) phosphorylation, brain-derived neurotrophic factor (BDNF) and tropomyosin-related kinase B (TrkB) phosphorylation were attenuated by SCM-198 both in vivo and in primary cortical neurons, which could be blocked by protein kinase A (PKA) inhibitors, suggesting the involvement of upstream PKA in enhancing the BDNF/TrkB/CREB signaling by SCM-198. Our results indicate that SCM-198, a drug that could promote neuronal survival and enhance BDNF/TrkB/CREB signaling, has beneficial effects on behavioral and biochemical alterations without affecting Aβ burden in AβPP/PS1 mice and might become a potential drug candidate for AD treatment in the future.

  10. Correlation Between Expression of Recombinant Proteins and Abundance of H3K4Me3 on the Enhancer of Human Cytomegalovirus Major Immediate-Early Promoter.

    Science.gov (United States)

    Soo, Benjamin P C; Tay, Julian; Ng, Shirelle; Ho, Steven C L; Yang, Yuansheng; Chao, Sheng-Hao

    2017-08-01

    Role of epigenetic regulation in the control of gene expression is well established. The impact of several epigenetic mechanisms, such as DNA methylation and histone acetylation, on recombinant protein production in mammalian cells has been investigated recently. Here we investigate the correlation between the selected epigenetic markers and five trastuzumab biosimilar-producing Chinese hamster ovary (CHO) cell lines in which the expression of trastuzumab is driven by human cytomegalovirus (HCMV) major immediate-early (MIE) promoter. We chose the producing clones in which transcription was the determinative step for the production of recombinant trastuzumab. We found that the abundance of trimethylation of histone 3 at lysine 4 (H3K4Me3) on the enhancer of HCMV MIE promoter correlated well with the relative titers of recombinant trastuzumab among the clones. Such close correlation was not observed between the recombinant protein and other epigenetic markers examined in our study. Our results demonstrate that the HCMV MIE enhancer-bound H3K4Me3 epigenetic marker may be used as the epigenetic indicator to predict the relative production of recombinant proteins between the producing CHO cell lines.

  11. Applying carbon dioxide, plant growth-promoting rhizobacterium and EDTA can enhance the phytoremediation efficiency of ryegrass in a soil polluted with zinc, arsenic, cadmium and lead.

    Science.gov (United States)

    Guo, Junkang; Feng, Renwei; Ding, Yongzhen; Wang, Ruigang

    2014-08-01

    This study was conducted to investigate the use of elevated carbon dioxide (CO2), plant growth-promoting rhizobacterium Burkholderia sp. D54 (PGPR) and ethylenediaminetetraacetic acid (EDTA) to enhance the phytoextraction efficiency of ryegrass in response to multiple heavy metal (or metalloid)-polluted soil containing zinc (Zn), arsenic (As), cadmium (Cd) and lead (Pb). All of the single or combined CO2, PGPR and EDTA treatments promoted ryegrass growth. The stimulation of ryegrass growth by CO2 and PGPR could primarily be attributed to the regulation of photosynthesis rather than decreased levels of Zn, As and Cd in the shoots. Most treatments seemed to reduce the Zn, As and Cd contents in the shoots, which might be associated with enhanced shoot biomass, thus causing a "dilution effect" regarding their levels. The combined treatments seemed to perform better than single treatments in removing Zn, As, Cd and Pb from soil, judging from the larger biomass and relatively higher total amounts (TAs) of Zn, As, Cd and Pb in both the shoots and roots. Therefore, we suggest that the CO2 plus PGPR treatment will be suitable for removing Zn, As, Cd and Pb from heavy metal (or metalloid)-polluted soils using ryegrass as a phytoremediation material. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Optimized PCR with sequence specific primers (PCR-SSP for fast and efficient determination of Interleukin-6 Promoter -597/-572/-174Haplotypes

    Directory of Open Access Journals (Sweden)

    Bugert Peter

    2009-12-01

    Full Text Available Abstract Background Interleukin-6 (IL-6 promoter polymorphisms at positions -597(G→A, -572(G→C and -174(G→C were shown to have a clinical impact on different major diseases. At present PCR-SSP protocols for IL-6 -597/-572/-174haplotyping are elaborate and require large amounts of genomic DNA. Findings We describe an improved typing technique requiring a decreased number of PCR-reactions and a reduced PCR-runtime due to optimized PCR-conditions. Conclusion This enables a fast and efficient determination of IL-6 -597/-572/-174haplotypes in clinical diagnosis and further evaluation of IL-6 promoter polymorphisms in larger patient cohorts.

  13. Enhancer-driven chromatin interactions during development promote escape from silencing by a long non-coding RNA

    Directory of Open Access Journals (Sweden)

    Korostowski Lisa

    2011-11-01

    Full Text Available Abstract Background Gene regulation in eukaryotes is a complex process entailing the establishment of transcriptionally silent chromatin domains interspersed with regions of active transcription. Imprinted domains consist of clusters of genes, some of which exhibit parent-of-origin dependent monoallelic expression, while others are biallelic. The Kcnq1 imprinted domain illustrates the complexities of long-range regulation that coexists with local exceptions. A paternally expressed repressive non-coding RNA, Kcnq1ot1, regulates a domain of up to 750 kb, encompassing 14 genes. We study how the Kcnq1 gene, initially silenced by Kcnq1ot1, undergoes tissue-specific escape from imprinting during development. Specifically, we uncover the role of chromosome conformation during these events. Results We show that Kcnq1 transitions from monoallelic to biallelic expression during mid gestation in the developing heart. This transition is not associated with the loss of methylation on the Kcnq1 promoter. However, by exploiting chromosome conformation capture (3C technology, we find tissue-specific and stage-specific chromatin loops between the Kcnq1 promoter and newly identified DNA regulatory elements. These regulatory elements showed in vitro activity in a luciferase assay and in vivo activity in transgenic embryos. Conclusions By exploring the spatial organization of the Kcnq1 locus, our results reveal a novel mechanism by which local activation of genes can override the regional silencing effects of non-coding RNAs.

  14. Prior alcohol use enhances vulnerability to compulsive cocaine self-administration by promoting degradation of HDAC4 and HDAC5

    OpenAIRE

    Griffin, Edmund A.; Melas, Philippe A.; Zhou, Royce; Li, Yang; Mercado, Peter; Kempadoo, Kimberly A.; Stephenson, Stacy; Colnaghi, Luca; Taylor, Kathleen; Hu, Mei-Chen; Kandel, Eric R.; Kandel, Denise B.

    2017-01-01

    Addiction to cocaine is commonly preceded by experiences with legal or decriminalized drugs, such as alcohol, nicotine, and marijuana. The biological mechanisms by which these gateway drugs contribute to cocaine addiction are only beginning to be understood. We report that in the rat, prior alcohol consumption results in enhanced addiction-like behavior to cocaine, including continued cocaine use despite aversive consequences. Conversely, prior cocaine use has no effect on alcohol preference....

  15. A late embryogenesis abundant protein HVA1 regulated by an inducible promoter enhances root growth and abiotic stress tolerance in rice without yield penalty.

    Science.gov (United States)

    Chen, Yi-Shih; Lo, Shuen-Fang; Sun, Peng-Kai; Lu, Chung-An; Ho, Tuan-Hua D; Yu, Su-May

    2015-01-01

    Regulation of root architecture is essential for maintaining plant growth under adverse environment. A synthetic abscisic acid (ABA)/stress-inducible promoter was designed to control the expression of a late embryogenesis abundant protein (HVA1) in transgenic rice. The background of HVA1 is low but highly inducible by ABA, salt, dehydration and cold. HVA1 was highly accumulated in root apical meristem (RAM) and lateral root primordia (LRP) after ABA/stress treatments, leading to enhanced root system expansion. Water-use efficiency (WUE) and biomass also increased in transgenic rice, likely due to the maintenance of normal cell functions and metabolic activities conferred by HVA1 which is capable of stabilizing proteins, under osmotic stress. HVA1 promotes lateral root (LR) initiation, elongation and emergence and primary root (PR) elongation via an auxin-dependent process, particularly by intensifying asymmetrical accumulation of auxin in LRP founder cells and RAM, even under ABA/stress-suppressive conditions. We demonstrate a successful application of an inducible promoter in regulating the spatial and temporal expression of HVA1 for improving root architecture and multiple stress tolerance without yield penalty. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  16. Enhanced performance of the microalga Chlorella sorokiniana remotely induced by the plant growth-promoting bacteria Azospirillum brasilense and Bacillus pumilus

    Science.gov (United States)

    Amavizca, Edgar; Bashan, Yoav; Ryu, Choong-Min; Farag, Mohamed A.; Bebout, Brad M.; de-Bashan, Luz E.

    2017-01-01

    Remote effects (occurring without physical contact) of two plant growth-promoting bacteria (PGPB) Azospirillum brasilense Cd and Bacilus pumilus ES4 on growth of the green microalga Chlorella sorokiniana UTEX 2714 were studied. The two PGPB remotely enhanced the growth of the microalga, up to six-fold, and its cell volume by about three-fold. In addition to phenotypic changes, both bacteria remotely induced increases in the amounts of total lipids, total carbohydrates, and chlorophyll a in the cells of the microalga, indicating an alteration of the microalga’s physiology. The two bacteria produced large amounts of volatile compounds, including CO2, and the known plant growth-promoting volatile 2,3-butanediol and acetoin. Several other volatiles having biological functions in other organisms, as well as numerous volatile compounds with undefined biological roles, were detected. Together, these bacteria-derived volatiles can positively affect growth and metabolic parameters in green microalgae without physical attachment of the bacteria to the microalgae. This is a new paradigm on how PGPB promote growth of microalgae which may serve to improve performance of Chlorella spp. for biotechnological applications. PMID:28145473

  17. Localized sequence-specific release of a chemopreventive agent and an anticancer drug in a time-controllable manner to enhance therapeutic efficacy.

    Science.gov (United States)

    Pan, Wen-Yu; Lin, Kun-Ju; Huang, Chieh-Cheng; Chiang, Wei-Lun; Lin, Yu-Jung; Lin, Wei-Chih; Chuang, Er-Yuan; Chang, Yen; Sung, Hsing-Wen

    2016-09-01

    Combination chemotherapy with multiple drugs commonly requires several injections on various schedules, and the probability that the drug molecules reach the diseased tissues at the proper time and effective therapeutic concentrations is very low. This work elucidates an injectable co-delivery system that is based on cationic liposomes that are adsorbed on anionic hollow microspheres (Lipos-HMs) via electrostatic interaction, from which the localized sequence-specific release of a chemopreventive agent (1,25(OH)2D3) and an anticancer drug (doxorubicin; DOX) can be thermally driven in a time-controllable manner by an externally applied high-frequency magnetic field (HFMF). Lipos-HMs can greatly promote the accumulation of reactive oxygen species (ROS) in tumor cells by reducing their cytoplasmic expression of an antioxidant enzyme (superoxide dismutase) by 1,25(OH)2D3, increasing the susceptibility of cancer cells to the cytotoxic action of DOX. In nude mice that bear xenograft tumors, treatment with Lipos-HMs under exposure to HFMF effectively inhibits tumor growth and is the most effective therapeutic intervention among all the investigated. These empirical results demonstrate that the synergistic anticancer effects of sequential release of 1,25(OH)2D3 and DOX from the Lipos-HMs may have potential for maximizing DOX cytotoxicity, supporting more effective cancer treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset.

    Science.gov (United States)

    Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A

    2014-01-01

    The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  19. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

    Directory of Open Access Journals (Sweden)

    Elena V. Ignatieva

    2014-03-01

    Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  20. Annexin A4 fucosylation enhances its interaction with the NF-kB p50 and promotes tumor progression of ovarian clear cell carcinoma.

    Science.gov (United States)

    Wang, Huimin; Deng, Lu; Cai, Mingbo; Zhuang, Huiyu; Zhu, Liancheng; Hao, Yingying; Gao, Jian; Liu, Juanjuan; Li, Xiao; Lin, Bei

    2017-12-08

    To study the structural relationship between annexin A4 and the Lewis y antigen and compare their expression and significance in ovarian clear cell carcinoma, and to explore how annexin A4 fucose glycosylation effects the interaction between annexin A4 and NF-kB p50, and how it promotes tumour progression of ovarian clear cell carcinoma. Structural relationships between annexin A4 and Lewis y antigen were detected using immunoprecipitation. Annexin A4 and Lewis y antigen expression in various subtypes of ovarian cancer tissues was detected by immunohistochemistry, and the relation between their expression was examined. Any interactions between annexin A4 and NF-kB p50 in ovarian clear cell carcinoma were detected by co-immunoprecipitation. Then looked for changes in expression of Lewis y antigen, annexin A4, NF-kB p50 and a number of downstream related molecules before and after transfection annexin A4 or FUT1, and also analyzed changes in biological processes. Lewis y antigen is a part of annexin A4 structure. The expression rate of both annexin A4 and Lewis y antigen was significantly higher in ovarian clear cell carcinoma than in other subtypes of epithelial ovarian cancer, and are associated with the clinical stages, chemotherapy resistance and poor prognostic. The interaction between annexin A4 and NF-kB p50 promoted cell proliferation, adhesion, invasion, metastasis ability and autophagy, and inhibits apoptosis, Lewis y enhanced this interaction. Annexin A4 contains Lewis y structure, Lewis y antigen modification of annexin A4 enhances its interaction with NF-kB p50, which promotes ovarian clear cell carcinoma malignancy progression.

  1. Down-regulation of Transducin-Like Enhancer of Split protein 4 in hepatocellular carcinoma promotes cell proliferation and epithelial-Mesenchymal-Transition

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Xiao-cai; Xiao, Cui-cui; Li, Hua [Department of Hepatic Surgery, 3rd Affiliated Hospital of Sun Yat-sen University, Guangzhou (China); Guangdong Provincial Key Laboratory of Liver Disease Research, Guangzhou (China); Tai, Yan; Zhang, Qi [Guangdong Provincial Key Laboratory of Liver Disease Research, Guangzhou (China); Yang, Yang, E-mail: yysysu2@163.com [Department of Hepatic Surgery, 3rd Affiliated Hospital of Sun Yat-sen University, Guangzhou (China)

    2016-08-19

    Background: Transducin-Like Enhancer of Split protein 4 (TLE4) has been reported to be involved in some subsets of acute myeloid leukemia and colorectal cancer. In the present study, we aimed to explore the role of TLE4 in tumorigenesis and cancer progression in hepatocellular carcinoma (HCC). Methods: The expression pattern of TLE4 in HCC was determined by Western-blot and qRT-PCR, gain-of-function and loss-of-function was used to explore the biological role of TLE4 in HCC cells. A xenograft model was established to confirm its effects on proliferation. Results: The protein expression levels of TLE4 were significantly down-regulated in HCC tissues compared to matched adjacent normal liver tissues. In vitro, down-regulation of TLE4 in Huh7 or SMMC-7721 promoted cell proliferation and ectopical expression of TLE4 in Hep3B or Bel-7404 suppressed cell proliferation. In addition, the cell colony formation ability was enhanced after down-regulation of TLE4 expression in Huh-7 but suppressed after over-expression in Hep3B. Furthermore, down-regulation of TLE4 increased the cell invasion ability, as well as increased the expression level of Vimentin and decreased that of E-cadherin, indicating a phenotype of epithelial-mesenchymal transition (EMT) in HCC cells. On the contrary, ectopical expression of TLE4 in HCC cells decreased the cell invasion ability and inhibited EMT. In vivo, compared to control group, xenograft tumor volumes were significantly decreased in TLE4 overexpression group. Conclusions: These results demonstrated that TLE4 might play important regulatory roles in cellular proliferation and EMT process in HCC. - Highlights: • TLE4 is significantly down-regulated in HCC samples. • Down regulated of TLE4 in HCC cells promotes cell proliferation. • Down regulated of TLE4 in HCC cells promotes epithelial-to-mesenchymal transition.

  2. Anthocyanins from black rice (Oryza sativa) promote immune responses in leukemia through enhancing phagocytosis of macrophages in vivo.

    Science.gov (United States)

    Fan, Ming-Jen; Yeh, Ping-Hsuan; Lin, Jing-Pin; Huang, An-Cheng; Lien, Jin-Cherng; Lin, Hui-Yi; Chung, Jing-Gung

    2017-07-01

    Rice is a staple food in numerous countries around the world. Anthocyanins found in black rice have been reported to reduce the risk of certain diseases, but the effects of crude extract of anthocyanins from Asia University-selected purple glutinous indica rice (AUPGA) on immune responses have not yet been demonstrated. The current study aimed to investigate whether AUPGA treatment could affect immune responses in murine leukemia cells in vivo . Murine acute myelomonocytic leukemia WEHI-3 cells were intraperitoneally injected into normal BALB/c mice to generate leukemia mice. A total of 50 mice were randomly divided into five groups (n=10 in each group) and were fed a diet supplemented with AUPGA at 0, 20, 50 or 100 mg/kg for three weeks. All mice were weighed and the blood, liver and spleen were collected for further experiments. The results indicated that AUPGA did not significantly affect animal body weight, but significantly increased spleen weight (P<0.05) and decreased liver weight (P<0.05) when compared with the control group. AUPGA significantly increased the T cell (CD3) population at treatments of 20 and 100 mg/kg (P<0.05). However, it only significantly increased the B cell (CD19) population at a treatment of 20 mg/kg (P<0.05). Furthermore, AUPGA at 50 and 100 mg/kg significantly increased the monocyte (CD11b) population and the level of macrophages (Mac-3; P<0.05 for both). AUPGA at 50 and 100 mg/kg significantly promoted macrophage phagocytosis in peripheral blood mononuclear cells (P<0.05), and all doses of AUPGA treatment significantly promoted macrophage phagocytotic activity in the peritoneum (P<0.05). AUPGA treatment significantly decreased natural killer cell activity from splenocytes (P<0.05). Finally, AUPGA treatment at 20 mg/kg treatment significantly promoted T cell proliferation (P<0.05), and treatment at 50 and 100 mg/kg significantly decreased B cell proliferation compared with the control group (P<0.05).

  3. Label-Free Detection of Sequence-Specific DNA Based on Fluorescent Silver Nanoclusters-Assisted Surface Plasmon-Enhanced Energy Transfer.

    Science.gov (United States)

    Ma, Jin-Liang; Yin, Bin-Cheng; Le, Huynh-Nhu; Ye, Bang-Ce

    2015-06-17

    We have developed a label-free method for sequence-specific DNA detection based on surface plasmon enhanced energy transfer (SPEET) process between fluorescent DNA/AgNC string and gold nanoparticles (AuNPs). DNA/AgNC string, prepared by a single-stranded DNA template encoded two emitter-nucleation sequences at its termini and an oligo spacer in the middle, was rationally designed to produce bright fluorescence emission. The proposed method takes advantage of two strategies. The first one is the difference in binding properties of single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) toward AuNPs. The second one is SPEET process between fluorescent DNA/AgNC string and AuNPs, in which fluorescent DNA/AgNC string can be spontaneously adsorbed onto the surface of AuNPs and correspondingly AuNPs serve as "nanoquencher" to quench the fluorescence of DNA/AgNC string. In the presence of target DNA, the sensing probe hybridized with target DNA to form duplex DNA, leading to a salt-induced AuNP aggregation and subsequently weakened SPEET process between fluorescent DNA/AgNC string and AuNPs. A red-to-blue color change of AuNPs and a concomitant fluorescence increase were clearly observed in the sensing system, which had a concentration dependent manner with specific DNA. The proposed method achieved a detection limit of ∼2.5 nM, offering the following merits of simple design, convenient operation, and low experimental cost because of no chemical modification, organic dye, enzymatic reaction, or separation procedure involved.

  4. Role of Counseling to Promote Adherence in Healthy Lifestyle Medicine: Strategies to Improve Exercise Adherence and Enhance Physical Activity.

    Science.gov (United States)

    Stonerock, Gregory L; Blumenthal, James A

    Although healthy lifestyles (HL) offer a number of health benefits, nonadherence to recommended lifestyle changes remains a frequent and difficult obstacle to realizing these benefits. Behavioral counseling can improve adherence to an HL. However, individuals' motivation for change and resistance to altering unhealthy habits must be considered when developing an effective approach to counseling. In the present article, we review psychological, behavioral, and environmental factors that may promote adherence and contribute to nonadherence. We discuss two established models for counseling, motivational interviewing and the transtheoretical model of behavior change, and provide an example of how these approaches can be used to counsel patients to exercise and increase their levels of physical activity. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Optimization of pulsed electric field pre-treatments to enhance health-promoting glucosinolates in broccoli flowers and stalk.

    Science.gov (United States)

    Aguiló-Aguayo, Ingrid; Suarez, Manuel; Plaza, Lucia; Hossain, Mohammad B; Brunton, Nigel; Lyng, James G; Rai, Dilip K

    2015-07-01

    The effect of pulsed electric field (PEF) treatment variables (electric field strength and treatment time) on the glucosinolate content of broccoli flowers and stalks was evaluated. Samples were subjected to electric field strengths from 1 to 4 kV cm(-1) and treatment times from 50 to 1000 µs at 5 Hz. Data fitted significantly (P broccoli flowers (ranging from 187.1 to 212.5%) and stalks (ranging from 110.6 to 203.0%) respectively. The predicted values from the developed quadratic polynomial equation were in close agreement with the actual experimental values, with low average mean deviations (E%) ranging from 0.59 to 8.80%. The use of PEF processing at moderate conditions could be a suitable method to stimulate production of broccoli with high health-promoting glucosinolate content. © 2014 Society of Chemical Industry.

  6. Truncated thioredoxin (Trx-80) promotes pro-inflammatory macrophages of the M1 phenotype and enhances atherosclerosis.

    Science.gov (United States)

    Mahmood, Dler Faieeq Darweesh; Abderrazak, Amna; Couchie, Dominique; Lunov, Oleg; Diderot, Vimala; Syrovets, Tatiana; Slimane, Mohamed-Naceur; Gosselet, Fabien; Simmet, Thomas; Rouis, Mustapha; El Hadri, Khadija

    2013-07-01

    Vascular cells are particularly susceptible to oxidative stress that is believed to play a key role in the pathogenesis of cardiovascular disorders. Thioredoxin-1 (Trx-1) is an oxidative stress-limiting protein with anti-inflammatory and anti-apoptotic properties. In contrast, its truncated form (Trx-80) exerts pro-inflammatory effects. Here we analyzed whether Trx-80 might exert atherogenic effects by promoting macrophage differentiation into the M1 pro-inflammatory phenotype. Trx-80 at 1 µg/ml significantly attenuated the polarization of anti-inflammatory M2 macrophages induced by exposure to either IL-4 at 15 ng/ml or IL-4/IL-13 (10 ng/ml each) in vitro, as evidenced by the expression of the characteristic markers, CD206 and IL-10. By contrast, in LPS-challenged macrophages, Trx-80 significantly potentiated the differentiation into inflammatory M1 macrophages as indicated by the expression of the M1 cytokines, TNF-α and MCP-1. When Trx-80 was administered to hyperlipoproteinemic ApoE2.Ki mice at 30 µg/g body weight (b.w.) challenged either with LPS at 30 µg/30 g (b.w.) or IL-4 at 500 ng/30 g (b.w.), it significantly induced the M1 phenotype but inhibited differentiation of M2 macrophages in thymus and liver. When ApoE2.Ki mice were challenged once weekly with LPS for 5 weeks, they showed severe atherosclerotic lesions enriched with macrophages expressing predominantly M1 over M2 markers. Such effect was potentiated when mice received daily, in addition to LPS, the Trx-80. Moreover, the Trx-80 treatment led to a significantly increased aortic lesion area. The ability of Trx-80 to promote differentiation of macrophages into the classical proinflammatory phenotype may explain its atherogenic effects in cardiovascular diseases. Copyright © 2013 Wiley Periodicals, Inc.

  7. EPO-independent functional EPO receptor in breast cancer enhances estrogen receptor activity and promotes cell proliferation

    International Nuclear Information System (INIS)

    Reinbothe, Susann; Larsson, Anna-Maria; Vaapil, Marica; Wigerup, Caroline; Sun, Jianmin; Jögi, Annika; Neumann, Drorit; Rönnstrand, Lars; Påhlman, Sven

    2014-01-01

    Highlights: • New anti-human EPOR antibody confirms full-length EPOR expression in breast cancer cells. • Proliferation of breast cancer cells is not affected by rhEPO treatment in vitro. • EPOR knockdown impairs proliferation of ERa positive breast cancer cells. • EPOR knockdown reduces AKT phosphorylation and ERa activity. - Abstract: The main function of Erythropoietin (EPO) and its receptor (EPOR) is the stimulation of erythropoiesis. Recombinant human EPO (rhEPO) is therefore used to treat anemia in cancer patients. However, clinical trials have indicated that rhEPO treatment might promote tumor progression and has a negative effect on patient survival. In addition, EPOR expression has been detected in several cancer forms. Using a newly produced anti-EPOR antibody that reliably detects the full-length isoform of the EPOR we show that breast cancer tissue and cells express the EPOR protein. rhEPO stimulation of cultured EPOR expressing breast cancer cells did not result in increased proliferation, overt activation of EPOR (receptor phosphorylation) or a consistent activation of canonical EPOR signaling pathway mediators such as JAK2, STAT3, STAT5, or AKT. However, EPOR knockdown experiments suggested functional EPO receptors in estrogen receptor positive (ERα + ) breast cancer cells, as reduced EPOR expression resulted in decreased proliferation. This effect on proliferation was not seen in ERα negative cells. EPOR knockdown decreased ERα activity further supports a mechanism by which EPOR affects proliferation via ERα-mediated mechanisms. We show that EPOR protein is expressed in breast cancer cells, where it appears to promote proliferation by an EPO-independent mechanism in ERα expressing breast cancer cells

  8. EPO-independent functional EPO receptor in breast cancer enhances estrogen receptor activity and promotes cell proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Reinbothe, Susann; Larsson, Anna-Maria; Vaapil, Marica; Wigerup, Caroline [Department of Laboratory Medicine, Translational Cancer Research, Medicon Village, Lund University, SE-223 81 Lund (Sweden); CREATE Health, Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Sun, Jianmin [Department of Laboratory Medicine, Translational Cancer Research, Medicon Village, Lund University, SE-223 81 Lund (Sweden); Jögi, Annika [Department of Laboratory Medicine, Translational Cancer Research, Medicon Village, Lund University, SE-223 81 Lund (Sweden); CREATE Health, Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Neumann, Drorit [Department of Cell and Developmental Biology, Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Rönnstrand, Lars [Department of Laboratory Medicine, Translational Cancer Research, Medicon Village, Lund University, SE-223 81 Lund (Sweden); Påhlman, Sven, E-mail: sven.pahlman@med.lu.se [Department of Laboratory Medicine, Translational Cancer Research, Medicon Village, Lund University, SE-223 81 Lund (Sweden); CREATE Health, Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-02-28

    Highlights: • New anti-human EPOR antibody confirms full-length EPOR expression in breast cancer cells. • Proliferation of breast cancer cells is not affected by rhEPO treatment in vitro. • EPOR knockdown impairs proliferation of ERa positive breast cancer cells. • EPOR knockdown reduces AKT phosphorylation and ERa activity. - Abstract: The main function of Erythropoietin (EPO) and its receptor (EPOR) is the stimulation of erythropoiesis. Recombinant human EPO (rhEPO) is therefore used to treat anemia in cancer patients. However, clinical trials have indicated that rhEPO treatment might promote tumor progression and has a negative effect on patient survival. In addition, EPOR expression has been detected in several cancer forms. Using a newly produced anti-EPOR antibody that reliably detects the full-length isoform of the EPOR we show that breast cancer tissue and cells express the EPOR protein. rhEPO stimulation of cultured EPOR expressing breast cancer cells did not result in increased proliferation, overt activation of EPOR (receptor phosphorylation) or a consistent activation of canonical EPOR signaling pathway mediators such as JAK2, STAT3, STAT5, or AKT. However, EPOR knockdown experiments suggested functional EPO receptors in estrogen receptor positive (ERα{sup +}) breast cancer cells, as reduced EPOR expression resulted in decreased proliferation. This effect on proliferation was not seen in ERα negative cells. EPOR knockdown decreased ERα activity further supports a mechanism by which EPOR affects proliferation via ERα-mediated mechanisms. We show that EPOR protein is expressed in breast cancer cells, where it appears to promote proliferation by an EPO-independent mechanism in ERα expressing breast cancer cells.

  9. New genome sequence data and molecular tools promote the use of photosynthetic and edible cyanobacteria in bioregenerative systems to support human space exploration.

    Science.gov (United States)

    Leys, Natalie; Morin, Nicolas; Janssen, Paul; Mergeay, Max

    Cyanobacteria are daily used as nutritional supplements (e.g. Spirulina) and are considered for promising applications beyond Earth, in space, where they can play a crucial role in closed miniaturised biological waste recycling systems that are currently developed to support future long-term space missions. Cyanobacteria can be cultured with artificial light in controllable photobioreactors, and used for the efficient removal of CO2 from and production of O2 in the at-mosphere of the confined spacecraft, for removal of nitrate from waste water that is recycled to potable water, and as complementary food source. In this context, the filamentous cyanobac-terium Arthrospira sp. PCC 8005 was selected as part of the bio-regenerative life-support system MELiSSA from the European Space Agency. For bioprocess control and optimisation, the access to its genetic information and the development of molecular tools is crucial. Here we report on our efforts to determine the full genome of the cyanobacterium Arthrospira sp. PCC 8005. The obtained sequence data were analysed in detail to gain a better insight in the photosynthetic, nutritive, or potential toxic potential of this strain. In addition, the sensitivity of PCC 8005 to ionizing radiation was investigated because prolonged exposure of PCC 8005 to cosmic radiation in space might have a deleterious effect on its metabolism and oxygenic properties. To our knowledge, of the 6 different research groups across the globe trying to sequence Arthrospira strains, none of them, including us, were yet able to obtain a complete genome sequence. For Arthrospira sp. strain PCC 8005, we obtained 119 contigs (assembled in 16 scaffolds), representing 6,3 Mb, with 5,856 predicted protein-coding sequences (CDSs) and 176 genes encoding RNA. The PCC 8005 genome displays an unusual high number of large repeated sequences, covering around 8% of the genome, which likely hampered the sequenc-ing. The PCC 8005 genome is also ridden by mobile

  10. A cooperative interaction between nontranslated RNA sequences and NS5A protein promotes in vivo fitness of a chimeric hepatitis C/GB virus B.

    Directory of Open Access Journals (Sweden)

    Lucile Warter

    Full Text Available GB virus B (GBV-B is closely related to hepatitis C virus (HCV, infects small non-human primates, and is thus a valuable surrogate for studying HCV. Despite significant differences, the 5' nontranslated RNAs (NTRs of these viruses fold into four similar structured domains (I-IV, with domains II-III-IV comprising the viral internal ribosomal entry site (IRES. We previously reported the in vivo rescue of a chimeric GBV-B (vGB/III(HC containing HCV sequence in domain III, an essential segment of the IRES. We show here that three mutations identified within the vGB/III(HC genome (within the 3'NTR, upstream of the poly(U tract, and NS5A coding sequence are necessary and sufficient for production of this chimeric virus following intrahepatic inoculation of synthetic RNA in tamarins, and thus apparently compensate for the presence of HCV sequence in domain III. To assess the mechanism(s underlying these compensatory mutations, and to determine whether 5'NTR subdomains participating in genome replication do so in a virus-specific fashion, we constructed and evaluated a series of chimeric subgenomic GBV-B replicons in which various 5'NTR subdomains were substituted with their HCV homologs. Domains I and II of the GBV-B 5'NTR could not be replaced with HCV sequence, indicating that they contain essential, virus-specific RNA replication elements. In contrast, domain III could be swapped with minimal loss of genome replication capacity in cell culture. The 3'NTR and NS5A mutations required for rescue of the related chimeric virus in vivo had no effect on replication of the subgenomic GBneoD/III(HC RNA in vitro. The data suggest that in vivo fitness of the domain III chimeric virus is dependent on a cooperative interaction between the 5'NTR, 3'NTR and NS5A at a step in the viral life cycle subsequent to genome replication, most likely during particle assembly. Such a mechanism may be common to all hepaciviruses.

  11. N-myc downstream-regulated gene 1 promotes oxaliplatin-triggered apoptosis in colorectal cancer cells via enhancing the ubiquitination of Bcl-2.

    Science.gov (United States)

    Yang, Xiao; Zhu, Fan; Yu, Chaoran; Lu, Jiaoyang; Zhang, Luyang; Lv, Yanfeng; Sun, Jing; Zheng, Minhua

    2017-07-18

    N-myc downstream-regulated gene1 (NDRG1) has been identified as a potent tumor suppressor gene. The molecular mechanisms of anti-tumor activity of NDRG1 involve its suppressive effects on a variety of tumorigenic signaling pathways. The purpose of this study was to investigate the role of NDRG1 in the apoptosis of colorectal cancer (CRC) cells. We first collected the clinical data of locally advanced rectal cancer (LARC) patients receiving oxaliplatin-based neoadjuvant chemotherapy in our medical center. Correlation analysis revealed that NDRG1 positively associated with the downstaging rates and prognosis of patients. Then, the effects of over-expression and depletion of NDRG1 gene on apoptosis of colorectal cancer were tested in vitro and in vivo. NDRG1 over-expression promoted apoptosis in colorectal cancer cells whereas depletion of NDRG1 resulted in resistance to oxaliplatin treatment. Furthermore, we observed that Bcl-2, a major anti-apoptotic protein, was regulated by NDRG1 at post-transcriptional level. By binding Protein kinase Cα (PKCα), a classical regulating factor of Bcl-2, NDRG1 enhanced the ubiquitination and degradation of Bcl-2, thus promoting apoptosis in CRC cells. In addition, NDRG1 inhibited tumor growth and promoted apoptosis in mouse xenograft model. In conclusion,NDRG1 promotes oxaliplatin-triggered apoptosis in colorectal cancer. Therefore, colorectal cancer patients can be stratified by the expression level of NDRG1. NDRG1-positive patients may benefit from oxaliplatin-containing chemotherapy regimens whereas those with negative NDRG1 expression should avoid the usage of this cytotoxic drug.

  12. Pre-oxidation of low-density polyethylene (LDPE) by ultraviolet light (UV) promotes enhanced degradation of LDPE in soil.

    Science.gov (United States)

    Tribedi, Prosun; Dey, Samrat

    2017-11-09

    Polyethylene represents nearly 64% of all the synthetic plastics produced and are mainly used for domestic and industrial applications. Their extensive use poses a serious environmental threat because of their non-biodegradable nature. Among all the polyethylene remediation strategies, in situ bioremediation happens to be the safest and efficient one. In the current study, efforts had been given to compare the extent of LDPE degradation under UV-treated and UV-untreated conditions by soil microcosm. Landfill soil was collected and UV-treated and UV-untreated LDPE were added separately to the soil following incubation under similar conditions. Electron microscopic images as well as the weight loss and the tensile strength results clearly revealed that UV-treated LDPE showed better degradation than the non-treated ones in soil. To elucidate the mechanism of this enhanced biodegradation, the bond spectra of differentially treated LDPE were analyzed by FTIR. The results obtained from bond spectra studies revealed that UV treatment increases both carbonyl and terminal double-bond index of the LDPE, thereby making it highly susceptible for microbial degradation. Moreover, incubation of UV-treated LDPE with soil favors better adherence of metabolically active and significantly higher number of microorganisms on it. Taken together, all these results demonstrate the higher microbial association and their better metabolic potential to the UV-treated LDPE that lead to enhanced degradation of the LDPE by the soil microorganisms.

  13. Curcumin-Based "Enhanced SNAr" Promoted Ultrafast Fluorescent Probe for Thiophenols Detection in Aqueous Solution and in Living Cells.

    Science.gov (United States)

    Yue, Yongkang; Huo, Fangjun; Zhang, Yongbin; Chao, Jianbin; Martínez-Máñez, Ramón; Yin, Caixia

    2016-11-01

    We report herein a highly selective and sensitive turn-on fluorescent probe (compound 1) with a fast response time (less than 2 min) for thiophenol detection based on an "enhanced S N Ar" reaction between thiophenols and a sulfonyl-ester moiety covalently attach to curcumin. Reaction of 1 in Hepes-MeOH (1:1, v/v, pH 7.4) in the presence of 4-methylthiophenol (MTP) resulted in a remarkable enhancement of the fluorescence. A linear response in the presence of MTP of the relative fluorescent intensity (F - F 0 ) of 1 at 536 nm in the 0-40 μM MTP concentration range was found. A limit of detection (LOD) for the detection of MTP of 26 nM, based on the definition by IUPAC (C DL = 3 Sb/m), was calculated. Probe 1 was applied to monitor and imaging exogenous MTP in live cells and to the detection of MTP in real water samples.

  14. Stronger enhancer II/core promoter activities of hepatitis B virus isolates of B2 subgenotype than those of C2 subgenotype.

    Science.gov (United States)

    Qin, Yanli; Zhou, Xueshi; Jia, Haodi; Chen, Chaoyang; Zhao, Weifeng; Zhang, Jiming; Tong, Shuping

    2016-07-27

    Hepatitis B virus (HBV) genotype C causes prolonged chronic infection and increased risk for liver cancer than genotype B. Our previous work revealed lower replication capacity of wild-type genotype C2 than B2 isolates. HBV DNA replication is driven by pregenomic RNA, which is controlled by core promoter (CP) and further augmented by enhancer I (ENI) and enhancer II (ENII). DNA fragments covering these regulatory elements were amplified from B2 and C2 isolates to generate luciferase reporter constructs. As ENII is fully embedded in CP, we inserted HBV DNA fragments in the sense orientation to determine their combined activities, and in the antisense orientation to measure enhancer activities alone. Genotype B2 isolates displayed higher ENI+ENII+CP, ENII+CP, and ENII activities, but not ENI or ENI+ENII activity, than C2 isolates. The higher ENII+CP activity was partly attributable to 4 positions displaying genotype-specific variability. Exchanging CP region was sufficient to revert the replication phenotypes of several B2 and C2 clones tested. These results suggest that a weaker ENII and/or CP at least partly accounts for the lower replication capacities of wild-type C2 isolates, which could drive the subsequent acquisition of CP mutations. Such mutations increase genome replication and are implicated in liver cancer development.

  15. Decrease in Survival Rate of Colorectal Cancer Patients Due to Insertion of a Single Guanine Base in Promoter Sequences of Matrix Metalloproteinase-1 Gene (in Tehran Population

    Directory of Open Access Journals (Sweden)

    Z Hojati

    2009-01-01

    Full Text Available Introduction: Insertion or deletion of a guanine in -1607 at promoter region of matrix metalloproteinase-1 enzyme creates two allelic types for this gene in the population: 2G and 1G, respectively. 2G allele contains an extra binding site for ETS transcription factors that this may increase the level of gene expression. Therefore, aim of this study was investigation of the single Guanine insertion in the promoter gene and its association with colorectal cancer patient survival rate and tumor progression. Methods: Blood samples from 150 colorectal patients and 100 cases were extracted. The mean follow-up was 25 months (12-36 months. Cases and patients were genotyped using genomic DNA extraction and PCR-RFLP. Results: Colorectal cancer patients were divided in two groups; with activity of metastasis (M+ and without activity of metastasis (M-. 2G allele in metastasis group (55% showed more frequency rather than controls (23%. Survival analyses showed that 3 years survival patients rate in the patients without metastasis activity carrying 1G allele (homo and heterozygote was 81% and for 2G homozygote is 66% (p=0.04. The survival rate dependent to cancer was 90% and 71%, respectively (P=0.01. Conclusion: According to the results, it seems that patients carrying 1G allele show a better survival rate dependent on cancer as compared to patients who do not carry this allele.

  16. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

    Science.gov (United States)

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

  17. Class A scavenger receptor promotes osteoclast differentiation via the enhanced expression of receptor activator of NF-{kappa}B (RANK)

    Energy Technology Data Exchange (ETDEWEB)

    Takemura, Kenichi [Department of Cell Pathology, Graduate School of Medical Sciences, Kumamoto University, 1-1-1 Honjo, Kumamoto 860-8556 (Japan); Department of Orthopaedic and Neuro-Musculoskeletal Surgery, Graduate School of Medical Sciences, Kumamoto University, Kumamoto (Japan); Sakashita, Naomi; Fujiwara, Yukio; Komohara, Yoshihiro; Lei, XiaoFeng; Ohnishi, Koji [Department of Cell Pathology, Graduate School of Medical Sciences, Kumamoto University, 1-1-1 Honjo, Kumamoto 860-8556 (Japan); Suzuki, Hiroshi [National Research Center for Protozoan Diseases, Obihiro University of Agriculture and Veterinary Medicine, Hokkaido (Japan); Kodama, Tatsuhiko [Department of Molecular Biology and Medicine, Research Center for Advanced Science and Technology, The University of Tokyo, Tokyo (Japan); Mizuta, Hiroshi [Department of Orthopaedic and Neuro-Musculoskeletal Surgery, Graduate School of Medical Sciences, Kumamoto University, Kumamoto (Japan); Takeya, Motohiro, E-mail: takeya@kumamoto-u.ac.jp [Department of Cell Pathology, Graduate School of Medical Sciences, Kumamoto University, 1-1-1 Honjo, Kumamoto 860-8556 (Japan)

    2010-01-22

    Osteoclasts originate from bone marrow monocyte/macrophage lineage cells, and their differentiation depends on macrophage colony-stimulating factor (M-CSF) and receptor activator nuclear factor kappa B (RANK) ligand. Class A scavenger receptor (SR-A) is one of the principal functional molecules of macrophages, and its level of expression declines during osteoclast differentiation. To investigate the role of SR-A in osteoclastogenesis, we examined pathological changes in femoral bone and the expression levels of osteoclastogenesis-related molecules in SR-A{sup -/-} mice. The femoral osseous density of SR-A{sup -/-} mice was higher than that of SR-A{sup +/+} mice, and the number of multinucleated osteoclasts was significantly decreased. An in vitro differentiation assay revealed that the differentiation of multinucleated osteoclasts from bone marrow-derived progenitor cells is impaired in SR-A{sup -/-} mice. Elimination of SR-A did not alter the expression level of the M-CSF receptor, c-fms; however, the expression levels of RANK and RANK-related osteoclast-differentiation molecules such as nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 (NFATc1) and microphthalmia-associated transcription factor (MITF) significantly decreased. Furthermore, acetylated low-density lipoprotein (AcLDL), an SR-A ligand, significantly increased the expression level of RANK and MITF during osteoclast differentiation. These data indicate that SR-A promotes osteoclastogenesis via augmentation of the expression level of RANK and its related molecules.

  18. Carpobrotus edulis methanol extract inhibits the MDR efflux pumps, enhances killing of phagocytosed S. aureus and promotes immune modulation.

    Science.gov (United States)

    Ordway, Diane; Hohmann, Judit; Viveiros, Miguel; Viveiros, Antonio; Molnar, Joseph; Leandro, Clara; Arroz, Maria Jorge; Gracio, Maria Amelia; Amaral, Leonard

    2003-05-01

    Although alkaloids from the family Aizoaceae have anticancer activity, species of this family have received little attention. Because these alkaloids also exhibit properties normally associated with compounds that have activity at the level of the plasma membrane, a methanol extract of Carpobrotus edulis, a common plant found along the Portuguese coast, was studied for properties normally associated with plasma membrane active compounds. The results of this study show that the extract is non-toxic at concentrations that inhibit a verapamil sensitive efflux pump of L5178 mouse T cell lymphoma cell line thereby rendering these multi-drug resistant cells susceptible to anticancer drugs. These non-toxic concentrations also prime THP-1 human monocyte-derived macrophages to kill ingested Staphylococcus aureus and to promote the release of lymphokines associated with cellular immune functions. The extract also induces the proliferation of THP-1 cells within 1 day of exposure to quantities normally associated with phytohaemagglutinin. The potential role of the compound(s) isolated from this plant in cancer biology is intriguing and is currently under investigation. It is supposed that the resistance modifier and immunomodulatory effect of this plant extract can be exploited in the experimental chemotherapy of cancer and bacterial or viral infections. Copyright 2003 John Wiley & S