Draft Genome Sequence of Halomonas elongata Strain K4, an Endophytic Growth-Promoting Bacterium Enhancing Salinity Tolerance In Planta

KAUST Repository

Lafi, Feras Fawzi; Ramirez Prado, Juan Sebastian; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

2016-01-01

Halomonas elongata strain K4 is an endophytic bacterial strain that was isolated from roots of Cyperus conglomeratus collected at the Red Sea coast in Thuwal, Saudi Arabia. Here, we present a draft genome sequence of this strain, highlighting a number of pathways involved in plant growth promotion under salt stress.

Draft Genome Sequence of Halomonas elongata Strain K4, an Endophytic Growth-Promoting Bacterium Enhancing Salinity Tolerance In Planta

KAUST Repository

Lafi, Feras Fawzi

2016-11-04

Halomonas elongata strain K4 is an endophytic bacterial strain that was isolated from roots of Cyperus conglomeratus collected at the Red Sea coast in Thuwal, Saudi Arabia. Here, we present a draft genome sequence of this strain, highlighting a number of pathways involved in plant growth promotion under salt stress.

Synthetic cold-inducible promoter enhances recombinant protein accumulation during Agrobacterium-mediated transient expression in Nicotiana excelsior at chilling temperatures.

Science.gov (United States)

Gerasymenko, I M; Sheludko, Y V

2017-07-01

To exploit cold-inducible biochemical processes beneficial for foreign mRNA transcription, translation and storage, as well as protein product stability, during Agrobacterium-mediated transient expression. The efficiency of three different 5'-regulatory sequences to achieve transient expression of the GFP-based reporter gene under chilling conditions (6-8 °C since the 3rd day post inoculation) was compared. We studied the upstream sequences of a cold-inducible Arabidopsis thaliana cor15a gene, the core element of 35S CaMV promoter fused to the TMV omega 5'-UTR, and the synthetic promoter including the 35S core sequence and two binding sites for cold-inducible CBF transcription factors (P_DRE::35S). Cultivation of plants transiently expressing reporter gene under control of the synthetic P_DRE::35S promoter under chilling conditions since the 3rd dpi led to the reliably higher reporter accumulation as compared to the other tested regulatory sequences under chilling or greenhouse conditions. Reporter protein fluorescence under chilling conditions using P_DRE::35S reached 160% as compared to the transient expression in the greenhouse. Period of transient expression considerably extended if plants were cultivated at chilling temperature since the 3rd dpi: reporter protein fluorescence reached its maximum at the 20th dpi and was detected in leaves up to the 65th dpi. The enhanced protein accumulation at low temperature was accompanied by the prolonged period of corresponding mRNA accumulation. Transient expression under chilling conditions using synthetic cold-inducible promoter enhances target protein accumulation and may decrease greenhouse heating expenses.

PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences

OpenAIRE

Lescot, Magali; Déhais, Patrice; Thijs, Gert; Marchal, Kathleen; Moreau, Yves; Van de Peer, Yves; Rouzé, Pierre; Rombauts, Stephane

2002-01-01

PlantCARE is a database of plant cis-acting regulatory elements, enhancers and repressors. Regulatory elements are represented by positional matrices, consensus sequences and individual sites on particular promoter sequences. Links to the EMBL, TRANSFAC and MEDLINE databases are provided when available. Data about the transcription sites are extracted mainly from the literature, supplemented with an increasing number of in silico predicted data. Apart from a general description for specific t...

Sequence conservation and combinatorial complexity of Drosophila neural precursor cell enhancers

Directory of Open Access Journals (Sweden)

Kuzin Alexander

2008-08-01

Full Text Available Abstract Background The presence of highly conserved sequences within cis-regulatory regions can serve as a valuable starting point for elucidating the basis of enhancer function. This study focuses on regulation of gene expression during the early events of Drosophila neural development. We describe the use of EvoPrinter and cis-Decoder, a suite of interrelated phylogenetic footprinting and alignment programs, to characterize highly conserved sequences that are shared among co-regulating enhancers. Results Analysis of in vivo characterized enhancers that drive neural precursor gene expression has revealed that they contain clusters of highly conserved sequence blocks (CSBs made up of shorter shared sequence elements which are present in different combinations and orientations within the different co-regulating enhancers; these elements contain either known consensus transcription factor binding sites or consist of novel sequences that have not been functionally characterized. The CSBs of co-regulated enhancers share a large number of sequence elements, suggesting that a diverse repertoire of transcription factors may interact in a highly combinatorial fashion to coordinately regulate gene expression. We have used information gained from our comparative analysis to discover an enhancer that directs expression of the nervy gene in neural precursor cells of the CNS and PNS. Conclusion The combined use EvoPrinter and cis-Decoder has yielded important insights into the combinatorial appearance of fundamental sequence elements required for neural enhancer function. Each of the 30 enhancers examined conformed to a pattern of highly conserved blocks of sequences containing shared constituent elements. These data establish a basis for further analysis and understanding of neural enhancer function.

Genome Sequence of Bacillus velezensis S141, a New Strain of Plant Growth-Promoting Rhizobacterium Isolated from Soybean Rhizosphere.

Science.gov (United States)

Sibponkrung, Surachat; Kondo, Takahiko; Tanaka, Kosei; Tittabutr, Panlada; Boonkerd, Nantakorn; Teaumroong, Neung; Yoshida, Ken-Ichi

2017-11-30

Bacillus velezensis strain S141 is a plant growth-promoting rhizobacterium isolated from soybean ( Glycine max ) rhizosphere that enhances soybean growth, nodulation, and N 2 fixation efficiency by coinoculation with Bradyrhizobium diazoefficiens USDA110. The S141 genome was identified to comprise a 3,974,582-bp-long circular DNA sequence encoding at least 3,817 proteins. Copyright © 2017 Sibponkrung et al.

Enhanced learning of natural visual sequences in newborn chicks.

Science.gov (United States)

Wood, Justin N; Prasad, Aditya; Goldman, Jason G; Wood, Samantha M W

2016-07-01

To what extent are newborn brains designed to operate over natural visual input? To address this question, we used a high-throughput controlled-rearing method to examine whether newborn chicks (Gallus gallus) show enhanced learning of natural visual sequences at the onset of vision. We took the same set of images and grouped them into either natural sequences (i.e., sequences showing different viewpoints of the same real-world object) or unnatural sequences (i.e., sequences showing different images of different real-world objects). When raised in virtual worlds containing natural sequences, newborn chicks developed the ability to recognize familiar images of objects. Conversely, when raised in virtual worlds containing unnatural sequences, newborn chicks' object recognition abilities were severely impaired. In fact, the majority of the chicks raised with the unnatural sequences failed to recognize familiar images of objects despite acquiring over 100 h of visual experience with those images. Thus, newborn chicks show enhanced learning of natural visual sequences at the onset of vision. These results indicate that newborn brains are designed to operate over natural visual input.

Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

Science.gov (United States)

He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

2013-09-04

To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

Enhancer-promoter interference and its prevention in transgenic plants

Science.gov (United States)

Transcriptional enhancer elements have been shown to override the specificity of nearby promoters in a position- and orientation-independent manner. This is problematic when multiple enhancers/promoters co-exist within a single transgenic construct as it has the potential to cause the mis-expressio...

Discriminative identification of transcriptional responses of promoters and enhancers after stimulus

KAUST Repository

Kleftogiannis, Dimitrios A.

2016-10-17

Promoters and enhancers regulate the initiation of gene expression and maintenance of expression levels in spatial and temporal manner. Recent findings stemming from the Cap Analysis of Gene Expression (CAGE) demonstrate that promoters and enhancers, based on their expression profiles after stimulus, belong to different transcription response subclasses. One of the most promising biological features that might explain the difference in transcriptional response between subclasses is the local chromatin environment. We introduce a novel computational framework, PEDAL, for distinguishing effectively transcriptional profiles of promoters and enhancers using solely histone modification marks, chromatin accessibility and binding sites of transcription factors and co-activators. A case study on data from MCF-7 cell-line reveals that PEDAL can identify successfully the transcription response subclasses of promoters and enhancers from two different stimulations. Moreover, we report subsets of input markers that discriminate with minimized classification error MCF-7 promoter and enhancer transcription response subclasses. Our work provides a general computational approach for identifying effectively cell-specific and stimulation-specific promoter and enhancer transcriptional profiles, and thus, contributes to improve our understanding of transcriptional activation in human.

Diagnostic accuracy of unenhanced, contrast-enhanced perfusion and angiographic MRI sequences for pulmonary embolism diagnosis: results of independent sequence readings

Energy Technology Data Exchange (ETDEWEB)

Revel, Marie Pierre [Hopital Europeen Georges Pompidou, APHP, Departments of Radiology, Paris (France); Universite Paris Descartes Sorbonne Paris Cite, Paris (France); Hotel-Dieu, Service de Radiologie, Paris (France); Sanchez, Olivier; Meyer, Guy [Hopital Europeen Georges Pompidou, APHP, Respiratory and intensive care and, Paris (France); Universite Paris Descartes Sorbonne Paris Cite, Paris (France); INSERM Unite 765, Paris (France); Lefort, Catherine; Couchon, Sophie; Hernigou, Anne; Frija, Guy [Hopital Europeen Georges Pompidou, APHP, Departments of Radiology, Paris (France); Niarra, Ralph [Hopital Europeen Georges Pompidou, APHP, Clinical Epidemiology, Paris (France); Universite Paris Descartes Sorbonne Paris Cite, Paris (France); Chatellier, Gilles [Hopital Europeen Georges Pompidou, APHP, Clinical Epidemiology, Paris (France); Universite Paris Descartes Sorbonne Paris Cite, Paris (France); INSERM CIC-EC E4, Paris (France)

2013-09-15

To independently evaluate unenhanced, contrast-enhanced perfusion and angiographic MR sequences for pulmonary embolism (PE) diagnosis. Prospective investigation, including 274 patients who underwent perfusion, unenhanced 2D steady-state-free-precession (SSFP) and contrast-enhanced 3D angiographic MR sequences on a 1.5-T unit, in addition to CTA (CT angiography). Two independent readers evaluated each sequence independently in random order. Sensitivity, specificity, predictive values and inter-reader agreement were calculated for each sequence, excluding sequences judged inconclusive. Sensitivity was also calculated according to PE location. Contrast-enhanced angiographic sequences showed the highest sensitivity (82.9 and 89.7 %, reader 1 and reader 2, respectively), specificity (98.5 and 100 %) and agreement (kappa value 0.77). Unenhanced angiographic sequences, although less sensitive overall (68.7 and 76.4 %), were sensitive for the detection of proximal PE (92.7 and 100 %) and showed high specificity (96.1 and 99.1 %) and good agreement (kappa value 0.62). Perfusion sequences showed lower sensitivity (75.0 and 79.3 %), specificity (84.8 and 89.7 %) and agreement (kappa value 0.51), and a negative predictive value of 84.8 % at best. Compared with contrast-enhanced angiographic sequences, unenhanced sequences demonstrate lower sensitivity, except for proximal PE, but high specificity and agreement. The negative predictive value of perfusion sequences was insufficient to safely rule out PE. (orig.)

Gift from statistical learning: Visual statistical learning enhances memory for sequence elements and impairs memory for items that disrupt regularities.

Science.gov (United States)

Otsuka, Sachio; Saiki, Jun

2016-02-01

Prior studies have shown that visual statistical learning (VSL) enhances familiarity (a type of memory) of sequences. How do statistical regularities influence the processing of each triplet element and inserted distractors that disrupt the regularity? Given that increased attention to triplets induced by VSL and inhibition of unattended triplets, we predicted that VSL would promote memory for each triplet constituent, and degrade memory for inserted stimuli. Across the first two experiments, we found that objects from structured sequences were more likely to be remembered than objects from random sequences, and that letters (Experiment 1) or objects (Experiment 2) inserted into structured sequences were less likely to be remembered than those inserted into random sequences. In the subsequent two experiments, we examined an alternative account for our results, whereby the difference in memory for inserted items between structured and random conditions is due to individuation of items within random sequences. Our findings replicated even when control letters (Experiment 3A) or objects (Experiment 3B) were presented before or after, rather than inserted into, random sequences. Our findings suggest that statistical learning enhances memory for each item in a regular set and impairs memory for items that disrupt the regularity. Copyright © 2015 Elsevier B.V. All rights reserved.

In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

OpenAIRE

W.S.I. de Silva; M.M.N. Perera; K.L.N.S. Perera; A.M. Wickramasuriya; G.A.U. Jayasekera

2017-01-01

The promoter region of a drought and abscisic acid (ABA) inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involv...

Functional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation

International Nuclear Information System (INIS)

Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio

2005-01-01

Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells

The Evolution of Bony Vertebrate Enhancers at Odds with Their Coding Sequence Landscape.

Science.gov (United States)

Yousaf, Aisha; Sohail Raza, Muhammad; Ali Abbasi, Amir

2015-08-06

Enhancers lie at the heart of transcriptional and developmental gene regulation. Therefore, changes in enhancer sequences usually disrupt the target gene expression and result in disease phenotypes. Despite the well-established role of enhancers in development and disease, evolutionary sequence studies are lacking. The current study attempts to unravel the puzzle of bony vertebrates' conserved noncoding elements (CNE) enhancer evolution. Bayesian phylogenetics of enhancer sequences spotlights promising interordinal relationships among placental mammals, proposing a closer relationship between humans and laurasiatherians while placing rodents at the basal position. Clock-based estimates of enhancer evolution provided a dynamic picture of interspecific rate changes across the bony vertebrate lineage. Moreover, coelacanth in the study augmented our appreciation of the vertebrate cis-regulatory evolution during water-land transition. Intriguingly, we observed a pronounced upsurge in enhancer evolution in land-dwelling vertebrates. These novel findings triggered us to further investigate the evolutionary trend of coding as well as CNE nonenhancer repertoires, to highlight the relative evolutionary dynamics of diverse genomic landscapes. Surprisingly, the evolutionary rates of enhancer sequences were clearly at odds with those of the coding and the CNE nonenhancer sequences during vertebrate adaptation to land, with land vertebrates exhibiting significantly reduced rates of coding sequence evolution in comparison to their fast evolving regulatory landscape. The observed variation in tetrapod cis-regulatory elements caused the fine-tuning of associated gene regulatory networks. Therefore, the increased evolutionary rate of tetrapods' enhancer sequences might be responsible for the variation in developmental regulatory circuits during the process of vertebrate adaptation to land. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for

Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

OpenAIRE

Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

1984-01-01

We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to ...

Isolation and sequencing analysis on the seed-specific promoter from soybean

Institute of Scientific and Technical Information of China (English)

CAIYIN Qinggele; LI Mingchun; WEI Dongsheng; CAI Yi; XING Laijun

2007-01-01

The low level of foreign genes' expression in transgenic plants is a key factor that limits plant genetic engineering.Because of the critical regulatory activity of the promoters on gene transcription,they are studied extensively to improve the efficiency of the plant transgenic system.The constitutive promoters,such as CaMV 35S promoter,are usually used in plant genetic engineering.But those constitutive promoters continuously express their downstream genes during the whole life span in all the tissues of the host plants.This is not only wasteful to host plant's energy,but also harmful to host plants and usually affects their agronomic characteristics.In contrast,the seed-specific promoter only expresses its downstream genes from mid to late stage of seed maturation,and there is no expression or much lower expression in other tissues.So the seed-specific promoters are distinguished for their improvement and what they have brought to plant quality engineering.The aim of this article is to characterize a new seed-specific promoter and improve grain quality.The promoter region of β-conglycinin α-subunit gene was isolated from the genomic DNA of soybean Jilin 43 by PCR method,and successfully extended this fragment by TAIL PCR method and obtained the promoter fragment BCSP666.Sequencing analysis showed that the cloned fragment BCSP666 contained all of the motifs,such as RY repeat element,AG/CCCCA motif,TACACAT motif,ACGTmotif,A/T rich motif and E-box etc.,which constituted the seed-specific promoter activity.Based on this sequencing analysis,the seed-specific promoter activity of the fragment BCSP666 was predicted.And then the seed-specific expression vector pBI121-666,which contained GUS reporter gene,was constructed with the fragment BCSP666.Transformation of Arabidopsis thaliana plants by Agrobacterium-mediated floral-dip method with the recombined vector pBI121-666was conducted.The transgenic plants were selected on the kanamycin-resistant MS medium

Characterization and sequence analysis of the F2 promoter from corynephage BFK20

International Nuclear Information System (INIS)

Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.

1994-01-01

F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)

9 CFR 3.81 - Environment enhancement to promote psychological well-being.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Environment enhancement to promote..., Treatment, and Transportation of Nonhuman Primates 2 Facilities and Operating Standards § 3.81 Environment..., document, and follow an appropriate plan for environment enhancement adequate to promote the psychological...

Transcriptional activation signals found in the Epstein-Barr virus (EBV) latency C promoter are conserved in the latency C promoter sequences from baboon and Rhesus monkey EBV-like lymphocryptoviruses (cercopithicine herpesviruses 12 and 15).

Science.gov (United States)

Fuentes-Pananá, E M; Swaminathan, S; Ling, P D

1999-01-01

The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (-1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates.

Differential evolution optimization combined with chaotic sequences for image contrast enhancement

Energy Technology Data Exchange (ETDEWEB)

Santos Coelho, Leandro dos [Industrial and Systems Engineering Graduate Program, LAS/PPGEPS, Pontifical Catholic University of Parana, PUCPR Imaculada Conceicao, 1155, 80215-901 Curitiba, Parana (Brazil)], E-mail: leandro.coelho@pucpr.br; Sauer, Joao Guilherme [Industrial and Systems Engineering Graduate Program, LAS/PPGEPS, Pontifical Catholic University of Parana, PUCPR Imaculada Conceicao, 1155, 80215-901 Curitiba, Parana (Brazil)], E-mail: joao.sauer@gmail.com; Rudek, Marcelo [Industrial and Systems Engineering Graduate Program, LAS/PPGEPS, Pontifical Catholic University of Parana, PUCPR Imaculada Conceicao, 1155, 80215-901 Curitiba, Parana (Brazil)], E-mail: marcelo.rudek@pucpr.br

2009-10-15

Evolutionary Algorithms (EAs) are stochastic and robust meta-heuristics of evolutionary computation field useful to solve optimization problems in image processing applications. Recently, as special mechanism to avoid being trapped in local minimum, the ergodicity property of chaotic sequences has been used in various designs of EAs. Three differential evolution approaches based on chaotic sequences using logistic equation for image enhancement process are proposed in this paper. Differential evolution is a simple yet powerful evolutionary optimization algorithm that has been successfully used in solving continuous problems. The proposed chaotic differential evolution schemes have fast convergence rate but also maintain the diversity of the population so as to escape from local optima. In this paper, the image contrast enhancement is approached as a constrained nonlinear optimization problem. The objective of the proposed chaotic differential evolution schemes is to maximize the fitness criterion in order to enhance the contrast and detail in the image by adapting the parameters using a contrast enhancement technique. The proposed chaotic differential evolution schemes are compared with classical differential evolution to two testing images. Simulation results on three images show that the application of chaotic sequences instead of random sequences is a possible strategy to improve the performance of classical differential evolution optimization algorithm.

Targets of DNA-binding proteins in bacterial promoter regions present enhanced probabilities for spontaneous thermal openings

International Nuclear Information System (INIS)

Apostolaki, Angeliki; Kalosakas, George

2011-01-01

We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties

In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

Directory of Open Access Journals (Sweden)

W.S.I. de Silva

2017-07-01

Full Text Available The promoter region of a drought and abscisic acid (ABA inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involved in regulation of osr40c1 expression under different conditions were found in the 5′-upstream region of osr40c1. These are ABA-responsive element, light-responsive elements (ATCT-motif, Box I, G-box, GT1-motif, Gap-box and Sp1, myeloblastosis oncogene response element (CCAAT-box, auxin responsive element (TGA-element, gibberellin-responsive element (GARE-motif and fungal-elicitor responsive elements (Box E and Box-W1. A putative regulatory element, required for endosperm-specific pattern of gene expression designated as Skn-1 motif, was also detected in the Pokkali osr40c1 promoter region. In conclusion, the bioinformatic analysis of osr40c1 promoter region isolated from indica rice variety Pokkali led to the identification of several important stress-responsive cis-acting regulatory elements, and therefore, the isolated promoter sequence could be employed in rice genetic transformation to mediate expression of abiotic stress induced genes.

In Vivo Enhancer Analysis Chromosome 16 Conserved NoncodingSequences

Energy Technology Data Exchange (ETDEWEB)

Pennacchio, Len A.; Ahituv, Nadav; Moses, Alan M.; Nobrega,Marcelo; Prabhakar, Shyam; Shoukry, Malak; Minovitsky, Simon; Visel,Axel; Dubchak, Inna; Holt, Amy; Lewis, Keith D.; Plajzer-Frick, Ingrid; Akiyama, Jennifer; De Val, Sarah; Afzal, Veena; Black, Brian L.; Couronne, Olivier; Eisen, Michael B.; Rubin, Edward M.

2006-02-01

The identification of enhancers with predicted specificitiesin vertebrate genomes remains a significant challenge that is hampered bya lack of experimentally validated training sets. In this study, weleveraged extreme evolutionary sequence conservation as a filter toidentify putative gene regulatory elements and characterized the in vivoenhancer activity of human-fish conserved and ultraconserved1 noncodingelements on human chromosome 16 as well as such elements from elsewherein the genome. We initially tested 165 of these extremely conservedsequences in a transgenic mouse enhancer assay and observed that 48percent (79/165) functioned reproducibly as tissue-specific enhancers ofgene expression at embryonic day 11.5. While driving expression in abroad range of anatomical structures in the embryo, the majority of the79 enhancers drove expression in various regions of the developingnervous system. Studying a set of DNA elements that specifically droveforebrain expression, we identified DNA signatures specifically enrichedin these elements and used these parameters to rank all ~;3,400human-fugu conserved noncoding elements in the human genome. The testingof the top predictions in transgenic mice resulted in a three-foldenrichment for sequences with forebrain enhancer activity. These datadramatically expand the catalogue of in vivo-characterized human geneenhancers and illustrate the future utility of such training sets for avariety of iological applications including decoding the regulatoryvocabulary of the human genome.

Cellular specificity of HIV-1 replication can be controlled by LTR sequences

International Nuclear Information System (INIS)

Reed-Inderbitzin, Edward; Maury, Wendy

2003-01-01

Two well-established determinants of retroviral tropism are envelope sequences that regulate entry and LTR sequences that can regulate viral expression in a cell-specific manner. Studies with human immunodeficiency virus-1 (HIV-1) have demonstrated that tropism of this virus maps primarily to variable envelope sequences. Studies have demonstrated that T cell and macrophage-specific transcription factor binding motifs exist in the upstream region of the LTR U3; however, the ability of the core enhancer/promoter proximal elements (two NF-κB and three Sp1 sites) to function well in macrophages and T cells have led many to conclude that HIV LTR sequences are not primary determinants of HIV tropism. To determine if cellular specificity could be imparted to HIV by the core enhancer elements, the enhancer/promoter proximal region of the HIV LTR was substituted with motifs that control gene expression in a myeloid-specific manner. The enhancer region from equine infectious anemia virus (EIAV) when substituted for the HIV enhancer/promoter proximal region was found to drive expression in a macrophage-specific manner and was responsive to HIV Tat. The addition of a 5' methylation-dependent binding site (MDBP) and a promoter proximal Sp1 motif increased expression without altering cellular specificity. Spacing between the promoter proximal region and the TATA box was also found to influence LTR activity. Infectivity studies using chimeric LTRs within the context of a dual-tropic infectious molecular clone established that these LTRs directed HIV replication and production of infectious virions in macrophages but not primary T cells or T cell lines. This investigation demonstrates that cellular specificity can be imparted onto HIV-1 replication at the level of viral transcription and not entry

A tandem sequence motif acts as a distance-dependent enhancer in a set of genes involved in translation by binding the proteins NonO and SFPQ

Directory of Open Access Journals (Sweden)

Roepcke Stefan

2011-12-01

Full Text Available Abstract Background Bioinformatic analyses of expression control sequences in promoters of co-expressed or functionally related genes enable the discovery of common regulatory sequence motifs that might be involved in co-ordinated gene expression. By studying promoter sequences of the human ribosomal protein genes we recently identified a novel highly specific Localized Tandem Sequence Motif (LTSM. In this work we sought to identify additional genes and LTSM-binding proteins to elucidate potential regulatory mechanisms. Results Genome-wide analyses allowed finding a considerable number of additional LTSM-positive genes, the products of which are involved in translation, among them, translation initiation and elongation factors, and 5S rRNA. Electromobility shift assays then showed specific signals demonstrating the binding of protein complexes to LTSM in ribosomal protein gene promoters. Pull-down assays with LTSM-containing oligonucleotides and subsequent mass spectrometric analysis identified the related multifunctional nucleotide binding proteins NonO and SFPQ in the binding complex. Functional characterization then revealed that LTSM enhances the transcriptional activity of the promoters in dependency of the distance from the transcription start site. Conclusions Our data demonstrate the power of bioinformatic analyses for the identification of biologically relevant sequence motifs. LTSM and the here found LTSM-binding proteins NonO and SFPQ were discovered through a synergistic combination of bioinformatic and biochemical methods and are regulators of the expression of a set of genes of the translational apparatus in a distance-dependent manner.

The Ties That Bind: Mapping the Dynamic Enhancer-Promoter Interactome.

Science.gov (United States)

Spurrell, Cailyn H; Dickel, Diane E; Visel, Axel

2016-11-17

Coupling chromosome conformation capture to molecular enrichment for promoter-containing DNA fragments enables the systematic mapping of interactions between individual distal regulatory sequences and their target genes. In this Minireview, we describe recent progress in the application of this technique and related complementary approaches to gain insight into the lineage- and cell-type-specific dynamics of interactions between regulators and gene promoters. Copyright © 2016 Elsevier Inc. All rights reserved.

The complete genome sequence of the plant growth-promoting bacterium Pseudomonas sp. UW4.

Directory of Open Access Journals (Sweden)

Jin Duan

Full Text Available The plant growth-promoting bacterium (PGPB Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated "housekeeping" genes (16S rRNA, gyrB, rpoB and rpoD of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup.

The Complete Genome Sequence of the Plant Growth-Promoting Bacterium Pseudomonas sp. UW4

Science.gov (United States)

Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J.; Glick, Bernard R.

2013-01-01

The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated “housekeeping” genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524

Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

Science.gov (United States)

Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

2016-02-09

Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

Sequencing of DC-SIGN promoter indicates an association between promoter variation and risk of nasopharyngeal carcinoma in cantonese

Directory of Open Access Journals (Sweden)

Liu Wen-Sheng

2010-11-01

Full Text Available Abstract Background The dendritic cell-specific intercellular adhesion molecule 3 grabbing non-integrin (DC-SIGN is an important pathogen recognition receptor of the innate immune system. DC-SIGN promoter variants play important role in the susceptibility to various infectious diseases. Nasopharyngeal carcinoma (NPC is a malignancy that is common in southern China and whether DC-SIGN promoter variants have effects on susceptibility to NPC is still unknown. The aim of this study is to ascertain the potential involvement of DC-SIGN promoter single nucleotide polymorphisms (SNPs in NPC susceptibility. Methods We conducted a case control study based on Cantonese population including 444 NPC patients and 464 controls matched on age and sex. The 1041 bp of DC-SIGN promoter region was directly sequenced for all samples. Sequence alignment and SNP search were inspected using DNAStar analysis programs and haplotype frequencies were estimated in Haploview V 4.0. The associations between the SNPs and the risk of NPC were analyzed using chi-square test and non-conditional logistic regression analysis with SPSS 13.0 software. Results A total of six variants were observed in the DC-SIGN promoter region and DC-SIGN -139 GG and -939 AA were significantly associated with NPC risk with adjusted Odds Ratios (ORs of 2.10 (95% confidence interval [CI] = 1.23-3.59; P = 0.006 and 2.52 (1.29-4.93; P = 0.007 respectively and subjects carrying the risk allele DC-SIGN -871 G had 1.47-fold (95% CI = 1.14-1.90 increased risks of developing NPC (P = 0.003. Haplotype analysis revealed that h1 'AAAG' was significantly associated with protection against NPC (OR = 0.69; P = 0.0002 and the association was still significant when using 1000 permutation test runs (P = 0.001. Conclusions Our study indicated that DC-SIGN promoter variants appear to be involved in the susceptibility to NPC and the detailed mechanism of this effect need further studies.

Genome-wide mapping of autonomous promoter activity in human cells.

Science.gov (United States)

van Arensbergen, Joris; FitzPatrick, Vincent D; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J; van Steensel, Bas

2017-02-01

Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of the sequences that could be tested. Here we present 'survey of regulatory elements' (SuRE), a method that assays more than 10 8 DNA fragments, each 0.2-2 kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library of random genomic fragments upstream of a 20-bp barcode is constructed, and decoded by paired-end sequencing. This library is used to transfect cells, and barcodes in transcribed RNA are quantified by high-throughput sequencing. When applied to the human genome, we achieve 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide in K562 cells. By computational modeling we delineate subregions within promoters that are relevant for their activity. We show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites.

Draft Genome Sequence of Ochrobactrum intermedium Strain SA148, a Plant Growth-Promoting Desert Rhizobacterium

KAUST Repository

Lafi, Feras Fawzi

2017-03-03

Ochrobactrum intermedium strain SA148 is a plant growth-promoting bacterium isolated from sandy soil in the Jizan area of Saudi Arabia. Here, we report the 4.9-Mb draft genome sequence of this strain, highlighting different pathways characteristic of plant growth promotion activity and environmental adaptation of SA148.

Identification of hamster inducible nitric oxide synthase (iNOS) promoter sequences that influence basal and inducible iNOS expression

Science.gov (United States)

Saldarriaga, Omar A.; Travi, Bruno L.; Choudhury, Goutam Ghosh; Melby, Peter C.

2012-01-01

IFN-γ/LPS-activated hamster (Mesocricetus auratus) macrophages express significantly less iNOS (NOS2) than activated mouse macrophages, which contributes to the hamster's susceptibility to intracellular pathogens. We determined a mechanism responsible for differences in iNOS promoter activity in hamsters and mice. The HtPP (1.2 kb) showed low basal and inducible promoter activity when compared with the mouse, and sequences within a 100-bp region (−233 to −133) of the mouse and hamster promoters influenced this activity. Moreover, within this 100 bp, we identified a smaller region (44 bp) in the mouse promoter, which recovered basal promoter activity when swapped into the hamster promoter. The mouse homolog (100-bp region) contained a cis-element for NF-IL-6 (−153/−142), which was absent in the hamster counterpart. EMSA and supershift assays revealed that the hamster sequence did not support the binding of NF-IL-6. Introduction of a functional NF-IL-6 binding sequence into the hamster promoter or its alteration in the mouse promoter revealed the critical importance of this transcription factor for full iNOS promoter activity. Furthermore, the binding of NF-IL-6 to the iNOS promoter (−153/−142) in vivo was increased in mouse cells but was reduced in hamster cells after IFN-γ/LPS stimulation. Differences in the activity of the iNOS promoters were evident in mouse and hamster cells, so they were not merely a result of species-specific differences in transcription factors. Thus, we have identified unique DNA sequences and a critical transcription factor, NF-IL-6, which contribute to the overall basal and inducible expression of hamster iNOS. PMID:22517919

Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

Directory of Open Access Journals (Sweden)

Tatsuya eKon

2014-11-01

Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

Science.gov (United States)

Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

1993-12-01

Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

Distinct Prion Domain Sequences Ensure Efficient Amyloid Propagation by Promoting Chaperone Binding or Processing In Vivo.

Directory of Open Access Journals (Sweden)

Christine R Langlois

2016-11-01

Full Text Available Prions are a group of proteins that can adopt a spectrum of metastable conformations in vivo. These alternative states change protein function and are self-replicating and transmissible, creating protein-based elements of inheritance and infectivity. Prion conformational flexibility is encoded in the amino acid composition and sequence of the protein, which dictate its ability not only to form an ordered aggregate known as amyloid but also to maintain and transmit this structure in vivo. But, while we can effectively predict amyloid propensity in vitro, the mechanism by which sequence elements promote prion propagation in vivo remains unclear. In yeast, propagation of the [PSI+] prion, the amyloid form of the Sup35 protein, has been linked to an oligopeptide repeat region of the protein. Here, we demonstrate that this region is composed of separable functional elements, the repeats themselves and a repeat proximal region, which are both required for efficient prion propagation. Changes in the numbers of these elements do not alter the physical properties of Sup35 amyloid, but their presence promotes amyloid fragmentation, and therefore maintenance, by molecular chaperones. Rather than acting redundantly, our observations suggest that these sequence elements make complementary contributions to prion propagation, with the repeat proximal region promoting chaperone binding to and the repeats promoting chaperone processing of Sup35 amyloid.

Transcriptome Sequencing Revealed Significant Alteration of Cortical Promoter Usage and Splicing in Schizophrenia

Science.gov (United States)

Wu, Jing Qin; Wang, Xi; Beveridge, Natalie J.; Tooney, Paul A.; Scott, Rodney J.; Carr, Vaughan J.; Cairns, Murray J.

2012-01-01

Background While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression. Methodology/Principal Findings The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22) from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDRschizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia. PMID:22558445

A multi-slice gradient sequence for contrast enhanced MR diagnosis of intracranial tumours

International Nuclear Information System (INIS)

Schoerner, W.; Sander, B.; Kornmesser, W.; Laniado, M.; Nakamura, T.; Felix, R.

1988-01-01

A multi-slice gradient echo sequence (FLASH) was compared with a conventional spin-echo (SE) technique with regard to its value for contrast enhanced MR diagnosis. In 28 patients with cerebral tumours, SE images (SE 400/30; four images/3.4 minutes) and FLASH images (FLASH 315/14; 15 images/1.4 minutes) were obtained before and after gadolinium DTPA. After gadolinium-DTPA results were comparable for both techniques with respect to contrast enhancement, tumor contrast and delineation. Because of the higher efficiency of the FLASH 315/14 technique, this sequence is the method of choice for contrast enhanced cerebral MR imaging. (orig.) [de

Fat-saturated, contrast-enhanced spin echo sequences in magnetic resonance tomographic diagnosis of peritoneal carcinosis

International Nuclear Information System (INIS)

Ricke, J.; Hosten, N.; Stroszczynski, C.; Amthauer, H.; Felix, R.; Sehouli, J.; Buchmann, E.; Rieger, J.

1999-01-01

Purpose: To evaluate contrast-enhanced, fat-saturated spin echo sequences for the detection of peritoneal carcinosis with MRI. Material and Methods: 61 patients, 35 with and 26 without peritoneal carcinosis, were examined with abdominal MRI. Fat-saturated, T 1 -weighted spin echo sequences were performed before and after administration of Gd-DTPA. In addition, 22 patients with peritoneal carcinosis were examined with contrast-enhanced abdominal CT. Results: 32 of 35 patients with peritoneal carcinosis demonstrated contrast enhancement of the visceral and 30 to 35 enhancement of the parietal peritoneum (91 and 86%, respectively). Wall thickening of the intestine or parietal peritoneum were noted in 21 and 20 of 35 patients (60 and 57%, respectively), ascites in 18 of 35 patients (51%). False positive contrast enhancement of the peritoneum was noted in 4 of 26 patients (15%). In the direct comparison of MRI and CT, 22 of 22 patients versus 7 of 22 patients showed contrast enhancement of the visceral peritoneum (100 and 32%, respectively). For other signs of peritoneal carcinosis (e.g., ascites, peritoneal seedings), no differences in diagnostic reliability were demonstrated. Conclusions: The use of fat-saturated, spin echo sequences facilitates the diagnosis of peritoneal carcinosis by artifact reduction and improved detection of peritoneal contrast enhancement. MRI with fat-saturated sequences was superior to CT. (orig.) [de

A Synthetic Oligo Library and Sequencing Approach Reveals an Insulation Mechanism Encoded within Bacterial σ54 Promoters

Directory of Open Access Journals (Sweden)

Lior Levy

2017-10-01

Full Text Available We use an oligonucleotide library of >10,000 variants to identify an insulation mechanism encoded within a subset of σ54 promoters. Insulation manifests itself as reduced protein expression for a downstream gene that is expressed by transcriptional readthrough. It is strongly associated with the presence of short CT-rich motifs (3–5 bp, positioned within 25 bp upstream of the Shine-Dalgarno (SD motif of the silenced gene. We provide evidence that insulation is triggered by binding of the ribosome binding site (RBS to the upstream CT-rich motif. We also show that, in E. coli, insulator sequences are preferentially encoded within σ54 promoters, suggesting an important regulatory role for these sequences in natural contexts. Our findings imply that sequence-specific regulatory effects that are sparsely encoded by short motifs may not be easily detected by lower throughput studies. Such sequence-specific phenomena can be uncovered with a focused oligo library (OL design that mitigates sequence-related variance, as exemplified herein.

Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli.

Science.gov (United States)

Urtecho, Guillaume; Tripp, Arielle D; Insigne, Kimberly; Kim, Hwangbeom; Kosuri, Sriram

2018-02-01

Promoters are the key drivers of gene expression and are largely responsible for the regulation of cellular responses to time and environment. In E. coli , decades of studies have revealed most, if not all, of the sequence elements necessary to encode promoter function. Despite our knowledge of these motifs, it is still not possible to predict the strength and regulation of a promoter from primary sequence alone. Here we develop a novel multiplexed assay to study promoter function in E. coli by building a site-specific genomic recombination-mediated cassette exchange (RMCE) system that allows for the facile construction and testing of large libraries of genetic designs integrated into precise genomic locations. We build and test a library of 10,898 σ70 promoter variants consisting of all combinations of a set of eight -35 elements, eight -10 elements, three UP elements, eight spacers, and eight backgrounds. We find that the -35 and -10 sequence elements can explain approximately 74% of the variance in promoter strength within our dataset using a simple log-linear statistical model. Neural network models can explain greater than 95% of the variance in our dataset, and show the increased power is due to nonlinear interactions of other elements such as the spacer, background, and UP elements.

Bioinformatic analysis of neurotropic HIV envelope sequences identifies polymorphisms in the gp120 bridging sheet that increase macrophage-tropism through enhanced interactions with CCR5

International Nuclear Information System (INIS)

Mefford, Megan E.; Kunstman, Kevin; Wolinsky, Steven M.; Gabuzda, Dana

2015-01-01

Macrophages express low levels of the CD4 receptor compared to T-cells. Macrophage-tropic HIV strains replicating in brain of untreated patients with HIV-associated dementia (HAD) express Envs that are adapted to overcome this restriction through mechanisms that are poorly understood. Here, bioinformatic analysis of env sequence datasets together with functional studies identified polymorphisms in the β3 strand of the HIV gp120 bridging sheet that increase M-tropism. D197, which results in loss of an N-glycan located near the HIV Env trimer apex, was detected in brain in some HAD patients, while position 200 was estimated to be under positive selection. D197 and T/V200 increased fusion and infection of cells expressing low CD4 by enhancing gp120 binding to CCR5. These results identify polymorphisms in the HIV gp120 bridging sheet that overcome the restriction to macrophage infection imposed by low CD4 through enhanced gp120–CCR5 interactions, thereby promoting infection of brain and other macrophage-rich tissues. - Highlights: • We analyze HIV Env sequences and identify amino acids in beta 3 of the gp120 bridging sheet that enhance macrophage tropism. • These amino acids at positions 197 and 200 are present in brain of some patients with HIV-associated dementia. • D197 results in loss of a glycan near the HIV Env trimer apex, which may increase exposure of V3. • These variants may promote infection of macrophages in the brain by enhancing gp120–CCR5 interactions

Bioinformatic analysis of neurotropic HIV envelope sequences identifies polymorphisms in the gp120 bridging sheet that increase macrophage-tropism through enhanced interactions with CCR5

Energy Technology Data Exchange (ETDEWEB)

Mefford, Megan E., E-mail: megan_mefford@hms.harvard.edu [Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Boston, MA (United States); Kunstman, Kevin, E-mail: kunstman@northwestern.edu [Northwestern University Medical School, Chicago, IL (United States); Wolinsky, Steven M., E-mail: s-wolinsky@northwestern.edu [Northwestern University Medical School, Chicago, IL (United States); Gabuzda, Dana, E-mail: dana_gabuzda@dfci.harvard.edu [Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Boston, MA (United States); Department of Neurology (Microbiology and Immunobiology), Harvard Medical School, Boston, MA (United States)

2015-07-15

Macrophages express low levels of the CD4 receptor compared to T-cells. Macrophage-tropic HIV strains replicating in brain of untreated patients with HIV-associated dementia (HAD) express Envs that are adapted to overcome this restriction through mechanisms that are poorly understood. Here, bioinformatic analysis of env sequence datasets together with functional studies identified polymorphisms in the β3 strand of the HIV gp120 bridging sheet that increase M-tropism. D197, which results in loss of an N-glycan located near the HIV Env trimer apex, was detected in brain in some HAD patients, while position 200 was estimated to be under positive selection. D197 and T/V200 increased fusion and infection of cells expressing low CD4 by enhancing gp120 binding to CCR5. These results identify polymorphisms in the HIV gp120 bridging sheet that overcome the restriction to macrophage infection imposed by low CD4 through enhanced gp120–CCR5 interactions, thereby promoting infection of brain and other macrophage-rich tissues. - Highlights: • We analyze HIV Env sequences and identify amino acids in beta 3 of the gp120 bridging sheet that enhance macrophage tropism. • These amino acids at positions 197 and 200 are present in brain of some patients with HIV-associated dementia. • D197 results in loss of a glycan near the HIV Env trimer apex, which may increase exposure of V3. • These variants may promote infection of macrophages in the brain by enhancing gp120–CCR5 interactions.

Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

Science.gov (United States)

Wyszyńska-Koko, J; Kurył, J

2004-01-01

MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

Using social media to enhance career development opportunities for health promotion professionals.

Science.gov (United States)

Roman, Leah A

2014-07-01

For health promotion professionals, social media offers many ways to engage with a broader range of colleagues; participate in professional development events; promote expertise, products, or services; and learn about career-enhancing opportunities such as funding and fellowships. Previous work has recommended "building networking into what you are already doing." This article provides updated and new social media resources, as well as practical examples and strategies to promote effective use of social media. Social media offers health promotion professionals cost-effective opportunities to enhance their career by building communities of practice, participating in professional development events, and enriching classroom learning. Developing the skills necessary to use social media for networking is important in the public health workforce, especially as social media is increasingly used in academic and practice settings. © 2014 Society for Public Health Education.

Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.

Science.gov (United States)

Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A

1999-08-01

Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.

Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents.

Science.gov (United States)

Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z

2014-03-01

The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.

A novel approach to enhance biological nutrient removal using a culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (Rpf) in SBR process.

Science.gov (United States)

Liu, Yindong; Su, Xiaomei; Lu, Lian; Ding, Linxian; Shen, Chaofeng

2016-03-01

A culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (SRpf) was used to enhance the biological nutrient removal of potentially functional bacteria. The obtained results suggest that SRpf accelerated the start-up process and significantly enhanced the biological nutrient removal in sequencing batch reactor (SBR). PO4 (3-)-P removal efficiency increased by over 12 % and total nitrogen removal efficiency increased by over 8 % in treatment reactor acclimated by SRpf compared with those without SRpf addition. The Illumina high-throughput sequencing analysis showed that SRpf played an essential role in shifts in the composition and diversity of bacterial community. The phyla of Proteobacteria and Actinobacteria, which were closely related to biological nutrient removal, were greatly abundant after SRpf addition. This study demonstrates that SRpf acclimation or addition might hold great potential as an efficient and cost-effective alternative for wastewater treatment plants (WWTPs) to meet more stringent operation conditions and legislations.

Intragenic HIV-1 env sequences that enhance gag expression

International Nuclear Information System (INIS)

Suptawiwat, Ornpreya; Sutthent, Ruengpung; Lee, T.-H.; Auewarakul, Prasert

2003-01-01

Expression of HIV-1 genes is regulated at multiple levels including the complex RNA splicing and transport mechanisms. Multiple cis-acting elements involved in these regulations have been previously identified in various regions of HIV-1 genome. Here we show that another cis-acting element was present in HIV-1 env region. This element enhanced the expression of Gag when inserted together with Rev response element (RRE) into a truncated HIV-1 genome in the presence of Rev. The enhancing activity was mapped to a 263-bp fragment in the gp41 region downstream to RRE. RNA analysis showed that it might function by promoting RNA stability and Rev-dependent RNA export. The enhancement was specific to Rev-dependent expression, since it did not enhance Gag expression driven by Sam68, a cellular protein that has been shown to be able to substitute for Rev in RNA export function

In situ detection of a heat-shock regulatory element binding protein using a soluble short synthetic enhancer sequence

Energy Technology Data Exchange (ETDEWEB)

Harel-Bellan, A; Brini, A T; Farrar, W L [National Cancer Institute, Frederick, MD (USA); Ferris, D K [Program Resources, Inc., Frederick, MD (USA); Robin, P [Institut Gustave Roussy, Villejuif (France)

1989-06-12

In various studies, enhancer binding proteins have been successfully absorbed out by competing sequences inserted into plasmids, resulting in the inhibition of the plasmid expression. Theoretically, such a result could be achieved using synthetic enhancer sequences not inserted into plasmids. In this study, a double stranded DNA sequence corresponding to the human heat shock regulatory element was chemically synthesized. By in vitro retardation assays, the synthetic sequence was shown to bind specifically a protein in extracts from the human T cell line Jurkat. When the synthetic enhancer was electroporated into Jurkat cells, not only the enhancer was shown to remain undegraded into the cells for up to 2 days, but also its was shown to bind intracellularly a protein. The binding was specific and was modulated upon heat shock. Furthermore, the binding protein was shown to be of the expected molecular weight by UV crosslinking. However, when the synthetic enhancer element was co-electroporated with an HSP 70-CAT reporter construct, the expression of the reporter plasmid was consistently enhanced in the presence of the exogenous synthetic enhancer.

Draft Genome Sequence of Ochrobactrum intermedium Strain SA148, a Plant Growth-Promoting Desert Rhizobacterium

KAUST Repository

Lafi, Feras Fawzi; Alam, Intikhab; Geurts, Rene; Bisseling, Ton; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

2017-01-01

Ochrobactrum intermedium strain SA148 is a plant growth-promoting bacterium isolated from sandy soil in the Jizan area of Saudi Arabia. Here, we report the 4.9-Mb draft genome sequence of this strain, highlighting different pathways characteristic

Developing a set of strong intronic promoters for robust metabolic engineering in oleaginous Rhodotorula (Rhodosporidium) yeast species.

Science.gov (United States)

Liu, Yanbin; Yap, Sihui Amy; Koh, Chong Mei John; Ji, Lianghui

2016-11-25

Red yeast species in the Rhodotorula/Rhodosporidium genus are outstanding producers of triacylglyceride and cell biomass. Metabolic engineering is expected to further enhance the productivity and versatility of these hosts for the production of biobased chemicals and fuels. Promoters with strong activity during oil-accumulation stage are critical tools for metabolic engineering of these oleaginous yeasts. The upstream DNA sequences of 6 genes involved in lipid biosynthesis or accumulation in Rhodotorula toruloides were studied by luciferase reporter assay. The promoter of perilipin/lipid droplet protein 1 gene (LDP1) displayed much stronger activity (4-11 folds) than that of glyceraldehyde-3-phosphate dehydrogenase gene (GPD1), one of the strongest promoters known in yeasts. Depending on the stage of cultivation, promoter of acetyl-CoA carboxylase gene (ACC1) and fatty acid synthase β subunit gene (FAS1) exhibited intermediate strength, displaying 50-160 and 20-90% levels of GPD1 promoter, respectively. Interestingly, introns significantly modulated promoter strength at high frequency. The incorporation of intron 1 and 2 of LDP1 (LDP1in promoter) enhanced its promoter activity by 1.6-3.0 folds. Similarly, the strength of ACC1 promoter was enhanced by 1.5-3.2 folds if containing intron 1. The intron 1 sequences of ACL1 and FAS1 also played significant regulatory roles. When driven by the intronic promoters of ACC1 and LDP1 (ACC1in and LDP1in promoter, respectively), the reporter gene expression were up-regulated by nitrogen starvation, independent of de novo oil biosynthesis and accumulation. As a proof of principle, overexpression of the endogenous acyl-CoA-dependent diacylglycerol acyltransferase 1 gene (DGA1) by LDP1in promoter was significantly more efficient than GPD1 promoter in enhancing lipid accumulation. Intronic sequences play an important role in regulating gene expression in R. toruloides. Three intronic promoters, LDP1in, ACC1in and FAS1in, are

Direct interactions of OCA-B and TFII-I regulate immunoglobulin heavy-chain gene transcription by facilitating enhancer-promoter communication.

Science.gov (United States)

Ren, Xiaodi; Siegel, Rachael; Kim, Unkyu; Roeder, Robert G

2011-05-06

B cell-specific coactivator OCA-B, together with Oct-1/2, binds to octamer sites in promoters and enhancers to activate transcription of immunoglobulin (Ig) genes, although the mechanisms underlying their roles in enhancer-promoter communication are unknown. Here, we demonstrate a direct interaction of OCA-B with transcription factor TFII-I, which binds to DICE elements in Igh promoters, that affects transcription at two levels. First, OCA-B relieves HDAC3-mediated Igh promoter repression by competing with HDAC3 for binding to promoter-bound TFII-I. Second, and most importantly, Igh 3' enhancer-bound OCA-B and promoter-bound TFII-I mediate promoter-enhancer interactions, in both cis and trans, that are important for Igh transcription. These and other results reveal an important function for OCA-B in Igh 3' enhancer function in vivo and strongly favor an enhancer mechanism involving looping and facilitated factor recruitment rather than a tracking mechanism. Copyright © 2011 Elsevier Inc. All rights reserved.

Transcriptome sequencing revealed significant alteration of cortical promoter usage and splicing in schizophrenia.

Directory of Open Access Journals (Sweden)

Jing Qin Wu

Full Text Available While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression.The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22 from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDR<0.05. Both types of transcriptional isoforms were exemplified by reads aligned to the neurodevelopmentally significant doublecortin-like kinase 1 (DCLK1 gene.This study provided the first deep and un-biased analysis of schizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia.

Gene activation regresses atherosclerosis, promotes health, and enhances longevity

Directory of Open Access Journals (Sweden)

Luoma Pauli V

2010-07-01

Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.

Prevalence of transcription promoters within archaeal operons and coding sequences.

Science.gov (United States)

Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

2009-01-01

Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638

Science.gov (United States)

Taghavi, Safiyh; van der Lelie, Daniel; Hoffman, Adam; Zhang, Yian-Biao; Walla, Michael D.; Vangronsveld, Jaco; Newman, Lee; Monchy, Sébastien

2010-01-01

Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa×deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plant roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT–PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to

Genome-Wide Mapping Targets of the Metazoan Chromatin Remodeling Factor NURF Reveals Nucleosome Remodeling at Enhancers, Core Promoters and Gene Insulators.

Directory of Open Access Journals (Sweden)

So Yeon Kwon

2016-04-01

Full Text Available NURF is a conserved higher eukaryotic ISWI-containing chromatin remodeling complex that catalyzes ATP-dependent nucleosome sliding. By sliding nucleosomes, NURF is able to alter chromatin dynamics to control transcription and genome organization. Previous biochemical and genetic analysis of the specificity-subunit of Drosophila NURF (Nurf301/Enhancer of Bithorax (E(bx has defined NURF as a critical regulator of homeotic, heat-shock and steroid-responsive gene transcription. It has been speculated that NURF controls pathway specific transcription by co-operating with sequence-specific transcription factors to remodel chromatin at dedicated enhancers. However, conclusive in vivo demonstration of this is lacking and precise regulatory elements targeted by NURF are poorly defined. To address this, we have generated a comprehensive map of in vivo NURF activity, using MNase-sequencing to determine at base pair resolution NURF target nucleosomes, and ChIP-sequencing to define sites of NURF recruitment. Our data show that, besides anticipated roles at enhancers, NURF interacts physically and functionally with the TRF2/DREF basal transcription factor to organize nucleosomes downstream of active promoters. Moreover, we detect NURF remodeling and recruitment at distal insulator sites, where NURF functionally interacts with and co-localizes with DREF and insulator proteins including CP190 to establish nucleosome-depleted domains. This insulator function of NURF is most apparent at subclasses of insulators that mark the boundaries of chromatin domains, where multiple insulator proteins co-associate. By visualizing the complete repertoire of in vivo NURF chromatin targets, our data provide new insights into how chromatin remodeling can control genome organization and regulatory interactions.

A New Approach to Sequence Analysis Exemplified by Identification of cis-Elements in Abscisic Acid Inducible Promoters

DEFF Research Database (Denmark)

Busk, Peter Kamp; Hallin, Peter Fischer; Salomon, Jesper

-regulatory elements. We have developed a method for identifying short, conserved motifs in biological sequences such as proteins, DNA and RNA5. This method was used for analysis of approximately 2000 Arabidopsis thaliana promoters that have been shown by DNA array analysis to be induced by abscisic acid6....... These promoters were compared to 28000 promoters that are not induced by abscisic acid. The analysis identified previously described ABA-inducible promoter elements such as ABRE, CE3 and CRT1 but also new cis-elements were found. Furthermore, the list of DNA elements could be used to predict ABA...

TaALMT1 promoter sequence compositions, acid tolerance, and Al tolerance in wheat cultivars and landraces from Sichuan in China.

Science.gov (United States)

Han, C; Dai, S F; Liu, D C; Pu, Z J; Wei, Y M; Zheng, Y L; Wen, D J; Zhao, L; Yan, Z H

2013-11-18

Previous genetic studies on wheat from various sources have indicated that aluminum (Al) tolerance may have originated independently in USA, Brazil, and China. Here, TaALMT1 promoter sequences of 92 landraces and cultivars from Sichuan, China, were sequenced. Five promoter types (I', II, III, IV, and V) were observed in 39 cultivars, and only three promoter types (I, II, and III) were observed in 53 landraces. Among the wheat collections worldwide, only the Chinese Spring (CS) landrace native to Sichuan, China, carried the TaALMT1 promoter type III. Besides CS, two other Sichuan-bred landraces and six cultivars with TaALMT1 promoter type III were identified in this study. In the phylogenetic tree constructed based on the TaALMT1 promoter sequences, type III formed a separate branch, which was supported by a high bootstrap value. It is likely that TaALMT1 promoter type III originated from Sichuan-bred wheat landraces of China. In addition, the landraces with promoter type I showed the lowest Al tolerance among all landraces and cultivars. Furthermore, the cultivars with promoter type IV showed better Al tolerance than landraces with promoter type II. A comparison of acid tolerance and Al tolerance between cultivars and landraces showed that the landraces had better acid tolerance than the cultivars, whereas the cultivars showed better Al tolerance than the landraces. Moreover, significant difference in Al tolerance was also observed between the cultivars raised by the National Ministry of Agriculture and by Sichuan Province. Among the landraces from different regions, those from the East showed better acid tolerance and Al tolerance than those from the South and West of Sichuan. Additional Al-tolerant and acid-tolerant wheat lines were also identified.

Promoter or enhancer, what's the difference? Deconstruction of established distinctions and presentation of a unifying model

DEFF Research Database (Denmark)

Andersson, Robin

2015-01-01

Gene transcription is strictly controlled by the interplay of regulatory events at gene promoters and gene-distal regulatory elements called enhancers. Despite extensive studies of enhancers, we still have a very limited understanding of their mechanisms of action and their restricted spatio......-temporal activities. A better understanding would ultimately lead to fundamental insights into the control of gene transcription and the action of regulatory genetic variants involved in disease. Here, I review and discuss pros and cons of state-of-the-art genomics methods to localize and infer the activity...... of enhancers. Among the different approaches, profiling of enhancer RNAs yields the highest specificity and may be superior in detecting in vivo activity. I discuss their apparent similarities to promoters, which challenge the established view of enhancers and promoters as distinct entities, and present...

Matlab enhanced multi-threaded tomography optimization sequence (MEMTOS)

International Nuclear Information System (INIS)

Lum, Edward S.; Pope, Chad L.

2016-01-01

Highlights: • Monte Carlo simulation of spent nuclear fuel assembly neutron computed tomography. • Optimized parallel calculations conducted from within the MATLAB environment. • Projection difference technique used to identify anomalies in spent nuclear fuel assemblies. - Abstract: One challenge associated with spent nuclear fuel assemblies is the lack of non-destructive analysis techniques to determine if fuel pins have been removed or replaced or if there are significant defects associated with fuel pins deep within a fuel assembly. Neutron computed tomography is a promising technique for addressing these qualitative issues. Monte Carlo simulation of spent nuclear fuel neutron computed tomography allows inexpensive process investigation and optimization. The main purpose of this work is to provide a fully automated advanced simulation framework for the analysis of spent nuclear fuel inspection using neutron computed tomography. The simulation framework, called Matlab Enhanced Multi-Threaded Tomography Optimization Sequence (MEMTOS) not only automates the simulation process, but also generates superior tomography image results. MEMTOS is written in the MATLAB scripting language and addresses file management, parallel Monte Carlo execution, results extraction, and tomography image generation. This paper describes the mathematical basis for neutron computed tomography, the Monte Carlo technique used to simulate neutron computed tomography, and the overall tomography simulation optimization algorithm. Sequence results presented include overall simulation speed enhancement, tomography and image results obtained for Experimental Breeder Reactor II spent fuel assemblies and light water reactor fuel assemblies. Optimization using a projection difference technique are also described.

MR of normal pancreas : comparison of five pulse sequences and enhancing patterns on dynamic imaging

International Nuclear Information System (INIS)

Jang, Hyun Jung; Kim, Tae Kyoung; Hong, Sung Hwan; Han, Joon Koo; Choi, Byung Ihn

1997-01-01

To compare T1-weighted FLASH and turbo spin echo (SE) T2-weighted sequences with conventional T1- and T2-weighted sequences in imaging normal pancreas and to describe the enhancing patterns on dynamic MR imging. Forty-four patients with presumed hepatic hemangiomas were studied at 1.0T or 1.5T by using conventional SE sequences (T1-weighted, T2-weighted, and heavily T2-weighted), turbo-SE T2-weighted sequences, and breath-hold T1-weighted FLASH sequences acquired before, immediately on, and at 1, 2, 3, and 5 or 10 minutes after injection of a bolus of gadopentetate dimeglumine. No patients had either a history or its clinical features of pancreatic disease. Images were quantitatively analyzed for signal-difference-to noise ratios (SD/Ns) between the pancreas and peripancreatic fat. Percentage enhancement of the pancreas was measured on each dynamic MR image. Conspicuity of the pancreatic border was qualitatively evaluated according to a consensus, reached by three radiologists. Turbo-SE T2-weighted images had a significantly higher SD/N ratio (p<0.001) and better conspicuity of the pancreatic border (p<0.001) than SE T2- and heavily T2-weighted images;T1-weighted SE images had a significantly higher SD/N ratio than T1-weighted FLASH images (p<0.001), but there was no significant difference between tham in qualitative analysis (p=0.346). Percentage enhancement immediately on and at 1, 2, 3, 5, and 10 minutes after administration of contrast material was 39.9%, 44.5%, 42.9%, 40.8%, 36.3%, 29.9%, respectively, with peak enhancement at 1 minute. In MR imaging of normal pancreas, turbo-SE T2-weighted imaging is superior to SE T2- and heavily T2- weighted imaging, and SE T1-weighted imaging is superior to T1-weighted FLASH imaging. On serial gadolinium-enhanced FLASH imaging, normal pancreas shows peak enhancement at 1 minute

T1 Gd-enhanced compared with CISS sequences in retinoblastoma: superiority of T1 sequences in evaluation of tumour extension

Energy Technology Data Exchange (ETDEWEB)

Gizewski, Elke R.; Wanke, Isabel; Guengoer, Ali-Riza; Forsting, Michael [University Hospital, Department of Diagnostic and Interventional Neuroradiology, Essen (Germany); Jurklies, Christine [University Hospital Essen, Department of Ophthalmology (Germany)

2005-01-01

Background As adequate therapy for retinoblastoma in young children depends on infiltration of extra-retinal structures, diagnostic modalities play an essential role. Methods: In this widely extended study, 80 children with retinoblastoma were studied with MRI (standard fat-suppressed Gd-enhanced T1, T2 thin-slice sequences (additionally with small loop surface coil), constructive interference in steady state (CISS) sequence covering the orbita). The images were analysed by two blinded neuroradiologists. Histology was used as the gold standard. MRI assumed infiltration of extra-retinal structures in 13 of 80 patients of which ten were confirmed by histology. Affected extra-retinal structures were: optic nerve (five, of which two were on CISS and three on T1 with higher image resolution using the surface coil), scleral infiltration (five, of which four on CISS and T1) and ciliary body infiltration (one on CISS and T1). Another 61 enucleated patients did not have any extra-retinal infiltration in histology. The CISS sequence with multiplanar reconstruction was mainly helpful in revealing exact three-dimensional tumour extension with excellent clinical acceptance and pre-surgical planning but T1 fat-suppressed Gd-enhanced images were superior in revealing exact tumour extension. CISS sequences allow to produce excellent anatomical images and to perform multiplanar reconstruction to better demonstrate tumour extension. However, T1-weighted sequences after contrast application are more sensitive (60 versus 40%) in detecting infiltration of the optic nerve but equal in detecting scleral infiltration. (orig.)

Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

Directory of Open Access Journals (Sweden)

Hoorig Nassanian

2007-08-01

Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.

Contrast-enhanced dynamic MR imaging of parasellar tumor using fast spin-echo sequence

International Nuclear Information System (INIS)

Kusunoki, Katsusuke; Ohue, Shiro; Ichikawa, Haruhisa; Saito, Masahiro; Sadamoto, Kazuhiko; Sakaki, Saburo; Miki, Hitoshi.

1995-01-01

We have applied a new dynamic MRI technique that uses a fast spin-echo sequence to parasellar tumors. This sequence has less susceptible effect and better spatial resolution than a gradient echo sequence, providing faster images than a short spin-echo sequence does. Image was obtained in the coronal or sagittal plane using a 1.5T clinical MRI system, and then, dynamic MR images were acquired every 10 to 20 sec after administration of Gd-DTPA (0.1 mmol/kg). The subjects were 12 patients (5 microadenomas, 5 macroadenomas and 2 Rathke's cleft cysts) and 5 normal volunteers. As for volunteers, the cavernous sinus, pituitary stalk and posterior pituitary gland were contrasted on the first image, followed by visualization of the proximal portion adjacent to the junction of the infundibulum and the anterior pituitary gland, and finally by contrasting the distal portion of the anterior pituitary gland. There was a difference with respect to tumor contrast between microadenomas and macroadenomas. In the case of the macroadenomas, the tumor was contrasted at the same time as, or faster than the anterior pituitary gland, while with the microadenomas the tumor was enhanced later than the anterior pituitary gland. No enhancement with contrast medium was seen in Rathke's cleft cysts. In addition, it was possible to differentiate a recurrent tumor from a piece of muscle placed at surgery since the images obtained by the fast spin-echo sequence were clearer than those obtained by gradient echo sequence. (author)

A functional variant in the stearoyl-CoA desaturase gene promoter enhances fatty acid desaturation in pork.

Directory of Open Access Journals (Sweden)

Joan Estany

Full Text Available There is growing public concern about reducing saturated fat intake. Stearoyl-CoA desaturase (SCD is the lipogenic enzyme responsible for the biosynthesis of oleic acid (18 ∶ 1 by desaturating stearic acid (18 ∶ 0. Here we describe a total of 18 mutations in the promoter and 3' non-coding region of the pig SCD gene and provide evidence that allele T at AY487830:g.2228T>C in the promoter region enhances fat desaturation (the ratio 18 ∶ 1/18 ∶ 0 in muscle increases from 3.78 to 4.43 in opposite homozygotes without affecting fat content (18 ∶ 0+18 ∶ 1, intramuscular fat content, and backfat thickness. No mutations that could affect the functionality of the protein were found in the coding region. First, we proved in a purebred Duroc line that the C-T-A haplotype of the 3 single nucleotide polymorphisms (SNPs (g.2108C>T; g.2228T>C; g.2281A>G of the promoter region was additively associated to enhanced 18 ∶ 1/18 ∶ 0 both in muscle and subcutaneous fat, but not in liver. We show that this association was consistent over a 10-year period of overlapping generations and, in line with these results, that the C-T-A haplotype displayed greater SCD mRNA expression in muscle. The effect of this haplotype was validated both internally, by comparing opposite homozygote siblings, and externally, by using experimental Duroc-based crossbreds. Second, the g.2281A>G and the g.2108C>T SNPs were excluded as causative mutations using new and previously published data, restricting the causality to g.2228T>C SNP, the last source of genetic variation within the haplotype. This mutation is positioned in the core sequence of several putative transcription factor binding sites, so that there are several plausible mechanisms by which allele T enhances 18 ∶ 1/18 ∶ 0 and, consequently, the proportion of monounsaturated to saturated fat.

MEG3 is a prognostic factor for CRC and promotes chemosensitivity by enhancing oxaliplatin-induced cell apoptosis.

Science.gov (United States)

Li, Lixia; Shang, Jian; Zhang, Yupeng; Liu, Shi; Peng, Yanan; Zhou, Zhou; Pan, Huaqing; Wang, Xiaobing; Chen, Lipng; Zhao, Qiu

2017-09-01

A major reason for the failure of advanced colorectal cancer (CRC) treatment is the occurrence of chemoresistance to oxaliplatin-based chemotherapy. Recently, studies have shown that long non-coding RNAs (lncRNAs) play an important role in drug resistance. Using HiSeq sequencing methods, we identified that lncRNAs show differential expression levels in oxaliplatin-resistant (OxR) and non-resistant CRC patients. RT-qPCR was then performed in tissues and serum samples, and lncRNA MEG3 was verified to be downregulated in non-responding patients and to have considerable discriminating potential to identify responding patients from non-responding patients. Moreover, decreased serum MEG3 expression was associated with poor chemoresponse and low survival rate in CRC patients receiving oxaliplatin treatment. Subsequently, OxR cell lines were established, and MEG3 was significantly downregulated in HT29 OxR and SW480 OxR cells. In addition, overexpression of MEG3 with pMEG3 reversed oxaliplatin resistance in both CRC cell lines. Flow cytometric apoptosis analysis indicated that MEG3 promoted CRC cell apoptosis. More importantly, MEG3 enhanced oxaliplatin‑induced cell cytotoxicity in CRC. In conclusion, our integrated approach demonstrated that decreased expression of lncRNA MEG3 in CRC confers potent poor therapeutic efficacy, and that MEG3 promotes chemosensitivity by enhancing oxaliplatin-induced cell apoptosis. Thus, overexpression of MEG3 may be a future direction by which to develop a novel therapeutic strategy to overcome oxaliplatin resistance of CRC patients.

Plant Growth Promoting Rhizobacteria and Silicon Synergistically Enhance Salinity Tolerance of Mung Bean

KAUST Repository

Mahmood, Sajid

2016-06-17

The present study explored the eco-friendly approach of utilizing plant-growth-promoting rhizobacteria (PGPR) inoculation and foliar application of silicon (Si) to improve the physiology, growth, and yield of mung bean under saline conditions. We isolated 18 promising PGPR from natural saline soil in Saudi Arabia, and screened them for plant-growth-promoting activities. Two effective strains were selected from the screening trial, and were identified as Enterobacter cloacae and Bacillus drentensis using matrix-assisted laser desorption ionization-time-of-flight mass spectrometry and 16S rRNA gene sequencing techniques, respectively. Subsequently, in a 2-year mung bean field trial, using a randomized complete block design with a split-split plot arrangement, we evaluated the two PGPR strains and two Si levels (1 and 2 kg ha−1), in comparison with control treatments, under three different saline irrigation conditions (3.12, 5.46, and 7.81 dS m−1). The results indicated that salt stress substantially reduced stomatal conductance, transpiration rate, relative water content (RWC), total chlorophyll content, chlorophyll a, chlorophyll b, carotenoid content, plant height, leaf area, dry biomass, seed yield, and salt tolerance index. The PGPR strains and Si levels independently improved all the aforementioned parameters. Furthermore, the combined application of the B. drentensis strain with 2 kg Si ha−1 resulted in the greatest enhancement of mung bean physiology, growth, and yield. Overall, the results of this study provide important information for the benefit of the agricultural industry.

Plant Growth Promoting Rhizobacteria and Silicon Synergistically Enhance Salinity Tolerance of Mung Bean

KAUST Repository

Mahmood, Sajid; Daur, Ihsanullah; Al-Solaimani, Samir G.; Ahmad, Shakeel; Madkour, Mohamed H.; Yasir, Muhammad; Hirt, Heribert; Ali, Shawkat; Ali, Zahir

2016-01-01

The present study explored the eco-friendly approach of utilizing plant-growth-promoting rhizobacteria (PGPR) inoculation and foliar application of silicon (Si) to improve the physiology, growth, and yield of mung bean under saline conditions. We isolated 18 promising PGPR from natural saline soil in Saudi Arabia, and screened them for plant-growth-promoting activities. Two effective strains were selected from the screening trial, and were identified as Enterobacter cloacae and Bacillus drentensis using matrix-assisted laser desorption ionization-time-of-flight mass spectrometry and 16S rRNA gene sequencing techniques, respectively. Subsequently, in a 2-year mung bean field trial, using a randomized complete block design with a split-split plot arrangement, we evaluated the two PGPR strains and two Si levels (1 and 2 kg ha−1), in comparison with control treatments, under three different saline irrigation conditions (3.12, 5.46, and 7.81 dS m−1). The results indicated that salt stress substantially reduced stomatal conductance, transpiration rate, relative water content (RWC), total chlorophyll content, chlorophyll a, chlorophyll b, carotenoid content, plant height, leaf area, dry biomass, seed yield, and salt tolerance index. The PGPR strains and Si levels independently improved all the aforementioned parameters. Furthermore, the combined application of the B. drentensis strain with 2 kg Si ha−1 resulted in the greatest enhancement of mung bean physiology, growth, and yield. Overall, the results of this study provide important information for the benefit of the agricultural industry.

Sequence comparison for non-enhanced MRA of the lower extremity arteries at 7 Tesla.

Directory of Open Access Journals (Sweden)

Sören Johst

Full Text Available In this study three sequences for non-contrast-enhanced MRA of the lower extremity arteries at 7T were compared. Cardiac triggering was used with the aim to reduce signal variations in the arteries. Two fast single-shot 2D sequences, a modified Ultrafast Spoiled Gradient Echo (UGRE sequence and a variant of the Quiescent-Interval Single-Shot (QISS sequence were triggered via phonocardiogram and compared in volunteer examinations to a non-triggered 2D gradient echo (GRE sequence. For image acquisition, a 16-channel transmit/receive coil and a manually positionable AngioSURF table were used. To tackle B1 inhomogeneities at 7T, Time-Interleaved Acquisition of Modes (TIAMO was integrated in GRE and UGRE. To compare the three sequences quantitatively, a vessel-to-background ratio (VBR was measured in all volunteers and stations. In conclusion, cardiac triggering was able to suppress flow artifacts satisfactorily. The modified UGRE showed only moderate image artifacts. Averaged over all volunteers and stations, GRE reached a VBR of 4.18±0.05, UGRE 5.20±0.06, and QISS 2.72±0.03. Using cardiac triggering and TIAMO imaging technique was essential to perform non-enhanced MRA of the lower extremities vessels at 7T. The modified UGRE performed best, as observed artifacts were only moderate and the highest average VBR was reached.

Deletion of the LTR enhancer/promoter has no impact on the integration profile of MLV vectors in human hematopoietic progenitors.

Directory of Open Access Journals (Sweden)

Arianna Moiani

Full Text Available Moloney murine leukemia virus (MLV-derived gamma-retroviral vectors integrate preferentially near transcriptional regulatory regions in the human genome, and are associated with a significant risk of insertional gene deregulation. Self-inactivating (SIN vectors carry a deletion of the U3 enhancer and promoter in the long terminal repeat (LTR, and show reduced genotoxicity in pre-clinical assays. We report a high-definition analysis of the integration preferences of a SIN MLV vector compared to a wild-type-LTR MLV vector in the genome of CD34(+ human hematopoietic stem/progenitor cells (HSPCs. We sequenced 13,011 unique SIN-MLV integration sites and compared them to 32,574 previously generated MLV sites in human HSPCs. The SIN-MLV vector recapitulates the integration pattern observed for MLV, with the characteristic clustering of integrations around enhancer and promoter regions associated to H3K4me3 and H3K4me1 histone modifications, specialized chromatin configurations (presence of the H2A.Z histone variant and binding of RNA Pol II. SIN-MLV and MLV integration clusters and hot spots overlap in most cases and are generated at a comparable frequency, indicating that the reduced genotoxicity of SIN-MLV vectors in hematopoietic cells is not due to a modified integration profile.

An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR

Directory of Open Access Journals (Sweden)

Davis Thomas M

2010-03-01

Full Text Available Abstract Background Although technological advances allow for the economical acquisition of whole genome sequences, many organisms' genomes remain unsequenced, and fully sequenced genomes may contain gaps. Researchers reliant upon partial genomic or heterologous sequence information require methods for obtaining unknown sequences from loci of interest. Various PCR based techniques are available for sequence walking - i.e., the acquisition of unknown DNA sequence adjacent to known sequence. Many such methods require rigid, elaborate protocols and/or impose narrowly confined options in the choice of restriction enzymes for necessary genomic digests. We describe a new method, TOPO® Vector-Ligation PCR (or TVL-PCR that innovatively integrates available tools and familiar concepts to offer advantages as a means of both targeted sequence walking and paralog mining. Findings TVL-PCR exploits the ligation efficiency of the pCR®4-TOPO® (Invitrogen, Carlsbad, California vector system to capture fragments of unknown sequence by creating chimeric molecules containing defined priming sites at both ends. Initially, restriction enzyme-digested genomic DNA is end-repaired to create 3' adenosine overhangs and is then ligated to pCR4-TOPO vectors. The ligation product pool is used directly as a template for nested PCR, using specific primers to target orthologous sequences, or degenerate primers to enable capture of paralogous gene family members. We demonstrated the efficacy of this method by capturing entire coding and partial promoter sequences of several strawberry Superman-like genes. Conclusions TVL-PCR is a convenient and efficient method for DNA sequence walking and paralog mining that is applicable to any organism for which relevant DNA sequence is available as a basis for primer design.

Discriminative identification of transcriptional responses of promoters and enhancers after stimulus

KAUST Repository

Kleftogiannis, Dimitrios A.; Kalnis, Panos; Arner, Erik; Bajic, Vladimir B.

2016-01-01

factors and co-activators. A case study on data from MCF-7 cell-line reveals that PEDAL can identify successfully the transcription response subclasses of promoters and enhancers from two different stimulations. Moreover, we report subsets of input markers

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

Science.gov (United States)

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Enhanced spatio-temporal alignment of plantar pressure image sequences using B-splines.

Science.gov (United States)

Oliveira, Francisco P M; Tavares, João Manuel R S

2013-03-01

This article presents an enhanced methodology to align plantar pressure image sequences simultaneously in time and space. The temporal alignment of the sequences is accomplished using B-splines in the time modeling, and the spatial alignment can be attained using several geometric transformation models. The methodology was tested on a dataset of 156 real plantar pressure image sequences (3 sequences for each foot of the 26 subjects) that was acquired using a common commercial plate during barefoot walking. In the alignment of image sequences that were synthetically deformed both in time and space, an outstanding accuracy was achieved with the cubic B-splines. This accuracy was significantly better (p align real image sequences with unknown transformation involved, the alignment based on cubic B-splines also achieved superior results than our previous methodology (p alignment on the dynamic center of pressure (COP) displacement was also assessed by computing the intraclass correlation coefficients (ICC) before and after the temporal alignment of the three image sequence trials of each foot of the associated subject at six time instants. The results showed that, generally, the ICCs related to the medio-lateral COP displacement were greater when the sequences were temporally aligned than the ICCs of the original sequences. Based on the experimental findings, one can conclude that the cubic B-splines are a remarkable solution for the temporal alignment of plantar pressure image sequences. These findings also show that the temporal alignment can increase the consistency of the COP displacement on related acquired plantar pressure image sequences.

Promoter2.0: for the recognition of PolII promoter sequences

DEFF Research Database (Denmark)

Knudsen, Steen; Knudsen, Steen

1999-01-01

transcription start sites. On standardized test setsconsisting of human genomic DNA, the performance of Promoter2.0 compares well with other softwaredeveloped for the same purpose. Availability : Promoter2.0 is available as a Web server at http://www.cbs.dtu.dk/services/promoter/ Contact : steen@cbs.dtu.dk...

Identification of TNF-α-responsive promoters and enhancers in the intestinal epithelial cell model Caco-2

DEFF Research Database (Denmark)

Boyd, Mette; Coskun, Mehmet; Lilje, Berit

2014-01-01

The Caco-2 cell line is one of the most important in vitro models for enterocytes, and is used to study drug absorption and disease, including inflammatory bowel disease and cancer. In order to use the model optimally, it is necessary to map its functional entities. In this study, we have generated...... genome-wide maps of active transcription start sites (TSSs), and active enhancers in Caco-2 cells with or without tumour necrosis factor (TNF)-α stimulation to mimic an inflammatory state. We found 520 promoters that significantly changed their usage level upon TNF-α stimulation; of these, 52...... promoters. As a case example, we characterize an enhancer regulating the laminin-5 γ2-chain (LAMC2) gene by nuclear factor (NF)-κB binding. This report is the first to present comprehensive TSS and enhancer maps over Caco-2 cells, and highlights many novel inflammation-specific promoters and enhancers....

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

Science.gov (United States)

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Complete genome sequence of the rapeseed plant-growth promoting Serratia plymuthica strain AS9

Energy Technology Data Exchange (ETDEWEB)

Neupane, Saraswoti [Uppsala University, Uppsala, Sweden; Hogberg, Nils [Uppsala University, Uppsala, Sweden; Alstrom, Sadhna [Uppsala University, Uppsala, Sweden; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Han, James [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Lu, Megan [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Fiebig, Anne [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Finlay, Roger D. [Uppsala University, Uppsala, Sweden

2012-01-01

Serratia plymuthica are plant-associated, plant beneficial species belonging to the family Enterobacteriaceae. The members of the genus Serratia are ubiquitous in nature and their life style varies from endophytic to free-living. S. plymuthica AS9 is of special interest for its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The genome of S. plymuthica AS9 comprises a 5,442,880 bp long circular chromosome that consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome is part of the project entitled Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens awarded through the 2010 DOE-JGI Community Sequencing Program (CSP2010).

Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

Directory of Open Access Journals (Sweden)

Yasuhito Ohsaka

2010-01-01

Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

OPTIMAL practice conditions enhance the benefits of gradually increasing error opportunities on retention of a stepping sequence task.

Science.gov (United States)

Levac, Danielle; Driscoll, Kate; Galvez, Jessica; Mercado, Kathleen; O'Neil, Lindsey

2017-12-01

Physical therapists should implement practice conditions that promote motor skill learning after neurological injury. Errorful and errorless practice conditions are effective for different populations and tasks. Errorful learning provides opportunities for learners to make task-relevant choices. Enhancing learner autonomy through choice opportunities is a key component of the Optimizing Performance through Intrinsic Motivation and Attention for Learning (OPTIMAL) theory of motor learning. The objective of this study was to evaluate the interaction between error opportunity frequency and OPTIMAL (autonomy-supportive) practice conditions during stepping sequence acquisition in a virtual environment. Forty healthy young adults were randomized to autonomy-supportive or autonomy-controlling practice conditions, which differed in instructional language, focus of attention (external vs internal) and positive versus negative nature of verbal and visual feedback. All participants practiced 40 trials of 4, six-step stepping sequences in a random order. Each of the 4 sequences offered different amounts of choice opportunities about the next step via visual cue presentation (4 choices; 1 choice; gradually increasing [1-2-3-4] choices, and gradually decreasing [4-3-2-1] choices). Motivation and engagement were measured by the Intrinsic Motivation Inventory (IMI) and the User Engagement Scale (UES). Participants returned 1-3 days later for retention tests, where learning was measured by time to complete each sequence. No choice cues were offered on retention. Participants in the autonomy-supportive group outperformed the autonomy-controlling group at retention on all sequences (mean difference 2.88s, p errorful (4 choice) sequence (p error opportunities over time, suggest that participants relied on implicit learning strategies for this full body task and that feedback about successes minimized errors and reduced their potential information-processing benefits. Subsequent

Complete Genome Sequence of Bacillus velezensis GQJK49, a Plant Growth-Promoting Rhizobacterium with Antifungal Activity.

Science.gov (United States)

Ma, Jinjin; Liu, Hu; Liu, Kai; Wang, Chengqiang; Li, Yuhuan; Hou, Qihui; Yao, Liangtong; Cui, Yanru; Zhang, Tongrui; Wang, Haide; Wang, Beibei; Wang, Yun; Ge, Ruofei; Xu, Baochao; Yao, Gan; Xu, Wenfeng; Fan, Lingchao; Ding, Yanqin; Du, Binghai

2017-08-31

Bacillus velezensis GQJK49 is a plant growth-promoting rhizobacterium with antifungal activity, which was isolated from Lycium barbarum L. rhizosphere. Here, we report the complete genome sequence of B. velezensis GQJK49. Twelve gene clusters related to its biosynthesis of secondary metabolites, including antifungal and antibacterial antibiotics, were predicted. Copyright © 2017 Ma et al.

Sequence analysis of the Epstein-Barr virus (EBV) latent membrane protein-1 gene and promoter region

DEFF Research Database (Denmark)

Sandvej, Kristian; Gratama, J W; Munch, M

1997-01-01

Sequence variations in the Epstein-Barr virus (EBV) encoded latent membrane protein-1 (LMP-1) gene have been described in a Chinese nasopharyngeal carcinoma-derived isolate (CAO), and in viral isolates from various EBV-associated tumors. It has been suggested that these genetic changes, which...... include loss of a Xho I restriction site (position 169425) and a C-terminal 30-base pair (bp) deletion (position 168287-168256), define EBV genotypes associated with increased tumorigenicity or with disease among particular geographic populations. To determine the frequency of LMP-1 variations in European...... wild-type virus isolates, we sequenced the LMP-1 promoter and gene in EBV from lymphoblastoid cell lines from healthy carriers and patients without EBV-associated disease. Sequence changes were often present, and defined at least four main groups of viral isolates, which we designate Groups A through D...

Enhancing promotional strategies within social marketing programs: use of Web 2.0 social media.

Science.gov (United States)

Thackeray, Rosemary; Neiger, Brad L; Hanson, Carl L; McKenzie, James F

2008-10-01

The second generation of Internet-based applications (i.e., Web 2.0), in which users control communication, holds promise to significantly enhance promotional efforts within social marketing campaigns. Web 2.0 applications can directly engage consumers in the creative process by both producing and distributing information through collaborative writing, content sharing, social networking, social bookmarking, and syndication. Web 2.0 can also enhance the power of viral marketing by increasing the speed at which consumers share experiences and opinions with progressively larger audiences. Because of the novelty and potential effectiveness of Web 2.0, social marketers may be enticed to prematurely incorporate related applications into promotional plans. However, as strategic issues such as priority audience preferences, selection of appropriate applications, tracking and evaluation, and related costs are carefully considered, Web 2.0 will expand to allow health promotion practitioners more direct access to consumers with less dependency on traditional communication channels.

The construction of a library of synthetic promoters revealed some specific features of strong Streptomyces promoters

DEFF Research Database (Denmark)

Seghezzi, Nicolas; Amar, Patrick; Købmann, Brian

2011-01-01

Streptomyces are bacteria of industrial interest whose genome contains more than 73% of bases GC. In order to define, in these GC-rich bacteria, specific sequence features of strong promoters, a library of synthetic promoters of various sequence composition was constructed in Streptomyces. To do so...... cloned into the promoter-probe plasmid pIJ487 just upstream of the promoter-less aphII gene that confers resistance to neomycin. This synthetic promoter library was transformed into Streptomyces lividans, and the resulting transformants were screened for their ability to grow in the presence of different...... projects. Thirty-eight promoters were sequenced, and the sequences of the 14 weakest and 14 strongest promoters were compared using the WebLogo software with small sample correction. This comparison revealed that the −10 box, the −10 extended motif as well as the spacer of the strong Streptomyces promoters...

Enhancer Evolution across 20 Mammalian Species

Science.gov (United States)

Villar, Diego; Berthelot, Camille; Aldridge, Sarah; Rayner, Tim F.; Lukk, Margus; Pignatelli, Miguel; Park, Thomas J.; Deaville, Robert; Erichsen, Jonathan T.; Jasinska, Anna J.; Turner, James M.A.; Bertelsen, Mads F.; Murchison, Elizabeth P.; Flicek, Paul; Odom, Duncan T.

2015-01-01

Summary The mammalian radiation has corresponded with rapid changes in noncoding regions of the genome, but we lack a comprehensive understanding of regulatory evolution in mammals. Here, we track the evolution of promoters and enhancers active in liver across 20 mammalian species from six diverse orders by profiling genomic enrichment of H3K27 acetylation and H3K4 trimethylation. We report that rapid evolution of enhancers is a universal feature of mammalian genomes. Most of the recently evolved enhancers arise from ancestral DNA exaptation, rather than lineage-specific expansions of repeat elements. In contrast, almost all liver promoters are partially or fully conserved across these species. Our data further reveal that recently evolved enhancers can be associated with genes under positive selection, demonstrating the power of this approach for annotating regulatory adaptations in genomic sequences. These results provide important insight into the functional genetics underpinning mammalian regulatory evolution. PMID:25635462

Automatic gallbladder segmentation using combined 2D and 3D shape features to perform volumetric analysis in native and secretin-enhanced MRCP sequences.

Science.gov (United States)

Gloger, Oliver; Bülow, Robin; Tönnies, Klaus; Völzke, Henry

2017-11-24

We aimed to develop the first fully automated 3D gallbladder segmentation approach to perform volumetric analysis in volume data of magnetic resonance (MR) cholangiopancreatography (MRCP) sequences. Volumetric gallbladder analysis is performed for non-contrast-enhanced and secretin-enhanced MRCP sequences. Native and secretin-enhanced MRCP volume data were produced with a 1.5-T MR system. Images of coronal maximum intensity projections (MIP) are used to automatically compute 2D characteristic shape features of the gallbladder in the MIP images. A gallbladder shape space is generated to derive 3D gallbladder shape features, which are then combined with 2D gallbladder shape features in a support vector machine approach to detect gallbladder regions in MRCP volume data. A region-based level set approach is used for fine segmentation. Volumetric analysis is performed for both sequences to calculate gallbladder volume differences between both sequences. The approach presented achieves segmentation results with mean Dice coefficients of 0.917 in non-contrast-enhanced sequences and 0.904 in secretin-enhanced sequences. This is the first approach developed to detect and segment gallbladders in MR-based volume data automatically in both sequences. It can be used to perform gallbladder volume determination in epidemiological studies and to detect abnormal gallbladder volumes or shapes. The positive volume differences between both sequences may indicate the quantity of the pancreatobiliary reflux.

First draft genome sequencing of indole acetic acid producing and plant growth promoting fungus Preussia sp. BSL10.

Science.gov (United States)

Khan, Abdul Latif; Asaf, Sajjad; Khan, Abdur Rahim; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung

2016-05-10

Preussia sp. BSL10, family Sporormiaceae, was actively producing phytohormone (indole-3-acetic acid) and extra-cellular enzymes (phosphatases and glucosidases). The fungus was also promoting the growth of arid-land tree-Boswellia sacra. Looking at such prospects of this fungus, we sequenced its draft genome for the first time. The Illumina based sequence analysis reveals an approximate genome size of 31.4Mbp for Preussia sp. BSL10. Based on ab initio gene prediction, total 32,312 coding sequences were annotated consisting of 11,967 coding genes, pseudogenes, and 221 tRNA genes. Furthermore, 321 carbohydrate-active enzymes were predicted and classified into many functional families. Copyright © 2016 Elsevier B.V. All rights reserved.

Enhanced regulatory sequence prediction using gapped k-mer features.

Science.gov (United States)

Ghandi, Mahmoud; Lee, Dongwon; Mohammad-Noori, Morteza; Beer, Michael A

2014-07-01

Oligomers of length k, or k-mers, are convenient and widely used features for modeling the properties and functions of DNA and protein sequences. However, k-mers suffer from the inherent limitation that if the parameter k is increased to resolve longer features, the probability of observing any specific k-mer becomes very small, and k-mer counts approach a binary variable, with most k-mers absent and a few present once. Thus, any statistical learning approach using k-mers as features becomes susceptible to noisy training set k-mer frequencies once k becomes large. To address this problem, we introduce alternative feature sets using gapped k-mers, a new classifier, gkm-SVM, and a general method for robust estimation of k-mer frequencies. To make the method applicable to large-scale genome wide applications, we develop an efficient tree data structure for computing the kernel matrix. We show that compared to our original kmer-SVM and alternative approaches, our gkm-SVM predicts functional genomic regulatory elements and tissue specific enhancers with significantly improved accuracy, increasing the precision by up to a factor of two. We then show that gkm-SVM consistently outperforms kmer-SVM on human ENCODE ChIP-seq datasets, and further demonstrate the general utility of our method using a Naïve-Bayes classifier. Although developed for regulatory sequence analysis, these methods can be applied to any sequence classification problem.

Enhanced regulatory sequence prediction using gapped k-mer features.

Directory of Open Access Journals (Sweden)

Mahmoud Ghandi

2014-07-01

Full Text Available Oligomers of length k, or k-mers, are convenient and widely used features for modeling the properties and functions of DNA and protein sequences. However, k-mers suffer from the inherent limitation that if the parameter k is increased to resolve longer features, the probability of observing any specific k-mer becomes very small, and k-mer counts approach a binary variable, with most k-mers absent and a few present once. Thus, any statistical learning approach using k-mers as features becomes susceptible to noisy training set k-mer frequencies once k becomes large. To address this problem, we introduce alternative feature sets using gapped k-mers, a new classifier, gkm-SVM, and a general method for robust estimation of k-mer frequencies. To make the method applicable to large-scale genome wide applications, we develop an efficient tree data structure for computing the kernel matrix. We show that compared to our original kmer-SVM and alternative approaches, our gkm-SVM predicts functional genomic regulatory elements and tissue specific enhancers with significantly improved accuracy, increasing the precision by up to a factor of two. We then show that gkm-SVM consistently outperforms kmer-SVM on human ENCODE ChIP-seq datasets, and further demonstrate the general utility of our method using a Naïve-Bayes classifier. Although developed for regulatory sequence analysis, these methods can be applied to any sequence classification problem.

Alternative growth promoters alter broiler gut microbiome and enhance body weight gain

Science.gov (United States)

Antibiotic growth promoters (AGPs) have commonly been used to enhance growth in poultry production. However, there has been increasing concern over the impact of AGPs use in food production on acquisition of antibiotic resistance in zoonotic bacterial pathogens through inter-bacterial transfer of an...

Ginsenoside compound K promotes β-amyloid peptide clearance in primary astrocytes via autophagy enhancement.

Science.gov (United States)

Guo, Jinhui; Chang, Li; Zhang, Xin; Pei, Sujuan; Yu, Meishuang; Gao, Jianlian

2014-10-01

The aim of the present study was to investigate the effect of ginsenoside compound K on β-amyloid (Aβ) peptide clearance in primary astrocytes. Aβ degradation in primary astrocytes was determined using an intracellular Aβ clearance assay. Aggregated LC3 in astrocyte cells, which is a marker for the level of autophagy, was detected using laser scanning confocal microscope. The effect of compound K on the mammalian target of rapamycin (mTOR)/autophagy pathway was determined using western blot analysis, and an enzyme-linked immunosorbent assay was used for Aβ detection. The results demonstrated that compound K promoted the clearance of Aβ and enhanced autophagy in primary astrocytes. In addition, it was found that phosphorylation of mTOR was inhibited by compound K, which may have contributed to the enhanced autophagy. In conclusion, compound K promotes Aβ clearance by enhancing autophagy via the mTOR signaling pathway in primary astrocytes.

A trans-activator function is generated by integration of hepatitis B virus preS/S sequences in human hepatocellular carcinoma DNA

International Nuclear Information System (INIS)

Caselmann, W.H.; Meyer, M.; Kekule, A.S.; Lauer, U.; Hofschneider, P.H.; Koshy, R.

1990-01-01

The X gene of wild-type hepatitis B virus or integrated DNA has recently been shown to stimulate transcription of a variety of enhancers and promoters. To further delineate the viral sequences responsible for trans-activation in hepatomas, the authors cloned the single hepatitis B virus insert from human hepatocellular carcinoma DNA M1. The plasmid pM1 contains 2004 base of hepatitis B virus DNA subtype adr, including truncated preS/S sequences and the enhancer element. The X promoter and 422 nucleotides of the X coding region are present. The entire preC/C gene is deleted. In transient cotransfection assays using Chang liver cells (CCL 13), pM1 DNA exerts a 6- to 10-fold trans-activating effect on the expression of the pSV2CAT reporter plasmid. The transactivation occurs by stimulation of transcription and is dependent on the simian virus 40 enhancer in the reporter plasmid. Deletion analysis of pM1 subclones reveals that the transactivator is encoded by preS/S and not by X sequences. A frameshift mutation within the preS2 open reading frame shows that this portion is indispensable for the trans-activating function. Initiation of transcription has been mapped to the S1 promoter. A comparable trans-activating effect is also observed with cloned wild-type hepatitis B virus sequences similarly truncated. These results show that a transcriptional trans-activator function not present in the intact gene is generated by 3' truncation of integrated hepatitis B virus DNA preS/S sequences

Predicting stimulation-dependent enhancer-promoter interactions from ChIP-Seq time course data

Directory of Open Access Journals (Sweden)

Tomasz Dzida

2017-09-01

Full Text Available We have developed a machine learning approach to predict stimulation-dependent enhancer-promoter interactions using evidence from changes in genomic protein occupancy over time. The occupancy of estrogen receptor alpha (ERα, RNA polymerase (Pol II and histone marks H2AZ and H3K4me3 were measured over time using ChIP-Seq experiments in MCF7 cells stimulated with estrogen. A Bayesian classifier was developed which uses the correlation of temporal binding patterns at enhancers and promoters and genomic proximity as features to predict interactions. This method was trained using experimentally determined interactions from the same system and was shown to achieve much higher precision than predictions based on the genomic proximity of nearest ERα binding. We use the method to identify a genome-wide confident set of ERα target genes and their regulatory enhancers genome-wide. Validation with publicly available GRO-Seq data demonstrates that our predicted targets are much more likely to show early nascent transcription than predictions based on genomic ERα binding proximity alone.

Enhancing dopaminergic signaling and histone acetylation promotes long-term rescue of deficient fear extinction

Science.gov (United States)

Whittle, N; Maurer, V; Murphy, C; Rainer, J; Bindreither, D; Hauschild, M; Scharinger, A; Oberhauser, M; Keil, T; Brehm, C; Valovka, T; Striessnig, J; Singewald, N

2016-01-01

Extinction-based exposure therapy is used to treat anxiety- and trauma-related disorders; however, there is the need to improve its limited efficacy in individuals with impaired fear extinction learning and to promote greater protection against return-of-fear phenomena. Here, using 129S1/SvImJ mice, which display impaired fear extinction acquisition and extinction consolidation, we revealed that persistent and context-independent rescue of deficient fear extinction in these mice was associated with enhanced expression of dopamine-related genes, such as dopamine D1 (Drd1a) and -D2 (Drd2) receptor genes in the medial prefrontal cortex (mPFC) and amygdala, but not hippocampus. Moreover, enhanced histone acetylation was observed in the promoter of the extinction-regulated Drd2 gene in the mPFC, revealing a potential gene-regulatory mechanism. Although enhancing histone acetylation, via administering the histone deacetylase (HDAC) inhibitor MS-275, does not induce fear reduction during extinction training, it promoted enduring and context-independent rescue of deficient fear extinction consolidation/retrieval once extinction learning was initiated as shown following a mild conditioning protocol. This was associated with enhanced histone acetylation in neurons of the mPFC and amygdala. Finally, as a proof-of-principle, mimicking enhanced dopaminergic signaling by L-dopa treatment rescued deficient fear extinction and co-administration of MS-275 rendered this effect enduring and context-independent. In summary, current data reveal that combining dopaminergic and epigenetic mechanisms is a promising strategy to improve exposure-based behavior therapy in extinction-impaired individuals by initiating the formation of an enduring and context-independent fear-inhibitory memory. PMID:27922638

Detection of hepatic VX2 carcinomas with ferucarbotran-enhanced magnetic resonance imaging in rabbits: Comparison of nine pulse sequences

International Nuclear Information System (INIS)

Kim, Seong Hyun; Choi, Dongil; Lim, Hyo K.; Kim, Min Ju; Jang, Kyung Mi; Kim, Seung Hoon; Lee, Won Jae; Lee, Jongmee; Jeon, Yong Hwan; Lim, Jae Hoon

2006-01-01

Objective: To compare the diagnostic performance of a variety of magnetic resonance imaging (MRI) sequences, in order to identify the most effective ferucarbotran-enhanced sequence for the detection of multiple small hepatic VX2 carcinomas in rabbits. Methods: Fifteen rabbits with experimentally induced 135 VX2 carcinomas in the liver underwent ferucarbotran-enhanced MRI using the following nine pulse sequences: a fat-suppressed fast spin-echo (FSE) sequence with two echo times (TE) (proton density- and T2-weighted images), four different T2*-weighted fast multiplanar GRASS (gradient-recalled acquisition in the steady state) (FMPGR) with the combination of three TEs (9, 12, 15 ms, respectively) and two flip angles (20 deg., 80 deg., respectively), T2*-weighted fast multiplanar spoiled GRASS (FMPSPGR), T1-weighted FMPSPGR, and dynamic T1-weighted FMPSPGR. All images were reviewed by three radiologists with quantitative and qualitative analysis. Results: Tumor-to-liver contrast-to-noise ratio of the proton density-weighted FSE sequence was significantly higher than those of the others (p o ) images were superior to those of the others and for the detection of very small hepatic tumors of less than 5 mm, the sensitivities of these sequences were less than 30%. Conclusion: Ferucarbotran-enhanced T2- and proton density-weighted FSE and T2*-weighed FMPGR (TE/flip angle, 12/20 o ) images were found to be the most effective pulse sequences for the detection of multiple small hepatic VX2 carcinomas but these sequences were limited in the detection of very small hepatic tumors of less than 5 mm in size

Centrically reordered inversion recovery half-Fourier single-shot turbo spin-echo sequence: improvement of the image quality of oxygen-enhanced MRI

International Nuclear Information System (INIS)

Ohno, Yoshiharu; Hatabu, Hiroto; Higashino, Takanori; Kawamitsu, Hideaki; Watanabe, Hirokazu; Takenaka, Daisuke; Cauteren, Marc van; Sugimura, Kazuro

2004-01-01

Purpose: The purpose of the study presented here was to determine the improvement in image quality of oxygen-enhanced magnetic resonance (MR) subtraction imaging obtained with a centrically reordered inversion recovery half-Fourier single-shot turbo spin-echo (c-IR-HASTE) sequence compared with that obtained with a conventional sequentially reordered inversion recovery single-shot HASTE (s-IR-HASTE) sequence for pulmonary imaging. Materials and methods: Oxygen-enhanced MR imaging using a 1.5 T whole body scanner was performed on 12 healthy, non-smoking volunteers. Oxygen-enhanced MR images were obtained with the coronal two-dimensional (2D) c-IR-HASTE sequence and 2D s-IR-HASTE sequence combined with respiratory triggering. For a 256x256 matrix, 132 phase-encoding steps were acquired including four steps for phase correction. Inter-echo spacing for each sequence was 4.0 ms. The effective echo time (TE) for c-IR-HASTE was 4.0 ms, and 16 ms for s-IR-HASTE. The inversion time (TI) was 900 ms. To determine the improvement in oxygen-enhanced MR subtraction imaging by c-IR-HASTE, CNRs of subtraction image, overall image quality, and image degradation of the c-IR-HASTE and s-IR-HASTE techniques were statistically compared. Results: CNR, overall image quality, and image degradation of c-IR-HASTE images showed significant improvement compared to those s-IR-HASTE images (P<0.05). Conclusion: Centrically reordered inversion recovery half-Fourier single-shot turbo spin-echo (c-IR-HASTE) sequence enhanced the signal from the lung and improved the image quality of oxygen-enhanced MR subtraction imaging

Pol II promoter prediction using characteristic 4-mer motifs: a machine learning approach

Directory of Open Access Journals (Sweden)

Shoyaib Mohammad

2008-10-01

Full Text Available Abstract Background Eukaryotic promoter prediction using computational analysis techniques is one of the most difficult jobs in computational genomics that is essential for constructing and understanding genetic regulatory networks. The increased availability of sequence data for various eukaryotic organisms in recent years has necessitated for better tools and techniques for the prediction and analysis of promoters in eukaryotic sequences. Many promoter prediction methods and tools have been developed to date but they have yet to provide acceptable predictive performance. One obvious criteria to improve on current methods is to devise a better system for selecting appropriate features of promoters that distinguish them from non-promoters. Secondly improved performance can be achieved by enhancing the predictive ability of the machine learning algorithms used. Results In this paper, a novel approach is presented in which 128 4-mer motifs in conjunction with a non-linear machine-learning algorithm utilising a Support Vector Machine (SVM are used to distinguish between promoter and non-promoter DNA sequences. By applying this approach to plant, Drosophila, human, mouse and rat sequences, the classification model has showed 7-fold cross-validation percentage accuracies of 83.81%, 94.82%, 91.25%, 90.77% and 82.35% respectively. The high sensitivity and specificity value of 0.86 and 0.90 for plant; 0.96 and 0.92 for Drosophila; 0.88 and 0.92 for human; 0.78 and 0.84 for mouse and 0.82 and 0.80 for rat demonstrate that this technique is less prone to false positive results and exhibits better performance than many other tools. Moreover, this model successfully identifies location of promoter using TATA weight matrix. Conclusion The high sensitivity and specificity indicate that 4-mer frequencies in conjunction with supervised machine-learning methods can be beneficial in the identification of RNA pol II promoters comparative to other methods. This

Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence

International Nuclear Information System (INIS)

Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.

2015-01-01

The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)

Draft Genome Sequence of Bacillus velezensis Lzh-a42, a Plant Growth-Promoting Rhizobacterium Isolated from Tomato Rhizosphere.

Science.gov (United States)

Li, Zhenghua; Chen, Mei; Ran, Kun; Wang, Jihua; Zeng, Qiangcheng; Song, Feng

2018-03-22

The plant growth-promoting rhizobacterium Bacillus velezensis strain Lzh-a42, which has antimicrobial activity, was isolated from tomato rhizosphere. Here, we report its genome sequence, which includes several predicted functional genes related to secondary metabolite biosynthesis, antimicrobial activity, and biofilm synthesis. Copyright © 2018 Li et al.

Contrast-enhanced Magnetic Resonance Imaging of Pelvic Bone Metastases at 3.0 T: Comparison Between 3-dimensional T1-weighted CAIPIRINHA-VIBE Sequence and 2-dimensional T1-weighted Turbo Spin-Echo Sequence.

Science.gov (United States)

Yoon, Min A; Hong, Suk-Joo; Lee, Kyu-Chong; Lee, Chang Hee

2018-06-12

This study aimed to compare 3-dimensional T1-weighted gradient-echo sequence (CAIPIRINHA-volumetric interpolated breath-hold examination [VIBE]) with 2-dimensional T1-weighted turbo spin-echo sequence for contrast-enhanced magnetic resonance imaging (MRI) of pelvic bone metastases at 3.0 T. Thirty-one contrast-enhanced MRIs of pelvic bone metastases were included. Two contrast-enhanced sequences were evaluated for the following parameters: overall image quality, sharpness of pelvic bone, iliac vessel clarity, artifact severity, and conspicuity and edge sharpness of the smallest metastases. Quantitative analysis was performed by calculating signal-to-noise ratio and contrast-to-noise ratio of the smallest metastases. Significant differences between the 2 sequences were assessed. CAIPIRINHA-VIBE had higher scores for overall image quality, pelvic bone sharpness, iliac vessel clarity, and edge sharpness of the metastatic lesions, and had less artifacts (all P 0.05). Our results suggest that CAIPIRINHA-VIBE may be superior to turbo spin-echo for contrast-enhanced MRI of pelvic bone metastases at 3.0 T.

Three-dimensional gradient echo versus spin echo sequence in contrast-enhanced imaging of the pituitary gland at 3 T

Energy Technology Data Exchange (ETDEWEB)

Kakite, Suguru, E-mail: sugkaki@med.tottori-u.ac.jp [Division of Radiology, Department of Pathophysiological and Therapeutic Science, Faculty of Medicine, Tottori University, 36-1, Nishicho, Yonago 683-8503 (Japan); Fujii, Shinya [Division of Radiology, Department of Pathophysiological and Therapeutic Science, Faculty of Medicine, Tottori University, 36-1, Nishicho, Yonago 683-8503 (Japan); Kurosaki, Masamichi [Department of Neurosurgery, Faculty of Medicine, Tottori University, 36-1, Nishicho, Yonago 683-8503 (Japan); Kanasaki, Yoshiko; Matsusue, Eiji; Kaminou, Toshio; Ogawa, Toshihide [Division of Radiology, Department of Pathophysiological and Therapeutic Science, Faculty of Medicine, Tottori University, 36-1, Nishicho, Yonago 683-8503 (Japan)

2011-07-15

Introduction: To clarify whether a three-dimensional-gradient echo (3D-GRE) or spin echo (SE) sequence is more useful for evaluating sellar lesions on contrast-enhanced T1-weighted MR imaging at 3.0 Tesla (T). Methods: We retrospectively assessed contrast-enhanced T1-weighted images using 3D-GRE and SE sequences at 3.0 T obtained from 33 consecutive patients with clinically suspected sellar lesions. Two experienced neuroradiologists evaluated the images qualitatively in terms of the following criteria: boundary edge of the cavernous sinus and pituitary gland, border of sellar lesions, delineation of the optic nerve and cranial nerves within the cavernous sinus, susceptibility and flow artifacts, and overall image quality. Results: At 3.0 T, 3D-GRE provided significantly better images than the SE sequence in terms of the border of sellar lesions, delineation of cranial nerves, and overall image quality; there was no significant difference regarding the boundary edge of the cavernous sinus and pituitary gland. In addition, the 3D-GRE sequence showed fewer pulsation artifacts but more susceptibility artifacts. Conclusion: Our results indicate that 3D-GRE is the more suitable sequence for evaluating sellar lesions on contrast-enhanced T1-weighted imaging at 3.0 T.

Complete genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium of Calendula officinalis

Energy Technology Data Exchange (ETDEWEB)

Koeberl, Martina; White, Richard A.; Erschen, Sabine; Spanberger, Nora; El-Arabi, Tarek F.; Jansson, Janet K.; Berg, Gabriele

2015-08-13

The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activities against plant pathogenic fungi, bacteria and nematodes, consists of a single 3.9 Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.

MRI evaluation of myometrial invasion by endometrial carcinoma. Comparison between fast-spin-echo T2W and coronal FMPSPGR Gadolinium-Dota-Enhanced Sequences

International Nuclear Information System (INIS)

Nasi, Francesca; Fiocchi, Federica; Pecchi, Annarita; Torricelli, Pietro; Rivasi, Francesco

2005-01-01

Purpose. The depth of myometrial invasion by endometrial carcinoma strongly affects the incidence of metastasis to regional nodes and influences the surgical strategies. The aim of this paper is to compare the results of FSE T2-w and Gadolinium-enhanced FMPSGR MR sequences in assessing the depth of myometrial invasion by endometrial cancer. Materials and methods. Forty-five women with histopathologically-proven endometrial carcinoma underwent preoperative MRI. Axial SE TI w, axial, sagittal and para-coronal FSE T2w and para-coronal Gadolinium enhanced FMPSGR sequences were performed using a high field strength magnet (1.5T). Within one month of MR all patients underwent hysterectomy, and anatomical evaluation of the surgical specimen was done sectioning the uterus along the short axis. Based upon the results of the histological evaluation the results of the FSE T2w and Gadolinium-enhanced sequences were compared and the statistical difference between the results obtained was statistically evaluated. Results. The histological evaluation showed intra mucosal neoplasm in 11 patients, myometrial infiltration less than 50% in 31 patients, myometrial infiltration more than 50% in 12 patients and transmural cancer 1 patient. Statistical evaluation showed that the FSE T2w sequence had a global sensitivity and specificity of 80.6% and 87.6%, respectively, with a mean Negative Predictive Value of 92.6% and a mean Positive Predictive Value of 86%. Gadolinium-enhanced FMPSPGR sequence had a global sensitivity and specificity of 90.6% and 93.3%, respectively, with a mean Negative Predictive Value of 96,3% and a mean Positive Predictive Value of 88%. The staging accuracy (χ 2 test) on FMPSPGR images (95%) was higher than that on FSE T2w images (78%). Conclusions. In our experience Gadolinium-enhanced dynamic sequences increase the accuracy of MR imaging in diagnosing the depth of myometrial invasion. In particular they improve the visualisation of the inner myometrium, the so

Functional assessment of human enhancer activities using whole-genome STARR-sequencing.

Science.gov (United States)

Liu, Yuwen; Yu, Shan; Dhiman, Vineet K; Brunetti, Tonya; Eckart, Heather; White, Kevin P

2017-11-20

Genome-wide quantification of enhancer activity in the human genome has proven to be a challenging problem. Recent efforts have led to the development of powerful tools for enhancer quantification. However, because of genome size and complexity, these tools have yet to be applied to the whole human genome.  In the current study, we use a human prostate cancer cell line, LNCaP as a model to perform whole human genome STARR-seq (WHG-STARR-seq) to reliably obtain an assessment of enhancer activity. This approach builds upon previously developed STARR-seq in the fly genome and CapSTARR-seq techniques in targeted human genomic regions. With an improved library preparation strategy, our approach greatly increases the library complexity per unit of starting material, which makes it feasible and cost-effective to explore the landscape of regulatory activity in the much larger human genome. In addition to our ability to identify active, accessible enhancers located in open chromatin regions, we can also detect sequences with the potential for enhancer activity that are located in inaccessible, closed chromatin regions. When treated with the histone deacetylase inhibitor, Trichostatin A, genes nearby this latter class of enhancers are up-regulated, demonstrating the potential for endogenous functionality of these regulatory elements. WHG-STARR-seq provides an improved approach to current pipelines for analysis of high complexity genomes to gain a better understanding of the intricacies of transcriptional regulation.

The inhibition of IGF-1 signaling promotes proteostasis by enhancing protein aggregation and deposition.

Science.gov (United States)

Moll, Lorna; Ben-Gedalya, Tziona; Reuveni, Hadas; Cohen, Ehud

2016-04-01

The discovery that the alteration of aging by reducing the activity of the insulin/IGF-1 signaling (IIS) cascade protects nematodes and mice from neurodegeneration-linked, toxic protein aggregation (proteotoxicity) raises the prospect that IIS inhibitors bear therapeutic potential to counter neurodegenerative diseases. Recently, we reported that NT219, a highly efficient IGF-1 signaling inhibitor, protects model worms from the aggregation of amyloid β peptide and polyglutamine peptides that are linked to the manifestation of Alzheimer's and Huntington's diseases, respectively. Here, we employed cultured cell systems to investigate whether NT219 promotes protein homeostasis (proteostasis) in mammalian cells and to explore its underlying mechanisms. We found that NT219 enhances the aggregation of misfolded prion protein and promotes its deposition in quality control compartments known as "aggresomes." NT219 also elevates the levels of certain molecular chaperones but, surprisingly, reduces proteasome activity and impairs autophagy. Our findings show that IGF-1 signaling inhibitors in general and NT219 in particular can promote proteostasis in mammalian cells by hyperaggregating hazardous proteins, thereby bearing the potential to postpone the onset and slow the progression of neurodegenerative illnesses in the elderly.-Moll, L., Ben-Gedalya, T., Reuveni, H., Cohen, E. The inhibition of IGF-1 signaling promotes proteostasis by enhancing protein aggregation and deposition. © FASEB.

Complete Genome Sequence Analysis of Enterobacter sp. SA187, a Plant Multi-Stress Tolerance Promoting Endophytic Bacterium

KAUST Repository

Andres-Barrao, Cristina; Lafi, Feras Fawzi; Alam, Intikhab; Zé licourt, Axel de; Eida, Abdul Aziz; Bokhari, Ameerah; Alzubaidy, Hanin S.; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

2017-01-01

Enterobacter sp. SA187 is an endophytic bacterium that has been isolated from root nodules of the indigenous desert plant Indigofera argentea. SA187 could survive in the rhizosphere as well as in association with different plant species, and was able to provide abiotic stress tolerance to Arabidopsis thaliana. The genome sequence of SA187 was obtained by using Pacific BioScience (PacBio) single-molecule sequencing technology, with average coverage of 275X. The genome of SA187 consists of one single 4,429,597 bp chromosome, with an average 56% GC content and 4,347 predicted protein coding DNA sequences (CDS), 153 ncRNA, 7 rRNA, and 84 tRNA. Functional analysis of the SA187 genome revealed a large number of genes involved in uptake and exchange of nutrients, chemotaxis, mobilization and plant colonization. A high number of genes were also found to be involved in survival, defense against oxidative stress and production of antimicrobial compounds and toxins. Moreover, different metabolic pathways were identified that potentially contribute to plant growth promotion. The information encoded in the genome of SA187 reveals the characteristics of a dualistic lifestyle of a bacterium that can adapt to different environments and promote the growth of plants. This information provides a better understanding of the mechanisms involved in plant-microbe interaction and could be further exploited to develop SA187 as a biological agent to improve agricultural practices in marginal and arid lands.

Complete Genome Sequence Analysis of Enterobacter sp. SA187, a Plant Multi-Stress Tolerance Promoting Endophytic Bacterium

KAUST Repository

Andres-Barrao, Cristina

2017-10-20

Enterobacter sp. SA187 is an endophytic bacterium that has been isolated from root nodules of the indigenous desert plant Indigofera argentea. SA187 could survive in the rhizosphere as well as in association with different plant species, and was able to provide abiotic stress tolerance to Arabidopsis thaliana. The genome sequence of SA187 was obtained by using Pacific BioScience (PacBio) single-molecule sequencing technology, with average coverage of 275X. The genome of SA187 consists of one single 4,429,597 bp chromosome, with an average 56% GC content and 4,347 predicted protein coding DNA sequences (CDS), 153 ncRNA, 7 rRNA, and 84 tRNA. Functional analysis of the SA187 genome revealed a large number of genes involved in uptake and exchange of nutrients, chemotaxis, mobilization and plant colonization. A high number of genes were also found to be involved in survival, defense against oxidative stress and production of antimicrobial compounds and toxins. Moreover, different metabolic pathways were identified that potentially contribute to plant growth promotion. The information encoded in the genome of SA187 reveals the characteristics of a dualistic lifestyle of a bacterium that can adapt to different environments and promote the growth of plants. This information provides a better understanding of the mechanisms involved in plant-microbe interaction and could be further exploited to develop SA187 as a biological agent to improve agricultural practices in marginal and arid lands.

Stakeholder Capability Enhancement as a Path to Promote Human Dignity and Cooperative Advantage

NARCIS (Netherlands)

Westermann-Behaylo, M.K.; Van Buren III, H.J.; Berman, S.L.

2016-01-01

Promoting dignity is at the heart of the human capability approach to development. We introduce the concept of stakeholder capability enhancement, beginning with a discussion of the capability approach to development proposed by Sen (1985) and further advanced by Nussbaum (1990) to incorporate

[Brd3 promotes IL-6 production via enhancing acetylase CBP recruitment and histone 3 acetylation within IL6 promoter].

Science.gov (United States)

Ren, Wenhui; Sun, Donghao; Wang, Chunmei; Li, Nan

2016-10-01

Objective To investigate the role of bromodomain containing 3 (Brd3) in LPS-triggered interleukin-6 (IL-6) production in macrophages and the underlying mechanism. Methods CRISPR-Cas9 technology was used to screen an RAW264.7 cell line with Brd3 knockout (Brd3 -/- ). The Brd3 -/- cells were used as an experimental group, and the parential cells expressing wide-type Brd3 as a control group. The IL-6 level in cell culture supernatant was detected by ELISA after 100 ng/mL LPS challenging. Effect of Brd3 knockout on the expression and activation of signal pathways involved in IL-6 expression, including the NF-κB and mitogen-activated protein kinase (MAPK) pathways were examined by Western blot analysis. Chromatin immunoprecipitation (ChIP) assay was used to evaluate the recruitment of acetylase CREB-binding protein (CBP) to IL6 gene promoter and the acetylation level of histone 3 within IL6 gene promoter. Results LPS treatment significantly downregulated Brd3 expression in mouse peritoneal macrophages. LPS-induced production of IL-6 was significantly inhibited in Brd3 -/- macrophages. The expressions and activation of signal molecules within NF-κB and MAPK pathways were barely affected. Brd3 knockout significantly decreased the recruitment of acetylase CBP to IL6 gene promoter, and the acetylation level of histone3 within IL6 gene promoter was also repressed. Conclusion Brd3 promotes LPS-triggered IL-6 production via promoting the recruitment of CBP to IL6 promoter and enhancing the acetylation level of histone 3 within IL6 promoter.

High-yielding Wheat Varieties Harbour Superior Plant Growth Promoting-Bacterial Endophytes

Directory of Open Access Journals (Sweden)

Mehwish Yousaf

2017-06-01

Full Text Available Background and Objective: The purpose of this study was to compare the endophytic microbial flora of different wheat varieties to check whether a better yielding variety also harbours superior plant growth promoting bacteria. Such bacteria are helpful in food biotechnology as their application can enhance the yield of the crop.Material and Methods: Three wheat varieties (Seher, Faisalabad and Lasani were selected, Seher being the most superior variety. endophytic bacteria were isolated from the histosphere of the leaves and roots at different growth phases of the plants. The isolates were analyzed for plant growth promoting activities. Isolates giving best results were identified through 16S rRNA gene sequencing. Statistical analysis was done using Microsoft Excel 2013. All the experiments were conducted in triplicates.Results and Conclusion: The endophytes of Seher variety showed maximum plant growth promoting abilities. Among the shoot endophytes, the highest auxin production was shown by Seher isolate SHHP1-3 up to 51.9μg ml-1, whereas in the case of root endophytes, the highest auxin was produced by SHHR1-5 up to 36 μg ml-1. The bacteria showing significant plant growth promoting abilities were identified by 16S rRNA sequencing. Bacillus, Proteobacteria and Actinobacteria species were the dominant bacteria showing all the traits of plant growth promotion. It can be concluded that Seher variety harbours superior plant growth promoting endophytes that must be one of the reasons for its better growth and yield as compared to the other two varieties. The investigated results support possible utilization of the selected isolates in wheat growth promotion with respect to increase in agro-productivity. The application of such bacteria could be useful to enhance wheat yield and can help in food biotechnology.Conflict of interest: The authors declare no conflict of interest.

Evaluation of Dixon Sequence on Hybrid PET/MR Compared with Contrast-Enhanced PET/CT for PET-Positive Lesions

International Nuclear Information System (INIS)

Jeong, Ju Hye; Cho, Ihn Ho; Kong, Eun Jung; Chun, Kyung Ah

2014-01-01

Hybrid positron emission tomography and magnetic resonance (PET/MR) imaging performs a two-point Dixon MR sequence for attenuation correction. However, MR data in hybrid PET/MR should provide anatomic and morphologic information as well as an attenuation map. We evaluated the Dixon sequence of hybrid PET/MR for anatomic correlation of PET-positive lesions compared with contrast-enhanced PET/computed tomography (CT) in patients with oncologic diseases. Twelve patients underwent a single injection, dual imaging protocol. PET/CT was performed with an intravenous contrast agent (85±13 min after 18 F-FDG injection of 403± 45 MBq) and then (125±19 min after injection) PET/MR was performed. Attenuation correction and anatomic allocation of PET were performed using contrast-enhanced CT for PET/CT and Dixon MR sequence for hybrid PET/MR. The Dixon MR sequence and contrast-enhanced CT were compared for anatomic correlation of PET-positive lesions (scoring scale ranging from 0 to 3 for visual ratings). Additionally, standardized uptake values (SUVs) for the detected lesions were assessed for quantitative comparison. Both hybrid PET/MR and contrast-enhanced PET/CT identified 55 lesions with increased FDG uptake in ten patients. In total, 28 lymph nodes, 11 bone lesions, 3 dermal nodules, 3 pleural thickening lesions, 2 thyroid nodules, 1 pancreas, 1 liver, 1 ovary, 1 uterus, 1 breast, 1 soft tissue and 2 lung lesions were present. The best performance was observed for anatomic correlation of PET findings by the contrast-enhanced CT scans (contrast-enhanced CT, 2.64± 0.70; in-phase, 1.29±1.01; opposed-phase, 1.29±1.15; water-weighted, 1.71±1.07; fat weighted, 0.56±1.03). A significant difference was observed between the scores obtained from the contrast-enhanced CT and all four coregistered Dixon MR images. Quantitative evaluation revealed a high correlation between the SUVs measured with hybrid PET/MR (SUVmean, 2.63±1.62; SUVmax, 4.30±2.88) and contrast-enhanced PET

Evaluation of Dixon Sequence on Hybrid PET/MR Compared with Contrast-Enhanced PET/CT for PET-Positive Lesions

Energy Technology Data Exchange (ETDEWEB)

Jeong, Ju Hye; Cho, Ihn Ho; Kong, Eun Jung; Chun, Kyung Ah [Yeungnam Univ. Hospital, Daegu (Korea, Republic of)

2014-03-15

Hybrid positron emission tomography and magnetic resonance (PET/MR) imaging performs a two-point Dixon MR sequence for attenuation correction. However, MR data in hybrid PET/MR should provide anatomic and morphologic information as well as an attenuation map. We evaluated the Dixon sequence of hybrid PET/MR for anatomic correlation of PET-positive lesions compared with contrast-enhanced PET/computed tomography (CT) in patients with oncologic diseases. Twelve patients underwent a single injection, dual imaging protocol. PET/CT was performed with an intravenous contrast agent (85±13 min after {sup 18}F-FDG injection of 403± 45 MBq) and then (125±19 min after injection) PET/MR was performed. Attenuation correction and anatomic allocation of PET were performed using contrast-enhanced CT for PET/CT and Dixon MR sequence for hybrid PET/MR. The Dixon MR sequence and contrast-enhanced CT were compared for anatomic correlation of PET-positive lesions (scoring scale ranging from 0 to 3 for visual ratings). Additionally, standardized uptake values (SUVs) for the detected lesions were assessed for quantitative comparison. Both hybrid PET/MR and contrast-enhanced PET/CT identified 55 lesions with increased FDG uptake in ten patients. In total, 28 lymph nodes, 11 bone lesions, 3 dermal nodules, 3 pleural thickening lesions, 2 thyroid nodules, 1 pancreas, 1 liver, 1 ovary, 1 uterus, 1 breast, 1 soft tissue and 2 lung lesions were present. The best performance was observed for anatomic correlation of PET findings by the contrast-enhanced CT scans (contrast-enhanced CT, 2.64± 0.70; in-phase, 1.29±1.01; opposed-phase, 1.29±1.15; water-weighted, 1.71±1.07; fat weighted, 0.56±1.03). A significant difference was observed between the scores obtained from the contrast-enhanced CT and all four coregistered Dixon MR images. Quantitative evaluation revealed a high correlation between the SUVs measured with hybrid PET/MR (SUVmean, 2.63±1.62; SUVmax, 4.30±2.88) and contrast-enhanced

Inverted repeats in the promoter as an autoregulatory sequence for TcrX in Mycobacterium tuberculosis

International Nuclear Information System (INIS)

Bhattacharya, Monolekha; Das, Amit Kumar

2011-01-01

Highlights: ► The regulatory sequences recognized by TcrX have been identified. ► The regulatory region comprises of inverted repeats segregated by 30 bp region. ► The mode of binding of TcrX with regulatory sequence is unique. ► In silico TcrX–DNA docked model binds one of the inverted repeats. ► Both phosphorylated and unphosphorylated TcrX binds regulatory sequence in vitro. -- Abstract: TcrY, a histidine kinase, and TcrX, a response regulator, constitute a two-component system in Mycobacterium tuberculosis. tcrX, which is expressed during iron scarcity, is instrumental in the survival of iron-dependent M. tuberculosis. However, the regulator of tcrX/Y has not been fully characterized. Crosslinking studies of TcrX reveal that it can form oligomers in vitro. Electrophoretic mobility shift assays (EMSAs) show that TcrX recognizes two regions in the promoter that are comprised of inverted repeats separated by ∼30 bp. The dimeric in silico model of TcrX predicts binding to one of these inverted repeat regions. Site-directed mutagenesis and radioactive phosphorylation indicate that D54 of TcrX is phosphorylated by H256 of TcrY. However, phosphorylated and unphosphorylated TcrX bind the regulatory sequence with equal efficiency, which was shown with an EMSA using the D54A TcrX mutant.

Dynamic MRI of tumours in head and neck with a contrast-enhanced FLASH-2D sequence

International Nuclear Information System (INIS)

Maeurer, J.; Rausch, M.; Richter, W.S.; Boeck, J.C.; Steinkamp, H.J.; Vogl, T.J.; Felix, R.

1995-01-01

The purpose of this study was to evaluate the utility of a dynamic contrast enhanced FLASH-2D sequence for differential diagnosis of tumours in head and neck in 93 patients. Initially, the localization of the lesion and the selection of four representative slices for the dynamic study were obtained by a T2-weighted spin-echo sequence (TR 2000-3000 ms; TE 25/90 ms). After IV bolus injection of the contrast agent 10 images were acquired during a period of 3 min by a FLASH-2D sequence (TR 60 ms; TE 6 ms; flip angle 40 ; matrix 256 x 256; one acquisition). The percentage signal intensity (SI) increase (r) and the slope (S) of the curve were calculated on the basis of the SI time curve of the pathological lesion and of muscle. Inflammatory processes could be differentiated from malignant or benign tumours by means of a higher contrast enhancement. The time of the maximum SI was not specific for the different lesions. In comparison with muscle the maximum SI change was achieved earlier in a pathological process. (orig.)

SPIO-enhanced MR imaging for HCC detection in cirrhotic patient : comparison of various techniques for optimal sequence selection

International Nuclear Information System (INIS)

Kim, In Hwan; Lee, Jeong Min; Kwak, Hyo Sung; Kim, Chong Soo; Yu, Hee Chul; Kim, Tae Kon; Lee Soo Tiek

2000-01-01

To compare the efficacy of breathhold and non-breathhold sequences in the detection of hepatocellular carcinoma (HCC) in cirrhotic patients using superparamagnetic iron oxide (SPIO)-enhanced MR imaging, and to determine the optimal sequence combination. By means of unenhanced and iron-oxide-enhanced MRI, 29 patients with 49 nodular HCCs were evaluated for the presence of HCC nodules. Twenty-one were male and eight were female, and their ages ranged from 38 to 71 (mean, 56) years. Eight different MR sequences were used, including four non-breath-hold sequences and four breath-hold, and images were obtained before and after the administration of SPIO particles. Non-breath-hold sequences included T2-, proton density-weighted SE, and TSE imaging, while breath-hold sequences comprised T1-weighted fast low-angle shot (T1w FLASH), half-Fourier acquisition single shot turbo spine echo (HASTE), T2-weighted fast imaging with steady-state free precession (T2 * wFISP) and T2-weighted breath-hold TSE (T2wBHTSE). Image analysis involved both quantitative and qualitative analysis. The quantitative parameters calculated were signal-to noise (S/N) ratios for livers and tumors, contrast to noise (C/N) ratios for tumors seen on precontrast and postcontrast images, and percentage of signal intensity loss (PSIL) after SPIO injection. Images were analysed qualitatively in terms of image artifacts and lesion conspicuity, and prior to calculating sensitivity, the number of lesions detected using various pulse sequences were counted. SPIO had a marked effect on liver S/N ratio but a minimal effect on tumor S/N ratio. PSIL was best in T2 * wFISP images, while T2wSE images showed the second-best results (p less than 0.05). Tumor-to-liver C/N values were also highest with T2 * wFISP, while T2wTSE and HASTE images were next. Qualitative study showed that non-breath hold images and FISP were better than breath hold images in terms of lesion conspicuity. The latter, however, were much better

Identification and characterization of the human SOX6 promoter

International Nuclear Information System (INIS)

Ikeda, Toshiyuki; Saito, Taku; Ushita, Masahiro; Yano, Fumiko; Kan, Akinori; Itaka, Keiji; Moro, Toru; Nakamura, Kozo; Kawaguchi, Hiroshi; Chung, Ung-il

2007-01-01

The present study attempted to identify and characterize the embryonic promoter of Sox6, a determinant regulator of chondrogenic differentiation. A common transcription start region for human and mouse Sox6 was initially identified, which contained a highly conserved sequence, A-box. Tandem repeats of A-box had a strong transcriptional activity both at the basal level and in response to Sox9. Cells carrying the 4xA-box-DsRed2 reporter fluoresced only upon chondrogenic differentiation. The 46-bp core enhancer region (CES6) was then identified in the 3' half of A-box, within which a C/EBP-binding motif was identified. Overexpressed C/EBPβ activated the Sox6 promoter, and mutant 4xCES6 constructs lacking the C/EBP motif lost their basal activity. CES6 and nuclear extracts formed a specific complex, which was supershifted by anti-C/EBPβ antibody, and in vitro translated C/EBPβ specifically bound to CES6. Thus, we successfully identified the Sox6 promoter and its core enhancer and characterized the interactions with regulatory transcription factors

Liver acquisition with acceleration volume acquisition gadolinium-enhanced magnetic resonance combined with T2 sequences in the diagnosis of local recurrence of rectal cancer.

Science.gov (United States)

Cao, Wuteng; Li, Fangqian; Gong, Jiaying; Liu, Dechao; Deng, Yanhong; Kang, Liang; Zhou, Zhiyang

2016-11-22

To investigate the efficacy of liver acquisition with acceleration volume acquisition (LAVA) gadolinium-enhanced magnetic resonance (MR) sequences and to assess its added accuracy in diagnosing local recurrence (LR) of rectal cancer with conventional T2-weighted fast spin echo (FSE) sequences. Pelvic MRI, including T2-weighted FSE sequences, gadolinium-enhanced sequences of LAVA and T1-weighted FSE with fat suppression, was performed on 225 patients with postoperative rectal cancer. Two readers evaluated the presence of LR according to "T2" (T2 sequences only), "T2 + LAVA-Gad" (LAVA and T2 imaging), and "T2 + T1-fs-Gad" (T1 fat suppression-enhanced sequence with T2 images). To evaluate diagnostic efficiency, imaging quality with LAVA and T1-fs-Gad by subjective scores and the signal intensity (SI) ratio. In the result, the SI ratio of LAVA was significantly higher than that of T1-fs-Gad (p = 0.0001). The diagnostic efficiency of "T2 + LAVA-Gad" was better than that of "T2 + T1-fs-Gad" (p = 0.0016 for Reader 1, p = 0.0001 for Reader 2) and T2 imaging only (p = 0.0001 for Reader 1; p = 0.0001 for Reader 2). Therefore, LAVA gadolinium-enhanced MR increases the accuracy of diagnosis of LR from rectal cancer and could replace conventional T1 gadolinium-enhanced sequences in the postoperative pelvic follow-up of rectal cancer.

AML1/ETO trans-activates c-KIT expression through the long range interaction between promoter and intronic enhancer.

Science.gov (United States)

Tian, Ying; Wang, Genjie; Hu, Qingzhu; Xiao, Xichun; Chen, Shuxia

2018-04-01

The AML1/ETO onco-fusion protein is crucial for the genesis of t(8;21) acute myeloid leukemia (AML) and is well documented as a transcriptional repressor through dominant-negative effect. However, little is known about the transactivation mechanism of AML1/ETO. Through large cohort of patient's expression level data analysis and a series of experimental validation, we report here that AML1/ETO transactivates c-KIT expression through directly binding to and mediating the long-range interaction between the promoter and intronic enhancer regions of c-KIT. Gene expression analyses verify that c-KIT expression is significantly high in t(8;21) AML. Further ChIP-seq analysis and motif scanning identify two regulatory regions located in the promoter and intronic enhancer region of c-KIT, respectively. Both regions are enriched by co-factors of AML1/ETO, such as AML1, CEBPe, c-Jun, and c-Fos. Further luciferase reporter assays show that AML1/ETO trans-activates c-KIT promoter activity through directly recognizing the AML1 motif and the co-existence of co-factors. The induction of c-KIT promoter activity is reinforced with the existence of intronic enhancer region. Furthermore, ChIP-3C-qPCR assays verify that AML1/ETO mediates the formation of DNA-looping between the c-KIT promoter and intronic enhancer region through the long-range interaction. Collectively, our data uncover a novel transcriptional activity mechanism of AML1/ETO and enrich our knowledge of the onco-fusion protein mediated transcription regulation. © 2017 Wiley Periodicals, Inc.

Pokemon promotes the invasiveness of hepatocellular carcinoma by enhancing MEF2D transcription.

Science.gov (United States)

Kong, Jing; Liu, Xiaoping; Li, Xiangqian; Wu, Jinsheng; Wu, Ning; Chen, Jun; Fang, Fang

2016-05-01

Pokemon, a master oncogene crucial for the tumorigenicity and progression of a variety of cancers, has been demonstrated to enhance the proliferation and survival of hepatocellular carcinoma (HCC). However, the contribution of Pokemon to the invasiveness of HCC has not yet been studied. In this study, we employed HCC cells to investigate the role of Pokemon in the invasion of HCC with multidisciplinary approaches. Pokemon overexpression was found to be closely associated with invasion and intrahepatic metastasis of HCC in clinical specimens. Suppression of Pokemon attenuated the invasion of HCC cells by in vitro transwell and wound-healing assays. Myocyte enhancer factor 2D (MEF2D), an oncogene that can promote the invasiveness of HCC, was found to be underexpressed during Pokemon silencing in HCC cells. Restoration of MEF2D abolished the effect of Pokemon downregulation on the migration of HCC cells. Further experiments verified that Pokemon binds two putative recognition sites located within the upstream region of the MEF2D promoter and enhances its transcription. The association between Pokemon and MEF2D was further confirmed in HCC specimens. Animal experiments further confirmed that Pokemon downregulation attenuated the metastasis of HCC cells in mice. Collectively, Pokemon was found to enhance the migration and invasion of HCC by increasing MEF2D expression. Thus, targeting Pokemon and MEF2D may be an effective strategy to suppress the metastasis of HCC.

A 1-kb bacteriophage lambda fragment functions as an insulator to effectively block enhancer-promoter interactions in Arabidopsis thaliana

Science.gov (United States)

The 35S cauliflower mosaic virus (CaMV) promoter contains an enhancer element that is able to override the tissue-, organ- and developmental-stage specificity of nearby promoters. Consequently, the precise control of transgene expression in transgenic plants, which often contain the 35S CaMV promot...

Development of a gene therapy strategy to target hepatocellular carcinoma based inhibition of protein phosphatase 2A using the α-fetoprotein promoter enhancer and pgk promoter: an in vitro and in vivo study

International Nuclear Information System (INIS)

Li, Wei; Tao, Min; Li, Dao-Ming; Chen, Kai; Chen, Zheng; Zong, Yang; Yin, Hong; Xu, Ze-Kuan; Zhu, Yi; Gong, Fei-Ran

2012-01-01

Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related deaths worldwide. Current therapies are insufficient, making HCC an intractable disease. Our previous studies confirmed that inhibition of protein phosphatase 2A (PP2A) may provide a promising therapeutic strategy for cancer. Unfortunately, constitutive expression of PP2A in normal tissues limits the application of PP2A inhibition. Thus, a HCC-specific gene delivery system should be developed. The α-fetoprotein (AFP) promoter is commonly used in HCC-specific gene therapy strategies; however, the utility of this approach is limited due to the weak activity of the AFP promoter. It has been shown that linking the AFP enhancer with the promoter of the non-tissue-specific, human housekeeping phosphoglycerate kinase (pgk) gene can generate a strong and HCC-selective promoter. We constructed a HCC-specific gene therapy system to target PP2A using the AFP enhancer/pgk promoter, and evaluated the efficiency and specificity of this system both in vitro and in vivo. AFP enhancer/pgk promoter-driven expression of the dominant negative form of the PP2A catalytic subunit α (DN-PP2Acα) exerted cytotoxic effects against an AFP-positive human hepatoma cell lines (HepG2 and Hep3B), but did not affect AFP-negative human hepatoma cells (SK-HEP-1) or normal human liver cells (L-02). Moreover, AFP enhancer/pgk promoter driven expression of DN-PP2Acα inhibited the growth of AFP-positive HepG2 tumors in nude mice bearing solid tumor xenografts, but did not affect AFP-negative SK-HEP-1 tumors. The novel approach of AFP enhancer/pgk promoter-driven expression of DN-PP2Acα may provide a useful cancer gene therapy strategy to selectively target HCC

DNA watermarks in non-coding regulatory sequences

Directory of Open Access Journals (Sweden)

Pyka Martin

2009-07-01

Full Text Available Abstract Background DNA watermarks can be applied to identify the unauthorized use of genetically modified organisms. It has been shown that coding regions can be used to encrypt information into living organisms by using the DNA-Crypt algorithm. Yet, if the sequence of interest presents a non-coding DNA sequence, either the function of a resulting functional RNA molecule or a regulatory sequence, such as a promoter, could be affected. For our studies we used the small cytoplasmic RNA 1 in yeast and the lac promoter region of Escherichia coli. Findings The lac promoter was deactivated by the integrated watermark. In addition, the RNA molecules displayed altered configurations after introducing a watermark, but surprisingly were functionally intact, which has been verified by analyzing the growth characteristics of both wild type and watermarked scR1 transformed yeast cells. In a third approach we introduced a second overlapping watermark into the lac promoter, which did not affect the promoter activity. Conclusion Even though the watermarked RNA and one of the watermarked promoters did not show any significant differences compared to the wild type RNA and wild type promoter region, respectively, it cannot be generalized that other RNA molecules or regulatory sequences behave accordingly. Therefore, we do not recommend integrating watermark sequences into regulatory regions.

CDinFusion--submission-ready, on-line integration of sequence and contextual data.

Science.gov (United States)

Hankeln, Wolfgang; Wendel, Norma Johanna; Gerken, Jan; Waldmann, Jost; Buttigieg, Pier Luigi; Kostadinov, Ivaylo; Kottmann, Renzo; Yilmaz, Pelin; Glöckner, Frank Oliver

2011-01-01

State of the art (DNA) sequencing methods applied in "Omics" studies grant insight into the 'blueprints' of organisms from all domains of life. Sequencing is carried out around the globe and the data is submitted to the public repositories of the International Nucleotide Sequence Database Collaboration. However, the context in which these studies are conducted often gets lost, because experimental data, as well as information about the environment are rarely submitted along with the sequence data. If these contextual or metadata are missing, key opportunities of comparison and analysis across studies and habitats are hampered or even impossible. To address this problem, the Genomic Standards Consortium (GSC) promotes checklists and standards to better describe our sequence data collection and to promote the capturing, exchange and integration of sequence data with contextual data. In a recent community effort the GSC has developed a series of recommendations for contextual data that should be submitted along with sequence data. To support the scientific community to significantly enhance the quality and quantity of contextual data in the public sequence data repositories, specialized software tools are needed. In this work we present CDinFusion, a web-based tool to integrate contextual and sequence data in (Multi)FASTA format prior to submission. The tool is open source and available under the Lesser GNU Public License 3. A public installation is hosted and maintained at the Max Planck Institute for Marine Microbiology at http://www.megx.net/cdinfusion. The tool may also be installed locally using the open source code available at http://code.google.com/p/cdinfusion.

HPV integration hijacks and multimerizes a cellular enhancer to generate a viral-cellular super-enhancer that drives high viral oncogene expression

Science.gov (United States)

Redmond, Catherine J.; Dooley, Katharine E.; Fu, Haiqing; Gillison, Maura L.; Akagi, Keiko; Symer, David E.; Aladjem, Mirit I.

2018-01-01

Integration of human papillomavirus (HPV) genomes into cellular chromatin is common in HPV-associated cancers. Integration is random, and each site is unique depending on how and where the virus integrates. We recently showed that tandemly integrated HPV16 could result in the formation of a super-enhancer-like element that drives transcription of the viral oncogenes. Here, we characterize the chromatin landscape and genomic architecture of this integration locus to elucidate the mechanisms that promoted de novo super-enhancer formation. Using next-generation sequencing and molecular combing/fiber-FISH, we show that ~26 copies of HPV16 are integrated into an intergenic region of chromosome 2p23.2, interspersed with 25 kb of amplified, flanking cellular DNA. This interspersed, co-amplified viral-host pattern is frequent in HPV-associated cancers and here we designate it as Type III integration. An abundant viral-cellular fusion transcript encoding the viral E6/E7 oncogenes is expressed from the integration locus and the chromatin encompassing both the viral enhancer and a region in the adjacent amplified cellular sequences is strongly enriched in the super-enhancer markers H3K27ac and Brd4. Notably, the peak in the amplified cellular sequence corresponds to an epithelial-cell-type specific enhancer. Thus, HPV16 integration generated a super-enhancer-like element composed of tandem interspersed copies of the viral upstream regulatory region and a cellular enhancer, to drive high levels of oncogene expression. PMID:29364907

Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

Energy Technology Data Exchange (ETDEWEB)

Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

2007-02-21

Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

Functional analysis of limb transcriptional enhancers in the mouse.

Science.gov (United States)

Nolte, Mark J; Wang, Ying; Deng, Jian Min; Swinton, Paul G; Wei, Caimiao; Guindani, Michele; Schwartz, Robert J; Behringer, Richard R

2014-01-01

Transcriptional enhancers are genomic sequences bound by transcription factors that act together with basal transcriptional machinery to regulate gene transcription. Several high-throughput methods have generated large datasets of tissue-specific enhancer sequences with putative roles in developmental processes. However, few enhancers have been deleted from the genome to determine their roles in development. To understand the roles of two enhancers active in the mouse embryonic limb bud we deleted them from the genome. Although the genes regulated by these enhancers are unknown, they were selected because they were identified in a screen for putative limb bud-specific enhancers associated with p300, an acetyltransferase that participates in protein complexes that promote active transcription, and because the orthologous human enhancers (H1442 and H280) drive distinct lacZ expression patterns in limb buds of embryonic day (E) 11.5 transgenic mice. We show that the orthologous mouse sequences, M1442 and M280, regulate dynamic expression in the developing limb. Although significant transcriptional differences in enhancer-proximal genes in embryonic limb buds accompany the deletion of M1442 and M280 no gross limb malformations during embryonic development were observed, demonstrating that M1442 and M280 are not required for mouse limb development. However, M280 is required for the development and/or maintenance of body size; M280 mice are significantly smaller than controls. M280 also harbors an "ultraconserved" sequence that is identical between human, rat, and mouse. This is the first report of a phenotype resulting from the deletion of an ultraconserved element. These studies highlight the importance of determining enhancer regulatory function by experiments that manipulate them in situ and suggest that some of an enhancer's regulatory capacities may be developmentally tolerated rather than developmentally required. © 2014 Wiley Periodicals, Inc.

Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter

International Nuclear Information System (INIS)

Dávalos-Salas, Mercedes; Furlan-Magaril, Mayra; González-Buendía, Edgar; Valdes-Quezada, Christian; Ayala-Ortega, Erandi; Recillas-Targa, Félix

2011-01-01

Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb) gene promoter in different tumoral cell lines. To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing

Technical innovation in dynamic contrast-enhanced magnetic resonance imaging of musculoskeletal tumors: an MR angiographic sequence using a sparse k-space sampling strategy.

Science.gov (United States)

Fayad, Laura M; Mugera, Charles; Soldatos, Theodoros; Flammang, Aaron; del Grande, Filippo

2013-07-01

We demonstrate the clinical use of an MR angiography sequence performed with sparse k-space sampling (MRA), as a method for dynamic contrast-enhanced (DCE)-MRI, and apply it to the assessment of sarcomas for treatment response. Three subjects with sarcomas (2 with osteosarcoma, 1 with high-grade soft tissue sarcomas) underwent MRI after neoadjuvant therapy/prior to surgery, with conventional MRI (T1-weighted, fluid-sensitive, static post-contrast T1-weighted sequences) and DCE-MRI (MRA, time resolution = 7-10 s, TR/TE 2.4/0.9 ms, FOV 40 cm(2)). Images were reviewed by two observers in consensus who recorded image quality (1 = diagnostic, no significant artifacts, 2 = diagnostic, 75 % with good response, >75 % with poor response). DCE-MRI findings were concordant with histological response (arterial enhancement with poor response, no arterial enhancement with good response). Unlike conventional DCE-MRI sequences, an MRA sequence with sparse k-space sampling is easily integrated into a routine musculoskeletal tumor MRI protocol, with high diagnostic quality. In this preliminary work, tumor enhancement characteristics by DCE-MRI were used to assess treatment response.

Sequencing and promoter analysis of the nifENXorf3orf5fdxAnifQ operon from Azospirillum brasilense Sp7

Directory of Open Access Journals (Sweden)

Potrich D.P.

2001-01-01

Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.

Mapping the transcription start points of the Staphylococcus aureus eap, emp, and vwb promoters reveals a conserved octanucleotide sequence that is essential for expression of these genes.

Science.gov (United States)

Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan

2008-01-01

Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.

Enhancement of the Enterocin CRL35 Activity by a Synthetic Peptide Derived from the NH2-Terminal Sequence

Science.gov (United States)

Saavedra, Lucila; Minahk, Carlos; de Ruiz Holgado, Aída P.; Sesma, Fernando

2004-01-01

The enterocin CRL35 biosynthetic gene cluster was cloned and sequenced. The sequence was revealed to be highly identical to that of the mundticin KS gene cluster (S. Kawamoto, J. Shima, R. Sato, T. Eguchi, S. Ohmomo, J. Shibato, N. Horikoshi, K. Takeshita, and T. Sameshima, Appl. Environ. Microbiol. 68:3830-3840, 2002). Short synthetic peptides were designed based on the bacteriocin sequence and were evaluated in antimicrobial competitive assays. The peptide KYYGNGVSCNKKGCS produced an enhancement of enterocin CRL35 antimicrobial activity in a buffer system. PMID:15215149

Genome dynamics of short oligonucleotides: the example of bacterial DNA uptake enhancing sequences.

Directory of Open Access Journals (Sweden)

Mohammed Bakkali

Full Text Available Among the many bacteria naturally competent for transformation by DNA uptake-a phenomenon with significant clinical and financial implications- Pasteurellaceae and Neisseriaceae species preferentially take up DNA containing specific short sequences. The genomic overrepresentation of these DNA uptake enhancing sequences (DUES causes preferential uptake of conspecific DNA, but the function(s behind this overrepresentation and its evolution are still a matter for discovery. Here I analyze DUES genome dynamics and evolution and test the validity of the results to other selectively constrained oligonucleotides. I use statistical methods and computer simulations to examine DUESs accumulation in Haemophilus influenzae and Neisseria gonorrhoeae genomes. I analyze DUESs sequence and nucleotide frequencies, as well as those of all their mismatched forms, and prove the dependence of DUESs genomic overrepresentation on their preferential uptake by quantifying and correlating both characteristics. I then argue that mutation, uptake bias, and weak selection against DUESs in less constrained parts of the genome combined are sufficient enough to cause DUESs accumulation in susceptible parts of the genome with no need for other DUES function. The distribution of overrepresentation values across sequences with different mismatch loads compared to the DUES suggests a gradual yet not linear molecular drive of DNA sequences depending on their similarity to the DUES. Other genomically overrepresented sequences, both pro- and eukaryotic, show similar distribution of frequencies suggesting that the molecular drive reported above applies to other frequent oligonucleotides. Rare oligonucleotides, however, seem to be gradually drawn to genomic underrepresentation, thus, suggesting a molecular drag. To my knowledge this work provides the first clear evidence of the gradual evolution of selectively constrained oligonucleotides, including repeated, palindromic and protein

CDinFusion--submission-ready, on-line integration of sequence and contextual data.

Directory of Open Access Journals (Sweden)

Wolfgang Hankeln

Full Text Available State of the art (DNA sequencing methods applied in "Omics" studies grant insight into the 'blueprints' of organisms from all domains of life. Sequencing is carried out around the globe and the data is submitted to the public repositories of the International Nucleotide Sequence Database Collaboration. However, the context in which these studies are conducted often gets lost, because experimental data, as well as information about the environment are rarely submitted along with the sequence data. If these contextual or metadata are missing, key opportunities of comparison and analysis across studies and habitats are hampered or even impossible. To address this problem, the Genomic Standards Consortium (GSC promotes checklists and standards to better describe our sequence data collection and to promote the capturing, exchange and integration of sequence data with contextual data. In a recent community effort the GSC has developed a series of recommendations for contextual data that should be submitted along with sequence data. To support the scientific community to significantly enhance the quality and quantity of contextual data in the public sequence data repositories, specialized software tools are needed. In this work we present CDinFusion, a web-based tool to integrate contextual and sequence data in (MultiFASTA format prior to submission. The tool is open source and available under the Lesser GNU Public License 3. A public installation is hosted and maintained at the Max Planck Institute for Marine Microbiology at http://www.megx.net/cdinfusion. The tool may also be installed locally using the open source code available at http://code.google.com/p/cdinfusion.

Plasmid origin of replication of herpesvirus papio: DNA sequence and enhancer function.

Science.gov (United States)

Loeb, D D; Sung, N S; Pesano, R L; Sexton, C J; Hutchison, C; Pagano, J S

1990-01-01

Herpesvirus papio (HVP) is a lymphotropic virus of baboons which is related to Epstein-Barr virus (EBV) and produces latent infection. The nucleotide sequence of the 5,775-base-pair (bp) EcoRI K fragment of HVP, which has previously been shown to confer the ability to replicate autonomously, has been determined. Within this DNA fragment is a region which bears structural and sequence similarity to the ori-P region of EBV. The HVP ori-P region has a 10- by 26-bp tandem array which is related to the 20- by 30-bp tandem array from the EBV ori-P region. In HVP there is an intervening region of 764 bp followed by five partial copies of the 26-bp monomer. Both the EBV and HVP 3' regions have the potential to form dyad structures which, however, differ in arrangement. We also demonstrate that a transcriptional enhancer which requires transactivation by a virus-encoded factor is present in the HVP ori-P. Images PMID:2159548

Draft Genome Sequence of the Plant Growth-Promoting Cupriavidus gilardii Strain JZ4 Isolated from the Desert Plant Tribulus terrestris

KAUST Repository

Lafi, Feras Fawzi; Bokhari, Ameerah; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

2016-01-01

We isolated the plant endophytic bacterium Cupriavidus gilardii strain JZ4 from the roots of the desert plant Tribulus terrestris, collected from the Jizan region, Saudi Arabia. We report here the draft genome sequence of JZ4, together with several enzymes related to plant growth-promoting activity, environmental adaption, and antifungal activity.

Draft Genome Sequence of the Plant Growth-Promoting Cupriavidus gilardii Strain JZ4 Isolated from the Desert Plant Tribulus terrestris

KAUST Repository

Lafi, Feras Fawzi

2016-07-28

We isolated the plant endophytic bacterium Cupriavidus gilardii strain JZ4 from the roots of the desert plant Tribulus terrestris, collected from the Jizan region, Saudi Arabia. We report here the draft genome sequence of JZ4, together with several enzymes related to plant growth-promoting activity, environmental adaption, and antifungal activity.

Technical innovation in dynamic contrast-enhanced magnetic resonance imaging of musculoskeletal tumors: an MR angiographic sequence using a sparse k-space sampling strategy

International Nuclear Information System (INIS)

Fayad, Laura M.; Mugera, Charles; Grande, Filippo del; Soldatos, Theodoros; Flammang, Aaron

2013-01-01

We demonstrate the clinical use of an MR angiography sequence performed with sparse k-space sampling (MRA), as a method for dynamic contrast-enhanced (DCE)-MRI, and apply it to the assessment of sarcomas for treatment response. Three subjects with sarcomas (2 with osteosarcoma, 1 with high-grade soft tissue sarcomas) underwent MRI after neoadjuvant therapy/prior to surgery, with conventional MRI (T1-weighted, fluid-sensitive, static post-contrast T1-weighted sequences) and DCE-MRI (MRA, time resolution = 7-10 s, TR/TE 2.4/0.9 ms, FOV 40 cm 2 ). Images were reviewed by two observers in consensus who recorded image quality (1 = diagnostic, no significant artifacts, 2 = diagnostic, 75 % with good response, >75 % with poor response). DCE-MRI findings were concordant with histological response (arterial enhancement with poor response, no arterial enhancement with good response). Unlike conventional DCE-MRI sequences, an MRA sequence with sparse k-space sampling is easily integrated into a routine musculoskeletal tumor MRI protocol, with high diagnostic quality. In this preliminary work, tumor enhancement characteristics by DCE-MRI were used to assess treatment response. (orig.)

Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

Science.gov (United States)

Wang, Cheng; Yu, Jie; Kallen, Caleb B

2008-01-01

The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

Agaricus bisporus genome sequence: a commentary.

Science.gov (United States)

Kerrigan, Richard W; Challen, Michael P; Burton, Kerry S

2013-06-01

The genomes of two isolates of Agaricus bisporus have been sequenced recently. This soil-inhabiting fungus has a wide geographical distribution in nature and it is also cultivated in an industrialized indoor process ($4.7bn annual worldwide value) to produce edible mushrooms. Previously this lignocellulosic fungus has resisted precise econutritional classification, i.e. into white- or brown-rot decomposers. The generation of the genome sequence and transcriptomic analyses has revealed a new classification, 'humicolous', for species adapted to grow in humic-rich, partially decomposed leaf material. The Agaricus biporus genomes contain a collection of polysaccharide and lignin-degrading genes and more interestingly an expanded number of genes (relative to other lignocellulosic fungi) that enhance degradation of lignin derivatives, i.e. heme-thiolate peroxidases and β-etherases. A motif that is hypothesized to be a promoter element in the humicolous adaptation suite is present in a large number of genes specifically up-regulated when the mycelium is grown on humic-rich substrate. The genome sequence of A. bisporus offers a platform to explore fungal biology in carbon-rich soil environments and terrestrial cycling of carbon, nitrogen, phosphorus and potassium. Copyright © 2013 Elsevier Inc. All rights reserved.

Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

Energy Technology Data Exchange (ETDEWEB)

Ferrari, S; Drusiani, E; Battini, R; Fregni, M

1988-01-11

Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

Production of recombinant AAV vectors encoding insulin-like growth factor I is enhanced by interaction among AAV rep regulatory sequences

Directory of Open Access Journals (Sweden)

Dilley Robert

2009-01-01

Full Text Available Abstract Background Adeno-associated virus (AAV vectors are promising tools for gene therapy. Currently, their potential is limited by difficulties in producing high vector yields with which to generate transgene protein product. AAV vector production depends in part upon the replication (Rep proteins required for viral replication. We tested the hypothesis that mutations in the start codon and upstream regulatory elements of Rep78/68 in AAV helper plasmids can regulate recombinant AAV (rAAV vector production. We further tested whether the resulting rAAV vector preparation augments the production of the potentially therapeutic transgene, insulin-like growth factor I (IGF-I. Results We constructed a series of AAV helper plasmids containing different Rep78/68 start codon in combination with different gene regulatory sequences. rAAV vectors carrying the human IGF-I gene were prepared with these vectors and the vector preparations used to transduce HT1080 target cells. We found that the substitution of ATG by ACG in the Rep78/68 start codon in an AAV helper plasmid (pAAV-RC eliminated Rep78/68 translation, rAAV and IGF-I production. Replacement of the heterologous sequence upstream of Rep78/68 in pAAV-RC with the AAV2 endogenous p5 promoter restored translational activity to the ACG mutant, and restored rAAV and IGF-I production. Insertion of the AAV2 p19 promoter sequence into pAAV-RC in front of the heterologous sequence also enabled ACG to function as a start codon for Rep78/68 translation. The data further indicate that the function of the AAV helper construct (pAAV-RC, that is in current widespread use for rAAV production, may be improved by replacement of its AAV2 unrelated heterologous sequence with the native AAV2 p5 promoter. Conclusion Taken together, the data demonstrate an interplay between the start codon and upstream regulatory sequences in the regulation of Rep78/68 and indicate that selective mutations in Rep78/68 regulatory elements

Triple helix-forming oligonucleotide corresponding to the polypyrimidine sequence in the rat alpha 1(I) collagen promoter specifically inhibits factor binding and transcription.

Science.gov (United States)

Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V

1996-01-19

Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.

Prospecting plant growth promoting bacteria and cyanobacteria as options for enrichment of macro- and micronutrients in grains in rice–wheat cropping sequence

Directory of Open Access Journals (Sweden)

Anuj Rana

2015-12-01

Full Text Available The influence of plant growth promoting bacteria (PGPB and cyanobacteria, alone and in combination, was investigated on micronutrient enrichment and yield in rice–wheat sequence, over a period of two years. Analysis of variance (ANOVA in both crops indicated significant differences in soil dehydrogenase activity and micronutrient enrichment in grains (Fe, Zn in rice, and Cu, Mn in wheat. The combined inoculation of Anabaena oscillarioides CR3, Brevundimonas diminuta PR7, and Ochrobactrum anthropi PR10 (T6 significantly increased nitrogen, phosphorus, and potassium (NPK content and improved rice yield by 21.2%, as compared to the application of recommended dose of NPK fertilizers (T2. The treatment T5 (Providencia sp. PR3 + B. diminuta PR7 + O. anthropi PR10 recorded an enhancement of 13–16% in Fe, Zn, Cu, and Mn concentrations, respectively, in rice grains. In wheat, Providencia sp. PW5 (T6 recorded the highest yield (5.23 Mg ha−1 and significantly higher enrichment of Fe and Cu (44–45% in the grains. This study highlighted the promise of combinations of cyanobacteria/bacteria and their synergistic action in biofortification and providing savings of 40–60 kg N ha−1. Future focus needs to be towards integrating such promising environment-friendly and environmentally sustainable options in nutrient management strategies for this cropping sequence.

Regulation of HFE expression by poly(ADP-ribose) polymerase-1 (PARP1) through an inverted repeat DNA sequence in the distal promoter.

Science.gov (United States)

Pelham, Christopher; Jimenez, Tamara; Rodova, Marianna; Rudolph, Angela; Chipps, Elizabeth; Islam, M Rafiq

2013-12-01

Hereditary hemochromatosis (HH) is a common autosomal recessive disorder of iron overload among Caucasians of northern European descent. Over 85% of all cases with HH are due to mutations in the hemochromatosis protein (HFE) involved in iron metabolism. Although the importance in iron homeostasis is well recognized, the mechanism of sensing and regulating iron absorption by HFE, especially in the absence of iron response element in its gene, is not fully understood. In this report, we have identified an inverted repeat sequence (ATGGTcttACCTA) within 1700bp (-1675/+35) of the HFE promoter capable to form cruciform structure that binds PARP1 and strongly represses HFE promoter. Knockdown of PARP1 increases HFE mRNA and protein. Similarly, hemin or FeCl3 treatments resulted in increase in HFE expression by reducing nuclear PARP1 pool via its apoptosis induced cleavage, leading to upregulation of the iron regulatory hormone hepcidin mRNA. Thus, PARP1 binding to the inverted repeat sequence on the HFE promoter may serve as a novel iron sensing mechanism as increased iron level can trigger PARP1 cleavage and relief of HFE transcriptional repression. © 2013.

Chunk concatenation evolves with practice and sleep-related enhancement consolidation in a complex arm movement sequence

Directory of Open Access Journals (Sweden)

Blischke Klaus

2016-06-01

Full Text Available This paper addresses the notion of chunk concatenation being associated with sleep-related enhancement consolidation of motor sequence memory, thereby essentially contributing to improvements in sequence execution speed. To this end, element movement times of a multi-joint arm movement sequence incorporated in a recent study by Malangré et al. (2014 were reanalyzed. As sequence elements differed with respect to movement distance, element movement times had to be purged from differences solely due to varying trajectory lengths. This was done by dividing each element movement time per subject and trial block by the respective “reference movement time” collected from subjects who had extensively practiced each sequence element in isolation. Any differences in these “relative element movement times” were supposed to reflect element-specific “production costs” imposed solely by the sequence context. Across all subjects non-idiosyncratic, lasting sequence segmentation was shown, and four possible concatenation points (i.e. transition points between successive chunks within the original arm movement sequence were identified. Based on theoretical suppositions derived from previous work with the discrete sequence production task and the dual processor model (Abrahamse et al., 2013, significantly larger improvements in transition speed occurring at these four concatenation points as compared to the five fastest transition positions within the sequence (associated with mere element execution were assumed to indicate increased chunk concatenation. As a result, chunk concatenation was shown to proceed during acquisition with physical practice, and, most importantly, to significantly progress some more during retention following a night of sleep, but not during a waking interval.

The porcine circovirus type 1 capsid gene promoter improves antigen expression and immunogenicity in a HIV-1 plasmid vaccine

Directory of Open Access Journals (Sweden)

Burger Marieta

2011-02-01

Full Text Available Abstract Background One of the promising avenues for development of vaccines against Human immunodeficiency virus type 1 (HIV-1 and other human pathogens is the use of plasmid-based DNA vaccines. However, relatively large doses of plasmid must be injected for a relatively weak response. We investigated whether genome elements from Porcine circovirus type 1 (PCV-1, an apathogenic small ssDNA-containing virus, had useful expression-enhancing properties that could allow dose-sparing in a plasmid vaccine. Results The linearised PCV-1 genome inserted 5' of the CMV promoter in the well-characterised HIV-1 plasmid vaccine pTHgrttnC increased expression of the polyantigen up to 2-fold, and elicited 3-fold higher CTL responses in mice at 10-fold lower doses than unmodified pTHgrttnC. The PCV-1 capsid gene promoter (Pcap alone was equally effective. Enhancing activity was traced to a putative composite host transcription factor binding site and a "Conserved Late Element" transcription-enhancing sequence previously unidentified in circoviruses. Conclusions We identified a novel PCV-1 genome-derived enhancer sequence that significantly increased antigen expression from plasmids in in vitro assays, and improved immunogenicity in mice of the HIV-1 subtype C vaccine plasmid, pTHgrttnC. This should allow significant dose sparing of, or increased responses to, this and other plasmid-based vaccines. We also report investigations of the potential of other circovirus-derived sequences to be similarly used.

Comparison between gadolinium-enhanced 2D T1-weighted gradient-echo and spin-echo sequences in the detection of active multiple sclerosis lesions on 3.0T MRI

Energy Technology Data Exchange (ETDEWEB)

Aymerich, F.X. [Hospital Universitari Vall d' Hebron, Universitat Autonoma de Barcelona, MR Unit. Department of Radiology (IDI), Barcelona (Spain); Universitat Politecnica de Catalunya - Barcelona Tech (UPC), Department of Automatic Control (ESAII), Barcelona (Spain); Auger, C.; Alcaide-Leon, P.; Pareto, D.; Huerga, E.; Corral, J.F.; Mitjana, R.; Rovira, A. [Hospital Universitari Vall d' Hebron, Universitat Autonoma de Barcelona, MR Unit. Department of Radiology (IDI), Barcelona (Spain); Sastre-Garriga, J.; Montalban, X. [Hospital Universitari Vall d' Hebron, Universitat Autonoma de Barcelona, Centre d' Esclerosi Multiple de Catalunya (Cemcat), Department of Neurology/Neuroimmunology, Barcelona (Spain)

2017-04-15

To compare the sensitivity of enhancing multiple sclerosis (MS) lesions in gadolinium-enhanced 2D T1-weighted gradient-echo (GRE) and spin-echo (SE) sequences, and to assess the influence of visual conspicuity and laterality on detection of these lesions. One hundred MS patients underwent 3.0T brain MRI including gadolinium-enhanced 2D T1-weighted GRE and SE sequences. The two sets of contrast-enhanced scans were evaluated in random fashion by three experienced readers. Lesion conspicuity was assessed by the image contrast ratio (CR) and contrast-to-noise ratio (CNR). The intracranial region was divided into four quadrants and the impact of lesion location on detection was assessed in each slice. Six hundred and seven gadolinium-enhancing MS lesions were identified. GRE images were more sensitive for lesion detection (0.828) than SE images (0.767). Lesions showed a higher CR in SE than in GRE images, whereas the CNR was higher in GRE than SE. Most misclassifications occurred in the right posterior quadrant. The gadolinium-enhanced 2D T1-weighted GRE sequence at 3.0T MRI enables detection of enhancing MS lesions with higher sensitivity and better lesion conspicuity than 2D T1-weighted SE. Hence, we propose the use of gadolinium-enhanced GRE sequences rather than SE sequences for routine scanning of MS patients at 3.0T. (orig.)

Detection of liver lesions with gadolinium-enhanced VIBE sequence in comparison with SPIO-enhanced MRI; Detektion von Leberlaesionen mit der Gadolinium-verstaerkten VIBE-Sequenz im Vergleich zur SPIO-verstaerkten MRT

Energy Technology Data Exchange (ETDEWEB)

Heim, P.; Steiner, P.; Dieckmann, C.; Adam, G. [Universitaetsklinikum Hamburg-Eppendorf (Germany). Klinik und Poliklinik fuer Diagnostische und Interventionelle Radiologie; Schoder, V. [Universitaetsklinikum Hamburg-Eppendorf (Germany). Inst. fuer Medizinische Biometrie und Epidemiologie; Kuhlencordt, R. [Universitaetsklinikum Hamburg-Eppendorf (Germany). Klinik und Poliklinik fuer Allgemein-, Viszeral-, und Thoraxchirurgie

2003-10-01

Purpose: Detection of malignant liver lesions with gadolinium-enhanced volumetric interpolated breath-hold examination (VIBE) in comparison with SPIO-enhanced MRT (four different SPIO-enhanced T2w sequences) and histological and imaging follow-up in non-cirrhotic livers at 1.5 T. Patients and methods: Twenty-two patients with suspected focal liver lesions prospectively underwent a gadolinium-enhanced 3D VIBE. Four T2w sequences (HASTE sequence, fast spin-echo-sequence with and without fat-saturation, FLASH 2D gradient echo-sequence) after administration of superparamagnetic iron oxide (SPIO) served as gold standard combined with histological work-up in 17 patients and histological and imaging follow-up in five patients. The image quality was evaluated and the detectability of intrahepatic lesions was rated by the alternative free-response receiver operating characteristic (AFROC) analysis. In addition, the contrast-to-noise ration was compared. Results: Altogether 49 malignant and 35 benign liver lesions were found. Concerning the image quality, VIBE turned out to be of slightly poorer image quality than the SPIO-enhanced examination with HASTE sequence (4.95 vs. 5.0). The fast spin-echo-sequence without fat-saturation demonstrated the highest contrast-to-noise ratio. All sequences showed a comparable certainty in detecting lesion (area under the curve 0.68-0.74) and identifying malignant liver lesions. Conclusions: Despite the small number of patients, VIBE seems to be a comparable, inexpensive and fast method in diagnosing malignant liver lesions. (orig.) [German] Ziel: Detektion maligner Leberlaesionen mit der Gadolinium-verstaerkten 3D-Gradientenecho-Sequenz in Atemanhaltetechnik (VIBE-Sequenz) im Vergleich mit der SPIO-verstaerkten MRT (vier verschiedene SPIO-verstaerkte T2-gew. Sequenzen) sowie histologischen und bildgebenden (Verlaufs-) Untersuchungen in nicht-zirrhotischen Lebern bei 1,5 T. Patienten und Methoden: 22 Patienten mit Verdacht auf maligne

Draft Genome Sequence of the Plant Growth–Promoting Rhizobacterium Acinetobacter radioresistens Strain SA188 Isolated from the Desert Plant Indigofera argentea

KAUST Repository

Lafi, Feras Fawzi; Alam, Intikhab; Bisseling, Ton; Geurts, Rene; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

2017-01-01

Acinetobacter radioresistens strain SA188 is a plant endophytic bacterium, isolated from root nodules of the desert plants Indigofera spp., collected in Jizan, Saudi Arabia. Here, we report the 3.2-Mb draft genome sequence of strain SA188, highlighting characteristic pathways for plant growth–promoting activity and environmental adaptation.

Draft Genome Sequence of the Plant Growth–Promoting Rhizobacterium Acinetobacter radioresistens Strain SA188 Isolated from the Desert Plant Indigofera argentea

KAUST Repository

Lafi, Feras Fawzi

2017-03-03

Acinetobacter radioresistens strain SA188 is a plant endophytic bacterium, isolated from root nodules of the desert plants Indigofera spp., collected in Jizan, Saudi Arabia. Here, we report the 3.2-Mb draft genome sequence of strain SA188, highlighting characteristic pathways for plant growth–promoting activity and environmental adaptation.

Tissue- and agonist-specific regulation of human and murine plasminogen activator inhibitor-1 promoters in transgenic mice.

Science.gov (United States)

Eren, M; Painter, C A; Gleaves, L A; Schoenhard, J A; Atkinson, J B; Brown, N J; Vaughan, D E

2003-11-01

Numerous studies have described regulatory factors and sequences that control transcriptional responses in vitro. However, there is a paucity of information on the qualitative and quantitative regulation of heterologous promoters using transgenic strategies. In order to investigate the physiological regulation of human plasminogen activator inhibitor type-1 (hPAI-1) expression in vivo compared to murine PAI-1 (mPAI-1) and to test the physiological relevance of regulatory mechanisms described in vitro, we generated transgenic mice expressing enhanced green fluorescent protein (EGFP) driven by the proximal -2.9 kb of the hPAI-1 promoter. Transgenic animals were treated with Ang II, TGF-beta1 and lipopolysaccharide (LPS) to compare the relative activation of the human and murine PAI-1 promoters. Ang II increased EGFP expression most effectively in brain, kidney and spleen, while mPAI-1 expression was quantitatively enhanced most prominently in heart and spleen. TGF-beta1 failed to induce activation of the hPAI-1 promoter but potently stimulated mPAI-1 in kidney and spleen. LPS administration triggered robust expression of mPAI-1 in liver, kidney, pancreas, spleen and lung, while EGFP was induced only modestly in heart and kidney. These results indicate that the transcriptional response of the endogenous mPAI-1 promoter varies widely in terms of location and magnitude of response to specific stimuli. Moreover, the physiological regulation of PAI-1 expression likely involves a complex interaction of transcription factors and DNA sequences that are not adequately replicated by in vitro functional studies focused on the proximal -2.9 kb promoter.

Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

Directory of Open Access Journals (Sweden)

Cheng Wang

Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

Research on dragons: a teaching sequence to promote the understanding of Nature of Science at Secondary School

Directory of Open Access Journals (Sweden)

Romero Ariza, Marta

2013-01-01

Full Text Available This paper presents a teaching sequence explicitly designed to improve the understanding of Nature of Science and support Secondary School students to acquire adequate understanding about scientific hypothesis, theories and laws. The instructional intervention engages students in an inquiry process where they have to formulate hypothesis, analyse data and draw conclusions based on evidence. It is a student-centred methodology where teachers act as facilitators and guides, promoting the development of scientific competences and the meaningful understanding of the terms hypothesis, law and theory.

Mechanism of selective recruitment of RNA polymerases II and III to snRNA gene promoters.

Science.gov (United States)

Dergai, Oleksandr; Cousin, Pascal; Gouge, Jerome; Satia, Karishma; Praz, Viviane; Kuhlman, Tracy; Lhôte, Philippe; Vannini, Alessandro; Hernandez, Nouria

2018-05-01

RNA polymerase II (Pol II) small nuclear RNA (snRNA) promoters and type 3 Pol III promoters have highly similar structures; both contain an interchangeable enhancer and "proximal sequence element" (PSE), which recruits the SNAP complex (SNAPc). The main distinguishing feature is the presence, in the type 3 promoters only, of a TATA box, which determines Pol III specificity. To understand the mechanism by which the absence or presence of a TATA box results in specific Pol recruitment, we examined how SNAPc and general transcription factors required for Pol II or Pol III transcription of SNAPc-dependent genes (i.e., TATA-box-binding protein [TBP], TFIIB, and TFIIA for Pol II transcription and TBP and BRF2 for Pol III transcription) assemble to ensure specific Pol recruitment. TFIIB and BRF2 could each, in a mutually exclusive fashion, be recruited to SNAPc. In contrast, TBP-TFIIB and TBP-BRF2 complexes were not recruited unless a TATA box was present, which allowed selective and efficient recruitment of the TBP-BRF2 complex. Thus, TBP both prevented BRF2 recruitment to Pol II promoters and enhanced BRF2 recruitment to Pol III promoters. On Pol II promoters, TBP recruitment was separate from TFIIB recruitment and enhanced by TFIIA. Our results provide a model for specific Pol recruitment at SNAPc-dependent promoters. © 2018 Dergai et al.; Published by Cold Spring Harbor Laboratory Press.

Diuretic-enhanced gadolinium excretory MR urography: comparison of conventional gradient-echo sequences and echo-planar imaging

Energy Technology Data Exchange (ETDEWEB)

Nolte-Ernsting, C.C.A.; Tacke, J.; Adam, G.B.; Haage, P.; Guenther, R.W. [Univ. of Technology, Aachen (Germany). Dept. of Diagnostic Radiology; Jung, P.; Jakse, G. [Univ. of Technology, Aachen (Germany). Dept. of Urology

2001-01-01

The aim of this study was to investigate the utility of different gadolinium-enhanced T1-weighted gradient-echo techniques in excretory MR urography. In 74 urologic patients, excretory MR urography was performed using various T1-weighted gradient-echo (GRE) sequences after injection of gadolinium-DTPA and low-dose furosemide. The examinations included conventional GRE sequences and echo-planar imaging (GRE EPI), both obtained with 3D data sets and 2D projection images. Breath-hold acquisition was used primarily. In 20 of 74 examinations, we compared breath-hold imaging with respiratory gating. Breath-hold imaging was significantly superior to respiratory gating for the visualization of pelvicaliceal systems, but not for the ureters. Complete MR urograms were obtained within 14-20 s using 3D GRE EPI sequences and in 20-30 s with conventional 3D GRE sequences. Ghost artefacts caused by ureteral peristalsis often occurred with conventional 3D GRE imaging and were almost completely suppressed in EPI sequences (p < 0.0001). Susceptibility effects were more pronounced on GRE EPI MR urograms and calculi measured 0.8-21.7% greater in diameter compared with conventional GRE sequences. Increased spatial resolution degraded the image quality only in GRE-EPI urograms. (orig.)

Genome-wide identification and characterization of Notch transcription complex-binding sequence paired sites in leukemia cells

Science.gov (United States)

Severson, Eric; Arnett, Kelly L.; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S.; Liu, X. Shirley; Blacklow, Stephen C.; Aster, Jon C.

2018-01-01

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and are linked to the Notch-responsiveness of a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that SPSs contribute to the regulation of approximately a third of direct Notch target genes. While originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. PMID:28465412

Qualitative and quantitative comparison of contrast-enhanced fluid-attenuated inversion recovery, magnetization transfer spin echo, and fat-saturation T1-weighted sequences in infectious meningitis

Energy Technology Data Exchange (ETDEWEB)

Azad, Rajiv; Tayal, Mohit; Azad, Sheenam; Sharma, Garima; Srivastava, Rajendra Kumar [SGRR Institute of Medical and Health Sciences, Patel Nagar, Dehradun (India)

2017-11-15

To compare the contrast-enhanced fluid-attenuated inversion recovery (CE-FLAIR), the CE T1-weighted (CE-T1W) sequence with fat suppression (FS) and magnetization transfer (MT) for early detection and characterization of infectious meningitis. Fifty patients and 10 control subjects were evaluated with the CE-FLAIR and the CE-T1W sequences with FS and MT. Qualitative assessment was done by two observers for presence and grading of abnormal leptomeningeal enhancement. Quantitative assessment included computation of net meningeal enhancement, using single pixel signal intensity software. A newly devised FLAIR based scoring system, based on certain imaging features including ventricular dilatation, ependymal enhancement, infarcts and subdural effusions was used to indicate the etiology. Data were analysed using the Student's t test, Cohen's Kappa coefficient, Pearson's correlation coefficient, the intraclass correlation coefficient, one way analysis of variance, and Fisher's exact test with Bonferroni correction as the post hoc test. The CE-FLAIR sequence demonstrated a better sensitivity (100%), diagnostic accuracy (95%), and a stronger correlation with the cerebrospinal fluid, total leukocyte count (r = 0.75), protein (r = 0.77), adenosine deaminase (r = 0.81) and blood glucose (r = -0.6) values compared to the CE-T1W sequences. Qualitative grades and quantitative meningeal enhancement on the CE-FLAIR sequence were also significantly greater than those on the other sequences. The FLAIR based scoring system yielded a diagnostic accuracy of 91.6% and a sensitivity of 96%. A strong inverse Pearson's correlation (r = -0.95) was found between the assigned score and patient's Glasgow Coma Scale at the time of admission. The CE-FLAIR sequence is better suited for evaluating infectious meningitis and could be included as a part of the routine MR imaging protocol.

Qualitative and quantitative comparison of contrast-enhanced fluid-attenuated inversion recovery, magnetization transfer spin echo, and fat-saturation T1-weighted sequences in infectious meningitis

International Nuclear Information System (INIS)

Azad, Rajiv; Tayal, Mohit; Azad, Sheenam; Sharma, Garima; Srivastava, Rajendra Kumar

2017-01-01

To compare the contrast-enhanced fluid-attenuated inversion recovery (CE-FLAIR), the CE T1-weighted (CE-T1W) sequence with fat suppression (FS) and magnetization transfer (MT) for early detection and characterization of infectious meningitis. Fifty patients and 10 control subjects were evaluated with the CE-FLAIR and the CE-T1W sequences with FS and MT. Qualitative assessment was done by two observers for presence and grading of abnormal leptomeningeal enhancement. Quantitative assessment included computation of net meningeal enhancement, using single pixel signal intensity software. A newly devised FLAIR based scoring system, based on certain imaging features including ventricular dilatation, ependymal enhancement, infarcts and subdural effusions was used to indicate the etiology. Data were analysed using the Student's t test, Cohen's Kappa coefficient, Pearson's correlation coefficient, the intraclass correlation coefficient, one way analysis of variance, and Fisher's exact test with Bonferroni correction as the post hoc test. The CE-FLAIR sequence demonstrated a better sensitivity (100%), diagnostic accuracy (95%), and a stronger correlation with the cerebrospinal fluid, total leukocyte count (r = 0.75), protein (r = 0.77), adenosine deaminase (r = 0.81) and blood glucose (r = -0.6) values compared to the CE-T1W sequences. Qualitative grades and quantitative meningeal enhancement on the CE-FLAIR sequence were also significantly greater than those on the other sequences. The FLAIR based scoring system yielded a diagnostic accuracy of 91.6% and a sensitivity of 96%. A strong inverse Pearson's correlation (r = -0.95) was found between the assigned score and patient's Glasgow Coma Scale at the time of admission. The CE-FLAIR sequence is better suited for evaluating infectious meningitis and could be included as a part of the routine MR imaging protocol

P1 interneurons promote a persistent internal state that enhances inter-male aggression in Drosophila

Science.gov (United States)

Hoopfer, Eric D; Jung, Yonil; Inagaki, Hidehiko K; Rubin, Gerald M; Anderson, David J

2015-01-01

How brains are hardwired to produce aggressive behavior, and how aggression circuits are related to those that mediate courtship, is not well understood. A large-scale screen for aggression-promoting neurons in Drosophila identified several independent hits that enhanced both inter-male aggression and courtship. Genetic intersections revealed that 8-10 P1 interneurons, previously thought to exclusively control male courtship, were sufficient to promote fighting. Optogenetic experiments indicated that P1 activation could promote aggression at a threshold below that required for wing extension. P1 activation in the absence of wing extension triggered persistent aggression via an internal state that could endure for minutes. High-frequency P1 activation promoted wing extension and suppressed aggression during photostimulation, whereas aggression resumed and wing extension was inhibited following photostimulation offset. Thus, P1 neuron activation promotes a latent, internal state that facilitates aggression and courtship, and controls the overt expression of these social behaviors in a threshold-dependent, inverse manner. DOI: http://dx.doi.org/10.7554/eLife.11346.001 PMID:26714106

Optimal pulse sequence for ferumoxides-enhanced MR imaging used in the detection of hepatocellular carcinoma: a comparative study using seven pulse sequences

International Nuclear Information System (INIS)

Kim, Seung Hoon; Choi, Dongil; Lim, Jae Hoon; Lee, Won Jae; Jang, Hyun Jung; Lim, Kyo Keun; Lee, Soon Jin; Cho, Jae Min; Kim, Seung Kwon; Kim, Gab Chul

2002-01-01

To identify the optimal pulse sequence for ferumoxides-enhanced magnetic resonance (MR) imaging in the detection of hepatocelluar carcinomas (HCCs). Sixteen patients with 25 HCCs underwent MR imaging following intravenous infusion of ferumoxides. All MR studies were performed on a 1.5-T MR system, using a phased-array coil. Ferumoxides (Feridex IV) at a dose of 15 μmol/Kg was slowly infused intravenously, and axial images of seven sequences were obtained 30 minutes after the end of infusion. The MR protocol included fast spin-echo (FSE) with two echo times (TR3333-8571/TE18 and 90-117), singleshot FSE (SSFSE) with two echo times (TR∞/TE39 and 98), T2-weighted gradient-recalled acquisition in the steady state (GRASS) (TR216/TE20), T2-weighted fast multiplanar GRASS (FMPGR) (TR130/TE8.4-9.5), and T2-weighted fast multiplanar spoiled GRASS (FMPSPGR) (TR130/TE8.4-9.5). Contrast-to-noise ratios (CNRs) of HCCs determined during the imaging sequences formed the basis of quantitative analysis, and images were qualitatively assessed in terms of lesion conspicuity and image artifacts. The diagnostic accuracy of all sequences was assessed using receiver operating characteristic (ROC) analysis. Quantitative analysis revealed that the CNRs of T2-weighted FMPGR and T2-weighted FMPSPGR were significantly higher than those of the other sequences, while qualitative analysis showed that image artifacts were prominent at T2-weighted GRASS imaging. Lesion conspicuity was statistically significantly less clear at SSFSE imaging. In term of lesion detection, T-weighted FMPGR, T2- weighted FMPSPGR, and proton density FSE imaging were statistically superior to the others. T2-weighted FMPGR, T2- weighted FMPSPGR, and proton density FSE appear to be the optimal pulse sequences for ferumoxidesenhanced MR imaging in the detection of HCCs

MGMT DNA repair gene promoter/enhancer haplotypes alter transcription factor binding and gene expression.

Science.gov (United States)

Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z

2016-10-01

The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.

Genome-scale regression analysis reveals a linear relationship for promoters and enhancers after combinatorial drug treatment

KAUST Repository

Rapakoulia, Trisevgeni

2017-08-09

Motivation: Drug combination therapy for treatment of cancers and other multifactorial diseases has the potential of increasing the therapeutic effect, while reducing the likelihood of drug resistance. In order to reduce time and cost spent in comprehensive screens, methods are needed which can model additive effects of possible drug combinations. Results: We here show that the transcriptional response to combinatorial drug treatment at promoters, as measured by single molecule CAGE technology, is accurately described by a linear combination of the responses of the individual drugs at a genome wide scale. We also find that the same linear relationship holds for transcription at enhancer elements. We conclude that the described approach is promising for eliciting the transcriptional response to multidrug treatment at promoters and enhancers in an unbiased genome wide way, which may minimize the need for exhaustive combinatorial screens.

Pulse sequences for contrast-enhanced magnetic resonance imaging

International Nuclear Information System (INIS)

Graves, Martin J.

2007-01-01

The theory and application of magnetic resonance imaging (MRI) pulse sequences following the administration of an exogenous contrast agent are discussed. Pulse sequences are categorised according to the contrast agent mechanism: changes in proton density, relaxivity, magnetic susceptibility and resonant frequency shift. Applications in morphological imaging, magnetic resonance angiography, dynamic imaging and cell labelling are described. The importance of optimising the pulse sequence for each application is emphasised

Using a Synchronous Online Learning Environment to Promote and Enhance Transactional Engagement beyond the Classroom

Science.gov (United States)

Wdowik, Steven

2014-01-01

Purpose: The purpose of this paper is to create a synchronous online learning community through the use of "Blackboard Collaborate!" to promote and enhance transactional engagement outside the classroom. Design/methodology/approach: This paper employs a quantitative and qualitative approach where data were sourced from a third year…

Prenylcoumarins in One or Two Steps by a Microwave-Promoted Tandem Claisen Rearrangement/Wittig Olefination/Cyclization Sequence.

Science.gov (United States)

Schultze, Christiane; Schmidt, Bernd

2018-05-04

The one-pot synthesis of 8-prenylcoumarins from 1,1-dimethylallylated salicylaldehydes and the stabilized ylide [(ethoxycarbonyl)methylene]triphenylphosphorane under microwave conditions was found to have a limited scope. The sequence suffers from a difficult and sometimes low-yielding synthesis of the precursors and from a competing deprenylation upon microwave irradiation. This side reaction occurs in particular with electron rich arenes with two or more alkoxy groups at adjacent positions, a prominent substitution pattern in naturally occurring 8-prenylcoumarins. Both limitations of this one-step sequence were overcome by a two-step synthesis consisting of a microwave-promoted tandem allyl ether Claisen rearrangement/Wittig olefination and a subsequent olefin cross metathesis with 2-methyl-2-butene. The cross metathesis step proceeds with a high selectivity and yields exclusively the desired prenyl, rather than the alternative crotyl substituent. Several naturally occurring 8-prenylcoumarins that were previously inaccessible have been synthesized in good overall yields along this route.

Mapping of the methylation pattern of the hMSH2 promoter in colon cancer, using bisulfite genomic sequencing

Directory of Open Access Journals (Sweden)

Zhang Hua

2006-08-01

Full Text Available Abstract The detailed methylation status of CpG sites in the promoter region of hMSH2 gene has yet not to be reported. We have mapped the complete methylation status of the hMSH2 promoter, a region that contains 75 CpG sites, using bisulfite genomic sequencing in 60 primary colorectal cancers. And the expression of hMSH2 was detected by immunohistochemistry. The hypermethylation of hMSH2 was detected in 18.33% (11/60 of tumor tissues. The protein of hMSH2 was detected in 41.67% (25/60 of tumor tissues. No hypermethylation of hMSH2 was detected in normal tissues. The protein of hMSH2 was detected in all normal tissues. Our study demonstrated that hMSH2 hypermethylation and protein expression were associated with the development of colorectal cancer.

Enhanced Dynamic Algorithm of Genome Sequence Alignments

OpenAIRE

Arabi E. keshk

2014-01-01

The merging of biology and computer science has created a new field called computational biology that explore the capacities of computers to gain knowledge from biological data, bioinformatics. Computational biology is rooted in life sciences as well as computers, information sciences, and technologies. The main problem in computational biology is sequence alignment that is a way of arranging the sequences of DNA, RNA or protein to identify the region of similarity and relationship between se...

Perception Enhancement using Visual Attributes in Sequence Motif Visualization

OpenAIRE

Oon, Yin; Lee, Nung; Kok, Wei

2016-01-01

Sequence logo is a well-accepted scientific method to visualize the conservation characteristics of biological sequence motifs. Previous studies found that using sequence logo graphical representation for scientific evidence reports or arguments could seriously cause biases and misinterpretation by users. This study investigates on the visual attributes performance of a sequence logo in helping users to perceive and interpret the information based on preattentive theories and Gestalt principl...

Hpa1 harpin needs nitroxyl terminus to promote vegetative growth and leaf photosynthesis in Arabidopsis.

Science.gov (United States)

Li, Xiaojie; Han, Liping; Zhao, Yanying; You, Zhenzhen; Dong, Hansong; Zhang, Chunling

2014-03-01

Hpa1 is a harpin protein produced by Xanthomonas oryzae, an important bacterial pathogen of rice, and has the growth-promoting activity in plants. To understand the molecular basis for the function of Hpa1, we generated an inactive variant protein, Hpa1 delta NT, by deleting the nitroxyl-terminal region of the Hpa1 sequence and compared Hpa1 delta NT with the full-length protein in terms of the effects on vegetative growth and related physiological responses in Arabidopsis. When Hpa1 was applied to plants, it acted to enhance the vegetative growth but did not affect the floral development. Enhanced plant growth was accompanied by induced expression of growth-promoting genes in plant leaves. The growth-promoting activity of Hpa1 was further correlated with a physiological consequence shown as promoted leaf photosynthesis as a result of facilitated CO2 conduction through leaf stomata and mesophyll cells. On the contrary, plant growth, growth-promoting gene expression, and the physiological consequence changed little in response to the Hpa1 delta NT treatment. These analyses suggest that Hpa1 requires the nitroxyl-terminus to facilitate CO2 transport inside leaf cells and promote leaf photosynthesis and vegetative growth of the plant.

Promoter reuse in prokaryotes

NARCIS (Netherlands)

Nijveen, H.; Matus-Garcia, M.; Passel, van M.W.J.

2012-01-01

Anecdotal evidence shows promoters being reused separate from their downstream gene, thus providing a mechanism for the efficient and rapid rewiring of a gene’s transcriptional regulation. We have identified over 4000 groups of highly similar promoters using a conservative sequence similarity search

Comparison of multi-echo and single-echo gradient-recalled echo sequences for SPIO-enhanced Liver MRI at 3 T

International Nuclear Information System (INIS)

Choi, J.S.; Kim, M.-J.; Kim, J.H.; Choi, J.-Y.; Chung, Y.E.; Park, M.-S.; Kim, K.W.

2010-01-01

Aim: To assess the utility of a T2*-weighted, multi-echo data imaging combination sequenced on superparamagnetic iron oxide (SPIO)-enhanced liver magnetic resonance imaging (MRI) using a 3 T system. Materials and methods: Fifty patients underwent SPIO-enhanced MRI at 3 T using T2*-weighted, single-echo, gradient-recalled echo (GRE) sequences [fast imaging with steady precession; repetition time (TR)/echo time (TE), 126 ms/9 ms; flip angle, 30 o ] and multi-echo GRE (multi-echo data image combination) sequences (TR/TE, 186 ms/9 ms; flip angle, 30 o ). Three radiologists independently reviewed the images in a random order. The sensitivity and accuracy for the detection of focal hepatic lesions (a total of 76 lesions in 33 patients; 48 solid lesions, 28 non-solid lesions) were compared by analysing the area under the receiver operating characteristic curves. Image artefacts (flow artefacts, susceptibility artefacts, dielectric artefacts, and motion artefacts), lesion conspicuity, and overall image quality were evaluated according to a four-point scale: 1, poor; 2, fair; 3, good; 4, excellent. The signal-to-noise ratio (SNR) and contrast-to-noise ratio (CNR) of the lesions were compared. Results: Image artefacts were more frequent with single-echo GRE (p < 0.05). The mean scale of image quality assessment for flow, susceptibility, dielectric, and motion artefacts were 2.76, 3.13, 3.42, and 2.89 with singe-echo, respectively, compared with 3.47, 3.43, 3.47, and 3.39, respectively, with multi-echo GRE. There was no significant difference in lesion conspicuity between single-echo (3.15) and multi-echo (3.30) GRE sequences. The overall image quality was significantly (p < 0.05) better with multi-echo (3.37) than with single-echo GRE (2.89). The mean SNR and CNR of the lesions were significantly (p < 0.05) higher on multi-echo (79 ± 23 and 128 ± 59, respectively) images than on single-echo (38 ± 11 and 102 ± 44, respectively) images. Lesion detection accuracy and

Electroacupuncture promotes post-stroke functional recovery via enhancing endogenous neurogenesis in mouse focal cerebral ischemia.

Directory of Open Access Journals (Sweden)

Yu Ri Kim

Full Text Available To investigate the question of whether electroacupuncture (EA promotes functional recovery via enhancement of proliferation and differentiation of neuronal stem cells (NSCs in ischemic stroke, EA stimulation with 2 Hz was applied at bilateral acupoints to Baihui (GV20 and Dazhui (GV14 in middle cerebral artery occlusion (MCAO mice. EA stimulation improved neuromotor function and cognitive ability after ischemic stroke. EA stimulation resulted in an increase in the number of proliferated cells, especially in the subventricular zone (SVZ of the ipsilateral hemisphere. Although a very limited number of NSCs survived and differentiated into neurons or astrocytes, EA treatment resulted in a significant increase in the number of proliferative cells and differentiated cells in the hippocampus and SVZ of the ipsilateral hemisphere compared to MCAO mice. EA stimulation resulted in significantly increased mRNA expression of brain-derived neurotrophic factor (BDNF and vascular endothelial growth factor (VEGF. Protein levels of these factors were confirmed in the ipsilateral hippocampus and SVZ by immunohistochemical and Western blotting analyses. Expression of phosphorylated phosphatidylinositol-3-kinase, BDNF, and VEGF-mediated down-stream were enhanced by EA stimulation in newly formed neuroblasts. These results indicate that EA treatment after ischemic stroke may promote post-stroke functional recovery by enhancement of proliferation and differentiation of NSCs via the BDNF and VEGF signaling pathway.

Ultrasensitive DNA sequence detection using nanoscale ZnO sensor arrays

Energy Technology Data Exchange (ETDEWEB)

Kumar, Nitin; Dorfman, Adam; Hahm, Jong-in [Department of Chemical Engineering, Pennsylvania State University, 160 Fenske Laboratory, University Park, PA 16802 (United States)

2006-06-28

We report that engineered nanoscale zinc oxide structures can be effectively used for the identification of the biothreat agent, Bacillus anthracis by successfully discriminating its DNA sequence from other genetically related species. We explore both covalent and non-covalent linking schemes in order to couple probe DNA strands to the zinc oxide nanostructures. Hybridization reactions are performed with various concentrations of target DNA strands whose sequence is unique to Bacillus anthracis. The use of zinc oxide nanomaterials greatly enhances the fluorescence signal collected after carrying out duplex formation reaction. Specifically, the covalent strategy allows detection of the target species at sample concentrations at a level as low as a few femtomolar as compared to the detection sensitivity in the tens of nanomolar range when using the non-covalent scheme. The presence of the underlying zinc oxide nanomaterials is critical in achieving increased fluorescence detection of hybridized DNA and, therefore, accomplishing rapid and extremely sensitive identification of the biothreat agent. We also demonstrate the easy integration potential of nanoscale zinc oxide into high density arrays by using various types of zinc oxide sensor prototypes in the DNA sequence detection. When combined with conventional automatic sample handling apparatus and computerized fluorescence detection equipment, our approach can greatly promote the use of zinc oxide nanomaterials as signal enhancing platforms for rapid, multiplexed, high-throughput, highly sensitive, DNA sensor arrays.

Ultrasensitive DNA sequence detection using nanoscale ZnO sensor arrays

International Nuclear Information System (INIS)

Kumar, Nitin; Dorfman, Adam; Hahm, Jong-in

2006-01-01

We report that engineered nanoscale zinc oxide structures can be effectively used for the identification of the biothreat agent, Bacillus anthracis by successfully discriminating its DNA sequence from other genetically related species. We explore both covalent and non-covalent linking schemes in order to couple probe DNA strands to the zinc oxide nanostructures. Hybridization reactions are performed with various concentrations of target DNA strands whose sequence is unique to Bacillus anthracis. The use of zinc oxide nanomaterials greatly enhances the fluorescence signal collected after carrying out duplex formation reaction. Specifically, the covalent strategy allows detection of the target species at sample concentrations at a level as low as a few femtomolar as compared to the detection sensitivity in the tens of nanomolar range when using the non-covalent scheme. The presence of the underlying zinc oxide nanomaterials is critical in achieving increased fluorescence detection of hybridized DNA and, therefore, accomplishing rapid and extremely sensitive identification of the biothreat agent. We also demonstrate the easy integration potential of nanoscale zinc oxide into high density arrays by using various types of zinc oxide sensor prototypes in the DNA sequence detection. When combined with conventional automatic sample handling apparatus and computerized fluorescence detection equipment, our approach can greatly promote the use of zinc oxide nanomaterials as signal enhancing platforms for rapid, multiplexed, high-throughput, highly sensitive, DNA sensor arrays

Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

International Nuclear Information System (INIS)

Depto, A.S.; Stenberg, R.M.

1989-01-01

To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene

Music and Sign Language to Promote Infant and Toddler Communication and Enhance Parent-Child Interaction

Science.gov (United States)

Colwell, Cynthia; Memmott, Jenny; Meeker-Miller, Anne

2014-01-01

The purpose of this study was to determine the efficacy of using music and/or sign language to promote early communication in infants and toddlers (6-20 months) and to enhance parent-child interactions. Three groups used for this study were pairs of participants (care-giver(s) and child) assigned to each group: 1) Music Alone 2) Sign Language…

Recognition of prokaryotic and eukaryotic promoters using convolutional deep learning neural networks

KAUST Repository

Umarov, Ramzan

2017-02-03

Accurate computational identification of promoters remains a challenge as these key DNA regulatory regions have variable structures composed of functional motifs that provide gene-specific initiation of transcription. In this paper we utilize Convolutional Neural Networks (CNN) to analyze sequence characteristics of prokaryotic and eukaryotic promoters and build their predictive models. We trained a similar CNN architecture on promoters of five distant organisms: human, mouse, plant (Arabidopsis), and two bacteria (Escherichia coli and Bacillus subtilis). We found that CNN trained on sigma70 subclass of Escherichia coli promoter gives an excellent classification of promoters and non-promoter sequences (Sn = 0.90, Sp = 0.96, CC = 0.84). The Bacillus subtilis promoters identification CNN model achieves Sn = 0.91, Sp = 0.95, and CC = 0.86. For human, mouse and Arabidopsis promoters we employed CNNs for identification of two well-known promoter classes (TATA and non-TATA promoters). CNN models nicely recognize these complex functional regions. For human promoters Sn/Sp/CC accuracy of prediction reached 0.95/0.98/0,90 on TATA and 0.90/0.98/0.89 for non-TATA promoter sequences, respectively. For Arabidopsis we observed Sn/Sp/CC 0.95/0.97/0.91 (TATA) and 0.94/0.94/0.86 (non-TATA) promoters. Thus, the developed CNN models, implemented in CNNProm program, demonstrated the ability of deep learning approach to grasp complex promoter sequence characteristics and achieve significantly higher accuracy compared to the previously developed promoter prediction programs. We also propose random substitution procedure to discover positionally conserved promoter functional elements. As the suggested approach does not require knowledge of any specific promoter features, it can be easily extended to identify promoters and other complex functional regions in sequences of many other and especially newly sequenced genomes. The CNNProm program is available to run at web server http://www.softberry.com.

Natural selection promotes antigenic evolvability.

Science.gov (United States)

Graves, Christopher J; Ros, Vera I D; Stevenson, Brian; Sniegowski, Paul D; Brisson, Dustin

2013-01-01

The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed 'cassettes' that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios) and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish chronic infections.

Natural selection promotes antigenic evolvability.

Directory of Open Access Journals (Sweden)

Christopher J Graves

Full Text Available The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed 'cassettes' that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

Science.gov (United States)

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

Science.gov (United States)

Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

1998-06-01

Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

3D Whole-Heart Coronary MR Angiography at 1.5T in Healthy Volunteers: Comparison between Unenhanced SSFP and Gd-Enhanced FLASH Sequences

International Nuclear Information System (INIS)

Gweon, Hye Mi; Kim, Sang Jin; Lee, Sang Min; Hong, Yoo Jin; Kim, Tae Hoon

2011-01-01

To validate the optimal cardiac phase and appropriate acquisition window for three-dimensional (3D) whole-heart coronary magnetic resonance angiography (MRA) with a steady-state free precession (SSFP) sequence, and to compare image quality between SSFP and Gd-enhanced fast low-angle shot (FLASH) MR techniques at 1.5 Tesla (T). Thirty healthy volunteers (M:F 25:5; mean age, 35 years; range, 24-54 years) underwent a coronary MRA at 1.5T. 3D whole-heart coronary MRA with an SSFP was performed at three different times: 1) at end-systole with a narrow (120-msec) acquisition window (ESN), 2) mid-diastole with narrow acquisition (MDN); and 3) mid-diastole with wide (170-msec) acquisition (MDW). All volunteers underwent a contrast enhanced coronary MRA after undergoing an unenhanced 3D true fast imaging with steady-state precession (FISP) MRA three times. A contrast enhanced coronary MRA with FLASH was performed during MDN. Visibility of the coronary artery and image quality were evaluated for 11 segments, as suggested by the American Heart Association. Image quality was scored by a five-point scale (1 = not visible to 5 = excellent). The signal-to-noise ratio (SNR) and contrast-to-noise ratio (CNR) were evaluated at the proximal coronary arteries. The SSFP sequence rendered higher visibility coronary segments, higher image quality, as well as higher SNR and CNR than the Gd-enhanced FLASH technique at 1.5T (p < 0.05). The visibility of coronary segments, image quality, SNR and CNR in the ESN, MDN and MDW with SSFP sequence did not differ significantly. An SSFP sequence provides an excellent method for the 3D whole-heart coronary MRA at 1.5T. Contrast enhanced coronary MRA using the FLASH sequence does not help improve the visibility of coronary segments, image quality, SNR or CNR on the 3D whole-heart coronary MRA.

Endothelial cell SHP-2 negatively regulates neutrophil adhesion and promotes transmigration by enhancing ICAM-1-VE-cadherin interaction.

Science.gov (United States)

Yan, Meiping; Zhang, Xinhua; Chen, Ao; Gu, Wei; Liu, Jie; Ren, Xiaojiao; Zhang, Jianping; Wu, Xiaoxiong; Place, Aaron T; Minshall, Richard D; Liu, Guoquan

2017-11-01

Intercellular adhesion molecule-1 (ICAM-1) mediates the firm adhesion of leukocytes to endothelial cells and initiates subsequent signaling that promotes their transendothelial migration (TEM). Vascular endothelial (VE)-cadherin plays a critical role in endothelial cell-cell adhesion, thereby controlling endothelial permeability and leukocyte transmigration. This study aimed to determine the molecular signaling events that originate from the ICAM-1-mediated firm adhesion of neutrophils that regulate VE-cadherin's role as a negative regulator of leukocyte transmigration. We observed that ICAM-1 interacts with Src homology domain 2-containing phosphatase-2 (SHP-2), and SHP-2 down-regulation via silencing of small interfering RNA in endothelial cells enhanced neutrophil adhesion to endothelial cells but inhibited neutrophil transmigration. We also found that VE-cadherin associated with the ICAM-1-SHP-2 complex. Moreover, whereas the activation of ICAM-1 leads to VE-cadherin dissociation from ICAM-1 and VE-cadherin association with actin, SHP-2 down-regulation prevented ICAM-1-VE-cadherin association and promoted VE-cadherin-actin association. Furthermore, SHP-2 down-regulation in vivo promoted LPS-induced neutrophil recruitment in mouse lung but delayed neutrophil extravasation. These results suggest that SHP-2- via association with ICAM-1-mediates ICAM-1-induced Src activation and modulates VE-cadherin switching association with ICAM-1 or actin, thereby negatively regulating neutrophil adhesion to endothelial cells and enhancing their TEM.-Yan, M., Zhang, X., Chen, A., Gu, W., Liu, J., Ren, X., Zhang, J., Wu, X., Place, A. T., Minshall, R. D., Liu, G. Endothelial cell SHP-2 negatively regulates neutrophil adhesion and promotes transmigration by enhancing ICAM-1-VE-cadherin interaction. © FASEB.

Application of magnetic OMS-2 in sequencing batch reactor for treating dye wastewater as a modulator of microbial community.

Science.gov (United States)

Pan, Fei; Yu, Yang; Xu, Aihua; Xia, Dongsheng; Sun, Youmin; Cai, Zhengqing; Liu, Wen; Fu, Jie

2017-10-15

The potential and mechanism of synthesized magnetic octahedral molecular sieve (Fe 3 O 4 @OMS-2) nanoparticles in enhancing the aerobic microbial ability of sequencing batch reactor (SBR) for treating dye wastewater have been revealed in this study. The addition of Fe 3 O 4 @OMS-2 of 0.25g/L enhanced the decolorization of SBRs with an operation cycle of 24h by more than 20%. The 16S rRNA gene high-throughput sequencing indicated Fe 3 O 4 @OMS-2 increased the microbial richness and diversity of SBRs, and more importantly, promoted the potential dye-degrading bacteria. After a series of enriching and screening, four bacterial strains with the considerable decolorizing ability were isolated from SBRs, designating Alcaligenes faecalis FP-G1, Bacillus aryabhattai FP-F1, Escherichia fergusonii FP-D1 and Rhodococcus ruber FP-E1, respectively. The growth and decolorization of these pure strains were promoted in the presence of Fe 3 O 4 @OMS-2, which agrees with the result of high-throughput sequencing. Monitoring dissolved Fe/Mn ions and investigating the change of oxidation states of Fe/Mn species discovered OMS-2 composition played the critical role in modulating the microbial community. The significant enhancement of Mn-oxidizing/-reducing bacteria suggested microbial Mn redox may be the key action mechanism of Fe 3 O 4 @OMS-2, which can provide numerous benefits for the microbial community and decolorization of SBRs. Copyright © 2017 Elsevier B.V. All rights reserved.

Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

International Nuclear Information System (INIS)

Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J.

1988-01-01

Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5' flanking region of the gene revealed a perfect TATA box at position -28 to position -23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5' flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk - fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides -305 and +75 of the plasminogen activator inhibitor type 1 gene

Salivary protein histatin 3 regulates cell proliferation by enhancing p27{sup Kip1} and heat shock cognate protein 70 ubiquitination

Energy Technology Data Exchange (ETDEWEB)

Imamura, Yasuhiro, E-mail: yimamura@po.mdu.ac.jp [Department of Pharmacology, Matsumoto Dental University, Shiojiri, Nagano 399-0781 (Japan); Wang, Pao-Li [Department of Bacteriology, Osaka Dental University, Hirakata, Osaka 573-1121 (Japan); Masuno, Kazuya [Department of Dental Education Innovation, Osaka Dental University, Hirakata, Osaka 573-1121 (Japan); Sogawa, Norio [Department of Pharmacology, Matsumoto Dental University, Shiojiri, Nagano 399-0781 (Japan)

2016-02-05

Histatins are salivary proteins with antimicrobial activities. We previously reported that histatin 3 binds to heat shock cognate protein 70 (HSC70), which is constitutively expressed, and induces DNA synthesis stimulation and promotes human gingival fibroblast (HGF) survival. However, the underlying mechanisms of histatin 3 remain largely unknown. Here, we found that the KRHH sequence of histatin 3 at the amino acid positions 5–8 was essential for enhancing p27{sup Kip1} (a cyclin-dependent kinase inhibitor) binding to HSC70 that occurred in a dose-dependent manner; histatin 3 enhanced the binding between p27{sup Kip1} and HSC70 during the G{sub 1}/S transition of HGFs as opposed to histatin 3-M(5–8) (substitution of KRHH for EEDD in histatin 3). Histatin 3, but not histatin 3-M(5–8), stimulated DNA synthesis and promoted HGF survival. Histatin 3 dose-dependently enhanced both p27{sup Kip1} and HSC70 ubiquitination, whereas histatin 3-M(5–8) did not. These findings provide further evidence that histatin 3 may be involved in the regulation of cell proliferation, particularly during G{sub 1}/S transition, via the ubiquitin–proteasome system of p27{sup Kip1} and HSC70. - Highlights: • KRHH amino acid sequence was required in histatin 3 to bind HSC70. • Histatin 3 enhanced HSC70 binding to p27{sup Kip1} during the G{sub 1}/S transition in HGFs. • KRHH sequence stimulated DNA synthesis and promoted cell survival. • Histatin 3 dose-dependently enhanced both p27{sup Kip1} and HSC70 ubiquitination. • Histatin 3 stimulates cell proliferation via the ubiquitin–proteasome system.

Sequence-based classification and identification of Fungi.

Science.gov (United States)

Hibbett, David; Abarenkov, Kessy; Kõljalg, Urmas; Öpik, Maarja; Chai, Benli; Cole, James; Wang, Qiong; Crous, Pedro; Robert, Vincent; Helgason, Thorunn; Herr, Joshua R; Kirk, Paul; Lueschow, Shiloh; O'Donnell, Kerry; Nilsson, R Henrik; Oono, Ryoko; Schoch, Conrad; Smyth, Christopher; Walker, Donald M; Porras-Alfaro, Andrea; Taylor, John W; Geiser, David M

Fungal taxonomy and ecology have been revolutionized by the application of molecular methods and both have increasing connections to genomics and functional biology. However, data streams from traditional specimen- and culture-based systematics are not yet fully integrated with those from metagenomic and metatranscriptomic studies, which limits understanding of the taxonomic diversity and metabolic properties of fungal communities. This article reviews current resources, needs, and opportunities for sequence-based classification and identification (SBCI) in fungi as well as related efforts in prokaryotes. To realize the full potential of fungal SBCI it will be necessary to make advances in multiple areas. Improvements in sequencing methods, including long-read and single-cell technologies, will empower fungal molecular ecologists to look beyond ITS and current shotgun metagenomics approaches. Data quality and accessibility will be enhanced by attention to data and metadata standards and rigorous enforcement of policies for deposition of data and workflows. Taxonomic communities will need to develop best practices for molecular characterization in their focal clades, while also contributing to globally useful datasets including ITS. Changes to nomenclatural rules are needed to enable validPUBLICation of sequence-based taxon descriptions. Finally, cultural shifts are necessary to promote adoption of SBCI and to accord professional credit to individuals who contribute to community resources.

The architecture of mammalian ribosomal protein promoters

Directory of Open Access Journals (Sweden)

Perry Robert P

2005-02-01

Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection.

Science.gov (United States)

Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike; Khan, Arifa S

2018-01-01

developed a new reference viral database (RVDB) that provides a broad representation of different virus species from eukaryotes by including all viral, virus-like, and virus-related sequences (excluding bacteriophages), regardless of their size. In particular, RVDB contains endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Sequences were clustered to reduce redundancy while retaining high viral sequence diversity. A particularly useful feature of RVDB is the reduction of cellular sequences, which can enhance the run efficiency of large transcriptomic and genomic data analysis and increase the specificity of virus detection.

GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states.

Directory of Open Access Journals (Sweden)

Rachel Herndon Klein

2017-04-01

Full Text Available Transcription factor binding, chromatin modifications and large scale chromatin re-organization underlie progressive, irreversible cell lineage commitments and differentiation. We know little, however, about chromatin changes as cells enter transient, reversible states such as migration. Here we demonstrate that when human progenitor keratinocytes either differentiate or migrate they form complements of typical enhancers and super-enhancers that are unique for each state. Unique super-enhancers for each cellular state link to gene expression that confers functions associated with the respective cell state. These super-enhancers are also enriched for skin disease sequence variants. GRHL3, a transcription factor that promotes both differentiation and migration, binds preferentially to super-enhancers in differentiating keratinocytes, while during migration, it binds preferentially to promoters along with REST, repressing the expression of migration inhibitors. Key epidermal differentiation transcription factor genes, including GRHL3, are located within super-enhancers, and many of these transcription factors in turn bind to and regulate super-enhancers. Furthermore, GRHL3 represses the formation of a number of progenitor and non-keratinocyte super-enhancers in differentiating keratinocytes. Hence, chromatin relocates GRHL3 binding and enhancers to regulate both the irreversible commitment of progenitor keratinocytes to differentiation and their reversible transition to migration.

Functionalization of CoCr surfaces with cell adhesive peptides to promote HUVECs adhesion and proliferation

Energy Technology Data Exchange (ETDEWEB)

Castellanos, Maria Isabel, E-mail: maria.isabel.castellanos@upc.edu [Biomaterials, Biomechanics and Tissue Engineering Group, Department of Materials Science and Metallurgical Engineering, Technical University of Catalonia (UPC), ETSEIB, 08028 Barcelona (Spain); Centre for Research in Nanoengineering (CRNE), UPC, 08028 Barcelona (Spain); Mas-Moruno, Carlos, E-mail: carles.mas.moruno@upc.edu [Biomaterials, Biomechanics and Tissue Engineering Group, Department of Materials Science and Metallurgical Engineering, Technical University of Catalonia (UPC), ETSEIB, 08028 Barcelona (Spain); Centre for Research in Nanoengineering (CRNE), UPC, 08028 Barcelona (Spain); Grau, Anna, E-mail: agraugar@gmail.com [Biomaterials, Biomechanics and Tissue Engineering Group, Department of Materials Science and Metallurgical Engineering, Technical University of Catalonia (UPC), ETSEIB, 08028 Barcelona (Spain); Centre for Research in Nanoengineering (CRNE), UPC, 08028 Barcelona (Spain); Serra-Picamal, Xavier, E-mail: xserrapicamal@gmail.com [Institute for Bioengineering of Catalonia (IBEC), 08028 Barcelona (Spain); University of Barcelona and CIBER-BBN, 08036 Barcelona (Spain); Institució Catalana de Recerca i Estudis Avançats (ICREA), 08010 Barcelona (Spain); Trepat, Xavier, E-mail: xtrepat@ub.edu [Institute for Bioengineering of Catalonia (IBEC), 08028 Barcelona (Spain); University of Barcelona and CIBER-BBN, 08036 Barcelona (Spain); Institució Catalana de Recerca i Estudis Avançats (ICREA), 08010 Barcelona (Spain); Albericio, Fernando, E-mail: fernando.albericio@irbbarcelona.org [Department of Chemistry, University of Barcelona, CIBER-BBN, 08028 Barcelona (Spain); Joner, Michael, E-mail: michaeljoner@me.com [Department of Cardiology, Deutsches Herzzentrum München, 80636 Munich (Germany); CVPath Institute, Gaithersburg, MD 20878 (United States); and others

2017-01-30

Highlights: • We immobilized peptides on CoCr alloy through physisorption and covalent bonding. • Surface activation is an essential step prior to silanization to enhance peptide attachment. • Biofunctionalized surface characteristics were discussed. • RGDS, YIGSR and combination peptides display an improved HUVECs adhesion and proliferation. - Abstract: Biomimetic surface modification with peptides that have specific cell-binding moieties is a promising approach to improve endothelialization of metal-based stents. In this study, we functionalized CoCr surfaces with RGDS, REDV, YIGSR peptides and their combinations to promote endothelial cells (ECs) adhesion and proliferation. An extensive characterization of the functionalized surfaces was performed by XPS analysis, surface charge and quartz crystal microbalance with dissipation monitoring (QCM-D), which demonstrated the successful immobilization of the peptides to the surface. Cell studies demonstrated that the covalent functionalization of CoCr surfaces with an equimolar combination of RGDS and YIGSR represents the most powerful strategy to enhance the early stages of ECs adhesion and proliferation, indicating a positive synergistic effect between the two peptide motifs. Although these peptide sequences slightly increased smooth muscle cells (SMCs) adhesion, these values were ten times lower than those observed for ECs. The combination of RGDS with the REDV sequence did not show synergistic effects in promoting the adhesion or proliferation of ECs. The strategy presented in this study holds great potential to overcome clinical limitations of current metal stents by enhancing their capacity to support surface endothelialization.

Violation of an evolutionarily conserved immunoglobulin diversity gene sequence preference promotes production of dsDNA-specific IgG antibodies.

Directory of Open Access Journals (Sweden)

Aaron Silva-Sanchez

Full Text Available Variability in the developing antibody repertoire is focused on the third complementarity determining region of the H chain (CDR-H3, which lies at the center of the antigen binding site where it often plays a decisive role in antigen binding. The power of VDJ recombination and N nucleotide addition has led to the common conception that the sequence of CDR-H3 is unrestricted in its variability and random in its composition. Under this view, the immune response is solely controlled by somatic positive and negative clonal selection mechanisms that act on individual B cells to promote production of protective antibodies and prevent the production of self-reactive antibodies. This concept of a repertoire of random antigen binding sites is inconsistent with the observation that diversity (DH gene segment sequence content by reading frame (RF is evolutionarily conserved, creating biases in the prevalence and distribution of individual amino acids in CDR-H3. For example, arginine, which is often found in the CDR-H3 of dsDNA binding autoantibodies, is under-represented in the commonly used DH RFs rearranged by deletion, but is a frequent component of rarely used inverted RF1 (iRF1, which is rearranged by inversion. To determine the effect of altering this germline bias in DH gene segment sequence on autoantibody production, we generated mice that by genetic manipulation are forced to utilize an iRF1 sequence encoding two arginines. Over a one year period we collected serial serum samples from these unimmunized, specific pathogen-free mice and found that more than one-fifth of them contained elevated levels of dsDNA-binding IgG, but not IgM; whereas mice with a wild type DH sequence did not. Thus, germline bias against the use of arginine enriched DH sequence helps to reduce the likelihood of producing self-reactive antibodies.

Functional and structural analysis of the DNA sequence conferring glucocorticoid inducibility to the mouse mammary tumor virus gene

International Nuclear Information System (INIS)

Skroch, P.

1987-05-01

In the first part of my thesis I show that the DNA element conferring glucocorticoid inducibility to the Mouse Mammary Tumor Virus (HRE) has enhancer properties. It activates a heterologous promoter - that of the β-globin gene, independently of distance, position and orientation. These properties however have to be regarded in relation to the remaining regulatory elements of the activated gene as the recombinants between HRE and the TK gene have demonstrated. In the second part of my thesis I investigated the biological significance of certain sequence motifs of the HRE, which are remarkable by their interaction with transacting factors or sequence homologies with other regulatory DNA elements. I could confirm the generally postulated modular structure of enhancers for the HRE and bring the relevance of the single subdomains for the function of the element into relationship. (orig.) [de

DNA structure in human RNA polymerase II promoters

DEFF Research Database (Denmark)

Pedersen, Anders Gorm; Baldi, Pierre; Chauvin, Yves

1998-01-01

with a very low level of sequence similarity. The sequences, which include both TATA-containing and TATA-less promoters, are aligned by hidden Markov models. Using three different models of sequence-derived DNA bendability, the aligned promoters display a common structural profile with bendability being low...... protein in a manner reminiscent of DNA in a nucleosome. This notion is further supported by the finding that the periodic bendability is caused mainly by the complementary triplet pairs CAG/CTG and GGC/GCC, which previously have been found to correlate with nucleosome positioning. We present models where......The fact that DNA three-dimensional structure is important for transcriptional regulation begs the question of whether eukaryotic promoters contain general structural features independently of what genes they control. We present an analysis of a large set of human RNA polymerase II promoters...

Quantitative assessment of hepatic function: modified look-locker inversion recovery (MOLLI) sequence for T1 mapping on Gd-EOB-DTPA-enhanced liver MR imaging

Energy Technology Data Exchange (ETDEWEB)

Yoon, Jeong Hee [Seoul National University Hospital, Department of Radiology, Seoul (Korea, Republic of); Lee, Jeong Min; Han, Joon Koo; Choi, Byung Ihn [Seoul National University Hospital, Department of Radiology, Seoul (Korea, Republic of); Seoul National University College of Medicine, Institute of Radiation Medicine, Jongno-gu, Seoul (Korea, Republic of); Paek, Munyoung [Siemens Healthcare, Seoul (Korea, Republic of)

2016-06-15

To determine whether multislice T1 mapping of the liver using a modified look-locker inversion recovery (MOLLI) sequence on gadoxetic acid-enhanced magnetic resonance imaging (MRI) can be used as a quantitative tool to estimate liver function and predict the presence of oesophageal or gastric varices. Phantoms filled with gadoxetic acid were scanned three times using MOLLI sequence to test repeatability. Patients with chronic liver disease or liver cirrhosis who underwent gadoxetic acid-enhanced liver MRI including MOLLI sequence at 3 T were included (n = 343). Pre- and postcontrast T1 relaxation times of the liver (T1liver), changes between pre- and postcontrast T1liver (ΔT1liver), and adjusted postcontrast T1liver (postcontrast T1liver-T1spleen/T1spleen) were compared among Child-Pugh classes. In 62 patients who underwent endoscopy, all T1 parameters and spleen sizes were correlated with varices. Phantom study showed excellent repeatability of MOLLI sequence. As Child-Pugh scores increased, pre- and postcontrast T1liver were significantly prolonged (P < 0.001), and ΔT1liver and adjusted postcontrast T1liver decreased (P< 0.001). Adjusted postcontrast T1liver and spleen size were independently associated with varices (R{sup 2} = 0.29, P < 0.001). T1 mapping of the liver using MOLLI sequence on gadoxetic acid-enhanced MRI demonstrated potential in quantitatively estimating liver function, and adjusted postcontrast T1liver was significantly associated with varices. (orig.)

Comparison of different magnetic resonance cholangiography techniques in living liver donors including Gd-EOB-DTPA enhanced T1-weighted sequences.

Directory of Open Access Journals (Sweden)

Sonja Kinner

Full Text Available Preoperative evaluation of potential living liver donors (PLLDs includes the assessment of the biliary anatomy to avoid postoperative complications. Aim of this study was to compare T2-weighted (T2w and Gd-EOB-DTPA enhanced T1-weighted (T1w magnetic resonance cholangiography (MRC techniques in the evaluation of PLLDs.30 PLLDs underwent MRC on a 1.5 T Magnetom Avanto (Siemens, Erlangen, Germany using (A 2D T2w HASTE (Half Fourier Acquisition Single Shot Turbo Spin Echo fat saturated (fs in axial plane, (B 2D T2w HASTE fs thick slices in coronal plane, (C free breathing 3D T2w TSE (turbo spin echo RESTORE (high-resolution navigator corrected plus (D maximum intensity projections (MIPs, (E T2w SPACE (sampling perfection with application optimized contrasts using different flip angle evolutions plus (F MIPs and (G T2w TSE BLADE as well as Gd-EOB-DTPA T1w images without (G and with (H inversion recovery. Contrast enhanced CT cholangiography served as reference imaging modality. Two independent reviewers evaluated the biliary tract anatomy on a 5-point scale subjectively and objectively. Data sets were compared using a Mann-Whitney-U-test. Kappa values were also calculated.Source images and maximum intensity projections of 3D T2w TSE sequences (RESTORE and SPACE proved to be best for subjective and objective evaluation directly followed by 2D HASTE sequences. Interobserver variabilities were good to excellent (k = 0.622-0.804.3D T2w sequences are essential for preoperative biliary tract evaluation in potential living liver donors. Furthermore, our results underline the value of different MRCP sequence types for the evaluation of the biliary anatomy in PLLDs including Gd-EOB-DTPA enhanced T1w MRC.

WeederH: an algorithm for finding conserved regulatory motifs and regions in homologous sequences

Directory of Open Access Journals (Sweden)

Pesole Graziano

2007-02-01

Full Text Available Abstract Background This work addresses the problem of detecting conserved transcription factor binding sites and in general regulatory regions through the analysis of sequences from homologous genes, an approach that is becoming more and more widely used given the ever increasing amount of genomic data available. Results We present an algorithm that identifies conserved transcription factor binding sites in a given sequence by comparing it to one or more homologs, adapting a framework we previously introduced for the discovery of sites in sequences from co-regulated genes. Differently from the most commonly used methods, the approach we present does not need or compute an alignment of the sequences investigated, nor resorts to descriptors of the binding specificity of known transcription factors. The main novel idea we introduce is a relative measure of conservation, assuming that true functional elements should present a higher level of conservation with respect to the rest of the sequence surrounding them. We present tests where we applied the algorithm to the identification of conserved annotated sites in homologous promoters, as well as in distal regions like enhancers. Conclusion Results of the tests show how the algorithm can provide fast and reliable predictions of conserved transcription factor binding sites regulating the transcription of a gene, with better performances than other available methods for the same task. We also show examples on how the algorithm can be successfully employed when promoter annotations of the genes investigated are missing, or when regulatory sites and regions are located far away from the genes.

Composing a Tumor Specific Bacterial Promoter.

Directory of Open Access Journals (Sweden)

Igor V Deyneko

Full Text Available Systemically applied Salmonella enterica spp. have been shown to invade and colonize neoplastic tissues where it retards the growth of many tumors. This offers the possibility to use the bacteria as a vehicle for the tumor specific delivery of therapeutic molecules. Specificity of such delivery is solely depending on promoter sequences that control the production of a target molecule. We have established the functional structure of bacterial promoters that are transcriptionally active exclusively in tumor tissues after systemic application. We observed that the specific transcriptional activation is accomplished by a combination of a weak basal promoter and a strong FNR binding site. This represents a minimal set of control elements required for such activation. In natural promoters, additional DNA remodeling elements are found that alter the level of transcription quantitatively. Inefficiency of the basal promoter ensures the absence of transcription outside tumors. As a proof of concept, we compiled an artificial promoter sequence from individual motifs representing FNR and basal promoter and showed specific activation in a tumor microenvironment. Our results open possibilities for the generation of promoters with an adjusted level of expression of target proteins in particular for applications in bacterial tumor therapy.

Cerebral staging of lung cancer: is one single contrast-enhanced T1-weighted three-dimensional gradient-echo sequence sufficient?

Energy Technology Data Exchange (ETDEWEB)

Ohana, Mickael; Jeung, Mi-Young; Roy, Catherine [Nouvel Hopital Civil-Hopitaux Universitaires de Strasbourg, Service de Radiologie B/Radiology Department, Strasbourg (France); Bazille, Gauthier [Clinique Saint Anne-Groupe Radiologique MIM, Strasbourg (France)

2014-08-15

Gadolinium-enhanced magnetic resonance imaging (MRI) is the gold standard for cerebral staging in thoracic oncology. We hypothesize that a minimalist examination, consisting of a single contrast-enhanced T1-weighted three-dimensional gradient-echo sequence (CE 3D-GRE), would be sufficient for the cerebral staging of nonsymptomatic lung cancer patients. Seventy nonsymptomatic patients (50 % men; 62 years ± 10.2) referred for cerebral staging of a lung cancer were retrospectively included. All underwent a standard 3 T MRI examination with T1, FLAIR, T2* GRE, diffusion, and CE 3D-GRE sequences, for a total examination time of 20 min. The sole CE 3D-GRE (acquisition time: 6 min) was extracted and blindly interpreted by two radiologists in search of brain metastases. Hemorrhagic features of potential lesions and relevant incidental findings were also noted. Discrepant cases were reviewed by a third reader. The full MRI examination and follow-up studies were used as a reference to calculate sensitivity and specificity of the sole CE 3D-GRE. Thirty-eight point six percent (27 out of 70) of the patients had brain metastases. Performances and reader's agreement with the sole CE 3D-GRE sequence were excellent for the diagnosis of brain metastases (sensitivity = 96.3 %, specificity = 100 %, κ = 0.91) and incidental findings (sensitivity = 85.7 %, specificity = 100 %, κ = 0.62) but insufficient for the identification of hemorrhages within the metastases (sensitivity = 33.3 %, specificity = 85.7 %, κ = 0.47). In the specific case of lung cancer, cerebral staging in nonsymptomatic patients can be efficiently achieved with a minimalistic protocol consisting of a single CE 3D-GRE sequence, completed if positive with a T2* sequence for hemorrhagic assessment, thus halving appointment delays. (orig.)

An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

Science.gov (United States)

Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

2006-07-01

This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

The promoter of the pepper pathogen-induced membrane protein gene CaPIMP1 mediates environmental stress responses in plants.

Science.gov (United States)

Hong, Jeum Kyu; Hwang, Byung Kook

2009-01-01

The promoter of the pepper pathogen-induced membrane protein gene CaPIMP1 was analyzed by an Agrobacterium-mediated transient expression assay in tobacco leaves. Several stress-related cis-acting elements (GT-1, W-box and ABRE) are located within the CaPIMP1 promoter. In tobacco leaf tissues transiently transformed with a CaPIMP1 promoter-beta-glucuronidase (GUS) gene fusion, serially 5'-deleted CaPIMP1 promoters were differentially activated by Pseudomonas syringae pv. tabaci, ethylene, methyl jasmonate, abscisic acid, and nitric oxide. The -1,193 bp region of the CaPIMP1 gene promoter sequence exhibited full promoter activity. The -417- and -593 bp promoter regions were sufficient for GUS gene activation by ethylene and methyl jasmonate treatments, respectively. However, CaPIMP1 promoter sequences longer than -793 bp were required for promoter activation by abscisic acid and sodium nitroprusside treatments. CaPIMP1 expression was activated in pepper leaves by treatment with ethylene, methyl jasmonate, abscisic acid, beta-amino-n-butyric acid, NaCl, mechanical wounding, and low temperature, but not with salicylic acid. Overexpression of CaPIMP1 in Arabidopsis conferred hypersensitivity to mannitol, NaCl, and ABA during seed germination but not during seedling development. In contrast, transgenic plants overexpressing CaPIMP1 exhibited enhanced tolerance to oxidative stress induced by methyl viologen during germination and early seedling stages. These results suggest that CaPIMP1 expression may alter responsiveness to environmental stress, as well as to pathogen infection.

Mechanical Stretching Promotes Skin Tissue Regeneration via Enhancing Mesenchymal Stem Cell Homing and Transdifferentiation.

Science.gov (United States)

Liang, Xiao; Huang, Xiaolu; Zhou, Yiwen; Jin, Rui; Li, Qingfeng

2016-07-01

Skin tissue expansion is a clinical procedure for skin regeneration to reconstruct cutaneous defects that can be accompanied by severe complications. The transplantation of mesenchymal stem cells (MSCs) has been proven effective in promoting skin expansion and helping to ameliorate complications; however, systematic understanding of its mechanism remains unclear. MSCs from luciferase-Tg Lewis rats were intravenously transplanted into a rat tissue expansion model to identify homing and transdifferentiation. To clarify underlying mechanisms, a systematic approach was used to identify the differentially expressed genes between mechanically stretched human MSCs and controls. The biological significance of these changes was analyzed through bioinformatic methods. We further investigated genes and pathways of interest to disclose their potential role in mechanical stretching-induced skin regeneration. Cross sections of skin samples from the expanded group showed significantly more luciferase(+) and stromal cell-derived factor 1α (SDF-1α)(+), luciferase(+)keratin 14(+), and luciferase(+)CD31(+) cells than the control group, indicating MSC transdifferentiation into epidermal basal cells and endothelial cells after SDF-1α-mediated homing. Microarray analysis suggested upregulation of genes related to hypoxia, vascularization, and cell proliferation in the stretched human MSCs. Further investigation showed that the homing of MSCs was blocked by short interfering RNA targeted against matrix metalloproteinase 2, and that mechanical stretching-induced vascular endothelial growth factor A upregulation was related to the Janus kinase/signal transducer and activator of transcription (Jak-STAT) and Wnt signaling pathways. This study determines that mechanical stretching might promote skin regeneration by upregulating MSC expression of genes related to hypoxia, vascularization, and cell proliferation; enhancing transplanted MSC homing to the expanded skin; and

Is there an added value of T1-weighted contrast-enhanced fat-suppressed spin-echo MR sequences compared to STIR sequences in MRI of the foot and ankle?

Energy Technology Data Exchange (ETDEWEB)

Zubler, Veronika; Zanetti, Marco; Dietrich, Tobias J.; Pfirrmann, Christian W.; Mamisch-Saupe, Nadja [University of Zurich, Faculty of Medicine, Zurich (Switzerland); Orthopedic University Hospital Balgrist, Department of Radiology, Zurich (Switzerland); Espinosa, Norman [University of Zurich, Faculty of Medicine, Zurich (Switzerland); Orthopedic University Hospital Balgrist, Orthopedic Surgery, Zurich (Switzerland)

2017-08-15

To prospectively compare T1-weighted fat-suppressed spin-echo magnetic resonance (MR) sequences after gadolinium application (T1wGdFS) to STIR sequences in patients with acute and chronic foot pain. In 51 patients referred for MRI of the foot and ankle, additional transverse and sagittal T1wGdFS sequences were obtained. Two sets of MR images (standard protocol with STIR or T1wGdFS) were analysed. Diagnosis, diagnostic confidence, and localization of the abnormality were noted. Standard of reference was established by an expert panel of two experienced MSK radiologists and one experienced foot surgeon based on MR images, clinical charts and surgical reports. Patients reported prospectively localization of pain. Descriptive statistics, McNemar test and Kappa test were used. Diagnostic accuracy with STIR protocol was 80% for reader 1, 67% for reader 2, with contrast-protocol 84%, both readers. Significance was found for reader 2. Diagnostic confidence for reader 1 was 1.7 with STIR, 1.3 with contrast-protocol; reader 2: 2.1/1.7. Significance was found for reader 1. Pain location correlated with STIR sequences in 64% and 52%, with gadolinium sequences in 70% and 71%. T1-weighted contrast material-enhanced fat-suppressed spin-echo magnetic resonance sequences improve diagnostic accuracy, diagnostic confidence and correlation of MR abnormalities with pain location in MRI of the foot and ankle. However, the additional value is small. (orig.)

Is there an added value of T1-weighted contrast-enhanced fat-suppressed spin-echo MR sequences compared to STIR sequences in MRI of the foot and ankle?

International Nuclear Information System (INIS)

Zubler, Veronika; Zanetti, Marco; Dietrich, Tobias J.; Pfirrmann, Christian W.; Mamisch-Saupe, Nadja; Espinosa, Norman

2017-01-01

To prospectively compare T1-weighted fat-suppressed spin-echo magnetic resonance (MR) sequences after gadolinium application (T1wGdFS) to STIR sequences in patients with acute and chronic foot pain. In 51 patients referred for MRI of the foot and ankle, additional transverse and sagittal T1wGdFS sequences were obtained. Two sets of MR images (standard protocol with STIR or T1wGdFS) were analysed. Diagnosis, diagnostic confidence, and localization of the abnormality were noted. Standard of reference was established by an expert panel of two experienced MSK radiologists and one experienced foot surgeon based on MR images, clinical charts and surgical reports. Patients reported prospectively localization of pain. Descriptive statistics, McNemar test and Kappa test were used. Diagnostic accuracy with STIR protocol was 80% for reader 1, 67% for reader 2, with contrast-protocol 84%, both readers. Significance was found for reader 2. Diagnostic confidence for reader 1 was 1.7 with STIR, 1.3 with contrast-protocol; reader 2: 2.1/1.7. Significance was found for reader 1. Pain location correlated with STIR sequences in 64% and 52%, with gadolinium sequences in 70% and 71%. T1-weighted contrast material-enhanced fat-suppressed spin-echo magnetic resonance sequences improve diagnostic accuracy, diagnostic confidence and correlation of MR abnormalities with pain location in MRI of the foot and ankle. However, the additional value is small. (orig.)

The whole set of constitutive promoters recognized by RNA polymerase RpoD holoenzyme of Escherichia coli.

Directory of Open Access Journals (Sweden)

Tomohiro Shimada

Full Text Available The promoter selectivity of Escherichia coli RNA polymerase is determined by the sigma subunit with promoter recognition activity. The model prokaryote Escherichia coli contains seven species of the sigma subunit, each recognizing a specific set of promoters. The major sigma subunit, sigma-70 encoded by rpoD, plays a major role in transcription of growth-related genes. Concomitant with the increase in detection of promoters functioning in vivo under various stressful conditions, the variation is expanding in the consensus sequence of RpoD promoters. In order to identify the canonical sequence of "constitutive promoters" that are recognized by the RNA polymerase holoenzyme containing RpoD sigma in the absence of supporting transcription factors, an in vitro mixed transcription assay was carried out using a whole set of variant promoters, each harboring one base replacement, within the model promoter with the conserved -35 and -10 sequences of RpoD promoters. The consensus sequences, TTGACA(-35 and TATAAT(-10, were identified to be ideal for the maximum level of open complex formation and the highest rate of promoter opening, respectively. For identification of the full range of constitutive promoters on the E. coli genome, a total of 2,701 RpoD holoenzyme-binding sites were identified by Genomic SELEX screening, and using the reconfirmed consensus promoter sequence, a total of maximum 669 constitutive promoters were identified, implying that the majority of hitherto identified promoters represents the TF-dependent "inducible promoters". One unique feature of the constitutive promoters is the high level of promoter sequence conservation, about 85% carrying five-out-of-six agreements with -35 or -10 consensus sequence. The list of constitutive promoters provides the community resource toward estimation of the inducible promoters that operate under various stressful conditions in nature.

7 CFR 1215.16 - Promotion.

Science.gov (United States)

2010-01-01

... Promotion. Promotion means any action, including paid advertising, to enhance the image or desirability of... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1215.16 Section 1215.16 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POPCORN PROMOTION, RESEARCH, AND...

Artificial promoter libraries for selected organisms and promoters derived from such libraries

DEFF Research Database (Denmark)

1998-01-01

or organisms may be selected from prokaryotes and from eukaryotes; and in prokaryotes the consensus sequences to be retained most often will comprise the -35 signal (-35 to -30): TTGACA and the -10 signal (-12 to -7): TATAAT or parts of both comprising at least 3 conserved nucleotides of each, while...... in eukaryotes said consensus sequences should comprise a TATA box and at least one upstream activation sequence (UAS). Such artificial promoter libraries can be used i.a. for optimizing the expression of specific genes in various selected organisms....

Regulatory sequence of cupin family gene

Science.gov (United States)

Hood, Elizabeth; Teoh, Thomas

2017-07-25

This invention is in the field of plant biology and agriculture and relates to novel seed specific promoter regions. The present invention further provide methods of producing proteins and other products of interest and methods of controlling expression of nucleic acid sequences of interest using the seed specific promoter regions.

A Peptide Derived from the HIV-1 gp120 Coreceptor-Binding Region Promotes Formation of PAP248-286 Amyloid Fibrils to Enhance HIV-1 Infection.

Directory of Open Access Journals (Sweden)

Jinquan Chen

Full Text Available Semen is a major vehicle for HIV transmission. Prostatic acid phosphatase (PAP fragments, such as PAP248-286, in human semen can form amyloid fibrils to enhance HIV infection. Other endogenous or exogenous factors present during sexual intercourse have also been reported to promote the formation of seminal amyloid fibrils.Here, we demonstrated that a synthetic 15-residue peptide derived from the HIV-1 gp120 coreceptor-binding region, designated enhancing peptide 2 (EP2, can rapidly self-assemble into nanofibers. These EP2-derivated nanofibers promptly accelerated the formation of semen amyloid fibrils by PAP248-286, as shown by Thioflavin T (ThT and Congo red assays. The amyloid fibrils presented similar morphology, assessed via transmission electron microscopy (TEM, in the presence or absence of EP2. Circular dichroism (CD spectroscopy revealed that EP2 accelerates PAP248-286 amyloid fibril formation by promoting the structural transition of PAP248-286 from a random coil into a cross-β-sheet. Newly formed semen amyloid fibrils effectively enhanced HIV-1 infection in TZM-bl cells and U87 cells by promoting the binding of HIV-1 virions to target cells.Nanofibers composed of EP2 promote the formation of PAP248-286 amyloid fibrils and enhance HIV-1 infection.

Multiple regulatory mechanisms of hepatocyte growth factor expression in malignant cells with a short poly(dA) sequence in the HGF gene promoter.

Science.gov (United States)

Sakai, Kazuko; Takeda, Masayuki; Okamoto, Isamu; Nakagawa, Kazuhiko; Nishio, Kazuto

2015-01-01

Hepatocyte growth factor (HGF) expression is a poor prognostic factor in various types of cancer. Expression levels of HGF have been reported to be regulated by shorter poly(dA) sequences in the promoter region. In the present study, the poly(dA) mononucleotide tract in various types of human cancer cell lines was examined and compared with the HGF expression levels in those cells. Short deoxyadenosine repeat sequences were detected in five of the 55 cell lines used in the present study. The H69, IM95, CCK-81, Sui73 and H28 cells exhibited a truncated poly(dA) sequence in which the number of poly(dA) repeats was reduced by ≥5 bp. Two of the cell lines exhibited high HGF expression, determined by reverse transcription quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. The CCK-81, Sui73 and H28 cells with shorter poly(dA) sequences exhibited low HGF expression. The cause of the suppression of HGF expression in the CCK-81, Sui73 and H28 cells was clarified by two approaches, suppression by methylation and single nucleotide polymorphisms in the HGF gene. Exposure to 5-Aza-dC, an inhibitor of DNA methyltransferase 1, induced an increased expression of HGF in the CCK-81 cells, but not in the other cells. Single-nucleotide polymorphism (SNP) rs72525097 in intron 1 was detected in the Sui73 and H28 cells. Taken together, it was found that the defect of poly(dA) in the HGF promoter was present in various types of cancer, including lung, stomach, colorectal, pancreas and mesothelioma. The present study proposes the negative regulation mechanisms by methylation and SNP in intron 1 of HGF for HGF expression in cancer cells with short poly(dA).

ISOLASI DAN KARAKTERISASI PROMOTER β-ACTIN DARI IKAN KERAPU BEBEK (Cromileptes altivelis

Directory of Open Access Journals (Sweden)

Alimuddin Alimuddin

2016-11-01

Promoter as gene expression regulator is one of the factors affecting the successful of transgenesis. Isolation and characterization of β -actin promoter (ktBA from humpback grouper (Cromileptes altivelis towards generation of autotransgenic grouper have been conducted.  β -actin promoter has high activity in muscle. Sequence of ktBA promoter was isolated by using degenerate PCR method. Sequencing was performed using ABI PRISM 3100 machine. Analysis of sequences was conducted using BLAST, GENETYX version 7 and TFBind softwares. DNA fragment of PCR amplification product digested from the vector cloning was then ligated with pEGFPN1 to generate pktBA-GFP construct. The construct was microinjected into one-cell stage of zebrafish (Danio rerio embryos to test the ktBA promoter activity. EGFP gene expression was observed by fluorescence microscope. The result of sequence analysis showed that the length of DNA fragment obtained is about 1.6 kb and containing the evolutionary conserved sequences of transcription factor for β -actin promoter including CCAAT, CArG and TATA boxes. Furthermore, ktBA sequence in pktBA-EGFP construct could drove GFP expression in muscle of zebrafish embryos injected with the construct. The results suggested that PCR amplification product is the regulator sequence of humpback grouper β -actin gene. Autotransgenic grouper can be then produced by changing GFP gene fragment of pktBA-EGFP construct with genes from grouper encoding important traits in aquaculture.

Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

Science.gov (United States)

Palumbo, Michael J; Newberg, Lee A

2010-07-01

The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

Enhancement of extracellular expression of Bacillus naganoensis pullulanase from recombinant Bacillus subtilis: Effects of promoter and host.

Science.gov (United States)

Song, Wan; Nie, Yao; Mu, Xiao Qing; Xu, Yan

2016-08-01

Pullulanase plays an important role in industrial applications of starch processing. However, extracellular production of pullulanase from recombinant Bacillus subtilis is yet limited due to the issues on regulatory elements of B. subtilis expression system. In this study, the gene encoding B. naganoensis pullulanase (PUL) was expressed in B. subtilis WB800 under the promoter PHpaII in the shuttle vector pMA0911. The extracellular activity of expressed pullulanase was 3.9 U ml(-1) from the recombinant B. subtilis WB800/pMA0911-PHpaII-pul. To further enhance the yield of PUL, the promoter PHpaII in pMA0911 was replaced by a stronger constitutive promoter P43. Then the activity was increased to 8.7 U ml(-1) from the recombinant B. subtilis WB800/pMA0911-P43-pul. Effect of host on pullulanase expression was further investigated by comparison between B. subtilis WB600 and B. subtilis WB800. In addition to the available B. subtilis WB800 recombinants, the constructed plasmids pMA0911-PHpaII-pul and pMA0911-P43-pul were transformed into B. subtilis WB600, respectively. Consequently, the extracellular production of PUL was significantly enhanced by B. subtilis WB600/pMA0911-P43-pul, resulting in the extracellular pullulanase activity of 24.5 U ml(-1). Therefore, promoter and host had an impact on pullulanase expression and their optimization would be useful to improve heterologous protein expression in B. subtilis. Copyright © 2016 Elsevier Inc. All rights reserved.

ΔNp73 enhances promoter activity of TGF-β induced genes.

Directory of Open Access Journals (Sweden)

Maarten Niemantsverdriet

Full Text Available The p53 homolog p73 is frequently overexpressed in cancers. Especially the transactivation domain truncated isoform ΔNp73 has oncogenic properties and its upregulation is associated with poor patient survival. It has been shown that ΔNp73 has an inhibitory effect on the transactivation capacity of p53 and other p73 isoforms. Here, we confirm this finding but surprisingly find that ΔNp73 may also stimulate the expression of TGF-β signaling targets. Promoter-reporter analysis indicated that the presence of Smad Binding Elements (SBE in the promoter is sufficient for stimulation of gene expression by ΔNp73. TGF-β signaling was less efficient in ΔNp73 downregulated cells, whereas tetracycline induced ΔNp73 increased expression of endogenous TGF-β regulated genes PAI-1 and Col1a1. Pull-down assays with SBE DNA suggest that ΔNp73 enhances smad3/4 binding to SBEs, thereby stimulating TGF-β signaling. Chromatin immunoprecipitation assays confirmed a direct interaction between ΔNp73 and SBE. Given the role of TGF-β signaling in carcinogenesis, tumor invasion and metastasis via targets like PAI-1 and Col1a1, our data suggest a model on how this effect of ΔNp73 could be a contributing factor in cancer progression.

Comprehensive benchmarking reveals H2BK20 acetylation as a distinctive signature of cell-state-specific enhancers and promoters.

Science.gov (United States)

Kumar, Vibhor; Rayan, Nirmala Arul; Muratani, Masafumi; Lim, Stefan; Elanggovan, Bavani; Xin, Lixia; Lu, Tess; Makhija, Harshyaa; Poschmann, Jeremie; Lufkin, Thomas; Ng, Huck Hui; Prabhakar, Shyam

2016-05-01

Although over 35 different histone acetylation marks have been described, the overwhelming majority of regulatory genomics studies focus exclusively on H3K27ac and H3K9ac. In order to identify novel epigenomic traits of regulatory elements, we constructed a benchmark set of validated enhancers by performing 140 enhancer assays in human T cells. We tested 40 chromatin signatures on this unbiased enhancer set and identified H2BK20ac, a little-studied histone modification, as the most predictive mark of active enhancers. Notably, we detected a novel class of functionally distinct enhancers enriched in H2BK20ac but lacking H3K27ac, which was present in all examined cell lines and also in embryonic forebrain tissue. H2BK20ac was also unique in highlighting cell-type-specific promoters. In contrast, other acetylation marks were present in all active promoters, regardless of cell-type specificity. In stimulated microglial cells, H2BK20ac was more correlated with cell-state-specific expression changes than H3K27ac, with TGF-beta signaling decoupling the two acetylation marks at a subset of regulatory elements. In summary, our study reveals a previously unknown connection between histone acetylation and cell-type-specific gene regulation and indicates that H2BK20ac profiling can be used to uncover new dimensions of gene regulation. © 2016 Kumar et al.; Published by Cold Spring Harbor Laboratory Press.

Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

Energy Technology Data Exchange (ETDEWEB)

Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.; Salzberg, Steven L.; Rubin, Gerald M.; Eisen, Michael B.; Celniker, SusanE.

2004-08-06

The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.

Strong transcription blockage mediated by R-loop formation within a G-rich homopurine-homopyrimidine sequence localized in the vicinity of the promoter.

Science.gov (United States)

Belotserkovskii, Boris P; Soo Shin, Jane Hae; Hanawalt, Philip C

2017-06-20

Guanine-rich (G-rich) homopurine-homopyrimidine nucleotide sequences can block transcription with an efficiency that depends upon their orientation, composition and length, as well as the presence of negative supercoiling or breaks in the non-template DNA strand. We report that a G-rich sequence in the non-template strand reduces the yield of T7 RNA polymerase transcription by more than an order of magnitude when positioned close (9 bp) to the promoter, in comparison to that for a distal (∼250 bp) location of the same sequence. This transcription blockage is much less pronounced for a C-rich sequence, and is not significant for an A-rich sequence. Remarkably, the blockage is not pronounced if transcription is performed in the presence of RNase H, which specifically digests the RNA strands within RNA-DNA hybrids. The blockage also becomes less pronounced upon reduced RNA polymerase concentration. Based upon these observations and those from control experiments, we conclude that the blockage is primarily due to the formation of stable RNA-DNA hybrids (R-loops), which inhibit successive rounds of transcription. Our results could be relevant to transcription dynamics in vivo (e.g. transcription 'bursting') and may also have practical implications for the design of expression vectors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Video Enhancement and Dynamic Range Control of HDR Sequences for Automotive Applications

Directory of Open Access Journals (Sweden)

Giovanni Ramponi

2007-01-01

Full Text Available CMOS video cameras with high dynamic range (HDR output are particularly suitable for driving assistance applications, where lighting conditions can strongly vary, going from direct sunlight to dark areas in tunnels. However, common visualization devices can only handle a low dynamic range, and thus a dynamic range reduction is needed. Many algorithms have been proposed in the literature to reduce the dynamic range of still pictures. Anyway, extending the available methods to video is not straightforward, due to the peculiar nature of video data. We propose an algorithm for both reducing the dynamic range of video sequences and enhancing its appearance, thus improving visual quality and reducing temporal artifacts. We also provide an optimized version of our algorithm for a viable hardware implementation on an FPGA. The feasibility of this implementation is demonstrated by means of a case study.

Promoter Motifs in NCLDVs: An Evolutionary Perspective

Directory of Open Access Journals (Sweden)

Graziele Pereira Oliveira

2017-01-01

Full Text Available For many years, gene expression in the three cellular domains has been studied in an attempt to discover sequences associated with the regulation of the transcription process. Some specific transcriptional features were described in viruses, although few studies have been devoted to understanding the evolutionary aspects related to the spread of promoter motifs through related viral families. The discovery of giant viruses and the proposition of the new viral order Megavirales that comprise a monophyletic group, named nucleo-cytoplasmic large DNA viruses (NCLDV, raised new questions in the field. Some putative promoter sequences have already been described for some NCLDV members, bringing new insights into the evolutionary history of these complex microorganisms. In this review, we summarize the main aspects of the transcription regulation process in the three domains of life, followed by a systematic description of what is currently known about promoter regions in several NCLDVs. We also discuss how the analysis of the promoter sequences could bring new ideas about the giant viruses’ evolution. Finally, considering a possible common ancestor for the NCLDV group, we discussed possible promoters’ evolutionary scenarios and propose the term “MEGA-box” to designate an ancestor promoter motif (‘TATATAAAATTGA’ that could be evolved gradually by nucleotides’ gain and loss and point mutations.

Promoter Motifs in NCLDVs: An Evolutionary Perspective

Science.gov (United States)

Oliveira, Graziele Pereira; Andrade, Ana Cláudia dos Santos Pereira; Rodrigues, Rodrigo Araújo Lima; Arantes, Thalita Souza; Boratto, Paulo Victor Miranda; Silva, Ludmila Karen dos Santos; Dornas, Fábio Pio; Trindade, Giliane de Souza; Drumond, Betânia Paiva; La Scola, Bernard; Kroon, Erna Geessien; Abrahão, Jônatas Santos

2017-01-01

For many years, gene expression in the three cellular domains has been studied in an attempt to discover sequences associated with the regulation of the transcription process. Some specific transcriptional features were described in viruses, although few studies have been devoted to understanding the evolutionary aspects related to the spread of promoter motifs through related viral families. The discovery of giant viruses and the proposition of the new viral order Megavirales that comprise a monophyletic group, named nucleo-cytoplasmic large DNA viruses (NCLDV), raised new questions in the field. Some putative promoter sequences have already been described for some NCLDV members, bringing new insights into the evolutionary history of these complex microorganisms. In this review, we summarize the main aspects of the transcription regulation process in the three domains of life, followed by a systematic description of what is currently known about promoter regions in several NCLDVs. We also discuss how the analysis of the promoter sequences could bring new ideas about the giant viruses’ evolution. Finally, considering a possible common ancestor for the NCLDV group, we discussed possible promoters’ evolutionary scenarios and propose the term “MEGA-box” to designate an ancestor promoter motif (‘TATATAAAATTGA’) that could be evolved gradually by nucleotides’ gain and loss and point mutations. PMID:28117683

ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

Science.gov (United States)

Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

2008-07-01

Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

Pd enhanced WC catalyst to promote heterogeneous methane combustion

International Nuclear Information System (INIS)

Terracciano, Anthony Carmine; De Oliveira, Samuel; Siddhanti, Deepti; Blair, Richard; Vasu, Subith S.; Orlovskaya, Nina

2017-01-01

Highlights: • Pd enhanced WC catalyst particles were synthesized via mechanochemical alloying. • Catalyst was characterized by XRD, XRF, SEM, and EDS. • Catalyst was deposited on porous ZrO_2 and evaluated in heterogeneous combustion. • During combustion temperature profiles and spectral emissions were collected. - Abstract: The efficiency of combustion for low cost heat production could be greatly enhanced if an active and low cost catalyst would be used to facilitate the chemical reactions occurring during combustor operation. Within this work an experimental study of palladium (Pd) enhanced tungsten carbide (WC) catalyst, synthesized via high energy ball milling and deposited by dip coating onto a magnesia partially stabilized zirconia (MgO-ZrO_2) porous matrix of 10 ppin was evaluated in heterogeneous methane combustion. The synthesized powder was characterized by X-ray Diffraction (XRD), Scanning Electron Microscopy (SEM) coupled with Energy Dispersive Spectroscopy (EDS) analysis, as well as by X-ray Fluorescence (XRF); and the morphology of the deposited WC-Pd coating was also characterized using SEM and EDS. Performance evaluation of the heterogeneous combustor with WC-Pd coated MgO-ZrO_2 porous media was conducted at constant air flow rate and various equivalence ratios of methane/air gaseous mixtures, while monitoring axial temperature profiles within the combustion chamber using thermocouples, as well as thermal radiative and acoustic emissions from the combustor exhaust using an externally placed CCD camera and a microphone. It was found that there is a strong dependence of flame position and maximum temperature on equivalence ratio (φ) over the range of 0.47 ± 0.02 ⩽ φ ⩽ 0.75 ± 0.02. Additionally it was found that over the same equivalence ratio range, there is a characteristic 4 peak acoustic signature between 200 and 500 Hz. It was found that at higher equivalence ratios 0.51 ± 0.02 ⩽ φ ⩽ 0.75 ± 0.02 the performance of combustor

Promoting Active Learning in Calculus and General Physics through Interactive and Media-Enhanced Lectures

Directory of Open Access Journals (Sweden)

Guoqing Tang

2004-02-01

Full Text Available In this paper we present an approach of incorporating interactive and media-enhanced lectures to promote active learning in Calculus and General Physics courses. The pedagogical practice of using interactive techniques in lectures to require "heads-on" and "hands-on" learning, and involve students more as active participants than passive receivers is a part of academic curricular reform efforts undertaken currently by the mathematics, physics and chemistry departments at North Carolina A&T State University under the NSF funded project "Talent-21: Gateway for Advancing Science and Mathematics Talents."

Exploiting nucleotide composition to engineer promoters.

Directory of Open Access Journals (Sweden)

Manfred G Grabherr

Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

Genome Sequencing of a Mung Bean Plant Growth Promoting Strain of P. aeruginosa with Biocontrol Ability

Directory of Open Access Journals (Sweden)

Devaraj Illakkiam

2014-01-01

Full Text Available Pseudomonas aeruginosa PGPR2 is a mung bean rhizosphere strain that produces secondary metabolites and hydrolytic enzymes contributing to excellent antifungal activity against Macrophomina phaseolina, one of the prevalent fungal pathogens of mung bean. Genome sequencing was performed using the Ion Torrent Personal Genome Machine generating 1,354,732 reads (6,772,433 sequenced bases achieving ~25-fold coverage of the genome. Reference genome assembly using MIRA 3.4.0 yielded 198 contigs. The draft genome of PGPR2 encoded 6803 open reading frames, of which 5314 were genes with predicted functions, 1489 were genes of known functions, and 80 were RNA-coding genes. Strain specific and core genes of P. aeruginosa PGPR2 that are relevant to rhizospheric habitat were identified by pangenome analysis. Genes involved in plant growth promoting function such as synthesis of ACC deaminase, indole-3-acetic acid, trehalose, mineral scavenging siderophores, hydrogen cyanide, chitinases, acyl homoserine lactones, acetoin, 2,3-butanediol, and phytases were identified. In addition, niche-specific genes such as phosphate solubilising 3-phytase, adhesins, pathway-specific transcriptional regulators, a diguanylate cyclase involved in cellulose synthesis, a receptor for ferrienterochelin, a DEAD/DEAH-box helicase involved in stress tolerance, chemotaxis/motility determinants, an HtpX protease, and enzymes involved in the production of a chromanone derivative with potent antifungal activity were identified.

Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

Energy Technology Data Exchange (ETDEWEB)

Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

1994-09-01

The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

Systematic search for the Cra-binding promoters using genomic SELEX system.

Science.gov (United States)

Shimada, Tomohiro; Fujita, Nobuyuki; Maeda, Michihisa; Ishihama, Akira

2005-09-01

Cra (or FruR), a global transcription factor with both repression and activation activities, controls a large number of the genes for glycolysis and gluconeogenesis. To get insights into the entire network of transcription regulation of the E. coli genome by Cra, we isolated a set of Cra-binding sequences using an improved method of genomic SELEX. From the DNA sequences of 97 independently isolated DNA fragments by SELEX, the Cra-binding sequences were identified in a total of ten regions on the E. coli genome, including promoters of six known genes and four hitherto-unidentified genes. All six known promoters are repressed by Cra, but none of the activation-type promoters were cloned after two cyles of SELEX, because the Cra-binding affinity to the repression-type promoters is higher than the activation-type promoters, as determined by the quantitative gel shift assay. Of a total of four newly identified Cra-binding sequences, two are associated with promoter regions of the gapA (glyceraldehyde 3-phosphate dehydrogenase) and eno (enolase) genes, both involved in sugar metabolism. The regulation of newly identified genes by Cra was confirmed by the in vivo promoter strength assay using a newly developed TFP (two-fluorescent protein) vector for promoter assay or by in vitro transcription assay in the presence of Cra protein.

Zinc deficiency promotes cystitis-related bladder pain by enhancing function and expression of Cav3.2 in mice.

Science.gov (United States)

Ozaki, Tomoka; Matsuoka, Junki; Tsubota, Maho; Tomita, Shiori; Sekiguchi, Fumiko; Minami, Takeshi; Kawabata, Atsufumi

2018-01-15

Ca v 3.2 T-type Ca 2+ channel activity is suppressed by zinc that binds to the extracellular histidine-191 of Ca v 3.2, and enhanced by H 2 S that interacts with zinc. Ca v 3.2 in nociceptors is upregulated in an activity-dependent manner. The enhanced Ca v 3.2 activity by H 2 S formed by the upregulated cystathionine-γ-lyase (CSE) is involved in the cyclophosphamide (CPA)-induced cystitis-related bladder pain in mice. We thus asked if zinc deficiency affects the cystitis-related bladder pain in mice by altering Ca v 3.2 function and/or expression. Dietary zinc deficiency for 2 weeks greatly decreased zinc concentrations in the plasma but not bladder tissue, and enhanced the bladder pain/referred hyperalgesia (BP/RH) following CPA at 200mg/kg, a subeffective dose, but not 400mg/kg, a maximal dose, an effect abolished by pharmacological blockade or gene silencing of Ca v 3.2. Acute zinc deficiency caused by systemic N,N,N',N'-tetrakis-(2-pyridylmethyl)-ethylendiamine (TPEN), a zinc chelator, mimicked the dietary zinc deficiency-induced Ca v 3.2-dependent promotion of BP/RH following CPA at 200mg/kg. CPA at 400mg/kg alone or TPEN plus CPA at 200mg/kg caused Ca v 3.2 overexpression accompanied by upregulation of Egr-1 and USP5, known to promote transcriptional expression and reduce proteasomal degradation of Ca v 3.2, respectively, in the dorsal root ganglia (DRG). The CSE inhibitor, β-cyano-l-alanine, prevented the BP/RH and upregulation of Ca v 3.2, Egr-1 and USP5 in DRG following TPEN plus CPA at 200mg/kg. Together, zinc deficiency promotes bladder pain accompanying CPA-induced cystitis by enhancing function and expression of Ca v 3.2 in nociceptors, suggesting a novel therapeutic avenue for treatment of bladder pain, such as zinc supplementation. Copyright © 2017 Elsevier B.V. All rights reserved.

A composite method based on formal grammar and DNA structural features in detecting human polymerase II promoter region.

Directory of Open Access Journals (Sweden)

Sutapa Datta

Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.

A Composite Method Based on Formal Grammar and DNA Structural Features in Detecting Human Polymerase II Promoter Region

Science.gov (United States)

Datta, Sutapa; Mukhopadhyay, Subhasis

2013-01-01

An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045

A T-cell specific transcriptional enhancer element 3' of Cα in the human T-cell receptor α locus

International Nuclear Information System (INIS)

Ho, Icheng; Yang, Lihsuan; Morle, G.; Leiden, J.M.

1989-01-01

A transcriptional enhancer element has been identified 4.5 kilobases 3' of C α (constant region α chain) in the human T-cell receptor (TCR) α-chain locus. This enhancer is active on both a TCR V α (variable region α chain) promoter and the minimal simian virus 40 promoter in TCR α/β Jurkat and EL4 cells but is inactive on a V α promoter TCR γ/δ PEER and Molt-13 cells, clone 13 B cells, and HeLa fibroblasts. The enhancer has been localized to a 116-base-pair BstXI/Dra I restriction enzyme fragment, which lacks immunoglobulin octamer and κB enhancer motifs but does contain a consensus cAMP-response element (CRE). DNase I footprint analyses demonstrated that the minimal enhancer contains two binding sites for Jurkat nuclear proteins. One of these sites corresponds to the CRE, while the other does not correspond to a known transcriptional enhancer motif. These data support a model in which TCR α gene transcription is regulated by a unique set of cis-acting sequences and trans-acting factors, which are differentially active in cells of the TCR α/β lineage. In addition, the TCR α enhancer may play a role in activating oncogene expression in T-lymphoblastoid tumors that have previously been shown to display chromosomal translocations into the human TCR α locus

Classical Mus musculus Igκ enhancers support transcription but not high level somatic hypermutation from a V-lambda promoter in chicken DT40 cells.

Directory of Open Access Journals (Sweden)

Naga Rama Kothapalli

2011-04-01

Full Text Available Somatic hypermutation (SHM of immunoglobulin genes is initiated by activation-induced cytidine deaminase (AID in activated B cells. This process is strictly dependent on transcription. Hence, cis-acting transcriptional control elements have been proposed to target SHM to immunoglobulin loci. The Mus musculus Igκ locus is regulated by the intronic enhancer (iE/MAR and the 3' enhancer (3'E, and multiple studies using transgenic and knock-out approaches in mice and cell lines have reported somewhat contradictory results about the function of these enhancers in AID-mediated sequence diversification. Here we show that the M. musculus iE/MAR and 3'E elements are active solely as transcriptional enhancer when placed in the context of the IGL locus in Gallus gallus DT40 cells, but they are very inefficient in targeting AID-mediated mutation events to this locus. This suggests that either key components of the cis-regulatory targeting elements reside outside the murine Igκ transcriptional enhancer sequences, or that the targeting of AID activity to Ig loci occurs by largely species-specific mechanisms.

Herpes simplex virus latency-associated transcript sequence downstream of the promoter influences type-specific reactivation and viral neurotropism.

Science.gov (United States)

Bertke, Andrea S; Patel, Amita; Krause, Philip R

2007-06-01

Herpes simplex virus (HSV) establishes latency in sensory nerve ganglia during acute infection and may later periodically reactivate to cause recurrent disease. HSV type 1 (HSV-1) reactivates more efficiently than HSV-2 from trigeminal ganglia while HSV-2 reactivates more efficiently than HSV-1 from lumbosacral dorsal root ganglia (DRG) to cause recurrent orofacial and genital herpes, respectively. In a previous study, a chimeric HSV-2 that expressed the latency-associated transcript (LAT) from HSV-1 reactivated similarly to wild-type HSV-1, suggesting that the LAT influences the type-specific reactivation phenotype of HSV-2. To further define the LAT region essential for type-specific reactivation, we constructed additional chimeric HSV-2 viruses by replacing the HSV-2 LAT promoter (HSV2-LAT-P1) or 2.5 kb of the HSV-2 LAT sequence (HSV2-LAT-S1) with the corresponding regions from HSV-1. HSV2-LAT-S1 was impaired for reactivation in the guinea pig genital model, while its rescuant and HSV2-LAT-P1 reactivated with a wild-type HSV-2 phenotype. Moreover, recurrences of HSV-2-LAT-S1 were frequently fatal, in contrast to the relatively mild recurrences of the other viruses. During recurrences, HSV2-LAT-S1 DNA increased more in the sacral cord compared to its rescuant or HSV-2. Thus, the LAT sequence region, not the LAT promoter region, provides essential elements for type-specific reactivation of HSV-2 and also plays a role in viral neurotropism. HSV-1 DNA, as quantified by real-time PCR, was more abundant in the lumbar spinal cord, while HSV-2 DNA was more abundant in the sacral spinal cord, which may provide insights into the mechanism for type-specific reactivation and different patterns of central nervous system infection of HSV-1 and HSV-2.

Simultaneous activation of parallel sensory pathways promotes a grooming sequence in Drosophila

Science.gov (United States)

Hampel, Stefanie; McKellar, Claire E

2017-01-01

A central model that describes how behavioral sequences are produced features a neural architecture that readies different movements simultaneously, and a mechanism where prioritized suppression between the movements determines their sequential performance. We previously described a model whereby suppression drives a Drosophila grooming sequence that is induced by simultaneous activation of different sensory pathways that each elicit a distinct movement (Seeds et al., 2014). Here, we confirm this model using transgenic expression to identify and optogenetically activate sensory neurons that elicit specific grooming movements. Simultaneous activation of different sensory pathways elicits a grooming sequence that resembles the naturally induced sequence. Moreover, the sequence proceeds after the sensory excitation is terminated, indicating that a persistent trace of this excitation induces the next grooming movement once the previous one is performed. This reveals a mechanism whereby parallel sensory inputs can be integrated and stored to elicit a delayed and sequential grooming response. PMID:28887878

Vaccine-induced anti-HA2 antibodies promote virus fusion and enhance influenza virus respiratory disease.

Science.gov (United States)

Khurana, Surender; Loving, Crystal L; Manischewitz, Jody; King, Lisa R; Gauger, Phillip C; Henningson, Jamie; Vincent, Amy L; Golding, Hana

2013-08-28

Vaccine-induced disease enhancement has been described in connection with several viral vaccines in animal models and in humans. We investigated a swine model to evaluate mismatched influenza vaccine-associated enhanced respiratory disease (VAERD) after pH1N1 infection. Vaccinating pigs with whole inactivated H1N2 (human-like) virus vaccine (WIV-H1N2) resulted in enhanced pneumonia and disease after pH1N1 infection. WIV-H1N2 immune sera contained high titers of cross-reactive anti-pH1N1 hemagglutinin (HA) antibodies that bound exclusively to the HA2 domain but not to the HA1 globular head. No hemagglutination inhibition titers against pH1N1 (challenge virus) were measured. Epitope mapping using phage display library identified the immunodominant epitope recognized by WIV-H1N2 immune sera as amino acids 32 to 77 of pH1N1-HA2 domain, close to the fusion peptide. These cross-reactive anti-HA2 antibodies enhanced pH1N1 infection of Madin-Darby canine kidney cells by promoting virus membrane fusion activity. The enhanced fusion activity correlated with lung pathology in pigs. This study suggests a role for fusion-enhancing anti-HA2 antibodies in VAERD, in the absence of receptor-blocking virus-neutralizing antibodies. These findings should be considered during the evaluation of universal influenza vaccines designed to elicit HA2 stem-targeting antibodies.

Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

International Nuclear Information System (INIS)

Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry

2008-01-01

The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

Combining brain stimulation and video game to promote long-term transfer of learning and cognitive enhancement.

Science.gov (United States)

Looi, Chung Yen; Duta, Mihaela; Brem, Anna-Katharine; Huber, Stefan; Nuerk, Hans-Christoph; Cohen Kadosh, Roi

2016-02-23

Cognitive training offers the potential for individualised learning, prevention of cognitive decline, and rehabilitation. However, key research challenges include ecological validity (training design), transfer of learning and long-term effects. Given that cognitive training and neuromodulation affect neuroplasticity, their combination could promote greater, synergistic effects. We investigated whether combining transcranial direct current stimulation (tDCS) with cognitive training could further enhance cognitive performance compared to training alone, and promote transfer within a short period of time. Healthy adults received real or sham tDCS over their dorsolateral prefrontal cortices during two 30-minute mathematics training sessions involving body movements. To examine the role of training, an active control group received tDCS during a non-mathematical task. Those who received real tDCS performed significantly better in the game than the sham group, and showed transfer effects to working memory, a related but non-numerical cognitive domain. This transfer effect was absent in active and sham control groups. Furthermore, training gains were more pronounced amongst those with lower baseline cognitive abilities, suggesting the potential for reducing cognitive inequalities. All effects associated with real tDCS remained 2 months post-training. Our study demonstrates the potential benefit of this approach for long-term enhancement of human learning and cognition.

The dipeptide Pro-Asp promotes IGF-1 secretion and expression in hepatocytes by enhancing JAK2/STAT5 signaling pathway.

Science.gov (United States)

Wang, Songbo; Wang, Guoqing; Zhang, Mengyuan; Zhuang, Lu; Wan, Xiaojuan; Xu, Jingren; Wang, Lina; Zhu, Xiaotong; Gao, Ping; Xi, Qianyun; Zhang, Yongliang; Shu, Gang; Jiang, Qingyan

2016-11-15

It has been implicated that IGF-1 secretion can be regulated by dietary protein. However, whether the dipeptides, one of digested products of dietary protein, have influence on IGF-1 secretion remain largely unknown. Our study aimed to investigate the effects of the dipeptide Pro-Asp on IGF-1 secretion and expression in hepatocytes and to explore the possible underlying mechanisms. Our findings demonstrated that Pro-Asp promoted the secretion and gene expression of IGF-1 in HepG2 cells and primary porcine hepatocytes. Meanwhile, Pro-Asp activated the ERK and Akt signaling pathways, downstream of IGF-1. In addition, Pro-Asp enhanced GH-mediated JAK2/STAT5 signaling pathway, while inhibition of JAK2/STAT5 blocked the promotive effect of Pro-Asp on IGF-1 secretion and expression. Moreover, acute injection of Pro-Asp stimulated IGF-1 expression and activated JAK2/STAT5 signaling pathway in mice liver. Together, these results suggested that the dipeptide Pro-Asp promoted IGF-1 secretion and expression in hepatocytes by enhancing GH-mediated JAK2/STAT5 signaling pathway. Copyright © 2016. Published by Elsevier Ireland Ltd.

RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

International Nuclear Information System (INIS)

Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

2006-01-01

RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

Mining Halophytes for Plant Growth-Promoting Halotolerant Bacteria to Enhance the Salinity Tolerance of Non-halophytic Crops

Directory of Open Access Journals (Sweden)

Hassan Etesami

2018-02-01

Full Text Available Salinity stress is one of the major abiotic stresses limiting crop production in arid and semi-arid regions. Interest is increasing in the application of PGPRs (plant growth promoting rhizobacteria to ameliorate stresses such as salinity stress in crop production. The identification of salt-tolerant, or halophilic, PGPRs has the potential to promote saline soil-based agriculture. Halophytes are a useful reservoir of halotolerant bacteria with plant growth-promoting capabilities. Here, we review recent studies on the use of halophilic PGPRs to stimulate plant growth and increase the tolerance of non-halophytic crops to salinity. These studies illustrate that halophilic PGPRs from the rhizosphere of halophytic species can be effective bio-inoculants for promoting the production of non-halophytic species in saline soils. These studies support the viability of bioinoculation with halophilic PGPRs as a strategy for the sustainable enhancement of non-halophytic crop growth. The potential of this strategy is discussed within the context of ensuring sustainable food production for a world with an increasing population and continuing climate change. We also explore future research needs for using halotolerant PGPRs under salinity stress.

Substitution of wild-type yellow fever Asibi sequences for 17D vaccine sequences in ChimeriVax-dengue 4 does not enhance infection of Aedes aegypti mosquitoes.

Science.gov (United States)

McGee, Charles E; Tsetsarkin, Konstantin; Vanlandingham, Dana L; McElroy, Kate L; Lang, Jean; Guy, Bruno; Decelle, Thierry; Higgs, Stephen

2008-03-01

To address concerns that a flavivirus vaccine/wild-type recombinant virus might have a high mosquito infectivity phenotype, the yellow fever virus (YFV) 17D backbone of the ChimeriVax-dengue 4 virus was replaced with the corresponding gene sequences of the virulent YFV Asibi strain. Field-collected and laboratory-colonized Aedes aegypti mosquitoes were fed on blood containing each of the viruses under investigation and held for 14 days after infection. Infection and dissemination rates were based on antigen detection in titrated body or head triturates. Our data indicate that, even in the highly unlikely event of recombination or substantial backbone reversion, virulent sequences do not enhance the transmissibility of ChimeriVax viruses. In light of the low-level viremias that have been observed after vaccination in human volunteers coupled with low mosquito infectivity, it is predicted that the risk of mosquito infection and transmission of ChimeriVax vaccine recombinant/revertant viruses in nature is minimal.

A Randomized Trial of SMART Goal Enhanced Debriefing after Simulation to Promote Educational Actions

Directory of Open Access Journals (Sweden)

Amish Aghera

2017-12-01

Full Text Available Introduction Goal setting is used in education to promote learning and performance. Debriefing after clinical scenario-based simulation is a well-established practice that provides learners a defined structure to review and improve performance. Our objective was to integrate formal learning goal generation, using the SMART framework (Specific, Measurable, Attainable, Realistic, and Time-bound, into standard debriefing processes (i.e., “SMART Goal Enhanced Debriefing” and subsequently measure the impact on the development of learning goals and execution of educational actions. Methods This was a prospective multicenter randomized controlled study of 80 emergency medicine residents at three academic hospitals comparing the effectiveness of SMART Goal Enhanced Debriefing to a standard debriefing. Residents were block randomized on a rolling basis following a simulation case. SMART Goal Enhanced Debriefing included five minutes of formal instruction on the development of SMART learning goals during the summary/application phase of the debrief. Outcome measures included the number of recalled learning goals, self-reported executed educational actions, and quality of each learning goal and educational action after a two-week follow-up period. Results The mean number of reported learning goals was similar in the standard debriefing group (mean 2.05 goals, SD 1.13, n=37 residents, and in the SMART Goal Enhanced Debriefing group (mean 1.93, SD 0.96, n=43, with no difference in learning goal quality. Residents receiving SMART Goal Enhanced Debriefing completed more educational actions on average (Control group actions completed 0.97 (SD 0.87, SMART debrief group 1.44 (SD 1.03 p=0.03. Conclusion The number and quality of learning goals reported by residents was not improved as a result of SMART Goal Enhanced Debriefing. Residents did, however, execute more educational actions, which is consistent with the overarching intent of any educational

The biology of eukaryotic promoter prediction - a review

DEFF Research Database (Denmark)

Pedersen, Anders Gorm; Baldi, Pierre; Chauvin, Yves

1999-01-01

between functional promoters has been estimated to be in the range of 30-40 kilobases. Although it is conceivable that some of these predicted promoters correspond to cryptic initiation sites that are used in vivo, it is likely that most are false positives. This suggests that it is important to carefully......Computational prediction of eukaryotic promoters from the nucleotide sequence is one of the most attractive problems in sequence analysis today, but it is also a very difficult one. Thus, current methods predict in the order of one promoter per kilobase in human DNA, while the average distance...... reconsider the biological data that forms the basis of current algorithms, and we here present a review of data that may be useful in this regard. The review covers the following topics: (1) basal transcription and core promoters, (2) activated transcription and transcription factor binding sites, (3) Cp...

The N-terminus of TDP-43 promotes its oligomerization and enhances DNA binding affinity

Energy Technology Data Exchange (ETDEWEB)

Chang, Chung-ke [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Wu, Tzong-Huah [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Chemical Biology and Molecular Biophysics Program, Taiwan International Graduate Program, Institute of Biochemistry, Academia Sinica, Taipei 115, Taiwan (China); Institute of Bioinformatics and Structural Biology, National Tsing Hua University, Hsinchu 300, Taiwan (China); Wu, Chu-Ya [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Graduate Institute of Engineering, National Taiwan University of Science and Technology, Taipei 106, Taiwan (China); Chiang, Ming-hui; Toh, Elsie Khai-Woon [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Hsu, Yin-Chih; Lin, Ku-Feng [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Liao, Yu-heng [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Huang, Tai-huang, E-mail: bmthh@gate.sinica.edu.tw [Institute of Biomedical Sciences, Academia Sinica, Taipei 115, Taiwan (China); Department of Physics, National Taiwan Normal University, Taipei 106, Taiwan (China); Huang, Joseph Jen-Tse, E-mail: jthuang@chem.sinica.edu.tw [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China)

2012-08-24

Highlights: Black-Right-Pointing-Pointer The N-terminus of TDP-43 contains an independently folded structural domain (NTD). Black-Right-Pointing-Pointer The structural domains of TDP-43 are arranged in a beads-on-a-string fashion. Black-Right-Pointing-Pointer The NTD promotes TDP-43 oligomerization in a concentration-dependent manner. Black-Right-Pointing-Pointer The NTD may assist nucleic acid-binding activity of TDP-43. -- Abstract: TDP-43 is a DNA/RNA-binding protein associated with different neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD-U). Here, the structural and physical properties of the N-terminus on TDP-43 have been carefully characterized through a combination of nuclear magnetic resonance (NMR), circular dichroism (CD) and fluorescence anisotropy studies. We demonstrate for the first time the importance of the N-terminus in promoting TDP-43 oligomerization and enhancing its DNA-binding affinity. An unidentified structural domain in the N-terminus is also disclosed. Our findings provide insights into the N-terminal domain function of TDP-43.

TiO2 promoted by two different non-noble metal cocatalysts for enhanced photocatalytic H2 evolution

International Nuclear Information System (INIS)

Lin, Jing-Dong; Yan, Shi; Huang, Qin-Dong; Fan, Mei-Ting; Yuan, You-Zhu; Tan, Timothy Thatt-Yang; Liao, Dai-Wei

2014-01-01

TiO 2 photocatalysts modified by cobalt and nickel cocatalysts were prepared via polymerized complex method (PCM) and evaluated by photocatalytic hydrogen evolution. Hydrogen generation in 6 h for the TiO 2 promoted by cobalt and nickel (0.1%Co + 0.2%Ni/TiO 2 ) is about two times (2456 μmol H 2 ) compared to that of TiO 2 promoted only by cobalt (1180 μmol H 2 for 0.1%Co/TiO 2 ) or nickel (1127 μmol H 2 for 0.2%Ni/TiO 2 ), and mechanically mixed TiO 2 promoted by cobalt and TiO 2 promoted by nickel (0.1%Co/TiO 2 :0.2%Ni/TiO 2 = 1:1 (m/m), 1282 μmol H 2 ). The high photocatalytic H 2 evolution activity over TiO 2 promoted by cobalt and nickel is ascribed to enhanced photo response due to the presence of cobalt and nickel impurity level, and effective separation of photogenerated electrons and holes due to the synergistic effect of cobalt and nickel, which serve as active sites for H 2 evolution reaction (HER) and oxidation reaction (OR) respectively. This study demonstrates a viable strategy to design more active photocatalysts for photocatalytic H 2 evolution by substituting noble metals with more abundant elements using as HER and OR cocatalysts, respectively.

Biomaterials that promote cell-cell interactions enhance the paracrine function of MSCs.

Science.gov (United States)

Qazi, Taimoor H; Mooney, David J; Duda, Georg N; Geissler, Sven

2017-09-01

Mesenchymal stromal cells (MSCs) secrete paracrine factors that play crucial roles during tissue regeneration. Whether this paracrine function is influenced by the properties of biomaterials in general, and those used for cell delivery in particular, largely remains unexplored. Here, we investigated if three-dimensional culture in distinct microenvironments - nanoporous hydrogels (mean pore size ∼5 nm) and macroporous scaffolds (mean pore size ∼120 μm) - affects the secretion pattern of MSCs, and consequently leads to differential paracrine effects on target progenitor cells such as myoblasts. We report that compared to MSCs encapsulated in hydrogels, scaffold seeded MSCs show an enhanced secretion profile and exert beneficial paracrine effects on various myoblast functions including migration and proliferation. Additionally, we show that the heightened paracrine effects of scaffold seeded cells can in part be attributed to N-cadherin mediated cell-cell interactions during culture. In hydrogels, this physical interaction between cells is prevented by the encapsulating matrix. Functionally blocking N-cadherin negatively affected the secretion profile and paracrine effects of MSCs on myoblasts, with stronger effects observed for scaffold seeded compared to hydrogel encapsulated cells. Together, these findings demonstrate that the therapeutic potency of MSCs can be enhanced by biomaterials that promote cell-cell interactions. Copyright © 2017 Elsevier Ltd. All rights reserved.

Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.

Science.gov (United States)

Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad

2018-02-01

The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.

Complete genome sequence of Bacillus velezensis S3-1, a potential biological pesticide with plant pathogen inhibiting and plant promoting capabilities.

Science.gov (United States)

Jin, Qing; Jiang, Qiuyue; Zhao, Lei; Su, Cuizhu; Li, Songshuo; Si, Fangyi; Li, Shanshan; Zhou, Chenhao; Mu, Yonglin; Xiao, Ming

2017-10-10

Antagonistic soil microorganisms, which are non-toxic, harmless non-pollutants, can effectively reduce the density of pathogenic species by some ways. Bacillus velezensis strain S3-1 was isolated from the rhizosphere soil of cucumber, and was shown to inhibit plant pathogens, promote plant growth and efficiently colonize rhizosphere soils. The strain produced 13 kinds of lipopeptide antibiotics, belonging to the surfactin, iturin and fengycin families. Here, we presented the complete genome sequence of S3-1. The genome consists of one chromosome without plasmids and also contains the biosynthetic gene cluster that encodes difficidin, macrolactin, surfactin and fengycin. The genome contains 86 tRNA genes, 27 rRNA genes and 57 antibiotic-related genes. The complete genome sequence of B. velezensis S3-1 provides useful information to further detect the molecular mechanisms behind antifungal actions, and will facilitate its potential as a biological pesticide in the agricultural industry. Copyright © 2017 Elsevier B.V. All rights reserved.

SPORT PROMOTION STRATEGIES

Directory of Open Access Journals (Sweden)

Alexandru Lucian MIHAI

2013-10-01

Full Text Available In sport marketing, the word promotion covers a range of interrelated activities. All of these activities are designed to attract attention, stimulate the interest and awareness of consumers, and of course, encourage them to purchase a sport product. Promotion is about communicating with and educating consumers. The purpose of a sport promotional strategy is to build brand loyalty and product credibility, develop image, and position the brand. A promotional strategy is similar to a marketing strategy, but the promotional strategy seeks short-term objectives, both direct and indirect. Promotional objectives usually include increased sales, stimulate impulse buying, raise customer traffic, and present and reinforce image. It also provides information about products and services, publicizes new stores or websites, and creates and enhances customer satisfaction.

Potential of wheat bran to promote indigenous microbial enhanced oil recovery.

Science.gov (United States)

Zhan, Yali; Wang, Qinghong; Chen, Chunmao; Kim, Jung Bong; Zhang, Hongdan; Yoza, Brandon A; Li, Qing X

2017-06-01

Microbial enhanced oil recovery (MEOR) is an emerging oil extraction technology that utilizes microorganisms to facilitate recovery of crude oil in depleted petroleum reservoirs. In the present study, effects of wheat bran utilization were investigated on stimulation of indigenous MEOR. Biostimulation conditions were optimized with the response surface methodology. The co-application of wheat bran with KNO 3 and NH 4 H 2 PO 4 significantly promoted indigenous MEOR (IMEOR) and exhibited sequential aerobic (O-), facultative (A n -) and anaerobic (A 0 -) metabolic stages. The surface tension of fermented broth decreased by approximately 35%, and the crude oil was highly emulsified. Microbial community structure varied largely among and in different IMEOR metabolic stages. Pseudomonas sp., Citrobacter sp., and uncultured Burkholderia sp. dominated the O-, A n - and early A 0 -stages. Bacillus sp., Achromobacter sp., Rhizobiales sp., Alcaligenes sp. and Clostridium sp. dominated the later A 0 -stage. This study illustrated occurrences of microbial community succession driven by wheat bran stimulation and its industrial potential.

Development of useful recombinant promoter and its expression analysis in different plant cells using confocal laser scanning microscopy.

Directory of Open Access Journals (Sweden)

Deepak Kumar

Full Text Available BACKGROUND: Designing functionally efficient recombinant promoters having reduced sequence homology and enhanced promoter activity will be an important step toward successful stacking or pyramiding of genes in a plant cell for developing transgenic plants expressing desired traits(s. Also basic knowledge regarding plant cell specific expression of a transgene under control of a promoter is crucial to assess the promoter's efficacy. METHODOLOGY/PRINCIPAL FINDINGS: We have constructed a set of 10 recombinant promoters incorporating different up-stream activation sequences (UAS of Mirabilis mosaic virus sub-genomic transcript (MS8, -306 to +27 and TATA containing core domains of Figwort mosaic virus sub-genomic transcript promoter (FS3, -271 to +31. Efficacies of recombinant promoters coupled to GUS and GFP reporter genes were tested in tobacco protoplasts. Among these, a 369-bp long hybrid sub-genomic transcript promoter (MSgt-FSgt showed the highest activity in both transient and transgenic systems. In a transient system, MSgt-FSgt was 10.31, 2.86 and 2.18 times more active compared to the CaMV35S, MS8 and FS3 promoters, respectively. In transgenic tobacco (Nicotiana tabaccum, var. Samsun NN and Arabidopsis plants, the MSgt-FSgt hybrid promoter showed 14.22 and 7.16 times stronger activity compared to CaMV35S promoter respectively. The correlation between GUS activity and uidA-mRNA levels in transgenic tobacco plants were identified by qRT-PCR. Both CaMV35S and MSgt-FSgt promoters caused gene silencing but the degree of silencing are less in the case of the MSgt-FSgt promoter compared to CaMV35S. Quantification of GUS activity in individual plant cells driven by the MSgt-FSgt and the CaMV35S promoter were estimated using confocal laser scanning microscopy and compared. CONCLUSION AND SIGNIFICANCE: We propose strong recombinant promoter MSgt-FSgt, developed in this study, could be very useful for high-level constitutive expression of transgenes in

Dehydrins from wheat x Thinopyrum ponticum amphiploid increase salinity and drought tolerance under their own inducible promoters without growth retardation.

Science.gov (United States)

Qin, Yu-Xiang; Qin, Fangyuan

2016-02-01

Dehydrins confer abiotic stress tolerance in seedlings, but few dehydrins have been studied by transgenic analysis under their own promoters in relation to abiotic stress tolerance. Also the inducible promoters for transgenic engineering are limited. In this study, we isolated from wheat three salt-induced YSK2 dehydrin genes and their promoters. The cDNA sequences were 711, 785, and 932 bp in length, encoding proteins containing 133, 166 and 231 amino acids, respectively, and were named TaDHN1, TaDHN2, and TaDHN3. TaDHN2 doesn't contain introns, while the other two genes each contain one. Semi-quantitative reverse transcription PCR analysis revealed all three dehydrin genes are substantially induced by ABA and NaCl, but only TaDHN2 is induced in seedlings by PEG and by cold (4 °C). Regulatory sequences upstream of the first translation codon (775, 1615 and 889 bp) of the three dehydrin genes were also cloned. Cis-element prediction indicated the presence of ABRE and other abiotic-stress-related elements. Histochemical analysis using GUS expression demonstrated that all three promoters were induced by ABA, cold or NaCl. Ectopic over-expression of TaDHN1 or TaDHN3 in Arabidopsis under their own inducible promoters enhanced NaCl- and drought-stress tolerance without growth retardation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Enhancing Resources at the Workplace with Health-Promoting Leadership.

Science.gov (United States)

Jiménez, Paul; Bregenzer, Anita; Kallus, K Wolfgang; Fruhwirth, Bianca; Wagner-Hartl, Verena

2017-10-20

Leaders engaging in health-promoting leadership can influence their employees' health directly by showing health awareness or indirectly by changing working conditions. With health-promoting leadership, leaders are able to support a healthy working environment by providing resource-oriented working conditions for their employees to support their health. Changing working conditions in a health-supportive way can prevent possible negative consequences from critical working conditions (e.g., burnout risk). The present study examined the relationship between health-promoting leadership and the employees' resources, stress and burnout. To analyze our proposed model, structural equation modelling was conducted in two samples. The resulting model from the first sample of 228 Austrian workers was cross-validated and could be verified with the second sample (N = 263 Austrian workers). The results supported a model in which health-promoting leadership has a strong direct effect on the employees' resources and an indirect effect on stress and burnout, which was mediated by resources. The results indicate that health-promoting leadership describes the leaders' capability and dedication creating the right working conditions for their employees by increasing the employees' resources at the workplace. This in turn minimizes the risk of experiencing burnout.

Enhancing Resources at the Workplace with Health-Promoting Leadership

Directory of Open Access Journals (Sweden)

Paul Jiménez

2017-10-01

Full Text Available Leaders engaging in health-promoting leadership can influence their employees’ health directly by showing health awareness or indirectly by changing working conditions. With health-promoting leadership, leaders are able to support a healthy working environment by providing resource-oriented working conditions for their employees to support their health. Changing working conditions in a health-supportive way can prevent possible negative consequences from critical working conditions (e.g., burnout risk. The present study examined the relationship between health-promoting leadership and the employees’ resources, stress and burnout. To analyze our proposed model, structural equation modelling was conducted in two samples. The resulting model from the first sample of 228 Austrian workers was cross-validated and could be verified with the second sample (N = 263 Austrian workers. The results supported a model in which health-promoting leadership has a strong direct effect on the employees’ resources and an indirect effect on stress and burnout, which was mediated by resources. The results indicate that health-promoting leadership describes the leaders’ capability and dedication creating the right working conditions for their employees by increasing the employees’ resources at the workplace. This in turn minimizes the risk of experiencing burnout.

Identification and analysis of an efficient dicot constitutive promoter from tomato

International Nuclear Information System (INIS)

Bacha, S.; Khatoon, A.; Asif, M.; Bashir, A.

2015-01-01

The regulatory sequence of sucrose synthase (susy) was explored in HTGS and screened using various bioinformatics tools for promoter prediction and identification of functional regulatory motifs. Transcription start site (TSS) was predicted in the promoter sequence. Species specific motifs were identified by using Plant PAN database. The Plant Care predicted various light responsive, hormone inducible and tissue specific motifs in the full length promoter which may be essential for the constitutive expression governed by this promoter. Full length susy promoter isolated from tomato (Solanum lycopersicum) drove maximum transient expression of GUS gene in various tissues of tobacco, cotton and peas. The susy promoter identified and analyzed in this study is suitable for transgene expression in economically important agricultural crops, especially to avoid strong over-expression. (author)

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

Science.gov (United States)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Synthetic promoter libraries for Corynebacterium glutamicum

DEFF Research Database (Denmark)

Rytter, Jakob Vang; Helmark, Søren; Chen, Jun

2014-01-01

The ability to modulate gene expression is an important genetic tool in systems biology and biotechnology. Here, we demonstrate that a previously published easy and fast PCR-based method for modulating gene expression in lactic acid bacteria is also applicable to Corynebacterium glutamicum. We co...... promoter library (SPL) technology is convenient for modulating gene expression in C. glutamicum and should have many future applications, within basic research as well as for optimizing industrial production organisms....... constructed constitutive promoter libraries based on various combinations of a previously reported C. glutamicum -10 consensus sequence (gngnTA(c/t)aaTgg) and the Escherichia coli -35 consensus, either with or without an AT-rich region upstream. A promoter library based on consensus sequences frequently found...... in low-GC Gram-positive microorganisms was also included. The strongest promoters were found in the library with a -35 region and a C. glutamicum -10 consensus, and this library also represents the largest activity span. Using the alternative -10 consensus TATAAT, which can be found in many other...

MRI of spondylodiscities: contribution of gadolinium-DTPA and fat suppression sequence

International Nuclear Information System (INIS)

Cova, M.A.; Dalla Palma, L.; Pozzi-Mucelli, R.S.; Ricci, C.

1993-01-01

Twenty-six patients with a clinical diagnosis of spondylodiscitis were examined with non-contrast and contrast-enhanced MRI in order to define the contribution of gadolinium-DTPA (Gd-DTPA) and different pulse sequences, including a fat suppression sequence (SPIR). Spin echo (SE) T1-weighted images before and after Gd-DTPA injection and SE T2-weighted images were obtained in all patients. Twelve patients were also examined using the SPIR sequence following Gd-DTPA injection. Signal intensity and morphological features of the disc and vertebral lesions were then evaluated. The SE T1-weighted sequence with Gd-DTPA was very effective in showing the pathological changes at the level of the disc as an area of low signal intensity surrounded by a peripheral rim of enhancement in 24 of 26 cases (92%). This feature was not visible on non-enhanced images. As regards contiguous vertebral lesions this sequence was less informative, since in 8 of 26 cases (31%) the vertebral lesions became isointense and therefore not detectable. In 12 cases there was extension into the surrounding structures (spinal canal and/or paravertebral tissues). An enhanced SE T1-weighted sequence provided good anatomical definition of the extension of the infection in the spinal canal in all cases with this type of involvement (7 of 12). Regarding the 7 cases with paravertebral extension, no extension was visible in 1 case due to the reduced contrast with the surrounding fat following Gd-DTPA injection. The enhanced SPIR sequence was very effective, particularly in detecting the lesions in the vertebral bodies, avoiding the limitation of the enhanced SE T1-weighted sequence. The SPIR sequence was also effective in showing the extension within the spinal canal and the paravertebral fat. On the basis of our results the combination of a SE T1-weighted sequence without contrast and SPIR sequence with Gd-DTPA seems to be the best approach in cases of spondylodiscitis. (orig.)

Deep whole-genome sequencing of 90 Han Chinese genomes.

Science.gov (United States)

Lan, Tianming; Lin, Haoxiang; Zhu, Wenjuan; Laurent, Tellier Christian Asker Melchior; Yang, Mengcheng; Liu, Xin; Wang, Jun; Wang, Jian; Yang, Huanming; Xu, Xun; Guo, Xiaosen

2017-09-01

Next-generation sequencing provides a high-resolution insight into human genetic information. However, the focus of previous studies has primarily been on low-coverage data due to the high cost of sequencing. Although the 1000 Genomes Project and the Haplotype Reference Consortium have both provided powerful reference panels for imputation, low-frequency and novel variants remain difficult to discover and call with accuracy on the basis of low-coverage data. Deep sequencing provides an optimal solution for the problem of these low-frequency and novel variants. Although whole-exome sequencing is also a viable choice for exome regions, it cannot account for noncoding regions, sometimes resulting in the absence of important, causal variants. For Han Chinese populations, the majority of variants have been discovered based upon low-coverage data from the 1000 Genomes Project. However, high-coverage, whole-genome sequencing data are limited for any population, and a large amount of low-frequency, population-specific variants remain uncharacterized. We have performed whole-genome sequencing at a high depth (∼×80) of 90 unrelated individuals of Chinese ancestry, collected from the 1000 Genomes Project samples, including 45 Northern Han Chinese and 45 Southern Han Chinese samples. Eighty-three of these 90 have been sequenced by the 1000 Genomes Project. We have identified 12 568 804 single nucleotide polymorphisms, 2 074 210 short InDels, and 26 142 structural variations from these 90 samples. Compared to the Han Chinese data from the 1000 Genomes Project, we have found 7 000 629 novel variants with low frequency (defined as minor allele frequency genome. Compared to the 1000 Genomes Project, these Han Chinese deep sequencing data enhance the characterization of a large number of low-frequency, novel variants. This will be a valuable resource for promoting Chinese genetics research and medical development. Additionally, it will provide a valuable supplement to the 1000

Prediction of plant promoters based on hexamers and random triplet pair analysis

Directory of Open Access Journals (Sweden)

Noman Nasimul

2011-06-01

Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

Does decentralisation enhance a school's role of promoting social cohesion? Bosnian school leaders' perceptions of school governance

Science.gov (United States)

Komatsu, Taro

2014-05-01

This study seeks to understand whether and how decentralised school governance in Bosnia and Herzegovina (BiH) enhances the schools' role of promoting social cohesion. This includes increasing "horizontal" trust among different ethnic groups and "vertical" trust between civilians and public institutes. The study examined secondary school leaders' perceptions regarding school board influence on social cohesion policies and practices, their interactions with school board members, and their accountability to the school-based governing body. The results show that school leaders and school boards, supposedly representing the interests of local stakeholders, did not appear to be actively engaged in the deliberate process of promoting social cohesion. While school directors tended to view themselves as being independent from the school boards, ethnically diverse school boards provided important support to proactive school leaders for their inter-group activities. Given that the central level is not providing initiatives to promote social cohesion and that BiH citizens appear to generally support social cohesion, decentralised school governance has the potential to improve social trust from the bottom up. To promote participatory school governance, the study recommends that BiH school leaders should be provided with opportunities to re-examine and redefine their professional accountability and to assist local stakeholders to improve their involvement in school governance.

Enhanced precipitation promotes decomposition and soil C stabilization in semiarid ecosystems, but seasonal timing of wetting matters

Science.gov (United States)

Campos, Xochi; Germino, Matthew; de Graaff, Marie-Anne

2017-01-01

AimsChanging precipitation regimes in semiarid ecosystems will affect the balance of soil carbon (C) input and release, but the net effect on soil C storage is unclear. We asked how changes in the amount and timing of precipitation affect litter decomposition, and soil C stabilization in semiarid ecosystems.MethodsThe study took place at a long-term (18 years) ecohydrology experiment located in Idaho. Precipitation treatments consisted of a doubling of annual precipitation (+200 mm) added either in the cold-dormant season or in the growing season. Experimental plots were planted with big sagebrush (Artemisia tridentata), or with crested wheatgrass (Agropyron cristatum). We quantified decomposition of sagebrush leaf litter, and we assessed organic soil C (SOC) in aggregates, and silt and clay fractions.ResultsWe found that: (1) increased precipitation applied in the growing season consistently enhanced decomposition rates relative to the ambient treatment, and (2) precipitation applied in the dormant season enhanced soil C stabilization.ConclusionsThese data indicate that prolonged increases in precipitation can promote soil C storage in semiarid ecosystems, but only if these increases happen at times of the year when conditions allow for precipitation to promote plant C inputs rates to soil.

Characterization of Aftershock Sequences from Large Strike-Slip Earthquakes Along Geometrically Complex Faults

Science.gov (United States)

Sexton, E.; Thomas, A.; Delbridge, B. G.

2017-12-01

Large earthquakes often exhibit complex slip distributions and occur along non-planar fault geometries, resulting in variable stress changes throughout the region of the fault hosting aftershocks. To better discern the role of geometric discontinuities on aftershock sequences, we compare areas of enhanced and reduced Coulomb failure stress and mean stress for systematic differences in the time dependence and productivity of these aftershock sequences. In strike-slip faults, releasing structures, including stepovers and bends, experience an increase in both Coulomb failure stress and mean stress during an earthquake, promoting fluid diffusion into the region and further failure. Conversely, Coulomb failure stress and mean stress decrease in restraining bends and stepovers in strike-slip faults, and fluids diffuse away from these areas, discouraging failure. We examine spatial differences in seismicity patterns along structurally complex strike-slip faults which have hosted large earthquakes, such as the 1992 Mw 7.3 Landers, the 2010 Mw 7.2 El-Mayor Cucapah, the 2014 Mw 6.0 South Napa, and the 2016 Mw 7.0 Kumamoto events. We characterize the behavior of these aftershock sequences with the Epidemic Type Aftershock-Sequence Model (ETAS). In this statistical model, the total occurrence rate of aftershocks induced by an earthquake is λ(t) = λ_0 + \\sum_{i:t_i

Dual‑sensitive HRE/Egr1 promoter regulates Smac overexpression and enhances radiation‑induced A549 human lung adenocarcinoma cell death under hypoxia.

Science.gov (United States)

Li, Chang-Feng; Chen, Li-Bo; Li, Dan-Dan; Yang, Lei; Zhang, Bao-Gang; Jin, Jing-Peng; Zhang, Ying; Zhang, Bin

2014-08-01

The aim of this study was to construct an expression vector carrying the hypoxia/radiation dual‑sensitive chimeric hypoxia response element (HRE)/early growth response 1 (Egr‑1) promoter in order to overexpress the therapeutic second mitochondria‑derived activator of caspases (Smac). Using this expression vector, the present study aimed to explore the molecular mechanism underlying radiotherapy‑induced A549 human lung adenocarcinoma cell death and apoptosis under hypoxia. The plasmids, pcDNA3.1‑Egr1‑Smac (pE‑Smac) and pcDNA3.1‑HRE/Egr-1‑Smac (pH/E‑Smac), were constructed and transfected into A549 human lung adenocarcinoma cells using the liposome method. CoCl2 was used to chemically simulate hypoxia, followed by the administration of 2 Gy X‑ray irradiation. An MTT assay was performed to detect cell proliferation and an Annexin V‑fluorescein isothiocyanate apoptosis detection kit was used to detect apoptosis. Quantitative polymerase chain reaction and western blot analyses were used for the detection of mRNA and protein expression, respectively. Infection with the pE‑Smac and pH/E‑Smac plasmids in combination with radiation and/or hypoxia was observed to enhance the expression of Smac. Furthermore, Smac overexpression was found to enhance the radiation‑induced inhibition of cell proliferation and promotion of cycle arrest and apoptosis. The cytochrome c/caspase‑9/caspase‑3 pathway was identified to be involved in this regulation of apoptosis. Plasmid infection in combination with X‑ray irradiation was found to markedly induce cell death under hypoxia. In conclusion, the hypoxia/radiation dual‑sensitive chimeric HRE/Egr‑1 promoter was observed to enhance the expression of the therapeutic Smac, as well as enhance the radiation‑induced inhibition of cell proliferation and promotion of cycle arrest and apoptosis under hypoxia. This apoptosis was found to involve the mitochondrial pathway.

Next-Generation Sequencing in the Mycology Lab.

Science.gov (United States)

Zoll, Jan; Snelders, Eveline; Verweij, Paul E; Melchers, Willem J G

New state-of-the-art techniques in sequencing offer valuable tools in both detection of mycobiota and in understanding of the molecular mechanisms of resistance against antifungal compounds and virulence. Introduction of new sequencing platform with enhanced capacity and a reduction in costs for sequence analysis provides a potential powerful tool in mycological diagnosis and research. In this review, we summarize the applications of next-generation sequencing techniques in mycology.

Geoheritage, Geotourism and the Cultural Landscape: Enhancing the Visitor Experience and Promoting Geoconservation

Directory of Open Access Journals (Sweden)

John E. Gordon

2018-04-01

Full Text Available Geotourism spans a range of visitor interests, from the specialist geotourist to the more general visitor. As well as supporting geoconservation outcomes, it provides economic, cultural, relational and social benefits for both visitors and host communities. The interconnections between geoheritage and the cultural components of the landscape have antecedents in concepts of landscape aesthetics in different cultures. These interconnections provide a range of opportunities for enhancing the geotourist experience and promoting geoconservation and geoeducation by means of activities that involve aesthetic and emotional experiences and interpretation through different cultural filters that encourage the rediscovery of a sense of wonder both about the geological stories in the landscape and the human interactions. A cultural ecosystem services framework provides a holistic approach for informing conservation policy, management and planning for geotourism, enabling assessment of multiple benefits and trade-offs for visitors and communities based on the values of the geoheritage assets. Geotourism studies could also benefit from integration of existing theory, conceptual analysis and practice from broader heritage and nature-based tourism and closer collaboration with relevant social sciences. Adhering to sound geoethical practice is an essential part of geotourism, which can also play a role in the promotion of geoethics among the public and professionals.

Identification of distal silencing elements in the murine interferon-A11 gene promoter.

Science.gov (United States)

Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

1996-08-01

The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.

Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty.

Science.gov (United States)

Toro, Carlos A; Wright, Hollis; Aylwin, Carlos F; Ojeda, Sergio R; Lomniczi, Alejandro

2018-01-04

Polycomb group (PcG) proteins control the timing of puberty by repressing the Kiss1 gene in hypothalamic arcuate nucleus (ARC) neurons. Here we identify two members of the Trithorax group (TrxG) of modifiers, mixed-lineage leukemia 1 (MLL1), and 3 (MLL3), as central components of an activating epigenetic machinery that dynamically counteracts PcG repression. Preceding puberty, MLL1 changes the chromatin configuration at the promoters of Kiss1 and Tac3, two genes required for puberty to occur, from repressive to permissive. Concomitantly, MLL3 institutes a chromatin structure that changes the functional status of a Kiss1 enhancer from poised to active. RNAi-mediated, ARC-specific Mll1 knockdown reduced Kiss1 and Tac3 expression, whereas CRISPR-Cas9-directed epigenome silencing of the Kiss1 enhancer selectively reduced Kiss1 activity. Both interventions delay puberty and disrupt reproductive cyclicity. Our results demonstrate that an epigenetic switch from transcriptional repression to activation is crucial to the regulatory mechanism controlling the timing of mammalian puberty.

Promoter-enhancer interactions identified from Hi-C data using probabilistic models and hierarchical topological domains.

Science.gov (United States)

Ron, Gil; Globerson, Yuval; Moran, Dror; Kaplan, Tommy

2017-12-21

Proximity-ligation methods such as Hi-C allow us to map physical DNA-DNA interactions along the genome, and reveal its organization into topologically associating domains (TADs). As the Hi-C data accumulate, computational methods were developed for identifying domain borders in multiple cell types and organisms. Here, we present PSYCHIC, a computational approach for analyzing Hi-C data and identifying promoter-enhancer interactions. We use a unified probabilistic model to segment the genome into domains, which we then merge hierarchically and fit using a local background model, allowing us to identify over-represented DNA-DNA interactions across the genome. By analyzing the published Hi-C data sets in human and mouse, we identify hundreds of thousands of putative enhancers and their target genes, and compile an extensive genome-wide catalog of gene regulation in human and mouse. As we show, our predictions are highly enriched for ChIP-seq and DNA accessibility data, evolutionary conservation, eQTLs and other DNA-DNA interaction data.

Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans

Directory of Open Access Journals (Sweden)

Wang Xiaoqin

2005-10-01

Full Text Available Abstract Background Defective insulin secretion is a key defect in the pathogenesis of type 2 diabetes (T2DM. The β-cell specific transcription factor, insulin promoter factor 1 gene (IPF1, is essential to pancreatic development and the maintenance of β-cell mass. We hypothesized that regulatory or coding variants in IPF1 contribute to defective insulin secretion and thus T2DM. Methods We screened 71 Caucasian and 69 African American individuals for genetic variants in the promoter region, three highly conserved upstream regulatory sequences (PH1, PH2 and PH3, the human β-cell specific enhancer, and the two exons with adjacent introns. We tested for an association of each variant with T2DM Caucasians (192 cases and 192 controls and African Americans (341 cases and 186 controls. Results We identified 8 variants in the two populations, including a 3 bp insertion in exon 2 (InsCCG243 in African Americans that resulted in an in-frame proline insertion in the transactivation domain. No variant was associated with T2DM in Caucasians, but polymorphisms at -3766 in the human β-cell enhancer, at -2877 bp in the PH1 domain, and at -108 bp in the promoter region were associated with T2DM in African American subjects (p Conculsion The common alleles of regulatory variants in the 5' enhancer and promoter regions of the IPF1 gene increase susceptibility to type 2 diabetes among African American individuals, likely as a result of gene-gene or gene-environment interactions. In contrast, IPF1 is not a cause of type 2 diabetes in Caucasians. A previously described InsCCG243 variant may contribute to diabetes susceptibility in African American individuals, but is of low penetrance.

Hypoxia-induced mitogenic factor enhances angiogenesis by promoting proliferation and migration of endothelial cells

International Nuclear Information System (INIS)

Tong Qiangsong; Zheng Liduan; Li Bo; Wang Danming; Huang Chuanshu; Matuschak, George M.; Li Dechun

2006-01-01

Our previous studies have indicated that hypoxia-induced mitogenic factor (HIMF) has angiogenic properties in an in vivo matrigel plug model and HIMF upregulates expression of vascular endothelial growth factor (VEGF) in mouse lungs and cultured lung epithelial cells. However, whether HIMF exerts angiogenic effects through modulating endothelial cell function remains unknown. In this study, mouse aortic rings cultured with recombinant HIMF protein resulted in enhanced vascular sprouting and increased endothelial cell spreading as confirmed by Dil-Ac-LDL uptake, von Willebrand factor and CD31 staining. In cultured mouse endothelial cell line SVEC 4-10, HIMF dose-dependently enhanced cell proliferation, in vitro migration and tubulogenesis, which was not attenuated by SU1498, a VEGFR2/Flk-1 receptor tyrosine kinase inhibitor. Moreover, HIMF stimulation resulted in phosphorylation of Akt, p38 and ERK1/2 kinases in SVEC 4-10 cells. Treatment of mouse aortic rings and SVEC 4-10 cells with LY294002, but not SB203580, PD098059 or U0126, abolished HIMF-induced vascular sprouting and angiogenic responses. In addition, transfection of a dominant-negative mutant of phosphatidylinositol 3-kinase (PI-3K), Δp85, blocked HIMF-induced phosphorylation of Akt, endothelial activation and tubulogenesis. These results indicate that HIMF enhances angiogenesis by promoting proliferation and migration of endothelial cells via activation of the PI-3K/Akt pathways

Silk-based biomaterials functionalized with fibronectin type II promotes cell adhesion.

Science.gov (United States)

Pereira, Ana Margarida; Machado, Raul; da Costa, André; Ribeiro, Artur; Collins, Tony; Gomes, Andreia C; Leonor, Isabel B; Kaplan, David L; Reis, Rui L; Casal, Margarida

2017-01-01

The objective of this work was to exploit the fibronectin type II (FNII) module from human matrix metalloproteinase-2 as a functional domain for the development of silk-based biopolymer blends that display enhanced cell adhesion properties. The DNA sequence of spider dragline silk protein (6mer) was genetically fused with the FNII coding sequence and expressed in Escherichia coli. The chimeric protein 6mer+FNII was purified by non-chromatographic methods. Films prepared from 6mer+FNII by solvent casting promoted only limited cell adhesion of human skin fibroblasts. However, the performance of the material in terms of cell adhesion was significantly improved when 6mer+FNII was combined with a silk-elastin-like protein in a concentration-dependent behavior. With this work we describe a novel class of biopolymer that promote cell adhesion and potentially useful as biomaterials for tissue engineering and regenerative medicine. This work reports the development of biocompatible silk-based composites with enhanced cell adhesion properties suitable for biomedical applications in regenerative medicine. The biocomposites were produced by combining a genetically engineered silk-elastin-like protein with a genetically engineered spider-silk-based polypeptide carrying the three domains of the fibronectin type II module from human metalloproteinase-2. These composites were processed into free-standing films by solvent casting and characterized for their biological behavior. To our knowledge this is the first report of the exploitation of all three FNII domains as a functional domain for the development of bioinspired materials with improved biological performance. The present study highlights the potential of using genetically engineered protein-based composites as a platform for the development of new bioinspired biomaterials. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Functional analysis of human and chimpanzee promoters.

Science.gov (United States)

Heissig, Florian; Krause, Johannes; Bryk, Jaroslaw; Khaitovich, Philipp; Enard, Wolfgang; Pääbo, Svante

2005-01-01

It has long been argued that changes in gene expression may provide an additional and crucial perspective on the evolutionary differences between humans and chimpanzees. To investigate how often expression differences seen in tissues are caused by sequence differences in the proximal promoters, we tested the expression activity in cultured cells of human and chimpanzee promoters from genes that differ in mRNA expression between human and chimpanzee tissues. Twelve promoters for which the corresponding gene had been shown to be differentially expressed between humans and chimpanzees in liver or brain were tested. Seven showed a significant difference in activity between the human promoter and the orthologous chimpanzee promoter in at least one of the two cell lines used. However, only three of them showed a difference in the same direction as in the tissues. Differences in proximal promoter activity are likely to be common between humans and chimpanzees, but are not linked in a simple fashion to gene-expression levels in tissues. This suggests that several genetic differences between humans and chimpanzees might be responsible for a single expression difference and thus that relevant expression differences between humans and chimpanzees will be difficult to predict from cell culture experiments or DNA sequences.

ABS: Sequence alignment by scanning

KAUST Repository

Bonny, Mohamed Talal; Salama, Khaled N.

2011-01-01

Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the 'Needleman-Wunsch' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

ABS: Sequence alignment by scanning

KAUST Repository

Bonny, Mohamed Talal

2011-08-01

Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

Fast global sequence alignment technique

KAUST Repository

Bonny, Mohamed Talal

2011-11-01

Bioinformatics database is growing exponentially in size. Processing these large amount of data may take hours of time even if super computers are used. One of the most important processing tool in Bioinformatics is sequence alignment. We introduce fast alignment algorithm, called \\'Alignment By Scanning\\' (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the wellknown sequence alignment algorithms, the \\'GAP\\' (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 51% enhancement in alignment score when it is compared with the GAP Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

Enhancing synergies in a collaborative environment

CERN Document Server

Maeso-González, Elvira; Escudero-Santana, Alejandro

2015-01-01

This volume contains a selection of the best papers presented at the 8th International Conference on Industrial Engineering and Industrial Management, Engineering International Conference on Industrial Engineering and Operations Management, and International IIE Conference 2014,  hosted by ADINGOR, ABEPRO and the IIE, whose mission is to promote links between researchers and practitioners from different branches, to enhance an interdisciplinary perspective of industrial engineering and management.  The conference topics covered: operations research, modelling and simulation, computer and information systems, operations research, scheduling and sequencing, logistics, production and information systems, supply chain and logistics, transportation, lean management, production planning and control, production system design, reliability and maintenance, quality management, sustainability and eco-efficiency, marketing and consumer behavior, business administration and strategic management, economic and financial m...

Exploring plant growth-promotion actinomycetes from vermicompost and rhizosphere soil for yield enhancement in chickpea

Science.gov (United States)

Sreevidya, M.; Gopalakrishnan, S.; Kudapa, H.; Varshney, R.K.

2016-01-01

The main objective of the present study was to isolate and characterize actinomycetes for their plant growth-promotion in chickpea. A total of 89 actinomycetes were screened for their antagonism against fungal pathogens of chickpea by dual culture and metabolite production assays. Four most promising actinomycetes were evaluated for their physiological and plant growth-promotion properties under in vitro and in vivo conditions. All the isolates exhibited good growth at temperatures from 20 °C to 40 °C, pH range of 7–11 and NaCl concentrations up to 8%. These were also found highly tolerant to Bavistin, slightly tolerant to Thiram and Captan (except VAI-7 and VAI-40) but susceptible to Benlate and Ridomil at field application levels and were found to produce siderophore, cellulase, lipase, protease, chitinase (except VAI-40), hydrocyanic acid (except VAI-7 and VAI-40), indole acetic acid and β-1,3-glucanase. When the four actinomycetes were evaluated for their plant growth-promotion properties under field conditions on chickpea, all exhibited increase in nodule number, shoot weight and yield. The actinomycetes treated plots enhanced total N, available P and organic C over the un-inoculated control. The scanning electron microscope studies exhibited extensive colonization by actinomycetes on the root surface of chickpea. The expression profiles for indole acetic acid, siderophore and β-1,3-glucanase genes exhibited up-regulation for all three traits and in all four isolates. The actinomycetes were identified as Streptomyces but different species in the 16S rDNA analysis. It was concluded that the selected actinomycetes have good plant growth-promotion and biocontrol potentials on chickpea. PMID:26887230

Exploring plant growth-promotion actinomycetes from vermicompost and rhizosphere soil for yield enhancement in chickpea

Directory of Open Access Journals (Sweden)

M. Sreevidya

2016-03-01

Full Text Available Abstract The main objective of the present study was to isolate and characterize actinomycetes for their plant growth-promotion in chickpea. A total of 89 actinomycetes were screened for their antagonism against fungal pathogens of chickpea by dual culture and metabolite production assays. Four most promising actinomycetes were evaluated for their physiological and plant growth-promotion properties under in vitro and in vivo conditions. All the isolates exhibited good growth at temperatures from 20 °C to 40 °C, pH range of 7–11 and NaCl concentrations up to 8%. These were also found highly tolerant to Bavistin, slightly tolerant to Thiram and Captan (except VAI-7 and VAI-40 but susceptible to Benlate and Ridomil at field application levels and were found to produce siderophore, cellulase, lipase, protease, chitinase (except VAI-40, hydrocyanic acid (except VAI-7 and VAI-40, indole acetic acid and β-1,3-glucanase. When the four actinomycetes were evaluated for their plant growth-promotion properties under field conditions on chickpea, all exhibited increase in nodule number, shoot weight and yield. The actinomycetes treated plots enhanced total N, available P and organic C over the un-inoculated control. The scanning electron microscope studies exhibited extensive colonization by actinomycetes on the root surface of chickpea. The expression profiles for indole acetic acid, siderophore and β-1,3-glucanase genes exhibited up-regulation for all three traits and in all four isolates. The actinomycetes were identified as Streptomyces but different species in the 16S rDNA analysis. It was concluded that the selected actinomycetes have good plant growth-promotion and biocontrol potentials on chickpea.

Mass spectrometry for identification of proteins that specifically bind to a distal enhancer of the Oct4 gene

Science.gov (United States)

Bakhmet, E. I.; Nazarov, I. B.; Artamonova, T. O.; Khodorkovsky, M. A.; Tomilin, A. N.

2017-11-01

Transcription factor Oct4 is a marker of pluripotent stem cells and has a significant role in their self-renewal. Oct4 gene is controlled by three cis-regulatory elements - proximal promoter, proximal enhancer and distal enhancer. All of these elements are targets for binding of regulatory proteins. Distal enhancer is in our research focus because of its activity in early stages of embryonic development. There are two main sequences called site 2A and site 2B that are presented in distal enhancer. For this moment proteins which bind to a site 2A (CCCCTCCCCCC) remain unknown. Using combination of in vitro method electrophoretic mobility shift assay (EMSA) and mass spectromery we identified several candidates that can regulate Oct4 gene expression through site 2A.

Co-expression of interleukin 12 enhances antitumor effects of a novel chimeric promoter-mediated suicide gene therapy in an immunocompetent mouse model

International Nuclear Information System (INIS)

Xu, Yu; Liu, Zhengchun; Kong, Haiyan; Sun, Wenjie; Liao, Zhengkai; Zhou, Fuxiang; Xie, Conghua

2011-01-01

Highlights: → A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. → The promoter was characterized with radiation-inducibility and tumor-specificity. → Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. → Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.

Co-expression of interleukin 12 enhances antitumor effects of a novel chimeric promoter-mediated suicide gene therapy in an immunocompetent mouse model

Energy Technology Data Exchange (ETDEWEB)

Xu, Yu, E-mail: xuyu1001@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liu, Zhengchun, E-mail: l135027@126.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Kong, Haiyan, E-mail: suppleant@163.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Sun, Wenjie, E-mail: wendy11240325@163.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liao, Zhengkai, E-mail: fastbeta@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Zhou, Fuxiang, E-mail: happyzhoufx@sina.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Xie, Conghua, E-mail: chxie_65@hotmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); and others

2011-09-09

Highlights: {yields} A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. {yields} The promoter was characterized with radiation-inducibility and tumor-specificity. {yields} Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. {yields} Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.

Secretion of mature mouse interleukin-2 by Saccharomyces cerevisiae: use of a general secretion vector containing promoter and leader sequences of the mating pheromone alpha-factor.

Science.gov (United States)

Miyajima, A; Bond, M W; Otsu, K; Arai, K; Arai, N

1985-01-01

We have constructed a general expression vector which allows the synthesis and secretion of processed gene products in Saccharomyces cerevisiae. This vector contains yeast DNA, including the promoter of the mating pheromone (alpha-factor), its downstream leader sequence, and the TRP5 terminator. A cDNA [encoding mature mouse interleukin-2 (IL-2); Yokota et al., Proc. Natl. Acad. Sci. USA 82 (1984) 68-72] was fused immediately downstream to the alpha-factor leader sequence. The resulting recombinant plasmid directed the synthesis of mature mouse IL-2 in S. cerevisiae, with most of the T-cell growth-factor (TCGF) activity secreted into the culture fluid and extracellular space. TCGF activities in the cell extract, as well as in the culture fluid, increased in parallel with cell growth. Production of mature mouse IL-2 was inhibited by tunicamycin (TM), with precursor molecules accumulating in the cell extract. The precursor was processed accurately at the junction between the alpha-factor peptide leader sequence and the coding sequence downstream, yielding mature IL-2. The Mr of the secreted mouse IL-2 determined by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) was 17 kDal, a value expected for the mature mouse IL-2 polypeptide based on the nucleotide (nt) sequence.

Very high resolution single pass HLA genotyping using amplicon sequencing on the 454 next generation DNA sequencers: Comparison with Sanger sequencing.

Science.gov (United States)

Yamamoto, F; Höglund, B; Fernandez-Vina, M; Tyan, D; Rastrou, M; Williams, T; Moonsamy, P; Goodridge, D; Anderson, M; Erlich, H A; Holcomb, C L

2015-12-01

Compared to Sanger sequencing, next-generation sequencing offers advantages for high resolution HLA genotyping including increased throughput, lower cost, and reduced genotype ambiguity. Here we describe an enhancement of the Roche 454 GS GType HLA genotyping assay to provide very high resolution (VHR) typing, by the addition of 8 primer pairs to the original 14, to genotype 11 HLA loci. These additional amplicons help resolve common and well-documented alleles and exclude commonly found null alleles in genotype ambiguity strings. Simplification of workflow to reduce the initial preparation effort using early pooling of amplicons or the Fluidigm Access Array™ is also described. Performance of the VHR assay was evaluated on 28 well characterized cell lines using Conexio Assign MPS software which uses genomic, rather than cDNA, reference sequence. Concordance was 98.4%; 1.6% had no genotype assignment. Of concordant calls, 53% were unambiguous. To further assess the assay, 59 clinical samples were genotyped and results compared to unambiguous allele assignments obtained by prior sequence-based typing supplemented with SSO and/or SSP. Concordance was 98.7% with 58.2% as unambiguous calls; 1.3% could not be assigned. Our results show that the amplicon-based VHR assay is robust and can replace current Sanger methodology. Together with software enhancements, it has the potential to provide even higher resolution HLA typing. Copyright © 2015. Published by Elsevier Inc.

Identification of Cis-Acting Promoter Elements in Cold- and Dehydration-Induced Transcriptional Pathways in Arabidopsis, Rice, and Soybean

Science.gov (United States)

Maruyama, Kyonoshin; Todaka, Daisuke; Mizoi, Junya; Yoshida, Takuya; Kidokoro, Satoshi; Matsukura, Satoko; Takasaki, Hironori; Sakurai, Tetsuya; Yamamoto, Yoshiharu Y.; Yoshiwara, Kyouko; Kojima, Mikiko; Sakakibara, Hitoshi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

2012-01-01

The genomes of three plants, Arabidopsis (Arabidopsis thaliana), rice (Oryza sativa), and soybean (Glycine max), have been sequenced, and their many genes and promoters have been predicted. In Arabidopsis, cis-acting promoter elements involved in cold- and dehydration-responsive gene expression have been extensively analysed; however, the characteristics of such cis-acting promoter sequences in cold- and dehydration-inducible genes of rice and soybean remain to be clarified. In this study, we performed microarray analyses using the three species, and compared characteristics of identified cold- and dehydration-inducible genes. Transcription profiles of the cold- and dehydration-responsive genes were similar among these three species, showing representative upregulated (dehydrin/LEA) and downregulated (photosynthesis-related) genes. All (46 = 4096) hexamer sequences in the promoters of the three species were investigated, revealing the frequency of conserved sequences in cold- and dehydration-inducible promoters. A core sequence of the abscisic acid-responsive element (ABRE) was the most conserved in dehydration-inducible promoters of all three species, suggesting that transcriptional regulation for dehydration-inducible genes is similar among these three species, with the ABRE-dependent transcriptional pathway. In contrast, for cold-inducible promoters, the conserved hexamer sequences were diversified among these three species, suggesting the existence of diverse transcriptional regulatory pathways for cold-inducible genes among the species. PMID:22184637

Complete genome sequence of Serratia plymuthica strain AS12

Energy Technology Data Exchange (ETDEWEB)

Neupane, Saraswoti [Uppsala University, Uppsala, Sweden; Finlay, Roger D. [Uppsala University, Uppsala, Sweden; Alstrom, Sadhna [Uppsala University, Uppsala, Sweden; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Chertkov, Olga [Los Alamos National Laboratory (LANL); Han, James [U.S. Department of Energy, Joint Genome Institute; Han, Cliff [Los Alamos National Laboratory (LANL); Tapia, Roxanne [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Hogberg, Nils [Uppsala University, Uppsala, Sweden

2012-01-01

A plant associated member of the family Enterobacteriaceae, Serratia plymuthica strain AS12 was isolated from rapeseed roots. It is of scientific interest due to its plant growth promoting and plant pathogen inhibiting ability. The genome of S. plymuthica AS12 comprises a 5,443,009 bp long circular chromosome, which consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome was sequenced within the 2010 DOE-JGI Community Sequencing Program (CSP2010) as part of the project entitled 'Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens'.

Stromal Adipocyte Enhancer-binding Protein (AEBP1) Promotes Mammary Epithelial Cell Hyperplasia via Proinflammatory and Hedgehog Signaling*

Science.gov (United States)

Holloway, Ryan W.; Bogachev, Oleg; Bharadwaj, Alamelu G.; McCluskey, Greg D.; Majdalawieh, Amin F.; Zhang, Lei; Ro, Hyo-Sung

2012-01-01

Disruption of mammary stromal-epithelial communication leads to aberrant mammary gland development and induces mammary tumorigenesis. Macrophages have been implicated in carcinogenesis primarily by creating an inflammatory microenvironment, which promotes growth of the adjacent epithelial cells. Adipocyte enhancer-binding protein 1 (AEBP1), a novel proinflammatory mediator, promotes macrophage inflammatory responsiveness by inducing NF-κB activity, which has been implicated in tumor cell growth and survival by aberrant sonic hedgehog (Shh) expression. Here, we show that stromal macrophage AEBP1 overexpression results in precocious alveologenesis in the virgin AEBP1 transgenic (AEBP1TG) mice, and the onset of ductal hyperplasia was accelerated in AEBP1TG mice fed a high fat diet, which induces endogenous AEBP1 expression. Transplantation of AEBP1TG bone marrow cells into non-transgenic (AEBP1NT) mice resulted in alveolar hyperplasia with up-regulation of NF-κB activity and TNFα expression as displayed in the AEBP1TG mammary macrophages and epithelium. Shh expression was induced in AEBP1TG macrophages and RAW264.7 macrophages overexpressing AEBP1. The Shh target genes Gli1 and Bmi1 expression was induced in the AEBP1TG mammary epithelium and HC11 mammary epithelial cells co-cultured with AEBP1TG peritoneal macrophages. The conditioned AEBP1TG macrophage culture media promoted NF-κB activity and survival signal, Akt activation, in HC11 cells, whereas such effects were abolished by TNFα neutralizing antibody treatment. Furthermore, HC11 cells displayed enhanced proliferation in response to AEBP1TG macrophages and their conditioned media. Our findings highlight the role of AEBP1 in the signaling pathways regulating the cross-talk between mammary epithelium and stroma that could predispose the mammary tissue to tumorigenesis. PMID:22995915

Stromal adipocyte enhancer-binding protein (AEBP1) promotes mammary epithelial cell hyperplasia via proinflammatory and hedgehog signaling.

Science.gov (United States)

Holloway, Ryan W; Bogachev, Oleg; Bharadwaj, Alamelu G; McCluskey, Greg D; Majdalawieh, Amin F; Zhang, Lei; Ro, Hyo-Sung

2012-11-09

Disruption of mammary stromal-epithelial communication leads to aberrant mammary gland development and induces mammary tumorigenesis. Macrophages have been implicated in carcinogenesis primarily by creating an inflammatory microenvironment, which promotes growth of the adjacent epithelial cells. Adipocyte enhancer-binding protein 1 (AEBP1), a novel proinflammatory mediator, promotes macrophage inflammatory responsiveness by inducing NF-κB activity, which has been implicated in tumor cell growth and survival by aberrant sonic hedgehog (Shh) expression. Here, we show that stromal macrophage AEBP1 overexpression results in precocious alveologenesis in the virgin AEBP1 transgenic (AEBP1(TG)) mice, and the onset of ductal hyperplasia was accelerated in AEBP1(TG) mice fed a high fat diet, which induces endogenous AEBP1 expression. Transplantation of AEBP1(TG) bone marrow cells into non-transgenic (AEBP1(NT)) mice resulted in alveolar hyperplasia with up-regulation of NF-κB activity and TNFα expression as displayed in the AEBP1(TG) mammary macrophages and epithelium. Shh expression was induced in AEBP1(TG) macrophages and RAW264.7 macrophages overexpressing AEBP1. The Shh target genes Gli1 and Bmi1 expression was induced in the AEBP1(TG) mammary epithelium and HC11 mammary epithelial cells co-cultured with AEBP1(TG) peritoneal macrophages. The conditioned AEBP1(TG) macrophage culture media promoted NF-κB activity and survival signal, Akt activation, in HC11 cells, whereas such effects were abolished by TNFα neutralizing antibody treatment. Furthermore, HC11 cells displayed enhanced proliferation in response to AEBP1(TG) macrophages and their conditioned media. Our findings highlight the role of AEBP1 in the signaling pathways regulating the cross-talk between mammary epithelium and stroma that could predispose the mammary tissue to tumorigenesis.

Root bacterial endophytes confer drought resistance and enhance expression and activity of a vacuolar H+ -pumping pyrophosphatase in pepper plants.

Science.gov (United States)

Vigani, Gianpiero; Rolli, Eleonora; Marasco, Ramona; Dell'Orto, Marta; Michoud, Grégoire; Soussi, Asma; Raddadi, Noura; Borin, Sara; Sorlini, Claudia; Zocchi, Graziano; Daffonchio, Daniele

2018-05-22

It has been previously shown that the transgenic overexpression of the plant root vacuolar proton pumps H + -ATPase (V-ATPase) and H + -PPase (V-PPase) confer tolerance to drought. Since plant-root endophytic bacteria can also promote drought tolerance, we hypothesize that such promotion can be associated to the enhancement of the host vacuolar proton pumps expression and activity. To test this hypothesis, we selected two endophytic bacteria endowed with an array of in vitro plant growth promoting traits. Their genome sequences confirmed the presence of traits previously shown to confer drought resistance to plants, such as the synthesis of nitric oxide and of organic volatile organic compounds. We used the two strains on pepper (Capsicuum annuum L.) because of its high sensitivity to drought. Under drought conditions, both strains stimulated a larger root system and enhanced the leaves' photosynthetic activity. By testing the expression and activity of the vacuolar proton pumps, H + -ATPase (V-ATPase) and H + -PPase (V-PPase), we found that bacterial colonization enhanced V-PPase only. We conclude that the enhanced expression and activity of V-PPase can be favoured by the colonization of drought-tolerance-inducing bacterial endophytes. This article is protected by copyright. All rights reserved. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.

Recurrent TERT promoter mutations identified in a large-scale study of multiple tumor types are associated with increased TERT expression and telomerase activation

Science.gov (United States)

Huang, Dong-Sheng; Wang, Zhaohui; He, Xu-Jun; Diplas, Bill H.; Yang, Rui; Killela, Patrick J.; Liang, Junbo; Meng, Qun; Ye, Zai-Yuan; Wang, Wei; Jiang, Xiao-Ting; Xu, Li; He, Xiang-Lei; Zhao, Zhong-Sheng; Xu, Wen-Juan; Wang, Hui-Ju; Ma, Ying-Yu; Xia, Ying-Jie; Li, Li; Zhang, Ru-Xuan; Jin, Tao; Zhao, Zhong-Kuo; Xu, Ji; Yu, Sheng; Wu, Fang; Wang, Si-Zhen; Jiao, Yu-Chen; Yan, Hai; Tao, Hou-Quan

2015-01-01

Background Several somatic mutation hotspots were recently identified in the TERT promoter region in human cancers. Large scale studies of these mutations in multiple tumor types are limited, in particular in Asian populations. This study aimed to: analyze TERT promoter mutations in multiple tumor types in a large Chinese patient cohort, investigate novel tumor types and assess the functional significance of the mutations. Methods TERT promoter mutation status was assessed by Sanger sequencing for 13 different tumor types and 799 tumor tissues from Chinese cancer patients. Thymic epithelial tumors, gastrointestinal leiomyoma, and gastric schwannoma were included, for which the TERT promoter has not been previously sequenced. Functional studies included TERT expression by RT-qPCR, telomerase activity by the TRAP assay, and promoter activity by the luciferase reporter assay. Results TERT promoter mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%), and hepatocellular carcinoma (31.4%). C228T and C250T were the most common mutations. In urothelial carcinoma, several novel rare mutations were identified. TERT promoter mutations were absent in GIST, thymic epithelial tumors, gastrointestinal leiomyoma, gastric schwannoma, cholangiocarcinoma, gastric and pancreatic cancer. TERT promoter mutations highly correlated with upregulated TERT mRNA expression and telomerase activity in adult gliomas. These mutations differentially enhanced the transcriptional activity of the TERT core promoter. Conclusions TERT promoter mutations are frequent in multiple tumor types and have similar distributions in Chinese cancer patients. The functional significance of these mutations reflect the importance to telomere maintenance and hence tumorigenesis, making them potential therapeutic targets. PMID:25843513

The tRNA-like structure of Turnip yellow mosaic virus RNA is a 3'-translational enhancer

International Nuclear Information System (INIS)

Matsuda, Daiki; Dreher, Theo W.

2004-01-01

Many positive stand RNA viral genomes lack the poly(A) tail that is characteristic of cellular mRNAs and that promotes translation in cis. The 3' untranslated regions (UTRs) of such genomes are expected to provide similar translation-enhancing properties as a poly(A) tail, yet the great variety of 3' sequences suggests that this is accomplished in a range of ways. We have identified a translational enhancer present in the 3' UTR of Turnip yellow mosaic virus (TYMV) RNA using luciferase reporter RNAs with generic 5' sequences transfected into plant cells. The 3' terminal 109 nucleotides comprising the tRNA-like structure (TLS) and an upstream pseudoknot (UPSK) act in synergy with a 5'-cap to enhance translation, with a minor contribution in stabilizing the RNA. Maximum enhancement requires that the RNA be capable of aminoacylation, but either the native valine or engineered methionine is acceptable. Mutations that decrease the affinity for translation elongation factor eEF1A (but also diminish aminoacylation efficiency) strongly decrease translational enhancement, suggesting that eEF1A is mechanistically involved. The UPSK seems to act as an important, though nonspecific, spacer element ensuring proper presentation of a functional TLS. Our studies have uncovered a novel type of translational enhancer and a new role for a plant viral TLS

Comparative Analysis of Chloroplast psbD Promoters in Terrestrial Plants

Directory of Open Access Journals (Sweden)

Shuichi Shimmura

2017-07-01

Full Text Available The transcription of photosynthesis genes encoded by the plastid genome is mainly mediated by a prokaryotic-type RNA polymerase called plastid-encoded plastid RNA polymerase (PEP. Standard PEP-dependent promoters resemble bacterial sigma-70-type promoters containing the so-called -10 and -35 elements. On the other hand, an unusual light- and stress-responsive promoter (psbD LRP that is regulated by a 19-bp AAG-box immediately upstream of the -35 element has been mapped upstream of the psbD-psbC operon in some angiosperms. However, the occurrence of the AAG-box containing psbD LRP in plant evolution remains elusive. We have mapped the psbD promoters in eleven embryophytes at different evolutionary stages from liverworts to angiosperms. The psbD promoters were mostly mapped around 500–900 bp upstream of the psbD translational start sites, indicating that the psbD mRNAs have unusually long 5′-UTR extensions in common. The -10 elements of the psbD promoter are well-conserved in all embryophytes, but not the -35 elements. We found that the AAG-box sequences are highly conserved in angiosperms and gymnosperms except for gnetaceae plants. Furthermore, partial AAG-box-like sequences have been identified in the psbD promoters of some basal embryophytes such as moss, hornwort, and lycophyte, whereas liverwort has the standard PEP promoter without the AAG-box. These results suggest that the AAG-box sequences of the psbD LRP may have evolved from a primitive type of AAG-box of basal embryophytes. On the other hand, monilophytes (ferns use another type of psbD promoter composed of a distinct cis-element upstream of the potential -35 element. Furthermore, we found that psbD expression is not regulated by light in gymnosperms or basal angiosperms, although they have the well-conserved AAG-box sequences. Thus, it is unlikely that acquisition of the AAG-box containing psbD promoter is directly associated with light-induced transcription of the psb

Designing a Culturally Appropriate Visually Enhanced Low-Text Mobile Health App Promoting Physical Activity for Latinos: A Qualitative Study.

Science.gov (United States)

Bender, Melinda S; Martinez, Suzanna; Kennedy, Christine

2016-07-01

Rapid proliferation of smartphone ownership and use among Latinos offers a unique opportunity to employ innovative visually enhanced low-text (VELT) mobile health applications (mHealth app) to promote health behavior change for Latinos at risk for lifestyle-related diseases. Using focus groups and in-depth interviews with 16 promotores and 5 health care providers recruited from California clinics, this qualitative study explored perceptions of visuals for a VELT mHealth app promoting physical activity (PA) and limiting sedentary behavior (SB) for Latinos. In this Phase 1 study, participants endorsed visuals portraying PA guidelines and recommended visuals depicting family and socially oriented PA. Overall, participants supported a VELT mHealth app as an alternative to text-based education. Findings will inform the future Phase 2 study development of a culturally appropriate VELT mHealth app to promote PA for Latinos, improve health literacy, and provide an alternative to traditional clinic text-based health education materials. © The Author(s) 2015.

Purification, crystallization and preliminary X-ray crystallographic analysis of the ETS domain of human Ergp55 in complex with the cfos promoter DNA sequence

International Nuclear Information System (INIS)

Gangwar, Shanti P.; Meena, Sita R.; Saxena, Ajay K.

2012-01-01

The ETS domain of human Ergp55 was purified and crystallized in native, complexes with E74, and cfos promoter DNA sequences. The X-ray intensity data set was collected on ETS–cfos promoter DNA complex crystal at 3.1 Å resolution to analyze the structure by molecular replacement technique. The Ergp55 protein belongs to the Ets family of transciption factors. The Ets transcription factors are involved in various developmental processes and the regulation of cancer metabolism. They contain a highly similar DNA-binding domain known as the ETS domain and have diverse functions in oncogenesis and physiology. The Ets transcription factors differ in their DNA-binding preference at the ETS site and the mechanisms by which they target genes are not clearly understood. To understand its DNA-binding mechanism, the ETS domain of Ergp55 was expressed and purified. The ETS domain was crystallized in the native form and in complex forms with DNA sequences from the E74 and cfos promoters. An X-ray diffraction data set was collected from an ETS–cfos DNA complex crystal at a wavelength of 0.9725 Å on the BM14 synchrotron beamline at the ESRF, France. The ETS–cfos DNA complex crystal belonged to space group C222 1 , with four molecules in the asymmetric unit. For structure analysis, initial phases for the ETS–cfos DNA complex were obtained by the molecular-replacement technique with Phaser in the CCP4 suite using the coordinates of Fli-1 protein and cfos DNA as search models. Structure analysis of the ETS–cfos DNA complex may possibly explain the DNA-binding specificity and its mechanism of interaction with the ETS domain of Ergp55

Finding and Improving the Key-Frames of Long Video Sequences for Face Recognition

DEFF Research Database (Denmark)

Nasrollahi, Kamal; Moeslund, Thomas B.

2010-01-01

Face recognition systems are very sensitive to the quality and resolution of their input face images. This makes such systems unreliable when working with long surveillance video sequences without employing some selection and enhancement algorithms. On the other hand, processing all the frames...... of such video sequences by any enhancement or even face recognition algorithm is demanding. Thus, there is a need for a mechanism to summarize the input video sequence to a set of key-frames and then applying an enhancement algorithm to this subset. This paper presents a system doing exactly this. The system...... uses face quality assessment to select the key-frames and a hybrid super-resolution to enhance the face image quality. The suggested system that employs a linear associator face recognizer to evaluate the enhanced results has been tested on real surveillance video sequences and the experimental results...

Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

Science.gov (United States)

Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

2016-05-17

ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Strengthen Context To Enhance Health Promotion Effectiveness.

Science.gov (United States)

Sofian, Neal; Newton, Daniel; DeClaire, Joan

2003-01-01

Highlights one strategy to improve health promotion delivery and generate better outcomes by creating "Microcultures of Meaning" (MOMs), which are intended to provide a context to help people learn and take action. The issue introduces key theoretical concepts associated with the MOM methodology, describes the scientific rationale, discusses…

Evaluation of a health-promoting school program to enhance correct medication use in Taiwan

Directory of Open Access Journals (Sweden)

Hsueh-Yun Chi

2014-06-01

Full Text Available This study was an evaluation of the Health Promoting School (HPS program in Taiwan and its effectiveness in enhancing students' knowledge and abilities with regard to correct medication usage. In 2011, baseline and follow-up self-administered online surveys were received from 3520 middle-school and primary students from intervention schools, and 3738 students from comparison primary and secondary schools completed the same survey. The results indicated that after implementing the correct medication use HPS program, students' knowledge and abilities concerning correct medication usage (i.e., the need to express clearly personal conditions to physicians, to check information on the medication packages, to take medication correctly and adhere to prescribed medication regimens, not to buy or acquire medication from unlicensed sources, and to consult pharmacists/physicians were significantly increased among the students in the intervention schools (p < 0.001. In addition, students' knowledge and abilities concerning correct medication usage were significantly higher in the intervention schools compared with the comparison schools (p < 0.001. In conclusion, the correct medication use HPS program significantly enhanced students' knowledge and abilities concerning correct medication usage.

Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

Science.gov (United States)

Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

1989-10-05

We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

PN Sequence Preestimator Scheme for DS-SS Signal Acquisition Using Block Sequence Estimation

Directory of Open Access Journals (Sweden)

Sang Kyu Park

2005-03-01

Full Text Available An m-sequence (PN sequence preestimator scheme for direct-sequence spread spectrum (DS-SS signal acquisition by using block sequence estimation (BSE is proposed and analyzed. The proposed scheme consists of an estimator and a verifier which work according to the PN sequence chip clock, and provides not only the enhanced chip estimates with a threshold decision logic and one-chip error correction among the first m received chips, but also the reliability check of the estimates with additional decision logic. The probabilities of the estimator and verifier operations are calculated. With these results, the detection, the false alarm, and the missing probabilities of the proposed scheme are derived. In addition, using a signal flow graph, the average acquisition time is calculated. The proposed scheme can be used as a preestimator and easily implemented by changing the internal signal path of a generally used digital matched filter (DMF correlator or any other correlator that has a lot of sampling data memories for sampled PN sequence. The numerical results show rapid acquisition performance in a relatively good CNR.

Genome-wide analysis of promoter architecture in Drosophila melanogaster

Energy Technology Data Exchange (ETDEWEB)

Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.; Sandler, Jeremy E.; Takahashi, Hazuki; Lassmann, Timo; Yu, Charles; Booth, Benjamin W.; Zhang, Dayu; Wan, Kenneth H.; Yang, Li; Boley, Nathan; Andrews, Justen; Kaufman, Thomas C.; Graveley, Brenton R.; Bickel, Peter J.; Carninci, Piero; Carlson, Joseph W.; Celniker, Susan E.

2010-10-20

Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysis indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.

Acute Sleep Deprivation Enhances Post-Infection Sleep and Promotes Survival during Bacterial Infection in Drosophila

Science.gov (United States)

Kuo, Tzu-Hsing; Williams, Julie A.

2014-01-01

Study Objectives: Sleep is known to increase as an acute response to infection. However, the function of this behavioral response in host defense is not well understood. To address this problem, we evaluated the effect of acute sleep deprivation on post-infection sleep and immune function in Drosophila. Setting: Laboratory. Participants: Drosophila melanogaster. Methods and Results: Flies were subjected to sleep deprivation before (early DEP) or after (late DEP) bacterial infection. Relative to a non-deprived control, flies subjected to early DEP had enhanced sleep after infection as well as increased bacterial clearance and survival outcome. Flies subjected to late DEP experienced enhanced sleep following the deprivation period, and showed a modest improvement in survival outcome. Continuous DEP (early and late DEP) throughout infection also enhanced sleep later during infection and improved survival. However, improved survival in flies subjected to late or continuous DEP did not occur until after flies had experienced sleep. During infection, both early and late DEP enhanced NFκB transcriptional activity as measured by a luciferase reporter (κB-luc) in living flies. Early DEP also increased NFκB activity prior to infection. Flies that were deficient in expression of either the Relish or Dif NFκB transcription factors showed normal responses to early DEP. However, the effect of early DEP on post-infection sleep and survival was abolished in double mutants, which indicates that Relish and Dif have redundant roles in this process. Conclusions: Acute sleep deprivation elevated NFκB-dependent activity, increased post-infection sleep, and improved survival during bacterial infection. Citation: Kuo TH, Williams JA. Acute sleep deprivation enhances post-infection sleep and promotes survival during bacterial infection in Drosophila. SLEEP 2014;37(5):859-869. PMID:24790264

EPA Participates in Energy Roundtable with States, Tribes, Businesses and Environmental Groups to Enhance Coordination and Promote Responsible Domestic Production of Oil and Gas Resources

Science.gov (United States)

EPA News Release: EPA Participates in Energy Roundtable with States, Tribes, Businesses and Environmental Groups to Enhance Coordination and Promote Responsible Domestic Production of Oil and Gas Resources

Curtobacterium sp. Genome Sequencing Underlines Plant Growth Promotion-Related Traits.

Science.gov (United States)

Bulgari, Daniela; Minio, Andrea; Casati, Paola; Quaglino, Fabio; Delledonne, Massimo; Bianco, Piero A

2014-07-17

Endophytic bacteria are microorganisms residing in plant tissues without causing disease symptoms. Here, we provide the high-quality genome sequence of Curtobacterium sp. strain S6, isolated from grapevine plant. The genome assembly contains 2,759,404 bp in 13 contigs and 2,456 predicted genes. Copyright © 2014 Bulgari et al.

WRKY71 and TGA1a physically interact and synergistically regulate the activity of a novel promoter isolated from Petunia vein-clearing virus.

Science.gov (United States)

Shrestha, Ankita; Khan, Ahamed; Mishra, Dipti Ranjan; Bhuyan, Kashyap; Sahoo, Bhabani; Maiti, Indu B; Dey, Nrisingha

2018-02-01

Caulimoviral promoters have become excellent tools for efficient transgene expression in plants. However, the transcriptional framework controlling their systematic regulation is poorly understood. To understand this regulatory mechanism, we extensively studied a novel caulimoviral promoter, PV8 (-163 to +138, 301 bp), isolated from Petunia vein-clearing virus (PVCV). PVCV was found to be Salicylic acid (SA)-inducible and 2.5-3.0 times stronger than the widely used CaMV35S promoter. In silico analysis of the PV8 sequence revealed a unique clustering of two stress-responsive cis-elements, namely, as-1 1 and W-box 1-2 , located within a span of 31 bp (-74 to -47) that bound to the TGA1a and WRKY71 plant transcription factors (TFs), respectively. We found that as-1 (TTACG) and W-box (TGAC) elements occupied both TGA1a and WRKY71 on the PV8 backbone. Mutational studies demonstrated that the combinatorial influence of as-1 (-57) and W-box 1-2 (-74 and -47) on the PV8 promoter sequence largely modulated its activity. TGA1a and WRKY71 physically interacted and cooperatively enhanced the transcriptional activity of the PV8 promoter. Biotic stress stimuli induced PV8 promoter activity by ~1.5 times. We also established the possible pathogen-elicitor function of AtWRKY71 and NtabWRKY71 TFs. Altogether, this study elucidates the interplay between TFs, biotic stress and caulimoviral promoter function. Copyright © 2018 Elsevier B.V. All rights reserved.

Evaluation of iron colloid-enhanced T{sub 2}-weighted fast MR imaging of hepatocellular carcinoma. Comparison of SE, TSE and TGSE sequences

Energy Technology Data Exchange (ETDEWEB)

Sugihara, Shuji; Suto, Yuji; Kamba, Masayuki; Yoshida, Kotarou; Ohta, Yoshio [Tottori Univ., Yonago (Japan). Faculty of Medicine

1996-06-01

We have applied chondroitin sulfate iron colloid (CSIC) as a contrast agent for MRI in detecting hepatocellular carcinoma (HCC) on conventional spin-echo sequences (SE). In this report, we evaluated CSIC-enhanced T{sub 2}-weighted fast MR imaging of HCC. MR imaging were performed before and after i.v. administration of CSIC in 15 patients with 46 HCCs. T{sub 2}-weighted SE (1800/80/2, 210 x 256 matrix), T{sub 2}-weighted turbo spin-echo (TSE1800) (1800/90/5, echo train length=7, 252 x 256 matrix), TSE (3500/90/5, echo train length=7, 252 x 256 matrix) (TSE7), TSE (3500/99/5, echo train length=11, 242 x 256 matrix) (TSE11) and T{sub 2}-weighted turbo-gradient spine-echo (TGSE) (4500/108/4, echo train length=33, 252 x 256 matrix) images were compared quantitatively and qualitatively. In all sequences, liver signal-to-noise ratio (SNR) was significantly decreased and lesion-to-liver contrast-to-noise ratio (CNR) was significantly increased after CSIC administration. Although decreased ratio in liver and tumor SNR caused by CSIC was smaller on TSE sequences compared with SE and TGSE, increased ratio in lesion-to-liver CNR was largest on TSE7. Either before or after i.v. administration of CSIC, the number of detectable lesions was largest on TSE7. TSE with used longer TR, TE and decreased echo factor was useful method for CSIC-enhanced abdominal MR imaging. (author)

Bivalent promoter marks and a latent enhancer may prime the leukaemia oncogene LMO1 for ectopic expression in T-cell leukaemia.

Science.gov (United States)

Oram, S H; Thoms, J; Sive, J I; Calero-Nieto, F J; Kinston, S J; Schütte, J; Knezevic, K; Lock, R B; Pimanda, J E; Göttgens, B

2013-06-01

LMO1 is a transcriptional regulator and a T-acute lymphoblastic leukaemia (T-ALL) oncogene. Although first identified in association with a chromosomal translocation in T-ALL, the ectopic expression of LMO1 occurs far more frequently in the absence of any known mutation involving its locus. Given that LMO1 is barely expressed in any haematopoietic lineage, and activation of transcriptional drivers in leukaemic cells is not well described, we investigated the regulation of this gene in normal haematopoietic and leukaemic cells. We show that LMO1 has two promoters that drive reporter gene expression in transgenic mice to neural tissues known to express endogenous LMO1. The LMO1 promoters display bivalent histone marks in multiple blood lineages including T-cells, and a 3' flanking region at LMO1 +57 contains a transcriptional enhancer that is active in developing blood cells in transgenic mouse embryos. The LMO1 promoters become activated in T-ALL together with the 3' enhancer, which is bound in primary T-ALL cells by SCL/TAL1 and GATA3. Taken together, our results show that LMO1 is poised for expression in normal progenitors, where activation of SCL/TAL1 together with a breakdown of epigenetic repression of LMO1 regulatory elements induces ectopic LMO1 expression that contributes to the development and maintenance of T-ALL.

Resistance to BmNPV via overexpression of an exogenous gene controlled by an inducible promoter and enhancer in transgenic silkworm, Bombyx mori.

Directory of Open Access Journals (Sweden)

Liang Jiang

Full Text Available The hycu-ep32 gene of Hyphantria cunea NPV can inhibit Bombyx mori nucleopolyhedrovirus (BmNPV multiplication in co-infected cells, but it is not known whether the overexpression of the hycu-ep32 gene has an antiviral effect in the silkworm, Bombyx mori. Thus, we constructed four transgenic vectors, which were under the control of the 39 K promoter of BmNPV (39 KP, Bombyx mori A4 promoter (A4P, hr3 enhancer of BmNPV combined with 39 KP, and hr3 combined with A4P. Transgenic lines were created via embryo microinjection using practical diapause silkworm. qPCR revealed that the expression level of hycu-ep32 could be induced effectively after BmNPV infection in transgenic lines where hycu-ep32 was controlled by hr3 combined with 39 KP (i.e., HEKG. After oral inoculation of BmNPV with 3 × 10(5 occlusion bodies per third instar, the mortality with HEKG-B was approximately 30% lower compared with the non-transgenic line. The economic characteristics of the transgenic lines remained unchanged. These results suggest that overexpression of an exogenous antiviral gene controlled by an inducible promoter and enhancer is a feasible method for breeding silkworms with a high antiviral capacity.

SP-transcription factors are involved in basal MVP promoter activity and its stimulation by HDAC inhibitors.

Science.gov (United States)

Steiner, Elisabeth; Holzmann, Klaus; Pirker, Christine; Elbling, Leonilla; Micksche, Michael; Berger, Walter

2004-04-23

The major vault protein (MVP) has been implicated in multidrug resistance, cellular transport, and malignant transformation. In this study we aimed to identify crucial MVP promoter elements that regulate MVP expression. By mutation as well as deletion analysis a conserved proximal GC-box element was demonstrated to be essential for basal human MVP promoter transactivation. Binding of Sp-family transcription factors but not AP2 to this element in vitro and in vivo was shown by EMSA and ChIP assays, respectively. Inhibition of GC-box binding by a dominant-negative Sp1-variant and by mithramycin A distinctly attenuated MVP promoter activity. In Sp-null Drosophila cells, the silent human MVP promoter was transactivated by several human Sp-family members. In human cells the MVP promoter was potently stimulated by the histone deacetylase (HDAC) inhibitors butyrate (NaB) and trichostatin A (TSA), resulting in enhanced MVP expression. This stimulation was substantially decreased by mutation of the single GC-box and by application of mithramycin A. Treatment with HDAC inhibitors led to a distinct decrease of Sp1 but increase of Sp3 binding in vivo to the respective promoter sequence as demonstrated by ChIP assays. Summarising, this study identifies variations in Sp-transcription factor binding to a single proximal GC-box element as critical for basal MVP promoter activation and its stimulation by HDAC inhibitors.

Core Promoter Structure in the Oomycete Phytophthora infestans

Science.gov (United States)

McLeod, Adele; Smart, Christine D.; Fry, William E.

2004-01-01

We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940

Characterizing leader sequences of CRISPR loci

DEFF Research Database (Denmark)

Alkhnbashi, Omer; Shah, Shiraz Ali; Garrett, Roger Antony

2016-01-01

The CRISPR-Cas system is an adaptive immune system in many archaea and bacteria, which provides resistance against invading genetic elements. The first phase of CRISPR-Cas immunity is called adaptation, in which small DNA fragments are excised from genetic elements and are inserted into a CRISPR...... array generally adjacent to its so called leader sequence at one end of the array. It has been shown that transcription initiation and adaptation signals of the CRISPR array are located within the leader. However, apart from promoters, there is very little knowledge of sequence or structural motifs...... sequences by focusing on the consensus repeat of the adjacent CRISPR array and weak upstream conservation signals. We applied our tool to the analysis of a comprehensive genomic database and identified several characteristic properties of leader sequences specific to archaea and bacteria, ranging from...

TSSPlant: a new tool for prediction of plant Pol II promoters

KAUST Repository

Shahmuradov, Ilham A.

2017-01-13

Our current knowledge of eukaryotic promoters indicates their complex architecture that is often composed of numerous functional motifs. Most of known promoters include multiple and in some cases mutually exclusive transcription start sites (TSSs). Moreover, TSS selection depends on cell/tissue, development stage and environmental conditions. Such complex promoter structures make their computational identification notoriously difficult. Here, we present TSSPlant, a novel tool that predicts both TATA and TATA-less promoters in sequences of a wide spectrum of plant genomes. The tool was developed by using large promoter collections from ppdb and PlantProm DB. It utilizes eighteen significant compositional and signal features of plant promoter sequences selected in this study, that feed the artificial neural network-based model trained by the backpropagation algorithm. TSSPlant achieves significantly higher accuracy compared to the next best promoter prediction program for both TATA promoters (MCC≃0.84 and F1-score≃0.91 versus MCC≃0.51 and F1-score≃0.71) and TATA-less promoters (MCC≃0.80, F1-score≃0.89 versus MCC≃0.29 and F1-score≃0.50). TSSPlant is available to download as a standalone program at http://www.cbrc.kaust.edu.sa/download/.

TSSPlant: a new tool for prediction of plant Pol II promoters

KAUST Repository

Shahmuradov, Ilham A.; Umarov, Ramzan; Solovyev, Victor V.

2017-01-01

Our current knowledge of eukaryotic promoters indicates their complex architecture that is often composed of numerous functional motifs. Most of known promoters include multiple and in some cases mutually exclusive transcription start sites (TSSs). Moreover, TSS selection depends on cell/tissue, development stage and environmental conditions. Such complex promoter structures make their computational identification notoriously difficult. Here, we present TSSPlant, a novel tool that predicts both TATA and TATA-less promoters in sequences of a wide spectrum of plant genomes. The tool was developed by using large promoter collections from ppdb and PlantProm DB. It utilizes eighteen significant compositional and signal features of plant promoter sequences selected in this study, that feed the artificial neural network-based model trained by the backpropagation algorithm. TSSPlant achieves significantly higher accuracy compared to the next best promoter prediction program for both TATA promoters (MCC≃0.84 and F1-score≃0.91 versus MCC≃0.51 and F1-score≃0.71) and TATA-less promoters (MCC≃0.80, F1-score≃0.89 versus MCC≃0.29 and F1-score≃0.50). TSSPlant is available to download as a standalone program at http://www.cbrc.kaust.edu.sa/download/.

Health promotion in the workplace

OpenAIRE

Sultan T Al-Otaibi

2016-01-01

The objective of this review was to describe the scientific evidence for coordinating health promotion at the workplace and to discuss the required future research in this field. Literature review from March 1990 to November 2014 was performed. Using the keywords ′health, promotion, worksite and workplace′, literature was searched in the following databases: Medline, PubMed and Google Scholar; with no time limit. There is emerging evidence that workplace health promotion enhances the effectiv...

Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

International Nuclear Information System (INIS)

Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van

2003-01-01

The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

Suppression of LFA-1 expression by spermine is associated with enhanced methylation of ITGAL, the LFA-1 promoter area.

Directory of Open Access Journals (Sweden)

Yoshihiko Kano

Full Text Available Spermine and spermidine, natural polyamines, suppress lymphocyte function-associated antigen 1 (LFA-1 expression and its associated cellular functions through mechanisms that remain unknown. Inhibition of ornithine decarboxylase, which is required for polyamine synthesis, in Jurkat cells by 3 mM D,L-alpha-difluoromethylornithine hydrochloride (DFMO significantly decreased spermine and spermidine concentrations and was associated with decreased DNA methyltransferase (Dnmt activity, enhanced demethylation of the LFA-1 gene (ITGAL promoter area, and increased CD11a expression. Supplementation with extracellular spermine (500 µM of cells pretreated with DFMO significantly increased polyamine concentrations, increased Dnmt activity, enhanced methylation of the ITGAL promoter, and decreased CD11a expression. It has been shown that changes in intracellular polyamine concentrations affect activities of -adenosyl-L-methionine-decaroboxylase, and, as a result, affect concentrations of the methyl group donor, S-adenosylmethionine (SAM, and of the competitive Dnmt inhibitor, decarboxylated SAM. Additional treatments designed to increase the amount of SAM and decrease the amount of decarboxylated SAM-such as treatment with methylglyoxal bis-guanylhydrazone (an inhibitor of S-adenosyl-L-methionine-decaroboxylase and SAM supplementation-successfully decreased CD11a expression. Western blot analyses revealed that neither DFMO nor spermine supplementation affected the amount of active Ras-proximate-1, a member of the Ras superfamily of small GTPases and a key protein for regulation of CD11a expression. The results of this study suggest that polyamine-induced suppression of LFA-1 expression occurs via enhanced methylation of ITGAL.

Consolidating the effects of waking and sleep on motor-sequence learning.

Science.gov (United States)

Brawn, Timothy P; Fenn, Kimberly M; Nusbaum, Howard C; Margoliash, Daniel

2010-10-20

Sleep is widely believed to play a critical role in memory consolidation. Sleep-dependent consolidation has been studied extensively in humans using an explicit motor-sequence learning paradigm. In this task, performance has been reported to remain stable across wakefulness and improve significantly after sleep, making motor-sequence learning the definitive example of sleep-dependent enhancement. Recent work, however, has shown that enhancement disappears when the task is modified to reduce task-related inhibition that develops over a training session, thus questioning whether sleep actively consolidates motor learning. Here we use the same motor-sequence task to demonstrate sleep-dependent consolidation for motor-sequence learning and explain the discrepancies in results across studies. We show that when training begins in the morning, motor-sequence performance deteriorates across wakefulness and recovers after sleep, whereas performance remains stable across both sleep and subsequent waking with evening training. This pattern of results challenges an influential model of memory consolidation defined by a time-dependent stabilization phase and a sleep-dependent enhancement phase. Moreover, the present results support a new account of the behavioral effects of waking and sleep on explicit motor-sequence learning that is consistent across a wide range of tasks. These observations indicate that current theories of memory consolidation that have been formulated to explain sleep-dependent performance enhancements are insufficient to explain the range of behavioral changes associated with sleep.

Sequence specific DNA binding by P53 is enhanced by ionizing radiation and is mediated via DNA-PK activity

International Nuclear Information System (INIS)

Kachnic, L.A.; Wunsch, H.; Mekeel, K.L.; De Frank, J.S.; Powell, S.N.

1996-01-01

Purpose: P53 is known to be involved in the cellular response to DNA damage. It mediates many of its effects by acting as a transcription factor via sequence-specific DNA binding. The half-life of p53 is prolonged following DNA damage, and this results in elevated levels of p53 for a period of 2-8 hours. The increase in p53 is often relatively small, but this produces significant stimulation of a downstream gene such as p21(WAF1/cip1). We investigated post-translational modification of p53 following ionizing radiation damage. Materials and Methods: The response of normal Balb-C mouse fibroblasts (FC) to ionizing radiation (IR, 8 Gy) was measured at 0,3,6,9 and 24 hours, by the levels of p53, p21, flow cytometry and the electrophoretic mobility shift assay (EMSA). EMSA utilized a 26 bp consensus sequence end-labeled oligonucleotide to measure sequence-specific p53 binding. P53 specificity was confirmed by an enhanced mobility shift (retardation) when using p53 antibody. Comparison was made with scid fibroblasts (FS) and FC cells transfected with a plasmid (CX3) containing mutant p53 (alanine-143) or infected with a retrovirus containing the E6 protein of human papilloma virus type 16. Results: The response of p53 to DNA damage shows a 3-fold increase at 3-6 hours, and was not significantly different between FC and FS. FC-CX3 showed detectable basal levels of p53, and a 2-fold further induction of p53 after IR. FC-E6 showed no detectable levels of p53 before or after IR. No induction of p21 or G1/S arrest was seen in FC-CX3 or FC-E6, as has been observed previously. The induction of p21 in FS cells was attenuated and delayed: a 2-3-fold increase seen maximally at 9 hours, compared with a 5-fold increase seen maximally at 3-6 hours in FC cells. The accumulation of cells at the G1/S junction after IR showed the same kinetics as p21 induction: the peak of cells in G1 occurs at 3-6 hours in FC, but not until 9-24 hours in FS. The response is reminiscent of that seen in

Molecular Mechanisms of Enhanced Bacterial Growth on Hexadecane with Red Clay.

Science.gov (United States)

Jung, Jaejoon; Jang, In-Ae; Ahn, Sungeun; Shin, Bora; Kim, Jisun; Park, Chulwoo; Jee, Seung Cheol; Sung, Jung-Suk; Park, Woojun

2015-11-01

Red clay was previously used to enhance bioremediation of diesel-contaminated soil. It was speculated that the enhanced degradation of diesel was due to increased bacterial growth. In this study, we selected Acinetobacter oleivorans DR1, a soil-borne degrader of diesel and alkanes, as a model bacterium and performed transcriptional analysis using RNA sequencing to investigate the cellular response during hexadecane utilization and the mechanism by which red clay promotes hexadecane degradation. We confirmed that red clay promotes the growth of A. oleivorans DR1 on hexadecane, a major component of diesel, as a sole carbon source. Addition of red clay to hexadecane-utilizing DR1 cells highly upregulated β-oxidation, while genes related to alkane oxidation were highly expressed with and without red clay. Red clay also upregulated genes related to oxidative stress defense, such as superoxide dismutase, catalase, and glutaredoxin genes, suggesting that red clay supports the response of DR1 cells to oxidative stress generated during hexadecane utilization. Increased membrane fluidity in the presence of red clay was confirmed by fatty acid methyl ester analysis at different growth phases, suggesting that enhanced growth on hexadecane could be due to increased uptake of hexadecane coupled with upregulation of downstream metabolism and oxidative stress defense. The monitoring of the bacterial community in soil with red clay for a year revealed that red clay stabilized the community structure.

TRIM24 promotes glioma progression and enhances chemoresistance through activation of the PI3K/Akt signaling pathway.

Science.gov (United States)

Zhang, L-H; Yin, A-A; Cheng, J-X; Huang, H-Y; Li, X-M; Zhang, Y-Q; Han, N; Zhang, X

2015-01-29

The tripartite motif protein TRIM24 (tripartite motif-containing 24) has been found to play distinct roles in tumor development and progression, according to different tumor contexts. However, it remains elusive whether TRIM24 plays a role in malignant gliomas that are the most common and deadly primary brain tumors in adults. We report here that TRIM24 expression is positively correlated with glioma malignancy and is negatively associated with prognosis of patients with newly diagnosed glioblastoma, which is the most malignant form of gliomas but displays highly heterogeneous clinical outcome. The multivariate Cox regression analysis demonstrates the independent predictive value of TRIM24 expression level for overall and progression-free survival. Knockdown of TRIM24 suppresses cell proliferation, cell cycle progression, clone formation and in vivo tumor development, whereas overexpression of TRIM24 promotes cell growth. Chromatin immunoprecipitation, real-time reverse transcription-PCR and mutation analyses demonstrate that TRIM24 binds to the PIK3CA promoter via its PHD-Bromo domain to activate the transcription of PIK3CA gene, thus enhancing phosphatidylinositide 3-kinase (PI3K)/Akt signaling. The pan-PI3K inhibitor LY294002 and small interfering RNA targeting PIK3CA both abrogate the growth-promoting effect of TRIM24. Moreover, TRIM24 regulates the expression of DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT) through PI3K/Akt/nuclear factor-κB signaling transduction and enhances resistance to temozolomide, the standard chemotherapeutic agent for glioblastoma. Finally, glioblastoma patients with low TRIM24 expression benefit from chemotherapy, whereas those with high TRIM24 expression do not have such benefit. Our results suggest that TRIM24 might serve as a potential prognostic marker and therapeutic target for the management of malignant gliomas.

Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis.

Science.gov (United States)

Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R

2005-09-01

We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.

Deficiency of thioredoxin binding protein-2 (TBP-2 enhances TGF-β signaling and promotes epithelial to mesenchymal transition.

Directory of Open Access Journals (Sweden)

So Masaki

Full Text Available Transforming growth factor beta (TGF-β has critical roles in regulating cell growth, differentiation, apoptosis, invasion and epithelial-mesenchymal transition (EMT of various cancer cells. TGF-β-induced EMT is an important step during carcinoma progression to invasion state. Thioredoxin binding protein-2 (TBP-2, also called Txnip or VDUP1 is downregulated in various types of human cancer, and its deficiency results in the earlier onset of cancer. However, it remains unclear how TBP-2 suppresses the invasion and metastasis of cancer.In this study, we demonstrated that TBP-2 deficiency increases the transcriptional activity in response to TGF-β and also enhances TGF-β-induced Smad2 phosphorylation levels. Knockdown of TBP-2 augmented the TGF-β-responsive expression of Snail and Slug, transcriptional factors related to TGF-β-mediated induction of EMT, and promoted TGF-β-induced spindle-like morphology consistent with the depletion of E-Cadherin in A549 cells.Our results indicate that TBP-2 deficiency enhances TGF-β signaling and promotes TGF-β-induced EMT. The control of TGF-β-induced EMT is critical for the inhibition of the invasion and metastasis. Thus TBP-2, as a novel regulatory molecule of TGF-β signaling, is likely to be a prognostic indicator or a potential therapeutic target for preventing tumor progression.

Enhancing poxvirus vectors vaccine immunogenicity.

Science.gov (United States)

García-Arriaza, Juan; Esteban, Mariano

2014-01-01

Attenuated recombinant poxvirus vectors expressing heterologous antigens from pathogens are currently at various stages in clinical trials with the aim to establish their efficacy. This is because these vectors have shown excellent safety profiles, significant immunogenicity against foreign expressed antigens and are able to induce protective immune responses. In view of the limited efficacy triggered by some poxvirus strains used in clinical trials (i.e, ALVAC in the RV144 phase III clinical trial for HIV), and of the restrictive replication capacity of the highly attenuated vectors like MVA and NYVAC, there is a consensus that further improvements of these vectors should be pursuit. In this review we considered several strategies that are currently being implemented, as well as new approaches, to improve the immunogenicity of the poxvirus vectors. This includes heterologous prime/boost protocols, use of co-stimulatory molecules, deletion of viral immunomodulatory genes still present in the poxvirus genome, enhancing virus promoter strength, enhancing vector replication capacity, optimizing expression of foreign heterologous sequences, and the combined use of adjuvants. An optimized poxvirus vector triggering long-lasting immunity with a high protective efficacy against a selective disease should be sought.

Enhanced expression of membrane proteins in E. coli with a PBAD promoter mutant: synergies with chaperone pathway engineering strategies

Directory of Open Access Journals (Sweden)

Nannenga Brent L

2011-12-01

Full Text Available Abstract Background Membrane proteins (MPs populate 20-30% of genomes sequenced to date and hold potential as therapeutic targets as well as for practical applications in bionanotechnology. However, MP toxicity and low yields in normally robust expression hosts such as E. coli has curtailed progress in our understanding of their structure and function. Results Using the seven transmembrane segments H. turkmenica deltarhodopsin (HtdR as a reporter, we isolated a spontaneous mutant in the arabinose-inducible PBAD promoter leading to improved cell growth and a twofold increase in the recovery of active HtdR at 37°C. A single transversion in a conserved region of the cyclic AMP receptor protein binding site caused the phenotype by reducing htdR transcript levels by 65%. When the mutant promoter was used in conjunction with a host lacking the molecular chaperone Trigger Factor (Δtig cells, toxicity was further suppressed and the amount of correctly folded HtdR was 4-fold that present in the membranes of control cells. More importantly, while improved growth barely compensated for the reduction in transcription rates when another polytopic membrane protein (N. pharonis sensory rhodopsin II was expressed under control of the mutant promoter in wild type cells, a 4-fold increase in productivity could be achieved in a Δtig host. Conclusions Our system, which combines a downregulated version of the tightly repressed PBAD promoter with a TF-deficient host may prove a valuable alternative to T7-based expression for the production of membrane proteins that have so far remained elusive targets.

Polymer nanocomposites enhance S-nitrosoglutathione intestinal absorption and promote the formation of releasable nitric oxide stores in rat aorta.

Science.gov (United States)

Wu, Wen; Perrin-Sarrado, Caroline; Ming, Hui; Lartaud, Isabelle; Maincent, Philippe; Hu, Xian-Ming; Sapin-Minet, Anne; Gaucher, Caroline

2016-10-01

Alginate/chitosan nanocomposite particles (GSNO-acNCPs), i.e. S-nitrosoglutathione (GSNO) loaded polymeric nanoparticles incorporated into an alginate and chitosan matrix, were developed to increase the effective GSNO loading capacity, a nitric oxide (NO) donor, and to sustain its release from the intestine following oral administration. Compared with free GSNO and GSNO loaded nanoparticles, GSNO-acNCPs promoted 2.7-fold GSNO permeation through a model of intestinal barrier (Caco-2 cells). After oral administration to Wistar rats, GSNO-acNCPs promoted NO storage into the aorta during at least 17h, as highlighted by (i) a long-lasting hyporeactivity to phenylephrine (decrease in maximum vasoconstrictive effect of aortic rings) and (ii) N-acetylcysteine (a thiol which can displace NO from tissues)-induced vasodilation of aorxxtic rings preconstricted with phenylephrine. In conclusion, GSNO-acNCPs enhance GSNO intestinal absorption and promote the formation of releasable NO stores into the rat aorta. GSNO-acNCPs are promising carriers for chronic oral application devoted to the treatment of cardiovascular diseases. Copyright © 2016. Published by Elsevier Inc.

A baculovirus (Bombyx mori nuclear polyhedrosis virus) repeat element functions as a powerful constitutive enhancer in transfected insect cells.

Science.gov (United States)

Lu, M; Farrell, P J; Johnson, R; Iatrou, K

1997-12-05

It has been previously reported that baculovirus homologous regions, the regions of baculovirus genomes that contain the origins of DNA replication, can augment the expression of a small number of baculovirus genes in vitro. We are now reporting that a region of the genome of Bombyx mori nuclear polyhedrosis virus (BmNPV) containing the homologous region 3 (HR3) acts as an enhancer for the promoter of a nonviral gene, the cytoplasmic actin gene of the silkmoth B. mori. Incorporation of the HR3 sequences of BmNPV into an actin promoter-based expression cassette results in an augmentation of transgene expression in transfected cells by two orders of magnitude relative to the control recombinant expression cassette. This increase is due to a corresponding increase in the rate of transcription from the actin promoter and not to replication of the expression cassette and occurs only when the HR3 element is linked to the expression cassette in cis. A comparable degree of enhancement in the activity of the silkworm actin promoter occurs also in heterologous lepidopteran cells. Concomitant supplementation of transfected cells with the BmIE1 trans-activator, which was previously shown to be capable of functioning in vitro as a transcriptional co-activator of the cytoplasmic actin gene promoter, results in more than a 1,000-fold increase in the level of expression of recombinant proteins placed under the control of the actin gene promoter. These findings provide the foundation for the development of a nonlytic insect cell expression system for continuous high-level expression of recombinant proteins. Such a system should provide levels of expression of recombinant proteins comparable to those obtained from baculovirus expression systems and should also have the additional advantage of continuous production in a cellular environment that, in contrast to that generated by a baculovirus infection, supports continuously proper posttranslational modifications of recombinant

Estrogen receptor α enhances the transcriptional activity of ETS-1 and promotes the proliferation, migration and invasion of neuroblastoma cell in a ligand dependent manner

International Nuclear Information System (INIS)

Cao, Peng; Feng, Fan; Dong, Guofu; Yu, Chunyong; Feng, Sizhe; Song, Erlin; Shi, Guobing; Liang, Yong; Liang, Guobiao

2015-01-01

It is well known that estrogen receptor α (ERα) participates in the pathogenic progress of breast cancer, hepatocellular carcinoma and head and neck squamous cell carcinoma. In neuroblastoma cells and related cancer clinical specimens, moreover, the ectopic expression of ERα has been identified. However, the detailed function of ERα in the proliferation of neuroblastoma cell is yet unclear. The transcriptional activity of ETS-1 (E26 transformation specific sequence 1) was measured by luciferase analysis. Western blot assays and Real-time RT-PCR were used to examine the expression of ERα, ETS-1 and its targeted genes. The protein-protein interaction between ERα and ETS-1 was determined by co-IP and GST-Pull down assays. The accumulation of ETS-1 in nuclear was detected by western blot assays, and the recruitment of ETS-1 to its targeted gene’s promoter was tested by ChIP assays. Moreover, SH-SY5Y cells’ proliferation, anchor-independent growth, migration and invasion were quantified using the MTT, soft agar or Trans-well assay, respectively. The transcriptional activity of ETS-1 was significantly increased following estrogen treatment, and this effect was related to ligand-mediated activation of ERα. The interaction between the ERα and ETS-1 was identified, and enhancement of ERα activation would up-regulate the ETS-1 transcription factor activity via modulating its cytoplasm/nucleus translocation and the recruitment of ETS-1 to its target gene’s promoter. Furthermore, treatment of estrogen increased proliferation, migration and invasion of neuroblastoma cells, whereas the antagonist of ERα reduced those effects. In this study, we provided evidences that activation of ERα promoted neuroblastoma cells proliferation and up-regulated the transcriptional activity of ETS-1. By investigating the role of ERα in the ETS-1 activity regulation, we demonstrated that ERα may be a novel ETS-1 co-activator and thus a potential therapeutic target in human

Mutations in Cas9 Enhance the Rate of Acquisition of Viral Spacer Sequences during the CRISPR-Cas Immune Response.

Science.gov (United States)

Heler, Robert; Wright, Addison V; Vucelja, Marija; Bikard, David; Doudna, Jennifer A; Marraffini, Luciano A

2017-01-05

CRISPR loci and their associated (Cas) proteins encode a prokaryotic immune system that protects against viruses and plasmids. Upon infection, a low fraction of cells acquire short DNA sequences from the invader. These sequences (spacers) are integrated in between the repeats of the CRISPR locus and immunize the host against the matching invader. Spacers specify the targets of the CRISPR immune response through transcription into short RNA guides that direct Cas nucleases to the invading DNA molecules. Here we performed random mutagenesis of the RNA-guided Cas9 nuclease to look for variants that provide enhanced immunity against viral infection. We identified a mutation, I473F, that increases the rate of spacer acquisition by more than two orders of magnitude. Our results highlight the role of Cas9 during CRISPR immunization and provide a useful tool to study this rare process and develop it as a biotechnological application. Copyright © 2017 Elsevier Inc. All rights reserved.

Added value of diffusion-weighted MRI in detection of cervical cancer recurrence: comparison with morphologic and dynamic contrast-enhanced MRI sequences.

Science.gov (United States)

Lucas, Rita; Lopes Dias, João; Cunha, Teresa Margarida

2015-01-01

We aimed to evaluate the added value of diffusion-weighted imaging (DWI) to standard magnetic resonance imaging (MRI) for detecting post-treatment cervical cancer recurrence. The detection accuracy of T2-weighted (T2W) images was compared with that of T2W MRI combined with either dynamic contrast-enhanced (DCE) MRI or DWI. Thirty-eight women with clinically suspected uterine cervical cancer recurrence more than six months after treatment completion were examined with 1.5 Tesla MRI including T2W, DCE, and DWI sequences. Disease was confirmed histologically and correlated with MRI findings. The diagnostic performance of T2W imaging and its combination with either DCE or DWI were analyzed. Sensitivity, positive predictive value, and accuracy were calculated. Thirty-six women had histologically proven recurrence. The accuracy for recurrence detection was 80% with T2W/DCE MRI and 92.1% with T2W/DWI. The addition of DCE sequences did not significantly improve the diagnostic ability of T2W imaging, and this sequence combination misclassified two patients as falsely positive and seven as falsely negative. The T2W/DWI combination revealed a positive predictive value of 100% and only three false negatives. The addition of DWI to T2W sequences considerably improved the diagnostic ability of MRI. Our results support the inclusion of DWI in the initial MRI protocol for the detection of cervical cancer recurrence, leaving DCE sequences as an option for uncertain cases.

Rational Diversification of a Promoter Providing Fine-Tuned Expression and Orthogonal Regulation for Synthetic Biology

Science.gov (United States)

Blount, Benjamin A.; Weenink, Tim; Vasylechko, Serge; Ellis, Tom

2012-01-01

Yeast is an ideal organism for the development and application of synthetic biology, yet there remain relatively few well-characterised biological parts suitable for precise engineering of this chassis. In order to address this current need, we present here a strategy that takes a single biological part, a promoter, and re-engineers it to produce a fine-graded output range promoter library and new regulated promoters desirable for orthogonal synthetic biology applications. A highly constitutive Saccharomyces cerevisiae promoter, PFY1p, was identified by bioinformatic approaches, characterised in vivo and diversified at its core sequence to create a 36-member promoter library. TetR regulation was introduced into PFY1p to create a synthetic inducible promoter (iPFY1p) that functions in an inverter device. Orthogonal and scalable regulation of synthetic promoters was then demonstrated for the first time using customisable Transcription Activator-Like Effectors (TALEs) modified and designed to act as orthogonal repressors for specific PFY1-based promoters. The ability to diversify a promoter at its core sequences and then independently target Transcription Activator-Like Orthogonal Repressors (TALORs) to virtually any of these sequences shows great promise toward the design and construction of future synthetic gene networks that encode complex “multi-wire” logic functions. PMID:22442681

Rational diversification of a promoter providing fine-tuned expression and orthogonal regulation for synthetic biology.

Science.gov (United States)

Blount, Benjamin A; Weenink, Tim; Vasylechko, Serge; Ellis, Tom

2012-01-01

Yeast is an ideal organism for the development and application of synthetic biology, yet there remain relatively few well-characterised biological parts suitable for precise engineering of this chassis. In order to address this current need, we present here a strategy that takes a single biological part, a promoter, and re-engineers it to produce a fine-graded output range promoter library and new regulated promoters desirable for orthogonal synthetic biology applications. A highly constitutive Saccharomyces cerevisiae promoter, PFY1p, was identified by bioinformatic approaches, characterised in vivo and diversified at its core sequence to create a 36-member promoter library. TetR regulation was introduced into PFY1p to create a synthetic inducible promoter (iPFY1p) that functions in an inverter device. Orthogonal and scalable regulation of synthetic promoters was then demonstrated for the first time using customisable Transcription Activator-Like Effectors (TALEs) modified and designed to act as orthogonal repressors for specific PFY1-based promoters. The ability to diversify a promoter at its core sequences and then independently target Transcription Activator-Like Orthogonal Repressors (TALORs) to virtually any of these sequences shows great promise toward the design and construction of future synthetic gene networks that encode complex "multi-wire" logic functions.

Plant growth promoting rhizobacteria reduce aphid population and enhance the productivity of bread wheat.

Science.gov (United States)

Naeem, Muhammad; Aslam, Zubair; Khaliq, Abdul; Ahmed, Jam Nazir; Nawaz, Ahmad; Hussain, Mubshar

2018-04-24

Plant growth promoting rhizobacteria increase plant growth and give protection against insect pests and pathogens. Due to the negative impact of chemical pesticides on environment, alternatives to these chemicals are needed. In this scenario, the biological methods of pest control offer an eco-friendly and an attractive option. In this study, the effect of two plant growth promoting rhizobacterial strains (Bacillus sp. strain 6 and Pseudomonas sp. strain 6K) on aphid population and wheat productivity was evaluated in an aphid susceptible (Pasban-90) and resistant (Inqlab-91) wheat cultivar. The seeds were inoculated with each PGPR strain, separately or the combination of both. The lowest aphid population (2.1tiller -1 ), and highest plant height (85.8cm), number of spikelets per spike (18), grains per spike (44), productive tillers (320m -2 ), straw yield (8.6Mgha -1 ), and grain yield (4.8Mgha -1 ) were achieved when seeds were inoculated with Bacillus sp. strain 6+Pseudomonas sp. strain 6K. The grain yield of both varieties was enhanced by 35.5-38.9% with seed inoculation with both bacterial strains. Thus, the combine use of both PGPR strains viz. Bacillus sp. strain 6+Pseudomonas sp. strain 6K offers an attractive option to reduce aphid population tied with better wheat productivity. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Bacillus anthracis genome organization in light of whole transcriptome sequencing

Energy Technology Data Exchange (ETDEWEB)

Martin, Jeffrey; Zhu, Wenhan; Passalacqua, Karla D.; Bergman, Nicholas; Borodovsky, Mark

2010-03-22

Emerging knowledge of whole prokaryotic transcriptomes could validate a number of theoretical concepts introduced in the early days of genomics. What are the rules connecting gene expression levels with sequence determinants such as quantitative scores of promoters and terminators? Are translation efficiency measures, e.g. codon adaptation index and RBS score related to gene expression? We used the whole transcriptome shotgun sequencing of a bacterial pathogen Bacillus anthracis to assess correlation of gene expression level with promoter, terminator and RBS scores, codon adaptation index, as well as with a new measure of gene translational efficiency, average translation speed. We compared computational predictions of operon topologies with the transcript borders inferred from RNA-Seq reads. Transcriptome mapping may also improve existing gene annotation. Upon assessment of accuracy of current annotation of protein-coding genes in the B. anthracis genome we have shown that the transcriptome data indicate existence of more than a hundred genes missing in the annotation though predicted by an ab initio gene finder. Interestingly, we observed that many pseudogenes possess not only a sequence with detectable coding potential but also promoters that maintain transcriptional activity.

Enhanced Methods for Local Ancestry Assignment in Sequenced Admixed Individuals

Science.gov (United States)

Brown, Robert; Pasaniuc, Bogdan

2014-01-01

Inferring the ancestry at each locus in the genome of recently admixed individuals (e.g., Latino Americans) plays a major role in medical and population genetic inferences, ranging from finding disease-risk loci, to inferring recombination rates, to mapping missing contigs in the human genome. Although many methods for local ancestry inference have been proposed, most are designed for use with genotyping arrays and fail to make use of the full spectrum of data available from sequencing. In addition, current haplotype-based approaches are very computationally demanding, requiring large computational time for moderately large sample sizes. Here we present new methods for local ancestry inference that leverage continent-specific variants (CSVs) to attain increased performance over existing approaches in sequenced admixed genomes. A key feature of our approach is that it incorporates the admixed genomes themselves jointly with public datasets, such as 1000 Genomes, to improve the accuracy of CSV calling. We use simulations to show that our approach attains accuracy similar to widely used computationally intensive haplotype-based approaches with large decreases in runtime. Most importantly, we show that our method recovers comparable local ancestries, as the 1000 Genomes consensus local ancestry calls in the real admixed individuals from the 1000 Genomes Project. We extend our approach to account for low-coverage sequencing and show that accurate local ancestry inference can be attained at low sequencing coverage. Finally, we generalize CSVs to sub-continental population-specific variants (sCSVs) and show that in some cases it is possible to determine the sub-continental ancestry for short chromosomal segments on the basis of sCSVs. PMID:24743331

Test-enhanced learning: the potential for testing to promote greater learning in undergraduate science courses.

Science.gov (United States)

Brame, Cynthia J; Biel, Rachel

2015-01-01

Testing within the science classroom is commonly used for both formative and summative assessment purposes to let the student and the instructor gauge progress toward learning goals. Research within cognitive science suggests, however, that testing can also be a learning event. We present summaries of studies that suggest that repeated retrieval can enhance long-term learning in a laboratory setting; various testing formats can promote learning; feedback enhances the benefits of testing; testing can potentiate further study; and benefits of testing are not limited to rote memory. Most of these studies were performed in a laboratory environment, so we also present summaries of experiments suggesting that the benefits of testing can extend to the classroom. Finally, we suggest opportunities that these observations raise for the classroom and for further research. © 2015 C. J. Brame and R. Biel. CBE—Life Sciences Education © 2015 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Mammalian amyloidogenic proteins promote prion nucleation in yeast.

Science.gov (United States)

Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O

2018-03-02

Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Computational prediction and experimental verification of HVA1-like abscisic acid responsive promoters in rice (Oryza sativa).

Science.gov (United States)

Ross, Christian; Shen, Qingxi J

2006-09-01

Abscisic acid (ABA) is one of the central plant hormones, responsible for controlling both maturation and germination in seeds, as well as mediating adaptive responses to desiccation, injury, and pathogen infection in vegetative tissues. Thorough analyses of two barley genes, HVA1 and HVA22, indicate that their response to ABA relies on the interaction of two cis-acting elements in their promoters, an ABA response element (ABRE) and a coupling element (CE). Together, they form an ABA response promoter complex (ABRC). Comparison of promoters of barley HVA1 and it rice orthologue indicates that the structures and sequences of their ABRCs are highly similar. Prediction of ABA responsive genes in the rice genome is then tractable to a bioinformatics approach based on the structures of the well-defined barley ABRCs. Here we describe a model developed based on the consensus, inter-element spacing and orientations of experimentally determined ABREs and CEs. Our search of the rice promoter database for promoters that fit the model has generated a partial list of genes in rice that have a high likelihood of being involved in the ABA signaling network. The ABA inducibility of some of the rice genes identified was validated with quantitative reverse transcription PCR (QPCR). By limiting our input data to known enhancer modules and experimentally derived rules, we have generated a high confidence subset of ABA-regulated genes. The results suggest that the pathways by which cereals respond to biotic and abiotic stresses overlap significantly, and that regulation is not confined to the level transcription. The large fraction of putative regulatory genes carrying HVA1-like enhancer modules in their promoters suggests the ABA signal enters at multiple points into a complex regulatory network that remains largely unmapped.

Recombinant Promoter (MUASCsV8CP) Driven Totiviral Killer Protein 4 (KP4) Imparts Resistance Against Fungal Pathogens in Transgenic Tobacco

Science.gov (United States)

Deb, Debasish; Shrestha, Ankita; Maiti, Indu B.; Dey, Nrisingha

2018-01-01

Development of disease-resistant plant varieties achieved by engineering anti-microbial transgenes under the control of strong promoters can suffice the inhibition of pathogen growth and simultaneously ensure enhanced crop production. For evaluating the prospect of such strong promoters, we comprehensively characterized the full-length transcript promoter of Cassava Vein Mosaic Virus (CsVMV; -565 to +166) and identified CsVMV8 (-215 to +166) as the highest expressing fragment in both transient and transgenic assays. Further, we designed a new chimeric promoter ‘MUASCsV8CP’ through inter-molecular hybridization among the upstream activation sequence (UAS) of Mirabilis Mosaic Virus (MMV; -297 to -38) and CsVMV8, as the core promoter (CP). The MUASCsV8CP was found to be ∼2.2 and ∼2.4 times stronger than the CsVMV8 and CaMV35S promoters, respectively, while its activity was found to be equivalent to that of the CaMV35S2 promoter. Furthermore, we generated transgenic tobacco plants expressing the totiviral ‘Killer protein KP4’ (KP4) under the control of the MUASCsV8CP promoter. Recombinant KP4 was found to accumulate both in the cytoplasm and apoplast of plant cells. The agar-based killing zone assays revealed enhanced resistance of plant-derived KP4 against two deuteromycetous foliar pathogenic fungi viz. Alternaria alternata and Phoma exigua var. exigua. Also, transgenic plants expressing KP4 inhibited the growth progression of these fungi and conferred significant fungal resistance in detached-leaf and whole plant assays. Taken together, we establish the potential of engineering “in-built” fungal stress-tolerance in plants by expressing KP4 under a novel chimeric caulimoviral promoter in a transgenic approach. PMID:29556246

[Ru(bipy)3]2+ nanoparticle-incorporate dental light cure resin to promote photobiomodulation therapy for enhanced vital pulp tissue repair

Science.gov (United States)

Mosca, Rodrigo C.; Young, Nicholas; Zeituni, Carlos A.; Arany, Praveen R.

2018-02-01

The use of nanoparticle on dental light cure resin is not new, currently several compounds (nanoadditives) are used to promote better communication between the restorative material and biological tissues. The interest for this application is growing up to enhance mechanical proprieties to dental tissue cells regeneration. Bioactive nanoparticles and complex compounds with multiple functions are the major target for optimizing the restorative materials. In this work, we incorporate [Ru(bipy)3]2+ nanoparticles, that absorbs energy at 450 nm (blue-light) and emits strongly at 620 nm (red-light), in PLGA Microspheres and insert it in Dental Light Cure Resin to promote the Photobiomodulation Therapy (PBM) effects to accelerate dental pulp repair by in vitro using cytotoxicity and proliferation assay.

Enhancing the use of research in health-promoting, anti-racism policy.

Science.gov (United States)

Ferdinand, Angeline S; Paradies, Yin; Kelaher, Margaret

2017-07-11

The Localities Embracing and Accepting Diversity (LEAD) programme was established to improve the health of ethnic minority communities through the reduction of racial discrimination. Local governments in the state of Victoria, Australia, were at the forefront of LEAD implementation in collaboration with leading state and national organisations. Key aims included expanding the available evidence regarding effective anti-racism interventions and facilitating the uptake of this evidence in organisational policies and practices. One rural and one metropolitan local government areas were selected to participate in LEAD. Key informant interviews and discussions were conducted with individuals who had participated in LEAD implementation and members of LEAD governance structures. Data were also collected on programme processes and implementation, partnership formation and organisational assessments. The LEAD model demonstrated both strengths and weaknesses in terms of facilitating the use of evidence in a complex, community-based health promotion initiative. Representation of implementing, funding and advisory bodies at different levels of governance enabled the input of technical advice and guidance alongside design and implementation. The representation structure assisted in ensuring the development of a programme that was acceptable to all partners and informed by the best available evidence. Simultaneous evaluation also enhanced perceived validity of the intervention, allowed for strategy correction when necessary and supported the process of double-loop organisational learning. However, due to the model's demand for simultaneous and intensive effort by various organisations, when particular elements of the intervention were not functional, there was a considerable loss of time and resources across the partner organisations. The complexity of the model also presented a challenge in ensuring clarity regarding roles, functions and the direction of the programme. The

Set1/COMPASS and Mediator are repurposed to promote epigenetic transcriptional memory.

Science.gov (United States)

D'Urso, Agustina; Takahashi, Yoh-Hei; Xiong, Bin; Marone, Jessica; Coukos, Robert; Randise-Hinchliff, Carlo; Wang, Ji-Ping; Shilatifard, Ali; Brickner, Jason H

2016-06-23

In yeast and humans, previous experiences can lead to epigenetic transcriptional memory: repressed genes that exhibit mitotically heritable changes in chromatin structure and promoter recruitment of poised RNA polymerase II preinitiation complex (RNAPII PIC), which enhances future reactivation. Here, we show that INO1 memory in yeast is initiated by binding of the Sfl1 transcription factor to the cis-acting Memory Recruitment Sequence, targeting INO1 to the nuclear periphery. Memory requires a remodeled form of the Set1/COMPASS methyltransferase lacking Spp1, which dimethylates histone H3 lysine 4 (H3K4me2). H3K4me2 recruits the SET3C complex, which plays an essential role in maintaining this mark. Finally, while active INO1 is associated with Cdk8(-) Mediator, during memory, Cdk8(+) Mediator recruits poised RNAPII PIC lacking the Kin28 CTD kinase. Aspects of this mechanism are generalizable to yeast and conserved in human cells. Thus, COMPASS and Mediator are repurposed to promote epigenetic transcriptional poising by a highly conserved mechanism.

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

Analysis of Microbe-Associated Molecular Pattern-Responsive Synthetic Promoters with the Parsley Protoplast System.

Science.gov (United States)

Kanofsky, Konstantin; Lehmeyer, Mona; Schulze, Jutta; Hehl, Reinhard

2016-01-01

Plants recognize pathogens by microbe-associated molecular patterns (MAMPs) and subsequently induce an immune response. The regulation of gene expression during the immune response depends largely on cis-sequences conserved in promoters of MAMP-responsive genes. These cis-sequences can be analyzed by constructing synthetic promoters linked to a reporter gene and by testing these constructs in transient expression systems. Here, the use of the parsley (Petroselinum crispum) protoplast system for analyzing MAMP-responsive synthetic promoters is described. The synthetic promoter consists of four copies of a potential MAMP-responsive cis-sequence cloned upstream of a minimal promoter and the uidA reporter gene. The reporter plasmid contains a second reporter gene, which is constitutively expressed and hence eliminates the requirement of a second plasmid used as a transformation control. The reporter plasmid is transformed into parsley protoplasts that are elicited by the MAMP Pep25. The MAMP responsiveness is validated by comparing the reporter gene activity from MAMP-treated and untreated cells and by normalizing reporter gene activity using the constitutively expressed reporter gene.

Expression of N-WASP is regulated by HiF1α through the hypoxia response element in the N-WASP promoter

Directory of Open Access Journals (Sweden)

Amrita Salvi

2017-03-01

Full Text Available Cancer cell migration and invasion involves temporal and spatial regulation of actin cytoskeleton reorganization, which is regulated by the WASP family of proteins such as N-WASP (Neural- Wiskott Aldrich Syndrome Protein. We have previously shown that expression of N-WASP was increased under hypoxic conditions. In order to characterize the regulation of N-WASP expression, we constructed an N-WASP promoter driven GFP reporter construct, N-WASPpro-GFP. Transfection of N-WASPpro-GFP construct and plasmid expressing HiF1α (Hypoxia Inducible factor 1α enhanced the expression of GFP suggesting that increased expression of N-WASP under hypoxic conditions is mediated by HiF1α. Sequence analysis of the N-WASP promoter revealed the presence of two hypoxia response elements (HREs characterized by the consensus sequence 5′-GCGTG-3′ at -132 bp(HRE1 and at -662 bp(HRE2 relative to transcription start site (TSS. Site-directed mutagenesis of HRE1(-132 but not HRE2(-662 abolished the HiF1α induced activation of N-WASP promoter. Similarly ChIP assay demonstrated that HiF1α bound to HRE1(-132 but not HRE2(-662 under hypoxic condition. MDA-MB-231 cells but not MDA-MB-231KD cells treated with hypoxia mimicking agent, DMOG showed enhanced gelatin degradation. Similarly MDA-MB-231KD(N-WASPpro-N-WASPR cells expressing N-WASPR under the transcriptional regulation of WT N-WASPpro but not MDA-MB-231KD(N-WASPproHRE1-N-WASPR cells expressing N-WASPR under the transcriptional regulation of N-WASPproHRE1 showed enhanced gelatin degradation when treated with DMOG. Thus indicating the importance of N-WASP in hypoxia induced invadopodia formation. Thus, our data demonstrates that hypoxia-induced activation of N-WASP expression is mediated by interaction of HiF1α with the HRE1(-132 and explains the role of N-WASP in hypoxia induced invadopodia formation.

A specific role of iron in promoting meristematic cell division during adventitious root formation.

Science.gov (United States)

Hilo, Alexander; Shahinnia, Fahimeh; Druege, Uwe; Franken, Philipp; Melzer, Michael; Rutten, Twan; von Wirén, Nicolaus; Hajirezaei, Mohammad-Reza

2017-07-10

Adventitious root (AR) formation is characterized by a sequence of physiological and morphological processes and determined by external factors, including mineral nutrition, the impacts of which remain largely elusive. Morphological and anatomical evaluation of the effects of mineral elements on AR formation in leafy cuttings of Petunia hybrida revealed a striking stimulation by iron (Fe) and a promotive action of ammonium (NH4+). The optimal application period for these nutrients corresponded to early division of meristematic cells in the rooting zone and coincided with increased transcript levels of mitotic cyclins. Fe-localization studies revealed an enhanced allocation of Fe to the nuclei of meristematic cells in AR initials. NH4+ supply promoted AR formation to a lesser extent, most likely by favoring the availability of Fe. We conclude that Fe acts locally by promoting cell division in the meristematic cells of AR primordia. These results highlight a specific biological function of Fe in AR development and point to an unexploited importance of Fe for the vegetative propagation of plants from cuttings. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Dynamic Rewiring of Promoter-Anchored Chromatin Loops during Adipocyte Differentiation

DEFF Research Database (Denmark)

Siersbæk, Rasmus; Madsen, Jesper Grud Skat; Javierre, Biola Maria

2017-01-01

-C to demonstrate a rapid reorganization of promoter-anchored chromatin loops within 4 hr after inducing differentiation of 3T3-L1 preadipocytes. The establishment of new promoter-enhancer loops is tightly coupled to activation of poised (histone H3 lysine 4 mono- and dimethylated) enhancers, as evidenced...

GI-SVM: A sensitive method for predicting genomic islands based on unannotated sequence of a single genome.

Science.gov (United States)

Lu, Bingxin; Leong, Hon Wai

2016-02-01

Genomic islands (GIs) are clusters of functionally related genes acquired by lateral genetic transfer (LGT), and they are present in many bacterial genomes. GIs are extremely important for bacterial research, because they not only promote genome evolution but also contain genes that enhance adaption and enable antibiotic resistance. Many methods have been proposed to predict GI. But most of them rely on either annotations or comparisons with other closely related genomes. Hence these methods cannot be easily applied to new genomes. As the number of newly sequenced bacterial genomes rapidly increases, there is a need for methods to detect GI based solely on sequences of a single genome. In this paper, we propose a novel method, GI-SVM, to predict GIs given only the unannotated genome sequence. GI-SVM is based on one-class support vector machine (SVM), utilizing composition bias in terms of k-mer content. From our evaluations on three real genomes, GI-SVM can achieve higher recall compared with current methods, without much loss of precision. Besides, GI-SVM allows flexible parameter tuning to get optimal results for each genome. In short, GI-SVM provides a more sensitive method for researchers interested in a first-pass detection of GI in newly sequenced genomes.

Alternative Growth Promoters Modulate Broiler Gut Microbiome and Enhance Body Weight Gain

Science.gov (United States)

Salaheen, Serajus; Kim, Seon-Woo; Haley, Bradd J.; Van Kessel, Jo Ann S.; Biswas, Debabrata

2017-01-01

Antibiotic growth promoters (AGPs) are frequently used to enhance weight-gain in poultry production. However, there has been increasing concern over the impact of AGP on the emergence of antibiotic resistance in zoonotic bacterial pathogens in the microbial community of the poultry gut. In this study, we adopted mass-spectrophotometric, phylogenetic, and shotgun-metagenomic approaches to evaluate bioactive phenolic extracts (BPE) from blueberry (Vaccinium corymbosum) and blackberry (Rubus fruticosus) pomaces as AGP alternatives in broilers. We conducted two trials with 100 Cobb-500 broiler chicks (in each trial) in four equal groups that were provided water with no supplementation, supplemented with AGP (tylosin, neomycin sulfate, bacitracin, erythromycin, and oxytetracycline), or supplemented with 0.1 g Gallic acid equivalent (GAE)/L or 1.0 g GAE/L (during the last 72 h before euthanasia) of BPE for 6 weeks. When compared with the control group (water only), the chickens supplemented with AGP and 0.1 g GAE/L of BPE gained 9.5 and 5.8% more body weight, respectively. The microbiomes of both the AGP- and BPE-treated chickens had higher Firmicutes to Bacteroidetes ratios. AGP supplementation appeared to be associated with higher relative abundance of bacteriophages and unique cecal resistomes compared with BPE supplementation or control. Functional characterization of cecal microbiomes revealed significant animal-to-animal variation in the relative abundance of genes involved in energy and carbohydrate metabolism. These findings established a baseline upon which mechanisms of plant-based performance enhancers in regulation of animal growth can be investigated. In addition, the data will aid in designing alternate strategies to improve animal growth performance and consequently production. PMID:29123512

Alternative Growth Promoters Modulate Broiler Gut Microbiome and Enhance Body Weight Gain

Directory of Open Access Journals (Sweden)

Serajus Salaheen

2017-10-01

Full Text Available Antibiotic growth promoters (AGPs are frequently used to enhance weight-gain in poultry production. However, there has been increasing concern over the impact of AGP on the emergence of antibiotic resistance in zoonotic bacterial pathogens in the microbial community of the poultry gut. In this study, we adopted mass-spectrophotometric, phylogenetic, and shotgun-metagenomic approaches to evaluate bioactive phenolic extracts (BPE from blueberry (Vaccinium corymbosum and blackberry (Rubus fruticosus pomaces as AGP alternatives in broilers. We conducted two trials with 100 Cobb-500 broiler chicks (in each trial in four equal groups that were provided water with no supplementation, supplemented with AGP (tylosin, neomycin sulfate, bacitracin, erythromycin, and oxytetracycline, or supplemented with 0.1 g Gallic acid equivalent (GAE/L or 1.0 g GAE/L (during the last 72 h before euthanasia of BPE for 6 weeks. When compared with the control group (water only, the chickens supplemented with AGP and 0.1 g GAE/L of BPE gained 9.5 and 5.8% more body weight, respectively. The microbiomes of both the AGP- and BPE-treated chickens had higher Firmicutes to Bacteroidetes ratios. AGP supplementation appeared to be associated with higher relative abundance of bacteriophages and unique cecal resistomes compared with BPE supplementation or control. Functional characterization of cecal microbiomes revealed significant animal-to-animal variation in the relative abundance of genes involved in energy and carbohydrate metabolism. These findings established a baseline upon which mechanisms of plant-based performance enhancers in regulation of animal growth can be investigated. In addition, the data will aid in designing alternate strategies to improve animal growth performance and consequently production.

Dermatopontin interacts with fibronectin, promotes fibronectin fibril formation, and enhances cell adhesion.

Science.gov (United States)

Kato, Aiko; Okamoto, Osamu; Ishikawa, Kazushi; Sumiyoshi, Hideaki; Matsuo, Noritaka; Yoshioka, Hidekatsu; Nomizu, Motoyoshi; Shimada, Tatsuo; Fujiwara, Sakuhei

2011-04-29

We report that dermatopontin (DP), an abundant dermal extracellular matrix protein, is found in the fibrin clot and in the wound fluid, which comprise the provisional matrix at the initial stage of wound healing. DP was also found in the serum but at a lower concentration than that in wound fluid. DP co-localized with both fibrin and fibronectin on fibrin fibers and interacted with both proteins. Both normal fibroblast and HT1080 cell adhesion to the fibrin-fibronectin matrix were dose-dependently enhanced by DP, and the adhesion was mediated by α5β1 integrin. The cytoskeleton was more organized in the cells that adhered to the fibrin-fibronectin-DP complex. When incubated with DP, fibronectin formed an insoluble complex of fibronectin fibrils as visualized by electron microscopy. The interacting sites of fibronectin with DP were the first, thirteenth, and fourteenth type III repeats (III(1), III(13), and III(14)), with III(13) and III(14) assumed to be the major sites. The interaction between III(2-3) and III(12-14) was inhibited by DP, whereas the interaction between I(1-5) and III(12-14) was specifically and strongly enhanced by DP. Because the interaction between III(2-3) and III(12-14) is involved in forming a globular conformation of fibronectin, and that between I(1-5) and III(12-14) is required for forming fibronectin fibrils, DP promotes fibronectin fibril formation probably by changing the fibronectin conformation. These results suggest that DP has an accelerating role in fibroblast cell adhesion to the provisional matrix in the initial stage of wound healing.

Bioaggregate of photo-fermentative bacteria for enhancing continuous hydrogen production in a sequencing batch photobioreactor.

Science.gov (United States)

Xie, Guo-Jun; Liu, Bing-Feng; Wang, Rui-Qing; Ding, Jie; Ren, Hong-Yu; Zhou, Xu; Ren, Nan-Qi

2015-11-05

Hydrogen recovery through solar-driven biomass conversion by photo-fermentative bacteria (PFB) has been regarded as a promising way for sustainable energy production. However, a considerable fraction of organic substrate was consumed for the growth of PFB as biocatalysts, furthermore, these PFB were continuously washed out from the photobioreactor in continuous operation because of their poor flocculation. In this work, PFB bioaggregate induced by L-cysteine was applied in a sequencing batch photobioreactor to enhance continuous hydrogen production and reduce biomass washout. The effects of the hydraulic retention time (HRT), influent concentration and light intensity on hydrogen production of the photobioreactor were investigated. The maximum hydrogen yield (3.35 mol H2/mol acetate) and production rate (1044 ml/l/d) were obtained at the HRT of 96 h, influent concentration of 3.84 g COD/l, and light intensity of 200 W/m(2). With excellent settling ability, biomass accumulated in the photobioreactor and reached 2.15 g/l under the optimum conditions. Structural analysis of bioaggregate showed that bacterial cells were covered and tightly linked together by extracellular polymeric substances, and formed a stable structure. Therefore, PFB bioaggregate induced by L-cysteine is an efficient strategy to improve biomass retention capacity of the photobioreactor and enhance hydrogen recovery efficiency from organic wastes.

Bioaggregate of photo-fermentative bacteria for enhancing continuous hydrogen production in a sequencing batch photobioreactor

Science.gov (United States)

Xie, Guo-Jun; Liu, Bing-Feng; Wang, Rui-Qing; Ding, Jie; Ren, Hong-Yu; Zhou, Xu; Ren, Nan-Qi

2015-11-01

Hydrogen recovery through solar-driven biomass conversion by photo-fermentative bacteria (PFB) has been regarded as a promising way for sustainable energy production. However, a considerable fraction of organic substrate was consumed for the growth of PFB as biocatalysts, furthermore, these PFB were continuously washed out from the photobioreactor in continuous operation because of their poor flocculation. In this work, PFB bioaggregate induced by L-cysteine was applied in a sequencing batch photobioreactor to enhance continuous hydrogen production and reduce biomass washout. The effects of the hydraulic retention time (HRT), influent concentration and light intensity on hydrogen production of the photobioreactor were investigated. The maximum hydrogen yield (3.35 mol H2/mol acetate) and production rate (1044 ml/l/d) were obtained at the HRT of 96 h, influent concentration of 3.84 g COD/l, and light intensity of 200 W/m2. With excellent settling ability, biomass accumulated in the photobioreactor and reached 2.15 g/l under the optimum conditions. Structural analysis of bioaggregate showed that bacterial cells were covered and tightly linked together by extracellular polymeric substances, and formed a stable structure. Therefore, PFB bioaggregate induced by L-cysteine is an efficient strategy to improve biomass retention capacity of the photobioreactor and enhance hydrogen recovery efficiency from organic wastes.

SNBRFinder: A Sequence-Based Hybrid Algorithm for Enhanced Prediction of Nucleic Acid-Binding Residues.

Directory of Open Access Journals (Sweden)

Xiaoxia Yang

Full Text Available Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.

SNBRFinder: A Sequence-Based Hybrid Algorithm for Enhanced Prediction of Nucleic Acid-Binding Residues.

Science.gov (United States)

Yang, Xiaoxia; Wang, Jia; Sun, Jun; Liu, Rong

2015-01-01

Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder) by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.

Characterization of prokaryotic and eukaryotic promoters usinghidden Markov models

DEFF Research Database (Denmark)

Pedersen, Anders Gorm; Baldi, Pierre; Brunak, Søren

1996-01-01

In this paper we utilize hidden Markov models (HMMs) and information theory to analyze prokaryotic and eukaryotic promoters. We perform this analysis with special emphasis on the fact that promoters are divided into a number of different classes, depending on which polymerase-associated factors...... that bind to them. We find that HMMs trained on such subclasses of Escherichia coli promoters (specifically, the so-called sigma-70 and sigma-54 classes) give an excellent classification of unknown promoters with respect to sigma-class. HMMs trained on eukaryotic sequences from human genes also model nicely...

Clinical evaluation of further-developed MRCP sequences in comparison with standard MRCP sequences

International Nuclear Information System (INIS)

Hundt, W.; Scheidler, J.; Reiser, M.; Petsch, R.

2002-01-01

The purpose of this study was the comparison of technically improved single-shot magnetic resonance cholangiopancreatography (MRCP) sequences with standard single-shot rapid acquisition with relaxation enhancement (RARE) and half-Fourier acquired single-shot turbo spin-echo (HASTE) sequences in evaluating the normal and abnormal biliary duct system. The bile duct system of 45 patients was prospectively investigated on a 1.5-T MRI system. The investigation was performed with RARE and HASTE MR cholangiography sequences with standard and high spatial resolutions, and with a delayed-echo half-Fourier RARE (HASTE) sequence. Findings of the improved MRCP sequences were compared with the standard MRCP sequences. The level of confidence in assessing the diagnosis was divided into five groups. The Wilcoxon signed-rank test at a level of p<0.05 was applied. In 15 patients no pathology was found. The MRCP showed stenoses of the bile duct system in 10 patients and choledocholithiasis and cholecystolithiasis in 16 patients. In 12 patients a dilatation of the bile duct system was found. Comparison of the low- and high spatial resolution sequences and the short and long TE times of the half-Fourier RARE (HASTE) sequence revealed no statistically significant differences regarding accuracy of the examination. The diagnostic confidence level in assessing normal or pathological findings for the high-resolution RARE and half-Fourier RARE (HASTE) was significantly better than for the standard sequences. For the delayed-echo half-Fourier RARE (HASTE) sequence no statistically significant difference was seen. The high-resolution RARE and half-Fourier RARE (HASTE) sequences had a higher confidence level, but there was no significant difference in diagnosis in terms of detection and assessment of pathological changes in the biliary duct system compared with standard sequences. (orig.)

Sequencing of IncX-plasmids suggests ubiquity of mobile forms of a biofilm-promoting gene cassette recruited from Klebsiella pneumoniae.

Directory of Open Access Journals (Sweden)

Mette Burmølle

Full Text Available Plasmids are a highly effective means with which genetic traits that influence human health, such as virulence and antibiotic resistance, are disseminated through bacterial populations. The IncX-family is a hitherto sparsely populated group of plasmids that are able to thrive within Enterobacteriaceae. In this study, a replicon-centric screening method was used to locate strains from wastewater sludge containing plasmids belonging to the IncX-family. A transposon aided plasmid capture method was then employed to transport IncX-plasmids from their original hosts (and co-hosted plasmids into a laboratory strain (Escherichia coli Genehogs® for further study. The nucleotide sequences of the three newly isolated IncX-plasmids (pLN126_33, pMO17_54, pMO440_54 and the hitherto un-sequenced type-plasmid R485 revealed a remarkable occurrence of whole or partial gene cassettes that promote biofilm-formation in Klebsiella pneumonia or E. coli, in all four instances. Two of the plasmids (R485 and pLN126_33 were shown to directly induce biofilm formation in a crystal violet retention assay in E. coli. Sequence comparison revealed that all plasmid-borne forms of the type 3 fimbriae encoding gene cassette mrkABCDF were variations of a composite transposon Tn6011 first described in the E. coli IncX plasmid pOLA52. In conclusion, IncX-plasmids isolated from Enterobacteriaceae over almost 40 years and on three different continents have all been shown to carry a type 3 fimbriae gene cassette mrkABCDF stemming from pathogenic K. pneumoniae. Apart from contributing general knowledge about IncX-plasmids, this study also suggests an apparent ubiquity of a mobile form of an important virulence factor and is an illuminating example of the recruitment, evolution and dissemination of genetic traits through plasmid-mediated horizontal gene transfer.

Sequencing of IncX-plasmids suggests ubiquity of mobile forms of a biofilm-promoting gene cassette recruited from Klebsiella pneumoniae.

Science.gov (United States)

Burmølle, Mette; Norman, Anders; Sørensen, Søren J; Hansen, Lars Hestbjerg

2012-01-01

Plasmids are a highly effective means with which genetic traits that influence human health, such as virulence and antibiotic resistance, are disseminated through bacterial populations. The IncX-family is a hitherto sparsely populated group of plasmids that are able to thrive within Enterobacteriaceae. In this study, a replicon-centric screening method was used to locate strains from wastewater sludge containing plasmids belonging to the IncX-family. A transposon aided plasmid capture method was then employed to transport IncX-plasmids from their original hosts (and co-hosted plasmids) into a laboratory strain (Escherichia coli Genehogs®) for further study. The nucleotide sequences of the three newly isolated IncX-plasmids (pLN126_33, pMO17_54, pMO440_54) and the hitherto un-sequenced type-plasmid R485 revealed a remarkable occurrence of whole or partial gene cassettes that promote biofilm-formation in Klebsiella pneumonia or E. coli, in all four instances. Two of the plasmids (R485 and pLN126_33) were shown to directly induce biofilm formation in a crystal violet retention assay in E. coli. Sequence comparison revealed that all plasmid-borne forms of the type 3 fimbriae encoding gene cassette mrkABCDF were variations of a composite transposon Tn6011 first described in the E. coli IncX plasmid pOLA52. In conclusion, IncX-plasmids isolated from Enterobacteriaceae over almost 40 years and on three different continents have all been shown to carry a type 3 fimbriae gene cassette mrkABCDF stemming from pathogenic K. pneumoniae. Apart from contributing general knowledge about IncX-plasmids, this study also suggests an apparent ubiquity of a mobile form of an important virulence factor and is an illuminating example of the recruitment, evolution and dissemination of genetic traits through plasmid-mediated horizontal gene transfer.

Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters

Directory of Open Access Journals (Sweden)

Gagniuc Paul

2012-09-01

Full Text Available Abstract Background The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? Results In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on

Initiation-promotion skin carcinogenesis and immunological competence.

Science.gov (United States)

Curtis, G L; Stenbäck, F; Ryan, W L

1975-10-01

The immune competence of mice during initiation-promotion skin carcinogenesis was determined by skin allograft rejection and lymphocyte mitogenesis. The carcinogen 7, 12-dimethylbenzanthracene inhibited the cellular immune competence of mice while lymphocytes from croton oil treated mice had enhanced PWM response. Chlorphenesin, a stimulator of cellular immunity, was found to inhibit tumorigenesis in initiation-promotion skin carcinogenesis when injected during promotion.

Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

African Journals Online (AJOL)

The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

Insulators form gene loops by interacting with promoters in Drosophila.

Science.gov (United States)

Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

2011-09-01

Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

Whole Body MRI at 3T with Quantitative Diffusion Weighted Imaging and Contrast-Enhanced Sequences for the Characterization of Peripheral Lesions in Patients with Neurofibromatosis Type 2 and Schwannomatosis

International Nuclear Information System (INIS)

Fayad, Laura M.; Blakeley, Jaishri; Plotkin, Scott; Widemann, Brigitte; Jacobs, Michael A.

2013-01-01

Purpose. WB-MRI is mainly used for tumor detection and surveillance. The purpose of this study is to establish the feasibility of WB-MRI at 3T for lesion characterization, with DWI/ADC-mapping and contrast-enhanced sequences, in patients with neurofibromatosis type 2 (NF-2) and schwannomatosis. Materials and Methods. At 3T, WB-MRI was performed in 11 subjects (10 NF-2 and 1 schwannomatosis) with STIR, T1, contrast-enhanced T1, and DWI/ADC mapping (b = 50, 400, 800 s/mm 2 ). Two readers reviewed imaging for the presence and character of peripheral lesions. Lesion size and features (signal intensity, heterogeneity, enhancement characteristics, and ADC values) were recorded. Descriptive statistics were reported. Results. Twenty-three lesions were identified, with average size of 4.6 ± 2.8 cm. Lesions were characterized as tumors (21/23) or cysts (2/23) by contrast-enhancement properties (enhancement in tumors, no enhancement in cysts). On T1, tumors were homogeneously isointense (5/21) or hypointense (16/21); on STIR, tumors were hyperintense and homogeneous (10/21) or heterogeneous (11/21); on postcontrast T1, tumors enhanced homogeneously (14/21) or heterogeneously (7/21); on DWI, tumor ADC values were variable (range 0.8–2.7), suggesting variability in intrinsic tumor properties. Conclusion. WB-MRI with quantitative DWI and contrast-enhanced sequences at 3T is feasible and advances the utility of WB-MRI not only to include detection, but also to provide additional metrics for lesion characterization

The fitness landscapes of cis-acting binding sites in different promoter and environmental contexts.

Directory of Open Access Journals (Sweden)

Ryan K Shultzaberger

2010-07-01

Full Text Available The biophysical nature of the interaction between a transcription factor and its target sequences in vitro is sufficiently well understood to allow for the effects of DNA sequence alterations on affinity to be predicted. But even in relatively simple in vivo systems, the complexities of promoter organization and activity have made it difficult to predict how altering specific interactions between a transcription factor and DNA will affect promoter output. To better understand this, we measured the relative fitness of nearly all Escherichia coli sigma(70 -35 binding sites in different promoter and environmental contexts by competing four randomized -35 promoter libraries controlling the expression of the tetracycline resistance gene (tetagainst each other in increasing concentrations of drug. We sequenced populations after competition to determine the relative enrichment of each -35 sequence. We observed a consistent relationship between the frequency of recovery of each -35 binding site and its predicted affinity for sigma(70 that varied depending on the sequence context of the promoter and drug concentration. Overall the relative fitness of each promoter could be predicted by a simple thermodynamic model of transcriptional regulation, in which the rate of transcriptional initiation (and hence fitness is dependent upon the overall stability of the initiation complex, which in turn is dependent upon the energetic contributions of all sites within the complex. As implied by this model, a decrease in the free energy of association at one site could be compensated for by an increase in the binding energy at another to produce a similar output. Furthermore, these data show that a large and continuous range of transcriptional outputs can be accessed by merely changing the -35, suggesting that evolved or engineered mutations at this site could allow for subtle and precise control over gene expression.

DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

Science.gov (United States)

Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

2014-09-17

DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

Fatty acid elongase 1 (FAE1) promoter as a candidate for genetic ...

African Journals Online (AJOL)

As an important cis-regulatory element, a promoter plays a key role in plant gene expression and regulation, and has been widely used in plant genetic engineering. The fatty acid elongase 1 (FAE1) promoter was isolated from Arabidopsis thaliana. Sequence analysis showed that the FAE1 promoter contains two Skn-1 ...

Bottom-up driven involuntary auditory evoked field change: constant sound sequencing amplifies but does not sharpen neural activity.

Science.gov (United States)

Okamoto, Hidehiko; Stracke, Henning; Lagemann, Lothar; Pantev, Christo

2010-01-01

The capability of involuntarily tracking certain sound signals during the simultaneous presence of noise is essential in human daily life. Previous studies have demonstrated that top-down auditory focused attention can enhance excitatory and inhibitory neural activity, resulting in sharpening of frequency tuning of auditory neurons. In the present study, we investigated bottom-up driven involuntary neural processing of sound signals in noisy environments by means of magnetoencephalography. We contrasted two sound signal sequencing conditions: "constant sequencing" versus "random sequencing." Based on a pool of 16 different frequencies, either identical (constant sequencing) or pseudorandomly chosen (random sequencing) test frequencies were presented blockwise together with band-eliminated noises to nonattending subjects. The results demonstrated that the auditory evoked fields elicited in the constant sequencing condition were significantly enhanced compared with the random sequencing condition. However, the enhancement was not significantly different between different band-eliminated noise conditions. Thus the present study confirms that by constant sound signal sequencing under nonattentive listening the neural activity in human auditory cortex can be enhanced, but not sharpened. Our results indicate that bottom-up driven involuntary neural processing may mainly amplify excitatory neural networks, but may not effectively enhance inhibitory neural circuits.

Promoting communication with older adults: protocols for resolving interpersonal conflicts and for enhancing interactions with doctors.

Science.gov (United States)

Weitzman, Patricia Flynn; Weitzman, Eben A

2003-07-01

In this paper, we review the importance of effective communication in older adulthood, and ideas for promoting it. We focus on theoretical and applied work in two communicative encounters that have particular relevance for older adult health, i.e., interpersonal conflict and visits with a healthcare provider. Little applied work has aimed to adapt training protocols for older adults in these two areas. We will present training protocols we have developed in constructive conflict resolution for older adults, and on enhancing doctor-patient communication. We present these protocols to stimulate ideas on the part of the reader on how to further develop and refine training efforts for older adults in effective communication.

Localization of the CAPRICE-ENHANCER OF TRY AND CPC1 chimera protein in Arabidopsis root epidermis.

Science.gov (United States)

Tominaga-Wada, Rumi; Kurata, Tetsuya; Wada, Takuji

2017-09-01

The CAPRICE (CPC) encodes an R3-type MYB transcription factor, which promotes root-hair differentiation. Previously, we showed that the CPC protein moves from the non-hair cell to the neighboring cell and induces root-hair differentiation in Arabidopsis. In addition, we proposed two cell-to-cell movement signal sequences, S1 and S2, in CPC. However, an S1:2xGFP:S2 chimera protein did not move between root epidermal cells. Here, we show that the S1 and S2 sequences do not confer cell-to-cell movement or nuclear localization ability to a GFP protein. The ENHANCER OF TRY AND CPC1 (ETC1) gene encodes the CPC homolog R3 MYB; this protein does not possess cell-to-cell movement ability or the S1 sequence. To elucidate whether the S1 sequence can induce cell-to-cell movement ability in ETC1, CPCp:S1:ETC1:2xGFP was constructed and introduced into Arabidopsis. Our results indicate that the addition of the S1 sequence was not sufficient for ETC1 to acquire cell-to-cell movement ability.

Regulation of ALF promoter activity in Xenopus oocytes.

Directory of Open Access Journals (Sweden)

Dan Li

Full Text Available BACKGROUND: In this report we evaluate the use of Xenopus laevis oocytes as a matched germ cell system for characterizing the organization and transcriptional activity of a germ cell-specific X. laevis promoter. PRINCIPAL FINDINGS: The promoter from the ALF transcription factor gene was cloned from X. laevis genomic DNA using a PCR-based genomic walking approach. The endogenous ALF gene was characterized by RACE and RT-PCR for transcription start site usage, and by sodium bisulfite sequencing to determine its methylation status in somatic and oocyte tissues. Homology between the X. laevis ALF promoter sequence and those from human, chimpanzee, macaque, mouse, rat, cow, pig, horse, dog, chicken and X. tropicalis was relatively low, making it difficult to use such comparisons to identify putative regulatory elements. However, microinjected promoter constructs were very active in oocytes and the minimal promoter could be narrowed by PCR-mediated deletion to a region as short as 63 base pairs. Additional experiments using a series of site-specific promoter mutants identified two cis-elements within the 63 base pair minimal promoter that were critical for activity. Both elements (A and B were specifically recognized by proteins present in crude oocyte extracts based on oligonucleotide competition assays. The activity of promoter constructs in oocytes and in transfected somatic Xenopus XLK-WG kidney epithelial cells was quite different, indicating that the two cell types are not functionally equivalent and are not interchangeable as assay systems. CONCLUSIONS: Overall the results provide the first detailed characterization of the organization of a germ cell-specific Xenopus promoter and demonstrate the feasibility of using immature frog oocytes as an assay system for dissecting the biochemistry of germ cell gene regulation.

Development of a promoter shutoff system in Aspergillus oryzae using a sorbitol-sensitive promoter.

Science.gov (United States)

Oda, Ken; Terado, Shiho; Toyoura, Rieko; Fukuda, Hisashi; Kawauchi, Moriyuki; Iwashita, Kazuhiro

2016-09-01

Promoter shutoff is a general method for analyzing essential genes, but in the fungus Aspergillus oryzae, no tightly repressed promoters have been reported. To overcome the current limitations of conditional promoters, we examined sorbitol- and galactose-responsive genes using microarrays to identify regulatable genes with only minor physiological and genetic effects. We identified two sorbitol-induced genes (designated as sorA and sorB), cloned their promoters, and built a regulated egfp and brlA expression system. Growth medium-dependent enhanced green fluorescence protein (EGFP) fluorescence and conidiation were confirmed for egfp and brlA under the control of their respective promoters. We also used this shutoff system to regulate the essential rhoA, which demonstrated the expected growth inhibition under repressed growth conditions. Our new sorbitol promoter shutoff system developed can serve as a valuable new tool for essential gene analyses of filamentous fungi.

Researches on Transcriptome Sequencing in the Study of Traditional Chinese Medicine

Science.gov (United States)

Xin, Jie; Zhang, Rong-chao; Wang, Lei

2017-01-01

Due to its incomparable advantages, the application of transcriptome sequencing in the study of traditional Chinese medicine attracts more and more attention of researchers, which greatly promote the development of traditional Chinese medicine. In this paper, the applications of transcriptome sequencing in traditional Chinese medicine were summarized by reviewing recent related papers. PMID:28900463

Tunable promoters in synthetic and systems biology

DEFF Research Database (Denmark)

Dehli, Tore; Solem, Christian; Jensen, Peter Ruhdal

2012-01-01

in synthetic biology. A number of tools exist to manipulate the steps in between gene sequence and functional protein in living cells, but out of these the most straight-forward approach is to alter the gene expression level by manipulating the promoter sequence. Some of the promoter tuning tools available......Synthetic and systems biologists need standardized, modular and orthogonal tools yielding predictable functions in vivo. In systems biology such tools are needed to quantitatively analyze the behavior of biological systems while the efficient engineering of artificial gene networks is central...... for accomplishing such altered gene expression levels are discussed here along with examples of their use, and ideas for new tools are described. The road ahead looks very promising for synthetic and systems biologists as tools to achieve just about anything in terms of tuning and timing multiple gene expression...

Contribution for new genetic markers of rheumatoid arthritis activity and severity: sequencing of the tumor necrosis factor-alpha gene promoter.

Science.gov (United States)

Fonseca, João Eurico; Cavaleiro, João; Teles, José; Sousa, Elsa; Andreozzi, Valeska L; Antunes, Marília; Amaral-Turkman, Maria A; Canhão, Helena; Mourão, Ana F; Lopes, Joana; Caetano-Lopes, Joana; Weinmann, Pamela; Sobral, Marta; Nero, Patrícia; Saavedra, Maria J; Malcata, Armando; Cruz, Margarida; Melo, Rui; Braña, Araceli; Miranda, Luis; Patto, José V; Barcelos, Anabela; da Silva, José Canas; Santos, Luís M; Figueiredo, Guilherme; Rodrigues, Mário; Jesus, Herberto; Quintal, Alberto; Carvalho, Teresa; da Silva, José A Pereira; Branco, Jaime; Queiroz, Mário Viana

2007-01-01

The objective of this study was to assess whether clinical measures of rheumatoid arthritis activity and severity were influenced by tumor necrosis factor-alpha (TNF-alpha) promoter genotype/haplotype markers. Each patient's disease activity was assessed by the disease activity score using 28 joint counts (DAS28) and functional capacity by the Health Assessment Questionnaire (HAQ) score. Systemic manifestations, radiological damage evaluated by the Sharp/van der Heijde (SvdH) score, disease-modifying anti-rheumatic drug use, joint surgeries, and work disability were also assessed. The promoter region of the TNF-alpha gene, between nucleotides -1,318 and +49, was sequenced using an automated platform. Five hundred fifty-four patients were evaluated and genotyped for 10 single-nucleotide polymorphism (SNP) markers, but 5 of these markers were excluded due to failure to fall within Hardy-Weinberg equilibrium or to monomorphism. Patients with more than 10 years of disease duration (DD) presented significant associations between the -857 SNP and systemic manifestations, as well as joint surgeries. Associations were also found between the -308 SNP and work disability in patients with more than 2 years of DD and radiological damage in patients with less than 10 years of DD. A borderline effect was found between the -238 SNP and HAQ score and radiological damage in patients with 2 to 10 years of DD. An association was also found between haplotypes and the SvdH score for those with more than 10 years of DD. An association was found between some TNF-alpha promoter SNPs and systemic manifestations, radiological progression, HAQ score, work disability, and joint surgeries, particularly in some classes of DD and between haplotypes and radiological progression for those with more than 10 years of DD.

Strategy for complete NMR assignment of disordered proteins with highly repetitive sequences based on resolution-enhanced 5D experiments

Energy Technology Data Exchange (ETDEWEB)

Motackova, Veronika; Novacek, Jiri [Masaryk University, Faculty of Science, National Centre for Biomolecular Research (Czech Republic); Zawadzka-Kazimierczuk, Anna; Kazimierczuk, Krzysztof [University of Warsaw, Faculty of Chemistry (Poland); Zidek, Lukas, E-mail: lzidek@chemi.muni.c [Masaryk University, Faculty of Science, National Centre for Biomolecular Research (Czech Republic); Sanderova, Hana; Krasny, Libor [Academy of Sciences of the Czech Republic, Laboratory of Molecular Genetics of Bacteria and Department of Bacteriology, Institute of Microbiology (Czech Republic); Kozminski, Wiktor [University of Warsaw, Faculty of Chemistry (Poland); Sklenar, Vladimir [Masaryk University, Faculty of Science, National Centre for Biomolecular Research (Czech Republic)

2010-11-15

A strategy for complete backbone and side-chain resonance assignment of disordered proteins with highly repetitive sequence is presented. The protocol is based on three resolution-enhanced NMR experiments: 5D HN(CA)CONH provides sequential connectivity, 5D HabCabCONH is utilized to identify amino acid types, and 5D HC(CC-TOCSY)CONH is used to assign the side-chain resonances. The improved resolution was achieved by a combination of high dimensionality and long evolution times, allowed by non-uniform sampling in the indirect dimensions. Random distribution of the data points and Sparse Multidimensional Fourier Transform processing were used. Successful application of the assignment procedure to a particularly difficult protein, {delta} subunit of RNA polymerase from Bacillus subtilis, is shown to prove the efficiency of the strategy. The studied protein contains a disordered C-terminal region of 81 amino acids with a highly repetitive sequence. While the conventional assignment methods completely failed due to a very small differences in chemical shifts, the presented strategy provided a complete backbone and side-chain assignment.

HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study

Directory of Open Access Journals (Sweden)

Marla A. Endriga

2010-10-01

Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.

Culturable bacterial endophytes isolated from Mangrove tree (Rhizophora apiculata Blume) enhance seedling growth in Rice.

Science.gov (United States)